WorldWideScience

Sample records for kinase-3b promotes nuclear

  1. [Inhibition of glycogen synthase kinase 3b activity regulates Toll-like receptor 4-mediated liver inflammation].

    Science.gov (United States)

    Ren, Feng; Zhang, Hai-yan; Piao, Zheng-fu; Zheng, Su-jun; Chen, Yu; Chen, De-xi; Duan, Zhong-ping

    2012-09-01

    To determine the mechanism underlying the therapeutic activities of glycogen synthase kinase 3b (GSK3b) against hepatic ischemia-reperfusion (H-IR) injury by investigating the inhibitive effects of GSK3b on inflammation mediated by Toll-like receptor 4 (TLR4). C57BL/6 male mice were subjected to 90 min of warm liver cephalad lobe ischemia, followed by reperfusion for various lengths of time. The mice were divided into three groups: the H-IR untreated model (control group), and the H-IR inflammation-induced models that received an intraperitoneal injection of purified lipopolysaccharide (LPS) endotoxin alone (inflammation group) or with pretreatment of the SB216763 GSK3b-specific inhibitor (intervention group). To create a parallel isolated cell system for detailed investigations of macrophages, marrow-derived stem cells were isolated from femurs of the H-IR control group of mice and used to derive primary macrophages. The cells were then divided into the same three groups as the whole mouse system: control, LPS-induced inflammation model, and inflammation model with SB216763 intervention. Differential expressions of inflammation-related proteins and genes were detected by Western blotting and real-time quantitative PCR, respectively. The phosphorylation levels of ERK, JNK and p38 MAPK were induced in liver at 1 h after reperfusion, but then steadily decreased and returned to baseline levels by 4 h after reperfusion. In addition, the phosphorylation levels of ERK and JNK were induced in macrophages at 15 min after LPS stimulation, while the phosphorylation level of p38 MAPK was induced at 1 h; SB216763 pretreatment suppressed the LPS-stimulated ERK, JNK and p38 phosphorylation in macrophages. In the mouse model, GSK3b activity was found to promote the gene expression of anti-inflammatory cytokine IL-10 (control: 0.21 ± 0.08, inflammation: 0.83 ± 0.21, intervention: 1.76 ± 0.67; F = 3.16, P = 0.027) but to significantly inhibit the gene expression of pro

  2. Promoting nuclear energy through corporate media tools

    International Nuclear Information System (INIS)

    Moore, Alexander

    2002-01-01

    This presentation looks at the best way of communicating a specific message and how Urenco Ltd have achieved this by promoting the benefits of nuclear energy through current corporate media. The presentation is split in to two segments; firstly considering the basics of good communication and how communication tools can be used in a variety of ways to maximize the effectiveness of messages and ideas. Secondly, examples of how Urenco have used current corporate publications in order to present the benefits of nuclear energy to a wider audience. (author)

  3. Promoting the acceptance of nuclear technology

    International Nuclear Information System (INIS)

    Rueckl, E.

    1998-01-01

    Restoring the public acceptance of nuclear technology requires optimized public relations work and an enhanced interaction among the nuclear industry and schools and universities. Thinking in contexts needs to be promoted, also in order to improve knowledge of mass flows. Specific terms often mean different things to experts and to the public. This can be corrected by careful use of language and precision in public relations work. The young generation is more openminded towards technology now than it was in the seventies and eighties. This is a point of departure in winning young people also for nuclear technology. For this to happen, science education in schools needs to be improved and the appropriate courses need to be introduced. (orig.) [de

  4. Promoting nuclear energy: meeting with new generations

    International Nuclear Information System (INIS)

    Uemura, George; Neves, Maria A.; Pedron, Marilene Quinaud; Guimaraes, Regia R. Ramirez; Filgueiras, Sergio A. Cunha

    2000-01-01

    The VII General Congress on Nuclear Energy (VII CGEN) decided on another approach, in order to promote nuclear energy (NE) for the average public. Instead of promoting an event for the nuclear area, the VII CGEN was open to the general public, aiming at high schools of the city of Belo Horizonte, where the meeting was held. The papers submitted were classified to two poster sessions, one called journalistic, open to the public, and technical, for the congressmen. The authors of the former session were asked to make their posters understandable for an average person. The present article shows the strategies used in dealing with local high schools, which includes the preparation of two series of posters, one dealing with the history of NE until 1945, and the other with applications of NE, due to the lack of this kind of material in Portuguese. The results of these efforts are shown and discussed, in terms of a better public image for NE and her community in Brazil. The public response showed that there is more than enough public for this kind of event, but not events enough. (author)

  5. A study on the promotion of nuclear security culture

    International Nuclear Information System (INIS)

    Tamai, Hiroshi; Tazaki, Makiko; Kokaji, Lisa; Shimizu, Ryo; Suda, Kazunori

    2015-01-01

    In recent years the promotion of nuclear security culture aiming at strengthening nuclear security is extensively mentioned, however, awareness of nuclear security culture seems to be not much high compared to the permeation of nuclear safety culture. As a world's leading country of peaceful nuclear use, permeation of nuclear security culture into various social classes must be one of important issues in Japan. Learning from the TEPCO Fukushima Daiichi nuclear power plant accident, complementarity between nuclear safety and nuclear security in the aspect of both protection measures has been profoundly recognised. Therefore, it will be natural to promote nuclear security culture modelled on the preceding nuclear safety culture. On this standpoint, the paper examines an approach for the promotion of nuclear security culture which, for example, consists of awareness cultivation, attitude progress, permeation assessment, and resulting in the establishment of PDCA Cycle. (author)

  6. Sustainable promotion nuclear power enterprise procurement bidding risk management

    International Nuclear Information System (INIS)

    Wu Yimin

    2014-01-01

    Nuclear power enterprise procurement bidding work faced with certain risk in recent years, the domestic nuclear power enterprises in the bidding work never stop research and explore the effective ways to guard against legal risks, and has made considerable progress, the eighteenth big country advocates the safety and efficiency of nuclear power development policy, in the face of the subsequent nuclear power construction projects have started, nuclear power enterprise bidding risk management work shoulder heavy responsibilities article through nuclear power enterprise procurement bidding risk management present situation, proposed the sustainable promotion nuclear power enterprise procurement bidding risk management countermeasures. (author)

  7. Nuclear performance standards: Promoting efficient generation

    International Nuclear Information System (INIS)

    Nagelhout, M.

    1990-01-01

    Nuclear plant performance standards are designed to share the risks of operation associated with nuclear generation. Such standards often shift risks from ratepayers to utility shareholders, even without a finding of imprudence or mismanagement. The rationale underlying nuclear performance standards is that ratepayers should not be responsible for excessive replacement power costs incurred as a result of unreasonable decisions by utility management, especially because the high fixed costs of nuclear plants are already included in base rates. In addition, performance standards can be designed to provide incentives to reward utilities that achieve superior nuclear performance, for the benefit of both ratepayers and shareholders

  8. Promoting nuclear medicine in developing countries

    International Nuclear Information System (INIS)

    Ganatra, R.; Nofal, M.

    1986-01-01

    After a short review of the applications of nuclear medicine in diagnosis and treatment of diseases or in medical research the ways and the means of IAEA's support in helping developing countries to set up nuclear medicine capabilities in their hospitals are described. Some trends and new directions in the field of nuclear medicine and the problems related to the implementation of these techniques in developing countries are presented

  9. Accelerating nuclear power standards development and promoting sound nuclear power development in China

    International Nuclear Information System (INIS)

    Yang Changli

    2008-01-01

    The paper expounds the importance of quickening establishment and perfection of nuclear power standard system in China, analyzes achievements made and problems existed during the development of nuclear power standards, put forward proposals to actively promote the work in this regard, and indicates that CNNC will further strengthen the standardization work, enhance coordination with those trades related to nuclear power standards, and jointly promote the development of nuclear power standards. (authors)

  10. Promotion and financing of nuclear power programmes in developing countries

    International Nuclear Information System (INIS)

    1987-01-01

    The Director General of the International Atomic Energy Agency established in February 1986 a Senior Expert Group (SEG) on Mechanisms to Assist Developing Countries in the Promotion and Financing of Nuclear Power Programmes, which was asked: (a) To identify and analyse the problems of and constraints on nuclear power introduction/expansion in developing countries, with particular attention being paid to the problems of financing nuclear power projects; (b) To study mechanisms for dealing with the identified problems and constraints in order to assist developing countries with the promotion and financing of their nuclear power programmes, and to determine the role of the IAEA in this context. This report summarizes the Senior Expert Group's study. It also presents a number of recommendations on mechanisms to assist developing countries in promoting and financing their nuclear power programmes. 1 fig., 3 tabs

  11. International Nuclear Security Education Network (INSEN): Promoting nuclear security education

    International Nuclear Information System (INIS)

    Muhamad Samudi Yasir

    2013-01-01

    Full-text: The need for human resource development programmes in nuclear security was underlined at several International Atomic Energy Agency (IAEA) General Conferences and Board of Governors Meetings. Successive IAEA Nuclear Security Plans, the most recent of which was agreed by the Board of Governors in September 2009, give high priority to assisting States in establishing educational programmes in nuclear security in order to ensure the sustainability of nuclear security improvements. The current Nuclear Security Plan 1 covering 2010-2013 emphasizes on the importance of considering existing capacities at international, regional and national levels while designing nuclear security academic programmes. In the course of implementing the Plan, the IAEA developed a guide entitled Educational Programme in Nuclear Security (IAEA Nuclear Security Series No. 12) that consists of a model of a MAster of Science (M.Sc.) and a Certificate Programme in Nuclear Security. This guide was aims at assisting universities or other educational institutes to developed academic programmes in nuclear security. Independently, some universities already offered academic programmes covering some areas of nuclear security, while other universities have asked the IAEA to support the implementation of these programmes. In order to better address current and future request for assistance in this area, the IAEA establish a collaboration network-International Nuclear Security Education Network (INSEN), among universities who are providing nuclear security education or who are interested in starting an academic programme/ course(s) in nuclear security. Universiti Kebangsaan Malaysia (UKM) is a first local university became a member of INSEN since the beginning of the establishment. (author)

  12. Promotion of nuclear safety culture in Korea

    International Nuclear Information System (INIS)

    Eun, Youngsoo

    1996-01-01

    The term 'nuclear safety culture' was first introduced by the IAEA after the Chernobyl accident in the former USSR and subsequently defined in the IAEA's Safety Series No. 75-IMSAG-4 'Safety Culture' as follows : 'Safety culture is that assembly of characteristics and attitudes in organizations and individuals which establish that establish that, as an overriding priority, nuclear plant safety issues receive the attention warranted by their significance.' INSAG-4 deals with the concept of 'Safety Culture' as it relates to organizations and individuals engaged in nuclear power activities, and is intended for use by governmental authorities and by the nuclear industry and its supporting organizations. The IAEA's Assessment of Safety Culture in Organizations Team (ASCOT) developed ASCOT Guidelines that can be used in the assessment of the safety culture level of the organizations and their individual workers concerned, with a view to the tangible manifestations of safety culture that has intangible characteristics in nature. The IAEA provides the nuclear safety culture assessment service on the request of the Member States. Safety culture can not be achieved by the effort of the nuclear industry and its involved individuals alone. Rather, it requires a well concerted effort among various organizations engaged in nuclear activities including regulatory organizations

  13. Promoting Intercultural Competency in the Nuclear Workplace

    Energy Technology Data Exchange (ETDEWEB)

    Bachner K. M.

    2015-07-12

    Intercultural preparedness training is a staple of many workplaces that require international competence, including government, business, and non-profits. Even highly experienced diplomats are often advised to attend training sessions on this topic. Intercultural preparedness training promises to be especially relevant and useful for professionals working in the field of nuclear nonproliferation, including in the application of international nuclear safeguards. This paper outlines the fundamental philosophies underlying a training program that will benefit professionals in the nuclear arena, whether practitioners of nonproliferation or other sub-fields relying on international cooperation and collaboration, and how such a training program might be implemented efficiently.

  14. Non-advertising program in promoting nuclear power in Finland

    International Nuclear Information System (INIS)

    Ruuskanen, Antti

    1989-01-01

    In Finland, there are two nuclear power plants with four reactors totalling about 2 200 MWe. The oldest reactor has been operating just over ten years. In the Finnish power supply the share of nuclear power makes up one third. The optimum would be about 40%. Based on energy and nuclear attitude surveys showed that these issues are not independent in the society. Quite the opposite, the nuclear attitudes especially are tightly connected to general views like the pessimism toward the future, the credibility of large institutions, or politics, the acceptability of continuous economic growth, etc. The role of technical or economic facts, we engineers love, is found to be small, too. To change people's nuclear attitude one should be able to influence all the complex issues related to nuclear power. In theory, this is possible by ads. In that case the campaigning ought to be huge, it should last for years, and still would have basic question marks. The first question is how credible people see ads, in general, and, especially, in case of highly disputed and societal issues. Although there have been some educational ad campaigns in Finland, nuclear campaign would be a step to the unknown. Knowing that the nuclear attitudes are tightly connected to very many and quite stable societal views, and seeing the basic difficulties with ads, it is clear to me that there is no other way of promoting nuclear energy than a long and continuous public debate involving. Referring to the nuclear attitude survey results in Finland, advertising is not the solution to win the public confidence. Nuclear industry must be active in other ways than promoting nuclear power by advertising. This was the Finnish opinion. The nuclear issue is national in the sense that no country can copy models from other countries without carefully considering the local circumstances. So, in other countries there may be situations where other kinds of actions are called for

  15. Non-advertising program in promoting nuclear power in Finland

    Energy Technology Data Exchange (ETDEWEB)

    Ruuskanen, Antti [Department of Information, Imatran Voima Oy (IVO) (Finland)

    1989-07-01

    In Finland, there are two nuclear power plants with four reactors totalling about 2 200 MWe. The oldest reactor has been operating just over ten years. In the Finnish power supply the share of nuclear power makes up one third. The optimum would be about 40%. Based on energy and nuclear attitude surveys showed that these issues are not independent in the society. Quite the opposite, the nuclear attitudes especially are tightly connected to general views like the pessimism toward the future, the credibility of large institutions, or politics, the acceptability of continuous economic growth, etc. The role of technical or economic facts, we engineers love, is found to be small, too. To change people's nuclear attitude one should be able to influence all the complex issues related to nuclear power. In theory, this is possible by ads. In that case the campaigning ought to be huge, it should last for years, and still would have basic question marks. The first question is how credible people see ads, in general, and, especially, in case of highly disputed and societal issues. Although there have been some educational ad campaigns in Finland, nuclear campaign would be a step to the unknown. Knowing that the nuclear attitudes are tightly connected to very many and quite stable societal views, and seeing the basic difficulties with ads, it is clear to me that there is no other way of promoting nuclear energy than a long and continuous public debate involving. Referring to the nuclear attitude survey results in Finland, advertising is not the solution to win the public confidence. Nuclear industry must be active in other ways than promoting nuclear power by advertising. This was the Finnish opinion. The nuclear issue is national in the sense that no country can copy models from other countries without carefully considering the local circumstances. So, in other countries there may be situations where other kinds of actions are called for.

  16. Survey on Issues related to National Nuclear Promotion Policy

    International Nuclear Information System (INIS)

    Woo, Byungchool; Lee, Youngjoon; Lee, Youngcheol; Jeong, I. K.; Kim, Hyunjun; Kim, Youngsoo; Yun, Sungwon; Moon, Keehwan; Chung, Whansam

    2013-06-01

    Ο Major issues surrounding nuclear are including suspicions about nuclear safety, spent-fuel management, acquiring the advanced R and D capabilities and making the nuclear a creative industry Ο Solid measures for securing safety should be formulated and implemented for reducing public anxiety of nuclear use Ο The long-term R and D performance system from a scientific perspective should be established for expanding Research and Development for safer use of nuclear Ο The spent-fuel management policy should be determined through publicizing process Ο Establishing small and medium enterprises-oriented supply system of reactors and SMRs and Encouraging the radiation fusion technology industrialization for promoting creative industry utilizing nuclear

  17. Promotion of Bilateral Cooperative Programs in Nuclear Human Resources Development

    International Nuclear Information System (INIS)

    Lee, E. J.; Han, K. W.; Nam, Y. M.

    2009-08-01

    The purpose of this project is strengthening of bilateral cooperation with those countries for sharing Korea's technology, and providing of education and training on Korean experience regarding national nuclear policy, technology self reliance, and technology itself, in the field of nuclear power generation and the application of radioisotopes and radiation. This project covers an analysis on the need of nuclear human resource development in countries having interest in the introduction of nuclear power and/or promotion of the use of nuclear energy, and provision of courses on 'nuclear power policy, planning and management' and 'design and operation of nuclear research reactor, and application of radiation technology' along with the country specific needs. Education and training of key members in nuclear energy development from Egypt: It was implemented through bilateral cooperation and support by KOICA program. The first part, which targeted staff members from Egypt Nuclear Commission, was held for 2 months providing a KOICA course on policy, planning and management for nuclear power project, and second part was on the job training in Korea Hydro and Nuclear Power and Korea Institute of Nuclear Safety, KAERI respectively. On the job training of 1 scientist from Vietnam was implemented on the basis of bilateral cooperation in a research laboratory on radioactive waste treatment technology, at KAERI. Education and training for scientists from South East RCA countries were carried out for 11 participants from Vietnam, Thailand, Indonesia, China, Pakistan, Malaysia, Philippines, and Bangladesh. The course dealt with nuclear research reactor and radiation application technology. Development of nuclear education and training programs for key persons involved in nuclear power projects from countries of Middle East: The developed program consists of 15 courses addressing 3 technical levels, i.e. high level policy makers, middle level project implementers, and beginners

  18. Promotion of Bilateral Cooperative Programs in Nuclear Human Resources Development

    Energy Technology Data Exchange (ETDEWEB)

    Lee, E. J.; Han, K. W.; Nam, Y. M. (and others)

    2009-08-15

    The purpose of this project is strengthening of bilateral cooperation with those countries for sharing Korea's technology, and providing of education and training on Korean experience regarding national nuclear policy, technology self reliance, and technology itself, in the field of nuclear power generation and the application of radioisotopes and radiation. This project covers an analysis on the need of nuclear human resource development in countries having interest in the introduction of nuclear power and/or promotion of the use of nuclear energy, and provision of courses on 'nuclear power policy, planning and management' and 'design and operation of nuclear research reactor, and application of radiation technology' along with the country specific needs. Education and training of key members in nuclear energy development from Egypt: It was implemented through bilateral cooperation and support by KOICA program. The first part, which targeted staff members from Egypt Nuclear Commission, was held for 2 months providing a KOICA course on policy, planning and management for nuclear power project, and second part was on the job training in Korea Hydro and Nuclear Power and Korea Institute of Nuclear Safety, KAERI respectively. On the job training of 1 scientist from Vietnam was implemented on the basis of bilateral cooperation in a research laboratory on radioactive waste treatment technology, at KAERI. Education and training for scientists from South East RCA countries were carried out for 11 participants from Vietnam, Thailand, Indonesia, China, Pakistan, Malaysia, Philippines, and Bangladesh. The course dealt with nuclear research reactor and radiation application technology. Development of nuclear education and training programs for key persons involved in nuclear power projects from countries of Middle East: The developed program consists of 15 courses addressing 3 technical levels, i.e. high level policy makers, middle level project

  19. Nuclear power programmes in developing countries: Promotion and financing

    International Nuclear Information System (INIS)

    Bennett, L.L.

    1987-01-01

    In 1986 the Agency's Director General established a Senior Expert Group on Mechanisms to Assist Developing Countries in the Promotion and Planning of Nuclear Power Programmes. This group, which was comprised of 20 experts with extensive experience in the topics to be studied, coming from 15 Member States plus the World Bank, was asked to: identify and analyse the problems of and constraints on nuclear power introduction/expansion in developing countries, with particular attention being paid to the problems of financing nuclear power projects; study mechanisms for dealing with the identified problems and constraints in order to assist developing countries with the promotion and financing of their nuclear power programmes and to determine the role of the IAEA in this context. This paper summarizes the Senior Expert Group's study

  20. International cooperation for promotion of nuclear science and engineering research

    International Nuclear Information System (INIS)

    Shibata, Toshikazu; Sugiyama, Kazusuke; Nakazawa, Masaharu; Katoh, Toshio; Kimura, Itsuro.

    1993-01-01

    For promotion of nuclear science and engineering research, examinations were made on the possibilities and necessary measures to extend joint research at international level. The present article is a summary of the reports of investigations performed during FY 1986 through 1991 by the Special Committee of the AESJ for Feasibility Study on International Cooperation for Promotion of Nuclear Science and Engineering Research, under contract with Science and Technology Agency of Japan. Background information was collected on the present status of scientific research facilities in US, European and Asian countries on one hand, and on the expectations and prospects of Japanese scientists on the other hand. Based on the analysis of these data, some measures necessary to expand the international cooperation were proposed. It was emphasized that international joint research on a reciprocal basis would be effective in order to strengthen the technological basis of peaceful uses of nuclear energy. Problems to be solved for the new development were also discussed. (author)

  1. Nucleopolis for promoting the nuclear excellence of the Normandy region

    International Nuclear Information System (INIS)

    2016-01-01

    Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

  2. A Toast to Good Health: IAEA Promotes Nuclear Techniques

    International Nuclear Information System (INIS)

    Henriques, Sasha

    2013-01-01

    The IAEA promotes the use of nuclear techniques to help Member States achieve the Millennium Development Goals (MDGs) by training scientists, providing experts, and helping to fund the purchase of essential equipment. The Agency focuses its nutrition efforts on MDG 4 reduce child mortality, MDG 5 improve maternal health, MDG 6 combat HIV/AIDS malaria and other diseases, and MDG 8 global partnership for development

  3. Prospect on nuclear energy and promotion strategy for next 50 years

    International Nuclear Information System (INIS)

    Lee, Chang Gun

    1996-10-01

    This book describes prospect for nuclear energy and promotion strategy for next 50 years, which has four part ; summary, prospect on nuclear energy for next 50 years with wealth, quality of the life and energy, available energy, future power and energy, nuclear power except as using energy, promotion strategy for nuclear energy for next 50 year with current situation and the rule of nuclear energy in the future, international situation and effect on environment, nuclear reactor and strategy for nuclear fuel cycle, international, institutional and social problems, using nuclear energy except power, precondition for international use of nuclear power, use of nuclear energy for extra field and conclusion.

  4. Young Generation in Nuclear Initiative to Promote Nuclear Science and Technology

    International Nuclear Information System (INIS)

    Kilavi Ndege, P.K.

    2015-01-01

    The Kenyan Young Generation in Nuclear (KYGN) is a recently founded not to profit organization. Its mandate is to educate, inform, promote and transfer knowledge on the peaceful, safe and secure users of nuclear science and technology in Kenya. It brings on board all scientist and students with special interest in nuclear science and related fields. KYGN is an affiliate of International Youth Nuclear Congress (YNC) whose membership with IYNC whose membership is drawn from member state of United Nations. Through our membership with IYNC, KYGN members have been able to participate in different forums. In this paper, we discuss KYGN’s prime roles opportunities as well as the challenges of the organization

  5. Consensus together to jointly promote the safe and efficient development of China's Nuclear industry

    International Nuclear Information System (INIS)

    Lei Zengguang

    2012-01-01

    After the development of China's nuclear industry 56 years, and a certain ability to form a strategic advantage for sustainable development, laying a solid foundation for the development of the national nuclear energy. 2011 Japan's Fukushima Daiichi nuclear accident occurred seven. 2011 of the 'Economic and Social Development Twelfth Five Five Year plan' clearly stated: 'on the basis of ensuring efficient and safe development of nuclear power', the development of China's nuclear industry is facing unprecedented opportunities and challenges, requiring the nuclear industry and nuclear academia work together to jointly promote China's nuclear industry safe and efficient, development

  6. The Competence Promoting by NNSA for Keeping High Level Nuclear Safety: The Corner Stone of the Nuclear Safety Regulation Edifice

    International Nuclear Information System (INIS)

    Hu, L.

    2016-01-01

    Facing the fast development of the nuclear power industry and the application of radioactive sources, The MEP(NNSA) is endeavoured to promoting its competency, including: complementing the law system, training and recruiting staff to keep a capable team, constructing the R&D base to keep the basic capability, promoting safety culture both for the industry and the regulator. After the Fukushima nuclear accident, the MEP(NNSA) planned to construct R&D base, in which the Platform Nuclear Safety Monitoring and Emergency Responding, the Platform of Safety Technology of PWR Testing, the Laboratory of Safety Management Technology of Nuclear Waste Verification, the Laboratory of Environmental Radiation Monitoring and the Center of International Cooperation are included. On the other hand, the MEP(NNSA) issued Chinese nuclear safety culture policy declaration in 2014, and carried out a large scale Specialized Action for Nuclear Safety Promotion to promote the nuclear safety culture both for the industry and herself. For the nuclear regulator, It is essential to conduct the competence promoting by both “hardware” and “software”, the former is the material foundation of regulation authority, which will be effectively functioning under the facilitating of the latter. (author)

  7. Advertising the atom: federal promotion of nuclear power, 1953-1984

    Energy Technology Data Exchange (ETDEWEB)

    Smith, M.

    1984-01-01

    The public relations strategies of the Atomic Energy Commission (AEC) and the nuclear power industry reveal both public and official perceptions of nuclear power and the social uses of technology in general during the first 15 years after passage of the Atomic Energy Act of 1954. The relation between nuclear promotion and regulation also helps explain the environmental crisis of the 1969-1984 years. Project Plowshare coincides roughly with the early promotional years, and provides a case study of the relation of regulatory standards to promotion in AEC policymaking. The author examines the environmentalists challenge to nuclear power that emerged in 1969 alongside government and industry response. He concludes with an assessment of the present state of federal nuclear power policy and of the nuclear power industry.

  8. Advertising the atom: federal promotion of nuclear power, 1953-1984

    International Nuclear Information System (INIS)

    Smith, M.

    1984-01-01

    The public relations strategies of the Atomic Energy Commission (AEC) and the nuclear power industry reveal both public and official perceptions of nuclear power and the social uses of technology in general during the first 15 years after passage of the Atomic Energy Act of 1954. The relation between nuclear promotion and regulation also helps explain the environmental crisis of the 1969-1984 years. Project Plowshare coincides roughly with the early promotional years, and provides a case study of the relation of regulatory standards to promotion in AEC policymaking. The author examines the environmentalists challenge to nuclear power that emerged in 1969 alongside government and industry response. He concludes with an assessment of the present state of federal nuclear power policy and of the nuclear power industry

  9. Nuclear energy industry in Russia promoting global strategy

    International Nuclear Information System (INIS)

    Kobayashi, Masaharu

    2001-01-01

    Since former USSR disintegrated to birth new Russia on December, 1991, it already passed ten years. As Russian economic hardship affected its nuclear energy development, No.1 reactor of the Rostov nuclear power station (VVER-1000) established its full power operation on September, 2001 after passing eight years of pausing period as a Russian nuclear power station, at dull development of nuclear energy in the world. When beginning of its commercial operation, scale of nuclear power generation under operation in Russia will reach to the fourth one in the world by getting over the one in Germany. Russia also begins international business on reprocessing of spent fuel and intermittent storage. And, Russia positively develops export business of concentrated uranium and nuclear fuel, too. Furthermore, Russia shows some positive initiatives on export of nuclear power station to China, Iran and India, and development on advanced nuclear reactor and nuclear fuel cycle forecast to future. Here was introduced on international developmental development of nuclear energy industry activated recently at delayed time for this ten years. (G.K.)

  10. Promotion of public awareness relating nuclear power in young generation

    International Nuclear Information System (INIS)

    Kobayashi, Yoko

    2011-01-01

    Although nuclear power presents problems of waste, safety and non-proliferation, many people understand that it is an essential energy for addressing the global climate and reducing CO2. However, a vague negative-image to the radiation and nuclear power is deep-rooted among the public. Young generation is not an exception. It is very important to transfer many information from the experienced generation in the industry to young generations. In this paper, the research that applied the information intelligence to nuclear power, which involves of the nuclear fuel cycle, and the communication related activities for the social acceptance and improvement. (author)

  11. Promotion and financing of nuclear power programmes in developing countries

    International Nuclear Information System (INIS)

    Bennett, L.L.; Skjoeldebrand, R.

    1988-01-01

    Nuclear power has been introduced only to a small extent in a few developing countries. A group of senior experts conducted a study of the existing constraints on nuclear power in developing countries, the requirements to be met for successful introduction of a nuclear power programme, and mechanisms to assist developing countries in overcoming the identified constraints. Financing represents one (but not the only) major constraint to nuclear power development in developing countries. The present schemes of export credits and commercial financing are seen as not adequately meeting the needs of nuclear power financing in terms of repayment periods and profiles, or in terms of flexibility to meet delays and cost overruns. Innovative and workable arrangements to share the economic and financial risks would be helpful in obtaining financing for a nuclear power project. All possible efforts should be made by all parties involved in the development of nuclear power to reduce as far as possible the uncertainties surrounding the cost and schedule of a nuclear power project, as an essential step to improve the overall climate for financing the project. Government commitment, soundly based and thorough planning, development of qualified manpower and other key infrastructures, and good project management are important mechanisms to achieve greater predictability in project schedule and cost. Technical assistance provided by the IAEA can be very helpful in building these capabilities in developing countries. (author). 1 tab

  12. The role of governments in promoting a realistic public understanding of the potentialities of nuclear power

    International Nuclear Information System (INIS)

    Shapar, H.K.

    1983-01-01

    Adverse public attitudes towards nuclear power have been and continue to be a significant obstacle in the way of nuclear power growth. The three main ways in which governments could help to promote public understanding of nuclear power are 1) by carrying out effectively their traditional tasks of deciding priorities, funding research, encouraging information exchange with other countries and regulating nuclear activities; 2) by providing basic information about the need for nuclear power and its economic importance and providing appropriate opportunities for changes in policies and 3) by showing leadership particularly when no clear course is apparent. (U.K.)

  13. Promotion of international nuclear cooperation: Need, problems and prospects

    International Nuclear Information System (INIS)

    Khan, M.A.

    1985-01-01

    In this panel discussing nonproliferation and international cooperation, the point of view of developing countries, both signatories and nonsignatories to the NPT, is presented. The slow-down in the growth of nuclear trade and industry has adversely affected the economy of energy deficient developing countries, depriving them of the benefits of atomic energy in agriculture and health as well as in power sector. Among 26 countries using nuclear energy for electricity generation, there are just half a dozen developing countries, and their share in the installed nuclear power capacity in the world is only 2 %. Besides the overall slow-down of global economy, the inflexible framework of treaties and quidelines is an important factor of the slow-down. The gradual erosion of mutual confidence between supplier states and recipients has arisen. The greatest threat to world peace is the growing nuclear arsenals of superpowers rather than nuclear proliferation. The role of the IAEA, the setting up of the Committee on Assurance of Supplies, the economy of developing countries and others are discussed. (Kako, I.)

  14. Promoting nuclear energy: market price or regulated tariffs? - 5042

    International Nuclear Information System (INIS)

    Percebois, J.

    2015-01-01

    Because of its negative effects, the scheme for aiding renewable energies presently in force in Europe is likely to penalise investments in nuclear energy. The F.I.T. system is a costly mechanism and a source of perverse effects as a switching of the merit order curve on the spot electricity market (with sometimes negative prices). Restoring an equity and 'equal opportunity' for nuclear energy in Europe needs to implement a 'Contract for Differences' scheme for nuclear energy, like the model now gaining favour in the U.K. The contract for differences signed between EDF and the UK government means that if the wholesale price that EDF secures for Hinckley's power falls below the index-linked preset value, the difference will be covered by payments from the UK government. It appears that nuclear power has weakened in Europe by the system of guaranteed purchase prices for renewable energies. Moreover this system is costly. New fairer rules must be implemented in the market. Either the market is left on its own to send the signals to all investors (including renewable energies), or a minimum of regulation is introduced in order to limit the costly surges of under and over capacity. But in the latter case it is necessary to treat all the energy sources in an equal way and guarantee the nuclear industry that it will also recover its fixed costs over the long term)

  15. To promote public acceptance of nuclear energy by WiN-JAPAN

    International Nuclear Information System (INIS)

    Kuroiwa, Haruko; Kobayashi, Yoko; Ogawa, Junko

    2011-01-01

    Women in Nuclear Japan (WiN-J) has been striving to promote activities that increase public acceptance of nuclear energy especially by women. According to a public opinion poll in 2009 by the Cabient Office, Government of Japan, the ratio of men who have confidence in nuclear power plant safety was 52.1%, while the ratio of females was only 32.5%. And the ratio of negative feeling about nuclear power among males was 45.8%, while the ratio of females was 61.2%. This indicates the necessity of communication to females to encourage them to accept nuclear power. WiN-J developed two methods of communication with the public and young people about the benefits of nuclear energy and the applications of radiation in many aspects of the life. The first is town hall meetings, and the other is education for university students in the style of a Science Cafe. Surprisingly, present university student never studied about nuclear energy when they were elementary or junior high school students. However, those students will have to educate their own children to use energy wisely in consideration of the limited energy resources in the coming years. WiN-J, therefore, gives them some relevant lectures on nuclear energy and radiation. Also WiN-J can be the models for female university students who have issues such as marriage, pregnancy, promotions, and transfers which can be discussed. We have to increase the numbers of female nuclear engineers to promote public trust in the safety of nuclear power plants. For this purpose, WiN-J encourages female university students to enter the nuclear industry. We recognize that to gain people's understanding of and trust in nuclear energy may take a long time. WiN-J will continue to fulfill our challenging mission for the peaceful use of nuclear energy. (author)

  16. Communication promotes the peaceful use of nuclear power

    International Nuclear Information System (INIS)

    Edel, H.P.

    1992-01-01

    Personalities from industry and science, in agreement with the national government, early on recognized the extraordinary importance of keeping the public well informed about nuclear questions. As a result of the initiative of farsighted persons, the Swiss Association for Atomic Energy (Schweizerische Vereinigung fuer Atomenergie, SVA) was founded in 1958 as a grouping of all those who were convinced that the country needed nuclear power for a continuous, secure supply of electricity and for the protection of the environment. 'Atomic energy' as used in the Association's name is meant in a comprehensive sense, as the interests and activities of SVA from the outset were not restricted to the generation of energy from nuclear reactions for purposes of electricity and district heat production but also included such areas as the applications of ionizing radiation and radioactive substances in research, medicine, industry, technology, agriculture, and environmental protection, and the field of radiation protection. (orig.) [de

  17. Speak no evil: The promotional heritage of nuclear risk communication

    International Nuclear Information System (INIS)

    Gwin, L.

    1990-01-01

    Louis Gwin addresses the critically important problem of nuclear risk communication. His research suggests that while an orderly evacuation of the population actually at risk may be workable in theory, the more likely occurrence is widespread panic and gridlock. Gwin's research suggests that existing programs of nuclear risk communication actually make this problem worse. He found that those who had received no prior information on what to do in an emergency were significantly more likely to do the right thing (e.g., await further instructions) than those who had received instructions. With utilities themselves retaining the ultimate responsibility for developing communication programs, it is not surprising that they have been reluctant; to issue instructions on what to do in the event of a nuclear accident is to acknowledge that such accidents can and do occur. Gwin makes no attempt to protray the nuclear industry as purposefully dishonest or evil. The bottom line is that programs that combine the communication of emergency plans with a latent desire to reassure the public fail in their primary purpose. As Gwin observes the key issue is one of trust. People see such communications as little more than propaganda put out by industry for its own purposes and do not trust the utilities to tell them what to do in the event of an accident. It will be every man for himself, with potentially disastrous consequences. How do we restore trust in nuclear risk communications? Gwin offers a number of valuable suggestions such as placing communication responsibility in state or local agencies or in FEMA, and to ensure some form of public participation in the development and communication of emergency plans. This is an excellent study of an important and timely subject. It provides a much needed picture of just how badly our plans are likely to work in the next nuclear emergency. Gwin's warning should be heeded by policymakers now, while there is still time

  18. A-type nuclear lamins act as transcriptional repressors when targeted to promoters

    International Nuclear Information System (INIS)

    Lee, Damian C.; Welton, K. Linnea; Smith, Erica D.; Kennedy, Brian K.

    2009-01-01

    Regions of heterochromatin are often found at the periphery of the mammalian nucleus, juxtaposed to the nuclear lamina. Genes in these regions are likely maintained in a transcriptionally silent state, although other locations at the nuclear periphery associated with nuclear pores are sites of active transcription. As primary components of the nuclear lamina, A- and B-type nuclear lamins are intermediate filament proteins that interact with DNA, histones and known transcriptional repressors, leading to speculation that they may promote establishment of repressive domains. However, no direct evidence of a role for nuclear lamins in transcriptional repression has been reported. Here we find that human lamin A, when expressed in yeast and cultured human cells as a fusion protein to the Gal4 DNA-binding domain (DBD), can mediate robust transcriptional repression of promoters with Gal4 binding sites. Full repression by lamin A requires both the coiled-coil rod domain and the C-terminal tail domain. In human cells, other intermediate filament proteins such as lamin B and vimentin are unable to confer robust repression as Gal4-DBD fusions, indicating that this property is specific to A-type nuclear lamins. These findings indicate that A-type lamins can promote transcriptional repression when in proximity of a promoter

  19. Promoting the development of nuclear technology application in China

    International Nuclear Information System (INIS)

    Wang Naiyan

    2004-01-01

    The application of nuclear technology in China has been playing important parts in the fields of military, industry, agriculture, medical science, life science, material science, environment protection, etc. However, comparing with some advanced countries and to satisfy the need of national economy China still has a long way to go

  20. Regional Cooperation for the Promotion of Nuclear Power Business

    International Nuclear Information System (INIS)

    Kim, Jong Sok

    1991-01-01

    In the early year of nuclear power business in Korea, it was proceeded smoothly under the good situation in general. But in mid-1987 on the way of democratization in the country, mass demonstration of residents around the nuclear power plant and unfavorable groundless attitude to nuclear power plant presented US great deal of adversities. Upon this historical turning point KEPCO and government could provide the law on support for areas surrounding power plant and we recognized that the nuclear power business is only possible under the good-established, mutual cooperation between the utility and the surrounding communities and the enhancement of public understanding is inevitable than before. In order to secure these goals with the present recognition heartily, we firstly have to operate the plant safely to lay up the trust foundation and secondly to enhance the common understanding by giving more information of nuclear power especially contribution on national economic growth and environment preservation and, thirdly to do our best for the establishment of new era of co-prosperity between the utility and surrounding communities by strengthening the rational supports. By implementing all of these without any problems, the communities become more affluent than before and the conversion of the image of our corporation as a national entity will become widespread, so that it will be easy to find the necessary construction sites, as well as to operate existing plants, smoothly. Eventually we, as the public corporation, could carryout he social responsibility and contribute to the national economic growth, which leads to the final goal of community cooperation

  1. Action by the European Commission to promote nuclear safety outside the territory of the Union

    International Nuclear Information System (INIS)

    Joulia, J.P.

    2010-01-01

    The TACIS programme to improve nuclear safety in Central and Eastern Europe and the former USSR has now entered its final phase. A new programme 'the Instrument for Nuclear Safety Cooperation (INSC)' has been launched and its aim is to promote nuclear safety in all third-party countries. Support for improvement of the regulatory framework and the effectiveness of the bodies in charge of nuclear safety is a key element. Within the European Commission, the 'Europe, Southern Mediterranean, Middle East and Neighbourhood policy' Directorate, belonging to the AIDCO General Directorate, is tasked with implementation. (author)

  2. Promoting nuclear education and technology in Thai high schools

    International Nuclear Information System (INIS)

    Keyes, W.

    1998-01-01

    The public acceptance project which Thailand is undertaking through the Chulalongkorn University project is based on the awareness that increased public support of nuclear power is an essential precondition to the consideration of a nuclear power program for the country. By approaching public education on this matter via an independent and recognized authority such as Chulalongkorn University, the issue has remained as an education and information process rather than becoming a political issue and falling victim to all of the pitfalls of that process. The model of selecting independent partners and organizations to conduct public education and public acceptance activities appears to be more effective than for the utility itself to more directly address such issues. It is of course recognized that at some time there will be a public discussion and debate of the issue of nuclear power in Thailand. However the work done by such public education projects in advance of any public announcements on any project plans should help to ensure that the ensuing public discussion will take place amongst a better informed public

  3. Can we promote nuclear energy without talking about it?

    International Nuclear Information System (INIS)

    Chadeyron, Philippe; Le Breton, Sandrine

    2002-01-01

    In France, the public as mixed feelings on the subject of civil nuclear energy. The terrorist attacks of September 11th, and to a lesser extent, the explosion of the AZF chemical plant TotalfinaElf) in Toulouse a few days later, probably contributed to the further weakening of its image. However, quite a while before the terrorist attacks, EDF had decided that instead of continuing to 44 'challenge' public opinion directly on the subject of nuclear power, it would ratchet up the debate by embarking on the path of sustainable development and consequently, on that of an energy mix. Why? EDF is an electrical utility of international dimensions. As such, it is duty-bound to meet the needs of the planet (two billion people still do not have access to electrical power and this figure will probably have doubled by 2020), while limiting the impact of its activities on the environment, with particular reference to greenhouse gases. The solution to these energy needs is inevitably to be found in an energy mix, where all energy forms are represented, without excluding or glorifying any particular one. Renewable energy forms will be intensively developed in France and the rest of the world, as they provide an excellent solution for developing countries. Nuclear energy accounts for 35 of electrical power generation in Europe. Like all other energy forms, it will have its role to play. Affirming this fact within the context of sustainable development and a very receptive attitude towards all energy forms, is probably the greatest favour we can do it. When it comes to renewing European nuclear power facilities and finding lasting solutions for the storage of long-life waste in the not-too-distant future, the public will realise that this choice was not dictated by dogma or an isolated decision made by a few political decision-makers, but by a real need for our planet's stability. This presentation will include illustrations (TV/posters) from the EDF corporate advertising campaign

  4. Promotion of Nuclear Non-proliferation in East Asia

    International Nuclear Information System (INIS)

    Hwang, Yong Soo

    2009-07-01

    KAERI has jointly worked with Sandia National Laboratories for Nuclear Energy Non-proliferation in East Asia for the last five years. This project aims at support activities in this joint project between two states. The annual meetings were held during the project period, the 4th one in 2008 and the 5th one in 2009. In addition code comparison between KAERI and SNL's codes for assessing the back-end fuel cycle options was carried out. This project strongly enhances the close tie for the non-proliferation, transparency and safeguards among Korea Japan China Taiwan the United States Russia Malaysia Singapore Indonesia Thailand Vietnam and others for the project period

  5. AECL R and D's role in promoting nuclear research and education

    International Nuclear Information System (INIS)

    Sadhankar, R.

    2009-01-01

    Nuclear renaissance has created new opportunities for new technology development and has also brought along the challenge of meeting the growing demand of trained personnel in the nuclear science and engineering. Towards meeting this challenge, AECL R and D organization is actively promoting and supporting the creation of nuclear research capabilities at the universities and also effectively leveraging the R and D at the universities. It has also put in place several new initiatives to attract and develop the talented young people for careers in nuclear science and engineering. This paper describes various interactions and collaborations with the universities that supports the nuclear R and D at the universities and develop highly qualified personnel for the future nuclear R and D needs. (author)

  6. Nuclear pore protein NUP88 activates anaphase-promoting complex to promote aneuploidy

    NARCIS (Netherlands)

    Naylor, R.M.; Jeganathan, K.B.; Cao, X.; Deursen, J.M. van

    2016-01-01

    The nuclear pore complex protein NUP88 is frequently elevated in aggressive human cancers and correlates with reduced patient survival; however, it is unclear whether and how NUP88 overexpression drives tumorigenesis. Here, we show that mice overexpressing NUP88 are cancer prone and form intestinal

  7. Promoting nuclear power, achieving sustainable development of nuclear industry in China

    International Nuclear Information System (INIS)

    Kang, R.

    2006-01-01

    The past 5 decades witnessed the rapid growth of China's nuclear industry. The sustained and rapid economic growth and continuous improvement of people's living standards have placed higher requirements for energy and power supplies. As a safe and clean energy source, nuclear energy has been gradually and widely accepted by the Chinese government and the public. The Chinese government has adopted the policy a ctively pushing forward the nuclear power development , set up the target to reach 40GWe of nuclear power installed capacity by 2020, accounting for about 4% of the total installed capacity in China. In this regard, this paper presents the China's nuclear program to illustrate how China is going to achieve the target. The paper is composed of 3 parts. The first part gives a review of the achievements in nuclear power in the last 20 years. The second part presents China's ''three approach'' strategy for furthering the nuclear power development: carrying out duplication projects at the existing plant sites; introducing GUI technology via international bidding; developing the brand C NP1000 , i.e. Chinese Nuclear Power lOOOMwe class, with China's own intellectual property. This part also explores the ways of securing the fuel supply for nuclear power development. The third part concludes with CNNC's ''3221'' strategy which aims at building a world class conglomerate, and expresses its sincere wish to work with the nuclear community to push the nuclear industry worldwide by strengthening international cooperation

  8. Activities promoting the achievement of high nuclear fuel performance indicators

    International Nuclear Information System (INIS)

    Naev, I.; Tomov, A.

    2011-01-01

    This presentation begins with brief general information about Kozloduy Nuclear Power Plant and organization activities about fresh fuel delivery assurance. The TVSA implementation, fuel cycle, fresh fuel standard entrance inspection and additional fresh fuel inspection are briefly described. Activities concerning core refueling, radiochemistry analysis, control rods drop time, measurement of the distance between the reactor flange and PTU flange, specific items for core unloading and a comparison between the two variants for operations scope with full and without full core unloading are presented. The core unloading - results and next steps, final core design (Unit 6, 2010), preparing for core loading (Unit 6, 2010) , core loading (Unit 6, 2010), after loading core inspection (Unit 6, 2010), core inspection, reactor assembling (Unit 6, 2010), fuel control during reactor startup, fuel control during operation period and fuel assembly data base are also discussed

  9. Asian network for education in nuclear technology: An initiative to promote education and training in nuclear technology

    International Nuclear Information System (INIS)

    Kosilov, A.

    2006-01-01

    It has become increasingly clear that there is a need to consolidate the efforts of academia and industry in education and training. Partnerships of operating organizations with educational institutions and universities that provide qualified professionals for the nuclear industry should be assessed based upon medium and long term needs and strengthened where needed. In this regard the IAEA is taking the necessary action to initiate this kind of partnership through continuous networking. The paper describes the IAEA approach to promoting education and training through the Asian Network for Education in Nuclear Technology (ANENT). (author)

  10. Society for Promotion of Peaceful Applications of Nuclear in Kenya (SPANS)

    International Nuclear Information System (INIS)

    2006-01-01

    The seminar was organized by the National Council for Science and Technology in collaboration with International Atomic Energy Agency (IAEA) to achieve the following objectives; create public awareness on Peaceful use of Nuclear Science and Technology discuss and adopt the draft constitution for the Society for the Promotion of Nuclear Science in Kenya SPANS (K). The National Council for Science and Technology identified highly qualified resource persons who are competent enough in the area of nuclear applications who prepared relevant topics based on their knowledge and experiences in the field of nuclear science. The presentations covered topics of nuclear applications in the areas of agriculture, health, pollution and a draft of SPANS Constitution. The Council is in the process of compiling and publishing the proceedings whose details will be submitted later to INIS once it is ready

  11. Nuclear power plant construction and financial assistance - as regards subsidies for promotion of power plant siting

    International Nuclear Information System (INIS)

    Shindo, M.

    1983-01-01

    This paper describes the institutional framework for the granting of subsidies in particular to promote nuclear power plant construction in Japan. It also analyses the technical criteria applied and lists the type of improvements to various facilities and equipment made with such subsidies. (NEA) [fr

  12. Low nuclear body formation and tax SUMOylation do not prevent NF-kappaB promoter activation

    Directory of Open Access Journals (Sweden)

    Bonnet Amandine

    2012-09-01

    Full Text Available Abstract Background The Tax protein encoded by Human T-lymphotropic virus type 1 (HTLV-1 is a powerful activator of the NF-κB pathway, a property critical for HTLV-1-induced immortalization of CD4+ T lymphocytes. Tax permanently stimulates this pathway at a cytoplasmic level by activating the IκB kinase (IKK complex and at a nuclear level by enhancing the binding of the NF-κB factor RelA to its cognate promoters and by forming nuclear bodies, believed to represent transcriptionally active structures. In previous studies, we reported that Tax ubiquitination and SUMOylation play a critical role in Tax localization and NF-κB activation. Indeed, analysis of lysine Tax mutants fused or not to ubiquitin or SUMO led us to propose a two-step model in which Tax ubiquitination first intervenes to activate IKK while Tax SUMOylation is subsequently required for promoter activation within Tax nuclear bodies. However, recent studies showing that ubiquitin or SUMO can modulate Tax activities in either the nucleus or the cytoplasm and that SUMOylated Tax can serve as substrate for ubiquitination suggested that Tax ubiquitination and SUMOylation may mediate redundant rather than successive functions. Results In this study, we analyzed the properties of a new Tax mutant that is properly ubiquitinated, but defective for both nuclear body formation and SUMOylation. We report that reducing Tax SUMOylation and nuclear body formation do not alter the ability of Tax to activate IKK, induce RelA nuclear translocation, and trigger gene expression from a NF-κB promoter. Importantly, potent NF-κB promoter activation by Tax despite low SUMOylation and nuclear body formation is also observed in T cells, including CD4+ primary T lymphocytes. Moreover, we show that Tax nuclear bodies are hardly observed in HTLV-1-infected T cells. Finally, we provide direct evidence that the degree of NF-κB activation by Tax correlates with the level of Tax ubiquitination, but not

  13. Low nuclear body formation and tax SUMOylation do not prevent NF-kappaB promoter activation.

    Science.gov (United States)

    Bonnet, Amandine; Randrianarison-Huetz, Voahangy; Nzounza, Patrycja; Nedelec, Martine; Chazal, Maxime; Waast, Laetitia; Pene, Sabrina; Bazarbachi, Ali; Mahieux, Renaud; Bénit, Laurence; Pique, Claudine

    2012-09-25

    The Tax protein encoded by Human T-lymphotropic virus type 1 (HTLV-1) is a powerful activator of the NF-κB pathway, a property critical for HTLV-1-induced immortalization of CD4⁺ T lymphocytes. Tax permanently stimulates this pathway at a cytoplasmic level by activating the IκB kinase (IKK) complex and at a nuclear level by enhancing the binding of the NF-κB factor RelA to its cognate promoters and by forming nuclear bodies, believed to represent transcriptionally active structures. In previous studies, we reported that Tax ubiquitination and SUMOylation play a critical role in Tax localization and NF-κB activation. Indeed, analysis of lysine Tax mutants fused or not to ubiquitin or SUMO led us to propose a two-step model in which Tax ubiquitination first intervenes to activate IKK while Tax SUMOylation is subsequently required for promoter activation within Tax nuclear bodies. However, recent studies showing that ubiquitin or SUMO can modulate Tax activities in either the nucleus or the cytoplasm and that SUMOylated Tax can serve as substrate for ubiquitination suggested that Tax ubiquitination and SUMOylation may mediate redundant rather than successive functions. In this study, we analyzed the properties of a new Tax mutant that is properly ubiquitinated, but defective for both nuclear body formation and SUMOylation. We report that reducing Tax SUMOylation and nuclear body formation do not alter the ability of Tax to activate IKK, induce RelA nuclear translocation, and trigger gene expression from a NF-κB promoter. Importantly, potent NF-κB promoter activation by Tax despite low SUMOylation and nuclear body formation is also observed in T cells, including CD4⁺ primary T lymphocytes. Moreover, we show that Tax nuclear bodies are hardly observed in HTLV-1-infected T cells. Finally, we provide direct evidence that the degree of NF-κB activation by Tax correlates with the level of Tax ubiquitination, but not SUMOylation. These data reveal that the

  14. Human nucleoporins promote HIV-1 docking at the nuclear pore, nuclear import and integration.

    Directory of Open Access Journals (Sweden)

    Francesca Di Nunzio

    Full Text Available The nuclear pore complex (NPC mediates nucleo-cytoplasmic transport of macromolecules and is an obligatory point of passage and functional bottleneck in the replication of some viruses. The Human Immunodeficiency Virus (HIV has evolved the required mechanisms for active nuclear import of its genome through the NPC. However the mechanisms by which the NPC allows or even assists HIV translocation are still unknown. We investigated the involvement of four key nucleoporins in HIV-1 docking, translocation, and integration: Nup358/RanBP2, Nup214/CAN, Nup98 and Nup153. Although all induce defects in infectivity when depleted, only Nup153 actually showed any evidence of participating in HIV-1 translocation through the nuclear pore. We show that Nup358/RanBP2 mediates docking of HIV-1 cores on NPC cytoplasmic filaments by interacting with the cores and that the C-terminus of Nup358/RanBP2 comprising a cyclophilin-homology domain contributes to binding. We also show that Nup214/CAN and Nup98 play no role in HIV-1 nuclear import per se: Nup214/CAN plays an indirect role in infectivity read-outs through its effect on mRNA export, while the reduction of expression of Nup98 shows a slight reduction in proviral integration. Our work shows the involvement of nucleoporins in diverse and functionally separable steps of HIV infection and nuclear import.

  15. Promoting a learning culture to maintain the nuclear safety competence of AECB staff

    International Nuclear Information System (INIS)

    Omar, A.; Belisle, N.; Grant, I.

    2000-01-01

    In the Canadian regulatory approach, the safe operation of a nuclear installation is primarily the responsibility of the operator. The mission of the Atomic Energy Control Board (AECB) is to ensure that the use of nuclear energy does not pose unnecessary risk to workers, the general public and the environment. The AECB fulfills this responsibility through a comprehensive licensing framework in which compliance with regulatory standards and requirements is assured through systematic safety assessments, inspection and enforcement. These responsibilities require regulatory staff with specialized academic backgrounds and work experience related to the industry. In the past, the AECB readily attracted and retained the qualified personnel needed to ensure nuclear safety competence. However, several factors are now altering this situation. Anticipated retirement in the years ahead among the current generation of staff will result in significant losses of corporate knowledge and experience. In addition, the stagnation of the domestic nuclear power industry has impacted significantly on the recruitment of suitably qualified replacement candidates. Many Canadian universities have had to reduce their nuclear programmes as fewer undergraduate and postgraduate students choose a nuclear career option. In these circumstances, maintaining the AECB's nuclear safety competence requires a more systematic and deliberate approach. This paper describes the measures that the AECB has taken and is planning to take to promote a learning environment, and to assist staff in establishing and maintaining their knowledge and skills. (author)

  16. Tissue-specific interactions between nuclear proteins and the aminopeptidase N promoter

    DEFF Research Database (Denmark)

    Kärnström, U; Sjöström, H; Norén, O

    1991-01-01

    Aminopeptidase N/CD13 is a metallopeptidase found in many tissues. Aminopeptidase N activity is high in the small intestinal mucosa, moderate in the liver, and low in the spleen. Using DNase I footprinting and electrophoretic mobility shift assays with nuclear extracts from these tissues, three cis...... elements (DF, LF-B1, UF) were identified in the aminopeptidase N promoter. The DF region (-53 to -30) interacts with the ubiquitously expressed transcription factor Sp1. The LF-B1 region (-85 to -58) interacts with the liver transcription factor LF-B1 (HNF-1) which was detected as well in nuclei from small...... intestinal mucosa. The UF region (-112 to -90) interacts with nuclear factors which seem to be expressed differentially in the liver and the small intestine. Transfection of promoter deletions into HepG2 cells showed that the LF-B1 region is necessary for high expression of the aminopeptidase N gene in liver...

  17. The human nuclear poly(a-binding protein promotes RNA hyperadenylation and decay.

    Directory of Open Access Journals (Sweden)

    Stefan M Bresson

    Full Text Available Control of nuclear RNA stability is essential for proper gene expression, but the mechanisms governing RNA degradation in mammalian nuclei are poorly defined. In this study, we uncover a mammalian RNA decay pathway that depends on the nuclear poly(A-binding protein (PABPN1, the poly(A polymerases (PAPs, PAPα and PAPγ, and the exosome subunits RRP6 and DIS3. Using a targeted knockdown approach and nuclear RNA reporters, we show that PABPN1 and PAPα, redundantly with PAPγ, generate hyperadenylated decay substrates that are recognized by the exosome and degraded. Poly(A tail extension appears to be necessary for decay, as cordycepin treatment or point mutations in the PAP-stimulating domain of PABPN1 leads to the accumulation of stable transcripts with shorter poly(A tails than controls. Mechanistically, these data suggest that PABPN1-dependent promotion of PAP activity can stimulate nuclear RNA decay. Importantly, efficiently exported RNAs are unaffected by this decay pathway, supporting an mRNA quality control function for this pathway. Finally, analyses of both bulk poly(A tails and specific endogenous transcripts reveals that a subset of nuclear RNAs are hyperadenylated in a PABPN1-dependent fashion, and this hyperadenylation can be either uncoupled or coupled with decay. Our results highlight a complex relationship between PABPN1, PAPα/γ, and nuclear RNA decay, and we suggest that these activities may play broader roles in the regulation of human gene expression.

  18. RAF 0/047: Promoting the sustainability & networking of National Nuclear Institutions (NNI) for Development

    International Nuclear Information System (INIS)

    Wanjala, F.

    2017-01-01

    RAF/0/047 is being participated by Eleven Countries, namely, Egypt, Ethiopia, Ghana, Kenya, Madagascar, Morocco, Niger, Nigeria, Senegal, Tanzania, and Zambia. The Main objective of the project is to enhance the sustainability of African nuclear institutions by improving their performance and relevance to development programmes through good managerial practices, partnership building and marketing, including upgrading and strengthening of human resources capabilities”. There is government commitment to support and promote the development and training in nuclear science and technology. Inadequate or aging equipment equipment’s in some fields of nuclear science and technology is one of weakness in implementing this project. Income generating activities remain the most powerful force that influences NNI’s sustainability

  19. Celebrating 25 years of technical cooperation for promotion of nuclear science, technology in Latin America, Caribbean

    International Nuclear Information System (INIS)

    2009-01-01

    Full text: The IAEA celebrates the 25th Anniversary of the Regional Agreement of Technical Cooperation for the Promotion of Nuclear Science and Technology in Latin America and the Caribbean (ARCAL) for the peaceful use of nuclear energy as well as its applications for development during the 53rd General Conference of the International Atomic Energy Agency, taking place this week. The Board of Country Representatives of ARCAL (BAR) is celebrating the 25th anniversary of the Regional Agreement of Technical Cooperation for the Promotion of Nuclear Science and Technology in Latin America and the Caribbean (ARCAL) from 14-18 September, during the 53rd General Conference of the IAEA in Vienna, Austria. Through sustainable horizontal technical and economic cooperation over the past 25 years, the IAEA Member States of Latin America and the Caribbean have expressed their solidarity and commitment to the establishment and improvement of technical capabilities in nuclear science and technology within the region, with the goal of promoting the use of diverse nuclear techniques and their applications for peaceful use in the region. Thanks to the ARCAL agreement, a mechanism for regular meetings and discussions has been established between professionals working in the nuclear field in Latin America and the Caribbean. ARCAL was established in 1984, thanks to the initiative of the Andean Group countries. At the moment, ARCAL has 19 Member States: Argentina, Bolivia, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, El Salvador, Guatemala, Haiti, Mexico, Nicaragua, Panama, Paraguay, Peru, Dominican Republic, Uruguay and Venezuela. The main thematic areas covered by the technical cooperation projects sponsored by the IAEA through the ARCAL agreement are human health, agriculture and food security, physics and chemistry sciences, engineering and technology, hydrology, industrial applications, environment and nuclear security. During its 25 years, the ARCAL regional agreement has

  20. Celebrating 25 years of technical cooperation for promotion of nuclear science, technology in Latin America, Caribbean

    International Nuclear Information System (INIS)

    2009-01-01

    Full text: The IAEA celebrates the 25th Anniversary of the Regional Agreement of Technical Cooperation for the Promotion of Nuclear Science and Technology in Latin America and the Caribbean (ARCAL) for the peaceful use of nuclear energy as well as its applications for development during the 53rd General Conference of the International Atomic Energy Agency, taking place this week. The Board of Country Representatives of ARCAL (BAR) is celebrating the 25th anniversary of the Regional Agreement of Technical Cooperation for the Promotion of Nuclear Science and Technology in Latin America and the Caribbean (ARCAL) from 14-18 September, during the 53rd General Conference of the IAEA in Vienna, Austria. Through sustainable horizontal technical and economic cooperation over the past 25 years, the IAEA Member States of Latin America and the Caribbean have expressed their solidarity and commitment to the establishment and improvement of technical capabilities in nuclear science and technology within the region, with the goal of promoting the use of diverse nuclear techniques and their applications for peaceful use in the region. Thanks to the ARCAL agreement, a mechanism for regular meetings and discussions has been established between professionals working in the nuclear field in Latin America and the Caribbean. ARCAL was established in 1984, thanks to the initiative of the Andean Group countries. At the moment, ARCAL has 19 Member States: Argentina, Bolivia, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, El Salvador, Guatemala, Haiti, Mexico, Nicaragua, Panama, Paraguay, Peru, Dominican Republic, Uruguay and Venezuela. The main thematic areas covered by the technical cooperation projects sponsored by the IAEA through the ARCAL agreement are human health, agriculture and food security, physics and chemistry sciences, engineering and technology, hydrology, industrial applications, environment and nuclear security. During its 25 years, the ARCAL regional agreement has

  1. Effects and practices on nuclear safety convention promoting nuclear safety in China

    International Nuclear Information System (INIS)

    Zhang Wei; Cheng Jianxiu; Chen Maosong

    2010-01-01

    By the means of peer review and self-review, the Contracting Parties are reviewed on obligations under the Convention. In order to implementation these, the State Department established the specific group, under the efforts of departments together, the China fulfilled the obligations successfully. The international society affirmed the good practices on nuclear safety in China, at the same time, they pointed out some fields that China pay close attention to. On the basis of analyzing questions, we point out some aspects which are combined the common questions put forward by the International Atomic Energy Agency on the 4th reviewing meeting that the Chinese government pay close attention to on the next review meeting. Meanwhile, we also put forward some suggestions on how to do better on fulfilling the convention. (authors)

  2. Selective nuclear export of specific classes of mRNA from mammalian nuclei is promoted by GANP

    Science.gov (United States)

    Wickramasinghe, Vihandha O.; Andrews, Robert; Ellis, Peter; Langford, Cordelia; Gurdon, John B.; Stewart, Murray; Venkitaraman, Ashok R.; Laskey, Ronald A.

    2014-01-01

    The nuclear phase of the gene expression pathway culminates in the export of mature messenger RNAs (mRNAs) to the cytoplasm through nuclear pore complexes. GANP (germinal- centre associated nuclear protein) promotes the transfer of mRNAs bound to the transport factor NXF1 to nuclear pore complexes. Here, we demonstrate that GANP, subunit of the TRanscription-EXport-2 (TREX-2) mRNA export complex, promotes selective nuclear export of a specific subset of mRNAs whose transport depends on NXF1. Genome-wide gene expression profiling showed that half of the transcripts whose nuclear export was impaired following NXF1 depletion also showed reduced export when GANP was depleted. GANP-dependent transcripts were highly expressed, yet short-lived, and were highly enriched in those encoding central components of the gene expression machinery such as RNA synthesis and processing factors. After injection into Xenopus oocyte nuclei, representative GANP-dependent transcripts showed faster nuclear export kinetics than representative transcripts that were not influenced by GANP depletion. We propose that GANP promotes the nuclear export of specific classes of mRNAs that may facilitate rapid changes in gene expression. PMID:24510098

  3. Yes-Associated Protein (YAP) Promotes the Nuclear Import of p73

    International Nuclear Information System (INIS)

    Zhang Heng; Wu Shengnan

    2011-01-01

    p73 has been identified as a structural and functional homolog of the tumor suppressor p53. However, mechanisms that regulate the localization of p73 have not been fully clarified. The Yes-associated protein (YAP) is a transcriptional coactivator. As a transcriptional coactivator, YAP needs to bind transcription factors to stimulate gene expression. p73 is a reported YAP target transcription factors and YAP has been shown to positively regulate p73 in promoting apoptosis. Previous studies show that p73 interacts with YAP through its PPPY motif, and increases p73 transactivation of apoptotic genes. In this study, we focused on YAP's regulation of the localization of p73. After transient transfection into Rat pheochromocytoma (PC12) cells and Human embryonic kidney 293T cells with GFP-YAP and/or YFP-p73, and incubated for 24 hours expression. p73 was fused to YFP to allow the examination of its subcellular localization. When expressed alone, YFP-p73 was distributed throughout the cell. When coexpressed with YAP, nuclear accumulation of YFP-p73 became evident. We quantitated the effect of YAP on the redistribution of YFP-p73 by counting cells with nuclear-only YFP signal. We found that YAP can influence the subcellular distribution of p73. Altogether, coexpression with YAP affected the subcellular distribution of the p73 protein. Our studies attribute a central role to YAP in regulating p73 accumulation and YAP, at least in part, might promote the nuclear import of p73.

  4. Way of future development of nuclear power generation and its promotion

    International Nuclear Information System (INIS)

    Kodama, Katsuomi

    1976-01-01

    In the development of nuclear power generation in the world, light water reactors amount to 80 1/2 of the whole. The present status of these reactors are described together with the other types of reactors. In the nuclear power generation in Japan, the reliability should be analysed from the various operation experiences of annual utilization rate, failure of achieving maximum approved power, number of failure occurrence, and shut down period including both scheduled and accidental. Reconsideration to control and maintenance should be made after the above analysis. To say about the domestic production of light water reactors, ''what to produce'' must be considered and promoted seriously, instead of ''how to produce skillfully''. It seems to be necessary to assimilate the light water reactor techniques born in U.S. so as to take root in the soil of Japan, because original ideas have begun to appear from users and makers as the operation, construction and maintenance experiences on light water reactors have increased. The tendency of improving light water reactor techniques is the standardization. It is also required for the promotion of nuclear power generation to establish the fuel cycle, and to solve the waste processing and disposal. For low level solid wastes, the policy has been decided to perform it by combining underground and ocean disposal. In order to smooth the siting problems, it will be required to practice adequate and effective public relations while proving the safety, investigating the influence of warm water discharge on the environment and establishing their countermeasures. The way of thinking to obtain peoples' consensus for the safety is described. (Wakatsuki, Y.)

  5. Study on the Promotion in the Citation of the Nuclear Engineering and Technology

    Energy Technology Data Exchange (ETDEWEB)

    Chun, Young Choon; Yoo, J. B.; Yi, J. H. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    The Korean journal published in English, Nuclear Engineering and Technology (here under NET) has been enlisted in the global citation database SCI E(Science Citation Index Expanded) of Thomson Reuters (past ISI), beginning with NET vol.39 No.1 (Feb. 2007). As of July 2009, the citation index of NET as reported by JCR (Journal Citation Report) based on the cumulative data from ISI (Institute for Scientific Information) reached to 0.991. This index ranks on 12{sup th} among the 33 journals in the area of nuclear science and technology in the science and technology covered by JCR, meaning fairly high impact factor. The following year 2010, however, witnessed the JCR figure dropping down to 0.465. The reason behind such drastic fall would be the decreased citation and in a lesser extent self-citation in 2010, in comparison with 2009, despite the increased number of paper publication. This study attempts to give an analysis as of the end of 2011 on the NET citation frequency in SCI Source Journal and the citation frequency by KAERI authors, together with the nationalities of NET authors and SCI journals that refer to NET most. Based on the analysis, the paper suggests some ways to promoting the position of NET as a journal in the international nuclear sector

  6. Study on the Promotion in the Citation of the Nuclear Engineering and Technology

    International Nuclear Information System (INIS)

    Chun, Young Choon; Yoo, J. B.; Yi, J. H.

    2012-01-01

    The Korean journal published in English, Nuclear Engineering and Technology (here under NET) has been enlisted in the global citation database SCI E(Science Citation Index Expanded) of Thomson Reuters (past ISI), beginning with NET vol.39 No.1 (Feb. 2007). As of July 2009, the citation index of NET as reported by JCR (Journal Citation Report) based on the cumulative data from ISI (Institute for Scientific Information) reached to 0.991. This index ranks on 12 th among the 33 journals in the area of nuclear science and technology in the science and technology covered by JCR, meaning fairly high impact factor. The following year 2010, however, witnessed the JCR figure dropping down to 0.465. The reason behind such drastic fall would be the decreased citation and in a lesser extent self-citation in 2010, in comparison with 2009, despite the increased number of paper publication. This study attempts to give an analysis as of the end of 2011 on the NET citation frequency in SCI Source Journal and the citation frequency by KAERI authors, together with the nationalities of NET authors and SCI journals that refer to NET most. Based on the analysis, the paper suggests some ways to promoting the position of NET as a journal in the international nuclear sector

  7. Promoting excellence in nuclear power plant training in the United States

    International Nuclear Information System (INIS)

    Mangin, A.M.

    1983-01-01

    The Institute of Nuclear Power Operations (INPO) was formed in late 1979 by U.S. nuclear utilities to enhance the operational safety and reliability of their nuclear plants. One of INPO's major functions is to promote excellence in industry training and qualification programs. To accomplish this objective, INPO develops and uses guidelines and evaluation criteria to assist utilities in developing and implementing high quality training and education programs. The training guidelines permit utilities to develop performance-based programs which meet their specific need with minimal duplication of effort. INPO regularly evaluates each utility's training programs and practices in the plant evaluation and accreditation processes using criteria based on the training guidelines. In the accreditation process, INPO examines training programs and training organizations to determine whether they have the potential to produce individuals qualified to perform assigned tasks. During plant evaluations, INPO examines the implementation of the programs and their effectiveness in producing qualified individuals. After each accreditation review and plant evaluation, INPO recommends improvements and follows up to ensure they are made. (author)

  8. A Study to Promote a Collaboration of R and D for Nuclear Energy Technology Development between Korea and Kazakhstan

    Energy Technology Data Exchange (ETDEWEB)

    Ryh, Sipyo; Kim, Cheoljung; Yoo, Bungduk; Lee, Yongjoo; Kim, Hansoo; Yoon, Sungwon; Jeong, Hwansam; Jeong, Gijung

    2005-01-15

    The ultimate goal of this investigation to promote a collaboration of R and D for Nuclear Energy Technology Development between Korea and Kazakhstan. To understand the research power of the Kazakhstan, we visited the INP(Institute of Nuclear Physics) which is one of the branch of Nation Cuclear Center-Repunlic Kazakhstan. We presented the present status of the nuclear energy related research in KAERI. The director of international cooperation in the ministry of Mineral resources, the director of INP and vice director of IAE had visited KAERI, KIRAM and discussed about potential cooperation in nuclear research related field.

  9. Stakeholder engagement for promoting the Comprehensive Nuclear-Test-Ban Treaty (CTBT): Malaysia’s experience

    Science.gov (United States)

    Rashid, F. I. A.; Zolkaffly, M. Z.; Jamal, N.

    2018-01-01

    In order to keep abreast on issues related to CTBT in Malaysia, Malaysian Nuclear Agency (Nuklear Malaysia), as the CTBT National Authority in Malaysia, has collaborated with local partners to implement various stakeholder engagement programme. This paper aims at highlighting Malaysia’s approach in promoting CTBT through stakeholder engagement programme targeted at multilevel stakeholders, both national and international. Such programmes includes participation in the international forums, inter-agency meetings, awareness seminars, training courses, technical visits to IMS station, promoting civil and scientific application of International Monitoring System (IMS) data and International Data Centre (IDC) products using Virtual Data Exploitation Center (vDEC), inviting youth groups to participate in the CTBTO Youth Group, and publications of CTBT-related topics. This approach has successfully fortify Malaysia’s commitments at the international level, enhanced national awareness of global multilateral framework, increased stakeholders awareness and their roles related to CTBT, as well as building domestic capacity on CTBT matters. In conclusion, stakeholder engagement is crucial in promoting and enhancing stakeholders understanding on CTBT. Continuous engagement with relevant stakeholders will enable effective dissemination and smooth implementation of CTBT related matters that will eventually support global universalization of CTBT.

  10. The human papillomavirus (HPV) E6 oncoproteins promotes nuclear localization of active caspase 8

    International Nuclear Information System (INIS)

    Manzo-Merino, Joaquin; Massimi, Paola; Lizano, Marcela; Banks, Lawrence

    2014-01-01

    The HPV-16 E6 and E6 ⁎ proteins have been shown previously to be capable of regulating caspase 8 activity. We now show that the capacity of E6 to interact with caspase 8 is common to diverse HPV types, being also seen with HPV-11 E6, HPV-18 E6 and HPV-18 E6 ⁎ . Unlike most E6-interacting partners, caspase 8 does not appear to be a major proteasomal target of E6, but instead E6 appears able to stimulate caspase 8 activation, without affecting the overall apoptotic activity. This would appear to be mediated in part by the ability of the HPV E6 oncoproteins to recruit active caspase 8 to the nucleus. - Highlights: • Multiple HPV E6 oncoproteins interact with the caspase 8 DED domain. • HPV E6 stimulates activation of caspase 8. • HPV E6 promotes nuclear accumulation of caspase 8

  11. The human papillomavirus (HPV) E6 oncoproteins promotes nuclear localization of active caspase 8

    Energy Technology Data Exchange (ETDEWEB)

    Manzo-Merino, Joaquin [Unidad de Investigación Biomédica en Cáncer, Instituto Nacional de Cancerología, México/Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México. Av. San Fernando No. 22, Col. Sección XVI, Tlalpan 14080 (Mexico); Massimi, Paola [International Centre for Genetic Engineering and Biotechnology, Padriciano 99, I-34149 Trieste (Italy); Lizano, Marcela, E-mail: lizanosoberon@gmail.com [Unidad de Investigación Biomédica en Cáncer, Instituto Nacional de Cancerología, México/Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México. Av. San Fernando No. 22, Col. Sección XVI, Tlalpan 14080 (Mexico); Banks, Lawrence, E-mail: banks@icgeb.org [International Centre for Genetic Engineering and Biotechnology, Padriciano 99, I-34149 Trieste (Italy)

    2014-02-15

    The HPV-16 E6 and E6{sup ⁎} proteins have been shown previously to be capable of regulating caspase 8 activity. We now show that the capacity of E6 to interact with caspase 8 is common to diverse HPV types, being also seen with HPV-11 E6, HPV-18 E6 and HPV-18 E6{sup ⁎}. Unlike most E6-interacting partners, caspase 8 does not appear to be a major proteasomal target of E6, but instead E6 appears able to stimulate caspase 8 activation, without affecting the overall apoptotic activity. This would appear to be mediated in part by the ability of the HPV E6 oncoproteins to recruit active caspase 8 to the nucleus. - Highlights: • Multiple HPV E6 oncoproteins interact with the caspase 8 DED domain. • HPV E6 stimulates activation of caspase 8. • HPV E6 promotes nuclear accumulation of caspase 8.

  12. Networking of institutions in India to promote research and education in nuclear science and engineering

    International Nuclear Information System (INIS)

    Puri, R.R.

    2007-01-01

    will pool together the strength of each of its CI to accelerate the pace of basic research and its translation in to technology development. It would provide unique opportunity to students to learn from, and work with people having hands-on experience in the environment of highly advanced research facilities hardly available elsewhere in the country. It would promote interdisciplinary research essential for development of nuclear science and technology. The setting-up of HBNI is expected to attract those talented youngsters to nuclear science and engineering who are looking for intellectual challenges and recognition of their efforts in terms of formal degrees. The networking of the DAE Institutes under the umbrella of HBNI is a unique experiment to promote research and education in nuclear science and engineering in India. In the years to come, admission to HBNI may be opened to students from other countries. (author)

  13. Methods of promotion of nuclear research and development in the Federal Republic of Germany and international cooperation

    International Nuclear Information System (INIS)

    Lehr, G.

    1987-01-01

    The promotion of nuclear research and development in the Federal Republic of Germany is part of the overall R and D policy and is geared to the long-term energy policy goals. Nuclear energy development has been successfully promoted for more than thirty years, the non-nuclear energy technologies for almost 15 years. As a result of this support for new technologies, energy production has become more efficient and cost-effective and with regard to fossil energy sources also markedly less detrimental to the environment. Nuclear energy research policy is an integral part of energy research policy as a whole, which particularly aims to increasingly promote renewable energy sources, above all photovoltaic and wind energy, the utilization of biomass and geothermal energy as well as the development of various energy storage methods. In addition to some mining projects which aim to reduce coal production costs, promotion in the field of fossil energy sources concentrates above all on power plant engineering and combustion techniques - i.e. environment-oriented technologies. In view of future supply patterns, projects on coal conversion are continued; with present supply and price structures for mineral oil and natural gas, however, commercialization of coal conversion cannot be expected to be launched on a large scale. (J.P.N.)

  14. The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1–AMPK complex

    International Nuclear Information System (INIS)

    Nakagawa, Koji; Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie; Asaka, Masahiro; Takeda, Hiroshi; Kobayashi, Masanobu

    2012-01-01

    Highlights: ► The nuclear protein Artemis physically interacts with AMPKα2. ► Artemis co-localizes with AMPKα2 in the nucleus. ► Artemis promotes phosphorylation and activation of AMPK. ► The interaction between AMPKα2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic α subunit and regulatory β and γ subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the α-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPKα2-binding protein. Artemis was found to co-immunoprecipitate with AMPKα2, and the co-localization of Artemis with AMPKα2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPKα2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPKα2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1–AMPK complex.

  15. The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1-AMPK complex

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, Koji, E-mail: k_nakagawa@pharm.hokudai.ac.jp [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Asaka, Masahiro [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Takeda, Hiroshi [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Kobayashi, Masanobu [Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); School of Nursing and Social Services, Health Sciences University of Hokkaido, Ishikari-Toubetsu, Hokkaido 061-0293 (Japan)

    2012-11-02

    Highlights: Black-Right-Pointing-Pointer The nuclear protein Artemis physically interacts with AMPK{alpha}2. Black-Right-Pointing-Pointer Artemis co-localizes with AMPK{alpha}2 in the nucleus. Black-Right-Pointing-Pointer Artemis promotes phosphorylation and activation of AMPK. Black-Right-Pointing-Pointer The interaction between AMPK{alpha}2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic {alpha} subunit and regulatory {beta} and {gamma} subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the {alpha}-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPK{alpha}2-binding protein. Artemis was found to co-immunoprecipitate with AMPK{alpha}2, and the co-localization of Artemis with AMPK{alpha}2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPK{alpha}2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPK{alpha}2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1-AMPK complex.

  16. A Study on the Promotion of Networking for International Training and Education in Nuclear Technology

    International Nuclear Information System (INIS)

    Min, B. J.; Lee, E. J.; Han, K. W.

    2007-04-01

    For the diversification of Korea's participation in the ANENT, the country contributed to the establishment of a new project (2007-2009) for the promotion of ANENT activities. Along the same, KAERI contributed to the development of cyber platform. Also, available course contents from IAEA were surveyed. In particular an approval course entitled as 'Energy Planning' was planned to be implemented in 2007. Finally, the ANENT web-portal including the cyber platform was operated and improved by upgrading and adding information and data. In order to promote the domestic cultivation of young scientists, Korea hosted 2007 WNU SI for the first time in Asia. KAERI staff was attached to the head quarter office of WNU to develop the curricula of WNU SI jointly. Keeping the basic structure of the original curricula, the developed curricula included Korean experience of self reliance in nuclear power technology and development of advanced technology. Methodology for the cooperation between ANENT and WNU was studied resulting in 2 ways. Primarily, it was suggested and prepared to produce cyber contents from 2007 WNU SI so that they can be up-loaded both on WNU web site and ANENT cyber platform. Secondly, cooperation in education and training activities was suggested to conduct exchange of students, joint development of cyber contents, operation of ANENT-WNU joint courses, development of reference curricula, and mutual recognition of credits and degrees. The methodology for the cooperation between ANENT and WNU will be implemented as follows: cooperation in the use of cyber contents from 2007 WNU SI will be produced during the event and they will be up-loaded both on WNU web site and ANENT cyber platform for common use; cooperation in education and training activities will be implemented by way of exchanging students, jointly developing cyber contents, operating ANENT-WNU joint courses, developing reference curricula, and realizing mutual recognition of credits and degrees

  17. A Study on the Promotion of Networking for International Training and Education in Nuclear Technology

    Energy Technology Data Exchange (ETDEWEB)

    Min, B J; Lee, E J; Han, K W [and others

    2007-04-15

    For the diversification of Korea's participation in the ANENT, the country contributed to the establishment of a new project (2007-2009) for the promotion of ANENT activities. Along the same, KAERI contributed to the development of cyber platform. Also, available course contents from IAEA were surveyed. In particular an approval course entitled as 'Energy Planning' was planned to be implemented in 2007. Finally, the ANENT web-portal including the cyber platform was operated and improved by upgrading and adding information and data. In order to promote the domestic cultivation of young scientists, Korea hosted 2007 WNU SI for the first time in Asia. KAERI staff was attached to the head quarter office of WNU to develop the curricula of WNU SI jointly. Keeping the basic structure of the original curricula, the developed curricula included Korean experience of self reliance in nuclear power technology and development of advanced technology. Methodology for the cooperation between ANENT and WNU was studied resulting in 2 ways. Primarily, it was suggested and prepared to produce cyber contents from 2007 WNU SI so that they can be up-loaded both on WNU web site and ANENT cyber platform. Secondly, cooperation in education and training activities was suggested to conduct exchange of students, joint development of cyber contents, operation of ANENT-WNU joint courses, development of reference curricula, and mutual recognition of credits and degrees. The methodology for the cooperation between ANENT and WNU will be implemented as follows: cooperation in the use of cyber contents from 2007 WNU SI will be produced during the event and they will be up-loaded both on WNU web site and ANENT cyber platform for common use; cooperation in education and training activities will be implemented by way of exchanging students, jointly developing cyber contents, operating ANENT-WNU joint courses, developing reference curricula, and realizing mutual recognition of credits and degrees.

  18. A Study on the Promotion of Networking for International Training and Education in Nuclear Technology

    Energy Technology Data Exchange (ETDEWEB)

    Min, B. J.; Lee, E. J.; Han, K. W. (and others)

    2007-04-15

    For the diversification of Korea's participation in the ANENT, the country contributed to the establishment of a new project (2007-2009) for the promotion of ANENT activities. Along the same, KAERI contributed to the development of cyber platform. Also, available course contents from IAEA were surveyed. In particular an approval course entitled as 'Energy Planning' was planned to be implemented in 2007. Finally, the ANENT web-portal including the cyber platform was operated and improved by upgrading and adding information and data. In order to promote the domestic cultivation of young scientists, Korea hosted 2007 WNU SI for the first time in Asia. KAERI staff was attached to the head quarter office of WNU to develop the curricula of WNU SI jointly. Keeping the basic structure of the original curricula, the developed curricula included Korean experience of self reliance in nuclear power technology and development of advanced technology. Methodology for the cooperation between ANENT and WNU was studied resulting in 2 ways. Primarily, it was suggested and prepared to produce cyber contents from 2007 WNU SI so that they can be up-loaded both on WNU web site and ANENT cyber platform. Secondly, cooperation in education and training activities was suggested to conduct exchange of students, joint development of cyber contents, operation of ANENT-WNU joint courses, development of reference curricula, and mutual recognition of credits and degrees. The methodology for the cooperation between ANENT and WNU will be implemented as follows: cooperation in the use of cyber contents from 2007 WNU SI will be produced during the event and they will be up-loaded both on WNU web site and ANENT cyber platform for common use; cooperation in education and training activities will be implemented by way of exchanging students, jointly developing cyber contents, operating ANENT-WNU joint courses, developing reference curricula, and realizing mutual recognition of credits and

  19. Nuclear geyser model of the origin of life: Driving force to promote the synthesis of building blocks of life

    Directory of Open Access Journals (Sweden)

    Toshikazu Ebisuzaki

    2017-03-01

    Full Text Available We propose the nuclear geyser model to elucidate an optimal site to bear the first life. Our model overcomes the difficulties that previously proposed models have encountered. Nuclear geyser is a geyser driven by a natural nuclear reactor, which was likely common in the Hadean Earth, because of a much higher abundance of 235U as nuclear fuel. The nuclear geyser supplies the following: (1 high-density ionizing radiation to promote chemical chain reactions that even tar can be used for intermediate material to restart chemical reactions, (2 a system to maintain the circulation of material and energy, which includes cyclic environmental conditions (warm/cool, dry/wet, etc. to enable to produce complex organic compounds, (3 a lower temperature than 100 °C as not to break down macromolecular organic compounds, (4 a locally reductive environment depending on rock types exposed along the geyser wall, and (5 a container to confine and accumulate volatile chemicals. These five factors are the necessary conditions that the birth place of life must satisfy. Only the nuclear geyser can meet all five, in contrast to the previously proposed birth sites, such as tidal flat, submarine hydrothermal vent, and outer space. The nuclear reactor and associated geyser, which maintain the circulations of material and energy with its surrounding environment, are regarded as the nuclear geyser system that enables numerous kinds of chemical reactions to synthesize complex organic compounds, and where the most primitive metabolism could be generated.

  20. Application of nuclear techniques in food and agriculture: promoting world food security

    International Nuclear Information System (INIS)

    Salema, P.Manase

    1998-01-01

    Agriculture is the backbone of the economies of many countries, including Romania. The need to improve both quantity and quality of agricultural products and promote trade while at the same time preserving the natural resource base, and the environment in general, is paramount for achieving sustainable development. It was recognized at the World Food Summit held in Rome, Italy last year that, there was a need to break through the present yield/production barriers and to use natural resources in a more sustainable manner if there would be hope of eliminating hunger and associated poverty from the world in the foreseeable future. For this to happen, the world will have to rely on science and technology to provide new methods of farming, new varieties of crops, better ways of protecting crops and livestock etc. Nuclear techniques are efficient tools for research and development and will play an important and often indispensable role in the effort to achieve sustainable food security and development in the world. (author)

  1. Asymmetric Arginine dimethylation of Epstein-Barr virus nuclear antigen 2 promotes DNA targeting

    International Nuclear Information System (INIS)

    Gross, Henrik; Barth, Stephanie; Palermo, Richard D.; Mamiani, Alfredo; Hennard, Christine; Zimber-Strobl, Ursula; West, Michelle J.; Kremmer, Elisabeth; Graesser, Friedrich A.

    2010-01-01

    The Epstein-Barr virus (EBV) growth-transforms B-lymphocytes. The virus-encoded nuclear antigen 2 (EBNA2) is essential for transformation and activates gene expression by association with DNA-bound transcription factors such as RBPJκ (CSL/CBF1). We have previously shown that EBNA2 contains symmetrically dimethylated Arginine (sDMA) residues. Deletion of the RG-repeat results in a reduced ability of the virus to immortalise B-cells. We now show that the RG repeat also contains asymmetrically dimethylated Arginines (aDMA) but neither non-methylated (NMA) Arginines nor citrulline residues. We demonstrate that only aDMA-containing EBNA2 is found in a complex with DNA-bound RBPJκ in vitro and preferentially associates with the EBNA2-responsive EBV C, LMP1 and LMP2A promoters in vivo. Inhibition of methylation in EBV-infected cells results in reduced expression of the EBNA2-regulated viral gene LMP1, providing additional evidence that methylation is a prerequisite for DNA-binding by EBNA2 via association with the transcription factor RBPJκ.

  2. Nuclear Coexistence: Rethinking U.S. Policy to Promote Stability in an Era of Proliferation

    Science.gov (United States)

    1994-04-01

    into the effects of Israel’s nuclear weapons on regional stability. 25. See David Albright and Mark Hibbs, "Iraq’s Bomb: Blueprints and Artifacts...Foreign Minister Andrei V. Kozyrev warned Ukraine that the possession of deteriorating nuclear warheads could lead to an accident.32 Sovereign Control and...longstanding political disputes. By the standard of nuclear bipolarity, the nuclear politics on the subcontinent are largely a mirror of the U.S.-Soviet nuclear

  3. Synergistic regulation of the mouse orphan nuclear receptor SHP gene promoter by CLOCK-BMAL1 and LRH-1

    International Nuclear Information System (INIS)

    Oiwa, Ako; Kakizawa, Tomoko; Miyamoto, Takahide; Yamashita, Koh; Jiang, Wei; Takeda, Teiji; Suzuki, Satoru; Hashizume, Kiyoshi

    2007-01-01

    Small heterodimer partner (SHP; NR0B2) is an orphan nuclear receptor and acts as a repressor for wide variety of nuclear hormone receptors. We demonstrated here that mouse SHP mRNA showed a circadian expression pattern in the liver. Transient transfection of the mSHP promoter demonstrated that CLOCK-BMAL1, core circadian clock components, bound to E-box (CACGTG), and stimulated the promoter activity by 4-fold. Liver receptor homologue-1 (LRH-1; NR5A2) stimulated the mSHP promoter, and CLOCK-BMAL1 synergistically enhanced the LRH-1-mediated transactivation. Interestingly, SHP did not affect the CLOCK-BMAL1-mediated promoter activity, but strongly repressed the synergistic activation of CLOCK-BMAL1 and LRH-1. Furthermore, in vitro pull-down assays revealed the existence of direct protein-protein interaction between LRH-1 and CLOCK. In summary, this study shows that CLOCK-BMAL1, LRH-1 and SHP coordinately regulate the mSHP gene to generate the circadian oscillation. The cyclic expression of mSHP may affect daily activity of other nuclear receptors and contribute to circadian liver functions

  4. Canonical Poly(A Polymerase Activity Promotes the Decay of a Wide Variety of Mammalian Nuclear RNAs.

    Directory of Open Access Journals (Sweden)

    Stefan M Bresson

    2015-10-01

    Full Text Available The human nuclear poly(A-binding protein PABPN1 has been implicated in the decay of nuclear noncoding RNAs (ncRNAs. In addition, PABPN1 promotes hyperadenylation by stimulating poly(A-polymerases (PAPα/γ, but this activity has not previously been linked to the decay of endogenous transcripts. Moreover, the mechanisms underlying target specificity have remained elusive. Here, we inactivated PAP-dependent hyperadenylation in cells by two independent mechanisms and used an RNA-seq approach to identify endogenous targets. We observed the upregulation of various ncRNAs, including snoRNA host genes, primary miRNA transcripts, and promoter upstream antisense RNAs, confirming that hyperadenylation is broadly required for the degradation of PABPN1-targets. In addition, we found that mRNAs with retained introns are susceptible to PABPN1 and PAPα/γ-mediated decay (PPD. Transcripts are targeted for degradation due to inefficient export, which is a consequence of reduced intron number or incomplete splicing. Additional investigation showed that a genetically-encoded poly(A tail is sufficient to drive decay, suggesting that degradation occurs independently of the canonical cleavage and polyadenylation reaction. Surprisingly, treatment with transcription inhibitors uncouples polyadenylation from decay, leading to runaway hyperadenylation of nuclear decay targets. We conclude that PPD is an important mammalian nuclear RNA decay pathway for the removal of poorly spliced and nuclear-retained transcripts.

  5. Increased expression of hepatocyte nuclear factor 4 alpha transcribed by promoter 2 indicates a poor prognosis in hepatocellular carcinoma

    OpenAIRE

    Cai, Shao-hang; Lu, Shi-xun; Liu, Li-li; Zhang, Chris Zhiyi; Yun, Jing-ping

    2017-01-01

    Background: Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. Methods: A total of 615 HCC specimens were obtained to construct tissue microarrays and pe...

  6. Macrophage mitochondrial oxidative stress promotes atherosclerosis and nuclear factor-κB-mediated inflammation in macrophages.

    Science.gov (United States)

    Wang, Ying; Wang, Gary Z; Rabinovitch, Peter S; Tabas, Ira

    2014-01-31

    Mitochondrial oxidative stress (mitoOS) has been shown to correlate with the progression of human atherosclerosis. However, definitive cell type-specific causation studies in vivo are lacking, and the molecular mechanisms of potential proatherogenic effects remain to be determined. Our aims were to assess the importance of macrophage mitoOS in atherogenesis and to explore the underlying molecular mechanisms. We first validated Western diet-fed Ldlr(-/-) mice as a model of human mitoOS-atherosclerosis association by showing that non-nuclear oxidative DNA damage, a marker of mitoOS in lesional macrophages, correlates with aortic root lesion development. To investigate the importance of macrophage mitoOS, we used a genetic engineering strategy in which the OS suppressor catalase was ectopically expressed in mitochondria (mCAT) in macrophages. MitoOS in lesional macrophages was successfully suppressed in these mice, and this led to a significant reduction in aortic root lesional area. The mCAT lesions had less monocyte-derived cells, less Ly6c(hi) monocyte infiltration into lesions, and lower levels of monocyte chemotactic protein-1. The decrease in lesional monocyte chemotactic protein-1 was associated with the suppression of other markers of inflammation and with decreased phosphorylation of RelA (NF-κB p65), indicating decreased activation of the proinflammatory NF-κB pathway. Using models of mitoOS in cultured macrophages, we showed that mCAT suppressed monocyte chemotactic protein-1 expression by decreasing the activation of the IκB-kinase β-RelA NF-κB pathway. MitoOS in lesional macrophages amplifies atherosclerotic lesion development by promoting NF-κB-mediated entry of monocytes and other inflammatory processes. In view of the mitoOS-atherosclerosis link in human atheromata, these findings reveal a potentially new therapeutic target to prevent the progression of atherosclerosis.

  7. Lymphotoxin β receptor activation promotes bladder cancer in a nuclear factor-κB-dependent manner.

    Science.gov (United States)

    Shen, Mo; Duan, Xiuzhi; Zhou, Ping; Zhou, Wu; Wu, Xiuling; Xu, Siqi; Chen, Yuhua; Tao, Zhihua

    2015-02-01

    Bladder cancer (BCa) is the most common tumor of the urinary system. Chronic inflammation in the papillary urothelial neoplasm of low malignant potential (PUNLMP)may contribute to carcinogenesis, including that of BCa, via poorly understood mechanisms. In this study, we show that the lymphotoxin β receptor (LTβR) is upregulated in BCa via activation of the canonical and non-canonical nuclear factor-κB (NF-κB) pathways. The mRNA expression of LTβR in 81 BCa, 10 chronic cystitis and 23 healthy bladder mucosa tissues was investigated by reverse transcription-fluorescent quantitative polymerase chain reaction (RT-FQ-PCR), and protein expression was studied in 73 BCa, 30 cystitis and 15 healthy paraffin-embedded tissue sections by immunohistochemistry. Both LTβR mRNA and protein were upregulated in BCa and cystitis compared to the healthy group (P<0.05). The mRNA level of the downstream NF-κB canonical pathway p65 gene and of the non-canonical pathway RelB gene were higher in the BCa and cystitis groups compared to the healthy one. The level of phosphorylated p65 (p-p65) protein of the canonical NF-κB pathway and that of p52, a protein of the non-canonical NF-κB pathway, were also higher in the BCa and cystitis group compared to the healthy group. The levels of these proteins significantly correlated to the pathological grade, clinical stage and lymph node metastasis of BCa patients (P<0.05). In addition, there was a positive correlation between LTβR and NF-κB pathway proteins. Thus, LTβR signaling may be involved in promoting BCa through the NF-κB pathway, and which may represent the molecular link between inflammation and BCa.

  8. Implementing the strategy of multileveled PI activities to promote rapid nuclear power development

    International Nuclear Information System (INIS)

    Chen Gang

    2005-01-01

    The first two decades of the 21st century is the golden time for nuclear power development in China. According to the nuclear power development program laid down by the State Development and Reform Commission, nearly 30 units of 1000MW will be built in the next 15 years, so as to meet fastgrowing energy demand, to optimize energy mix and to alleviate environmental pollution. Under such a new situation, based on the public information practice and experience during the construction and operation of Qinshan Nuclear Power Complex where the first commercial NPP originated in the Mainland of China, this paper emphasizes on the necessity of establishment of an active and open strategy of multileveled nuclear energy public information activities and implementation of the strategy with adoption of various forms of nuclear energy popularization means, including seminars, contests, exhibitions, site tour to nuclear power plants, reports by mass media, hosting questions-answering dialogue by experts via Internet, TV and radio programs, newspapers and journals , etc.. Thus through the nuclear energy public information activity the recognition and confidence of the public, especially the local community and the public in vicinity of new nuclear power sites on the nuclear energy can be enhanced, and the nuclear power program can gain their support. Furthermore, the fine social environment for nuclear power development can be fostered. (authors)

  9. Promoting nuclear security: What the IAEA is doing. The Agency is implementing a comprehensive programme aimed at stemming the threat of nuclear terrorism

    International Nuclear Information System (INIS)

    2003-01-01

    The threat to public safety and security posed by some form of nuclear terrorism is not new. But in the wake of recent highly organized terrorist attacks in Kenya, Tanzania, the US, Indonesia, Saudi Arabia, Morocco and numerous other nations, the international community has come to recognize that new and stronger measures must be taken to protect against and prepare for a diverse range of terrorist scenarios. Given the multiplicity of targets and scenarios for terrorists, States must consider a comprehensive approach to combating nuclear terrorism. Among the key priorities: Adequate physical protection of all nuclear materials, radioactive materials and facilities plus transport systems; Proper regulatory control of nuclear and radioactive material; Effective detection and interdiction of illicit trafficking in nuclear and radioactive materials; Integration of nuclear safety and security systems for maximum benefits; and Readiness for implementing emergency response plans. The IAEA is assisting its Member States with these challenges in many ways. Through well-established activities, the Agency has been heavily involved in providing assistance and technical support to States in all these areas. The IAEA has established several advisory services to help Member States to assess the effectiveness and the need for improvement of their national physical oversight systems. The IAEA provides peer reviews in related areas such as regulatory or control infrastructures, and also supplies expert technical advice on the required upgrades. Several of these specialized services aim directly at protecting against terrorist threats. The International Nuclear Security Advisory Service is a new initiative that is providing specialized services promoting enhanced nuclear security. The International SSAC Advisory Service (ISSAS) is another new initiative providing advice to Member States in strengthening their SSAC. The IAEA also offers the EPREV (Emergency Preparedness REView

  10. A Study to Promote a Collaboration of R and D for Nuclear Energy Technology Development between Korea and Central Asia

    Energy Technology Data Exchange (ETDEWEB)

    Rho, Si Pyo; Kim, Cheol Jung; Yoo, Bung Duk; Kim, Jae Woo; Lee, Myung Ho; Kim, Kyung Pyo

    2006-02-15

    The goal of this research work is to promote the cooperation in the field of nuclear related works with Kazakhstan and Uzbekistan which are main countries in the central Asia. To make a basis on exchanging researchers, a staff in KAERI had visited INP NNC RK, touring research reactors, and make a discussion with the staffs in INP. With this, there is a efforts to make an arrangement between KAERI and NNC RK, signing will be made in near futures. To understand the level of nuclear technology in Uzbekistan, Dr. Rho had made a trip to INP. He visited the Gamma-radiation facility, a research reactor. In Nov. 2005, the chairman of Science Academy visited Korea to discuss the future cooperation in the field of peaceful use of the nuclear energy. By doing so, Korea will make an effort to cooperate with countries in the Central Asia.

  11. A Study to Promote a Collaboration of R and D for Nuclear Energy Technology Development between Korea and Central Asia

    International Nuclear Information System (INIS)

    Rho, Si Pyo; Kim, Cheol Jung; Yoo, Bung Duk; Kim, Jae Woo; Lee, Myung Ho; Kim, Kyung Pyo

    2006-02-01

    The goal of this research work is to promote the cooperation in the field of nuclear related works with Kazakhstan and Uzbekistan which are main countries in the central Asia. To make a basis on exchanging researchers, a staff in KAERI had visited INP NNC RK, touring research reactors, and make a discussion with the staffs in INP. With this, there is a efforts to make an arrangement between KAERI and NNC RK, signing will be made in near futures. To understand the level of nuclear technology in Uzbekistan, Dr. Rho had made a trip to INP. He visited the Gamma-radiation facility, a research reactor. In Nov. 2005, the chairman of Science Academy visited Korea to discuss the future cooperation in the field of peaceful use of the nuclear energy. By doing so, Korea will make an effort to cooperate with countries in the Central Asia

  12. Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

    Science.gov (United States)

    Kageyama, R; Merlino, G T; Pastan, I

    1989-09-15

    Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

  13. What's There to Debate about Nuclear Energy? Promoting Multidimensional Science Literacy by Implementing STS Strategies

    Science.gov (United States)

    Bartley, Elise; Brown, Patrick L.; Concannon, James P.; Stumpe, Laura

    2013-01-01

    In this lesson, the teacher begins by reviewing some key energy topics with the students. Next, students are asked to focus closely on nuclear energy as a viable resource by closely reading, highlighting, and annotating an article regarding the future of nuclear energy. The culminating activity and evaluation of students understanding of energy…

  14. The role of nuclear societies in the promotion of international cooperation

    International Nuclear Information System (INIS)

    Velez, C.

    1992-01-01

    International cooperation in the peaceful uses of atomic energy started with the Atoms for Peace initiative in 1955. The satisfaction of the foreseeable world demand for electricity requires a large increase in nuclear power. Such an increase will not be realized unless a number of current nuclear issues, both real and perceived, are resolved first. Most of the problems have acquired an international character and many of them are amenable only to international treatments. The nuclear societies can have an important role in this development. The last years of the present century will be decisive for the immediate future of nuclear power. The nuclear societies should coordinate efforts, join forces and speak out with one clear and distinct voice in all important issues

  15. International legal instruments promoting synergy's in nuclear safety, security and safeguards: myth of reality?

    International Nuclear Information System (INIS)

    Vasmant, A.

    2009-01-01

    The purpose of this article is to assess the existing synergies between nuclear safety, nuclear security and non-proliferation/safeguards resulting from the adoption of international legal instruments. Keeping in mind that a synergy is the extra success achieved by two or more elements of a system working together instead of on their own, this paper will try to evaluate the possibility of a so-called '3 S' approach to optimize the benefits so defined. to achieve this, Part 1 focuses on the history of the three regimes and their major features, while Part 2, 3 and 4 explore the various benefits of, limits to, synergies between the nuclear safety, nuclear security and safeguards regimes. Part 5 describes the potential '3 S' approach in international nuclear law. (N.C.)

  16. CNS members promoting nuclear energy in public debate - an example from Quebec

    International Nuclear Information System (INIS)

    Franta, J.; Sabourin, G.; Saint-Denis, M.

    2006-01-01

    For approximately two years, several members of the Quebec branch of the Canadian Nuclear Society have publicly expressed their views in favour of nuclear energy in Quebec. This paper summarizes their participation in the BAPE public hearings on the environment ('Bureau d'Audience Publique sur l'Environnement'), in the hearings of a Quebec Parliamentary Commission on economy and labour, and in the United Nations Conference on Climate Change in December 2005 in Montreal. The focus is mainly on a debate around the possible refurbishment of the Gentilly-2 nuclear power plant, the only operating nuclear plant in Quebec. Antinuclear groups are well organized and their message is transmitted loudly to the public by the mainstream media. Industry professionals must therefore express themselves publicly to counterbalance this biased message. In conclusion, we see a need for the formation of a coalition of all who support nuclear power in Quebec to support the refurbishment of Gentilly-2. (author)

  17. CNS members promoting nuclear energy in public debate - an example from Quebec

    Energy Technology Data Exchange (ETDEWEB)

    Franta, J.; Sabourin, G.; Saint-Denis, M. [Atomic Energy of Canada Limited, Montreal, Quebec (Canada)

    2006-07-01

    For approximately two years, several members of the Quebec branch of the Canadian Nuclear Society have publicly expressed their views in favour of nuclear energy in Quebec. This paper summarizes their participation in the BAPE public hearings on the environment ('Bureau d'Audience Publique sur l'Environnement'), in the hearings of a Quebec Parliamentary Commission on economy and labour, and in the United Nations Conference on Climate Change in December 2005 in Montreal. The focus is mainly on a debate around the possible refurbishment of the Gentilly-2 nuclear power plant, the only operating nuclear plant in Quebec. Antinuclear groups are well organized and their message is transmitted loudly to the public by the mainstream media. Industry professionals must therefore express themselves publicly to counterbalance this biased message. In conclusion, we see a need for the formation of a coalition of all who support nuclear power in Quebec to support the refurbishment of Gentilly-2. (author)

  18. KDM6B Elicits Cell Apoptosis by Promoting Nuclear Translocation of FOXO1 in Non-Small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Jun Ma

    2015-08-01

    Full Text Available Background/Aims: Non-small cell lung carcinoma (NSCLC is the most common type of lung cancer and the cause of most cancer-related deaths. The molecular mechanisms that are involved in NSCLC development are currently not well understood. Accumulating evidence shows that histone demethylases play important roles in the regulation of pathological developmental processes in many diseases, including various types of cancers. Methods: Mitochondrial membrane potential assays, migration and invasion assays, caspase-3 and caspase-9 activity assays and western blot analysis were used in this research. Results: We found that overexpression of KDM6B, a demethylase that acts on histone H3 at lysine 27 (H3K27, inhibited cell growth by initiating mitochondria-dependent apoptosis and by attenuating the invasion-metastasis cascade in NSCLC cells. Moreover, our results showed that KDM6B directly interacted with FOXO1 and that overexpression of KDM6B promoted nuclear accumulation of FOXO1. The effects of KDM6B on cell apoptosis and metastasis were weakened by knockdown of FOXO1 expression. On the contrary, knocking down expression of KDM6B inhibited cell apoptosis and promoted cell growth by mitigating the nuclear translocation of FOXO1 in NSCLC cells. Conclusions: These findings suggest that KDM6B may act in a pro-apoptotic role in NSCLC by causing the nuclear translocation of FOXO1.

  19. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    International Nuclear Information System (INIS)

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-01-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  20. France's Efforts to Promote NPP Exports and the Implications on the Role of Nuclear Regulatory Body

    International Nuclear Information System (INIS)

    Oh, Chae-Woon; Chang, Hyun-Sop; Choi, Young-Sung

    2008-01-01

    The global society facing sky-rocketing oil prices, global warming effects, and increased demand for electricity recognizes the comparative advantages of nuclear energy in terms of environmental impact and economic efficiency over the other energy sources of current use. Approximately 300 nuclear power plants (NPPs) expect to be constructed until 2030 worldwide. Accordingly, the global market size of nuclear power industry becomes scaled up to the extent of U$75 billion on the assumption that the construction of one reactor costs around U$2.5 billion. The nations in possession of advanced nuclear technology such as the U.S., France, Japan, etc not only recognized an abounding profitability in nuclear industry and anticipated nuclear renaissance but also prepared long before whatever necessary to expand their nuclear programs beyond their domestic boundaries. Amongst those nations, it seems to be France that has unfolded a remarkable array of government-led activities to export Evolutionary Pressurized Reactors (EPRs) under the cooperation of President, relevant government administration, utilities even a regulatory body. The omni-directional activities of France and its implications are presented in this paper

  1. Experimental evaluation of different mixing promoter for nuclear fuel element by means of a new thermal tracing technique

    International Nuclear Information System (INIS)

    Silin, Nicolas; Juanico, Luis; Delmastro, Dario

    2004-01-01

    In this work a new experimental method is used to experimentally evaluate the performance of different appendages promoting the turbulent mixing between the coupled subchannels of nuclear fuel elements.The method used will be introduced in another presentation and consists in the generation and measurement of small thermal traces in the refrigerating water flow between the fuel rods.Because it is suitable for heterogeneous and compact subchannels (as Argentinean fuels) with high water flows in simple and affordable tests at atmospheric pressure, this new method is specially well suited for the design of fuel elements, while it offers advantages over other methods of mixing measurement.The experiments carried out on a small test section proved that the buttons brazed to the fuel rods (similar to the 'turbulence promoters' of the Canflex fuel) had an excellent thermohydraulic performance as compared to different mixing vane designs studied.The thermal traces method developed has shown its potential as a thermohydraulic design tool for the development of advanced nuclear fuels, that eventually incorporate mixing promoter elements. In the case of CARA, and as it includes spacer grids, it could be possible to use them to incorporate these elements without the need of brazing them to the rods (as is the case in Canflex), and therefore without penalizing its integrity [es

  2. Decreased nuclear stiffness via FAK-ERK1/2 signaling is necessary for osteopontin-promoted migration of bone marrow-derived mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Lingling, E-mail: liulingling2012@163.com [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Luo, Qing, E-mail: qing.luo@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Sun, Jinghui, E-mail: sunjhemail@163.com [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Wang, Aoli, E-mail: leaf13332@163.com [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Shi, Yisong, E-mail: shiyis@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Ju, Yang, E-mail: ju@mech.nagoya-u.ac.jp [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Morita, Yasuyuki, E-mail: morita@mech.nagoya-u.ac.jp [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Song, Guanbin, E-mail: song@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China)

    2017-06-15

    Migration of bone marrow-derived mesenchymal stem cells (BMSCs) plays an important role in many physiological and pathological settings, including wound healing. During the migration of BMSCs through interstitial tissues, the movement of the nucleus must be coordinated with the cytoskeletal dynamics, which in turn affects the cell migration efficiency. Our previous study indicated that osteopontin (OPN) significantly promotes the migration of rat BMSCs. However, the nuclear behaviors and involved molecular mechanisms in OPN-mediated BMSC migration are largely unclear. In the present study, using an atomic force microscope (AFM), we found that OPN could decrease the nuclear stiffness of BMSCs and reduce the expression of lamin A/C, which is the main determinant of nuclear stiffness. Increased lamin A/C expression attenuates BMSC migration by increasing nuclear stiffness. Decreased lamin A/C expression promotes BMSC migration by decreasing nuclear stiffness. Furthermore, OPN promotes BMSC migration by diminishing lamin A/C expression and decreasing nuclear stiffness via the FAK-ERK1/2 signaling pathway. This study provides strong evidence for the role of nuclear mechanics in BMSC migration as well as new insight into the molecular mechanisms of OPN-promoted BMSC migration. - Highlights: • OPN promotes BMSC migration by decreasing nuclear stiffness. • Lamin A/C knockdown decreases, while its overexpression enhances, the nuclear stiffness of BMSCs. • Lamin A/C overexpression and downregulation affect the migration of BMSCs. • OPN diminishes lamin A/C expression and decreases nuclear stiffness through the activation of the FAK-ERK1/2 signaling pathway. • OPN promotes BMSC migration via the FAK-ERK1/2 signaling pathway.

  3. Decreased nuclear stiffness via FAK-ERK1/2 signaling is necessary for osteopontin-promoted migration of bone marrow-derived mesenchymal stem cells

    International Nuclear Information System (INIS)

    Liu, Lingling; Luo, Qing; Sun, Jinghui; Wang, Aoli; Shi, Yisong; Ju, Yang; Morita, Yasuyuki; Song, Guanbin

    2017-01-01

    Migration of bone marrow-derived mesenchymal stem cells (BMSCs) plays an important role in many physiological and pathological settings, including wound healing. During the migration of BMSCs through interstitial tissues, the movement of the nucleus must be coordinated with the cytoskeletal dynamics, which in turn affects the cell migration efficiency. Our previous study indicated that osteopontin (OPN) significantly promotes the migration of rat BMSCs. However, the nuclear behaviors and involved molecular mechanisms in OPN-mediated BMSC migration are largely unclear. In the present study, using an atomic force microscope (AFM), we found that OPN could decrease the nuclear stiffness of BMSCs and reduce the expression of lamin A/C, which is the main determinant of nuclear stiffness. Increased lamin A/C expression attenuates BMSC migration by increasing nuclear stiffness. Decreased lamin A/C expression promotes BMSC migration by decreasing nuclear stiffness. Furthermore, OPN promotes BMSC migration by diminishing lamin A/C expression and decreasing nuclear stiffness via the FAK-ERK1/2 signaling pathway. This study provides strong evidence for the role of nuclear mechanics in BMSC migration as well as new insight into the molecular mechanisms of OPN-promoted BMSC migration. - Highlights: • OPN promotes BMSC migration by decreasing nuclear stiffness. • Lamin A/C knockdown decreases, while its overexpression enhances, the nuclear stiffness of BMSCs. • Lamin A/C overexpression and downregulation affect the migration of BMSCs. • OPN diminishes lamin A/C expression and decreases nuclear stiffness through the activation of the FAK-ERK1/2 signaling pathway. • OPN promotes BMSC migration via the FAK-ERK1/2 signaling pathway.

  4. American National Standards and the DOE - A cooperative effort to promote nuclear criticality safety

    International Nuclear Information System (INIS)

    Rothleder, B.M.

    1996-01-01

    The U.S. Department of Energy's (DOE's) new criticality safety order, DOE Order 420.1 (open-quotes Facility Safety,close quotes October 13, 1995), Sec. 4.3 (open-quotes Nuclear Criticality Safetyclose quotes), invokes, as an integral part, 12 appropriate American National Standards Institute/American Nuclear Society (ANSI/ANS) Series-8 standards for nuclear criticality safety, but with modifications. (The order that 420.1/4.3 replaced also invoked some ANSI/ANS Series-8 standards.) These modifications include DOE operation-specific exceptions to the standards and elaborations on some of the wording in the standards

  5. The Japanese Nuclear Energy Encyclopedia edited and computerized to promote public acceptance

    International Nuclear Information System (INIS)

    Shimooke, T.; Kobayashi, K.; Suzuki, Y.; Kobayashi, S.

    1992-01-01

    Editing the Japanese Nuclear Energy Encyclopedia has been in progress since 1989. It will be completed in 1993. The book is intended to provide raw material for the public to have his own judgement on nuclear energy. It is also useful as a 'text book' for specialists who lecture on the nuclear energy including the social effects at public seminars and meetings. Computerization of the book is also being made simultaneously. The trial use of the partly completed book has been started by some 150 of the nominated lectures through the country from August 1992. The computerized book has been well received so far by these lectures. (J.P.N.)

  6. A CACGTG motif of the Antirrhinum majus chalcone synthase promoter is recognized by an evolutionarily conserved nuclear protein

    International Nuclear Information System (INIS)

    Staiger, D.; Kaulen, H.; Schell, J.

    1989-01-01

    In the chalcone synthase gene of Antirrhinum majus (snapdragon), 150 base pairs of the 5' flanking region contain cis-acting signals for UV light-induced expression. A nuclear factor, designated CG-1, specifically recognizes a hexameric motif with internal dyad symmetry, CACGTG, located within this light-responsive sequence. Binding of CG-1 is influenced by C-methylation of the CpG dinucleotide in the recognition sequence. CG-1 is a factor found in a variety of dicotyledonous plant species including Nicotiana tabacum, A. majus, Petunia hybrida, Arabidopsis thaliana, and Glycine max. CACGTG motifs contained within trans-acting factor recognition sites in various other plant promoters can interact with CG-1. In addition, the binding site of the human adenovirus major late transcription factor USF can compete for CG-1 binding to the chalcone synthase promoter. This suggests an evolutionary conservation of trans-acting factor recognition sites involved in divergent mechanisms of gene control. (author)

  7. Co-operation Agreement for the promotion of nuclear science and technology in Latin America and the Caribbean (ARCAL)

    International Nuclear Information System (INIS)

    1999-01-01

    The document reproduces the text of the Co-operation Agreement for the Promotion of Nuclear Science and Technology in Latin America and the Caribbean (ARCAL) which was opened for signature on 25 September 1998 and shall come into force after deposit of the instrument of ratification by ten Member States. It shall remain in force for ten years, and may be extended by periods of five years if the Member States so agree. By 15 september 1999, there were 14 Signatories to the above Agreement

  8. Influenza A Virus NS1 Protein Promotes Efficient Nuclear Export of Unspliced Viral M1 mRNA.

    Science.gov (United States)

    Pereira, Carina F; Read, Eliot K C; Wise, Helen M; Amorim, Maria J; Digard, Paul

    2017-08-01

    Influenza A virus mRNAs are transcribed by the viral RNA-dependent RNA polymerase in the cell nucleus before being exported to the cytoplasm for translation. Segment 7 produces two major transcripts: an unspliced mRNA that encodes the M1 matrix protein and a spliced transcript that encodes the M2 ion channel. Export of both mRNAs is dependent on the cellular NXF1/TAP pathway, but it is unclear how they are recruited to the export machinery or how the intron-containing but unspliced M1 mRNA bypasses the normal quality-control checkpoints. Using fluorescent in situ hybridization to monitor segment 7 mRNA localization, we found that cytoplasmic accumulation of unspliced M1 mRNA was inefficient in the absence of NS1, both in the context of segment 7 RNPs reconstituted by plasmid transfection and in mutant virus-infected cells. This effect was independent of any major effect on steady-state levels of segment 7 mRNA or splicing but corresponded to a ∼5-fold reduction in the accumulation of M1. A similar defect in intronless hemagglutinin (HA) mRNA nuclear export was seen with an NS1 mutant virus. Efficient export of M1 mRNA required both an intact NS1 RNA-binding domain and effector domain. Furthermore, while wild-type NS1 interacted with cellular NXF1 and also increased the interaction of segment 7 mRNA with NXF1, mutant NS1 polypeptides unable to promote mRNA export did neither. Thus, we propose that NS1 facilitates late viral gene expression by acting as an adaptor between viral mRNAs and the cellular nuclear export machinery to promote their nuclear export. IMPORTANCE Influenza A virus is a major pathogen of a wide variety of mammalian and avian species that threatens public health and food security. A fuller understanding of the virus life cycle is important to aid control strategies. The virus has a small genome that encodes relatively few proteins that are often multifunctional. Here, we characterize a new function for the NS1 protein, showing that, as well as

  9. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    International Nuclear Information System (INIS)

    Zhang, Jing; Wang, Zhihua; Jiang, Yong; Niu, Zhongying; Fu, Lei; Luo, Zhirong; Cooper, Paul R.; Smith, Anthony J.; He, Wenxi

    2015-01-01

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs

  10. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jing [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Stomatologic Hospital & College, Anhui Medical University, Key Lab of Oral Diseases Research of Anhui Province, Hefei (China); Wang, Zhihua; Jiang, Yong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Niu, Zhongying [Treatment center of oral diseases, The 306th Hospital of People' s Liberation Army, Beijing (China); Fu, Lei; Luo, Zhirong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Cooper, Paul R.; Smith, Anthony J. [Oral Biology, School of Dentistry, University of Birmingham, B4 6NN (United Kingdom); He, Wenxi, E-mail: hewenxi@fmmu.edu.cn [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China)

    2015-03-15

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs.

  11. Standardized System of Nuclear Safety Information for the Promotion of Transparency and Openness

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Gihyung; Kim, Sanghyun; Lee, Gyehwi; Yoon, Yeonhwa; Song, Song Hyerim; Jeong, Jina [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of); Byun, Jaehyung; Seo, Jonghwan [Dong-A Univ., Busan (Korea, Republic of)

    2013-05-15

    There has been an increasing emphasis on the need for increased disclosure of information through the home page of the Korea Institute of Nuclear Safety (KINS), responsible for nuclear safety regulations, and the Nuclear Safety Information Center (NSIC) to enhance public understanding of nuclear safety. However, due to the dazzled structure of the existing KINS and NSIC home pages, improvements in accessibility and convenience are necessary. At the same time, content standardization is required to increase operational efficiency and provide coherent information. In this study, the Delphi method was used to select the major contents to make available on the home page as well as the main user base definition for the home page layout development. Also, internal and external expert groups were created to conduct AHP (Analytic Hierarchy Process) analysis and develop the comparative analysis items for the U. S. Nuclear Regulatory Commission(NRC)/KINS/NSIC home pages. Afterwards, problems and points of improvements for the home page system, design, and profile were derived using heuristic analysis. The implications arising from the Delphi analysis results were applied to the home page layout. In the nuclear safety information standardized system construction process, the comparative analysis conducted using the AHP and heuristic analyses of the NRC home page resulted in deriving improvements for the Guidance, Organization, and Trustworthy items of the KINS/NSIC home page. Furthermore, through the Delphi analysis, a clear purpose and core values were set for the KINS web site, and the needs of the main user base were identified. By developing the home page layout, user interest and utility were raised to improve the organization method and layout. Through this study, KINS was able to construct a nuclear safety information standardized system and increase transparency and openness by providing feature enhancements in information provision as well as user accessibility and

  12. Standardized System of Nuclear Safety Information for the Promotion of Transparency and Openness

    International Nuclear Information System (INIS)

    Lee, Gihyung; Kim, Sanghyun; Lee, Gyehwi; Yoon, Yeonhwa; Song, Song Hyerim; Jeong, Jina; Byun, Jaehyung; Seo, Jonghwan

    2013-01-01

    There has been an increasing emphasis on the need for increased disclosure of information through the home page of the Korea Institute of Nuclear Safety (KINS), responsible for nuclear safety regulations, and the Nuclear Safety Information Center (NSIC) to enhance public understanding of nuclear safety. However, due to the dazzled structure of the existing KINS and NSIC home pages, improvements in accessibility and convenience are necessary. At the same time, content standardization is required to increase operational efficiency and provide coherent information. In this study, the Delphi method was used to select the major contents to make available on the home page as well as the main user base definition for the home page layout development. Also, internal and external expert groups were created to conduct AHP (Analytic Hierarchy Process) analysis and develop the comparative analysis items for the U. S. Nuclear Regulatory Commission(NRC)/KINS/NSIC home pages. Afterwards, problems and points of improvements for the home page system, design, and profile were derived using heuristic analysis. The implications arising from the Delphi analysis results were applied to the home page layout. In the nuclear safety information standardized system construction process, the comparative analysis conducted using the AHP and heuristic analyses of the NRC home page resulted in deriving improvements for the Guidance, Organization, and Trustworthy items of the KINS/NSIC home page. Furthermore, through the Delphi analysis, a clear purpose and core values were set for the KINS web site, and the needs of the main user base were identified. By developing the home page layout, user interest and utility were raised to improve the organization method and layout. Through this study, KINS was able to construct a nuclear safety information standardized system and increase transparency and openness by providing feature enhancements in information provision as well as user accessibility and

  13. A Study on planning of promotion for international collaborative development of Generation IV Nuclear Energy Systems

    International Nuclear Information System (INIS)

    Hee, Chang Moon; Yang, M. S.; Ha, J. J.

    2006-06-01

    Korea has participated in the international collaboration programs for the development of future nuclear energy systems driven by the countries holding advanced nuclear technology and Korea and U. S. have cooperated in the INERI. This study is mainly at developing the plan for participation in the collaborative development of the Gen IV, searching the participation strategy for INERI and the INPRO, and the international cooperation in these programs. Contents and scope of the study for successful achievement are as follows; - Investigation and analysis of international and domestic trends related to advanced nuclear technologies - Development of the plan for collaborative development of the Gen IV and conducting the international cooperation activities - Support for the activities related to I-NERI between Korea and U. S. and conducting the international cooperation - International cooperation activities for the INPRO This study can be useful for planning the research plan and setting up of the strategy of integrating the results of the international collaboration and the domestic R and D results by combining the Gen IV and the domestic R and D in the field of future nuclear technology. Furthermore, this study can contribute to establishing the effective foundation and broadening the cooperation activities not only with the advanced countries for acquisition of the advanced technologies but also with the developing countries for the export of the domestic nuclear energy systems

  14. Transient and Partial Nuclear Lamina Disruption Promotes Chromosome Movement in Early Meiotic Prophase.

    Science.gov (United States)

    Link, Jana; Paouneskou, Dimitra; Velkova, Maria; Daryabeigi, Anahita; Laos, Triin; Labella, Sara; Barroso, Consuelo; Pacheco Piñol, Sarai; Montoya, Alex; Kramer, Holger; Woglar, Alexander; Baudrimont, Antoine; Markert, Sebastian Mathias; Stigloher, Christian; Martinez-Perez, Enrique; Dammermann, Alexander; Alsheimer, Manfred; Zetka, Monique; Jantsch, Verena

    2018-04-23

    Meiotic chromosome movement is important for the pairwise alignment of homologous chromosomes, which is required for correct chromosome segregation. Movement is driven by cytoplasmic forces, transmitted to chromosome ends by nuclear membrane-spanning proteins. In animal cells, lamins form a prominent scaffold at the nuclear periphery, yet the role lamins play in meiotic chromosome movement is unclear. We show that chromosome movement correlates with reduced lamin association with the nuclear rim, which requires lamin phosphorylation at sites analogous to those that open lamina network crosslinks in mitosis. Failure to remodel the lamina results in delayed meiotic entry, altered chromatin organization, unpaired or interlocked chromosomes, and slowed chromosome movement. The remodeling kinases are delivered to lamins via chromosome ends coupled to the nuclear envelope, potentially enabling crosstalk between the lamina and chromosomal events. Thus, opening the lamina network plays a role in modulating contacts between chromosomes and the nuclear periphery during meiosis. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  15. The export receptor Crm1 forms a dimer to promote nuclear export of HIV RNA.

    Science.gov (United States)

    Booth, David S; Cheng, Yifan; Frankel, Alan D

    2014-12-08

    The HIV Rev protein routes viral RNAs containing the Rev Response Element (RRE) through the Crm1 nuclear export pathway to the cytoplasm where viral proteins are expressed and genomic RNA is delivered to assembling virions. The RRE assembles a Rev oligomer that displays nuclear export sequences (NESs) for recognition by the Crm1-Ran(GTP) nuclear receptor complex. Here we provide the first view of an assembled HIV-host nuclear export complex using single-particle electron microscopy. Unexpectedly, Crm1 forms a dimer with an extensive interface that enhances association with Rev-RRE and poises NES binding sites to interact with a Rev oligomer. The interface between Crm1 monomers explains differences between Crm1 orthologs that alter nuclear export and determine cellular tropism for viral replication. The arrangement of the export complex identifies a novel binding surface to possibly target an HIV inhibitor and may point to a broader role for Crm1 dimerization in regulating host gene expression.

  16. A study to promote a collaboration of basic and fundamental R and D for nuclear energy technology development between Korea and China

    International Nuclear Information System (INIS)

    Kim, Hark Rho; Kim, Young Jin; Kim, Hyun Jun; Park, Hyun Sik; Song, Chul Hwa; Chang, Jong Hwa; Chun, Se Young; Lee, Yong Joo; Choi, Byung Ho

    2003-11-01

    The goal of this study was to strengthen an cooperation basis of the B group through activating an operation of the WGSRD. The contents of this study were 1.Activating an operation of the WGSRD, 2. Promoting technology and information exchanges of B Group between two countries, 3. Promoting expert-exchange programs of B Group between two countries, 4. Establishing a reciprocal cooperation basis of each project of B Group. This study recommended that future cooperation between China and Korea should focus on promotion of JRC-establishment with an emphasis of following three areas; 1. to promote to establish JRC in Korea side for the areas of more developed nuclear technologies than China such as research reactor in order to contribute to construct a far-eastern Asia nuclear R and D hub, 2. to promote reciprocal cooperation for areas of nuclear thermal-hydraulics and nuclear data in order to inducing an innovation of them, 3. to promote to establish JRC in China side for areas of less developed nuclear technologies than China such as HTGR and laser in order of effective acquisition of advanced technologies

  17. Workshop to exchange and transfer knowledge for the purpose of increasing public understanding relating to nuclear safety and to provide a forum for discussion of alternatives available to promote revitalization of nuclear power in the US

    International Nuclear Information System (INIS)

    Cranston, G.V.

    1986-01-01

    This paper proposes an information dissemination program to adequately familiarize the public with the actual health and safety risks of nuclear energy development. It plans for a discussion panel for alternatives available to promote revitalization of nuclear power in the US. It also provides for technology transfer between contractors, designers, and training staff. It recognizes problem areas in licensing and certification by the Nuclear Regulatory Commission and ways to standardize the administrative procedures

  18. Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In, E-mail: ychi@uky.edu [Department of Molecular and Cellular Biochemistry and Center for Structural Biology, University of Kentucky, Lexington, KY 40536 (United States)

    2008-04-01

    Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants.

  19. Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element

    International Nuclear Information System (INIS)

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In

    2008-01-01

    Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants

  20. Role of international organizations in promoting nuclear medicine in the developing countries

    International Nuclear Information System (INIS)

    Nofal, M.

    1992-01-01

    Today, because of the diversity of its applications - radiation and radionuclides for medical and biological purposes are used in more countries and in more laboratories than any other application of atomic energy. International organizations, mainly the IAEA and the WHO, have played a significant role in the spread of this nuclear technology in developing countries. There are altogether 112 member states of the Agency, about 71 of them can be classified as developing countries. Out of them, nearly 56 have some kind of nuclear medicine. By that I mean there is some medical use of radioisotopes, be it imaging, radioimmunoassay or the old thyroid uptake. In most of these countries, the personnel working in nuclear medicine has been trained abroad. Training can be as short as few weeks abroad in the form of attendance at one of the four or six week training courses offered by an international organization. Occasionally it is through a fellowship offered by the same organizations. In terms of technology and training, Nuclear Medicine, in its present form, can thus be considered a high technology imported medicine in many of these countries

  1. Role of international organizations in promoting nuclear medicine in the developing countries

    Energy Technology Data Exchange (ETDEWEB)

    Nofal, M

    1993-12-31

    Today, because of the diversity of its applications - radiation and radionuclides for medical and biological purposes are used in more countries and in more laboratories than any other application of atomic energy. International organizations, mainly the IAEA and the WHO, have played a significant role in the spread of this nuclear technology in developing countries. There are altogether 112 member states of the Agency, about 71 of them can be classified as developing countries. Out of them, nearly 56 have some kind of nuclear medicine. By that I mean there is some medical use of radioisotopes, be it imaging, radioimmunoassay or the old thyroid uptake. In most of these countries, the personnel working in nuclear medicine has been trained abroad. Training can be as short as few weeks abroad in the form of attendance at one of the four or six week training courses offered by an international organization. Occasionally it is through a fellowship offered by the same organizations. In terms of technology and training, Nuclear Medicine, in its present form, can thus be considered a high technology imported medicine in many of these countries

  2. SUMO-1 promotes association of SNURF (RNF4) with PML nuclear bodies

    International Nuclear Information System (INIS)

    Haekli, Marika; Karvonen, Ulla; Jaenne, Olli A.; Palvimo, Jorma J.

    2005-01-01

    Small nuclear RING finger protein SNURF (RNF4) is involved in transcriptional and cell growth regulation. We show here that a significant portion of endogenous SNURF localizes to nuclear bodies (NBs) that overlap with or are adjacent to domains containing endogenous promyelocytic leukemia (PML) protein and small ubiquitin-like modifier-1 (SUMO-1). In biochemical assays, SNURF efficiently binds SUMO-1 in a noncovalent fashion. SNURF is also covalently modified by SUMO-1 at nonconsensus attachment sites. Ectopic expression of SUMO-1 markedly enhances the interaction between PML3 (PML IV) and SNURF, but covalent attachment of SUMO-1 to neither protein is required. Moreover, overexpression of PML3, but not PML-L (PML III), abolishes the coactivation function of SNURF in transactivation assays, which parallels the ability of PML3 to recruit SNURF to nuclear bodies. In sum, we have identified SNURF as a novel component in PML bodies and suggest that SUMO-1-facilitated sequestration into these nuclear domains regulates the transcriptional activity of SNURF

  3. Arginine Methylation Regulates MEIS2 Nuclear Localization to Promote Neuronal Differentiation of Adult SVZ Progenitors

    Directory of Open Access Journals (Sweden)

    Jasmine Kolb

    2018-04-01

    Full Text Available Summary: Adult neurogenesis is regulated by stem cell niche-derived extrinsic factors and cell-intrinsic regulators, yet the mechanisms by which niche signals impinge on the activity of intrinsic neurogenic transcription factors remain poorly defined. Here, we report that MEIS2, an essential regulator of adult SVZ neurogenesis, is subject to posttranslational regulation in the SVZ olfactory bulb neurogenic system. Nuclear accumulation of MEIS2 in adult SVZ-derived progenitor cells follows downregulation of EGFR signaling and is modulated by methylation of MEIS2 on a conserved arginine, which lies in close proximity to nested binding sites for the nuclear export receptor CRM1 and the MEIS dimerization partner PBX1. Methylation impairs interaction with CRM1 without affecting PBX1 dimerization and thereby allows MEIS2 nuclear accumulation, a prerequisite for neuronal differentiation. Our results describe a form of posttranscriptional modulation of adult SVZ neurogenesis whereby an extrinsic signal fine-tunes neurogenesis through posttranslational modification of a transcriptional regulator of cell fate. : A hallmark of adult neurogenesis is its strong dependence on physiological stimuli and environmental signals. Schulte and colleagues show that the nuclear localization and activity of a transcriptional regulator of adult neurogenesis is controlled by posttranslational modification. Their results link intrinsic control over neuron production to external signals and help to explain how adult neurogenesis can occur “on demand.” Keywords: subventricular zone, stem cell niche, posttranslational modification, controlled nuclear import, TALE-homdomain protein, MEIS2, PBX1, CRM1, neurogenesis, stem cell niche

  4. Arginine Methylation Regulates MEIS2 Nuclear Localization to Promote Neuronal Differentiation of Adult SVZ Progenitors.

    Science.gov (United States)

    Kolb, Jasmine; Anders-Maurer, Marie; Müller, Tanja; Hau, Ann-Christin; Grebbin, Britta Moyo; Kallenborn-Gerhardt, Wiebke; Behrends, Christian; Schulte, Dorothea

    2018-04-10

    Adult neurogenesis is regulated by stem cell niche-derived extrinsic factors and cell-intrinsic regulators, yet the mechanisms by which niche signals impinge on the activity of intrinsic neurogenic transcription factors remain poorly defined. Here, we report that MEIS2, an essential regulator of adult SVZ neurogenesis, is subject to posttranslational regulation in the SVZ olfactory bulb neurogenic system. Nuclear accumulation of MEIS2 in adult SVZ-derived progenitor cells follows downregulation of EGFR signaling and is modulated by methylation of MEIS2 on a conserved arginine, which lies in close proximity to nested binding sites for the nuclear export receptor CRM1 and the MEIS dimerization partner PBX1. Methylation impairs interaction with CRM1 without affecting PBX1 dimerization and thereby allows MEIS2 nuclear accumulation, a prerequisite for neuronal differentiation. Our results describe a form of posttranscriptional modulation of adult SVZ neurogenesis whereby an extrinsic signal fine-tunes neurogenesis through posttranslational modification of a transcriptional regulator of cell fate. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Celebration of the radium and polonium discovery as a promotion of nuclear energy in Poland

    International Nuclear Information System (INIS)

    Latek, Stanislaw

    1998-01-01

    The radium and polonium discovery centennial was inaugurated in April 1997. The first event was a Polish-French show of scientific documentary movies on the uses of ionizing radiation and nuclear power. A symposium Radiation - History and Modern Times was organized in spring 1997. Many other interesting events were held throughout 1997. Warsaw hosted an interesting exhibition 'From the Radium Needle to the Medical Accelerators'. A seminar and an exhibition on Radiation Technique in Environmental Protection were organized in cooperation with the IAEA. The Council for Atomic Energy initiated and conducted a workshop on Radioactivity - Risk and Hope. The Polish Academy of Science and the Society of Nuclear Medicine organised a symposium on Polonium and Radium Discovery Impact on Medicine, Radiation Protection and Medical Industry. The National Atomic Energy was the initiator of film shows held for school youth, which turned out to be a great success. The youngsters, mainly from schools bearing the name of Marie Curie, had an opportunity to see films about the great scientist and her discoveries, and on the very phenomenon of radiation. They also had a chance to visit Maria research reactor in the Institute of Atomic Energy in Swierk. Now, at the beginning of February 1998, a three-day scientific session is being held in Warsaw, to commemorate the radium and polonium discovery. Many other events will take place in the coming months. In particular, June 1998, an international conference on Nuclear Physics Close to the Barriers will be held. Another conference, closing the centennial sponsored by UNESCO will focus on the Scientific and Philosophical Consequences of Discovery of Plutonium and Radium, Benefits and Threats to Mankind. Public opinion polls, similar to those conducted in 1996, are planned for spring 1998. The 1996 polls, conducted 10 years after the Chernobyl accident, showed that the majority of Poles feared ionizing radiation and opposed the nuclear power

  6. Nucleoporin NUP153 guards genome integrity by promoting nuclear import of 53BP1

    Czech Academy of Sciences Publication Activity Database

    Moudrý, Pavel; Lukas, C.; Macůrek, Libor; Neumann, B.; Heriche, J.K.; Pepperkok, R.; Ellenberg, J.; Hodný, Zdeněk; Lukas, J.; Bartek, Jiří

    2012-01-01

    Roč. 19, č. 5 (2012), s. 798-807 ISSN 1350-9047 R&D Projects: GA ČR GA301/08/0353; GA ČR GAP301/10/1525; GA ČR GPP305/10/P420 Grant - others:7.RP EU(XE) CZ.1.05/2.1.00/01.0030 Institutional research plan: CEZ:AV0Z50520514 Keywords : DNA damage response * NUP153 * 53BP1 nuclear import Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.371, year: 2012

  7. KPNA7, a nuclear transport receptor, promotes malignant properties of pancreatic cancer cells in vitro

    International Nuclear Information System (INIS)

    Laurila, Eeva; Vuorinen, Elisa; Savinainen, Kimmo; Rauhala, Hanna; Kallioniemi, Anne

    2014-01-01

    Pancreatic cancer is an aggressive malignancy and one of the leading causes of cancer deaths. The high mortality rate is mostly due to the lack of appropriate tools for early detection of the disease and a shortage of effective therapies. We have previously shown that karyopherin alpha 7 (KPNA7), the newest member of the alpha karyopherin family of nuclear import receptors, is frequently amplified and overexpressed in pancreatic cancer. Here, we report that KPNA7 expression is absent in practically all normal human adult tissues but elevated in several pancreatic cancer cell lines. Inhibition of KPNA7 expression in AsPC-1 and Hs700T pancreatic cancer cells led to a reduction in cell growth and decreased anchorage independent growth, as well as increased autophagy. The cell growth effects were accompanied by an induction of the cell cycle regulator p21 and a G1 arrest of the cell cycle. Interestingly, the p21 induction was caused by increased mRNA synthesis and not defective nuclear transport. These data strongly demonstrate that KPNA7 silencing inhibits the malignant properties of pancreatic cancer cells in vitro and thereby provide the first evidence on the functional role for KPNA7 in human cancer. - Highlights: • KPNA7 expression is elevated in several pancreatic cancer cell lines. • KPNA7 silencing in high expressing cancer cells leads to growth inhibition. • The cell growth reduction is associated with p21 induction and G1 arrest. • KPNA7 silencing is also accompanied with increased autophagy

  8. Research activities for nuclear power plant aging promoted by PLEC, JAPEIC, Japan

    International Nuclear Information System (INIS)

    Maeda, N.; Tajima, K.

    2003-01-01

    In order to perform research activity for aging; countermeasure of nuclear power plant effectively, Plant Life Engineering Center (PLEC) was established in Japan Power Engineering and Inspection Corporation (JAPEIC) in April 2000 sponsored by Ministry of Economy, Trade and Industry (METI, called as MITI, at that time). Results of technical survey for research and development for aging phenomena have been summarized in a table (Research Map) categorizing them into 'inspection and monitoring', 'evaluation method for aging' and 'preventive maintenances and refurbishment'. Necessary research themes have been extracted from the Research Map consulting to experts of the specified research area. Medium and long-term research perspective (Research Perspective) has been established which contains prioritized research themes and outlined specification of each theme. Several new research themes proposed by various organizations and selected by PLEC as effective for the regulation activities of METI every year. There are about ten on-going research programs funded by METI. Their progress and performance are evaluated annually to improve their efficiency including their alteration, abolition and integration. This cycle of research is going to be attained successfully. Technology Advisory Committee composed of members from various field of nuclear power including prefectural and municipal governments supervises the PLEC activity to concentrate national wide potentials and to secure transparency, openness and neutrality. This paper also provides an outline of the aging related research projects currently conducted by JAPEIC under the auspices of METI. (author)

  9. The regulation for delivery of subsidies for measures of promoting power source location for nuclear power generating facilities

    International Nuclear Information System (INIS)

    1984-01-01

    According to the law for the arrangement of surrounding areas of power generating facilities, the regulations concern the allocation of subsidies to promote the most efficient way of siting nuclear power facilities. The contents consist of the following: limits on the subsidies, terms of subsidy allocations, the sum of subsidies for each respective year, applications for subsidies, determination of subsidy allocations, withdrawal of applications, the conditions attached to the allocations, a report on the work proceedings, a report on the results, confirmation on the sum of the subsidies, withdrawal of the decision for subsidies, limitations for disposal of the properties, payment of subsidies, accounting of the subsidy operations, a record of the subsidies, and the chief in the governmental office concerned. (Mori, K.)

  10. O-GlcNAcylation of Orphan Nuclear Receptor Estrogen-Related Receptor γ Promotes Hepatic Gluconeogenesis.

    Science.gov (United States)

    Misra, Jagannath; Kim, Don-Kyu; Jung, Yoon Seok; Kim, Han Byeol; Kim, Yong-Hoon; Yoo, Eun-Kyung; Kim, Byung Gyu; Kim, Sunghoon; Lee, In-Kyu; Harris, Robert A; Kim, Jeong-Sun; Lee, Chul-Ho; Cho, Jin Won; Choi, Hueng-Sik

    2016-10-01

    Estrogen-related receptor γ (ERRγ) is a major positive regulator of hepatic gluconeogenesis. Its transcriptional activity is suppressed by phosphorylation signaled by insulin in the fed state, but whether posttranslational modification alters its gluconeogenic activity in the fasted state is not known. Metabolically active hepatocytes direct a small amount of glucose into the hexosamine biosynthetic pathway, leading to protein O-GlcNAcylation. In this study, we demonstrate that ERRγ is O-GlcNAcylated by O-GlcNAc transferase in the fasted state. This stabilizes the protein by inhibiting proteasome-mediated protein degradation, increasing ERRγ recruitment to gluconeogenic gene promoters. Mass spectrometry identifies two serine residues (S317, S319) present in the ERRγ ligand-binding domain that are O-GlcNAcylated. Mutation of these residues destabilizes ERRγ protein and blocks the ability of ERRγ to induce gluconeogenesis in vivo. The impact of this pathway on gluconeogenesis in vivo was confirmed by the observation that decreasing the amount of O-GlcNAcylated ERRγ by overexpressing the deglycosylating enzyme O-GlcNAcase decreases ERRγ-dependent glucose production in fasted mice. We conclude that O-GlcNAcylation of ERRγ serves as a major signal to promote hepatic gluconeogenesis. © 2016 by the American Diabetes Association.

  11. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    OpenAIRE

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-01-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and...

  12. Obesity-Linked Phosphorylation of SIRT1 by Casein Kinase 2 Inhibits Its Nuclear Localization and Promotes Fatty Liver.

    Science.gov (United States)

    Choi, Sung E; Kwon, Sanghoon; Seok, Sunmi; Xiao, Zhen; Lee, Kwan-Woo; Kang, Yup; Li, Xiaoling; Shinoda, Kosaku; Kajimura, Shingo; Kemper, Byron; Kemper, Jongsook Kim

    2017-08-01

    Sirtuin1 (SIRT1) deacetylase delays and improves many obesity-related diseases, including nonalcoholic fatty liver disease (NAFLD) and diabetes, and has received great attention as a drug target. SIRT1 function is aberrantly low in obesity, so understanding the underlying mechanisms is important for drug development. Here, we show that obesity-linked phosphorylation of SIRT1 inhibits its function and promotes pathological symptoms of NAFLD. In proteomic analysis, Ser-164 was identified as a major serine phosphorylation site in SIRT1 in obese, but not lean, mice, and this phosphorylation was catalyzed by casein kinase 2 (CK2), the levels of which were dramatically elevated in obesity. Mechanistically, phosphorylation of SIRT1 at Ser-164 substantially inhibited its nuclear localization and modestly affected its deacetylase activity. Adenovirus-mediated liver-specific expression of SIRT1 or a phosphor-defective S164A-SIRT1 mutant promoted fatty acid oxidation and ameliorated liver steatosis and glucose intolerance in diet-induced obese mice, but these beneficial effects were not observed in mice expressing a phosphor-mimic S164D-SIRT1 mutant. Remarkably, phosphorylated S164-SIRT1 and CK2 levels were also highly elevated in liver samples of NAFLD patients and correlated with disease severity. Thus, inhibition of phosphorylation of SIRT1 by CK2 may serve as a new therapeutic approach for treatment of NAFLD and other obesity-related diseases. Copyright © 2017 American Society for Microbiology.

  13. Experimental study on accelerator driven subcritical reactor. JAERI's nuclear research promotion program, H12-031 (Contract research)

    International Nuclear Information System (INIS)

    Shiroya, Seiji; Misawa, Tsuyoshi; Unesaki, Hironobu

    2004-03-01

    In view of the future plan of Research Reactor Institute, Kyoto University (KURRI), the present study consisted of 1) the transmission experiments of high energy neutrons through materials, 2) experimental simulation of ADSR using the Kyoto University Critical Assembly (KUCA), and 3) conceptual neutronics design study on Kyoto University Reactor (KUR) type ADSR using the MCNPX code. The purpose of the present study was not only to obtain the knowledge usable for the realization of ADSR as a new neutron source for research but also to select technical issues in the field of reactor physics for the development of ADSR in general. Through the present study, valuable knowledge on the basic nuclear characteristics of ADSR was obtained both theoretically and experimentally. This kind of knowledge is indispensable to promote the study on ADSR further. If one dare say the main part of knowledge in short words, the basic nuclear characteristics of ADSR is overwhelmed by the characteristics of the subcritical reactor as expected. For the realization of ADSR in the future, it is considered to be necessary to accumulate results of research steadily. For this purpose, it is inevitable 1) to compile the more precise nuclear data for the wide energy range, 2) to establish experimental techniques for reactor physics study on ADSR including subcriticality measurement and absolute neutron flux measurement from the low energy region to the high energy region, and 3) to develop neutronics calculation tools which facilitate to take into account the neutron generation process by the spallation reaction and the delayed neutron behavior. (author)

  14. Residues R199H200 of prototype foamy virus transactivator Bel1 contribute to its binding with LTR and IP promoters but not its nuclear localization

    International Nuclear Information System (INIS)

    Ma, Qinglin; Tan, Juan; Cui, Xiaoxu; Luo, Di; Yu, Miao; Liang, Chen; Qiao, Wentao

    2014-01-01

    Prototype foamy virus encodes a transactivator called Bel1 that enhances viral gene transcription and is essential for PFV replication. Nuclear localization of Bel1 has been reported to rely on two proximal basic motifs R 199 H 200 and R 221 R 222 R 223 that likely function together as a bipartite nuclear localization signal. In this study, we report that mutating R 221 R 222 R 223 , but not R 199 H 200 , relocates Bel1 from the nucleus to the cytoplasm, suggesting an essential role for R 221 R 222 R 223 in the nuclear localization of Bel1. Although not affecting the nuclear localization of Bel1, mutating R 199 H 200 disables Bel1 from transactivating PFV promoters. Results of EMSA reveal that the R 199 H 200 residues are vital for the binding of Bel1 to viral promoter DNA. Moreover, mutating R 199 H 200 in Bel1 impairs PFV replication to a much greater extent than mutating R 221 R 222 R 223 . Collectively, our findings suggest that R 199 H 200 directly participate in Bel1 binding to viral promoter DNA and are indispensible for Bel1 transactivation activity. - Highlights: • The R 221 R 222 R 223 residues are essential for the nuclear localization of Bel1. • Although not affecting the nuclear localization of Bel1, mutating R 199 H 200 disables Bel1 from transactivating PFV promoters. • The R 199 H 200 residues directly participate in Bel1 binding to viral promoter DNA. • Mutating R 199 H 200 in Bel1 impairs PFV replication to a much greater extent than mutating R 221 R 222 R 223

  15. Research activities for nuclear power plant aging promoted by PLEC, JAPEIC, Japan

    International Nuclear Information System (INIS)

    Maeda, Noriyoshi; Tajima, Kenichi

    2004-01-01

    In order to perform research activity for aging countermeasure of nuclear power plant effectively, Plant Life Engineering Center (PLEC) was established in Japan Power Engineering and Inspection Corporation (JAPEIC) in April 2000 sponsored by Ministry of International Trade and Industry (MITI, presently METI). Outlined activities of PLEC are as follows. Results of technical survey for research and development for aging phenomena have been summarized in a table (Research Map) categorizing them into ''inspection and monitoring'', ''evaluation method for aging'' and ''preventive maintenances and refurbishment''. Necessary research themes have been extracted from the Research Map consulting to experts of the specified research area and they are summarized into Medium and Long-term Research Perspective (Research Perspective), which contains prioritized research themes and outlined specification of each theme. Several new research themes proposed by various organizations and selected by PLEC as effective for the regulation activities are identified and proposed to be funded by METI every year. This paper also provides outlines and obtained results of aging related research projects currently conducted by JAPEIC sponsored by METI. (author)

  16. Erythropoietin and carbamylated erythropoietin promote histone deacetylase 5 phosphorylation and nuclear export in rat hippocampal neurons

    International Nuclear Information System (INIS)

    Jo, Hye-Ryeong; Kim, Yong-Seok; Son, Hyeon

    2016-01-01

    Erythropoietin (EPO) produces neurotrophic effects in animal model of neurodegeneration. However, clinical use of EPO is limited due to thrombotic risk. Carbamylated EPO (cEPO), devoid of thrombotic risk, has been proposed as a novel neuroprotective and neurotrophic agent although the molecular mechanisms of cEPO remain incomplete. Here, we show a previously unidentified role of histone deacetylase 5 (HDAC5) in the actions of EPO and cEPO. EPO and cEPO regulate the HDAC5 phosphorylation at two critical sites, Ser259 and Ser498 through a protein kinase D (PKD) dependent pathway. In addition, EPO and cEPO rapidly stimulates nuclear export of HDAC5 in rat hippocampal neurons which expressing HDAC5-GFP. Consequently, EPO and cEPO enhanced the myocyte enhancer factor-2 (MEF2) target gene expression. Taken together, our results reveal that EPO and cEPO mediate MEF2 target gene expression via the regulation of HDAC5 phosphorylation at Ser259/498, and suggest that HDAC5 could be a potential mechanism contributing to the therapeutic actions of EPO and cEPO.

  17. Erythropoietin and carbamylated erythropoietin promote histone deacetylase 5 phosphorylation and nuclear export in rat hippocampal neurons

    Energy Technology Data Exchange (ETDEWEB)

    Jo, Hye-Ryeong [Department of Biomedical Sciences, Graduate School of Biomedical Science and Engineering (Korea, Republic of); Kim, Yong-Seok [Department of Biomedical Sciences, Graduate School of Biomedical Science and Engineering (Korea, Republic of); Department of Biochemistry and Molecular Biology, College of Medicine, Hanyang University, 17 Haengdang-dong, Sungdong-gu, Seoul 133-791 (Korea, Republic of); Son, Hyeon, E-mail: hyeonson@hanyang.ac.kr [Department of Biomedical Sciences, Graduate School of Biomedical Science and Engineering (Korea, Republic of); Department of Biochemistry and Molecular Biology, College of Medicine, Hanyang University, 17 Haengdang-dong, Sungdong-gu, Seoul 133-791 (Korea, Republic of)

    2016-01-29

    Erythropoietin (EPO) produces neurotrophic effects in animal model of neurodegeneration. However, clinical use of EPO is limited due to thrombotic risk. Carbamylated EPO (cEPO), devoid of thrombotic risk, has been proposed as a novel neuroprotective and neurotrophic agent although the molecular mechanisms of cEPO remain incomplete. Here, we show a previously unidentified role of histone deacetylase 5 (HDAC5) in the actions of EPO and cEPO. EPO and cEPO regulate the HDAC5 phosphorylation at two critical sites, Ser259 and Ser498 through a protein kinase D (PKD) dependent pathway. In addition, EPO and cEPO rapidly stimulates nuclear export of HDAC5 in rat hippocampal neurons which expressing HDAC5-GFP. Consequently, EPO and cEPO enhanced the myocyte enhancer factor-2 (MEF2) target gene expression. Taken together, our results reveal that EPO and cEPO mediate MEF2 target gene expression via the regulation of HDAC5 phosphorylation at Ser259/498, and suggest that HDAC5 could be a potential mechanism contributing to the therapeutic actions of EPO and cEPO.

  18. Assessing and Promoting the Level of Safeguards Culture in Hungarian Nuclear Facilities

    International Nuclear Information System (INIS)

    Stefanka, Z.; Vincze, A.

    2015-01-01

    The Hungarian SSAC has introduced a comprehensive domestic safeguards verification system consisting of regular comprehensive SSAC verifications in the whole lifetime of the facilities. The main goals of the comprehensive verification system are: (i) to assess the facility's safeguards system compliance with the relevant national legislation and recommendations, (ii) to assess the activities of the facility aimed at maintaining and further developing its safeguards system, and, (iii) to revise validity of data and information previously provided by the facility subject to safeguards licencing procedures. The maintenance level of the system as well as the available knowledge on the possible needs for change reflect the top management's awareness of this issue and is a good indicator of the present and future effectiveness of the facility level safeguards system and the level of safeguards culture. The structure, preparation, conduction, documentation and initial experiences of the comprehensive safeguards verification system is introduced in the paper. Additionally, HAEA has just introduced a safeguards indexing method for evaluation the safeguards culture at Hungarian nuclear facilities. The main goal of indexing method and the evaluated parameters are also shown in the paper. (author)

  19. PGE2 mediates EGFR internalization and nuclear translocation via caveolin endocytosis promoting its transcriptional activity and proliferation in human NSCLC cells.

    Science.gov (United States)

    Bazzani, Lorenzo; Donnini, Sandra; Giachetti, Antonio; Christofori, Gerhard; Ziche, Marina

    2018-03-13

    Prostaglandin E 2 (PGE 2 ) contributes to tumor progression by promoting cancer cell growth, invasion and by creating a favorable pro-tumor microenvironment. PGE 2 has been reported to transactivate and internalize into the nucleus receptor tyrosine kinases such as Epidermal growth factor receptor (EGFR), thereby supporting tumor progression. Here we demonstrate that in non-small cell lung carcinoma (NSCLC) cells, PGE 2 induces EGFR nuclear translocation via different dynamin-dependent endocytic pathways, promotes the formation of an EGFR-STAT3 complex, affects nuclear EGFR target gene expression and mediates tumor cell proliferation. Indeed, we find that PGE 2 induces EGFR internalization and consequent nuclear import through Clathrin- and Caveolin-mediated endocytosis and through the interaction of EGFR with Importin β1. Within the nucleus, EGFR forms a complex with STAT3, an event blocked by ablation of Clathrin Heavy Chain or Caveolin-1. The combination of EGF and PGE 2 prolongs nuclear EGFR transcriptional activity manifested by the upregulation of CCND1 , PTGS2 , MYC and NOS2 mRNA levels and potentiates nuclear EGFR-induced NSCLC cell proliferation. Additionally, NSCLC patients with high expression of a nuclear EGFR gene signature display shorter survival times than those with low expression, thus showing a putative correlation between nuclear EGFR and poor prognosis in NSCLC. Together, our findings indicate a complex mechanism underlying PGE 2 -induced EGF/EGFR signaling and transcriptional control, which plays a key role in cancer progression.

  20. Negative regulation of human parathyroid hormone gene promoter by vitamin D3 through nuclear factor Y

    International Nuclear Information System (INIS)

    Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.

    2005-01-01

    The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y

  1. Hepatitis B virus X promotes hepatocellular carcinoma development via nuclear protein 1 pathway

    Energy Technology Data Exchange (ETDEWEB)

    Bak, Yesol; Shin, Hye-jun; Bak, In seon [Disease Model Research Laboratory, Aging Intervention Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon (Korea, Republic of); Yoon, Do-young [Department of Bioscience and Biotechnology, Bio/Molecular Informatics Center, Konkuk University, Seoul (Korea, Republic of); Yu, Dae-Yeul, E-mail: dyyu10@kribb.re.kr [Disease Model Research Laboratory, Aging Intervention Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon (Korea, Republic of)

    2015-10-30

    Hepatocellular carcinoma (HCC) is one of the most common malignancies and chronic hepatitis B virus (HBV) infection is a major risk factor for HCC. Hepatitis B virus X (HBx) protein relates to trigger oncogenesis. HBx has oncogenic properties with a hyperproliferative response to HCC. Nuclear protein 1 (NUPR1) is a stress-response protein, frequently upregulated in several cancers. Recent data revealed that NUPR1 is involved in tumor progression, but its function in HCC is not revealed yet. Here we report HBx can induce NUPR1 in patients, mice, and HCC cell lines. In an HBx transgenic mouse model, we found that HBx overexpression upregulates NUPR1 expression consistently with tumor progression. Further, in cultured HBV positive cells, HBx knockdown induces downregulation of NUPR1. Smad4 is a representative transcription factor, regulated by HBx, and we showed that HBx upregulates NUPR1 by Smad4 dependent way. We found that NUPR1 can inhibit cell death and induce vasculogenic mimicry in HCC cell lines. Moreover, NUPR1 silencing in HepG2-HBx showed reduced cell motility. These results suggest that HBx can modulate NUPR1 expression through the Smad4 pathway and NUPR1 has a role in hepatocellular carcinoma progression. - Highlights: • NUPR1 is overexpressed in HBx transgenic mouse and HCC patients. • NUPR1 inactivation hampers the HBx induced growth, VM formation, and migration of HepG2 cells in vitro. • NUPR1 has a role for survival of HCC and mechanistically NUPR1 is activated by HBx-Smad4 axis.

  2. Matrix metalloproteinase 12 is induced by heterogeneous nuclear ribonucleoprotein K and promotes migration and invasion in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Chung, I-Che; Li, Hsin-Pai; Chang, Yu-Sun; Chen, Lih-Chyang; Chung, An-Ko; Chao, Mei; Huang, Hsin-Yi; Hsueh, Chuen; Tsang, Ngan-Ming; Chang, Kai-Ping; Liang, Ying

    2014-01-01

    Overexpression of heterogeneous nuclear ribonucleoprotein K (hnRNP K), a DNA/RNA binding protein, is associated with metastasis in nasopharyngeal carcinoma (NPC). However, the mechanisms underlying hnRNP K-mediated metastasis is unclear. The aim of the present study was to determine the role of matrix metalloproteinase (MMP) in hnRNP K-mediated metastasis in NPC. We studied hnRNP K-regulated MMPs by analyzing the expression profiles of MMP family genes in NPC tissues and hnRNP K-knockdown NPC cells using Affymetrix microarray analysis and quantitative RT-PCR. The association of hnRNP K and MMP12 expression in 82 clinically proven NPC cases was determined by immunohistochemical analysis. The hnRNP K-mediated MMP12 regulation was determined by zymography and Western blot, as well as by promoter, DNA pull-down and chromatin immunoprecipitation (ChIP) assays. The functional role of MMP12 in cell migration and invasion was demonstrated by MMP12-knockdown and the treatment of MMP12-specific inhibitor, PF-356231. MMP12 was overexpressed in NPC tissues, and this high level of expression was significantly correlated with high-level expression of hnRNP K (P = 0.026). The levels of mRNA, protein and enzyme activity of MMP12 were reduced in hnRNP K-knockdown NPC cells. HnRNP K interacting with the region spanning −42 to −33 bp of the transcription start site triggered transcriptional activation of the MMP12 promoter. Furthermore, inhibiting MMP12 by MMP12 knockdown and MMP12-specific inhibitor, PF-356231, significantly reduced the migration and invasion of NPC cells. Overexpression of MMP12 was significantly correlated with hnRNP K in NPC tissues. HnRNP K can induce MMP12 expression and enzyme activity through activating MMP12 promoter, which promotes cell migration and invasion in NPC cells. In vitro experiments suggest that NPC metastasis with high MMP12 expression may be treated with PF-356231. HnRNP K and MMP12 may be potential therapeutic markers for NPC, but

  3. ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

    International Nuclear Information System (INIS)

    Gillen, V.A.

    1990-09-01

    The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy

  4. Aarhus and Espoo Conventions: The role in promoting effective public participation in nuclear decision-making. The role of the Aarhus and Espoo Conventions in promoting effective public participation in nuclear decision-making

    International Nuclear Information System (INIS)

    Yanush, Maryna; Jendroska, Jerzy

    2017-01-01

    Ms Yanush and Mr Jendroska highlighted the role and importance of the Convention on Access to Information, Public Participation in Decision-Making and Access to Justice in Environmental Matters (the Aarhus Convention) and that of the Convention on Environmental Impact Assessment in a Transboundary Context (the Espoo Convention). These two conventions are open for global accession and, at present, have been ratified mainly by European and Central Asian countries within the United Nations Economic Commission for Europe (UNECE) region. Those two conventions, which apply to a wide range of activities including nuclear, are the only two binding international instruments setting minimum standards for public access to environmental information and public participation in decision making. The Maastricht Recommendations on Promoting Effective Public Participation in Decision-Making in Environmental Matters under the Aarhus Convention and the Good Practice Recommendations on the Application of the Convention to Nuclear Energy-related Activities under the Espoo Convention are instrumental in advancing the implementation in this area. Public participation under the Aarhus Convention goes beyond information or consultation: the decision maker must take into account the views of the 'public concerned' (i.e. the members of the public affected or likely to be affected by the decision making or having an interest in it). As the 'public concerned' is assessed through the potential impact of the proposed activity, including in the case of an accident, the obligation to notify and provide opportunity for public participation is not limited to the territory of the country hosting the proposed activity. Mr Jendroska indicated a particular finding of the Espoo Convention Implementation Committee that decisions regarding modifications, upgrades or extensions to the lifetime/operation of a nuclear installation would be subject to these obligations even though the activity remains exactly

  5. Increased expression of hepatocyte nuclear factor 4 alpha transcribed by promoter 2 indicates a poor prognosis in hepatocellular carcinoma.

    Science.gov (United States)

    Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping

    2017-10-01

    Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p  = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.

  6. Prefoldins Negatively Regulate Cold Acclimation in Arabidopsis thaliana by Promoting Nuclear Proteasome-Mediated HY5 Degradation.

    Science.gov (United States)

    Perea-Resa, Carlos; Rodríguez-Milla, Miguel A; Iniesto, Elisa; Rubio, Vicente; Salinas, Julio

    2017-06-05

    The process of cold acclimation is an important adaptive response whereby many plants from temperate regions increase their freezing tolerance after being exposed to low non-freezing temperatures. The correct development of this response relies on proper accumulation of a number of transcription factors that regulate expression patterns of cold-responsive genes. Multiple studies have revealed a variety of molecular mechanisms involved in promoting the accumulation of these transcription factors. Interestingly, however, the mechanisms implicated in controlling such accumulation to ensure their adequate levels remain largely unknown. In this work, we demonstrate that prefoldins (PFDs) control the levels of HY5, an Arabidopsis transcription factor with a key role in cold acclimation by activating anthocyanin biosynthesis, in response to low temperature. Our results show that, under cold conditions, PFDs accumulate into the nucleus through a DELLA-dependent mechanism, where they interact with HY5, triggering its ubiquitination and subsequent degradation. The degradation of HY5 would result, in turn, in anthocyanin biosynthesis attenuation, ensuring the accurate development of cold acclimation. These findings uncover an unanticipated nuclear function for PFDs in plant responses to abiotic stresses. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

  7. Promotion of double-duplex invasion of peptide nucleic acids through conjugation with nuclear localization signal peptide.

    Science.gov (United States)

    Aiba, Yuichiro; Honda, Yuta; Komiyama, Makoto

    2015-03-02

    Pseudo-complementary peptide nucleic acid (pcPNA), as one of the most widely used synthetic DNA analogues, invades double-stranded DNA according to Watson-Crick rules to form invasion complexes. This unique mode of DNA recognition induces structural changes at the invasion site and can be used for a range of applications. In this paper, pcPNA is conjugated with a nuclear localization signal (NLS) peptide, and its invading activity is notably promoted both thermodynamically and kinetically. Thus, the double-duplex invasion complex is formed promptly at low pcPNA concentrations under high salt conditions, where the invasion otherwise never occurs. Furthermore, NLS-modified pcPNA is successfully employed for site-selective DNA scission, and the targeted DNA is selectively cleaved under conditions that are not conducive for DNA cutters using unmodified pcPNAs. This strategy of pcPNA modification is expected to be advantageous and promising for a range of in vitro and in vivo applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. A hazy nuclear renaissance [Global initiatives call for developing advanced reactors and promoting nuclear education. The future is far from clear

    International Nuclear Information System (INIS)

    Murogov, V.M.

    2007-01-01

    As energy issues rise on the global agenda, what role is foreseen for nuclear power over the coming decades? Is enough being done to bring new reactors - and the knowledge to run them safely - on line when they are needed, especially in developing countries where energy demand is growing fastest? There are no easy answers, though some directions are emerging. Important developments are influencing the changing nuclear workforce, nuclear power technology, and the education of the next generation of leaders. A prime challenge is to preserve the knowledge and experience already acquired in nuclear fields so as to have a solid foundation from which to achieve safe and secure solutions. Fortunately, some global initiatives can help to pave the road to nuclear power's future and its contributions to sustainable development. They include steps taken by the IAEA, such as the International Project on Innovative Nuclear Reactors and Fuel Cycles (INPRO) and the World Nuclear University (WNU). Both initiatives are helping to raise awareness about education and knowledge management and the need for advanced nuclear technologies. Regrettably in Russia, as in the USA, Western Europe and developing nuclear countries, more attention and support is needed for nuclear education and training - and in preserving decades of nuclear experience that has fed such international initiatives. According to this author, opportunities are being lost in his view, leading to a hazy nuclear future

  9. Cyclophilin A potentiates TRIM5α inhibition of HIV-1 nuclear import without promoting TRIM5α binding to the viral capsid.

    Directory of Open Access Journals (Sweden)

    Mallori Burse

    Full Text Available The host immunophilin cyclophilin A (CypA binds to the capsid protein (CA of HIV-1 and regulates its infectivity. Depending on the target cell type, CypA can either promote or inhibit HIV-1 infection. The ability of CypA to promote HIV-1 infection has been extensively studied and linked to several steps in early replication including uncoating, reverse transcription and nuclear import. By contrast, the mechanism by which CypA inhibits infection is less well understood. We investigated the mechanism by which CypA potentiates restriction of HIV-1 by the tripartite motif-containing protein 5 (TRIM5α. Depletion of TRIM5α in the African green monkey cell line Vero, resulted in a loss of inhibition of infection by CypA, demonstrating that inhibition by CypA is mediated by TRIM5α. Complementary genetic and biochemical assays failed to demonstrate an ability of CypA to promote binding of TRIM5α to the viral capsid. TRIM5α inhibits HIV-1 reverse transcription in a proteasome-dependent manner; however, we observed that inhibition of proteasome activity did not reduce the ability of CypA to inhibit infection, suggesting that CypA acts at a step after reverse transcription. Accordingly, we observed a CypA-dependent reduction in the accumulation of nuclear HIV-1 DNA, indicating that CypA specifically promotes TRIM5α inhibition of HIV-1 nuclear import. We also observed that the ability of CypA to inhibit HIV-1 infection is abolished by amino acid substitutions within the conserved CPSF6-binding surface in CA. Our results indicate that CypA inhibits HIV-1 infection in Vero cells not by promoting TRIM5α binding to the capsid but by blocking nuclear import of the HIV-1 preintegration complex.

  10. AMPK activation represses the human gene promoter of the cardiac isoform of acetyl-CoA carboxylase: Role of nuclear respiratory factor-1

    Energy Technology Data Exchange (ETDEWEB)

    Adam, Tasneem; Opie, Lionel H. [Hatter Cardiovascular Research Institute, Faculty of Health Sciences, University of Cape Town, Observatory 7925 (South Africa); Essop, M. Faadiel, E-mail: mfessop@sun.ac.za [Cardio-Metabolic Research Group (CMRG), Department of Physiological Sciences, Stellenbosch University, Stellenbosch 7600 (South Africa)

    2010-07-30

    Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transiently transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.

  11. Political Aspects of Nuclear Energy Market Development in the Countries of South Asia. NSG Factor in Promoting Nuclear Energy in the Region

    Directory of Open Access Journals (Sweden)

    Boyko Aleksandr Aleksandrovich

    2016-04-01

    Full Text Available South Asian geopolitical face-off of Delhi and Islamabad revealed breaches of the nuclear nonproliferation. This encouraged the greatest nuclear powers to create a mechanism for additional regulation of the nuclear technology and materials export, which is now known as “Nuclear Suppliers’ Group”. This mechanism aims to impose restrictions for the nuclear technology and materials export to the countries that are not members of NPT. These are nuclear programs of India and Pakistan that are pressing challenge on the agenda. India has been a very attractive market for nuclear suppliers, especially the United States, so the restrictions were lifted from Delhi in 2008. However, they remained valid for Pakistan, which wasn’t an appealing market for the American nuclear exporters. As a result, China, which has been a member of NSG since 2004, has initiated building new NPPs in Pakistan getting mixed reaction of the international community. Despite the clearly contradicting Guidelines, the members of NSG haven’t reached common ground on how to restore its supporting role in maintaining the non-proliferation regime. Thus, the Asian nuclear market develops mostly spontaneously, and its future is shaped primarily by the international relations between importers and exporters. Russia isn’t able to influence all the NSG members to change the position, however it can take advantage of the situation for developing nuclear cooperation with the Asian countries to support sustainable development of the South Asian energy market.

  12. Heterogeneous nuclear ribonucleoprotein K upregulates the kinetochore complex component NUF2 and promotes the tumorigenicity of colon cancer cells

    International Nuclear Information System (INIS)

    Sugimasa, Hironobu; Taniue, Kenzui; Kurimoto, Akiko; Takeda, Yasuko; Kawasaki, Yoshihiro; Akiyama, Tetsu

    2015-01-01

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein involved in transcription, mRNA splicing, mRNA stabilization and translation. Although hnRNP K has been suggested to play a role in the development of many cancers, its molecular function in colorectal cancer has remained elusive. Here we show that hnRNP K plays an important role in the mitotic process in HCT116 colon cancer cells. Furthermore, we demonstrate that hnRNP K directly transactivates the NUF2 gene, the product of which is a component of the NDC80 kinetochore complex and which is known to be critical for a stable spindle microtubule-kinetochore attachment. In addition, knockdown of both hnRNP K and NUF2 caused failure in metaphase chromosome alignment and drastic decrease in the growth of colon cancer cells. These results suggest that the hnRNP K-NUF2 axis is important for the mitotic process and proliferation of colon cancer cells and that this axis could be a target for the therapy of colon cancer. - Highlights: • hnRNP K is required for the tumorigenicity of colon cancer cells. • hnRNP K binds to the promoter region of NUF2 and activates its transcription. • NUF2 expression is correlated with hnRNP K expression in colorectal cancer tissue. • hnRNP K and NUF2 are required for metaphase chromosome alignment. • The hnRNP K-NUF2 axis is important for the proliferation of colon cancer cells

  13. Heterogeneous nuclear ribonucleoprotein K upregulates the kinetochore complex component NUF2 and promotes the tumorigenicity of colon cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Sugimasa, Hironobu; Taniue, Kenzui [Laboratory of Molecular and Genetic Information, Institute of Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1, Yayoi, Bunkyo-ku, Tokyo, 113-0032 (Japan); Kurimoto, Akiko [Laboratory of Molecular and Genetic Information, Institute of Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1, Yayoi, Bunkyo-ku, Tokyo, 113-0032 (Japan); Oncology Research Laboratories, Daiichi Sankyo Co., Ltd, 1-2-58, Hiromachi, Shinagawa-ku, Tokyo, 140-8710 (Japan); Takeda, Yasuko; Kawasaki, Yoshihiro [Laboratory of Molecular and Genetic Information, Institute of Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1, Yayoi, Bunkyo-ku, Tokyo, 113-0032 (Japan); Akiyama, Tetsu, E-mail: akiyama@iam.u-tokyo.ac.jp [Laboratory of Molecular and Genetic Information, Institute of Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1, Yayoi, Bunkyo-ku, Tokyo, 113-0032 (Japan)

    2015-03-27

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein involved in transcription, mRNA splicing, mRNA stabilization and translation. Although hnRNP K has been suggested to play a role in the development of many cancers, its molecular function in colorectal cancer has remained elusive. Here we show that hnRNP K plays an important role in the mitotic process in HCT116 colon cancer cells. Furthermore, we demonstrate that hnRNP K directly transactivates the NUF2 gene, the product of which is a component of the NDC80 kinetochore complex and which is known to be critical for a stable spindle microtubule-kinetochore attachment. In addition, knockdown of both hnRNP K and NUF2 caused failure in metaphase chromosome alignment and drastic decrease in the growth of colon cancer cells. These results suggest that the hnRNP K-NUF2 axis is important for the mitotic process and proliferation of colon cancer cells and that this axis could be a target for the therapy of colon cancer. - Highlights: • hnRNP K is required for the tumorigenicity of colon cancer cells. • hnRNP K binds to the promoter region of NUF2 and activates its transcription. • NUF2 expression is correlated with hnRNP K expression in colorectal cancer tissue. • hnRNP K and NUF2 are required for metaphase chromosome alignment. • The hnRNP K-NUF2 axis is important for the proliferation of colon cancer cells.

  14. Proliferating Cell Nuclear Antigen (PCNA) Regulates Primordial Follicle Assembly by Promoting Apoptosis of Oocytes in Fetal and Neonatal Mouse Ovaries

    Science.gov (United States)

    Zhang, Yuanwei; Jiang, Xiaohua; Zhang, Huan; Ma, Tieliang; Zheng, Wei; Sun, Rui; Shen, Wei; Sha, Jiahao; Cooke, Howard J.; Shi, Qinghua

    2011-01-01

    Primordial follicles, providing all the oocytes available to a female throughout her reproductive life, assemble in perinatal ovaries with individual oocytes surrounded by granulosa cells. In mammals including the mouse, most oocytes die by apoptosis during primordial follicle assembly, but factors that regulate oocyte death remain largely unknown. Proliferating cell nuclear antigen (PCNA), a key regulator in many essential cellular processes, was shown to be differentially expressed during these processes in mouse ovaries using 2D-PAGE and MALDI-TOF/TOF methodology. A V-shaped expression pattern of PCNA in both oocytes and somatic cells was observed during the development of fetal and neonatal mouse ovaries, decreasing from 13.5 to 18.5 dpc and increasing from 18.5 dpc to 5 dpp. This was closely correlated with the meiotic prophase I progression from pre-leptotene to pachytene and from pachytene to diplotene when primordial follicles started to assemble. Inhibition of the increase of PCNA expression by RNA interference in cultured 18.5 dpc mouse ovaries strikingly reduced the apoptosis of oocytes, accompanied by down-regulation of known pro-apoptotic genes, e.g. Bax, caspase-3, and TNFα and TNFR2, and up-regulation of Bcl-2, a known anti-apoptotic gene. Moreover, reduced expression of PCNA was observed to significantly increase primordial follicle assembly, but these primordial follicles contained fewer guanulosa cells. Similar results were obtained after down-regulation by RNA interference of Ing1b, a PCNA-binding protein in the UV-induced apoptosis regulation. Thus, our results demonstrate that PCNA regulates primordial follicle assembly by promoting apoptosis of oocytes in fetal and neonatal mouse ovaries. PMID:21253613

  15. Proliferating cell nuclear antigen (PCNA regulates primordial follicle assembly by promoting apoptosis of oocytes in fetal and neonatal mouse ovaries.

    Directory of Open Access Journals (Sweden)

    Bo Xu

    Full Text Available Primordial follicles, providing all the oocytes available to a female throughout her reproductive life, assemble in perinatal ovaries with individual oocytes surrounded by granulosa cells. In mammals including the mouse, most oocytes die by apoptosis during primordial follicle assembly, but factors that regulate oocyte death remain largely unknown. Proliferating cell nuclear antigen (PCNA, a key regulator in many essential cellular processes, was shown to be differentially expressed during these processes in mouse ovaries using 2D-PAGE and MALDI-TOF/TOF methodology. A V-shaped expression pattern of PCNA in both oocytes and somatic cells was observed during the development of fetal and neonatal mouse ovaries, decreasing from 13.5 to 18.5 dpc and increasing from 18.5 dpc to 5 dpp. This was closely correlated with the meiotic prophase I progression from pre-leptotene to pachytene and from pachytene to diplotene when primordial follicles started to assemble. Inhibition of the increase of PCNA expression by RNA interference in cultured 18.5 dpc mouse ovaries strikingly reduced the apoptosis of oocytes, accompanied by down-regulation of known pro-apoptotic genes, e.g. Bax, caspase-3, and TNFα and TNFR2, and up-regulation of Bcl-2, a known anti-apoptotic gene. Moreover, reduced expression of PCNA was observed to significantly increase primordial follicle assembly, but these primordial follicles contained fewer granulosa cells. Similar results were obtained after down-regulation by RNA interference of Ing1b, a PCNA-binding protein in the UV-induced apoptosis regulation. Thus, our results demonstrate that PCNA regulates primordial follicle assembly by promoting apoptosis of oocytes in fetal and neonatal mouse ovaries.

  16. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    Science.gov (United States)

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-12-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

  17. Nuclear

    International Nuclear Information System (INIS)

    2014-01-01

    This document proposes a presentation and discussion of the main notions, issues, principles, or characteristics related to nuclear energy: radioactivity (presence in the environment, explanation, measurement, periods and activities, low doses, applications), fuel cycle (front end, mining and ore concentration, refining and conversion, fuel fabrication, in the reactor, back end with reprocessing and recycling, transport), the future of the thorium-based fuel cycle (motivations, benefits and drawbacks), nuclear reactors (principles of fission reactors, reactor types, PWR reactors, BWR, heavy-water reactor, high temperature reactor of HTR, future reactors), nuclear wastes (classification, packaging and storage, legal aspects, vitrification, choice of a deep storage option, quantities and costs, foreign practices), radioactive releases of nuclear installations (main released radio-elements, radioactive releases by nuclear reactors and by La Hague plant, gaseous and liquid effluents, impact of releases, regulation), the OSPAR Convention, management and safety of nuclear activities (from control to quality insurance, to quality management and to sustainable development), national safety bodies (mission, means, organisation and activities of ASN, IRSN, HCTISN), international bodies, nuclear and medicine (applications of radioactivity, medical imagery, radiotherapy, doses in nuclear medicine, implementation, the accident in Epinal), nuclear and R and D (past R and D programmes and expenses, main actors in France and present funding, main R and D axis, international cooperation)

  18. The immediate need for US universities to promote research related to a nuclear-weapon-free world

    International Nuclear Information System (INIS)

    Ionno, S.

    1999-01-01

    If disarmament is a goal, then the requisite skills must be fostered in academic research. Too many students today view nuclear weapons as a non-issue. It is crucial that those people in positions of influence encourage more young people to explore in-depth the political, scientific, and social changes that a nuclear-weapon-free world will require. The data presented are based on a search of nuclear-weapons-related keywords in the UMI Dissertation Abstracts Database which includes work from over 1000 North American graduate schools and European Universities. The search was focused on US Phd dissertations between 1987 and 1996. There was no PhDs focused on issues such as: zero-level nuclear-weapons-free world; nuclear-weapons-free zones; decreasing nuclear alert status; a nuclear weapons convention; no-first-use or-no use against non-nuclear-weapons-states; START; French nuclear weapons; a possible 'Eurobomb'; peace groups outside the USA, UK, and Germany; nuclear-weapons secrecy; funding disarmament; the role od UN in a nuclear-weapons-free world; an so on

  19. Proposal and field practice of a 'hiyarihatto' activity method for promotion of statements of participants for nuclear power plant organization

    International Nuclear Information System (INIS)

    Aoyagi, Saizo; Fujino, Hidenori; Ishii, Hirotake; Shimoda, Hiroshi; Sakuda, Hiroshi; Yoshikawa, Hidekazu; Sugiman, Toshio

    2011-01-01

    In a 'hiyarihatto' activity, workers report and discuss incident cases related to their work. Such an activity is particularly effective for cultivating participants' attitudes about safety. Nevertheless, a conventional face-to-face hiyarihatto activity includes features that are inappropriate for conduct in a nuclear power plant organization. For example, workers at nuclear power plants are geographically distributed and busy. Therefore, they have great difficulty in participating in a face-to-face hiyarihatto activity. Furthermore, workers' hesitation in discussing problems inhibits the continuation of their active participation. This study is conducted to propose a hiyarihatto activity with an asynchronous and distributed computer-mediated communication (CMC) for a nuclear power plant organization, with the demonstration of its effectiveness through field practice. The proposed method also involves the introduction of special participants who follow action guidelines for the promotion of the continuation of the activity. The method was used in an actual nuclear power plant organization. Results showed that the method is effective under some conditions, such as during periods without facility inspection. Special participants promoted the activity in some cases. Moreover, other factors affecting the activity and some improvements were identified. (author)

  20. People's response to the promotion of the effective use of nuclear power plants. From the viewpoint of favoring providing information about maintenance activities

    International Nuclear Information System (INIS)

    Sakai, Yukimi; Ueda, Yoshitaka; Goto, Manabu

    2010-01-01

    In order to elucidate people's response to the promotion of the effective use of nuclear power plants by high-reliability maintenance, we conducted a questionnaire survey targeting 306 respondents living in the cities of Kyoto, Osaka and Kobe. The questionnaire comprises information about maintenance contents and regulatory system concerning extension of plant operation cycle, long life operation, and plant power-up, not as a measure for safety but a measure for promoting effective use of power plants. It was found that a high number of respondents held a positive attitude towards the promotion of the effective use of plants, even if they tend to be anxious about safety problems. Moreover, the study suggests that no enhance the feeling of safety, information about maintenance activities and regulatory system was more effective than information about actual technical possibility. (author)

  1. A basic plan of a micro reactor for the promotion of nuclear literacy necessity of the reactor

    International Nuclear Information System (INIS)

    Murata, Takashi; Yoshiki, Nobuya; Kinehara, Yoshiki

    2000-01-01

    It is important for ordinary Japanese to achieve scientific literacy, which enables to understand information appropriately and make their decision reasonably, on science and technology, including nuclear activities. To achieve nuclear literacy, a reactor for interpretation should be established at a science and technology museum, where students, educators and the public would understand functions of an actual reactor and get interests in nuclear activities, so they would understand what nuclear energy is. In this facility, scientists and engineers including pioneers of nuclear activities in Japan should be engaged and provide interpretative contents for various guests, for example, practical operation of the reactor. This facility would be preferred to be established in metropolitan area, where many visitors would be expected to come. Then this facility would be very useful for the achievement of nuclear literacy. (author)

  2. Promoting safety in nuclear installations. The IAEA has established safety standards for nuclear reactors and provides expert review and safety services to assist Member States in their application

    International Nuclear Information System (INIS)

    2002-01-01

    More than 430 nuclear power plants (NPPs) are currently operating in 30 countries around the world. The nuclear share of total electricity production ranges from about 20 percent in the Czech Republic and United States to nearly 78 percent in France and Lithuania. Worldwide, nuclear power generates about 16% of the total electricity. The safety of such nuclear installations is fundamental. Every aspect of a power plant must be closely supervised and scrutinized by national regulatory bodies to ensure safety at every phase. These aspects include design, construction, commissioning, trial operation, commercial operation, repair and maintenance, plant upgrades, radiation doses to workers, radioactive waste management and, ultimately, plant decommissioning. Safety fundamentals comprise defence-in-depth, which means having in place multiple levels of protection. nuclear facilities; regulatory responsibility; communicating with the public; adoption of the international convention on nuclear safety including implementation of IAEA nuclear safety standards. This publication covers topics of designing for safety (including safety concepts, design principles, and human factors); operating safety (including safety culture and advance in operational safety); risk assessment and management

  3. Collaboration of nuclear knowledge. Execution of science partnership project promoted by MEXT and repercussion effect obtained from the viewpoint of intellectual collaboration

    International Nuclear Information System (INIS)

    Yanagisawa, Kazuaki; Nagasawa, Naotsugu; Sasagawa, Sumiko; Nakano, Koji

    2007-09-01

    The Fujioka Technical High School (FTHS) applied to the Science Partnership Project (SPP-2006), which was financially supported by the MEXT and promoted by the Japan Science and Technology Agency, and was approved the proposal entitled as 'Nuclear Technology and Its Future for Nuclear-Cite Neighboring Students'. FTHS decided to make intellectual linkage with Takasaki Branch, Japan Atomic Energy Agency (JAEA) and with Institute for Environmental Sciences, having with the following 5 menus. 1. Outline of nuclear energy. 2. Outline of radiation application and experimental practice. 3. Radiation and health for understanding the natural radiation and radioactivity. 4. Sightseeing of nuclear facilities around Tokai-mura. 5. Reporting of SPP activities. Adding to normal lectures listed above, the authors made several educational trials from the viewpoint of intellectual linkage. First is to verify the change of interest in students through lectures on nuclear, second is to reveal that which nuclear fields are interested by a majority of students, third is to make direct comparison of intellectual ability between the students and 5 specialists. Resultantly, if one teaches correctly the basic concept of nuclear energy and radiation application as learning inputs, aparting from his mind to nuclear and understanding ability of student increased 3 times than his background level. A comprehensive faculty of the students to the 5 specialists is 1/5 before making lecture but increased markedly to 1/2 after the lecture. A majority of students understand the matter of reprocessing, reactor accidents and food irradiation but understand poorly the location and name of the commercial nuclear power plant as well as the basic function of the power reactors. The latter is however recovered by the sightseeing of commercial power plants and fuel fabrication facilities located around Tokai-mura. Namely, to seeing is to believing. To teach a radiation application and a basic idea of nuclear

  4. Characterization of the N-terminal segment used by the barley yellow dwarf virus movement protein to promote interaction with the nuclear membrane of host plant cells.

    Science.gov (United States)

    Dennison, Sarah Rachel; Harris, Frederick; Brandenburg, Klaus; Phoenix, David Andrew

    2007-11-01

    The barley yellow dwarf virus movement protein (BYDV-MP) requires its N-terminal sequence to promote the transport of viral RNA into the nuclear compartment of host plant cells. Here, graphical analysis predicts that this sequence would form a membrane interactive amphiphilic alpha-helix. Confirming this prediction, NT1, a peptide homologue of the BYDV-MP N-terminal sequence, was found to be alpha-helical (65%) in the presence of vesicles mimics of the nuclear membrane. The peptide increased the fluidity of these nuclear membrane mimics (rise in wavenumber of circa 0.5-1.0 cm(-1)) and induced surface pressure changes of 2 mN m(-1) in lipid monolayers with corresponding compositions. Taken with isotherm analysis these results suggest that BYDV-MP forms an N-terminal amphiphilic alpha-helix, which partitions into the nuclear membrane primarily through thermodynamically stable associations with the membrane lipid headgroup region. We speculate that these associations may play a role in targeting of the nuclear membrane by BYDM-MP.

  5. Blockade of Y177 and Nuclear Translocation of Bcr-Abl Inhibits Proliferation and Promotes Apoptosis in Chronic Myeloid Leukemia Cells.

    Science.gov (United States)

    Li, Qianyin; Huang, Zhenglan; Gao, Miao; Cao, Weixi; Xiao, Qin; Luo, Hongwei; Feng, Wenli

    2017-03-02

    The gradual emerging of resistance to imatinib urgently calls for the development of new therapy for chronic myeloid leukemia (CML). The fusion protein Bcr-Abl, which promotes the malignant transformation of CML cells, is mainly located in the cytoplasm, while the c-Abl protein which is expressed in the nucleus can induce apoptosis. Based on the hetero-dimerization of FKBP (the 12-kDa FK506- and rapamycin-binding protein) and FRB (the FKBP-rapamycin binding domain of the protein kinase, mTOR) mediated by AP21967, we constructed a nuclear transport system to induce cytoplasmic Bcr-Abl into nuclear. In this study, we reported the construction of the nuclear transport system, and we demonstrated that FN3R (three nuclear localization signals were fused to FRBT2098L with a FLAG tag), HF2S (two FKBP domains were in tandem and fused to the SH2 domain of Grb2 with an HA tag) and Bcr-Abl form a complexus upon AP21967. Bcr-Abl was imported into the nucleus successfully by the nuclear transport system. The nuclear transport system inhibited CML cell proliferation through mitogen-activated protein kinase (MAPK) and signal transducer and activator of transcription 5 (STAT5) pathways mainly by HF2S. It was proven that nuclear located Bcr-Abl induced CML cell (including imatinib-resistant K562G01 cells) apoptosis by activation of p73 and its downstream molecules. In summary, our study provides a new targeted therapy for the CML patients even with Tyrosine Kinase Inhibitor (TKI)-resistance.

  6. Blockade of Y177 and Nuclear Translocation of Bcr-Abl Inhibits Proliferation and Promotes Apoptosis in Chronic Myeloid Leukemia Cells

    Directory of Open Access Journals (Sweden)

    Qianyin Li

    2017-03-01

    Full Text Available The gradual emerging of resistance to imatinib urgently calls for the development of new therapy for chronic myeloid leukemia (CML. The fusion protein Bcr-Abl, which promotes the malignant transformation of CML cells, is mainly located in the cytoplasm, while the c-Abl protein which is expressed in the nucleus can induce apoptosis. Based on the hetero-dimerization of FKBP (the 12-kDa FK506- and rapamycin-binding protein and FRB (the FKBP-rapamycin binding domain of the protein kinase, mTOR mediated by AP21967, we constructed a nuclear transport system to induce cytoplasmic Bcr-Abl into nuclear. In this study, we reported the construction of the nuclear transport system, and we demonstrated that FN3R (three nuclear localization signals were fused to FRBT2098L with a FLAG tag, HF2S (two FKBP domains were in tandem and fused to the SH2 domain of Grb2 with an HA tag and Bcr-Abl form a complexus upon AP21967. Bcr-Abl was imported into the nucleus successfully by the nuclear transport system. The nuclear transport system inhibited CML cell proliferation through mitogen-activated protein kinase (MAPK and signal transducer and activator of transcription 5 (STAT5 pathways mainly by HF2S. It was proven that nuclear located Bcr-Abl induced CML cell (including imatinib-resistant K562G01 cells apoptosis by activation of p73 and its downstream molecules. In summary, our study provides a new targeted therapy for the CML patients even with Tyrosine Kinase Inhibitor (TKI-resistance.

  7. Promoting Implementation of Safety Culture in Nuclear Application for Industrial Facilities; an Important Role of Nuclear Energy Regulatory Agency in Indonesia

    Energy Technology Data Exchange (ETDEWEB)

    Setianingsih, Lilis Susanti [KINS-KAIST Master Degree Program, Daejeon (Korea, Republic of)

    2012-03-15

    Implementation of nuclear energy for industrial purposes has reached its highest peak. BAPETEN, as Nuclear Energy Regulatory Agency of Indonesia has published regulations regarding nuclear energy utilization. As high risk associating such utilization requires direct and thoroughly supervision in order to assure its compliance to safety and security aspect, procedures related to operational activities must by fully applied. Radiation Protection Program as one type of procedures that must be available in nuclear energy utilization operation is intended to provide operators specifically technical guidance to avoid undesired negative effects of incidents or accidents. It is the responsibility of managerial level in a company to provide the procedures and to further supervise their application in the field. Radiation workers, those are all employees working in or within radiation area must understand how to execute the procedures properly. The radiation protection program is intended to protect workers, member of community and property as well as the environment from the negative impacts of nuclear utilization operational due to its radiation exposure. Safety culture, a compound of nature derived from behavior of organization and people within the organization to pay a full attention and give main priority in radiation safety matters, is expected to be achieved by implementing the radiation protection program as safety habits at the work place. It requires a management commitment to ensure that all aspect in safety and, whenever necessary, security are accomplished within the radiation protection program in order to build a safety culture in a radiation work place. Government Regulation No. 33 2007 about Safety for Ionizing Radiation and Security for Radioactive Source and Government Regulation No. 29 2008 regarding Licensing for Utilization of Ionizing Radiation and Nuclear Material present regulation and arrangement related to radiation protection program as a basic

  8. Promoting Implementation of Safety Culture in Nuclear Application for Industrial Facilities; an Important Role of Nuclear Energy Regulatory Agency in Indonesia

    International Nuclear Information System (INIS)

    Setianingsih, Lilis Susanti

    2012-01-01

    Implementation of nuclear energy for industrial purposes has reached its highest peak. BAPETEN, as Nuclear Energy Regulatory Agency of Indonesia has published regulations regarding nuclear energy utilization. As high risk associating such utilization requires direct and thoroughly supervision in order to assure its compliance to safety and security aspect, procedures related to operational activities must by fully applied. Radiation Protection Program as one type of procedures that must be available in nuclear energy utilization operation is intended to provide operators specifically technical guidance to avoid undesired negative effects of incidents or accidents. It is the responsibility of managerial level in a company to provide the procedures and to further supervise their application in the field. Radiation workers, those are all employees working in or within radiation area must understand how to execute the procedures properly. The radiation protection program is intended to protect workers, member of community and property as well as the environment from the negative impacts of nuclear utilization operational due to its radiation exposure. Safety culture, a compound of nature derived from behavior of organization and people within the organization to pay a full attention and give main priority in radiation safety matters, is expected to be achieved by implementing the radiation protection program as safety habits at the work place. It requires a management commitment to ensure that all aspect in safety and, whenever necessary, security are accomplished within the radiation protection program in order to build a safety culture in a radiation work place. Government Regulation No. 33 2007 about Safety for Ionizing Radiation and Security for Radioactive Source and Government Regulation No. 29 2008 regarding Licensing for Utilization of Ionizing Radiation and Nuclear Material present regulation and arrangement related to radiation protection program as a basic

  9. Real-time environmental monitoring at the Japan Nuclear Cycle Development Institute O-arai Engineering Center. Using the internet to promote safety and environmental transparency

    International Nuclear Information System (INIS)

    Motomatsu, Sheila; Nakashima Inoue, Naoko

    2000-12-01

    The report documents the results of an effort at the Japan Nuclear Cycle Development Institute O-arai Engineering Center (JNC/OEC) to provide via the Internet, in real-time, environmental monitoring data to promote safety and environmental transparency. Provided in Japanese as well as in English, the Internet site provides assurance that OEC nuclear operations are being conducted in a manner that is safe to both people in the surrounding area and the environment. This work conducted by Environmental Monitoring Team of the OEC Safety Administration Section fulfilled the assignment to release data real-time via the Internet tasked by the Information Disclosure Section of the JNC Headquarters Public Relations Division. The work conducted by the visiting exchange scientist fulfilled the experimental portion of Action Sheet 34 of the Agreement between JNC and DOE for Cooperation in Research and Development Concerning Nuclear Material Control and Accounting Measures for Safeguards and Nonproliferation. In Japan, the project for Action Sheet 34 Personnel Exchange on Remote Monitoring and Transparency' entailed both a study and an experiment on how remote monitoring technologies can be used to promote nonproliferation, environmental and safety transparency. Environmental airborne radionuclide monitoring falls under the definition of remote monitoring technology more broadly defined as 'remotely accessed unattended monitoring system technology'. (author)

  10. Research on nuclear reactor instrumentation system using optical technology. JAERI's nuclear research promotion program, H10-041. Contract research

    Energy Technology Data Exchange (ETDEWEB)

    Nakazawa, Masaharu; Takahashi, Hiroyuki; Fukuda, Daiji [University of Tokyo, Graduate School of Engineering, Tokyo (Japan)

    2002-03-01

    To apply optical fiber sensing technique to nuclear measurements, we have irradiated the F-doped optical fiber and experimented with two optical fiber sensors: Raman Distributed Temperature Sensor (RDTS) and Fiber Bragg Grating (FBG). We have irradiated F-doped optical fiber, which has high radiation resistivity, with a 60Co gamma source and fast neutron source reactor YAYOI. Although the radiation induced loss with gamma source showed saturation tendency, the loss with YAYOI showed linear loss increase. RDTS has been installed at YAYOI with the correction techniques. During the continuous measurements more than 1 year, the feasibility of RDTS for remote inspection and surveillance was demonstrated. From the result of irradiation experiments on FBG, FBG has high radiation resistivity for a temperature or strain monitor in nuclear plants. For these results, optical fiber sensing can be expected as nuclear measurements. (author)

  11. CSAEC tutor board its necessity and use for technical and economic promotion of the Czechoslovak nuclear programme

    International Nuclear Information System (INIS)

    Kriz, Z.

    1985-01-01

    The article informs of scientific, technical and economic publicity on the peaceful uses of nuclear power. A board of tutors has been established whose activity is divided into seven subject areas. (E.S.)

  12. Promoting Safe, Secure, and Peaceful Growth of Nuclear Energy: Next Steps for Russia and the United States

    OpenAIRE

    Bunn, Matthew G.; Vyacheslav P. Kuznetzov

    2010-01-01

    Russia, the United States and other countries must cooperate to enable large-scale growth of nuclear energy around the world while achieving even higher standards of safety, security, and nonproliferation than are in place today. This will require building a new global framework for nuclear energy, including new or strengthened global institutions. The Belfer Center's Managing the Atom (MTA) Project and the Russian Research Center's Kurchatov Institute developed these and additional recommend...

  13. Two intestinal specific nuclear factors binding to the lactase-phlorizin hydrolase and sucrase-isomaltase promoters are functionally related oligomeric molecules

    DEFF Research Database (Denmark)

    Troelsen, J T; Mitchelmore, C; Sjöström, H

    1994-01-01

    Lactase-phlorizin hydrolase (LPH) and sucrase-isomaltase (SI) are enterocyte-specific gene products. The identification of regulatory cis-elements in the promoter of these two genes has enabled us to carry out comparative studies of the corresponding intestinal-specific nuclear factors (NF-LPH1...... and SIF1-BP). Electrophoretic mobility shift assays demonstrated that the two nuclear factors compete for binding on the same cis-elements. The molecular size of the DNA binding polypeptide is estimated to be approximately 50 kDa for both factors. In the native form the factors are found as 250 k......Da oligomeric complexes. Based on these results NF-LPH1 and SIF1-BP are suggested to be either identical or closely related molecules....

  14. Nuclear envelope-distributed CD147 interacts with and inhibits the transcriptional function of RING1 and promotes melanoma cell motility.

    Directory of Open Access Journals (Sweden)

    Junchen Chen

    Full Text Available Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play an important role in the aggressive phenotype in melanoma. The interactions between CD147 and RING1 were identified with a yeast two-hybrid and RING1 interacted with CD147 through the transmembrane domain. RING1 inhibits CD147's capability promoting melanoma cell migration. In conclusion, the study identified novel interactions between CD147 and RING1, recovered CD147 nuclear envelope distribution in melanoma cells, and suggested a new mechanism underlying how cytoplasmic CD147 promotes melanoma development.

  15. Nuclear envelope-distributed CD147 interacts with and inhibits the transcriptional function of RING1 and promotes melanoma cell motility.

    Science.gov (United States)

    Chen, Junchen; Peng, Cong; Lei, Li; Zhang, Jianglin; Zeng, Weiqi; Chen, Xiang

    2017-01-01

    Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play an important role in the aggressive phenotype in melanoma. The interactions between CD147 and RING1 were identified with a yeast two-hybrid and RING1 interacted with CD147 through the transmembrane domain. RING1 inhibits CD147's capability promoting melanoma cell migration. In conclusion, the study identified novel interactions between CD147 and RING1, recovered CD147 nuclear envelope distribution in melanoma cells, and suggested a new mechanism underlying how cytoplasmic CD147 promotes melanoma development.

  16. Insertion of liver enriched transcription factor hepatocyte nuclear factor-4 (HNF-4) in a vector which contains simian virus (SV40) promoter

    International Nuclear Information System (INIS)

    Al-Nbaheen, M.; Pourzand, C.; Tyrrell, R.M.

    2006-01-01

    One way of targeting gene expression in vivo is to control transcription using a tissue-specific regulatory system. Tissue specific promoters or enhancers are in use in transgenic animals and could be utilized in medical for gene therapy. At present the usual method for selection of a tissue-specific promoter is to identify a gene, which is expressed at unusually high level in the target tissue, and then to use the promoter for this gene to drive expression of another therapeutic gene in the target tissue. This approach is logical but does not always lead to high levels of gene expression. A second approach is to investigate the scope for discovery of synthetic specific promoters using a target tissue. The objective of the work described in this paper was to use both approach to design plasmid DNA expression vectors that would carry liver-specific promoter/enhancer linked to reporter gene (i.e. luciferase). Then transfect these vectors to both liver-derived and non-liver cell lines. This is followed by evaluation of the liver-specificity of each construct by measuring the basal level expression of the reporter gene (i.e. luciferase activity) in both cell lines. Hepatocyte nuclear factor-4 (HNF-4) is liver-enriched transcription factor used to design new synthetic enhancers by inserting a tandem array of 1', 3' or 5' repeats of the HNF-4 binding site upstream of the SV40 promoter linked to the luciferase reporter gene within an Epstein-Barr virus (EBV)-based vector, p 706. The results of transfection revealed that unexpectedly the HNF-4 binding sites in these constructs act as a repressor rather than enhancer of the liver-specific expression of the luciferase gene. (author)

  17. A basic plan of micro reactor for the promotion of nuclear literacy problems in realization of the reactor

    Energy Technology Data Exchange (ETDEWEB)

    Murata, Takashi [Graduate School of Energy Science, Kyoto University, Kyoto (Japan); Yoshiki, Nobuya [Central Research Inst. of Electric Power Industry, Tokyo (Japan); Nakagawa, Haruo [Hitachi Ltd., Tokyo (Japan)

    2001-04-01

    It is difficult for new sciences and big technologies such as life sciences, nuclear energy, biotechnology, etc. to achieve the appropriate public understanding. One of the issues is the lack of scientific literacy in the public. We propose a new type of nuclear reactor to prepare the opportunity for the public to be acquainted with the information and technology of the nuclear science and engineering. This reactor for interpretation is a symbolic facility adjacent to the scientific and technological museum. Features of the interpretative reactor must be safety and openness. The safety is satisfied by the excess reactivity less than 0.5% {delta}k/k and little burn up based on the thermal output less than 1 W. (author)

  18. A basic plan of micro reactor for the promotion of nuclear literacy problems in realization of the reactor

    International Nuclear Information System (INIS)

    Murata, Takashi; Yoshiki, Nobuya; Nakagawa, Haruo

    2001-01-01

    It is difficult for new sciences and big technologies such as life sciences, nuclear energy, biotechnology, etc. to achieve the appropriate public understanding. One of the issues is the lack of scientific literacy in the public. We propose a new type of nuclear reactor to prepare the opportunity for the public to be acquainted with the information and technology of the nuclear science and engineering. This reactor for interpretation is a symbolic facility adjacent to the scientific and technological museum. Features of the interpretative reactor must be safety and openness. The safety is satisfied by the excess reactivity less than 0.5% Δk/k and little burn up based on the thermal output less than 1 W. (author)

  19. The fanconi anemia proteins FANCA and FANCG stabilize each other and promote the nuclear accumulation of the Fanconi anemia complex.

    Science.gov (United States)

    Garcia-Higuera, I; Kuang, Y; Denham, J; D'Andrea, A D

    2000-11-01

    Fanconi anemia (FA) is an autosomal recessive cancer susceptibility syndrome with 8 complementation groups. Four of the FA genes have been cloned, and at least 3 of the encoded proteins, FANCA, FANCC, and FANCG/XRCC9, interact in a multisubunit protein complex. The FANCG protein binds directly to the amino terminal nuclear localization sequence (NLS) of FANCA, suggesting that FANCG plays a role in regulating FANCA nuclear accumulation. In the current study the functional consequences of FANCG/FANCA binding were examined. Correction of an FA-G cell line with the FANCG complementary DNA (cDNA) resulted in FANCA/FANCG binding, prolongation of the cellular half-life of FANCA, and an increase in the nuclear accumulation of the FA protein complex. Similar results were obtained upon correction of an FA-A cell line, with a reciprocal increase in the half-life of FANCG. Patient-derived mutant forms of FANCA, containing an intact NLS sequence but point mutations in the carboxy-terminal leucine zipper region, bound FANCG in the cytoplasm. The mutant forms failed to translocate to the nucleus of transduced cells, thereby suggesting a model of coordinated binding and nuclear translocation. These results demonstrate that the FANCA/FANCG interaction is required to maintain the cellular levels of both proteins. Moreover, at least one function of FANCG and FANCA is to regulate the nuclear accumulation of the FA protein complex. Failure to accumulate the nuclear FA protein complex results in the characteristic spectrum of clinical and cellular abnormalities observed in FA.

  20. Protein kinase A antagonist inhibits β-catenin nuclear translocation, c-Myc and COX-2 expression and tumor promotion in ApcMin/+ mice

    Directory of Open Access Journals (Sweden)

    Brudvik Kristoffer W

    2011-12-01

    Full Text Available Abstract Background The adenomatous polyposis coli (APC protein is part of the destruction complex controlling proteosomal degradation of β-catenin and limiting its nuclear translocation, which is thought to play a gate-keeping role in colorectal cancer. The destruction complex is inhibited by Wnt-Frz and prostaglandin E2 (PGE2 - PI-3 kinase pathways. Recent reports show that PGE2-induced phosphorylation of β-catenin by protein kinase A (PKA increases nuclear translocation indicating two mechanisms of action of PGE2 on β-catenin homeostasis. Findings Treatment of ApcMin/+ mice that spontaneously develop intestinal adenomas with a PKA antagonist (Rp-8-Br-cAMPS selectively targeting only the latter pathway reduced tumor load, but not the number of adenomas. Immunohistochemical characterization of intestines from treated and control animals revealed that expression of β-catenin, β-catenin nuclear translocation and expression of the β-catenin target genes c-Myc and COX-2 were significantly down-regulated upon Rp-8-Br-cAMPS treatment. Parallel experiments in a human colon cancer cell line (HCT116 revealed that Rp-8-Br-cAMPS blocked PGE2-induced β-catenin phosphorylation and c-Myc upregulation. Conclusion Based on our findings we suggest that PGE2 act through PKA to promote β-catenin nuclear translocation and tumor development in ApcMin/+ mice in vivo, indicating that the direct regulatory effect of PKA on β-catenin nuclear translocation is operative in intestinal cancer.

  1. Nuclear

    International Nuclear Information System (INIS)

    Anon.

    2000-01-01

    The first text deals with a new circular concerning the collect of the medicine radioactive wastes, containing radium. This campaign wants to incite people to let go their radioactive wastes (needles, tubes) in order to suppress any danger. The second text presents a decree of the 31 december 1999, relative to the limitations of noise and external risks resulting from the nuclear facilities exploitation: noise, atmospheric pollution, water pollution, wastes management and fire prevention. (A.L.B.)

  2. Report of 'the 2014 international forum on peaceful use of nuclear energy, nuclear non-proliferation and nuclear security. Future direction toward promoting non-proliferation and the ideal method of developing human resources using Centers of Excellence (COEs) following the new strategic energy plan'

    International Nuclear Information System (INIS)

    Yamaga, Chikanobu; Tomikawa, Hirofumi; Kobayashi, Naoki; Naoi, Yosuke; Oda, Tetsuzo; Mochiji, Toshiro

    2015-10-01

    The Japan Atomic Energy Agency (JAEA) held 'International Forum on Peaceful Use of Nuclear Energy, Nuclear Non-proliferation and Nuclear Security – Future direction toward promoting non-proliferation and the ideal method of developing human resources using Centers of Excellence (COEs) following the New Strategic Energy Plan -' on 3 December 2014, with the Japan Institute of International Affairs (JIIA) and School of Engineering, The University of Tokyo, and International Nuclear Research Center, Tokyo Institute of Technology as co-hosts. In the Forum, officials and experts from Japan, the United States explained their efforts regarding peaceful use of nuclear energy, nuclear non-proliferation and nuclear security. Discussion was made in two panels, entitled 'Effective and efficient measures to ensure nuclear non-proliferation based on domestic and foreign issues and the direction and role of technology development' and 'Roles of nuclear security COEs and future expectations'. In Panel Discussion 1, as the nuclear non-proliferation regime is facing various problems and challenges under current international circumstances, how to implement effective and efficient safeguards was discussed. In Panel Discussion 2, panelists discussed the following three points: 1. Current status of Nuclear Security Training and Support Centers and COEs, and Good Practice; 2. What these centers can do to enhance nuclear security (New role for COEs); 3. Regional cooperation in the Nuclear Security Training and Support Center (NSSC) and COEs in states, which the IAEA recommends establishing, and international cooperation and partnerships with international initiatives (New Role). Officials and experts from Japan, IAEA, the United States, France, Republic of Korea, and Indonesia participated in the panel and made contributions to active discussion. This report includes abstracts of keynote speeches, summaries of two panel discussions and materials of the

  3. Low LET radiation-induced telomerase catalytic subunit promoter activation is mediated by nuclear factor Kappa B

    International Nuclear Information System (INIS)

    Natarajan, M.; Hong, F.A.; Mohan, S.; Herman, T.S.

    2003-01-01

    Full text: The objective of this study is to understand whether low doses of low LET radiation induces survival advantage in normal cells. As an increase in telomerase activity is associated with longevity and cell proliferation, we examined the telomerase response following gamma-irradiation in normal aortic endothelial cells. Telomeric Repeat Amplification Protocol assay following low LET radiation showed an increase in telomerase enzyme activity as early as 8 h post irradiation and reaches its maximum at 24 h. Subsequent analysis revealed that the increased telomerse enzyme activity is due to increased synthesis resulting from an increased transcription. Examination of transcriptional activation of telomerase reverse transcriptase (TERT) promoter regulation showed an enhanced transcription of the telomerse gene following gamma-irradiation. In our previous reports we documented an increase in NF-kB DNA-binding property following low LET radiation (3). Therefore, to determine whether the activation of NF-kB-signaling is responsible for induced TERT promoter activation, cells transiently transfected with minimal promoter region of TERT containing wild type or mutant NF-kB binding site were examined following low LET radiation. TERT promoter activation was induced in wild type transfected cells whereas, in mutant kB binding site, the activation remained at the basal level similar to that of un-irradiated cells. More significantly, the gamma-ray mediated promoter activation of telomerase gene as well as induce telomerase enzyme activity was abrogated by ectopically expressing the IkBa mutant (IkBa (S32A/S36A)), which blocks NF-kB activation. The results thus suggest that exposure to low LET radiation could induce telomerase activity and the activation is at least, in part, mediated by the transcription factor NF-kB. Sustained activation of telomerase in these cells after low LET radiation may impart extended life span

  4. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  5. Hepatocyte DACH1 Is Increased in Obesity via Nuclear Exclusion of HDAC4 and Promotes Hepatic Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Lale Ozcan

    2016-06-01

    Full Text Available Defective insulin signaling in hepatocytes is a key factor in type 2 diabetes. In obesity, activation of calcium/calmodulin-dependent protein kinase II (CaMKII in hepatocytes suppresses ATF6, which triggers a PERK-ATF4-TRB3 pathway that disrupts insulin signaling. Elucidating how CaMKII suppresses ATF6 is therefore essential to understanding this insulin resistance pathway. We show that CaMKII phosphorylates and blocks nuclear translocation of histone deacetylase 4 (HDAC4. As a result, HDAC4-mediated SUMOylation of the corepressor DACH1 is decreased, which protects DACH1 from proteasomal degradation. DACH1, together with nuclear receptor corepressor (NCOR, represses Atf6 transcription, leading to activation of the PERK-TRB3 pathway and defective insulin signaling. DACH1 is increased in the livers of obese mice and humans, and treatment of obese mice with liver-targeted constitutively nuclear HDAC4 or DACH1 small hairpin RNA (shRNA increases ATF6, improves hepatocyte insulin signaling, and protects against hyperglycemia and hyperinsulinemia. Thus, DACH1-mediated corepression in hepatocytes emerges as an important link between obesity and insulin resistance.

  6. Regulations on the allocating of subsidies to promote the development of radiation exposure reduction technology for nuclear power facilities

    International Nuclear Information System (INIS)

    1984-01-01

    The regulations provide for subsidies for the research and development of radiation exposure reduction technology for nuclear power facilities and evaluation of the results. The subsidies are for purchase of equipment, materials, etc. and other expendures approved. The contents are as follows: applications for subsidies, determination of subsidy allocations, withdrawal of applications, a report on the work proceedings, a report on the results, confirmation on the sum of the subsidies, payment of subsidies, approval of alterations in the plans, withdrawal of the decision for subsidies, patent rights, payment of the earnings, management of the properties, etc. (Mori, K.)

  7. The regulation for delivery of subsidies for measures of promoting power source location for nuclear power generating facilities

    International Nuclear Information System (INIS)

    1977-01-01

    The Regulation is based on the prescriptions of the Enforcement Order for the Law for Arrangement of Surrounding Areas of Power Generating Facilities, the Law for Proper Budget Enforcement Concerning Subsidies and its Enforcement Order. These rules apply to the subsidies concerning nuclear power generating facilities, reprocessing facilities and test and examination facilities for nuclear fuel materials used for power generating reactors, reactors used for research on the safety of power generating reactors, and experimental reactors for fast breeder reactors. The limits of subsidies are specified respectively for the cases that a unit of power generating facility or two and more units of such facilities are set up in a local municipality. The subsidies are delivered for the expenses occurred in the period, beginning from the fiscal year when construction of the generating facility concerned starts or the arrangement plan of the concerned project is approved, and ending in the fiscal year when such construction comes to an end. The subsidies are given as evenly as possible in each fiscal year. The applicants of the subsidies file the applications attached with the explanations of the projects to the chief of the competent ministry (Director General of the Science and Technology Agency or the Minister of International Trade and Industry). Terms of delivery, reports submitted by the receivers of the subsidies and other related matters are specified. (Okada, K.)

  8. Research on the mechanism of inhibition of stress corrosion cracking by water chemistry of nuclear reactor. JAERI's nuclear research promotion program, H10-004 (contact research)

    International Nuclear Information System (INIS)

    Shibata, Toshio; Haruna, Takumi; Fujimoto, Shinji; Zhang, Shenghan

    2000-09-01

    We have developed a slow strain rate testing apparatus combined with a CCD camera system for researching stress corrosion cracking of the materials in high temperature and high pressure water, like nuclear reactor environment. The features of the tensile testing apparatus are the following; pressure up to 100 kg/cm 2 , temperature up to 300degC, and cross head speed down to 10 -5 mm/min. In addition, initiation and propagation of the multiple crack appearing on the material surface in the water at high pressure and high temperature can be clearly observed through a sapphire window penetrating an autoclave. Using the apparatus, we investigated the effects of temperature and species of anion, SO 4 2- and B 4 O 7 2- on the crack initiation and propagation of sensitized 304 stainless steel. The following were revealed: in the sulfate solutions, crack initiation time decreased with increase in temperature from 100 to 250degC, while crack initiation frequency showed maximum at 150degC. In the borate solutions, however, no crack was found on the gauge section of the specimen at any temperatures. This indicates the borate can suppress the initiation of cracks. The effect of anion on the crack initiation may be explained by hardness of anion based on the hard and soft acids and bases concept and the passive film model. (author)

  9. Study on the application of CANDLE burnup strategy to several nuclear reactors. JAERI's nuclear research promotion program, H13-002 (Contract research)

    International Nuclear Information System (INIS)

    Kunitomi, Kazuhiko

    2005-03-01

    The CANDLE burnup strategy is a new reactor burnup concept, where the distributions of fuel nuclide densities, neutron flux, and power density move with the same constant speed from bottom to top (or from top to bottom) of the core and without any change in their shapes. Therefore, any burnup control mechanisms are not required, and reactor characteristics do not change along burnup. The reactor is simple and safe. When this burnup scheme is applied to some neutron rich fast reactors, either natural or depleted uranium can be utilized as fresh fuel after second core and the burnup of discharged fuel is about 40%. It means that the nuclear energy can be utilized for many hundreds years without new mining, enrichment and reprocessing, and the amount of spent fuel can be reduced considerably. However, in order to perform such a high fuel burnup some innovative technologies should be developed. Though development of innovative fuel will take a lot of time, intermediate re-cladding may be easy to be employed. Compared to fast reactors, application of CANDLE burnup to prismatic fuel high-temperature gas cooled reactors is very easy. In this report the application of CANDLE burnup to both these types of reactors are studied. (author)

  10. Workplace activities to promote small attempts for safety. Toward development of safety culture in a nuclear power plant

    International Nuclear Information System (INIS)

    Fukui, Hirokazu; Sugiman, Toshio

    2007-01-01

    Activities that could possibly grow into learning activities for developing safety culture were explored by intensive fieldwork in a nuclear power plant depending on Engestroem's activity theory. As a first step to achieve this goal, workers' small attempts that might contribute to nurturing a safety culture were investigated. Eight kinds of activity were observed and interpreted as having the possibility to facilitate small recognition and small practice, i.e., activities including (1) workgroup as community, (2) other workgroups and other departments as community, (3) meeting drawing remarks as mediating artifacts, (4) study session and Off-the-Job-Training as mediating artifact, (5) award as mediating artifact, (6) extended leave as mediating artifact, (7) check sheet as mediating artifact, and (8) skill-transfer system as mediating artifact. (author)

  11. Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

    Science.gov (United States)

    Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

    2014-01-01

    The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  12. Analysis of the 227 bp short interspersed nuclear element (SINE insertion of the promoter of the myostatin (MSTN gene in different horse breeds

    Directory of Open Access Journals (Sweden)

    Stefania Dall'Olio

    2014-09-01

    Full Text Available The myostatin (MSTN gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic. The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81 and in the Thoroughbred (0.51, whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  13. Statin-activated nuclear receptor PXR promotes SGK2 dephosphorylation by scaffolding PP2C to induce hepatic gluconeogenesis.

    Science.gov (United States)

    Gotoh, Saki; Negishi, Masahiko

    2015-09-22

    Statin therapy is known to increase blood glucose levels in humans. Statins utilize pregnane X receptor (PXR) and serum/glucocorticoid regulated kinase 2 (SGK2) to activate phosphoenolpyruvate carboxykinase 1 (PEPCK1) and glucose-6-phosphatase (G6Pase) genes, thereby increasing glucose production in human liver cells. Here, the novel statin/PXR/SGK2-mediated signaling pathway has now been characterized for hepatic gluconeogenesis. Statin-activated PXR scaffolds the protein phosphatase 2C (PP2C) and SGK2 to stimulate PP2C to dephosphorylate SGK2 at threonine 193. Non-phosphorylated SGK2 co-activates PXR-mediated trans-activation of promoters of gluconeogenic genes in human liver cells, thereby enhancing gluconeogenesis. This gluconeogenic statin-PXR-SGK2 signal is not present in mice, in which statin treatment suppresses hepatic gluconeogenesis. These findings provide the basis for statin-associated side effects such as an increased risk for Type 2 diabetes.

  14. Mineral trioxide aggregate promotes the odonto/osteogenic differentiation and dentinogenesis of stem cells from apical papilla via nuclear factor kappa B signaling pathway.

    Science.gov (United States)

    Yan, Ming; Wu, Jintao; Yu, Yan; Wang, Yanping; Xie, Lizhe; Zhang, Guangdong; Yu, Jinhua; Zhang, Chengfei

    2014-05-01

    Mineral trioxide aggregate (MTA) has been widely used in clinical apexification and apexogenesis. However, the effects of MTA on the stem cells from apical papilla (SCAPs) and the precise mechanism of apexogenesis have not been elucidated in detail. Multiple colony-derived stem cells were isolated from the apical papillae, and the effects of MTA on the proliferation and differentiation of SCAPs were investigated both in vitro and in vivo. Activation of nuclear factor kappa B (NFκB) pathway in MTA-treated SCAPs was analyzed by immunofluorescence assay and Western blot. MTA at the concentration of 2 mg/mL did not affect the proliferation activity of SCAPs. However, 2 mg/mL MTA-treated SCAPs presented the ultrastructural changes, up-regulated alkaline phosphatase, increased calcium deposition, up-regulated expression of odontoblast markers (dentin sialoprotein and dentin sialophosphoprotein) and odonto/osteoblast markers (runt-related transcription factor 2 and osteocalcin), suggesting that MTA enhanced the odonto/osteoblastic differentiation of SCAPs in vitro. In vivo results confirmed that MTA can promote the regular dentinogenesis of SCAPs. Moreover, MTA-treated SCAPs exhibited the up-regulated cytoplasmic phos-IκBα and phos-P65, enhanced nuclear P65, and increased nuclear translocation of P65. When co-treated with BMS345541 (the specific NFκB inhibitor), MTA-mediated odonto/osteoblastic differentiation was significantly attenuated. MTA at the concentration of 2 mg/mL can improve the odonto/osteogenic capacity of SCAPs via the activation of NFκB pathway. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  15. Promoting industrialisation

    International Nuclear Information System (INIS)

    Hayfield, F.

    1986-04-01

    When the first nuclear power programme is decided upon, automatically the country has to initiate in parallel a programme to modify or add to its current industrial structure and resources. The extent of this new industrialisation depends upon many factors which both, the Government and the Industries have to consider. The Government has a vital role which includes the setting up of the background against which the industrial promotion should take place and in many cases may have also to play an active role all along this programme. Equally, the existing industries have an important role so as to achieve the most efficient participation in the nuclear programme. Invariably the industrial promotional programme will incur a certain degree of transfer of technology, the extent depending on the policies adopted. For this technology transfer to take place efficiently, both the donor and the receiver have to recognise each other's legitimate ambitions and fears. The transfer of technology is a process having a high human content and both donor and receiver have to take this into account. This can be further complicated when there is a difference in culture between them. Technology transfer is carried out within a contractual and organisational framework which will identify the donor (licensor) and the receiver (licensee). This framework may take various forms from a simple cooperative agreement, through a joint-venture organisation right to a standard contract between two separate entities. Each arrangement has its advantages and drawbacks and requires investment of different degrees. One of the keys to a successful industrial promotion is having it carried out in a timely fashion which will be parallel with the nuclear power programme. Experience in some countries has shown the problems when the industrialisation is out of phase with the programme whilst in other cases this industrialisation was at a level and scale unjustified. (author)

  16. Up-regulation of Store-operated Ca2+ Entry and Nuclear Factor of Activated T Cells Promote the Acinar Phenotype of the Primary Human Salivary Gland Cells.

    Science.gov (United States)

    Jang, Shyh-Ing; Ong, Hwei Ling; Liu, Xibao; Alevizos, Ilias; Ambudkar, Indu S

    2016-04-15

    The signaling pathways involved in the generation and maintenance of exocrine gland acinar cells have not yet been established. Primary human salivary gland epithelial cells, derived from salivary gland biopsies, acquired an acinar-like phenotype when the [Ca(2+)] in the serum-free medium (keratinocyte growth medium, KGM) was increased from 0.05 mm (KGM-L) to 1.2 mm (KGM-H). Here we examined the mechanism underlying this Ca(2+)-dependent generation of the acinar cell phenotype. Compared with cells in KGM-L, those in KGM-H display enhancement of Orai1, STIM1, STIM2, and nuclear factor of activated T cells 1 (NFAT1) expression together with an increase in store-operated Ca(2+) entry (SOCE), SOCE-dependent nuclear translocation of pGFP-NFAT1, and NFAT-dependent but not NFκB-dependent gene expression. Importantly, AQP5, an acinar-specific protein critical for function, is up-regulated in KGM-H via SOCE/NFAT-dependent gene expression. We identified critical NFAT binding motifs in the AQP5 promoter that are involved in Ca(2+)-dependent up-regulation of AQP5. These important findings reveal that the Ca(2+)-induced switch of salivary epithelial cells to an acinar-like phenotype involves remodeling of SOCE and NFAT signaling, which together control the expression of proteins critically relevant for acinar cell function. Our data provide a novel strategy for generating and maintaining acinar cells in culture. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Up-regulation of Store-operated Ca2+ Entry and Nuclear Factor of Activated T Cells Promote the Acinar Phenotype of the Primary Human Salivary Gland Cells*

    Science.gov (United States)

    Jang, Shyh-Ing; Ong, Hwei Ling; Liu, Xibao; Alevizos, Ilias; Ambudkar, Indu S.

    2016-01-01

    The signaling pathways involved in the generation and maintenance of exocrine gland acinar cells have not yet been established. Primary human salivary gland epithelial cells, derived from salivary gland biopsies, acquired an acinar-like phenotype when the [Ca2+] in the serum-free medium (keratinocyte growth medium, KGM) was increased from 0.05 mm (KGM-L) to 1.2 mm (KGM-H). Here we examined the mechanism underlying this Ca2+-dependent generation of the acinar cell phenotype. Compared with cells in KGM-L, those in KGM-H display enhancement of Orai1, STIM1, STIM2, and nuclear factor of activated T cells 1 (NFAT1) expression together with an increase in store-operated Ca2+ entry (SOCE), SOCE-dependent nuclear translocation of pGFP-NFAT1, and NFAT-dependent but not NFκB-dependent gene expression. Importantly, AQP5, an acinar-specific protein critical for function, is up-regulated in KGM-H via SOCE/NFAT-dependent gene expression. We identified critical NFAT binding motifs in the AQP5 promoter that are involved in Ca2+-dependent up-regulation of AQP5. These important findings reveal that the Ca2+-induced switch of salivary epithelial cells to an acinar-like phenotype involves remodeling of SOCE and NFAT signaling, which together control the expression of proteins critically relevant for acinar cell function. Our data provide a novel strategy for generating and maintaining acinar cells in culture. PMID:26903518

  18. Heat shock factor 1 upregulates transcription of Epstein–Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    International Nuclear Information System (INIS)

    Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju; Liao, Yi-Ji; Lin, Sheng; Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin; Mai, Shi-Juan; Xie, Dan

    2011-01-01

    Epstein–Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the − 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  19. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  20. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  1. Proliferating cell nuclear antigen (PCNA)-associated KIAA0101/PAF15 protein is a cell cycle-regulated anaphase-promoting complex/cyclosome substrate.

    Science.gov (United States)

    Emanuele, Michael J; Ciccia, Alberto; Elia, Andrew E H; Elledge, Stephen J

    2011-06-14

    The anaphase-promoting complex/cyclosome (APC/C) is a cell cycle-regulated E3 ubiquitin ligase that controls the degradation of substrate proteins at mitotic exit and throughout the G1 phase. We have identified an APC/C substrate and cell cycle-regulated protein, KIAA0101/PAF15. PAF15 protein levels peak in the G2/M phase of the cell cycle and drop rapidly at mitotic exit in an APC/C- and KEN-box-dependent fashion. PAF15 associates with proliferating cell nuclear antigen (PCNA), and depletion of PAF15 decreases the number of cells in S phase, suggesting a role for it in cell cycle regulation. Following irradiation, PAF15 colocalized with γH2AX foci at sites of DNA damage through its interaction with PCNA. Finally, PAF15 depletion led to an increase in homologous recombination-mediated DNA repair, and overexpression caused sensitivity to UV-induced DNA damage. We conclude that PAF15 is an APC/C-regulated protein involved in both cell cycle progression and the DNA damage response.

  2. Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Feng-Wei [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Wu, Xian-Rui [Department of Surgery, Sixth Affiliated Hospital, Sun Yat-sen University, Guangzhou (China); Liu, Wen-Ju; Liao, Yi-Ji [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Lin, Sheng [Laboratory of Integrated Biosciences, School of Life Science, Sun Yat-sen University, Guangzhou (China); Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Mai, Shi-Juan, E-mail: maishj@sysucc.org.cn [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China); Xie, Dan, E-mail: xied@mail.sysu.edu.cn [The State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University, Guangzhou (China)

    2011-12-20

    Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  3. 15 years in promoting the use of isotopic and nuclear technique for combating land degradation and soil erosion: the contribution of the Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture

    Science.gov (United States)

    Mabit, Lionel; Toloza, Arsenio; Heng, Lee

    2017-04-01

    The world population will exceed 9 billion by the year 2050 and food production will need to be approximately doubled to meet this crucial demand. Most of this increase will occur in developing countries, where the majority of the population depends on agriculture and their land for their livelihoods. Reports from the Intergovernmental Panel on Climate Change (IPCC) predicted negative impact of climate change, threatening global food security. In addition, the intensification of agricultural activities has increased pressure on land and water resources, resulting in different forms of soil degradation, of which soil erosion and associated sedimentation are worsening. Worldwide economic costs of agricultural soil loss and associated sedimentation downstream have been estimated at US 400 billion per year. As a result of climate change, world average soil erosion is expected to further increase significantly. Adapting to climate change requires agricultural soil and water management practices that make agricultural production systems resilient to drought, floods and land degradation, to enhance the conservation of the natural resource base for sustainable upland farming. These current concerns with ensuring sustainable use and management of agroecosystems create an urgent need for reliable quantitative data on the extent and magnitude of soil resource degradation over several spatial and time scales to formulate sound policies and management measures. Integrated isotopic approaches can help in targeting adapted and effective soil-water conservation measures to control soil degradation and therefore contribute to positive feedback mechanisms to mitigate climate change impact on soil and water resources. Set up 60 years ago as the world's centre for cooperation in the nuclear field, the International Atomic Energy Agency (IAEA) promotes the safe, secure and peaceful use of nuclear technologies. Since the end of the 1990s, the Joint FAO/IAEA Division of Nuclear

  4. TNF-α promotes nuclear enrichment of the transcription factor TonEBP/NFAT5 to selectively control inflammatory but not osmoregulatory responses in nucleus pulposus cells.

    Science.gov (United States)

    Johnson, Zariel I; Doolittle, Alexandra C; Snuggs, Joseph W; Shapiro, Irving M; Le Maitre, Christine L; Risbud, Makarand V

    2017-10-20

    Intervertebral disc degeneration (IDD) causes chronic back pain and is linked to production of proinflammatory molecules by nucleus pulposus (NP) and other disc cells. Activation of tonicity-responsive enhancer-binding protein (TonEBP)/NFAT5 by non-osmotic stimuli, including proinflammatory molecules, occurs in cells involved in immune response. However, whether inflammatory stimuli activate TonEBP in NP cells and whether TonEBP controls inflammation during IDD is unknown. We show that TNF-α, but not IL-1β or LPS, promoted nuclear enrichment of TonEBP protein. However, TNF-α-mediated activation of TonEBP did not cause induction of osmoregulatory genes. RNA sequencing showed that 8.5% of TNF-α transcriptional responses were TonEBP-dependent and identified genes regulated by both TNF-α and TonEBP. These genes were over-enriched in pathways and diseases related to inflammatory response and inhibition of matrix metalloproteases. Based on RNA-sequencing results, we further investigated regulation of novel TonEBP targets CXCL1 , CXCL2 , and CXCL3 TonEBP acted synergistically with TNF-α and LPS to induce CXCL1 -proximal promoter activity. Interestingly, this regulation required a highly conserved NF-κB-binding site but not a predicted TonE, suggesting cross-talk between these two members of the Rel family. Finally, analysis of human NP tissue showed that TonEBP expression correlated with canonical osmoregulatory targets TauT/SLC6A6 , SMIT/SLC5A3 , and AR/AKR1B1 , supporting in vitro findings that the inflammatory milieu during IDD does not interfere with TonEBP osmoregulation. In summary, whereas TonEBP participates in the proinflammatory response to TNF-α, therapeutic strategies targeting this transcription factor for treatment of disc disease must spare osmoprotective, prosurvival, and matrix homeostatic activities. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. A study on the promotion of Japan's Nuclear Security Culture. Based on the Implementing Guide of IAEA and actually-occurred threat cases

    International Nuclear Information System (INIS)

    Inamura, Tomoaki

    2014-01-01

    The ministerial ordinance relating to the Nuclear Reactor Regulation Law, revised in 2012, requires licensees of nuclear facilities to establish a system to foster Nuclear Security Culture. However, such measures are introduced without thorough consideration of essentials of Nuclear Security Culture. This report aims to provide deeper understanding of the concept and raise issues relating to implementation of nuclear security measures by reviewing the Implementing Guide of Nuclear Security Culture published by International Atomic Energy Agency and related documents, as well as analyzing security threats that actually happened recently. The results are summarized as follows: 1) Two beliefs, namely, 'a credible threat exists' and 'nuclear security is important', form the basis of Nuclear Security Culture. Nuclear Security Culture bears a high degree of resemblance to Nuclear Safety Culture because the both assume the same organizational culture model. The differences between the two are derived from whether the malevolence of adversaries should be taken into consideration or not. As the questioning attitude plays an important role to implant the two beliefs, a proper management system of Nuclear Security Culture is necessary to cultivate it. 2) Based on the related documents and an analysis of the cases of actual threats, the following viewpoints should be made clear: (a) the role of the actors of Nuclear Security Culture, (b) flexible sensitivity to share the same understanding about the credible threat, (c) systematic revision of the related regulation about sensitive information management and security clearance of the personnel, and complementary measures such as hotline, (d) measures to encourage the positive action of the personnel, (e) how to construct continuous cycle of improvement of Nuclear Security Culture at state level. (author)

  6. Hydrocortisone fails to abolish NF-κB1 protein nuclear translocation in deletion allele carriers of the NFKB1 promoter polymorphism (-94ins/delATTG and is associated with increased 30-day mortality in septic shock.

    Directory of Open Access Journals (Sweden)

    Simon T Schäfer

    Full Text Available BACKGROUND: Previous investigations and meta-analyses on the effect of glucocorticoids on mortality in septic shock revealed mixed results. This heterogeneity might be evoked by genetic variations. Such candidate is a promoter polymorphism (-94ins/delATTG of the gene encoding the ubiquitous transcription-factor nuclear-factor-κB (NF-κB which binds to recognition elements in the promoter of several genes encoding for the innate immune-system. In turn, hydrocortisone inhibits NF-κB nuclear translocation and thus transcription of key immune-response regulators. Accordingly, we tested the hypotheses that hydrocortisone has a NFKB1 genotype dependent effect on 1 NF-κB1 nuclear translocation evoked by lipopolysaccharide (LPS in monocytes in vitro, and 2 mortality in septic shock. METHODS: Monocytes of volunteers with the homozygous insertion (II; n = 5 or deletion (DD; n = 6 NFKB1 genotype were incubated with 10 µgml-1 LPS ± hydrocortisone (10-5M, and NF-κB1 nuclear translocation was assessed (immunofluorescence. Furthermore, we analyzed 30-day-mortality in 160 patients with septic shock stratified for both genotype and hydrocortisone therapy. RESULTS: Hydrocortisone inhibited LPS induced nuclear translocation of NF-κB1 in II (25%±11;p = 0.0001 but not in DD genotypes (51%±15;p = n.s.. Onehundredandfour of 160 patients with septic shock received hydrocortisone, at the discretion of the intensivist. NFKB1 deletion allele carriers (ID/DD receiving hydrocortisone had a much greater 30-day-mortality (57.6% than II genotypes (24.4%; HR:3.18, 95%-CI:1.61-6.28;p = 0.001. In contrast, 30-day mortality was 22.2% in ID/DD and 25.0% in II genotypes without hydrocortisone therapy. Results were similar when using propensity score matching to account for possible bias in the intensivists' decision to administer hydrocortisone. CONCLUSION: Hydrocortisone fails to inhibit LPS induced nuclear NF-κB1 translocation in deletion allele

  7. Hydrocortisone Fails to Abolish NF-κB1 Protein Nuclear Translocation in Deletion Allele Carriers of the NFKB1 Promoter Polymorphism (-94ins/delATTG) and Is Associated with Increased 30-Day Mortality in Septic Shock

    Science.gov (United States)

    Schäfer, Simon T.; Gessner, Sophia; Scherag, André; Rump, Katharina; Frey, Ulrich H.; Siffert, Winfried; Westendorf, Astrid M.; Steinmann, Jörg; Peters, Jürgen; Adamzik, Michael

    2014-01-01

    Background Previous investigations and meta-analyses on the effect of glucocorticoids on mortality in septic shock revealed mixed results. This heterogeneity might be evoked by genetic variations. Such candidate is a promoter polymorphism (-94ins/delATTG) of the gene encoding the ubiquitous transcription-factor nuclear-factor-κB (NF-κB) which binds to recognition elements in the promoter of several genes encoding for the innate immune-system. In turn, hydrocortisone inhibits NF-κB nuclear translocation and thus transcription of key immune-response regulators. Accordingly, we tested the hypotheses that hydrocortisone has a NFKB1 genotype dependent effect on 1) NF-κB1 nuclear translocation evoked by lipopolysaccharide (LPS) in monocytes in vitro, and 2) mortality in septic shock. Methods Monocytes of volunteers with the homozygous insertion (II; n = 5) or deletion (DD; n = 6) NFKB1 genotype were incubated with 10 µgml-1 LPS ± hydrocortisone (10-5M), and NF-κB1 nuclear translocation was assessed (immunofluorescence). Furthermore, we analyzed 30-day-mortality in 160 patients with septic shock stratified for both genotype and hydrocortisone therapy. Results Hydrocortisone inhibited LPS induced nuclear translocation of NF-κB1 in II (25%±11;p = 0.0001) but not in DD genotypes (51%±15;p = n.s.). Onehundredandfour of 160 patients with septic shock received hydrocortisone, at the discretion of the intensivist. NFKB1 deletion allele carriers (ID/DD) receiving hydrocortisone had a much greater 30-day-mortality (57.6%) than II genotypes (24.4%; HR:3.18, 95%-CI:1.61-6.28;p = 0.001). In contrast, 30-day mortality was 22.2% in ID/DD and 25.0% in II genotypes without hydrocortisone therapy. Results were similar when using propensity score matching to account for possible bias in the intensivists' decision to administer hydrocortisone. Conclusion Hydrocortisone fails to inhibit LPS induced nuclear NF-κB1 translocation in deletion allele carriers of the

  8. Nuclear power

    International Nuclear Information System (INIS)

    King, P.

    1990-01-01

    Written from the basis of neutrality, neither for nor against nuclear power this book considers whether there are special features of nuclear power which mean that its development should be either promoted or restrained by the State. The author makes it dear that there are no easy answers to the questions raised by the intervention of nuclear power but calls for openness in the nuclear decision making process. First, the need for energy is considered; most people agree that energy is the power to progress. Then the historicalzed background to the current position of nuclear power is given. Further chapters consider the fuel cycle, environmental impacts including carbon dioxide emission and the greenhouse effect, the costs, safety and risks and waste disposal. No conclusion either for or against nuclear power is made. The various shades of opinion are outlined and the arguments presented so that readers can come to their own conclusions. (UK)

  9. Nuclear uptake of an amino-terminal fragment of apolipoprotein E4 promotes cell death and localizes within microglia of the Alzheimer's disease brain.

    Science.gov (United States)

    Love, Julia E; Day, Ryan J; Gause, Justin W; Brown, Raquel J; Pu, Xinzhu; Theis, Dustin I; Caraway, Chad A; Poon, Wayne W; Rahman, Abir A; Morrison, Brad E; Rohn, Troy T

    2017-01-01

    Although harboring the apolipoprotein E4 ( APOE4 ) allele is a well known risk factor in Alzheimer's disease (AD), the mechanism by which it contributes to disease risk remains elusive. To investigate the role of proteolysis of apoE4 as a potential mechanism, we designed and characterized a site-directed cleavage antibody directed at position D151 of the mature form of apoE4 and E3. Characterization of this antibody indicated a high specificity for detecting synthesized recombinant proteins corresponding to the amino acid sequences 1-151 of apoE3 and E4 that would generate the 17 kDa (p17) fragment. In addition, this antibody also detected a ~17 kDa amino-terminal fragment of apoE4 following incubation with collagenase and matrix metalloproteinase-9 (MMP-9), but did not react with full-length apoE4. Application of this amino-terminal apoE cleavage-fragment (nApoECFp17) antibody, revealed nuclear labeling within glial cells and labeling of a subset of neurofibrillary tangles in the human AD brain. A quantitative analysis indicated that roughly 80% of labeled nuclei were microglia. To confirm these findings, cultured BV2 microglia cells were incubated with the amino-terminal fragment of apoE4 corresponding to the cleavage site at D151. The results indicated efficient uptake of this fragment and trafficking to the nucleus that also resulted in significant cell death. In contrast, a similarly designed apoE3 fragment showed no toxicity and primarily localized within the cytoplasm. These data suggest a novel cleavage event by which apoE4 is cleaved by the extracellular proteases, collagenase and MMP-9, generating an amino-terminal fragment that is then taken up by microglia, traffics to the nucleus and promotes cell death. Collectively, these findings provide important mechanistic insights into the mechanism by which harboring the APOE4 allele may elevate dementia risk observed in AD.

  10. The Role of S P2, SP3 AND SP4 in The Transcriptional Regulation of The Promoter of Nuclear Encoded Mitochondrial Genes

    International Nuclear Information System (INIS)

    Zaid, A.; Salem, Gh.

    2012-01-01

    The GC-box is an important transcriptional regulatory element present in the promoters of many mammalian genes, and is found in most, if not all, oxidative phosphorylation (OXPHOS) promoters. In the present study we examine the effects of three Spl family members (Sp2, Sp3, and Sp4) on the adenine nucleotide translocase 2, cytochrome cl, Fl-ATPase β-subunit, and the mitochondria transcription factor (mtTFA) promoters in Drosophila SL2 cell line. Sp3, like Spl, strongly activates transcription all four promoters. SP4 stimulates, moderately, but Sp2 had no effect. In addition, Sp3 can, like Spl, inhibit transcription from the proximal promoter of the ANT2 gene through binding to the Cbox GC element. By contrast, Sp4 and Sp2 do not repress promoter activity. Furthermore, since Sp4 and Sp2 bind to the Cbox repression element on the ANT2 promoter, but do not repress transcription, inhibition of transcription cannot be explained by steric hindrance of pre-initiation complex assembly. These data suggest that different Spl family members differentially affect transcription from the OXPHOS promoters.

  11. A study to promote the establishment of R and D collaboration center for nuclear fundamental core technology development between Korea and China

    International Nuclear Information System (INIS)

    Kim, Hark Rho; Chang, J. H.; Song, C. H.; Choi, B. H.; Kim, Y. J.; Choi, C. O.; Lee, C. H.; Lee, Y. J.; Chun, S. Y.; Kim, H. J.

    2005-05-01

    This study constructed the infra for Joint R and D Collaboration Center through activating the working group activities for PRC-ROK Joint Committee on Nuclear Energy Group of Scientific Research and Development

  12. Co-operation Agreement for the Promotion of Nuclear Science and Technology in Latin America and the Caribbean (ARCAL). Status list as of 30 September 2002. Signature and ratification. Declarations/reservations made upon signature

    International Nuclear Information System (INIS)

    2002-01-01

    The document reproduces the text of the Co-operation Agreement for the Promotion of Nuclear Science and Technology in Latin America and the Caribbean (ARCAL) which was opened for signature on 25 September 1998 and shall come into force after deposit of the instrument of ratification by ten Member States. It shall remain in force for ten years, and may be extended by periods of five years if the Member States so agree. By 30 September 2002, there were 18 Signatories to the above Agreement

  13. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    International Nuclear Information System (INIS)

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-01-01

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX

  14. Facts in nuclear engineering

    International Nuclear Information System (INIS)

    Buenemann, D.

    1979-07-01

    This compilation of facts has been published on behalf of Kerntechnische Gesellschaft (Society for Nuclear Engineering), as a basis for the discussion between promoters and opponents of nuclear power. It intends to make the nuclear discussion less emotional by providing relevant data material. (orig./HP) [de

  15. Nuclear technologies

    International Nuclear Information System (INIS)

    Toyama, Makoto; Hamasaki, Manabu; Kobayashi, Masahiko; Hoshide, Akihiko; Katayama, Kimio; Nozawa, H.; Karigome, Satoshi

    2010-01-01

    In recent days, energy security is becoming a major global concern and it has been recognized that a major reduction in greenhouse-gas emissions is required to combat climate change. Considerable expansion and new introduction of nuclear power generation are currently being planned and considered for the further in various parts of the world. Nuclear technologies of the latest 10 years in Japan were reviewed with their characteristics, advancement and future perspective. Steady efforts have been made to construct new nuclear power stations with computer-aided engineering system and modular and prefabricated structures, extend the interval of periodic inspections under the new inspection system that should improve both safety and reliability, implement advanced measures against aging and develop the next-generation light water reactors including a medium small reactor. Export of nuclear power plants has been promoted with international business alliance or cooperation. Activities to close nuclear fuel cycle to ensure sustainable nuclear energy utilization have been promoted. Decommissioning technologies for Tokai power station have been developed and accumulated know-how will be utilized in light water reactors. (T. Tanaka)

  16. Nuclear knowledge management

    International Nuclear Information System (INIS)

    2007-01-01

    The management of nuclear knowledge has emerged as a growing challenge in recent years. The need to preserve and transfer nuclear knowledge is compounded by recent trends such as ageing of the nuclear workforce, declining student numbers in nuclear-related fields, and the threat of losing accumulated nuclear knowledge. Addressing these challenges, the IAEA promotes a 'knowledge management culture' through: - Providing guidance for policy formulation and implementation of nuclear knowledge management; - Strengthening the contribution of nuclear knowledge in solving development problems, based on needs and priorities of Member States; - Pooling, analysing and sharing nuclear information to facilitate knowledge creation and its utilization; - Implementing effective knowledge management systems; - Preserving and maintaining nuclear knowledge; - Securing sustainable human resources for the nuclear sector; and - Enhancing nuclear education and training

  17. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

    Science.gov (United States)

    Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

    2002-11-01

    We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells.

  18. The far and distal enhancers in the CYP3A4 gene co-ordinate the proximal promoter in responding similarly to the pregnane X receptor but differentially to hepatocyte nuclear factor-4alpha.

    Science.gov (United States)

    Liu, Fu-Jun; Song, Xiulong; Yang, Dongfang; Deng, Ruitang; Yan, Bingfang

    2008-01-01

    CYP3A4 (cytochrome P450 3A4) is involved in the metabolism of more than 50% of drugs and other xenobiotics. The expression of CYP3A4 is induced by many structurally dissimilar compounds. The PXR (pregnane X receptor) is recognized as a key regulator for the induction, and the PXR-directed transactivation of the CYP3A4 gene is achieved through a co-ordinated mechanism of the distal module with the proximal promoter. Recently, a far module was found to support constitutive expression of CYP3A4. The far module, like the distal module, is structurally clustered by a PXR response element (F-ER6) and elements recognized by HNF-4alpha (hepatocyte nuclear receptor-4alpha). We hypothesized that the far module supports PXR transactivation of the CYP3A4 gene. Consistent with the hypothesis, fusion of the far module to the proximal promoter of CYP3A4 markedly increased rifampicin-induced reporter activity. The increase was synergistically enhanced when both the far and distal modules were fused to the proximal promoter. The increase, however, was significantly reduced when the F-ER6 was disrupted. Chromatin immunoprecipitation detected the presence of PXR in the far module. Interestingly, HNF-4alpha increased the activity of the distal-proximal fused promoter, but decreased the activity of the far-proximal fused promoter. Given the fact that induction of CYP3A4 represents an important detoxification mechanism, the functional redundancy and synergistic interaction in supporting PXR transactivation suggest that the far and distal modules ensure the induction of CYP3A4 during chemical insults. The difference in responding to HNF-4alpha suggests that the magnitude of the induction is under control through various transcriptional networks.

  19. FOXP2 promotes the nuclear translocation of POT1, but FOXP2(R553H), mutation related to speech-language disorder, partially prevents it

    International Nuclear Information System (INIS)

    Tanabe, Yuko; Fujita, Eriko; Momoi, Takashi

    2011-01-01

    Highlights: → We isolated protection of telomeres 1 (POT1) as a FOXP2-associated protein by a yeast two-hybrid. → FOXP2 associated and co-localized with POT1 in the nuclei. → FOXP2(R553H) also co-localized with POT1 in both the cytoplasm and nuclei. → FOXP2(R553H) partially prevented the nuclear translocation of POT1. → FOXP2(R553H) mutation may be associated with the pathogenesis of speech-language disorder. -- Abstract: FOXP2 is a forkhead box-containing transcription factor with several recognizable sequence motifs. However, little is known about the FOXP2-associated proteins except for C-terminal binding protein (CtBP). In the present study, we attempted to isolate the FOXP2-associated protein with a yeast two-hybrid system using the C-terminal region, including the forkhead domain, as a bait probe, and identified protection of telomeres 1 (POT1) as a FOXP2-associated protein. Immunoprecipitation assay confirmed the association with FOXP2 and POT1. POT1 alone localized in the cytoplasm but co-localized with FOXP2 and the forkhead domain of FOXP2 in nuclei. However, both FOXP2 with mutated nuclear localization signals and (R553H) mutated forkhead, which is associated with speech-language disorder, prevented the nuclear translocation of POT1. These results suggest that FOXP2 is a binding partner for the nuclear translocation of POT1. As loss of POT1 function induces the cell arrest, the impaired nuclear translocation of POT1 in the developing neuronal cells may be associated with the pathogenesis of speech-language disorder with FOXP2(R553H) mutation.

  20. FOXP2 promotes the nuclear translocation of POT1, but FOXP2(R553H), mutation related to speech-language disorder, partially prevents it

    Energy Technology Data Exchange (ETDEWEB)

    Tanabe, Yuko [Division of Development and Differentiation, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigasi, Kodaira 187-8511 (Japan); Fujita, Eriko [Division of Development and Differentiation, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigasi, Kodaira 187-8511 (Japan); Department of Pediatrics, Jichi Medical University, 3311-1 Yakushiji, Shimotsuke, Tochigi 329-0498 (Japan); Momoi, Takashi, E-mail: momoi@iuhw.ac.jp [Division of Development and Differentiation, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigasi, Kodaira 187-8511 (Japan); Center for Medical Science, International University of Health and Welfare, 2600-1 Kitakanamaru, Otawara, Tochigi 324-8501 (Japan)

    2011-07-08

    Highlights: {yields} We isolated protection of telomeres 1 (POT1) as a FOXP2-associated protein by a yeast two-hybrid. {yields} FOXP2 associated and co-localized with POT1 in the nuclei. {yields} FOXP2(R553H) also co-localized with POT1 in both the cytoplasm and nuclei. {yields} FOXP2(R553H) partially prevented the nuclear translocation of POT1. {yields} FOXP2(R553H) mutation may be associated with the pathogenesis of speech-language disorder. -- Abstract: FOXP2 is a forkhead box-containing transcription factor with several recognizable sequence motifs. However, little is known about the FOXP2-associated proteins except for C-terminal binding protein (CtBP). In the present study, we attempted to isolate the FOXP2-associated protein with a yeast two-hybrid system using the C-terminal region, including the forkhead domain, as a bait probe, and identified protection of telomeres 1 (POT1) as a FOXP2-associated protein. Immunoprecipitation assay confirmed the association with FOXP2 and POT1. POT1 alone localized in the cytoplasm but co-localized with FOXP2 and the forkhead domain of FOXP2 in nuclei. However, both FOXP2 with mutated nuclear localization signals and (R553H) mutated forkhead, which is associated with speech-language disorder, prevented the nuclear translocation of POT1. These results suggest that FOXP2 is a binding partner for the nuclear translocation of POT1. As loss of POT1 function induces the cell arrest, the impaired nuclear translocation of POT1 in the developing neuronal cells may be associated with the pathogenesis of speech-language disorder with FOXP2(R553H) mutation.

  1. Enhancement of organizational resilience in light of the Fukushima Dai-ichi Nuclear Power Plant accident (2). Promoting of attitude-building measures

    International Nuclear Information System (INIS)

    Oba, Kyoko; Yoshizawa, Atsufumi; Kitamura, Masaharu

    2014-01-01

    The disaster of Fukushima-Daiichi Nuclear Power Plant was indeed an unprecedented accident. However, the consequence could have been worse without tremendous struggles of the personnel on the site. In order to identify the key factors that enabled such tremendous and self-sacrificing struggles, documents including narrative statements of the personnel have been reviewed. The ultimate purpose of this paper is to enhance operational resilience of nuclear power plants. Out of the four key capabilities proposed in the framework of resilience engineering, the capability to respond has been mainly studied. Particular attention has been paid to attitude of operators which definitely contributed to the outstanding behaviors. Through extensive reviewing activities, number of factors such as the sense of vocation, consciousness for one's own plants, sprit of operator, leadership, followership, comradeship, regional loyalty, connection with family, etc. have been identified as the important driving forces that contributed to the honorable attitude. (author)

  2. Renewable energy sources (promotion)

    International Nuclear Information System (INIS)

    Cook, F.

    1986-01-01

    Permission to present a Bill to establish an independent commission directly responsible for the research, development and demonstration of clean, renewable, alternative sources of energy (to nuclear energy) is requested. The paragraphs of the preamble to the Bill are summarized by the Member seeking permission. The main reason for promoting renewable energy sources is opposition to the nuclear industry. One objection was raised. However, permission was granted to present the Bill and it was read for the first time with a second reading ordered for 7 March 1986. The Bill itself is not reprinted but the permission and question are reported verbatim. (U.K.)

  3. Intense Resistance Exercise Promotes the Acute and Transient Nuclear Translocation of Small Ubiquitin-Related Modifier (SUMO-1 in Human Myofibres

    Directory of Open Access Journals (Sweden)

    Sebastian Gehlert

    2016-04-01

    Full Text Available Protein sumoylation is a posttranslational modification triggered by cellular stress. Because general information concerning the role of small ubiquitin-related modifier (SUMO proteins in adult skeletal muscle is sparse, we investigated whether SUMO-1 proteins will be subjected to time-dependent changes in their subcellular localization in sarcoplasmic and nuclear compartments of human type I and II skeletal muscle fibers in response to acute stimulation by resistance exercise (RE. Skeletal muscle biopsies were taken at baseline (PRE, 15, 30, 60, 240 min and 24 h post RE from 6 male subjects subjected to a single bout of one-legged knee extensions. SUMO-1 localization was determined via immunohistochemistry and confocal laser microscopy. At baseline SUMO-1 was localized in perinuclear regions of myonuclei. Within 15 and up to 60 min post exercise, nuclear SUMO-1 localization was significantly increased (p < 0.01, declining towards baseline levels within 240 min post exercise. Sarcoplasmic SUMO-1 localization was increased at 15 min post exercise in type I and up to 30 min post RE in type II myofibres. The changing localization of SUMO-1 proteins acutely after intense muscle contractions points to a role for SUMO proteins in the acute regulation of the skeletal muscle proteome after exercise.

  4. A novel function for the IκB inhibitor Cactus in promoting Dorsal nuclear localization and activity in the Drosophila embryo.

    Science.gov (United States)

    Cardoso, Maira Arruda; Fontenele, Marcio; Lim, Bomyi; Bisch, Paulo Mascarello; Shvartsman, Stanislav Y; Araujo, Helena Marcolla

    2017-08-15

    The evolutionarily conserved Toll signaling pathway controls innate immunity across phyla and embryonic patterning in insects. In the Drosophila embryo, Toll is required to establish gene expression domains along the dorsal-ventral axis. Pathway activation induces degradation of the IκB inhibitor Cactus, resulting in a ventral-to-dorsal nuclear gradient of the NFκB effector Dorsal. Here, we investigate how cactus modulates Toll signals through its effects on the Dorsal gradient and on Dorsal target genes. Quantitative analysis using a series of loss- and gain-of-function conditions shows that the ventral and lateral aspects of the Dorsal gradient can behave differently with respect to Cactus fluctuations. In lateral and dorsal embryo domains, loss of Cactus allows more Dorsal to translocate to the nucleus. Unexpectedly, cactus loss-of-function alleles decrease Dorsal nuclear localization ventrally, where Toll signals are high. Overexpression analysis suggests that this ability of Cactus to enhance Toll stems from the mobilization of a free Cactus pool induced by the Calpain A protease. These results indicate that Cactus acts to bolster Dorsal activation, in addition to its role as a NFκB inhibitor, ensuring a correct response to Toll signals. © 2017. Published by The Company of Biologists Ltd.

  5. Research on the behavior of polonium produced in lead-bismuth eutectic irradiated with neutrons. JAERI's nuclear research promotion program, H10-026. Contract research

    International Nuclear Information System (INIS)

    Sekimoto, Hiroshi; Igashira, Masayuki; Yano, Toyohiko; Obara, Toru; Ohsaki, Toshiro

    2002-03-01

    Lead-Bismuth Eutectic (LBE) is proposed by several research institutes as a coolant of liquid metal cooled fast reactors, instead of sodium, and a target of accelerator driven subcritical nuclear reactor systems (ADS). LBE has some advantages that it is chemically inert compared to sodium and that its melting point is low like sodium. A problem might be that bismuth produces polonium, which is an alpha emitter, by irradiation of neutrons. The purpose of the study is to get information for quantitative estimations of the release of polonium on LBE cooled fast reactors and on ADSs by making it clear about production rate of polonium (information about cross section) by neutron irradiation of LBE, release rate of the produced polonium from LBE, and adsorption rate of the polonium on various materials. To get the information about production rate of polonium, neutron cross sections of bismuth were measured in keV energy region, which was important in fast reactors, by using the Pelletron accelerator in Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology. The obtained neutron capture cross sections were from 1/2 to 1/3 of the evaluated values in JENDL and the obtained polonium production cross sections were almost 1/3 of it. At the same time, an experimental device was designed for heating and adsorption experiments and the performance was tested. The performance of alpha spectrometer was tested also. By those the method was established for the measurement of polonium released from melted LBE after neutron irradiation. (author)

  6. Nuclear safety

    International Nuclear Information System (INIS)

    2014-01-01

    The Program on Nuclear Safety comprehends Radioprotection, Radioactive Waste Management and Nuclear Material Control. These activities are developed at the Nuclear Safety Directory. The Radioactive Waste Management Department (GRR) was formally created in 1983, to promote research and development, teaching and service activities in the field of radioactive waste. Its mission is to develop and employ technologies to manage safely the radioactive wastes generated at IPEN and at its customer’s facilities all over the country, in order to protect the health and the environment of today's and future generations. The Radioprotection Service (GRP) aims primarily to establish requirements for the protection of people, as workers, contractors, students, members of the general public and the environment from harmful effects of ionizing radiation. Furthermore, it also aims to establish the primary criteria for the safety of radiation sources at IPEN and planning and preparing for response to nuclear and radiological emergencies. The procedures about the management and the control of exposures to ionizing radiation are in compliance with national standards and international recommendations. Research related to the main activities is also performed. The Nuclear Material Control has been performed by the Safeguard Service team, which manages the accountability and the control of nuclear material at IPEN facilities and provides information related to these activities to ABACC and IAEA. (author)

  7. Nuclear safety

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2014-07-01

    The Program on Nuclear Safety comprehends Radioprotection, Radioactive Waste Management and Nuclear Material Control. These activities are developed at the Nuclear Safety Directory. The Radioactive Waste Management Department (GRR) was formally created in 1983, to promote research and development, teaching and service activities in the field of radioactive waste. Its mission is to develop and employ technologies to manage safely the radioactive wastes generated at IPEN and at its customer’s facilities all over the country, in order to protect the health and the environment of today's and future generations. The Radioprotection Service (GRP) aims primarily to establish requirements for the protection of people, as workers, contractors, students, members of the general public and the environment from harmful effects of ionizing radiation. Furthermore, it also aims to establish the primary criteria for the safety of radiation sources at IPEN and planning and preparing for response to nuclear and radiological emergencies. The procedures about the management and the control of exposures to ionizing radiation are in compliance with national standards and international recommendations. Research related to the main activities is also performed. The Nuclear Material Control has been performed by the Safeguard Service team, which manages the accountability and the control of nuclear material at IPEN facilities and provides information related to these activities to ABACC and IAEA. (author)

  8. Citrullination of NF-κB p65 promotes its nuclear localization and TLR-induced expression of IL-1β and TNFα.

    Science.gov (United States)

    Sun, Bo; Dwivedi, Nishant; Bechtel, Tyler J; Paulsen, Janet L; Muth, Aaron; Bawadekar, Mandar; Li, Gang; Thompson, Paul R; Shelef, Miriam A; Schiffer, Celia A; Weerapana, Eranthie; Ho, I-Cheng

    2017-06-09

    Many citrullinated proteins are known autoantigens in rheumatoid arthritis, a disease mediated by inflammatory cytokines, such as tumor necrosis factor-α (TNFα). Citrullinated proteins are generated by converting peptidylarginine to peptidylcitrulline, a process catalyzed by the peptidylarginine deiminases (PADs), including PAD1 to PAD4 and PAD6. Several major risk factors for rheumatoid arthritis are associated with heightened citrullination. However, the physiological role of citrullination in immune cells is poorly understood. We report that suppression of PAD activity attenuates Toll-like receptor-induced expression of interleukin-1β (IL-1β) and TNFα by neutrophils in vivo and in vitro but not their global transcription activity. Mechanistically, PAD4 directly citrullinates nuclear factor κB (NF-κB) p65 and enhances the interaction of p65 with importin α3, which brings p65 into the nucleus. The citrullination-enhanced interaction of p65 with importin α3 and its nuclear translocation and transcriptional activity can be attributed to citrullination of four arginine residues located in the Rel homology domain of p65. Furthermore, a rheumatoid arthritis-prone variant of PAD4, carrying three missense mutations, is more efficient in interacting with p65 and enhancing NF-κB activity. Together, these data not only demonstrate a critical role of citrullination in an NF-κB-dependent expression of IL-1β and TNFα but also provide a molecular mechanism by which heightened citrullination propagates inflammation in rheumatoid arthritis. Accordingly, attenuating p65-mediated production of IL-1β and TNFα by blocking the citrullination of p65 has great therapeutic potential in rheumatoid arthritis. Copyright © 2017, American Association for the Advancement of Science.

  9. A novel -192c/g mutation in the proximal P2 promoter of the hepatocyte nuclear factor-4 alpha gene (HNF4A) associates with late-onset diabetes

    DEFF Research Database (Denmark)

    Ek, Jakob; Hansen, Sara P; Lajer, Maria

    2006-01-01

    Recently, it has been shown that mutations in the P2 promoter of the hepatocyte nuclear factor (HNF)-4 alpha gene (HNF4A) cause maturity-onset diabetes of the young (MODY), while single nucleotide polymorphisms in this locus are associated with type 2 diabetes. In this study, we examined 1,189 bp...... of the P2 promoter and the associated exon 1D of HNF4A for variations associated with diabetes in 114 patients with type 2 diabetes, 72 MODYX probands, and 85 women with previous gestational diabetes mellitus. A -192c/g mutation was found in five patients. We screened 1,587 diabetic subjects and 4......,812 glucose-tolerant subjects for the -192c/g mutation and identified 5 diabetic and 1 glucose-tolerant mutation carriers (P=0.004). Examination of the families showed that carriers of the -192c/g mutation had a significantly impaired glucose-stimulated insulin release and lower levels of serum total...

  10. The Korean nuclear power program

    International Nuclear Information System (INIS)

    Choi, Chang Tong

    1996-01-01

    Although the world nuclear power industry may appear to be in decline, continued nuclear power demand in Korea indicates future opportunities for growth and prosperity in this country. Korea has one of the world's most vigorous nuclear power programs. Korea has been an active promoter of nuclear power generation since 1978, when the country introduced nuclear power as a source of electricity. Korea now takes pride in the outstanding performance of its nuclear power plants, and has established a grand nuclear power scheme. This paper is aimed at introducing the nuclear power program of Korea, including technological development, international cooperation, and CANDU status in Korea. (author). 2 tabs

  11. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  12. Trends in nuclear education

    International Nuclear Information System (INIS)

    Lartigue, J.; Martinez, T.

    2008-01-01

    Today's nuclear curricula have the purpose to fulfil labor requirements of the nuclear market, both power and applications, as well as keeping up the academic level required for research and development in nuclear sciences. This work analyses the power and applications markets and the situation of nuclear education in several countries, including Mexico, as well as collective efforts promoted by the International Atomic Energy Agency (IAEA) and other organizations. Conclusions are obtained about the status and trends in nuclear education, emphasizing the role of the academic and users sectors to fit the future demand and the availability of skilled personnel. (author)

  13. Nuclear power development: History and outlook

    International Nuclear Information System (INIS)

    Char, N.L.; Csik, B.J.

    1987-01-01

    The history of nuclear power development is briefly described (including the boosts from oil price shocks to the promotion of nuclear energy). The role of public opinion in relation to nuclear power is mentioned too, in particular in connection with accidents in nuclear plants. The recent trends in nuclear power development are described and the role of nuclear power is foreseen. Estimates of total and nuclear electrical generating capacity are made

  14. Hearings on nuclear deterrence

    International Nuclear Information System (INIS)

    Adam, Patricia; Tertrais, Bruno; Niquet, Valerie; Vilboux, Nicole; Kalika, Arnaud; Ravel, Luc; Korsia, Haim; Remy, Stephane; Arbi, Abdelkader; Bentegeat, Henri; Villiers, Pierre de; Norlain, Bernard; Mercier, Denis; Charaix, Patrick; Rogel, Bernard; Coriolis, Charles-edouard de; Boissier, Patrick; Bouvier, Antoine; Charmeau, Alain; Collet-Billon, Laurent; Ricketts, Peter; Collin, Jean-Marie; Bouveret, Patrice; Bigot, Bernard; Verwaerde, Daniel

    2014-01-01

    This report contains hearings of various French actors and experts (researchers, military chaplains, high-ranking officers, industrial executives, members of public military agencies, members of associations promoting non proliferation) on the issue of nuclear deterrence. Each of them states its point of view on nuclear deterrence, on strategic issues, on military issues, on philosophical issues, depending on their positions

  15. Nuclear safety research

    International Nuclear Information System (INIS)

    1999-01-01

    The NNSA checked and coordinated in 1999 the research project of the Surveillance Technology on Nuclear Installations under the National 9th-Five-Year Program to promote the organizations that undertake the research work on schedule and lay a foundation of obtaining achievements and effectiveness for the 9th-five-year plan on nuclear safety research

  16. Curcumin mediated suppression of nuclear factor-κB promotes chondrogenic differentiation of mesenchymal stem cells in a high-density co-culture microenvironment.

    Science.gov (United States)

    Buhrmann, Constanze; Mobasheri, Ali; Matis, Ulrike; Shakibaei, Mehdi

    2010-01-01

    Osteoarthritis (OA) and rheumatoid arthritis (RA) are characterised by joint inflammation and cartilage degradation. Although mesenchymal stem cell (MSC)-like progenitors are resident in the superficial zone of articular cartilage, damaged tissue does not possess the capacity for regeneration. The high levels of pro-inflammatory cytokines present in OA/RA joints may impede the chondrogenic differentiation of these progenitors. Interleukin (IL)-1β activates the transcription factor nuclear factor-κB (NF-κB), which in turn activates proteins involved in matrix degradation, inflammation and apoptosis. Curcumin is a phytochemical capable of inhibiting IL-1β-induced activation of NF-κB and expression of apoptotic and pro-inflammatory genes in chondrocytes. Therefore, the aim of the present study was to evaluate the influence of curcumin on IL-1β-induced NF-κB signalling pathway in MSCs during chondrogenic differentiation. MSCs were either cultured in a ratio of 1:1 with primary chondrocytes in high-density culture or cultured alone in monolayer with/without curcumin and/or IL-1β. We demonstrate that although curcumin alone does not have chondrogenic effects on MSCs, it inhibits IL-1β-induced activation of NF-κB, activation of caspase-3 and cyclooxygenase-2 in MSCs time and concentration dependently, as it does in chondrocytes. In IL-1β stimulated co-cultures, four-hour pre-treatment with curcumin significantly enhanced the production of collagen type II, cartilage specific proteoglycans (CSPGs), β1-integrin, as well as activating MAPKinase signaling and suppressing caspase-3 and cyclooxygenase-2. Curcumin treatment may help establish a microenvironment in which the effects of pro-inflammatory cytokines are antagonized, thus facilitating chondrogenesis of MSC-like progenitor cells in vivo. This strategy may support the regeneration of articular cartilage.

  17. Nuclear law - Nuclear safety

    International Nuclear Information System (INIS)

    Pontier, Jean-Marie; Roux, Emmanuel; Leger, Marc; Deguergue, Maryse; Vallar, Christian; Pissaloux, Jean-Luc; Bernie-Boissard, Catherine; Thireau, Veronique; Takahashi, Nobuyuki; Spencer, Mary; Zhang, Li; Park, Kyun Sung; Artus, J.C.

    2012-01-01

    This book contains the contributions presented during a one-day seminar. The authors propose a framework for a legal approach to nuclear safety, a discussion of the 2009/71/EURATOM directive which establishes a European framework for nuclear safety in nuclear installations, a comment on nuclear safety and environmental governance, a discussion of the relationship between citizenship and nuclear, some thoughts about the Nuclear Safety Authority, an overview of the situation regarding the safety in nuclear waste burying, a comment on the Nome law with respect to electricity price and nuclear safety, a comment on the legal consequences of the Fukushima accident on nuclear safety in the Japanese law, a presentation of the USA nuclear regulation, an overview of nuclear safety in China, and a discussion of nuclear safety in the medical sector

  18. Nuclear non-proliferation

    International Nuclear Information System (INIS)

    Anon.

    1984-01-01

    DOE's nuclear non-proliferation responsibilities are defined by the provisions of the Atomic Energy Act of 1954, as amended, and of the Nuclear Non-Proliferation Act of 1978 (NNPA). The Department's major responsibilities in this area are to: (1) provide technical assistance to the Department of State in negotiating agreements for civil cooperation in the peaceful uses of nuclear energy with other countries and international organizations; (2) join with other agencies to reach executive branch judgments with respect to the issuance of export licenses by the Nuclear Regulatory Commission; (3) be responsible for processing subsequent arrangements with other agencies as required by the Nuclear Non-Proliferation Act; (4) control the distribution of special nuclear materials, components, equipment, and nuclear technology exports; (5) participate in bilateral and multilateral cooperation with foreign governments and organizations to promote the peaceful uses of nuclear energy; and (6) act as a primary technical resource with respect to US participation in the International Atomic Energy Agency

  19. Nuclear operations dictionary

    International Nuclear Information System (INIS)

    1990-01-01

    In less than fifty years, a sophisticated technical language has developed worldwide around broad-ranging operations in the field of nuclear technology. In South Africa the need to adapt this new technical language in an orderly and acceptable manner for common use was identified. The aim of this dictionary is to promote the use of correct nuclear technology in both English and Afrikaans, and to aid in the translation of nuclear terms from English into Afrikaans

  20. Nuclear operations dictionary

    International Nuclear Information System (INIS)

    1990-01-01

    In less than fifty years, a sophisticated technical language has developed worldwide around broad-ranging operations in the field of nuclear technology. In South Africa the need to adapt this new technical language in an orderly and acceptable manner for common use was identified. The aim of this dictionary is to promote the use of correct nuclear terminology in both Afrikaans and English, and to aid in the translation of nuclear terms from Afrikaans into English

  1. Nuclear energy in Spain

    International Nuclear Information System (INIS)

    Villota, C. de

    2007-01-01

    Carlos Villota. Director of Nuclear Energy of UNESA gave an overview of the Spanish nuclear industry, the utility companies and the relevant institutions. Companies of the nuclear industry include firms that produce heavy components or equipment (ENSA), manufacturers of nuclear fuel (ENUSA), engineering companies, the National Company for Radioactive Waste Management (ENRESA), and nuclear power plants (nine units at seven sites). Nuclear energy is a significant component of the energy mix in Spain: 11% of all energy produced in Spain is of nuclear origin, whilst the share of nuclear energy in the total electricity generation is approximately 23%. The five main players of the energy sector that provide for the vast majority of electricity production, distribution, and supply have formed the Spanish Electricity Industry Association (UNESA). The latter carries out co-ordination, representation, management and promotion tasks for its members, as well as the protection of their business and professional interests. In the nuclear field, UNESA through its Nuclear Energy Committee co-ordinates aspects related to nuclear safety and radiological protection, regulation, NPP operation and R and D. Regarding the institutional framework of the nuclear industry, ENSA, ENUSA and ENRESA are controlled by the national government through the Ministry of Economy and Finance and the Ministry of Science and Technology. All companies of the nuclear industry are licensed by the Ministry of Industry, Tourism and Trade (MITYC), while the regulatory body is the Nuclear Safety Council (CSN). It is noteworthy that CSN is independent of the government, as it reports directly to Parliament. (author)

  2. Enlightenment on international cooperation for nuclear safety in China in light of Fukushima nuclear accident

    International Nuclear Information System (INIS)

    Fu Jie; Feng Yi; Luan Haiyan; Meng Yue; Zhang Ou

    2013-01-01

    This thesis elaborates on the impact of Fukushima nuclear accident on global nuclear power development and subsequent international activities carried out by major countries. It analyses significance of international cooperation in ensuring nuclear safety and promoting nuclear power development and makes some suggestions to further strengthen the international cooperation on nuclear safety in China. (authors)

  3. Nuclear Manpower Training

    International Nuclear Information System (INIS)

    Han, K. W.; Lee, H. Y.; Lee, E. J. and others

    2004-12-01

    Through the project on nuclear human resources development in 2004, the Nuclear Training Center of KAERI has provided various nuclear education and training courses for 1,962 persons from the domestic nuclear related organizations such as Government Agencies, nuclear industries, R and D institutes, universities, and public as well as from IAEA Member States. The NTC has developed education programs for master/doctorial course on advanced nuclear engineering in cooperation with the University of Science and Technology which was established in 2003. Additionally, nuclear education programs such as nuclear technical training courses for the promotion of cooperation with member countries, have developed during the project period. The center has also developed and conducted 7 training courses on nuclear related technology. In parallel, the center has produced 20 training materials including textbooks, 3 multi-media education materials, and 56 Video On Demand (VOD) cyber training materials. In order to promote international cooperation for human resources development, the NTC has implemented a sub-project on the establishment of a web-portal including database for the exchange of information and materials within the framework of ANENT. Also, the center has cooperated with FNCA member countries to establish a model of human resources development, as well as with member countries on bilateral cooperation bases to develop training programs. The International Nuclear Training and Education Center (INTEC), which was opened in 2002, has hosted 318 international and domestic events (training courses, conferences, workshops, etc.) during the project period

  4. Health promotion.

    Science.gov (United States)

    Miyake, S; Lucas-Miyake, M

    1989-01-01

    This article will describe a marketing model for the development of a role for occupational therapy in the industrial market. Health promotion activities are used as a means to diversify existing revenue bases by establishing new referral sources in industry. The technique of need satisfaction -selling or marketing one's services to a customer based on needs expressed by the customer - is reviewed, and implementation of this approach is described from two settings, one in psychiatry and the other in rehabilitation.

  5. 36th Brazilian Workshop on Nuclear Physics

    CERN Document Server

    Brandão de Oliveira, José Roberto; Barbosa Shorto, Julian Marco; Higa, Renato

    2014-01-01

    The Brazilian Workshop on Nuclear Physics (RTFNB, acronym in Portuguese) is organized annually by the Brazilian Physics Society since 1978, in order to: promote Nuclear Physics research in the country; stimulate and reinforce collaborations among nuclear physicists from around the country; disseminate advances in nuclear physics research and its applications; disseminate, disclose and evaluate the scientific production in this field.

  6. Nuclear Medicine

    Science.gov (United States)

    ... Parents/Teachers Resource Links for Students Glossary Nuclear Medicine What is nuclear medicine? What are radioactive tracers? ... funded researchers advancing nuclear medicine? What is nuclear medicine? Nuclear medicine is a medical specialty that uses ...

  7. Proliferation: does the peaceful use of nuclear energy have to lead to proliferation of nuclear weapons

    International Nuclear Information System (INIS)

    Muench, E.; Stein, G.

    The question of whether the proliferation of nuclear weapons is promoted by an increasing use of peaceful nuclear energy can be answered with a well-founded no. Even a regional renouncing of the peaceful use of nuclear energy would not reduce the worldwide problem of nuclear weapons' proliferation. Therefore, joint efforts must be aimed at promoting trust between peoples in the nuclear sphere and the political reasons for the proliferation of nuclear weapons must be reduced in order also to promote international harmony

  8. Nuclear safety. Seguranca nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Aveline, A [Rio Grande do Sul Univ., Porto Alegre, RS (Brazil). Inst. de Fisica

    1981-01-01

    What is nuclear safety Is there any technical way to reduce risks Is it possible to put them at reasonable levels Are there competitiveness and economic reliability to employ the nuclear energy by means of safety technics Looking for answers to these questions the author describes the sources of potential risks to nuclear reactors and tries to apply the answers to the Brazilian Nuclear Programme. (author).

  9. Perspectives for nuclear energy

    International Nuclear Information System (INIS)

    Baugnet, J.-M.; Abderrahim, H.A.; Dekeyser, J.; Meskens, G.

    1998-09-01

    In Belgium, approximately 60 percent of the produced electricity is generated by nuclear power. At present, nuclear power production tends to stagnate in Europe and North America but is still growing in Asia. The document gives an overview of the present status and the future energy demand with emphasis on electric power. Different evaluation criteria including factors hindering and factors promoting the expansion of nuclear power as well as requirements of new nuclear power plants are discussed. The extension of the lifetime of existing facilities as well as fuel supply are taken into consideration. A comparative assesment of nuclear power with other energy sources is made. The report concludes with estimating the contribution and the role of nuclear power in future energy demand as well as with an overview of future reactors and research and development programmes

  10. Invisible nuclear; converting nuclear

    International Nuclear Information System (INIS)

    Park, Jongmoon

    1993-03-01

    This book consists of 14 chapters which are CNN era and big science, from East and West to North and South, illusory nuclear strategy, UN and nuclear arms reduction, management of armaments, advent of petroleum period, the track of nuclear power generation, view of energy, internationalization of environment, the war over water in the Middle East, influence of radiation and an isotope technology transfer and transfer armament into civilian industry, the end of nuclear period and the nuclear Nonproliferation, national scientific and technological power and political organ and executive organ.

  11. Securing Chinese nuclear power development: further strengthening nuclear security

    International Nuclear Information System (INIS)

    Zhang Hui

    2014-01-01

    Chinese President Xi Jinping addresses China's new concept of nuclear security with four 'equal emphasis' at the third Nuclear Security Summit, and makes four commitments to strengthen nuclear security in the future. To convert President Xi's political commitments into practical, sustainable reality, China should take further steps to install a complete, reliable, and effective security system to ensure that all its nuclear materials and nuclear facilities are effectively protected against the full spectrum of plausible terrorist and criminal threats. This paper suggests the following measures be taken to improve China's existing nuclear security system, including updating and clarifying the requirements for a national level DBT; updating and enforcing existing regulations; further promoting nuclear security culture; balancing the costs of nuclear security, and further strengthening international cooperation on nuclear security. (author)

  12. Benefits of using nuclear energy

    International Nuclear Information System (INIS)

    Lira, Elda Vilaca

    2015-01-01

    The purpose of this work is to present, especially for high school students, the benefits of the use of nuclear energy, promoting a deeper knowledge of this technology, encouraging critical thinking of students and society around them

  13. Nuclear energy and information

    International Nuclear Information System (INIS)

    Chen Baisong

    1996-01-01

    The information tells us that since the first chain reaction discovery about 50 years ago up to now, there are more than 400 commercial nuclear power plants connected to electricity supply net works. The electricity supplied by nuclear power plants has exceeded 2000 TWH, which represents almost 17% of the total electricity generated in the world and this proportion is still increasing. The accumulated operating experience of nuclear power plants reach more than 6000 reactor-year. Quite high average life time energy availability factors demonstrate the good reliability of nuclear power plants. The present status of the electricity development in the world shows that nuclear power has become an imperative and exclusively realistic alternative energy source. All of these information demonstrate that nuclear power as a safe, clean and less cost power source has already been widely accepted in the world. In Asia and Pacific region, the fast development of economy provides a vast possibility for the development of nuclear power. In China, shortage of electricity has become the 'bottle neck' which retards the economic development nowadays. China has already drawn up the plan for the development of nuclear power. The information is of great significance to promote the development of nuclear power. It could be said that without information, nuclear power could not be smoothly introduced in any country or region. (J.P.N.)

  14. Nuclear power in Japan

    International Nuclear Information System (INIS)

    Kishida, J.

    1990-01-01

    The Japanese movement against nuclear energy reached a climax in its upsurge in 1988 two years after the Chernobyl accident. At the outset of that year, this trend was triggered by the government acknowledgement that the Tokyo market was open to foods contaminated by the fallout from Chernobyl. Anti-nuclear activists played an agitating role and many housewives were persuaded to join them. Among many public opinion surveys conducted at that time by newspapers and broadcasting networks, I would like to give you some figures of results from the poll carried out by NHK: Sixty percent of respondents said that nuclear power 'should be promoted', either 'vigorously' 7 or 'carefully' 53%). Sixty-six percent doubted the 'safety of nuclear power', describing it as either 'very dangerous' 20%) or 'rather dangerous' (46%). Only 27% said it was 'safe'. In other words, those who acknowledged the need for nuclear power were almost equal in number with those who found it dangerous. What should these figures be taken to mean? I would take note of the fact that nearly two-thirds of valid responses were in favor of nuclear power even at the time when public opinion reacted most strongly to the impact of the Chernobyl accident. This apparently indicates that the majority of the Japanese people are of the opinion that they would 'promote nuclear power though it is dangerous' or that they would 'promote it, but with the understanding that it is dangerous'. But the anti-nuclear movement is continuing. It remains a headache for both the government and the electric utilities. But we can regard the anti-nuclear movement in Japan as not so serious as that faced by other industrial nations

  15. Nuclear power in Japan

    Energy Technology Data Exchange (ETDEWEB)

    Kishida, J [Japan Research Institute, Ltd., Tokyo (Japan)

    1990-07-01

    The Japanese movement against nuclear energy reached a climax in its upsurge in 1988 two years after the Chernobyl accident. At the outset of that year, this trend was triggered by the government acknowledgement that the Tokyo market was open to foods contaminated by the fallout from Chernobyl. Anti-nuclear activists played an agitating role and many housewives were persuaded to join them. Among many public opinion surveys conducted at that time by newspapers and broadcasting networks, I would like to give you some figures of results from the poll carried out by NHK: Sixty percent of respondents said that nuclear power 'should be promoted', either 'vigorously' 7 or 'carefully' 53%). Sixty-six percent doubted the 'safety of nuclear power', describing it as either 'very dangerous' 20%) or 'rather dangerous' (46%). Only 27% said it was 'safe'. In other words, those who acknowledged the need for nuclear power were almost equal in number with those who found it dangerous. What should these figures be taken to mean? I would take note of the fact that nearly two-thirds of valid responses were in favor of nuclear power even at the time when public opinion reacted most strongly to the impact of the Chernobyl accident. This apparently indicates that the majority of the Japanese people are of the opinion that they would 'promote nuclear power though it is dangerous' or that they would 'promote it, but with the understanding that it is dangerous'. But the anti-nuclear movement is continuing. It remains a headache for both the government and the electric utilities. But we can regard the anti-nuclear movement in Japan as not so serious as that faced by other industrial nations.

  16. The spread of nuclear weapons among nations: militarization or development

    International Nuclear Information System (INIS)

    Khan, A.Q.

    1986-01-01

    The paper reviews nuclear proliferation among nations. Nuclear weapons promotion and proliferation are discussed, including both motivation and lack of motivation to manufacture nuclear weapons. The failure of the Non-Proliferation Treaty is examined with respect to vertical and horizontal proliferation, and the containment of horizontal proliferation. Risks of nuclear war by accident are outlined, as well as nuclear weapon development. (UK)

  17. [Nuclear theory

    International Nuclear Information System (INIS)

    Haxton, W.

    1990-01-01

    This report discusses research in nuclear physics. Topics covered in this paper are: symmetry principles; nuclear astrophysics; nuclear structure; quark-gluon plasma; quantum chromodynamics; symmetry breaking; nuclear deformation; and cold fusion

  18. Global nuclear safety culture

    International Nuclear Information System (INIS)

    1997-01-01

    As stated in the Nuclear Safety Review 1996, three components characterize the global nuclear safety culture infrastructure: (i) legally binding international agreements; (ii) non-binding common safety standards; and (iii) the application of safety standards. The IAEA has continued to foster the global nuclear safety culture by supporting intergovernmental collaborative efforts; it has facilitated extensive information exchange, promoted the drafting of international legal agreements and the development of common safety standards, and provided for the application of safety standards by organizing a wide variety of expert services

  19. ANSTO: Australian Nuclear Science and Technology Organization

    International Nuclear Information System (INIS)

    1989-01-01

    The Australian Nuclear Science and Technology Organization conducts or is engaged in collaborative research and development in the application of nuclear science and associated technology. Through its Australian radio-isotopes unit, it markets radioisotopes, their products and other services for nuclear medicine industry and research. It also operates national nuclear facilities ( HIFAR and Moata research reactors), promote training, provide advice and disseminates information on nuclear science and technology. The booklet briefly outlines these activities. ills

  20. Nuclear topics

    International Nuclear Information System (INIS)

    Lukner, C.

    1982-07-01

    The pamphlet touches on all aspects of nuclear energy, from the world energy demands and consumption, the energy program of the Federal Government, nuclear power plants in the world, nuclear fusion, nuclear liability up to the nuclear fuel cycle and the shutdown of nuclear power plants. (HSCH) [de

  1. The nuclear proliferation

    International Nuclear Information System (INIS)

    Gere, F.

    1995-04-01

    In this book is detailed the beginning of nuclear military power, with the first bomb of Hiroshima, the different ways of getting uranium 235 and plutonium 239, and how the first countries (Usa, Ussr, China, United kingdom, France) got nuclear weapons. Then the most important part is reviewed with the details of non-proliferation treaty and the creation of IAEA to promote civilian nuclear power in the world and to control the use of plutonium and uranium in nuclear power plants. The cases of countries who reached the atom mastery, such Israel, South Africa, Pakistan, Iraq, North Korea, Argentina, Brazil, Iran, Algeria, Taiwan and the reasons which they wanted nuclear weapon for or why they gave up, are exposed

  2. Nuclear power - the Hydra's head

    Energy Technology Data Exchange (ETDEWEB)

    Bunyard, P

    1986-01-01

    Following the accident at Chernobyl, the nuclear policies of many governments have been reconsidered and restated. Those in favour of nuclear power are those with highly centralised state bureaucracies, such as France and the USSR, where public opinion is disregarded. In more democratic countries, where referenda are held, such as Austria and Sweden, the people have chosen to do away with nuclear power. Indeed, the author states that nuclear power represents the State against the people, the State against democracy. Reference is made to the IAEA Reactor Safety Conference held in September, 1986, in Vienna, and the declaration sent to it by AntiAtom International. This called for the United Nations to promote the phasing out of nuclear power facilities throughout the world. It also called on the IAEA to support the phasing out of nuclear power and promote benign energy forms instead.

  3. Nuclear power - the Hydra's head

    International Nuclear Information System (INIS)

    Bunyard, Peter.

    1986-01-01

    Following the accident at Chernobyl, the nuclear policies of many governments have been reconsidered and restated. Those in favour of nuclear power are those with highly centralised state bureaucracies, such as France and the USSR, where public opinion is disregarded. In more democratic countries, where referenda are held, such as Austria and Sweden, the people have chosen to do away with nuclear power. Indeed, the author states that nuclear power represents the State against the people, the State against democracy. Reference is made to the IAEA Reactor Safety Conference held in September, 1986, in Vienna, and the declaration sent to it by AntiAtom International. This called for the United Nations to promote the phasing out of nuclear power facilities throughout the world. It also called on the IAEA to support the phasing out of nuclear power and promote benign energy forms instead. (UK)

  4. Nuclear power and nuclear weapons

    International Nuclear Information System (INIS)

    Vaughen, V.C.A.

    1983-01-01

    The proliferation of nuclear weapons and the expanded use of nuclear energy for the production of electricity and other peaceful uses are compared. The difference in technologies associated with nuclear weapons and nuclear power plants are described

  5. Kenyan Young Generation in Nuclear

    International Nuclear Information System (INIS)

    Chesori, R.

    2017-01-01

    KYGN Educates, informs, promotes and facilitate transfer of knowledge on peaceful, safe and secure uses of nuclear science and technology in Kenya. A network of young scientists and students with special interest in the nuclear science and allied fields. It is an affiliate of the IYNC whose membership is drawn from member states of United Nations

  6. A revival of nuclear power

    International Nuclear Information System (INIS)

    Lavernhe, Ch.; Chalifoux, B.

    1997-01-01

    Worldwide nuclear progress is suspended. The aim of this paper is to show the possibility and to determine the conditions of a new start-up. The goal is to promote a renewal of nuclear power in the new strategic context defined by the end of the 'cold war'. (J.S.)

  7. Nuclear power in the US

    International Nuclear Information System (INIS)

    Judson, Tim

    2018-01-01

    The Trump government promotes the further operation of aging nuclear power plants in the US by governmental support although several operators close their nuclear power plants due to economic reasons. The Trump government is also repowering the Yucca-Mountain-Project for radioactive waste disposal that was stopped by the Obama government based on geological problems in the region.

  8. Non Proliferation of Nuclear

    International Nuclear Information System (INIS)

    Bambang S Irawan

    2004-01-01

    Non-Proliferation Treaty of Nuclear Weapons is the international community's efforts to maintain the security of the world, in order to prevent the spread of nuclear technology and the use of nuclear weapons, promoting cooperation for the use of nuclear peaceful purposes, build mutual trust (Confidence Building Measures) as well as to achieve the ultimate goal of disarmament overall (General and Complete Disarmament). Addressing the post-WTC tragedy, 11 September 2001, the Indonesian government should set up a National Measures (National Action Plan), among others formed the National Security Council and NBC Counter Proliferation Unit, or the National Authority for Nuclear Treaty, preparing national legislation, to prevent the abuse nuclear materials for terrorist acts, prevent Illicit Trafficking of Nuclear materials, developed a National Preparedness and Emergency Response Management in the event of a nuclear accident or attack by the use of nuclear terrorism. Importance of a National Action Plan meant the existence of a national commitment in the context of compliance with treaties and conventions which have been ratified relating to safety, security, safeguards towards a general and complete disarmament, to safeguard national security and maintain peace (safeguards) international

  9. Nuclear rights - nuclear wrongs

    Energy Technology Data Exchange (ETDEWEB)

    Paul, E.F.; Miller, F.D.; Paul, J.; Ahrens, J.

    1986-01-01

    This book contains 11 selections. The titles are: Three Ways to Kill Innocent Bystanders: Some Conundrums Concerning the Morality of War; The International Defense of Liberty; Two Concepts of Deterrence; Nuclear Deterrence and Arms Control; Ethical Issues for the 1980s; The Moral Status of Nuclear Deterrent Threats; Optimal Deterrence; Morality and Paradoxical Deterrence; Immoral Risks: A Deontological Critique of Nuclear Deterrence; No War Without Dictatorship, No Peace Without Democracy: Foreign Policy as Domestic Politics; Marxism-Leninism and its Strategic Implications for the United States; Tocqueveille War.

  10. Nuclear moments

    CERN Document Server

    Kopferman, H; Massey, H S W

    1958-01-01

    Nuclear Moments focuses on the processes, methodologies, reactions, and transformations of molecules and atoms, including magnetic resonance and nuclear moments. The book first offers information on nuclear moments in free atoms and molecules, including theoretical foundations of hyperfine structure, isotope shift, spectra of diatomic molecules, and vector model of molecules. The manuscript then takes a look at nuclear moments in liquids and crystals. Discussions focus on nuclear paramagnetic and magnetic resonance and nuclear quadrupole resonance. The text discusses nuclear moments and nucl

  11. Asian collaboration on nuclear reaction data compilation

    International Nuclear Information System (INIS)

    Aikawa, Masayuki; Furutachi, Naoya; Kato, Kiyoshi; Makinaga, Ayano; Devi, Vidya; Ichinkhorloo, Dagvadorj; Odsuren, Myagmarjav; Tsubakihara, Kohsuke; Katayama, Toshiyuki; Otuka, Naohiko

    2013-01-01

    Nuclear reaction data are essential for research and development in nuclear engineering, radiation therapy, nuclear physics and astrophysics. Experimental data must be compiled in a database and be accessible to nuclear data users. One of the nuclear reaction databases is the EXFOR database maintained by the International Network of Nuclear Reaction Data Centres (NRDC) under the auspices of the International Atomic Energy Agency. Recently, collaboration among the Asian NRDC members is being further developed under the support of the Asia-Africa Science Platform Program of the Japan Society for the Promotion of Science. We report the activity for three years to develop the Asian collaboration on nuclear reaction data compilation. (author)

  12. A strategy study on international nuclear cooperation

    International Nuclear Information System (INIS)

    Chang, Hong Rae; Kim, Kyung Pyo; Kim, Young Min; Shin, Kyung Hye; Yoon, Sung Won; Lee, Myung Ho; Lee, Jong Hee; Hong Young Don

    1995-12-01

    The implementing methodologies suggested from this study cover the following: 1) strategies for the promotion of the nation's leading roles in such international organizations as the IAEA and OECD/NEA; 2) strategies for the implementation of national nuclear policy, positively coping with international nuclear trends; 3) strategies for the promotion of technical cooperation with the Russian Federation to introduce essential nuclear technology by utilizing its new environment of science and technology. 39 tabs., 28 figs., 64 refs. (Author)

  13. Public enlightment seminar on nuclear power. Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Yildirim, N

    1998-12-31

    The seminar considered different aspects of nuclear power development, including the following issues: electricity generation, power supply and demand, energy sources, consumption of electricity, energy outlook in Europe, comparative analysis of energy options, safety of modern nuclear power plants, radiation and human health, radioactive waste management, nuclear techniques to promote world food security, public information issues.

  14. 1976 compilation of national nuclear data committees

    International Nuclear Information System (INIS)

    1977-01-01

    This list of currently existing National Nuclear Data Committees, and their memberships, is published with the object of promoting the interaction and enhance the awareness of nuclear data activities in IAEA Member States. The following Member States have indicated the existence of a nuclear data committee in their countries: Bangladesh, Bolivia, Bulgaria, France, Hungary, India, Japan, Romania, Sweden, USSR, United Kingdom, USA, Yugoslavia

  15. Public enlightment seminar on nuclear power. Proceedings

    International Nuclear Information System (INIS)

    Yildirim, N.

    1997-01-01

    The seminar considered different aspects of nuclear power development, including the following issues: electricity generation, power supply and demand, energy sources, consumption of electricity, energy outlook in Europe, comparative analysis of energy options, safety of modern nuclear power plants, radiation and human health, radioactive waste management, nuclear techniques to promote world food security, public information issues

  16. Financing of nuclear trade. The brazilian experience

    International Nuclear Information System (INIS)

    Andrade Cavalcanti, C. de.

    1990-01-01

    The importance of financing instruments as means for the promotion of international nuclear trade is analysed. Besides the specific characteristics of nuclear trade is examined. Furthermore the role of governmental authorities and international agencies, mainly the IAEA is discussed. Finally the presence of Brazil in the international financial market and the financing of nuclear trade in Brazil are described [pt

  17. A mechanism for the promotion of technical co-operation among the countries of Latin America and the Caribbean in the field of the peaceful use of nuclear energy

    International Nuclear Information System (INIS)

    1998-03-01

    Day after day, in hospitals, industry, agricultural enterprises and universities all over the world, advantage is being taken of the peaceful uses of nuclear technology. In recent years, the Agency's regional technical co-operation projects have acquired considerable importance in Latin America and the Caribbean, particularly in such areas of common interest as nuclear information, radiation protection, human health, agriculture, hydrology, industry, and the maintenance and repair of nuclear instruments used for research purposes and related studies, to cite but a few examples. As a result, a group of Latin American countries decided to join forces to carry out specific technical co-operation projects aimed at raising the level of nuclear applications in the region. This effort culminated in the decision, made in 1984, to establish, under the auspices of the Agency, a regional co-operation programme called ARCAL. This document describes the ARCAL programme, participating countries and main results achieved

  18. Emerging nuclear suppliers in the Third World

    International Nuclear Information System (INIS)

    Stahl, K.

    1990-01-01

    The emergence of new supplier states of nuclear technology within the Third World has raised concern, if those nuclear supplier states will promote an unrestricted and uncontrolled transfer of nuclear technology to developing countries and augment the risk of nuclear weapons proliferation. The article analyses the nuclear export capacities, nuclear exports and the export policy of Argentina, Brazil and India. Argentina is considered as the most important emerging nuclear supplier state in the Third World. Nuclear exports have to be authorisized by the government in all three states and will be covered by IAEA-safeguards in the recipient country. The three states will exercise restraint in the transfer of sensitive nuclear technology. Nuclear exports of Argentina, Brazil and India so far will not augment the danger of nuclear weapons proliferation. (orig./HSCH) [de

  19. Physical Protection of Nuclear Safeguards Technology

    International Nuclear Information System (INIS)

    Hoskins, Richard

    2004-01-01

    IAEA's Nuclear Security Plan is established to assist Member States in implementing effective measures against nuclear terrorism. Four potential threats were identified: theft of nuclear weapon, nuclear explosive device, radiological dispersal device and an attack on radiation facility. In order to achieve effective protection of nuclear materials and facilities, the IAEA sponsored the Convention of the Physical Protection of Nuclear Materials which focuses on the protection of nuclear materials 'in international transport. The IAEA also promoted INFCIRC/255 entitled the Physical Protection of Nuclear Materials and Nuclear Facilities and published TECDOC/967 for the protection of nuclear materials and facilities against theft and sabotage and during transport. Assistance is available for the Member States through the International Physical Protection Advisory Service (IPPAS) and the International Nuclear Security Advisory Service (INSServ). (author)

  20. Nuclear energy in Korea

    International Nuclear Information System (INIS)

    Ahn, J.-H.

    2000-01-01

    The total electricity generated in 1998 was 215,300 GWh with 43,261 MWe of total installed capacity of electric power, while in 1978 when the first Nuclear Power Plant began operation it was 31,510 GWh with 6,916 MWe installed capacity. The share of nuclear power generation in 1998 increased up to 41.7%. Currently, 16 units of nuclear power are operating with an additional four units under construction. Nuclear power has contributed to enhancing energy security and supplying stable energy for Korea. The government's strong commitment to the nuclear power program together with a long-term national policy resulted in favorable conditions for KEPCO to manage the program and promote increasing levels of national participation in successive nuclear power projects. The role of nuclear power as a sustainable energy resource can not be emphasized enough with respect to global environmental issues. Increasing the share of nuclear power in the total installed capacity for electricity generation will undoubtedly play a very important role. (author)

  1. Nuclear education in Japanese universities

    International Nuclear Information System (INIS)

    Yamamuro, Nobuhiro

    1981-01-01

    In 1957, the graduate courses for nuclear engineering were established in Kyoto University, Osaka University and the Tokyo Institute of Technology. Since then, the expansion of nuclear education has kept pace with the growth of the nuclear industry in Japan. The nuclear education in universities in more than 20 years can be roughly divided into three periods. In the first period from 1955 to 1965, nuclear education began at undergraduate level, and the facilities required for the research and education were set up. The imported reactor began the commercial operation in 1966 for the first time, and during the period of high economic growth, the request by the nuclear industry was met by providing special studies in addition to the regular curriculum studies. The research committee on nuclear engineering education was formed, and in 1973, Japan-U.S. cooperative seminar on education program for nuclear engineering was held. The first ''oil crisis'' occurred in 1973, and the significance of nuclear power as an alternative to oil increased. But as nuclear power plants became bigger and increased, the safety and the effect on environment have been discussed. Also the research and development of nuclear fusion have been promoted. All these factors were reflected to the nuclear education in universities. The carricula in universities and the tasks and prospects in nuclear engineering education are described. (Kako, I.)

  2. Radionuclides for nuclear medicine: a nuclear physicists' view

    DEFF Research Database (Denmark)

    Cantone, M.; Haddad, F.; Harissopoulos, S.

    2013-01-01

    NuPECC (the Nuclear Physics European Collaboration Committee, an expert committee of the European Science Foundation) has the mission to strengthen European Collaboration in nuclear science through the promotion of nuclear physics and its trans-disciplinary use and application. NuPECC is currently...... working on a report on “Nuclear Physics for Medicine” and has set up a working group to review the present status and prospects of radionuclides for nuclear medicine. An interim report will be presented to seek comments and constructive input from EANM members. In particular it is investigated how nuclear...... physics Methods and nuclear physics facilities are supporting the development and supply of medical radionuclides and how this support could be further strengthened in future. Aspects that will be addressed: •In recent years, the reactor-based supply chain of 99Mo/99mTc generators was repeatedly...

  3. Dare nuclear energy with the Australian Nuclear Association

    International Nuclear Information System (INIS)

    Anon.

    2016-01-01

    Australian authorities have been traditionally opposed to nuclear energy. The interdiction to build nuclear power plants in the Australian states without the approval of the federal authority was even officially written in the environment code in 1999. Today coal provides 75% of the electricity needs of Australia. Because of climate warming, things are changing, the Australian government is now considering the possibility of using nuclear energy and a site located in southern Australian has been selected for the disposal of low and intermediate level radioactive wastes. In this context the Australian Nuclear Association (ANA) is developing an ambitious program for the promotion of all the applications of nuclear energy through the organisation of conferences and meetings with various experts of nuclear industry. The aim is to make the public aware of the assets of nuclear energy. (A.C.)

  4. US nuclear policy and business trend of Japan's nuclear industries

    International Nuclear Information System (INIS)

    Matsuo, Yuji

    2010-01-01

    As several countries in the east-Asia and middle-east area have been taking an increasing interest in the deployment of nuclear power generation, Japan's nuclear industries have promoted international business activities including the success in the bid of second nuclear power plants in Vietnam. While there are plans for more than thirty of new reactors in the US, the lifetime extension of existing aged reactors, development of non-existing natural gas and trend of greenhouse gases reduction measures have dampened these plans and probably most of new units will not start construction by 2030. This article reviewed the details of US's new nuclear power introduction, trend of recent government's policies, future perspective of nuclear power construction and business trend of Japan's nuclear industries. Japan's industries should be flexible regarding nuclear power as one option to realize low-carbon society. (T. Tanaka)

  5. International nuclear cooperation in Asia

    International Nuclear Information System (INIS)

    Lim, Yong-Kyu

    1987-01-01

    Nuclear power project traditionally involve huge financial investment, highly sophisticated technology, and long lead time. Many countries, particularly developing ones, find it impossible to implement their nuclear power programs without technical cooperation and assistance from advanced countries. In this Asia and Pacific Region, seven countries have commercial nuclear power units in operation and/or under construction. Korea has six nuclear power units in operation, and three under construction. Active nuclear cooperation has been instrumental in implementing her abmitious nuclear power programs successfully. Nuclear cooperation is one of the widely recognized necessities, which is quite often talked about among the countries of the Asia and Pacific Region. But the differences in nuclear maturity and national interests among those in the region seem to be standing against it. Given the constraints, it is not easy to select appropriate areas for cooperation. There is no doubt, however, that they should include the nuclear policy, nuclear safety, radwaste management, radiological protection, and the management of nuclear units. In order to effectively promote nuclear cooperation in the Region, the scope of RCA activities must be expanded to include the nuclear power area. The Regional Nuclear Data Bank, the Regional Training Center and the Nuclear Emergency Response Center, for example, would be the effective tools for cooperation to meet the demands of the countries in the Region. In view of the technological gap between Japan and all others in the region, we cannot speak of a regional nuclear cooperation without heavily counting on Japan, the most advanced nuclear state in the region. For these reasons, Japan is expected to share an increasing portion of her nuclear technology with others. (author)

  6. Nuclear Safety Review 2013

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-07-15

    The Nuclear Safety Review 2013 focuses on the dominant nuclear safety trends, issues and challenges in 2012. The Executive Overview provides crosscutting and worldwide nuclear safety information along with a summary of the major sections covered in this report. Sections A-E of this report cover improving radiation, transport and waste safety; strengthening safety in nuclear installations; improving regulatory infrastructure and effectiveness; enhancing emergency preparedness and response (EPR); and civil liability for nuclear damage. The Appendix provides details on the activities of the Commission on Safety Standards (CSS), and activities relevant to the IAEA Safety Standards. The world nuclear community has made noteworthy progress in strengthening nuclear safety in 2012, as promoted by the IAEA Action Plan on Nuclear Safety (hereinafter referred to as ''the Action Plan''). For example, an overwhelming majority of Member States with operating nuclear power plants (NPPs) have undertaken and essentially completed comprehensive safety reassessments ('stress tests') with the aim of evaluating the design and safety aspects of plant robustness to protect against extreme events, including: defence in depth, safety margins, cliff edge effects, multiple failures, and the prolonged loss of support systems. As a result, many have introduced additional safety measures including mitigation of station blackout. Moreover, the IAEA's peer review services and safety standards have been reviewed and strengthened where needed. Capacity building programmes have been built or improved, and EPR programmes have also been reviewed and improved. Furthermore, in 2012, the IAEA continued to share lessons learned from the Fukushima Daiichi accident with the nuclear community including through three international experts' meetings (IEMs) on reactor and spent fuel safety, communication in the event of a nuclear or radiological emergency, and protection against extreme earthquakes and tsunamis.

  7. Nuclear Safety Review 2013

    International Nuclear Information System (INIS)

    2013-07-01

    The Nuclear Safety Review 2013 focuses on the dominant nuclear safety trends, issues and challenges in 2012. The Executive Overview provides crosscutting and worldwide nuclear safety information along with a summary of the major sections covered in this report. Sections A-E of this report cover improving radiation, transport and waste safety; strengthening safety in nuclear installations; improving regulatory infrastructure and effectiveness; enhancing emergency preparedness and response (EPR); and civil liability for nuclear damage. The Appendix provides details on the activities of the Commission on Safety Standards (CSS), and activities relevant to the IAEA Safety Standards. The world nuclear community has made noteworthy progress in strengthening nuclear safety in 2012, as promoted by the IAEA Action Plan on Nuclear Safety (hereinafter referred to as ''the Action Plan''). For example, an overwhelming majority of Member States with operating nuclear power plants (NPPs) have undertaken and essentially completed comprehensive safety reassessments ('stress tests') with the aim of evaluating the design and safety aspects of plant robustness to protect against extreme events, including: defence in depth, safety margins, cliff edge effects, multiple failures, and the prolonged loss of support systems. As a result, many have introduced additional safety measures including mitigation of station blackout. Moreover, the IAEA's peer review services and safety standards have been reviewed and strengthened where needed. Capacity building programmes have been built or improved, and EPR programmes have also been reviewed and improved. Furthermore, in 2012, the IAEA continued to share lessons learned from the Fukushima Daiichi accident with the nuclear community including through three international experts' meetings (IEMs) on reactor and spent fuel safety, communication in the event of a nuclear or radiological emergency, and protection against extreme earthquakes and tsunamis

  8. Nuclear Manpower Training

    Energy Technology Data Exchange (ETDEWEB)

    Min, B. J.; Han, K. W.; Lee, H. Y. and others

    2006-01-15

    Through the project on nuclear human resources development in 2005, the Nuclear Training Center of KAERI has provided 67 nuclear education and training courses for 3,658 persons from the domestic nuclear related organizations such as Government Agencies, nuclear industries, R and D institutes, universities, and public as well as from IAEA Member States. In addition, 6 students (MS and Ph D.) have taken nuclear technology related courses offered by UST-KAERI. The project has developed 8 programs and 12 courses. They includes programs for IAEA training, bilateral education and training, and in-house training as well as courses dealing with maintenance of nuclear power plants and management of electricity generation, thermal-hydraulics nuclear hydrogen, nuclear safeguards, radiation emergency preparedness and etc. National and international cooperation has been promoted. For ANENT, test operation, data loading and revision of the web-portal have been undertaken. Also the web-portal operation system has been established. For FNCA, NTC has cooperated for the establishment of a model of human resource development and the exchange of information/materials. With WNU, the NTC has made an effort for hosting 2007 WNU Summer Institute. The infrastructure for nuclear education and training has been strengthened. Basic directions for providing the customers with better service, This includes showing kindness to the customer, renovation of the interior of training facilities, and upgrading of web-based management system for learning and using facilities of NTC. Other efforts have resulted in the publication of 25 course materials (10 for international courses and 15 for national courses), and the improvement of education and training equipment. The International Nuclear Training and Education Center (INTEC), which was opened in 2002, has hosted 296 international and domestic events in 2005.

  9. International Youth Nuclear Congress (IYNC)

    International Nuclear Information System (INIS)

    Janin, D.

    2017-01-01

    International Youth Nuclear Congress (IYNC) is the global network of a new generation of nuclear professionals to: Communicate the benefits of nuclear energy; Promote the peaceful use of nuclear science and technology; Facilitate knowledge transfer between generations; Provide a platform for networking. The benefits of IYNC's biannual congress maintain IYNC. Innovation for Nuclear: To propose and reward innovative ideas focused on nuclear technologies for a sustainable development; To support young energy in thinking innovative solutions. The congress is funded from sponsorship (between 1000 and 45,000 euros) and individual participant's registration fees (400 euros including meals, technical visit and networking events). Knowledge Transfer at IYNC congress involves Speakers: top managers and nuclear experts, Publication of technical papers, Face-to-face with keynote speakers and organising Workshops

  10. Nuclear power: safety and prospects

    International Nuclear Information System (INIS)

    Miniere, D.

    2012-01-01

    Despite the Fukushima accident new countries are willing to use nuclear power and as a nuclear accident somewhere is a nuclear accident everywhere, all countries are concerned with nuclear safety. A big association that would gather all the national Safety Authorities would be an efficient tool to promote and improve safety at the world scale and may be the unique available tool as no country would let a foreign authority to drive its own nuclear industry. An important lesson from Fukushima and Chernobyl accidents is that the signature of a big nuclear accident is not the number of casualties (it will always be limited) but the importance of the radioactive contamination. The question is how to make this long-term and long-range contamination impossible to happen, it is the mission of nuclear safety. (A.C.)

  11. Competitiveness of nuclear power generation

    International Nuclear Information System (INIS)

    Sumi, Yoshihiko

    1998-01-01

    In view of the various merits of nuclear power generation, Japanese electric utilities will continue to promote nuclear power generation. At the same time, however, it is essential to further enhance cost performance. Japanese electric utilities plan to reduce the cost of nuclear power generation, such as increasing the capacity factor, reducing operation and maintenance costs, and reducing construction costs. In Asia, nuclear power will also play an important role as a stable source of energy in the future. For those countries planning to newly introduce nuclear power, safety is the highest priority, and cost competitiveness is important. Moreover, financing will be an essential issue to be resolved. Japan is willing to support the establishment of nuclear power generation in Asia, through its experience and achievements. In doing this, support should not only be bilateral, but should include all nuclear nations around the Pacific rim in a multilateral support network. (author)

  12. Nuclear Option in Korea

    International Nuclear Information System (INIS)

    Han, K. I.

    2002-01-01

    With sixteen(16) operating nuclear units in Korea, the share of nuclear power generation reached 41% of the total electric power generation as of December 2000. A prediction is that it would further increase to 44.5% by year 2015 according to the national long term power development plan. Four units are currently under construction with 6 more units in order. With little domestic energy resource and increasing energy demand to support national economic growth, Korea has chosen nuclear power as one of the major energy sources to ensure stable power supply and to promote energy self-sufficiency. It has been recognized that nuclear power in Korea is not a selective option but rather a necessity. The Korean nuclear power development started with construction of a 600 MWe size reactor that was designed and constructed by foreign vendors. As the national grid capacity became larger, the size of nuclear units increased to 1000 MWe class. In the mean time, the need for nuclear technology self-reliance grew not only in operation and maintenance but also in construction, manufacturing and design. For this, a nuclear technology self-reliance program has been embarked with the support of the Government and utility, and the 1000 MWe class KSNP(Korean Standard Nuclear Power Plant) has been developed. The KSNPs are currently being designed, manufactured, constructed and operated by relevant Korean entities themselves. To fit into a larger capacity national grid and also to improve nuclear economic competitiveness, the 1400 MWe class KNGR(Korean Next Generation Reactor) design has been developed uprating the 1000 MWe KSNP design. Its construction project is currently under contract negotiation, and is planned to be finished by 2010. In the mean time, to be ready for future electric power market deregulation, the 600 MWe class small KSNP design is being developed downsizing the KSNP. A modular small size reactor, SMART(System Integrated Modular Advanced Reactor) is also being

  13. Nuclear battery materials and application of nuclear batteries

    International Nuclear Information System (INIS)

    Hao Shaochang; Lu Zhenming; Fu Xiaoming; Liang Tongxiang

    2006-01-01

    Nuclear battery has lots of advantages such as small volume, longevity, environal stability and so on, therefore, it was widely used in aerospace, deep-sea, polar region, heart pacemaker, micro-electromotor and other fields etc. The application of nuclear battery and the development of its materials promote each other. In this paper the development and the latest research progress of nuclear battery materials has been introduced from the view of radioisotope, electric energy conversion and encapsulation. And the current and potential applications of the nuclear battery are also summarized. (authors)

  14. Introduction to nuclear technology

    International Nuclear Information System (INIS)

    Goldsmith, M.W.

    1985-01-01

    In the late 1940s and early 1950s when nuclear technology emerged, there was no oil embargo or any obvious signs of an energy crisis. The driving forces for the rapid development of the atom were its fuel efficiency and its potential cost-effectiveness compared to its alternatives. Uranium was a cheap and abundant domestic fuel and the development of the technology provided new vistas and challenges for the engineering community. It was the goal of providing environmentally clean, abundant, and reasonably priced energy that motivated engineers then as now. Nuclear technology developed under a mixture of government regulation and promotion and utility industry commercialization. This paper discusses the development and implementation of a technology largely resulting from the efforts of government to make the production of nuclear-powered electricity a commercial enterprise. This effort has largely succeeded, as greater than 10% of the electricity generated nationally is now provided by nuclear power

  15. Nuclear plant safety

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    The four-member New York Power Pool Panel concluded that, for a number of reasons, no nuclear power plant in New York State is prone to the type of accident that occurred at Three Mile Island (TMI). The Panel further concluded that changes in operating practices, both regulatory and voluntary, and heightened sensitivity to reactor-core-cooling requirements will substantially reduce the chances for another such accident anywhere. Panel members found that New York State utilities have taken a responsible attitude with regard to requirements set forth by the Nuclear Regulatory Commission (NRC) as a result of the TMI accident. In a cover letter that accompanied the report to Federal and New York state officials, New York Power Pool Executive Committee Chairman Francis E. Drake, Jr. expressed hope that the report will alleviate public fears of nuclear reactors and promote wider acceptance of nuclear energy as an economic and safe means of power production. 17 references

  16. Nuclear Security Education in Morocco

    International Nuclear Information System (INIS)

    Hakam, O.K.

    2015-01-01

    Morocco has made significant progress in the field of nuclear security by supporting the efforts and activities of the International Atomic Energy Agency (IAEA), promoting nuclear security under international initiatives and continues to undertake actions aiming at strengthening capacity building in nuclear security. As well, Morocco has developed a new law on radiological and nuclear safety and security which was promulgated in 2014. Some Moroccan universities in cooperation with the IAEA-International Nuclear Security Education Network (INSEN) and the US-DoS Partnership for Nuclear Security (PNS) are working to develop their nuclear security educational programmes. In this regard, faculties who have been involved in INSEN Professional Development Courses (PDCs) have acquired a high-quality of knowledge and teaching tools in nuclear security topics that led them to be able to develop and teach their nuclear security curriculum as is the case at the University of Ibn Tofail. Furthermore, University of Ibn Tofail has developed in 2014 with collaboration with CRDFGlobal the first Institute of Nuclear Material Management (INMM) Student Chapter in Africa. This Chapter has organized many events to promote best practices among the young generation. Moreover, University of Ibn Tofail and Brandenburg University in Germany are working to develop a PDC on Nuclear IT/Cyber Security to be held in Kenitra, Morocco. This PDC aims at building capacity among the academic communities from Africa and MENA Region in order to further raise awareness, develop and disseminate best practices, increase professional standards and therefore enhance nuclear security culture. So, this paper will present some nuclear security education activities in Morocco and more specifically at the University of Ibn Tofail. These activities involve women as leaders but also contribute in education and training of young generation of women in nuclear field. (author)

  17. Nuclear power

    International Nuclear Information System (INIS)

    Abd Khalik Wood

    2005-01-01

    This chapter discussed the following topics related to the nuclear power: nuclear reactions, nuclear reactors and its components - reactor fuel, fuel assembly, moderator, control system, coolants. The topics titled nuclear fuel cycle following subtopics are covered: , mining and milling, tailings, enrichment, fuel fabrication, reactor operations, radioactive waste and fuel reprocessing. Special topic on types of nuclear reactor highlighted the reactors for research, training, production, material testing and quite detail on reactors for electricity generation. Other related topics are also discussed: sustainability of nuclear power, renewable nuclear fuel, human capital, environmental friendly, emission free, impacts on global warming and air pollution, conservation and preservation, and future prospect of nuclear power

  18. Integrated engineering system for nuclear facilities building

    International Nuclear Information System (INIS)

    Tomura, H.; Miyamoto, A.; Futami, F.; Yasuda, S.; Ohtomo, T.

    1995-01-01

    In the construction of buildings for nuclear facilities in Japan, construction companies are generally in charge of the building engineering work, coordinating with plant engineering. An integrated system for buildings (PROMOTE: PROductive MOdeling system for Total nuclear Engineering) described here is a building engineering system including the entire life cycle of buildings for nuclear facilities. A Three-dimensional (3D) building model (PRO-model) is to be in the core of the system (PROMOTE). Data sharing in the PROMOTE is also done with plant engineering systems. By providing these basic technical foundations, PROMOTE is oriented toward offering rational, highquality engineering for the projects. The aim of the system is to provide a technical foundation in building engineering. This paper discusses the characteristics of buildings for nuclear facilities and the outline of the PROMOTE. (author)

  19. The physicians and the nuclear war

    International Nuclear Information System (INIS)

    Arruda, W.O.

    1985-01-01

    This paper shows that a lot of physicians in the world are worried about a new nuclear war and they created the International Physicians for Prevention of Nuclear War. The main objectives of the IPPNNW are to amplify the public or people knowledge of the medical aspects of the nuclear war and promote and coordinate researches about the medical and psychological effects of the nuclear weapon race. (author)

  20. Nuclear Safety and Security Culture Within the Regulatory Body in Romania

    International Nuclear Information System (INIS)

    Tronea, M.

    2016-01-01

    The paper (poster) presents the activities implemented in the Nuclear Fuel Cycle Division of CNCAN (National Commission for Nuclear Activities Control) for promoting nuclear safety and security culture. (author)

  1. White paper on nuclear safety in 2005

    International Nuclear Information System (INIS)

    2006-04-01

    The white paper consists of four parts. The first part described the outline of international discussions on safety culture and activities promoted by utilities and regulatory bodies in Japan. The second part explained the main activities of the Nuclear Safety Commission of Japan and nuclear regulatory authorities on nuclear safety regulation. The third part introduced various activities for ensuring overall nuclear safety in Japan, such as safety regulation systems for nuclear facilities, disaster measures at nuclear facilities, progress in nuclear research, nuclear safety regulation by risk-informed utilization, environmental radiation surveys, international cooperation on nuclear safety. The forth part contained various materials and data related to the Nuclear Safety Commission of Japan. (J.P.N.)

  2. Nuclear technology options

    International Nuclear Information System (INIS)

    Salvatores, Massimo

    2013-01-01

    Different strategies and motivations in different countries have led to diverse options. In Europe the SNETP (Sustainable Nuclear Energy Technology Platform) has the objective of developing R&D supporting GEN-II (present) and GEN-III nuclear systems under development; allowing sustainability and minimisation of waste burden, promoting advanced Gen-IV Fast Reactors; and accounting for a Nuclear Cogeneration Industrial Initiative. A remarkable initiative in the USA has been the promotion of small modular reactors (SMRs) – at less than 300 MWe in capacity, much smaller than typical reactors – which can be an ideal choice for (remote) areas which cannot support a larger reactor. Compact scalable design offers a host of potential safety, construction and economic benefits. More “upbeat” strategies are expected in other areas of the world where significant increase in nuclear energy demand is predicted in the next decades. If this growth materialises, future fuel cycles characteristics, feasibility and acceptability will be crucial. This paper will discuss different scenarios for future fuel cycles, resources optimisation and/or waste minimization, the range from full fast reactor deployment to phase-out, management of spent nuclear fuel and the significant potential benefits of advanced cycles. The next 45 years will be dominated by deployment of standard large or medium size plants operating for 60 years. Available resources do allow it. However, fuel cycle will be a growing and most challenging issue and early assessments will be needed for public acceptance and policy decisions.

  3. General overview of nuclear activities in Morocco

    International Nuclear Information System (INIS)

    Karouani, K.

    1998-01-01

    Nuclear activities have been introduced in Morocco since the early seventies. These activities concern the utilization of nuclear techniques in medicine, food and agriculture as well as training and research in nuclear physics. In 1984, Morocco decided to undertake a technical and economic feasibility study as well as the site study of the first nuclear power plant. Two years after, he decided to create the ''Centre National de l'Energie des Sciences et des Techniques Nucleaires'' as a technical and research support for the nuclear power program and as a promoting institute of nuclear techniques. Obviously, he also decided to set up a regulatory framework. (author)

  4. Nuclear science

    International Nuclear Information System (INIS)

    1989-01-01

    This fact sheet answers specific questions about the Department of Energy's possible acquisition and conversion of a partially completed commercial nuclear power plant to a nuclear materials production facility. The nuclear power plant is the Washington Nuclear Plant number sign 1 owned by the Washington Public Power Supply System and is located on DOE's Hanford Reservation near Richland, Washington

  5. Nuclear science

    International Nuclear Information System (INIS)

    1989-04-01

    This report answers questions about the Department of Energy's possible acquisition and conversion of a partially completed commercial nuclear power plant to a nuclear materials production facility. The nuclear power plant is the Washington Nuclear Plant No.1 owned by the Washington Public Power Supply System and is located on DOE's Hanford Reservation near Richland, Washington

  6. Nuclear medicine

    International Nuclear Information System (INIS)

    Lentle, B.C.

    1986-01-01

    Several growth areas for nuclear medicine were defined. Among them were: cardiac nuclear medicine, neuro-psychiatric nuclear medicine, and cancer diagnosis through direct tumor imaging. A powerful new tool, Positron Emission Tomography (PET) was lauded as the impetus for new developments in nuclear medicine. The political environment (funding, degree of autonomy) was discussed, as were the economic and scientific environments

  7. Nuclear option

    Energy Technology Data Exchange (ETDEWEB)

    Kemm, K R

    1978-05-01

    The global outlook is that nuclear reactors are here to stay and South Africa has already entered the nuclear power stakes. This article discusses the rocketing oil prices, and the alternatives that can be used in power generation, the good safety record of the nuclear industry and the effect that South Africa's first nuclear power station should have on the environment.

  8. Nuclear resisters

    International Nuclear Information System (INIS)

    1981-01-01

    The booklet contains six papers by different authors, under the headings: dangers along the nuclear fuel cycle; the nuclear profiteers; the nuclear state is a police state; a non-disposable future (renewable energy sources, energy conservation); nuclear weapons - out of control; man made madness. (U.K.)

  9. A project in support of Nuclear Technology Cooperation

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Ki Jung; Choi, Pyong Hoon; Yi, Ji Ho [and others

    2005-12-15

    Establish the integrated management system of information resources and to automate business flow and to improve business productivity through efficient information sharing. - Promotion of domestic nuclear energy technology by utilizing nuclear energy informations and computer software developed in the advanced countries. - Establish strategies of international cooperation in an effort to promote our nation's Leading role in international society, to form the foundation for the effective transfer of nuclear technology to developing countries, and to cope with the rapidly changing international nuclear climate.

  10. A project in support of Nuclear Technology Cooperation

    International Nuclear Information System (INIS)

    Jung, Ki Jung; Choi, Pyong Hoon; Yi, Ji Ho

    2005-12-01

    Establish the integrated management system of information resources and to automate business flow and to improve business productivity through efficient information sharing. - Promotion of domestic nuclear energy technology by utilizing nuclear energy informations and computer software developed in the advanced countries. - Establish strategies of international cooperation in an effort to promote our nation's Leading role in international society, to form the foundation for the effective transfer of nuclear technology to developing countries, and to cope with the rapidly changing international nuclear climate

  11. Nuclear links

    International Nuclear Information System (INIS)

    1981-01-01

    The subject is dealt with in sections: introduction; energy and the third world; world energy consumption 1978; oil -the energy dilemma; nuclear chains - introduction; uranium; Namibia; enrichment and reprocessing; countries with enrichment and reprocessing facilities; waste; conclusion; why take the nuclear option; third world countries with nuclear reactors; the arms connection; government spending and human resources 1977 (by countries); nuclear power - the final solution; the fascists; world bank; campaigns; community action in Plogoff; Australian labour movement; NUM against nuclear power; Scottish campaign; students against nuclear energy; anti-nuclear campaign; partizans; 3W1 disarmament and development; campaign ATOM; CANUC; 3W1; SANE. (U.K.)

  12. What Is a Promotion?

    Science.gov (United States)

    Pergamit, Michael R.; Veum, Jonathan R.

    1999-01-01

    For a sample of young workers, "promotion" involved no change in position or duties; promotion was more likely for males than females and Whites than Blacks or Hispanics. Company training and prior promotions were important predictors. Promotion did not appear to have a direct impact on job satisfaction. (SK)

  13. Position paper on nuclear proliferation issues preventing nuclear proliferation. A duty for the nuclear community

    Energy Technology Data Exchange (ETDEWEB)

    Goldschmidt, Pierre; Bonin, Bernard [ENS High Scientific Council, Brussels (Belgium)

    2010-06-15

    The production of electricity from nuclear power plants is widely seen today as having an increasing role to play in meeting global energy requirements in a sustainable manner. Conscious of the inherently sensitive nature of nuclear technology and materials the ENS-HSC (European Nuclear Society - High Scientific Council) is well aware that a severe safety, security, environmental or proliferation mishap stemming from nuclear energy anywhere in the world would undermine the potential for nuclear energy to contribute to the global energy supply and the minimization of harmful carbon emissions. While the safety of nuclear power plants has continuously improved over the last three decades, the same degree of success cannot be claimed when it comes to the achievements of the international community in stemming the risk of nuclear weapons proliferation. This unfortunate situation is due to both technical and political reasons. The European nuclear industry is committed to the exclusively peaceful use of nuclear energy and to export nuclear facilities and related materials, equipment and technology solely in accordance with relevant national export laws and regulations, Nuclear Suppliers Group guidelines and pertinent United Nations Security Council Resolutions. The ENS-HSC considers that, as a manifestation of their strong commitment to nonproliferation, it is important for the nuclear industry to pay special attention to and promote proliferation-resistant designs and to take IAEA safeguards requirements into account at the design stage. Preventing nuclear proliferation is primarily the responsibility of states but, as major stakeholders, the nuclear industry and scientific community should actively support nuclear disarmament as foreseen in the Non-Proliferation Treaty and measures necessary to strengthen the non-proliferation regime, particularly the international control of the flux of nuclear material and technology. (orig.)

  14. Position paper on nuclear proliferation issues preventing nuclear proliferation. A duty for the nuclear community

    International Nuclear Information System (INIS)

    Goldschmidt, Pierre; Bonin, Bernard

    2010-01-01

    The production of electricity from nuclear power plants is widely seen today as having an increasing role to play in meeting global energy requirements in a sustainable manner. Conscious of the inherently sensitive nature of nuclear technology and materials the ENS-HSC (European Nuclear Society - High Scientific Council) is well aware that a severe safety, security, environmental or proliferation mishap stemming from nuclear energy anywhere in the world would undermine the potential for nuclear energy to contribute to the global energy supply and the minimization of harmful carbon emissions. While the safety of nuclear power plants has continuously improved over the last three decades, the same degree of success cannot be claimed when it comes to the achievements of the international community in stemming the risk of nuclear weapons proliferation. This unfortunate situation is due to both technical and political reasons. The European nuclear industry is committed to the exclusively peaceful use of nuclear energy and to export nuclear facilities and related materials, equipment and technology solely in accordance with relevant national export laws and regulations, Nuclear Suppliers Group guidelines and pertinent United Nations Security Council Resolutions. The ENS-HSC considers that, as a manifestation of their strong commitment to nonproliferation, it is important for the nuclear industry to pay special attention to and promote proliferation-resistant designs and to take IAEA safeguards requirements into account at the design stage. Preventing nuclear proliferation is primarily the responsibility of states but, as major stakeholders, the nuclear industry and scientific community should actively support nuclear disarmament as foreseen in the Non-Proliferation Treaty and measures necessary to strengthen the non-proliferation regime, particularly the international control of the flux of nuclear material and technology. (orig.)

  15. Nuclear exports and international cooperation

    International Nuclear Information System (INIS)

    McCardle, J.J.

    1981-06-01

    Canada's nuclear export policy together with its non-proliferation and safeguards policy embrace both the country's desire to promote international cooperation in the peaceful uses of nuclear energy and its effort to minimize the risk of further proliferation of nuclear weapons. This policy reflects the belief that only if Canadian parliamentary and public opinion can be convinced that Canada's nuclear exports will not contribute to nuclear proliferation will the long-term health of the country's nuclear industry be assured. Canada requires a political commitment to non-proliferation from its nuclear partners, and looks to the IAEA to administer safeguards on nuclear material of Canadian origin to guarantee that commitment. Agreements reached with its nuclear partners are in accordance with provisions of the non-proliferation treaty and include a contingency provision for fall-back safeguards if the other state should withdraw from the NPT. Provision is made for mutual agreement on reprocessing and enrichment of nuclear material. Agreements have been reached with some twenty nuclear partners, and efforts are continuing to come to new international understanding on reprocessing, enrichment, and plutonium storage

  16. Nuclear power. The Windscale controversy

    International Nuclear Information System (INIS)

    Boyle, G.

    1978-01-01

    The aims of this unit are: (1) to provide a basic understanding of nuclear technology and of the associated technical and environmental problems; (2) to provide an understanding of: (a) the historical growth of the nuclear industry; (b) the arguments for the continued development of nuclear power, and the institutions promoting that development; (3) to provide a basic understanding of the mechanisms and institutions which officially regulate the nuclear power programme in the UK; (4) to provide an understanding of the main issues - technical, economic, social and political - involved in the controversy over the proposed expansion of British Nuclear Fuels Ltd's reprocessing facilities at Windscale, and the events leading up to the Public Inquiry on the proposal which began in June 1977; and (5) to examine (a) the reason for the growth in opposition to nuclear power in various countries and the different approaches taken by the opposition groups; (b) the political impact and effectiveness of that opposition. (author)

  17. National Nuclear Technology Map Development

    International Nuclear Information System (INIS)

    Shin, J. I.; Lee, T. J.; Yoon, S. W.

    2005-03-01

    The objective of NuTRM is to prepare a plan of nuclear R and D and technological innovations which is very likely to make nuclear technology a promising power source for future national developments. The NuTRM finds out systematically the nuclear R and D vision and the high-value-added strategic technologies to be developed by the efficient cooperation of actors including government, industry, academy and research institute by 2020. In other words, NuTRM aims at a long-term strategic planning of nuclear R and D and technological innovation in order to promote the socio-economic contributions of nuclear science and technology for the nation's future competitiveness and sustainable development and to raise the global status of the Korean nuclear R and D and Industry

  18. Nuclear agricultural sciences in China

    International Nuclear Information System (INIS)

    Xu Bujin

    2004-01-01

    Nuclear technique is a powerful scientific tool in agricultural research, an area with fruitful achievements in China. Nuclear technique application in agriculture based on the development of related science and technology is of a high technical area, and also a meaningful aspect of non-electrical power application of nuclear technique. Nuclear Agricultural Sciences is an important component of agricultural science and technology, and has been made a lot of significant achievements, which has made remarkable contribution to the development in economy, society and ecology of China. This article reviews the achievements and present situation of Nuclear Agricultural Sciences in China briefly. For promoting its development, the author strongly suggests that Chinese government bodies should put more attention to the study on the application of nuclear technique in agriculture to make further more contributions to Chinese society and agriculture. (authors)

  19. Sustainable development and nuclear power

    International Nuclear Information System (INIS)

    Grimston, M.C.

    1994-01-01

    The United Kingdom Government's strategy aimed at securing sustainable development has recently been published, and is analysed here by the Energy Issues Adviser, for the British Nuclear Industry Forum. The energy framework aims to ensure secure supplies of energy at competitive prices and to minimise possible adverse environmental impacts of energy use. It is argued here that both of these aims will be promoted by the continued and growing use of nuclear power in the United Kingdom. As the cost of nuclear electricity depends chiefly on the price of uranium, which is likely to stabilize due to increased supplies from nuclear weapons destruction, uranium recycling and mixed oxide fuel reprocessing, it is unlikely that world fuel price inflation will affect these costs. Secondly, nuclear power is not associated with acid rain or the threat of global warming, so its environment protection claims can be substantiated. Indeed, unlike other fuel sources, nuclear power already pays for its waste and decommissioning procedures. (UK)

  20. Rewriting Germany's nuclear law

    International Nuclear Information System (INIS)

    Roser, T.

    1992-01-01

    In Germany, the private use of nuclear energy for peaceful uses is strictly regulated by a Nuclear Energy Act. Since its enactment back in 1959, this legislation has been overhauled five times - most recently in 1985. Now Klaus Toepfer, Germany's Federal Minister for the Environment, Protection of Nature, and Nuclear Safety, has set out to revise the Act for the sixth time. The present draft bill is intended to reorganise the back end of the nuclear fuel cycle; eliminate public promotion of nuclear power; clarify points of legal dispute. Of the draft bill's three aims, the last two are more parochial. The real novelty lies in the changes to the rules for the back end of the fuel cycle. First, the Federal Government proposes to abandon the priority given to spent fuel recycling. In future, direct disposal will be an equivalent option, and waste avoidance will have top priority. Intimately linked to the back end proposal is the Government's plan to load on the shoulders of nuclear operators the full responsibility for building and operating repositories for the final disposal of nuclear waste. The third aspect of Government's back end plans concerns decommissioning. At present, operators accumulate provisions over the plant lifetime, which for that purpose is estimated at 19 years. The provisions vary from plant to plant but are generally around DM1 billion and are tax free. Under the proposed regulations, this sum must be available from the first day of operation to cover the case of an early shutdown. In practice, this will increase the initial investment for a nuclear power plant in Germany by 10-20% and so make nuclear power less competitive. (author)

  1. Principles for enhancing professionalism of nuclear personnel

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-03-01

    The management principles in this publication were developed by a committee of senior utility officials with assistance by the staff of the Institute of Nuclear Power Operations (INPO) and with input from virtually all U.S. nuclear utilities. The principles are aimed at creating an environment within a nuclear power plant that promotes a healthy respect for the unique technology that nuclear electric power represents and, thus, to promote great care and conservative, thoughtful decision-making by the nuclear plant staff. The scope of the principles includes all nuclear personnel and gives guidance in the selection and development of management and supervisory personnel and other key individuals in the areas of operations, maintenance, technical support and engineering. Utility managers are encouraged to make in-depth comparisons between these principles and their day-to-day policies and practices, and to use such efforts as opportunities to communicate their organization's management philosophy to all nuclear personnel.

  2. Nuclear energy for the 21. century

    International Nuclear Information System (INIS)

    2005-03-01

    This document gathers 5 introductory papers to this conference about nuclear energy for the 21. century: the French energy policy during the last 30 years (situation of France with respect to the energy supply and demand, main trends of the French energy policy, future of the French nuclear policy); presentation of IAEA (technology transfer, nuclear safety, non-proliferation policy, structure and financial resources, council of governors, general conference, secretariat); nuclear power and sustainable development; promoting safety at nuclear facilities (promoting safety, basics of safety, safety at the design stage, risk management, regulatory control and efficiency of the regulation organization, role of IAEA); nuclear energy today (contribution to sustainable development, safety, best solution for the management of radioactive wastes, future of nuclear energy). (J.S.)

  3. Principles for enhancing professionalism of nuclear personnel

    International Nuclear Information System (INIS)

    1989-01-01

    The management principles in this publication were developed by a committee of senior utility officials with assistance by the staff of the Institute of Nuclear Power Operations (INPO) and with input from virtually all U.S. nuclear utilities. The principles are aimed at creating an environment within a nuclear power plant that promotes a healthy respect for the unique technology that nuclear electric power represents and, thus, to promote great care and conservative, thoughtful decision-making by the nuclear plant staff. The scope of the principles includes all nuclear personnel and gives guidance in the selection and development of management and supervisory personnel and other key individuals in the areas of operations, maintenance, technical support and engineering. Utility managers are encouraged to make in-depth comparisons between these principles and their day-to-day policies and practices, and to use such efforts as opportunities to communicate their organization's management philosophy to all nuclear personnel

  4. Developing nuclear law

    International Nuclear Information System (INIS)

    1968-01-01

    Many aspects of nuclear energy pose special problems for the lawmakers because of the unusual materials and processes involved. Much of it calls for international agreements to protect people, to guard against military exploitation of peaceful work, to promote trade in the new industry, to increase collaboration and to encourage new projects. Mr. Werner Boulanger, Director of the IAEA Legal Division, here indicates the part played by the Agency and other international organizations in securing compatibility of legislation. (author)

  5. Perceptions of health promoters about health promotion ...

    African Journals Online (AJOL)

    2013-02-11

    Feb 11, 2013 ... regarding a health promotion programme for families with ... to contribute to high rates of not going to school (ibid. ... sector in order, amongst other objectives, to prevent health ... exercise and mental health promotion must be incorporated ..... (2009:141) identified ignorance and misconception about the.

  6. International nuclear material safeguards

    International Nuclear Information System (INIS)

    Syed Azmi Syed Ali

    1985-01-01

    History can be a very dull subject if it relates to events which have long since lost their relevance. The factors which led to the creation of the International Atomic Energy Agency (IAEA), however, are as important and relevant today as they were when the Agency was first created. Without understanding these factors it is impossible to realise how important the Agency is in the present world or to understand some of the controversies surrounding its future. Central to these controversies is the question of how best to promote the international transfer of nuclear technology without contributing further to the problem of proliferating nuclear explosives or explosive capabilities. One effective means is to subject nuclear materials (see accompanying article in box), which forms the basic link between the manufacture of nuclear explosives and nuclear power generation, to international safeguards. This was realized very early in the development of nuclear power and was given greater emphasis following the deployment of the first two atomic bombs towards the end of World War II. (author)

  7. Nuclear Power

    International Nuclear Information System (INIS)

    Douglas-Hamilton, J.; Home Robertson, J.; Beith, A.J.

    1987-01-01

    In this debate the Government's policy on nuclear power is discussed. Government policy is that nuclear power is the safest and cleanest way of generating electricity and is cheap. Other political parties who do not endorse a nuclear energy policy are considered not to be acting in the people's best interests. The debate ranged over the risks from nuclear power, the UK safety record, safety regulations, and the environmental effects of nuclear power. The Torness nuclear power plant was mentioned specifically. The energy policy of the opposition parties is strongly criticised. The debate lasted just over an hour and is reported verbatim. (UK)

  8. Nuclear Safety Review for 2014

    International Nuclear Information System (INIS)

    2014-07-01

    The Nuclear Safety Review 2014 focuses on the dominant nuclear safety trends, issues and challenges in 2013. The Executive Overview provides general nuclear safety information along with a summary of the major issues covered in this report: strengthening safety in nuclear installations; improving radiation, transport and waste safety; enhancing emergency preparedness and response (EPR); improving regulatory infrastructure and effectiveness; and strengthening civil liability for nuclear damage. The Appendix provides details on the activities of the Commission on Safety Standards, and activities relevant to the Agency’s safety standards. The global nuclear community has made steady and continuous progress in strengthening nuclear safety in 2013, as promoted by the IAEA Action Plan on Nuclear Safety (hereinafter referred to as “the Action Plan”) and reported in Progress in the Implementation of the IAEA Action Plan on Nuclear Safety (document GOV/INF/2013/8-GC(57)/INF/5), and the Supplementary Information to that report and Progress in the Implementation of the IAEA Action Plan on Nuclear Safety (document GOV/INF/2014/2). • Significant progress continues to be made in several key areas, such as assessments of safety vulnerabilities of nuclear power plants (NPPs), strengthening of the Agency’s peer review services, improvements in EPR capabilities, strengthening and maintaining capacity building, and protecting people and the environment from ionizing radiation. The progress that has been made in these and other areas has contributed to the enhancement of the global nuclear safety framework. • Significant progress has also been made in reviewing the Agency’s safety standards, which continue to be widely applied by regulators, operators and the nuclear industry in general, with increased attention and focus on vitally important areas such as design and operation of NPPs, protection of NPPs against severe accidents, and EPR. • The Agency continued to

  9. World Council of Nuclear Workers

    International Nuclear Information System (INIS)

    Maisseu, Andre

    2007-01-01

    WONUC is an association of Trade Unions, Scientific Societies and Social Organizations of the employees, workers and professionals of the nuclear energy related industries and technologies; integrated by 35 Countries and 1.8 millions members. This paper expose the products and services that WONUC provide for the promotion of peaceful uses of nuclear energy and the result of their work around all the world

  10. KWU Nuclear Plant Analyzer

    International Nuclear Information System (INIS)

    Bennewitz, F.; Hummel, R.; Oelmann, K.

    1986-01-01

    The KWU Nuclear Plant Analyzer is a real time engineering simulator based on the KWU computer programs used in plant transient analysis and licensing. The primary goal is to promote the understanding of the technical and physical processes of a nuclear power plant at an on-site training facility. Thus the KWU Nuclear Plant Analyzer is available with comparable low costs right at the time when technical questions or training needs arise. This has been achieved by (1) application of the transient code NLOOP; (2) unrestricted operator interaction including all simulator functions; (3) using the mainframe computer Control Data Cyber 176 in the KWU computing center; (4) four color graphic displays controlled by a dedicated graphic computer, no control room equipment; and (5) coupling of computers by telecommunication via telephone

  11. Canada's domestic nuclear issues

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    The Interfaith Program for Public Awareness of Nuclear Issues (IPPANI) is a committee of representatives of religious groups in Toronto, a group of people concerned about the moral and ethical implications of the operation of Canada's nuclear industry and of its exports to other countries. The faith groups represented are the Anglican Diocese of Toronto, the Baha'i Community of Canada, the Jewish Community of Toronto, the Roman Catholic Archdiocese of Toronto and the United Church of Canada Toronto Conference. Wishing to encourage the Canadian government to enquire into this broad question, the faith groups established IPPANI and assigned to it the task of enhancing their knowledge of the nuclear industry. IPPANI was to develop an effective set of questions to be placed before governments and to promote public discussion so that governments might become more responsive to these issues

  12. Nuclear medicine tomorrow

    International Nuclear Information System (INIS)

    Marko, A.M.

    1986-04-01

    The purpose of this Workshop was to discuss and promote future nuclear medicine applications. Atomic Energy of Canada Limited (AECL) is determined to assist in this role. A major aim of this gathering was to form an interface that was meaningful, representative of the two entities, and above all, on-going. In the opening address, given by Mr. J. Donnelly, President of AECL, this strong commitment was emphasized. In the individual sessions, AECL participants outlined R and D programs and unique expertise that promised to be of interest to members of the nuclear medicine community. The latter group, in turn, described what they saw as some problems and needs of nuclear medicine, especially in the near future. These Proceedings comprise the record of the formal presentations. Additionally, a system of reporting by rapporteurs insured a summary of informal discussions at the sessions and brought to focus pertinent conclusions of the workshop attendees

  13. Health Promotion Education

    DEFF Research Database (Denmark)

    Lehn-Christiansen, Sine

    The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills are concei......The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills...

  14. JPRS Report, Nuclear Developments

    National Research Council Canada - National Science Library

    1991-01-01

    Partial Contents: Medium Range Missiles, Rocket Engine, Nuclear Submarine, Nuclear Reactor, Nuclear Inspection, Nuclear Weapons, Transfer Technology, Scud, Safety, Nuclear Power, Chernobyl Trial, ,CHemical Weapons...

  15. The Nuclear Non-Proliferation Policy of the Obama Administration

    International Nuclear Information System (INIS)

    Baek, Jin Hyun; Hwang, Ji Hwan

    2009-12-01

    The objective of this study is to analyze and foresee trends of international nuclear non-proliferation regimes focused on the nuclear non-proliferation policy of the Obama administration, and suggest national policy directions which promote utilization and development of nuclear energy in Korea. For the effective and efficient implementation of the national nuclear use and development program in current international nuclear environment, many efforts should be made: to actively and positively participate in the international nuclear non-proliferation regime; to strengthen nuclear diplomacy in a more systematic manner; and to strengthen the international nuclear cooperation

  16. Towards sustainable nuclear power development

    International Nuclear Information System (INIS)

    Andrianov, Andrei A.; Murogov, Victor M.; Kuptsov, Ilya S.

    2014-01-01

    The review of the current situation in the nuclear energy sector carried out in this article brings to light key problems and contradictions, development trends and prospects, which finally determine the role and significance of nuclear power as a factor ensuring a sustainable energy development. Authors perspectives on the most appropriate developments of nuclear power, which should be based on a balanced use of proven innovative nuclear technologies and comprehensive multilateral approaches to the nuclear fuel cycle are expressed. The problems of wording appropriate and essential requirements for new countries with respect to their preparedness to develop nuclear programs, taking into account their development level of industry and infrastructure as well as national heritages and peculiarities, are explained. It is also indicated that one of the major components of sustainability in the development of nuclear power, which legitimates its public image as a power technology, is the necessity of developing and promoting the concepts of nuclear culture, nuclear education, and professional nuclear ethics. (orig.)

  17. Towards sustainable nuclear power development

    Energy Technology Data Exchange (ETDEWEB)

    Andrianov, Andrei A.; Murogov, Victor M.; Kuptsov, Ilya S. [Obninsk Institute for Nuclear Power Engineering of NNRU MEPhl, Obninsk, Kaluga Region (Russian Federation)

    2014-05-15

    The review of the current situation in the nuclear energy sector carried out in this article brings to light key problems and contradictions, development trends and prospects, which finally determine the role and significance of nuclear power as a factor ensuring a sustainable energy development. Authors perspectives on the most appropriate developments of nuclear power, which should be based on a balanced use of proven innovative nuclear technologies and comprehensive multilateral approaches to the nuclear fuel cycle are expressed. The problems of wording appropriate and essential requirements for new countries with respect to their preparedness to develop nuclear programs, taking into account their development level of industry and infrastructure as well as national heritages and peculiarities, are explained. It is also indicated that one of the major components of sustainability in the development of nuclear power, which legitimates its public image as a power technology, is the necessity of developing and promoting the concepts of nuclear culture, nuclear education, and professional nuclear ethics. (orig.)

  18. Nuclear forensics

    International Nuclear Information System (INIS)

    Venugopal, V.

    2010-01-01

    Nuclear forensics is the analysis of nuclear materials recovered from either the capture of unused materials, or from the radioactive debris following a nuclear explosion and can contribute significantly to the identification of the sources of the materials and the industrial processes used to obtain them. In the case of an explosion, nuclear forensics can also reconstruct key features of the nuclear device. Nuclear forensic analysis works best in conjunction with other law enforcement, radiological protection dosimetry, traditional forensics, and intelligence work to provide the basis for attributing the materials and/or nuclear device to its originators. Nuclear forensics is a piece of the overall attribution process, not a stand-alone activity

  19. Nuclear power

    International Nuclear Information System (INIS)

    1987-01-01

    ''Nuclear Power'' describes how a reactor works and examines the different designs including Magnox, AGR, RBMK and PWR. It charts the growth of nuclear generation in the world and its contributions to world energy resources. (author)

  20. Nuclear Scans

    Science.gov (United States)

    Nuclear scans use radioactive substances to see structures and functions inside your body. They use a special ... images. Most scans take 20 to 45 minutes. Nuclear scans can help doctors diagnose many conditions, including ...

  1. The Chinese nuclear program

    International Nuclear Information System (INIS)

    Prenez, J.C.; Bettoun, G.

    2009-01-01

    This series of slides presents the organization of the Chinese nuclear industry and its perspectives for the 2 next decades. The presentation is divided into 5 parts. Part one: the energy sector in China. Due to the economic development of the country this sector is flourishing and reaches an average growth rate of 9% per year. More than fifty per cent of the power plants being built in the world, are located in China. The electricity production stems by far from fossil energies (>80%) but this part is expected to decrease to reach 70% in 2020. Part 2: the Chinese nuclear program. This program is dual: the massive deployment of chinese improved reactors of second generation (the construction of 6 CPR1000 reactors will be launched each year) and the import and assimilation of reactors of the third generation: 4 AP1000 and 2 EPR are being built. Part 3: the organization of the Chinese nuclear sector. The main actors are CNNC (China National Nuclear Corporation), CGNPC (China Guangdong Nuclear Power Corporation), CPI (China Power Investment Corporation), SNPTC (State Nuclear Power Technology Corporation). The main 5 Chinese suppliers are also presented. Part 4: The role of EDF. Today's EDF role is multiple: to be active in the Chinese nuclear program, to go beyond technical assistance to reach partnership, to invest in Chinese power plants, to promote cooperation between French and Chinese actors of the nuclear industry. A lot of joint ventures have been created. Part 5: the Taishan project. Taishan is a coastal site near Macao in the Guangdong province in which 2 EPR are being built, the first concrete was cast in october 2009, 52 months of construction are scheduled and the first unit will be commissioned in end 2013 while the second commissioning is planned for end 2014. (A.C.)

  2. Nuclear power plant safety

    International Nuclear Information System (INIS)

    Otway, H.J.

    1974-01-01

    Action at the international level will assume greater importance as the number of nuclear power plants increases, especially in the more densely populated parts of the world. Predictions of growth made prior to October 1973 [9] indicated that, by 1980, 14% of the electricity would be supplied by nuclear plants and by the year 2000 this figure would be about 50%. This will make the topic of international co-operation and standards of even greater importance. The IAEA has long been active in providing assistance to Member States in the siting design and operation of nuclear reactors. These activities have been pursued through advisory missions, the publication of codes of practice, guide books, technical reports and in arranging meetings to promote information exchange. During the early development of nuclear power, there was no well-established body of experience which would allow formulation of internationally acceptable safety criteria, except in a few special cases. Hence, nuclear power plant safety and reliability matters often received an ad hoc approach which necessarily entailed a lack of consistency in the criteria used and in the levels of safety required. It is clear that the continuation of an ad hoc approach to safety will prove inadequate in the context of a world-wide nuclear power industry, and the international trade which this implies. As in several other fields, the establishment of internationally acceptable safety standards and appropriate guides for use by regulatory bodies, utilities, designers and constructors, is becoming a necessity. The IAEA is presently planning the development of a comprehensive set of basic requirements for nuclear power plant safety, and the associated reliability requirements, which would be internationally acceptable, and could serve as a standard frame of reference for nuclear plant safety and reliability analyses

  3. Nuclear safety in Spain

    International Nuclear Information System (INIS)

    Caro, R.

    1988-01-01

    Control and monitoring of all Spanish nuclear facilities was first carried out by the Department of Nuclear Safety of the Junta de Energia Nuclear established by the Nuclear Energy Act in 1964. Later, following the example of other Western countries, it was concluded that regulations and monitoring of nuclear energy on one hand and its promotion and development on the other should not be done by the same national body. Therefore, the Consejo de Seguridad Nuclear (CSN) was created in 1980, as the sole national body responsible for controlling the safety of nuclear installations, and radiological protection. The CSN has five members, one chairman and four comissioners, required to be independent and therefore with politically objective criteria, internationally acknowledged technical capability, and free from other duties and responsibilities. For this purpose the Chairman has been given the status of Minister and the commissioners that of Secretary of State. They serve for six years, after being accepted by Parliament by a majority of at least 3/5 of the votes, and are called upon to report to Parliament at least twice a year on nuclear safety and radiological protection in the country. A complete report on those issues is presented to Parliament, becoming a politic document as from that moment. To prepare that report (basically a summary of CSN activities) and, in general, to fulfill all its tasks, the CSN has a staff of some 300, about 50% being technical. CSN activities cover: 1. Standards; 2. Licences; 3. Research; 4. Environment; 5. Information; and 6. International Relations

  4. Country nuclear power profiles

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    The preparation of Country Nuclear Power Profiles was initiated within the framework of the IAEA`s programme for nuclear power plant performance assessment and feedback. It responded to a need for a database and a technical document containing a description of the energy and economic situation and the primary organizations involved in nuclear power in IAEA Member States. The task was included in the IAEA`s programmes for 1993/1994 and 1995/1996. In March 1993, the IAEA organized a Technical Committee meeting to discuss the establishment of country data ``profiles``, to define the information to be included in the profiles and to review the information already available in the IAEA. Two expert meetings were convened in November 1994 to provide guidance to the IAEA on the establishment of the country nuclear profiles, on the structure and content of the profiles, and on the preparation of the publication and the electronic database. In June 1995, an Advisory Group meeting provided the IAEA with comprehensive guidance on the establishment and dissemination of an information package on industrial and organizational aspects of nuclear power to be included in the profiles. The group of experts recommended that the profiles focus on the overall economic, energy and electricity situation in the country and on its nuclear power industrial structure and organizational framework. In its first release, the compilation would cover all countries with operating power plants by the end of 1995. It was also recommended to further promote information exchange on the lessons learned from the countries engaged in nuclear programmes. For the preparation of this publication, the IAEA received contributions from the 29 countries operating nuclear power plants and Italy. A database has been implemented and the profiles are supporting programmatic needs within the IAEA; it is expected that the database will be publicly accessible in the future. Refs, figs, tabs.

  5. Country nuclear power profiles

    International Nuclear Information System (INIS)

    1998-03-01

    The preparation of Country Nuclear Power Profiles was initiated within the framework of the IAEA's programme for nuclear power plant performance assessment and feedback. It responded to a need for a database and a technical document containing a description of the energy and economic situation and the primary organizations involved in nuclear power in IAEA Member States. The task was included in the IAEA's programmes for 1993/1994 and 1995/1996. In March 1993, the IAEA organized a Technical Committee meeting to discuss the establishment of country data ''profiles'', to define the information to be included in the profiles and to review the information already available in the IAEA. Two expert meetings were convened in November 1994 to provide guidance to the IAEA on the establishment of the country nuclear profiles, on the structure and content of the profiles, and on the preparation of the publication and the electronic database. In June 1995, an Advisory Group meeting provided the IAEA with comprehensive guidance on the establishment and dissemination of an information package on industrial and organizational aspects of nuclear power to be included in the profiles. The group of experts recommended that the profiles focus on the overall economic, energy and electricity situation in the country and on its nuclear power industrial structure and organizational framework. In its first release, the compilation would cover all countries with operating power plants by the end of 1995. It was also recommended to further promote information exchange on the lessons learned from the countries engaged in nuclear programmes. For the preparation of this publication, the IAEA received contributions from the 29 countries operating nuclear power plants and Italy. A database has been implemented and the profiles are supporting programmatic needs within the IAEA; it is expected that the database will be publicly accessible in the future

  6. Nuclear energy

    International Nuclear Information System (INIS)

    Kuhn, W.

    1986-01-01

    This loose-leaf collection is made up of five didactically prepared units covering the following subjects: basic knowledge on nuclear energy, nuclear energy in relation to energy economy, site issues, environmental compatibility of nuclear energy, and nuclear energy in the focus of political and social action. To this was added a comprehensive collection of material: specific scientific background material, a multitude of tables, diagrams, charts etc. for copying, as well as 44 transparent charts, mostly in four colours. (orig./HP) [de

  7. Nuclear structure

    International Nuclear Information System (INIS)

    Eastham, D.A.; Joy, T.

    1986-01-01

    The paper on 'nuclear structure' is the Appendix to the Daresbury (United Kingdom) Annual Report 1985/86, and contains the research work carried out at the Nuclear Structure Facility, Daresbury, within that period. During the year a total of 74 experiments were scheduled covering the main areas of activity including: nuclear collective motion, nuclei far from stability, and nuclear collisions. The Appendix contains brief reports on these experiments and associated theory. (U.K.)

  8. Basic plans of nuclear energy development and utilization for fiscal 1982 (report)

    International Nuclear Information System (INIS)

    1982-01-01

    A report by the Nuclear Safety Commission to the Prime Minister, concerning the basic plans of nuclear energy development and utilization for fiscal 1982, was presented; the NSC has decided on the plans drawn up by the Prime Minister. Nuclear power generation as the nucleus of petroleum substitutes must be developed steadily. For the purpose, nuclear fuel cycle should be established, including the securing of uranium resources, uranium enrichment, fuel reprocessing, and waste management. The contents are as follows: the strengthening of nuclear safety measures, the promotion of nuclear power generation, the establishment of nuclear fuel cycle, the development of advanced types of reactors, the research on nuclear fusion, the research and development of nuclear powered ships, the promotion of radiation utilization, the strengthening of basis for nuclear energy development and utilization, the promotion of international cooperation, the strengthening of safeguard and nuclear material protection measures, fiscal 1982 budgets related to nuclear energy. (Mori, K.)

  9. Nuclear terrorism

    International Nuclear Information System (INIS)

    2002-01-01

    Recent reports of alleged terrorist plans to build a 'dirty bomb' have heightened longstanding concerns about nuclear terrorism. This briefing outlines possible forms of attack, such as: detonation of a nuclear weapon; attacks involving radioactive materials; attacks on nuclear facilities. Legislation addressing these risks and the UK's strategy for coping with them are also considered

  10. Nuclear power

    International Nuclear Information System (INIS)

    d'Easum, Lille.

    1976-03-01

    An environmentalist's criticism of nuclear energy is given, on a layman's level. Such subjects as conflict of interest in controlling bodies, low-level radiation, reactor safety, liability insurance, thermal pollution, economics, heavy water production, export of nuclear technology, and the history of the anti-nuclear movement are discussed in a sensationalistic tone. (E.C.B.)

  11. Nuclear alerts

    International Nuclear Information System (INIS)

    Anon.

    1983-01-01

    Anti-nuclear demonstrations against the deployment of new US missiles were held in Nato Europe. As no agreement has yet been reached at the US-Soviet Intermediate Nuclear Forces talks in Geneva, the deployment of nuclear missiles in Europe has started

  12. Nuclear questions

    International Nuclear Information System (INIS)

    Berg, Eugene

    2012-01-01

    Civilian and military nuclear questions fill a multitude of publications these days, especially after the Japanese tsunami and the Fukushima disaster. The author analyses some of them and highlights the links between civil and military nuclear industries, the realities of the nuclear cycle and related industrial questions before concluding on the controversial issue of weapons and their proliferation potential

  13. Nuclear decommissioning

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    The paper on nuclear decommissioning was presented by Dr H. Lawton to a meeting of the British Nuclear Energy Society and Institution of Nuclear Engineers, 1986. The decommissioning work currently being undertaken on the Windscale advanced gas cooled reactor (WAGR) is briefly described, along with projects in other countries, development work associated with the WAGR operation and costs. (U.K.)

  14. Nuclear electronics

    International Nuclear Information System (INIS)

    Friese, T.

    1981-09-01

    A short survey is given on nuclear radiation detectors and nuclear electronics. It is written for newcomers and those, who are not very familiar with this technique. Some additional information is given on typical failures in nuclear measurement systems. (orig.) [de

  15. Estimation of nuclear power-related expenditures in fiscal 1982

    International Nuclear Information System (INIS)

    1981-01-01

    In fiscal 1982 (April to March, 1983), the research and development on nuclear power should be promoted actively and extensively by taking the appropriate measures. In view of the importance, the budgetary expenditures are to be estimated duly for the purpose, considering also the stringent financial situation. The budgetary expenditures for nuclear power estimated for the fiscal year 1982 are about 292,800 Million in total and the obligation act limit is about 139,900 Million. The following matters are described: nuclear power-related measures for securing nuclear power safety, promotion of nuclear power generation, establishment of the nuclear fuel cycle, development of power reactors, research on nuclear fusion, strengthening of the foundation in nuclear power research, development and utilization, promotion of international cooperation, etc.; estimated budgetary expenditures; tables of budgetary demands in various categories. (J.P.N.)

  16. Promoting preschool reading

    OpenAIRE

    Istenič, Vesna

    2013-01-01

    The thesis titled Promoting preschool reading consists of a theoretiral and an empirical part. In the theoretical part I wrote about reading, the importance of reading, types of reading, about reading motivation, promoting reading motivation, internal and external motivation, influence of reading motivation on the child's reading activity, reading and familial literacy, the role of adults in promotion reading literacy, reading to a child and promoting reading in pre-school years, where I ...

  17. What do health-promoting schools promote?

    DEFF Research Database (Denmark)

    Simovska, Venka

    2012-01-01

    -promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...

  18. Canada's nuclear non-proliferation policy

    International Nuclear Information System (INIS)

    1985-01-01

    Canada's non-proliferation and safeguards policy has two objectives: 1) to promote the emergence of a more effective and comprehensive international non-proliferation regime; and 2) to assure the Canadian people and the international community that Canadian nuclear exports will not be used for any nuclear explosive purpose. By emphasizing the key role of the NPT, by promoting reliance upon and improvements in the IAEA safeguards system, by treating nuclear weapon and non-nuclear weapon states alike regarding Canadian nuclear exports, by working for new approaches covering the sensitive phases (e.g. reprocessing) of the nuclear fuel cycle, Canada's policy promotes attainment of the first objective. The latter objective is served through the network of bilateral nuclear agreements that Canada has put into place with its nuclear partners. Those agreements provide assurance that Canada's nuclear exports are used solely for legitimate, peaceful, nuclear energy production purposes. At the same time, Canada, having formulated its non-proliferation and safeguards policy during the period 1945 to 1980, has recognized that it has gone as far as it can on its own in this field and that from this point on any further changes should be made on the basis of international agreement. The Canadian objective in post-INFCE forums such as the Committee on Assurances of Supply is to exert Canada's best efforts to persuade the international community to devise a more effective and comprehensive international non-proliferation regime into which Canada and other suppliers might subsume their national requirements

  19. The Romanian nuclear regulatory body as a nuclear communicator

    International Nuclear Information System (INIS)

    Cluculescu, Cristina

    2000-01-01

    A comprehensive nuclear law environment could be a relevant tool to promote greater confidence in the nuclear energy. Romania has had laws in place governing the regulation of nuclear activities since 1974, which remained in force throughout and subsequent to the national constitutional changes. Up to December 1996, the CNCAN activities were based on Law No. 61/1974 for the development of the nuclear activities in Romania and Law No. 61982 on the quality assurance of the nuclear facilities and nuclear power plants. The Nuclear Safety legislation has been enacted in November 1974 (Law No. 61/1974) and it followed as closely as possible (for that time) the US Atomic Energy Act of 1954, as amended subsequently. The Romanian nuclear regulatory body, called National Commission for Nuclear Activities Control (CNCAN) is a governmental organization responsible for the development of the regulatory framework, the control of its implementation and for the licensing of nuclear facilities. An important issue of CNCAN is to provide the correct and reasoning information to the public. The most important topics focused on nuclear activities for the interest of mass media in Romania are: Radioactive waste management; The cost and benefit of nuclear energy compared by conventional energy; The conditions for transportation of radioactive materials; The consequences of a suppositional nuclear accidents; The safety in operation for nuclear installations. The information provided to press and public by regulatory body is clearly and well structured. The target is to clearly explain to mass media and the public should understand very well the difference between the meaning of a nuclear accident, nuclear incident or nuclear event. CNCAN monitories and surveys the operation in safe conditions the nuclear facilities and plants, the protection against nuclear radiation of the professionally exposed personnel, of the population, of the environment and the material goods. It is also

  20. Civil liability concerning nuclear accidents

    International Nuclear Information System (INIS)

    Anon.

    2013-01-01

    France and the USA wish to cooperate in order to promote an international regime of civil liability in order to give a fair compensation to victims of nuclear accidents as it is recommended by IAEA. On the other hand the European Commission has launched a consultation to see the necessity or not to harmonize all the civil liability regimes valid throughout Europe. According to the Commission the potential victims of nuclear accidents would not receive equal treatment at the European scale in terms of insurance cover and compensation which might distort competition in the nuclear sector. (A.C.)

  1. World nuclear directory. 6. ed.

    International Nuclear Information System (INIS)

    Wilson, C.W.J.

    1981-01-01

    The purpose of the directory is to provide a comprehensive, worldwide guide to organizations which conduct, promote, or encourage research into atomic energy. The term research is interpreted fairly generously. The directory is intended to be a reference source useful to scientists and administrators in the nuclear field, to information workers, librarians, journalists, market researchers, and others. It therefore includes nuclear research institutes; government departments; public corporations; industrial firms; electricity generating boards; learned and professional societies; and universities, polytechnics, and other institutes of higher education with nuclear departments. (author)

  2. Fear of nuclear power generation

    Energy Technology Data Exchange (ETDEWEB)

    Higson, D.J. [Paddington, NSW (Australia)

    2014-07-01

    Communicating the benefits of nuclear power generation, although essential, is unlikely to be sufficient by itself to counter the misconceptions which hinder the adoption of this technology, viz: that it is unsafe, generates intractable waste, facilitates the proliferation of nuclear weapons, etc. Underlying most of these objections is the fear of radiation, engendered by misunderstandings of the effects of exposure - not the actual risks of radiation exposure themselves. Unfortunately, some aspects of current radiation protection practices promote the misconception that there is no safe dose. A prime purpose of communications from the nuclear industry should be to dispel these misconceptions. (author)

  3. Enhancement of the Public Acceptance of Nuclear Energy

    International Nuclear Information System (INIS)

    Song, K. C.; Jeong, S. M.; Noh, T. W.

    2010-02-01

    To enhance the public acceptance of nuclear energy in Korea we translate the 'The Power to Save the World - The Truth about Nuclear Energy' written by the American novelist Gwyneth Cravens into Korean. 'Power to Save the World' is an eloquent, convincing argument for nuclear power as a safe energy source and an essential deterrent to global warming. To promote national power by keeping nuclear industry healthy, we need to supply the variety of material which enhances the public acceptance of nuclear energy

  4. Enhancing operational nuclear safety

    International Nuclear Information System (INIS)

    Sengoku, Katsuhisa

    2008-01-01

    's safety standards and program which provides the safety objective following the 10 fundamental safety principles. The safety requirements defines the functional conditions required for safety and the safety guides provides user-friendly and up-to-date practical guidance representing good/best practices to fulfill the requirements. The IAEA provides safety review services and fields safety review teams upon request of member states for the regulatory, the International Regulatory Review Team (IRRT) and Operational Safety Review Team (OSART) and Peer Review of the Operational and Safety Performance Experience Review (PROSPER). The OSART programme's purpose is to assist member states in enhancing the operational safety of individual nuclear power plants and to promote the continuous development of operational safety within all member states by the dissemination of information on good practice. The OSART Mission Results (OSMIR) database contains the results from 73 OSART missions and 54 follow up visits from 1991 and its continually updated. The Asian Nuclear Safety Network (ANSN) was established to pool and share existing and new technical knowledge and practical experience to further improve the safety of nuclear installation in Asia. In summary, the enhancement of the GNSR is anchored in the recognition that all the states are in the same boat and the increasing importance of sharing and mutual learning, sharing knowledge and experience through regional and global networking. It requires joint and coordinated strategy by all states. The IAEA is willing and ready to support the GNSR through the establishment and application of safety standards, and safety review and advisory services and international instruments. (Author)

  5. Convention on supplementary compensation for nuclear damage

    International Nuclear Information System (INIS)

    Chinese Nuclear Society, Beijing; U.S. Nuclear Energy Institute

    2000-01-01

    The Contracting parties recognize the importance of the measures provided in the Vienna Convention on Civil Liability for Nuclear Damage and the Paris Convention on Third party liability in the Field of Nuclear Energy as well as in national legislation on compensation for nuclear damage consistent with the principles of these conventions. The Contracting parties desire to establish a worldwide liability regime to supplement and enhance these measures with a view to increasing the amount of compensation for nuclear damage and encourage regional and global co-operation to promote a higher level of nuclear safety in accordance with the principle of international partnership and solidarity

  6. Proliferation risks from nuclear power infrastructure

    Science.gov (United States)

    Squassoni, Sharon

    2017-11-01

    Certain elements of nuclear energy infrastructure are inherently dual-use, which makes the promotion of nuclear energy fraught with uncertainty. Are current restraints on the materials, equipment, and technology that can be used either to produce fuel for nuclear electricity generation or material for nuclear explosive devices adequate? Technology controls, supply side restrictions, and fuel market assurances have been used to dissuade countries from developing sensitive technologies but the lack of legal restrictions is a continued barrier to permanent reduction of nuclear proliferation risks.

  7. Nuclear energy

    International Nuclear Information System (INIS)

    2007-01-01

    This digest document was written by members of the union of associations of ex-members and retired people of the Areva group (UARGA). It gives a comprehensive overview of the nuclear industry world, starting from radioactivity and its applications, and going on with the fuel cycle (front-end, back-end, fuel reprocessing, transports), the nuclear reactors (PWR, BWR, Candu, HTR, generation 4 systems), the effluents from nuclear facilities, the nuclear wastes (processing, disposal), and the management and safety of nuclear activities. (J.S.)

  8. Nuclear orientation and nuclear structure

    International Nuclear Information System (INIS)

    Krane, K.S.

    1988-01-01

    The present generation of on-line nuclear orientation facilities promises to revolutionize the gathering of nuclear structure information, especially for the hitherto poorly known and understood nuclei far from stability. Following a brief review of the technological developments that have facilitated these experiments, the nuclear spectroscopic information that can be obtained is summarized. Applications to understanding nuclear structure are reviewed, and challenges for future studies are discussed. (orig.)

  9. A study on the long-term nuclear policy direction responding the changes of international and domestic nuclear situation

    International Nuclear Information System (INIS)

    Kim, Hyun Jun; Yang, M. H.; Lee, B. O.; Ham, C. H.; Chung, W. S.; Lee, T. J.; Yun, S. W.; Ko, H. S.; Nha, K. H.

    1998-06-01

    The long-term nuclear policy directions are proposed with three aspects of nuclear technology development policy, nuclear regulatory policy, and tasks required for promoting pro-nuclear movement. Several nuclear technology areas, such as technology for the improvement of nuclear economics, safety enhancement technology, radwaste, treatment/disposal technology, fuel cycle technology, and proliferation-resistant nuclear technology, fuel recycle technology, and proliferation-resistant nuclear technology, appear very important in the future nuclear technology development policy. Nuclear regulation policy should be established with balancing between public safety and expansion of nuclear industry. Objective of nuclear regulation should be recognized not to collapse a nuclear industry, and the worth of nuclear regulatory regime may be also meaningful if nuclear industry can be well developed. It should be necessary to make a proper atmosphere that can resolve revealed or potential problems and issues against the harmonious implementation of nuclear policy. For the purpose, nuclear policy should contain certain policies to promote a nuclear development, such as social policy, international cooperation strategy, and national resource allocation policy. (author). 20 refs., 8 tabs., 5 figs

  10. Nuclear power development in Japan

    International Nuclear Information System (INIS)

    Sugawara, A.

    1994-01-01

    The energy situation in Japan is briefly outlined. Vulnerability in energy structure of the country is shown by a comparison of primary energy supply patterns of Japan and Western countries. Japan's energy policy consists in reducing dependence on oil, promoting efficient use of energy and increasing use of non-fossil fuels. Nuclear power is a core of alternative energy for petroleum because of stable supply of nuclear fuel, low detrimental emissions and less dependence on the fuel. A short historical review of nuclear power development in Japan is presented. Some future issues as development of entire nuclear fuel cycle, social acceptance, reactor safety and nuclear power economics are also discussed. 6 figs. (R.T.)

  11. Nuclear data and human society

    International Nuclear Information System (INIS)

    Fuketa, Toyojiro

    2002-01-01

    Necessity and significance of nuclear data activities are discussed with background of the world typical aspects at the end of the 20th century. We have to overcome the worldwide adverse wind to nuclear power production with a view to preserving global environment including natural resources and climate. The nuclear data activities should be promoted further to achieve more and more wide comprehension and integrity of evaluated nuclear databases. The comprehensive evaluated nuclear databases which link microscopic world to macroscopic world may be of use to link science and technology with perception of the public, and to link science and technology with the other fields of learning, hence of use to coordinate and integrate natural, human, and social sciences. (author)

  12. Reassessing the nuclear liability regime

    International Nuclear Information System (INIS)

    Havinh Phuong

    1985-01-01

    The nuclear liability regime was thoroughly reviewed by nuclear plant operators, officials of regulatory authorities, and legal and insurance experts at the Symposium on Nuclear Third Party Liability and Insurance, held in September 1984 in Munich, Federal Republic of Germany. The symposium highlighted specific areas where adjustments or improvements would be needed in order to cope with practical problems encountered or emerging issues. By focusing on questions of legitimate concern to the public, it also sought to promote confidence in a compensation system for public protection that is in many ways unique. Topics addressed included the following: greater harmonization of the compensation amounts for nuclear damage established in different countries and in territorial scope; the concept of unlimited liability; the time limitation for compensation claims; the problem of proving causation; the concept of nuclear damage; and insurance coverage

  13. Nuclear power

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    The committee concludes that the nature of the proliferation problem is such that even stopping nuclear power completely could not stop proliferation completely. Countries can acquire nuclear weapons by means independent of commercial nuclear power. It is reasonable to suppose if a country is strongly motivated to acquire nuclear weapons, it will have them by 2010, or soon thereafter, no matter how nuclear power is managed in the meantime. Unilateral and international diplomatic measures to reduce the motivations that lead to proliferation should be high on the foreign policy agenda of the United States. A mimimum antiproliferation prescription for the management of nuclear power is to try to raise the political barriers against proliferation through misuse of nuclear power by strengthening the Non-Proliferation Treaty, and to seek to raise the technological barriers by placing fuel-cycle operations involving weapons-usable material under international control. Any such measures should be considered tactics to slow the spread of nuclear weapons and thus earn time for the exercise of statesmanship. The committee concludes the following about technical factors that should be considered in formulating nuclear policy: (1) rate of growth of electricity use is a primary factor; (2) growth of conventional nuclear power will be limited by producibility of domestic uranium sources; (3) greater contribution of nuclear power beyond 400 GWe past the year 2000 can only be supported by advanced reactor systems; and (4) several different breeder reactors could serve in principle as candidates for an indefinitely sustainable source of energy

  14. Nuclear physics

    International Nuclear Information System (INIS)

    Kamal, Anwar

    2014-01-01

    Explains the concepts in detail and in depth. Provides step-by-step derivations. Contains numerous tables and diagrams. Supports learning and teaching with numerous worked examples, questions and problems with answers. Sketches also the historical development of the subject. This textbook explains the experimental basics, effects and theory of nuclear physics. It supports learning and teaching with numerous worked examples, questions and problems with answers. Numerous tables and diagrams help to better understand the explanations. A better feeling to the subject of the book is given with sketches about the historical development of nuclear physics. The main topics of this book include the phenomena associated with passage of charged particles and radiation through matter which are related to nuclear resonance fluorescence and the Moessbauer effect., Gamov's theory of alpha decay, Fermi theory of beta decay, electron capture and gamma decay. The discussion of general properties of nuclei covers nuclear sizes and nuclear force, nuclear spin, magnetic dipole moment and electric quadrupole moment. Nuclear instability against various modes of decay and Yukawa theory are explained. Nuclear models such as Fermi Gas Model, Shell Model, Liquid Drop Model, Collective Model and Optical Model are outlined to explain various experimental facts related to nuclear structure. Heavy ion reactions, including nuclear fusion, are explained. Nuclear fission and fusion power production is treated elaborately.

  15. Nuclear chemistry

    International Nuclear Information System (INIS)

    Vertes, A.; Kiss, I.

    1987-01-01

    This book is an introduction to the application of nuclear science in modern chemistry. The first group of chapters discuss the basic phenomena and concepts of nuclear physics with emphasis on their relation to chemical problems, including the main properties and the composition of atomic nuclei, nuclear reactions, radioactive decay and interactions of radiation with matter. These chapters provide the basis for understanding the following chapters which encompass the wide scope of nuclear chemistry. The methods of the investigation of chemical structure based on the interaction of nuclear radiation with matter including positronium chemistry and other exotic atoms is elaborated in particular detail. Separate chapters are devoted to the use of radioactive tracers, the chemical consequences of nuclear processes (i.e. hot atom chemistry), radiation chemistry, isotope effects and their applications, and the operation of nuclear reactors

  16. Nuclear chemistry

    International Nuclear Information System (INIS)

    Vertes, A.; Kiss, I.

    1987-01-01

    This book is an introduction to the application of nuclear science in modern chemistry. The first group of chapters discuss the basic phenomena and concepts of nuclear physics with emphasis on their relation to chemical problems, including the main properties and the composition of atomic nuclei, nuclear reactions, radioactive decay and interactions of radiation with matter. These chapters provide the basis for understanding the following chapters which encompass the wide scope of nuclear chemistry. The methods of the investigation of chemical structure based on the interaction of nuclear radiation with matter including positronium chemistry and other exotic atoms is elaborated in particular detail. Separate chapters are devoted to the use of radioactive tracers, the chemical consequences of nuclear processes (i.e. hot atom chemistry), radiation chemistry, isotope effects and their applications, and the operation of nuclear reactors. (Auth.)

  17. Nuclear forensics

    International Nuclear Information System (INIS)

    Karadeniz, O.; Guenalp, G.

    2010-01-01

    This review discusses the methodology of nuclear forensics and illicit trafficking of nuclear materials. Nuclear forensics is relatively new scientific branch whose aim it is to read out material inherent from nuclear material. Nuclear forensics investigations have to be considered as part of a comprehensive set of measures for detection,interception, categorization and characterization of illicitly trafficking nuclear material. Prevention, detection and response are the main elements in combating illicit trafficking. Forensics is a key element in the response process. Forensic science is defined as the application of a broad spectrum of sciences to answer questions of interest to the legal system. Besides, in this study we will explain age determination of nuclear materials.

  18. Nuclear fuels

    International Nuclear Information System (INIS)

    Gangwani, Saloni; Chakrabortty, Sumita

    2011-01-01

    Nuclear fuel is a material that can be consumed to derive nuclear energy, by analogy to chemical fuel that is burned for energy. Nuclear fuels are the most dense sources of energy available. Nuclear fuel in a nuclear fuel cycle can refer to the fuel itself, or to physical objects (for example bundles composed of fuel rods) composed of the fuel material, mixed with structural, neutron moderating, or neutron reflecting materials. Long-lived radioactive waste from the back end of the fuel cycle is especially relevant when designing a complete waste management plan for SNF. When looking at long-term radioactive decay, the actinides in the SNF have a significant influence due to their characteristically long half-lives. Depending on what a nuclear reactor is fueled with, the actinide composition in the SNF will be different. The following paper will also include the uses. advancements, advantages, disadvantages, various processes and behavior of nuclear fuels

  19. Nuclear networking.

    Science.gov (United States)

    Xie, Wei; Burke, Brian

    2017-07-04

    Nuclear lamins are intermediate filament proteins that represent important structural components of metazoan nuclear envelopes (NEs). By combining proteomics and superresolution microscopy, we recently reported that both A- and B-type nuclear lamins form spatially distinct filament networks at the nuclear periphery of mouse fibroblasts. In particular, A-type lamins exhibit differential association with nuclear pore complexes (NPCs). Our studies reveal that the nuclear lamina network in mammalian somatic cells is less ordered and more complex than that of amphibian oocytes, the only other system in which the lamina has been visualized at high resolution. In addition, the NPC component Tpr likely links NPCs to the A-type lamin network, an association that appears to be regulated by C-terminal modification of various A-type lamin isoforms. Many questions remain, however, concerning the structure and assembly of lamin filaments, as well as with their mode of association with other nuclear components such as peripheral chromatin.

  20. Radiation promotive concept

    International Nuclear Information System (INIS)

    Shebaita, M.K.

    1975-01-01

    The concept of radiation promotion was proposed in this study. The proposal of this concept was dependent upon stimulation in growth weight of survived chicks when fertile eggs were exposed to 60 Co gamma radiation. It was found that female chick (Promotive Sex) responded to this proposal concept rather than the male. Moreover, the dose level of 640 rads was found to be the Promotive Dose. It is important before applying ionizing radiation as a growth promotive to take into consideration whether you want increasing egg or meat production, as meat promotion in layers breed is bound to decrease egg production. (orig.) [de

  1. CNEN activities and brazilian nuclear power policy

    International Nuclear Information System (INIS)

    Costa, E.M. da

    1989-01-01

    The goal of the brazilian policy in nuclear power is to provide its use in a pacific way to promote the well being of our people. It is intended, as well, to finish the construction of Angra II and III and proceed with the implementation of the nuclear fuel cycle, progressively fomenting its nationalization. (A.C.A.S.)

  2. For a convention for nuclear weapon elimination

    International Nuclear Information System (INIS)

    2008-03-01

    This document contains two texts linked with the project of an international convention for the elimination of nuclear weapons (the text of this project has been sent to the UN General Secretary and is part of an international campaign to abolish nuclear weapons, ICAN). These two texts are contributions presented in London at the Global Summit for a Nuclear Weapon-free World. The first one calls into question the deterrence principle and the idea of a nuclear weapon-based security. It calls for different forms of action to promote a nuclear weapon-free world. The second text stresses the role and the responsibility of states with nuclear weapons in nuclear disarmament and in the reinforcement of the nuclear non proliferation treaty (NPT)

  3. NIASA: Nuclear Industry Association of South Africa

    International Nuclear Information System (INIS)

    Mollard, P.; Louf, P.H.; Gentet, G.; Doix, G.

    2015-01-01

    NIASA (Nuclear Industry Association of South Africa) aims at promoting the highest standards in the development and use of nuclear technologies. NIASA was founded in 2007. South-Africa has a long history in nuclear activity since the construction of the first nuclear power plant ever built on African soil was commissioned in 1984 in South-Africa (Koeberg plant equipped with two 900 MW reactors). There is also an important center for nuclear research near Pretoria that was founded in 1948 to regulate the prospecting for uranium. NECSA (South African Nuclear Energy Corporation is a state-owned public company) that manages nuclear research, operates the Safari-1 (2 MWe - commissioned in 1965) research reactor and manages the national radioactive waste center located at Vaalputs. The South African nuclear industry employs about 4000 people. (A.C.)

  4. Procurement strategic analysis of nuclear safety equipment

    International Nuclear Information System (INIS)

    Wu Caixia; Yang Haifeng; Li Xiaoyang; Li Shixin

    2013-01-01

    The nuclear power development plan in China puts forward a challenge on procurement of nuclear safety equipment. Based on the characteristics of the procurement of nuclear safety equipment, requirements are raised for procurement process, including further clarification of equipment technical specification, establishment and improvement of the expert database of the nuclear power industry, adoption of more reasonable evaluation method and establishment of a unified platform for nuclear power plants to procure nuclear safety equipment. This paper makes recommendation of procurement strategy for nuclear power production enterprises from following aspects, making a plan of procurement progress, dividing procurement packages rationally, establishing supplier database through qualification review and implementing classified management, promoting localization process of key equipment continually and further improving the system and mechanism of procurement of nuclear safety equipment. (authors)

  5. Nuclear Power in Korea

    International Nuclear Information System (INIS)

    Ha, Duk-Sang

    2009-01-01

    Full text: Korea's nuclear power program has been promoted by step-by-step approach; the first stage was 1970's when it depended on the foreign contractors' technology and the second was 1980's when it accumulated lots of technology and experience by jointly implementing the project. Lastly in the third stage in 1990's, Korea successfully achieved the nuclear power technological self-reliance and developed its standard nuclear power plant, so-called Optimized Power Reactor 1000 (OPR 1000). Following the development of OPR 1000, Korea has continued to upgrade the design, known as the Advanced Power Reactor 1400 (APR 1400) and APR+. Korea is one of the countries which continuously developed the nuclear power plant projects during the last 30 years while the other advanced countries ceased the project, and therefore, significant reduction of project cost and construction schedule were possible which benefits from the repetition of construction project. And now, its nuclear industry infrastructure possesses the strong competitiveness in this field.The electricity produced from the nuclear power is 150,958 MWh in 2008, which covers approximately 36% of the total electricity demand in Korea, while the installed capacity of nuclear power is 17,716 MW which is 24% of the total installed capacity. We are currently operating 20 units of nuclear power plants in Korea, and also are constructing 8 additional units (9,600 MW). Korea's nuclear power plants have displayed their excellent operating performance; the average plant capacity factor was 93.4% in 2008, which are about 15% higher than the world average of 77.8%. Moreover, the number of unplanned trips per unit was only 0.35 in 2008, which is the world top class performance. Also currently we are operating four CANDU nuclear units in Korea which are the same reactor type and capacity as the Cernavoda Units. They have been showing the excellent operating performance, of which capacity in 2008 is 92.8%. All the Korean

  6. European nuclear education initiatives

    International Nuclear Information System (INIS)

    Glatz, Jean-Paul

    2011-01-01

    Whatever option regarding their future nuclear energy development is chosen by European Union Member States, the availability of a sufficient number of well trained and experienced staff is key for the responsible use of nuclear energy. This is true in all areas including design, construction, operation, decommissioning, fuel cycle and waste management as well as radiation protection. Given the high average age of existing experts leading to a significant retirement induce a real risk of the loss of nuclear competencies in the coming years. Therefore the demand of hiring skilled employees is rising. The challenge of ensuring a sufficient number of qualified staff in the nuclear sector has been acknowledged widely among the different stakeholders, in particular the nuclear industry, national regulatory authorities and Technical Support Organisations (TSOs). Already the EURATOM Treaty refers explicitly to the obligation for the Commission to carry out training actions. Recently initiatives have been launched at EU level to facilitate and strengthen the efforts of national stakeholders. The European Nuclear Education Network (ENEN) Association aims at preservation and further development of expertise in the nuclear field by higher education and training. The goal of the European Nuclear Energy Leadership Academy (ENELA) is to educate future leaders in the nuclear field to ensure the further development of sustainable European nuclear energy solutions The European Nuclear Energy Forum (ENEF) is a platform operated by the European Commission for a broad discussion on the opportunities and risks of nuclear energy. The nuclear programs under investigation in the Joint Research Center (JRC) are increasingly contributing to Education and Training (E and T) initiatives, promoting a better cooperation between key players and universities as well as operators and regulatory bodies in order to mutually optimise their training programmes. Another objective is to increase

  7. Nuclear energy national plan. The directions for nuclear energy policy in Japan

    International Nuclear Information System (INIS)

    2006-11-01

    Nuclear energy is a key attaining an integrated solution for energy security and global warming issues. Under the Framework for Nuclear Energy Policy Japan aims to (1) maintain the 30 to 40% or more share of nuclear energy on electricity generation up to 2030 and afterwards, (2) promote the nuclear fuel cycle and (3) commercialize the fast-breeder reactors. As for policies to realize the basic targets, the 'Nuclear Energy National Plan' was compiled in August 2006 as follows: (1) Investment to construct new nuclear power plants and replace existing reactors in an era of electric power liberalization, 2) Appropriate use of existing nuclear power plants with assuring safety as a key prerequisite, (3) Steady advancement of the nuclear fuel cycle and strategic reinforcement of nuclear fuel cycle industries, (4) Strategy to secure uranium supplied, (5) Early commercialization of the fast breeder reactor cycle, (6) Achieving and developing advanced, technologies, industries and personnel, (7) Assisting the Japanese nuclear industry in promoting the international development, (8) Involved in and/or creating international frameworks to uphold both nonproliferation and expansion of nuclear power generation, (9) Fostering trust between the sates and communities where plants are located by making public hearings and public relations highly detailed and (10) Steady promotion of measures for disposal of radioactive wastes. Implementation policies were presented in details in this book with relevant data and documents. (T. Tanaka)

  8. Nuclear blackmail and nuclear balance

    International Nuclear Information System (INIS)

    Betts, R.K.

    1987-01-01

    This book raises pointed questions about nuclear saber rattling. More than a dozen cases since the bombing of Hiroshima and Magasaki in which some sort of nuclear threat was used as a sparring technique in tense confrontations are cited. Each incident is described and analyzed. Two theories offered to explain America's use of nuclear threats, the balance of interest theory and the balance of power theory, are contrasted throughout the book. This book helps to fill the gap in the understanding of nuclear weapons and their uses, while pointing out that nuclear bravado could lead to an unintended unleashing of these weapons

  9. The Canadian nuclear industry - a national asset

    International Nuclear Information System (INIS)

    1985-03-01

    The economic importance of the Canadian nuclear industry in saving costs and creating jobs is expounded. The medical work of Atomic Energy of Canada Limited is also extolled. The Canadian Nuclear Association urges the federal government to continue to support the industry at home, and to continue to promote nuclear exports. This report was prepared in response to the Federal Finance Minister's 'A New Direction for Canada'

  10. The sustainable development of nuclear energy

    International Nuclear Information System (INIS)

    Guo Huifang

    2012-01-01

    The wide use of nuclear energy has promoted the development of China's economy and the improvement of people's living standards. To some extent, the exploitation of nuclear power plants will solve the energy crisis faced with human society. Before the utilization of nuclear fusion energy, nuclear fission energy will be greatly needed for the purpose of alleviating energy crisis for a long period of time. Compared with fossil fuel, on the one hand, nuclear fission energy is more cost-efficient and cleaner, but on the other hand it will bring about many problems hard to deal with, such as the reprocessing and disposal of nuclear spent fuel, the contradiction between nuclear deficiency and nuclear development. This paper will illustrate the future and prospect of nuclear energy from the perspective of the difficulty of nuclear development, the present reprocessing way of spent fuel, and the measures taken to ensure the sustainable development of nuclear energy. By the means of data quoting and comparison, the feasibility of sustainable development of nuclear energy will be analyzed and the conclusion that as long as the nuclear fuel cycling system is established the sustainable development of nuclear energy could be a reality will be drawn. (author)

  11. Nuclear technology for sustainable development

    International Nuclear Information System (INIS)

    2001-01-01

    Introduces three of the IAEA's current programmes: Promoting food security - use of the sterile insect technique to eradicate the tsetse fly in Sub-Saharan Africa; Managing water resources - use of isotope hydrology to check water for traces of arsenic in Bangladesh; Improving human health - use of nuclear techniques for diagnosis, imaging and cancer treatment in developing countries

  12. Civil consequences of nuclear power

    International Nuclear Information System (INIS)

    Bell, D.I.; Verrastro, G.J.

    1978-01-01

    With the proliferation of nuclear power as an energy source, much controversy has developed regarding the compensation of injuries resulting from reactor accidents. In order to promote the continuing quest for safety, this paper suggests a scheme of liability that will protect the component manufacturers and designers and at the same time provide compensation within the current framework of our legal system

  13. Nuclear energy and nuclear weapons

    International Nuclear Information System (INIS)

    Robertson, J.A.L.

    1983-06-01

    We all want to prevent the use of nuclear weapons. The issue before us is how best to achieve this objective; more specifically, whether the peaceful applications of nuclear energy help or hinder, and to what extent. Many of us in the nuclear industry are working on these applications from a conviction that without peaceful nuclear energy the risk of nuclear war would be appreciably greater. Others, however, hold the opposite view. In discussing the subject, a necessary step in allaying fears is understanding some facts, and indeed facing up to some unpalatable facts. When the facts are assessed, and a balance struck, the conclusion is that peaceful nuclear energy is much more part of the solution to preventing nuclear war than it is part of the problem

  14. New development on the nuclear publicities

    International Nuclear Information System (INIS)

    Anon.

    2001-01-01

    A series of accidents and scandals in nuclear facilities made us not only importance of nuclear safety security again but also difference between technical safety and social relief at development promoting side further large. Then, it is at an actual state that in spite of being positioned at basic electric source as well, nuclear power generation is made further delay of its development without obtaining easy understanding of peoples as shown in difficulty of its new construction and location. Under such conditions, as the nuclear relatives have efforted development of its publicity actions earnestly, it seems to take some times to realize formation of peoples' agreements. Here was groped toward some future ways by reviewing traditional nuclear publicities, through nine articles such as subjects on future nuclear publicity, efforts to nuclear publicity as a manufacturer, a required approach based on 'negative national character', a network bound between women at source and consumption sites, friendliness to the earth and human beings, a promotive action of understanding toward relief recovery and new addition on nuclear power, a report on meeting of evaluation and investigation of the nuclear publicity, toward reconstruction of nuclear publicity strategy by the Tohoku Electric Power Co., Ltd., and development on publicity action of the Hokkaido Electric Power Co., Ltd. In the 'Nuclear Ten Days' at allover of Hokkaido. (G.K.)

  15. Nuclear financing in Spain

    International Nuclear Information System (INIS)

    Urrutia, C.G.-T.

    1975-04-01

    The basic objectives of the Spanish National Energy Plan are summarized as (1) To obtain maximum guarantees for continuity of supplies, (2) Reduce the cost of energy supplies to the maximum possible degree, (3) Reduce the difference in the balance of payments due to importation of primary energy sources, (4) Pro-mote the rational use of energy with the aim of moderating the growth rates in demand without affecting economic development (5) Reduce to an economical minimum the effect on the environment of energy-producing installations, and (6) Contribute to the technological development of the country and promote research in the energy field. To fulfil these objectives, the following forecasts are made: With the Gross National Product increasing at a rate of 5% or 6%, the demand on primary energy sources in 1985 will be 173 or 194 million e.c.t. (equivalent coal tons), i.e. annual growth rates of energy consumption of 6% and 7.2% respectively, compared with growths during the last decade of 9.2%. It is projected that generation of electrical energy from nuclear sources will grow to attain in a share of approximately 60% by 1985, i.e. an installed nuclear power level of 23.8.GW. The cost of the Spanish National Energy Plan, particularly the cost and financing of the nuclear program, is reviewed. Finally, the growing need for self-financing is stressed. (B.P.)

  16. Nuclear materials

    International Nuclear Information System (INIS)

    1996-01-01

    In 1998, Nuclear Regulatory Authority of the Slovak Republic (NRA SR) performed 38 inspections, 25 of them were performed in co-operation with IAEA inspectors. There is no fresh nuclear fuel at Bohunice A-1 NPP at present. Fresh fuel of Bohunice V-1 and V-2 NPPs is inspected in the fresh fuel storage.There are 327 fresh fuel assemblies in Mochovce NPP fresh fuel storage. In addition to that, are also 71 small users of nuclear materials in Slovakia. In most cases they use: covers made of depleted uranium for non-destructive works, detection of level in production plants, covers for therapeutical sources at medical facilities. In. 1995, NRA SR issued 4 new licences for nuclear material withdrawal. In the next part manipulation with nuclear materials, spent fuel stores and illegal trafficking in nuclear materials are reported

  17. Nuclear Law

    International Nuclear Information System (INIS)

    Wiesbauer, Bruno

    1978-01-01

    This book is the first attempt of a comprehensive compilation of national Austrian Nuclear Law (Nuclear Liability Act; Radiation protection Act, Radiation Protection Ordinance, Security Control Act, Act on the uses of Nuclear Energy - Zwentendorf Nuclear Power Plant) and the most important international agreements to which Austria is a party. Furthermore, the book contains the most important Nuclear Liability Conventions to which Austria is not yet a party, but which are applicable in neighbouring; the Paris Convention served as a model for the national Nuclear Liability Act and may be used for its interpretation. The author has translated a number of international instruments into German, such as the Expose des Motifs of the Paris Convention. (NEA) [fr

  18. Nuclear nonproliferation

    International Nuclear Information System (INIS)

    Neubert, M.

    1992-01-01

    The following motion was put before the United Kingdom House of Commons on 3rd February 1992 and agreed; that this House, recognising the potential dangers of the rapidly changing world order, welcomes the recent proposals for substantial reductions in nuclear weaponry, the growing support for the non-proliferation treaty and progress in the implementation of the United Nations Security Council Resolutions concerning the dismantling of Iraqi nuclear, chemical and biological capabilities; urges the Government to play their full part in helping the relevant authorities in the Commonwealth of Independent States to dismantle their nuclear devices, to safeguard their nuclear components and to discourage the proliferation of nuclear expertise; and believes it is of the first importance that Britain retains an effective and credible minimum nuclear deterrent as security in a world where there remain many sources of instability. The record of arguments for and against the motion in the debate is presented. (author)

  19. Nuclear energy

    International Nuclear Information System (INIS)

    Panait, A.

    1994-01-01

    This is a general report presenting the section VII entitled Nuclear Power of the National Conference on Energy (CNE '94) held in Neptun, Romania, on 13-16 June 1994. The problems addressed were those relating to electric power produced by nuclear power plant, to heat secondary generation, to quality assurance, to safety, etc. A special attention was paid to the commissioning of the first Romanian nuclear power unit, the Cernavoda-1 reactor of CANDU type. The communications were grouped in four subsections. These were: 1. Quality assurance, nuclear safety, and environmental protection; 2. Nuclear power plant, commissioning, and operation; 3. Nuclear power plant inspection, maintenance, and repairs, heavy water technology; 4. Public opinion education. There were 22 reports, altogether

  20. Nuclear power

    International Nuclear Information System (INIS)

    Porter, Arthur.

    1980-01-01

    This chapter of the final report of the Royal Commission on Electric Power Planning in Ontario updates its interim report on nuclear power in Ontario (1978) in the light of the Three Mile Island accident and presents the commission's general conclusions and recommendations relating to nuclear power. The risks of nuclear power, reactor safety with special reference to Three Mile Island and incidents at the Bruce generating station, the environmental effects of uranium mining and milling, waste management, nuclear power economics, uranium supplies, socio-political issues, and the regulation of nuclear power are discussed. Specific recommendations are made concerning the organization and public control of Ontario Hydro, but the commission concluded that nuclear power is acceptable in Ontario as long as satisfactory progress is made in the disposal of uranium mill tailings and spent fuel wastes. (LL)

  1. Nuclear's potential role in desalination

    International Nuclear Information System (INIS)

    Kupitz, J.

    1992-01-01

    Motivated by the growing need for fresh water in developing countries, the International Atomic Energy Agency (IAEA) has promoted a study of the technical and economic viability of using nuclear energy for producing fresh water by desalination of seawater. The outcome of the study is summarized. The most promising desalination processes for large scale water production are outlined and possible energy sources considered. The main incentives for using nuclear energy rather than fossil fuelled plants include: overall energy supply diversification; conservation of limited fossil fuel resources; promotion of technological development; and in particular, environmental protection through the reduction of emissions causing climate change and acid rain. An economic analysis showed that the levelized costs of electricity generation by nuclear power are in general in the same range as those for fossil fuel. Competitiveness depends on the unit size of the plant and interest rates. (UK)

  2. AESJ: communicating about nuclear issues in Japan

    International Nuclear Information System (INIS)

    Anon.

    2016-01-01

    The AESJ (Atomic Energy Society of Japan) was founded in 1959 to promote the information of the Japanese public about nuclear energy and to develop exchanges between professionals of the sector. AESJ gathers about 7000 professionals and is organized around 8 regional groups and 10 technical sessions. AESJ has been publishing 2 journals: Journal of Nuclear Science and Technology since 1964 and ATOMOΣ since 1959. AESJ also awards several prizes for promoting communication and technical achievements in nuclear activities. AESJ takes part into numerous international events like for instance supporting conferences or organizing student exchanges between research centers or universities. (A.C.)

  3. Benefits of using nuclear energy; Os beneficios do uso da energia nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Lira, Elda Vilaca

    2015-11-01

    The purpose of this work is to present, especially for high school students, the benefits of the use of nuclear energy, promoting a deeper knowledge of this technology, encouraging critical thinking of students and society around them.

  4. Nuclear astrophysics

    International Nuclear Information System (INIS)

    Haxton, W.C.

    1992-01-01

    The problem of core-collapse supernovae is used to illustrate the many connections between nuclear astrophysics and the problems nuclear physicists study in terrestrial laboratories. Efforts to better understand the collapse and mantle ejection are also motivated by a variety of interdisciplinary issues in nuclear, particle, and astrophysics, including galactic chemical evolution, neutrino masses and mixing, and stellar cooling by the emission of new particles. The current status of theory and observations is summarized

  5. Nuclear physics

    International Nuclear Information System (INIS)

    Patel, S.B.

    1991-01-01

    This book is a simple and direct introduction to the tools of modern nuclear physics, both experimental and mathematical. Emphasizes physical intuition and illuminating analogies, rather than formal mathematics. Topics covered include particle accelerators, radioactive series, types of nuclear reactions, detection of the neutrino, nuclear isomerism, binding energy of nuclei, fission chain reactions, and predictions of the shell model. Each chapter contains problems and illustrative examples. Pre-requisites are calculus and elementary vector analysis

  6. Nuclear energy

    International Nuclear Information System (INIS)

    Hesketh, Ross.

    1985-01-01

    The subject is treated under the headings: nuclear energy -what is it; fusion (principles; practice); fission (principles); reactor types and systems (fast (neutron) reactors as breeders; fast reactors; thermal reactors; graphite-moderated thermal reactors; the CANDU reactor; light water reactors - the BWR and the PWR); the nuclear fuel cycle (waste storage; fuel element manufacture; enrichment processes; uranium mining); safety and risk assessment; the nuclear power industry and the economy (regulating authorities; economics; advantages and disadvantages). (U.K.)

  7. SPORT PROMOTION STRATEGIES

    Directory of Open Access Journals (Sweden)

    Alexandru Lucian MIHAI

    2013-10-01

    Full Text Available In sport marketing, the word promotion covers a range of interrelated activities. All of these activities are designed to attract attention, stimulate the interest and awareness of consumers, and of course, encourage them to purchase a sport product. Promotion is about communicating with and educating consumers. The purpose of a sport promotional strategy is to build brand loyalty and product credibility, develop image, and position the brand. A promotional strategy is similar to a marketing strategy, but the promotional strategy seeks short-term objectives, both direct and indirect. Promotional objectives usually include increased sales, stimulate impulse buying, raise customer traffic, and present and reinforce image. It also provides information about products and services, publicizes new stores or websites, and creates and enhances customer satisfaction.

  8. Nuclear Asia

    National Research Council Canada - National Science Library

    Ferguson, Joseph; Tarleton, Gael

    2004-01-01

    .... This event was an opportunity for policy makers, security analysts, nuclear scientists and engineers, regional experts, and military planners to share perspectives and identify those issues requiring...

  9. Nuclear cardiology

    International Nuclear Information System (INIS)

    Fish, M.B.

    2002-01-01

    Recent advances in nuclear medicine instrumentation and software, including myocardial perfusion imaging, offer increased accuracy in the detection, diagnosis and prognosis of coronary artery disease. (orig.)

  10. Nuclear medicine

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    The area of nuclear medicine, the development of artificially produced radioactive isotopes for medical applications, is relatively recent. Among the subjects covered in a lengthy discussion are the following: history of development; impact of nuclear medicine; understanding the most effective use of radioisotopes; most significant uses of nuclear medicine radioimmunoassays; description of equipment designed for use in the field of nuclear medicine (counters, scanning system, display systems, gamma camera); description of radioisotopes used and their purposes; quality control. Numerous historical photographs are included. 52 refs

  11. Nuclear Law

    International Nuclear Information System (INIS)

    Pascal, Maurice.

    1979-01-01

    This book on nuclear law is the first of a series of analytical studies to be published by the French Energy Commission (CEA) concerning all the various nuclear activities. It describes national and international legislation applicable in France covering the following main sectors: the licensing procedure for nuclear installations, the law of the sea and nuclear law, the legal system governing radioisotopes, the transport of radioactive materials, third party liability and insurance and radiation protection. In each chapter, the overall analysis is supplemented by the relevant regulatory texts and by organisation charts in annex. (NEA) [fr

  12. Nuclear Safety

    Energy Technology Data Exchange (ETDEWEB)

    Silver, E G [ed.

    1989-01-01

    This document is a review journal that covers significant developments in the field of nuclear safety. Its scope includes the analysis and control of hazards associated with nuclear energy, operations involving fissionable materials, and the products of nuclear fission and their effects on the environment. Primary emphasis is on safety in reactor design, construction, and operation; however, the safety aspects of the entire fuel cycle, including fuel fabrication, spent-fuel processing, nuclear waste disposal, handling of radioisotopes, and environmental effects of these operations, are also treated.

  13. Nuclear power

    International Nuclear Information System (INIS)

    Bupp, I.C.

    1991-01-01

    Is a nuclear power renaissance likely to occur in the United States? This paper investigates the many driving forces that will determine the answer to that question. This analysis reveals some frequently overlooked truths about the current state of nuclear technology: An examination of the issues also produces some noteworthy insights concerning government regulations and related technologies. Public opinion will play a major role in the unfolding story of the nuclear power renaissance. Some observers are betting that psychological, sociological, and political considerations will hod sway over public attitudes. Others wager that economic and technical concerns will prevail. The implications for the nuclear power renaissance are striking

  14. Research on the fundamental process of thermal-hydraulic behaviors in severe accident. Estimation of trigger condition for vapor explosion. JAERI's nuclear research promotion program, H10-027-1. Contract research

    International Nuclear Information System (INIS)

    Nariai, Hideki

    2002-03-01

    The experimental and analytical researches were conducted to study melted core material and coolant interaction including solidification and vapor explosion which is one of the most unidentified thermal hydraulic phenomena during sever accident of nuclear reactor. At first, the effect of the material properties on vapor explosion and solidification was examined to clarify the dominant factors for the spontaneous vapor explosion. Next, the interfacial phenomena of the high temperature melt material and violent boiling behavior of water at the interface was visually observed in the experiment. The interfacial phenomena were physically modeled. Finally, trigger phenomena from liquid-liquid contact to atomization were clarified through the forced collapse experiment of vapor film around a molten droplet by using pressure wave generation device. It is indicated by applying the results obtained in the present study to the actual reactor conditions that the possibility of the vapor explosion is extremely unlikely in the actual reactor accident sequence, since the surface of the molten uranium oxide is solidified in the water and the liquid-liquid contact can not be achieved. It should be noted that the decrease of the solidified temperature by metal compounds and the increase of the molten core temperature. (author)

  15. Research on the fundamental process of thermal-hydraulic behaviors in severe accident. Vapor film collapse behavior on high temperature particle surface. JAERI's nuclear research promotion program, H10-027-3. Contract research

    International Nuclear Information System (INIS)

    Abe, Yutaka

    2002-03-01

    The experimental researches were conducted to study vapor film collapse behavior on high temperature melted core material coarsely mixed in the coolant under the film boiling condition. The film collapse is very important incipient incident of the trigger process for the vapor explosion in sever accident of nuclear reactor. In the experiment, pressure pulse was applied to the vapor film on a high temperature particle surface simulating melted core material to observed microscopic vapor film collapse behavior with a high-speed video camera of 40,500 fps. The particle surface temperature and pressure around the particle were simultaneously measured. The transition of the vapor film thickness and two-dimensional vapor-liquid interface movement and the velocity were estimated with visual data analysis technique, PIV and digital data analysis technique. Furthermore, heat conduction analysis was performed to estimate the vapor-liquid interfacial temperature with the measured temperature and estimated vapor film thickness. As the results, it was clarified that the vapor-liquid interface changed white from transparent view for all the experimental conditions. It is also clarified that the vapor-liquid interfacial temperature decreased under the saturation temperature when the pressure pulse arrive at the particle. The experimental facts indicates the possibility that the vapor film collapse occurs due to the liquid phase homogeneous moving toward the particle drove by the pressure reduction caused by the phase change inside the vapor film. (author)

  16. Research on the fundamental process of thermal-hydraulic behaviors in severe accident. Estimation of trigger condition for vapor explosion. JAERI's nuclear research promotion program, H10-027-1. Contract research

    Energy Technology Data Exchange (ETDEWEB)

    Nariai, Hideki [Tsukuba Univ., Institute of Engineering Mechanics and Systems, Tsukuba, Ibaraki (Japan)

    2002-03-01

    The experimental and analytical researches were conducted to study melted core material and coolant interaction including solidification and vapor explosion which is one of the most unidentified thermal hydraulic phenomena during sever accident of nuclear reactor. At first, the effect of the material properties on vapor explosion and solidification was examined to clarify the dominant factors for the spontaneous vapor explosion. Next, the interfacial phenomena of the high temperature melt material and violent boiling behavior of water at the interface was visually observed in the experiment. The interfacial phenomena were physically modeled. Finally, trigger phenomena from liquid-liquid contact to atomization were clarified through the forced collapse experiment of vapor film around a molten droplet by using pressure wave generation device. It is indicated by applying the results obtained in the present study to the actual reactor conditions that the possibility of the vapor explosion is extremely unlikely in the actual reactor accident sequence, since the surface of the molten uranium oxide is solidified in the water and the liquid-liquid contact can not be achieved. It should be noted that the decrease of the solidified temperature by metal compounds and the increase of the molten core temperature. (author)

  17. Research on the fundamental process of thermal-hydraulic behaviors in severe accident. Vapor film collapse behavior on high temperature particle surface. JAERI's nuclear research promotion program, H10-027-3. Contract research

    Energy Technology Data Exchange (ETDEWEB)

    Abe, Yutaka [Tsukuba Univ., Institute of Engineering Mechanics and Systems, Tsukuba, Ibaraki (Japan)

    2002-03-01

    The experimental researches were conducted to study vapor film collapse behavior on high temperature melted core material coarsely mixed in the coolant under the film boiling condition. The film collapse is very important incipient incident of the trigger process for the vapor explosion in sever accident of nuclear reactor. In the experiment, pressure pulse was applied to the vapor film on a high temperature particle surface simulating melted core material to observed microscopic vapor film collapse behavior with a high-speed video camera of 40,500 fps. The particle surface temperature and pressure around the particle were simultaneously measured. The transition of the vapor film thickness and two-dimensional vapor-liquid interface movement and the velocity were estimated with visual data analysis technique, PIV and digital data analysis technique. Furthermore, heat conduction analysis was performed to estimate the vapor-liquid interfacial temperature with the measured temperature and estimated vapor film thickness. As the results, it was clarified that the vapor-liquid interface changed white from transparent view for all the experimental conditions. It is also clarified that the vapor-liquid interfacial temperature decreased under the saturation temperature when the pressure pulse arrive at the particle. The experimental facts indicates the possibility that the vapor film collapse occurs due to the liquid phase homogeneous moving toward the particle drove by the pressure reduction caused by the phase change inside the vapor film. (author)

  18. Japan's regulatory and safety issues regarding nuclear materials transport

    International Nuclear Information System (INIS)

    Saito, T.; Yamanaka, T.

    2004-01-01

    This paper focuses on the regulatory and safety issues on nuclear materials transport which the Government of Japan (GOJ) faces and needs to well handle. Background information about the status of nuclear power plants (NPP) and nuclear fuel cycle (NFC) facilities in Japan will promote a better understanding of what this paper addresses

  19. The nuclear complex: Links between civil atom and military atom

    International Nuclear Information System (INIS)

    Barrillot, B.

    2005-02-01

    The fight against proliferation is topical. For lack of forgetting nuclear weapons, the international community makes the choice to limit the club of nuclear weapon owners. Nobody ignores that the way to reach bomb is the development of civil nuclear industry ( peaceful aim) these ones that want to stop the proliferation are the ardent promoters of this industry. (N.C.)

  20. Health promotion in globalization

    Directory of Open Access Journals (Sweden)

    Álvaro Franco-Giraldo

    2012-10-01

    Full Text Available Objective: to unravel some theoretical and factual elements required to implement more effective health promotion strategies and practices in the field of health services whilst following the great challenges that globalization has imposed on the health systems, which are inevitably expressed in the local context (glocalization. Methodology: a narrative review taking into account the concepts of globalization and health promotion in relation to health determinants. The authors approach some courses of action and strategies for health promotion based on the social principles and universal values that guide health promotion, health service reorientation and primary healthcare, empowerment, social participation, and inter-sectoral and social mobilization. Discussion: the discussion focuses on the redirection of health promotion services in relation to the wave of health reforms that has spread throughout the world under the neoliberal rule. The author also discusses health promotion, its ineffectiveness, and the quest for renewal. Likewise, the author sets priorities for health promotion in relation to social determinants. Conclusion: the current global order, in terms of international relations, is not consistent with the ethical principles of health promotion. In this paper, the author advocates for the implementation of actions to change the social and physical life conditions of people based on changes in the use of power in society and the appropriate practice of politics in the context of globalization in order to achieve the effectiveness of the actions of health promotion.

  1. Canada's nuclear non-proliferation policy

    International Nuclear Information System (INIS)

    1982-05-01

    Canada's non-proliferation safeguards policy has two objectives: 1) to promote a more effective and comprehensive international non-proliferation regime; and 2) to ensure that Canadian nuclear exports will not be used for any nuclear explosive purpose. By emphasizing the key role of the Non-Proliferation Treaty, promoting reliance upon and improvements in the IAEA safeguards system, treating nuclear weapon and non-weapon states alike, and working for new approaches covering reprocessing, Canada promotes attainment of the first objective. The second is served through the network of bilateral nuclear agreements that Canada has put into place with its partners. The Canadian objective in post-INFCE forums is to persuade the international community to devise a more effective and comprehensive non-proliferation regime into which Canada and other suppliers may subsume their national requirements

  2. Nuclear stress test

    Science.gov (United States)

    ... Persantine stress test; Thallium stress test; Stress test - nuclear; Adenosine stress test; Regadenoson stress test; CAD - nuclear stress; Coronary artery disease - nuclear stress; Angina - nuclear ...

  3. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    International Nuclear Information System (INIS)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-01-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  4. G-protein coupled receptor 56 promotes myoblast fusion through serum response factor- and nuclear factor of activated T-cell-mediated signalling but is not essential for muscle development in vivo.

    Science.gov (United States)

    Wu, Melissa P; Doyle, Jamie R; Barry, Brenda; Beauvais, Ariane; Rozkalne, Anete; Piao, Xianhua; Lawlor, Michael W; Kopin, Alan S; Walsh, Christopher A; Gussoni, Emanuela

    2013-12-01

    Mammalian muscle cell differentiation is a complex process of multiple steps for which many of the factors involved have not yet been defined. In a screen to identify the regulators of myogenic cell fusion, we found that the gene for G-protein coupled receptor 56 (GPR56) was transiently up-regulated during the early fusion of human myoblasts. Human mutations in the gene for GPR56 cause the disease bilateral frontoparietal polymicrogyria; however, the consequences of receptor dysfunction on muscle development have not been explored. Using knockout mice, we defined the role of GPR56 in skeletal muscle. GPR56(-/-) myoblasts have decreased fusion and smaller myotube sizes in culture. In addition, a loss of GPR56 expression in muscle cells results in decreases or delays in the expression of myogenic differentiation 1, myogenin and nuclear factor of activated T-cell (NFAT)c2. Our data suggest that these abnormalities result from decreased GPR56-mediated serum response element and NFAT signalling. Despite these changes, no overt differences in phenotype were identified in the muscle of GPR56 knockout mice, which presented only a mild but statistically significant elevation of serum creatine kinase compared to wild-type. In agreement with these findings, clinical data from 13 bilateral frontoparietal polymicrogyria patients revealed mild serum creatine kinase increase in only two patients. In summary, targeted disruption of GPR56 in mice results in myoblast abnormalities. The absence of a severe muscle phenotype in GPR56 knockout mice and human patients suggests that other factors may compensate for the lack of this G-protein coupled receptor during muscle development and that the motor delay observed in these patients is likely not a result of primary muscle abnormalities. © 2013 FEBS.

  5. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Energy Technology Data Exchange (ETDEWEB)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  6. Nuclear physics for nuclear fusion

    International Nuclear Information System (INIS)

    Li Xingzhong; Liu Bin; Wei Qingming; Ren Xianzhe

    2004-01-01

    The D-T fusion cross-section is calculated using quantum mechanics with the model of square nuclear potential well and Coulomb potential barrier. The agreement between ENDF data and the theoretically calculated results is well in the range of 0.2-280 keV. It shows that the application of Breit-Wigner formula is not suitable for the case of the light nuclei fusion reaction. When this model is applied to the nuclear reaction between the charged particles confined in a lattice, it explains the 'abnormal phenomena'. It implies a prospect of nuclear fusion energy without strong nuclear radiations

  7. Nuclear installations

    International Nuclear Information System (INIS)

    2001-01-01

    This document presents the fulfilling of the Brazilian obligations under the Convention on Nuclear Safety. The Chapter 2 of the document contains some details about the existing Brazilian nuclear installations. Also, safety improvements at Angra 1 and aspects of Angra 2 and 3 are reported

  8. Nuclear safety

    International Nuclear Information System (INIS)

    1991-02-01

    This book reviews the accomplishments, operations, and problems faced by the defense Nuclear Facilities Safety Board. Specifically, it discusses the recommendations that the Safety Board made to improve safety and health conditions at the Department of Energy's defense nuclear facilities, problems the Safety Board has encountered in hiring technical staff, and management problems that could affect the Safety Board's independence and credibility

  9. Nuclear violence

    International Nuclear Information System (INIS)

    Mullen, R.K.

    1987-01-01

    A great deal of attention has been paid in the past decade or so to the characteristics of terrorists and their apparent goals and objectives, capabilities, and evolving strategy and tactics with respect to nuclear terrorism. In contrast, little has been said about the procedural aspects of nuclear terrorism, and even less about the way in which such endeavors can fail. This latter omission is important because it bears directly on the ability to evaluate credibly the potential for nuclear terrorism. Here, the author addresses the requirements inherent in acquiring a nuclear explosive capability by three routes: separation of plutonium from irradiated light or heavy water reactor (LWR or HWR) fuel, processing, or use of separated fissile material, and theft of a nuclear weapon. In addition, he deals with other potential acts of nuclear terrorism: sabotage of power reactors, uranium enrichment facilities and spent nuclear fuel in transport, and dispersal of radioactive materials, in particular, plutonium. He specifically does not look at the design or production of a nuclear weapon. Finally, the discussion here assumes that the terrorist is subnational; that is, a nation is not involved. Also, the discussion of subnational participation does not address the possibility of collusion with insiders

  10. Nuclear installations

    International Nuclear Information System (INIS)

    1998-01-01

    This document presents the fulfilling of the Brazilian obligations under the Convention on Nuclear Safety. The Chapter 2 of the document contains some details about the existing Brazilian nuclear installations. Also, safety improvements at Angra 1 and aspects of Angra 2 and 3 are reported

  11. Nuclear power

    International Nuclear Information System (INIS)

    Abd Khalik Wood

    2003-01-01

    This chapter discuss on nuclear power and its advantages. The concept of nucleus fission, fusion, electric generation are discussed in this chapter. Nuclear power has big potential to become alternative energy to substitute current conventional energy from coal, oil and gas

  12. Nuclear energy

    International Nuclear Information System (INIS)

    1978-01-01

    This brochure is intended as a contribution to a better and more general understanding of one of the most urgent problems of present society. Emphasis is laid on three issues that are always raised in the nuclear debate: 1) Fuel cycle, 2) environmental effects of nuclear power plants, 3) waste disposal problems. (GL) [de

  13. Nuclear pollution

    International Nuclear Information System (INIS)

    Ramade, Francois

    1979-01-01

    In this chapter devoted to nuclear pollution the following topics were studied: fundamentals of radiobiology (ecological importance of the various radioisotopes, biological effects of ionizing radiations); ecological effects of radioactive fallout (contamination of atmosphere, terrestrial ecosystems, oceans). The electronuclear industry and its environmental impact. PWR type reactors, fuel reprocessing plants, contamination of trophic chains by radionuclides released in the environment from nuclear installations [fr

  14. Nuclear lifetimes

    International Nuclear Information System (INIS)

    Caraca, J.M.G.

    1976-01-01

    The importance of the results obtained in experiments of measurement of lifetimes for a detailed knowledge of nuclear structure is referred. Direct methods of measurement of nuclear lifetimes are described, namely, electronic methods, recoil-distance method, doppler shift atenuation method and blocking-method. A brief reference is made to indirect methods for measurement of life-times

  15. Nuclear facts

    International Nuclear Information System (INIS)

    1982-01-01

    The subject is discussed as follows: the case for using nuclear energy (Britain's energy needs; energy policy); safety; transport of spent fuel; radiation (natural radioactivity); environment (land use of nuclear power plants; storage and disposal of radioactive wastes). (U.K.)

  16. Nuclear waste processing

    International Nuclear Information System (INIS)

    Nienhuys, K.; Noordegraaf, D.

    1977-04-01

    This report is composed with a view to the discussions around the selection of a site in F.R.Germany near the Netherlands' border for a fuel reprocessing plant. Most of the scientific data available are placed side by side, especially those which are contradictory in order to promote better judgement of affairs before governmental decisions are made. The report comprises a brief introduction to nuclear power plants, fuel cycle, radioactive materials and their properties. Next the transportation of wastes from the nuclear power plants to the reprocessing plants is dealt with more extensively, including the processing and the effluents of as well as the experiences with operational reprocessing plants. The hazards from manipulation of radioactive materials accidents and theft are outlined in each case, followed by a problem discussion. The appendix illustrates the German concept of 'industrial park for after-treatment and disposal'

  17. The nuclear industry and the young generation

    International Nuclear Information System (INIS)

    Hanti, A.

    2000-01-01

    The European Nuclear Society was founded in 1975. It is a federation of 25 nuclear societies from 24 countries-stretching from the Atlantic to the Urals and on across Russia to the Pacific. Through Russia's membership in the Pacific Nuclear Council. ENS is directly linked to that area, too. ENS comprises more than 20 000 professionals from industry, power stations, research centers and authorities, working to advance nuclear energy. ENS has three Member Societies in Australia, Israel and Morocco. Also it has collaboration agreements with the American Nuclear Society, the Argentinean Nuclear Energy Association, the Canadian and the Chinese Nuclear Societies. ENS is doing pioneering work with its Young Generation Network, standing for positive measures to recruit and educate young people as engineers, technicians and skilled staff ion the nuclear field: from school to university and in industry. The goals of the YGN are: to promote the establishment of national Young Generation networks; to promote the exchange of knowledge between older and younger generation cross-linked all over Europe; to encourage young people in nuclear technology to provide a resource for the future; to communicate nuclear issues to the public (general public, media, politicians). (N.C.)

  18. Nuclear Waste Education Project

    International Nuclear Information System (INIS)

    1989-01-01

    In summary, both the Atlanta and Albuquerque pilot seminars achieved the Nuclear Waste Education Project's goal of informing citizens on both the substance and the process of nuclear waste policy so that they can better participate in future nuclear waste decisions. Nuclear waste issues are controversial, and the seminars exposed the nature of the controversy, and utilized the policy debates to create lively and provocative sessions. The format and content of any citizen education curriculum must be made to fit the particular goal that has been chosen. If the Department of Energy and the LWVEF decide to continue to foster an informed dialogue among presenters and participants, the principles of controversial issues education would serve this goal well. If, however, the Department of Energy and/or the LWVEF decide to go beyond imparting information and promoting a lively discussion of the issues, towards some kind of consensus-building process, it would be appropriate to integrate more interactive sessions into the format. As one evaluator wrote, ''In-depth participation in finding solutions or establishing policy -- small group discussion'' would have been preferable to the plenary sessions that mostly were in the form of lectures and expert panel discussion. The evaluator continued by saying, ''Since these [small group discussions] would require more time commitment, they might be part of follow-up workshops focused on particular topics.''

  19. The nuclear energy debate

    International Nuclear Information System (INIS)

    Rippon, S.

    1976-01-01

    With reference to the public discussion which is taking place at the moment concerning the future of nuclear energy in the UK, the document from the Advisory Council on Research and Development for Fuel and Power and also the report of the Royal Commission on Environmental Pollution are considered. Although there have been many other projections of UK and world energy requirements prepared by many different organisations, few cover such a wide range of scenarios in such detail as the ACORD report. The Royal Commission report contains many reassuring findings on the more extreme claims of the worldwide anti-nuclear movement, but one cannot read it without gaining the impression that the nuclear option is the energy source they would most like to do without. It is felt that against this background, it would seem to be time for the power industry to stop defending nuclear energy as an acceptable necessity and rather promoting it as the best energy option. (U.K.)

  20. Nuclear medicine in Ghana

    International Nuclear Information System (INIS)

    Affram, R.K.; Kyere, K.; Amuasi, J.

    1991-01-01

    The background to the introduction and application of radioisotopes in medicine culminating in the establishment of the nuclear Medicine Unit at the Korle Bu Teaching Hospital, Ghana, has been examined. The Unit has been involved in important clinical researches since early 1970s but routine application in patient management has not always been possible because of cost per test and lack of continuous availability of convertible currency for the purchase of radioisotopes which are not presently produced by the National Nuclear Research Institute at Kwabenya. The capabilities and potentials of the Unit are highlighted and a comparison of Nuclear Medicine techniques to other medical diagnostic and imaging methods have been made. There is no organised instruction in the principles of medical imaging and diagnostic methods at both undergraduate and postgraduate levels in Korle Bu Teaching Hospital which has not promoted the use of Nuclear Medicine techniques. The development of a comprehensive medical diagnostic and imaging services is urgently needed. (author). 18 refs., 3 tabs

  1. From the nuclear world

    International Nuclear Information System (INIS)

    Anon.

    2017-01-01

    This document gathers pieces of information from around the world concerning nuclear industry. The most relevant ones are the following. AREVA NP and EDF have created a new society EDVANCE to combine their engineering teams in the fields of reactor core design and construction. The German Constitutional Court considers as illegal the nuclear fuel tax that was implemented in 2010 to balance public finance and fund the remediation of the Ass salt mine. In France on the Tricastin AREVA's site the ATLAS laboratory has opened its doors, it is the laboratory that will perform all the environmental and industrial analyses of this site. In Japan the reactors 3 and 4 of the Takahama power plant have resumed operations. Today 5 nuclear power reactors are operating on Japanese soil. The Indian government has announced its intention to build heavy water cooled nuclear reactors based on an Indian design. 22 reactors are operating in India representing a total of 6780 MW and 5 others are being built. According to the 'SMR Start' consortium public-private partnership contracts have to be promoted in order to launch the small modular reactor (SMR) technology. (A.C.)

  2. Nuclear measurements

    International Nuclear Information System (INIS)

    Schenkel, R.

    2005-01-01

    Nuclear measurements play a fundamental role in the development of nuclear technology and the assurance of its peaceful use. They are also required in many non-power nuclear applications such as in nuclear medicine, agriculture, environmental protection, etc. This presentation will show examples of most recent advances in measurement methodology or technology in the areas described below. The Generation IV International Forum has selected six innovative reactor systems as candidates for a next generation of sustainable, economic and safe nuclear energy systems. The choice of the best options relies heavily on the availability of accurate nuclear data that can only be obtained, in an international effort, using highly specialised facilities. Significant efforts are being directed towards the partitioning and transmutation of highly active nuclear waste. Different concepts involving fast reactors or accelerator-driven systems are being studied in view of their transmutation capabilities. State of the art equipment has been developed to assess basic properties of nuclear fuel at very high burn-up; some fine examples of this work will be shown. Physical and chemical methods play a crucial role in the detection and identification of radioisotopes used in various stages of the nuclear fuel cycle. Radiation measurement techniques are used, for example, to monitor the quantities of uranium, plutonium and other actinide elements in fuel enrichment and reprocessing facilities. Another field of application of physical and chemical methods is the characterisation of nuclear material seized from illicit trafficking. Seized material has to be analysed in order to obtain clues on its origin and intended use and to prevent diversion of nuclear material from the same source in the future. A recent highlight in basic physics relates to nuclear fission and transmutation with high intensity lasers. Ultra-fast high intensity lasers can produce high energy (tens of MeV) photons through

  3. Nuclear rockets

    International Nuclear Information System (INIS)

    Sarram, M.

    1972-01-01

    Nuclear energy has found many applications in space projects. This article deals with these applications. The first application is the use of nuclear energy for the production of electricity in space and the second main application is the use of nuclear energy for propulsion purposes in space flight. The main objective is to develop a 75000 pound thrust flight engine call NERVA by heating liquid hydrogen, in a nuclear reactor, from 420F to 4000 0 F. The paper describes in detail the salient features of the NERVA rocket as well as its comparison with the conventional chemical rockets. It is shown that a nuclear rocket using liquid hydrogen as medium is at least 85% more efficient as compared with the chemical rockets such as those used for the APOLLO moon flight

  4. Nuclear rockets

    Energy Technology Data Exchange (ETDEWEB)

    Sarram, M [Teheran Univ. (Iran). Inst. of Nuclear Science and Technology

    1972-02-01

    Nuclear energy has found many applications in space projects. This article deals with these applications. The first application is the use of nuclear energy for the production of electricity in space and the second main application is the use of nuclear energy for propulsion purposes in space flight. The main objective is to develop a 75000 pound thrust flight engine called NERVA by heating liquid hydrogen in a nuclear reactor. The paper describes in detail the salient features of the NERVA rocket as well as its comparison with the conventional chemical rockets. It is shown that a nuclear rocket using liquid hydrogen as medium is at least 85% more efficient as compared with the chemical rockets such as those used for the APOLLO moon flight.

  5. Nuclear haematology

    International Nuclear Information System (INIS)

    Masjhur, J.S.

    1992-01-01

    Nuclear techniques have been applied to study diagnose and treat various haematological disorders for more than five decades. Two scientists are regarded as pioneers in this field, i.e. John Lawrence who in 1938 used 32 P to treat chronic myeloid leukaemia and George Hevessy who used 32 P labelled erythrocytes to measure blood volume in 1939. At present, many nuclear medicine procedures are available for diagnosis and therapy of a variety of haematological disorders. Although nuclear techniques are somewhat complex, they give direct and quantitative assessment of the kinetics of blood elements as compared to other non-isotopic haematological tests. Basically, equipment required for nuclear haematology is very simple such as well scintillation counters to measure radioactivity in blood samples. More sophisticated equipment like rectilinear scanner or gamma camera is required when imaging is necessary. An overview of the basic principles and clinical applications of nuclear haematology is given

  6. Nuclear forensics

    International Nuclear Information System (INIS)

    Venugopal, V.

    2010-01-01

    Increasing threat by terrorists for a possible nuclear attack is particularly alarming in recent years. The likelihood of such an event is highly uncertain but cannot be ruled out. The consequence of such an event would be highly disastrous and the implications could be far-reaching both socially and politically. It is feared that significant amount of nuclear weapons materials may be kept under poor security. Therefore, there is a greater demand with utmost priority to curb nuclear terrorism by adapting proper security measures. One of the most important measures is to stop illicit trafficking of nuclear materials which are the source of building nuclear explosive devices. According to the IAEA illicit trafficking database (ITDB) report, a total number of 252 incidents were reported in 2006, of which 150 occurred in 2006 and the remaining 102 had taken place prior to that year, mainly in 2005

  7. Nuclear Safety

    International Nuclear Information System (INIS)

    1978-09-01

    In this short paper it has only been possible to deal in a rather general way with the standards of safety used in the UK nuclear industry. The record of the industry extending over at least twenty years is impressive and, indeed, unique. No other industry has been so painstaking in protection of its workers and in its avoidance of damage to the environment. Headings are: introduction; how a nuclear power station works; radiation and its effects (including reference to ICRP, the UK National Radiological Protection Board, and safety standards); typical radiation doses (natural radiation, therapy, nuclear power programme and other sources); safety of nuclear reactors - design; key questions (matters of concern which arise in the public mind); safety of operators; safety of people in the vicinity of a nuclear power station; safety of the general public; safety bodies. (U.K.)

  8. Nuclear proliferation

    International Nuclear Information System (INIS)

    Stencel, S.

    1978-01-01

    The terms and reactions to President Carter's nuclear policy, culminating in the 1978 Nuclear Non-Proliferation Act, are reviewed and analyzed. The new law increases restrictions on nuclear exports, encourages continued use of light water reactors in preference to plutonium-fueled reactors, and emphasizes technical solutions to proliferation problems. Critics of the law point out that it will hurt U.S. trade unfairly, that other countries do not have as many fuel options as the U.S. has, and that nuclear sales have as many political and economic as technical solutions. Compromise areas include new international safety guidelines, the possibility of an international nuclear fuel bank, and a willingness to consider each case on its merits. 21 references

  9. Nuclear privatization

    International Nuclear Information System (INIS)

    Jeffs, E.

    1995-01-01

    The United Kingdom government announced in May 1995 plans to privatize the country's two nuclear generating companies, Nuclear Electric and Scottish Nuclear. Under the plan, the two companies will become operating divisions of a unified holding company, to be called British Electric, with headquarters in Scotland. Britain's nuclear plants were left out of the initial privatization in 1989 because the government believed the financial community would be unwilling to accept the open-ended liability of decommissioning the original nine stations based on the Magnox gas-cooled reactor. Six years later, the government has found a way around this by retaining these power stations in state ownership, leaving the new nuclear company with the eight Advanced Gas-cooled Reactor (AGR) stations and the recently completed Sizewell B PWR stations. The operating Magnox stations are to be transferred to BNFL, which operates two Magnox stations of their own at Calder Hall and Chapelcross

  10. Nuclear haematology

    Energy Technology Data Exchange (ETDEWEB)

    Masjhur, J S

    1993-12-31

    Nuclear techniques have been applied to study diagnose and treat various haematological disorders for more than five decades. Two scientists are regarded as pioneers in this field, i.e. John Lawrence who in 1938 used {sup 32}P to treat chronic myeloid leukaemia and George Hevessy who used {sup 32}P labelled erythrocytes to measure blood volume in 1939. At present, many nuclear medicine procedures are available for diagnosis and therapy of a variety of haematological disorders. Although nuclear techniques are somewhat complex, they give direct and quantitative assessment of the kinetics of blood elements as compared to other non-isotopic haematological tests. Basically, equipment required for nuclear haematology is very simple such as well scintillation counters to measure radioactivity in blood samples. More sophisticated equipment like rectilinear scanner or gamma camera is required when imaging is necessary. An overview of the basic principles and clinical applications of nuclear haematology is given

  11. Promoter reuse in prokaryotes

    NARCIS (Netherlands)

    Nijveen, H.; Matus-Garcia, M.; Passel, van M.W.J.

    2012-01-01

    Anecdotal evidence shows promoters being reused separate from their downstream gene, thus providing a mechanism for the efficient and rapid rewiring of a gene’s transcriptional regulation. We have identified over 4000 groups of highly similar promoters using a conservative sequence similarity search

  12. Health promotion in context:

    DEFF Research Database (Denmark)

    Liveng, Anne; Andersen, Heidi Myglegård; Lehn Christiansen, Sine

    2018-01-01

    Health promotion constitutes a complex field of study, as it addresses multifaceted problems and involves a range of methods and theories. Students in the field of health promotion can find this challenging. To raise their level of reflexivity and support learning we have developed the “context m...

  13. Nuclear energy development and national economy

    International Nuclear Information System (INIS)

    Fukami, Hiroaki

    1982-01-01

    The utilization and development of nuclear power in Japan are now advanced on the basis of a fact that nuclear power generation has taken root in the country. The scale of nuclear power generation is currently a total of 22 power plants with aggregate capacity over 15,500 MW, 16% of the total power generation. There are still two alternate arguments: i.e. whether nuclear energy can be a complete substitute of petroleum or not, because the consumption of petroleum is necessary for the fuel cycle. Due to the rise of petroleum price, the nuclear power generation is now positively economical. On the other hand, the promotion of nuclear power can lead to the saving in foreign currency. While the economy in nuclear power is through the use of LWRs presently, the research and development efforts in ATRs, FBRs, etc. are essential for the future. (Mori, K.)

  14. On modern needs in nuclear physics and nuclear safety education

    International Nuclear Information System (INIS)

    Tom Loennroth

    2005-01-01

    The teaching of nuclear physics has a long history, particularly after the second world war, and the present author has 20 years of experience of teaching in that field. The research in nuclear physics has made major advances over the years, and the experiments become increasingly sophisticated. However, very often the university literature lags the development, as is, indeed, the case in all physics education. As a remedy of to-day, the didactic aspects are emphasized, especially at a basic level, while the curriculum content is. still left without upgrade. A standard textbook in basic nuclear physics is, while represent more modern theoretical treatises. The latter two, as their headings indicate, do not treat experimental methods, whereas has a presentation that illustrates methods and results with figures and references. However, they are from the 60 s and 70 s, they are old, and therefore cannot attract modern students of today. Consequently, one has the inevitable feeling that modern university teaching in nuclear physics, and the related area of nuclear safety, must be upgraded. A recent report in Finland, concluded that there is not sufficient nuclear safety education, but that on the other hand, it does not necessarily have to be connected with nuclear physics education, although this is recommendable. Further, the present Finnish university law states that 'The mission of the university shall be to promote free research and scientific and artistic education, to provide higher education based on research, and. to educate students to serve their country and humanity. In carrying out their mission, the universities shall interact with the surrounding society and promote the societal impact o research finding and artistic activities'. This mismatch between the curricula and the required 'societal impact' will be discussed, and examples of implications, usually not implemented, will be given. For nuclear physics specifically, the (lack of) connection between

  15. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  16. Health-promoting schools

    DEFF Research Database (Denmark)

    Kwan, Stella Y L; Petersen, Poul Erik; Pine, Cynthia M

    2005-01-01

    Schools provide an important setting for promoting health, as they reach over 1 billion children worldwide and, through them, the school staff, families and the community as a whole. Health promotion messages can be reinforced throughout the most influential stages of children's lives, enabling...... them to develop lifelong sustainable attitudes and skills. Poor oral health can have a detrimental effect on children's quality of life, their performance at school and their success in later life. This paper examines the global need for promoting oral health through schools. The WHO Global School...... Health Initiative and the potential for setting up oral health programmes in schools using the health-promoting school framework are discussed. The challenges faced in promoting oral health in schools in both developed and developing countries are highlighted. The importance of using a validated...

  17. International Nuclear Security Education Network (INSEN) and the Nuclear Security Training and Support Centre (NSSC) Network

    International Nuclear Information System (INIS)

    Nikonov, Dmitriy

    2013-01-01

    International Nuclear Security Education Network established in 2010: A partnership between the IAEA and universities, research institutions and other stakeholders - •Promotion of nuclear security education; • Development of educational materials; • Professional development for faculty members; • Collaborative research and resource sharing. Currently over 90 members from 38 member states. Mission: to enhance global nuclear security by developing, sharing and promoting excellence in nuclear security education. Nuclear Security Support Centre: Primary objectives are: • Develop human resources through the implementation of a tailored training programme; • Develop a network of experts; • Provide technical support for lifecycle equipment management and scientific support for the detection of and the response to nuclear security events

  18. Nuclear technology and anthroposophic theory

    International Nuclear Information System (INIS)

    Leben, S.

    1982-01-01

    The construction of nuclear power plants as a solution to the current energy, crisis is controversial. That was not so in the beginning of the 'peaceful' utilization of nuclear power; with thousands of millions to promote it given as subsidies by the governments it was developing fast, until citizens' initiatives asked ecologic and moral questions delaying the further extension of this energy production. Both positions can be substantiated. But can a first judgement, too, be given with any degree of safety. And what cognitive aids are provided by the anthroposophic theory. This is demonstrated in some aspects. From the contents: The energy crisis and its apparent way out; of the causes: modern scientific methods; New forces: some facts and phenomena; Destructive powers as viewed by ancient mysteries; Of desirable states of conscience and technical forms; spelling their distortion; Nuclear powers and morality; Untimeliness in historicity; 'What's the stance of anthroposophic theory with regard to nuclear technology'. (orig./HP) [de

  19. Young generation in Romanian nuclear system - Romanian nuclear organizations implication in nuclear knowledge management at University 'Politehnica' of Bucharest - Results and expectations

    International Nuclear Information System (INIS)

    Ghizdeanu, E.N.; Dumitrescu, M.C.; Budu, A.R.; Pavelescu, A.O.

    2004-01-01

    The knowledge management should be assumed by the major players within the nuclear community: government, industry and university. Starting from these problems this article gives an overview about Romanian nuclear knowledge management and the Young Generation implications. In Romania there are many government and non-government nuclear institutions such: CNCAN (Romanian Regulatory Body), ROMATOM (Romanian Atomic Forum), AREN (Romanian 'Nuclear Energy' Association), and companies: SNN ('Nuclearelectrica' SA National Company), CITON (Centre of Technology and Engineering for Nuclear Projects), SCN (Institute for Nuclear Research), ROMAG - PROD (Romanian Heavy Water Plant). All these institutes and companies are sustaining the national nuclear program and promoting the new technologies in the nuclear industry according with CNCAN and ROMATOM regulations. University 'POLITEHNICA' of Bucharest - Power Engineering Faculty - through Nuclear Power Plant Department is the promoter of nuclear knowledge management. It is implied in assuring and maintaining a high-quality training for young staff. Young Generation is implicated in nuclear knowledge management through University 'Politehnica' of Bucharest - Power Engineering Faculty - Nuclear Power Plant Department and AREN (Romanian 'Nuclear Energy' Association). Young Generation Department has special educational programs for attracting and supporting students. It provides adequate information and interacts with potential students. Moreover the article gives results about Romanian nuclear engineers since 1970 till now. An analysis of these data is done. Also it is discussed how University 'Politehnica' of Bucharest, the Romanian Government and the Industry work together to co-ordinate more effectively their efforts to encourage the young generation. (author)

  20. Nuclear questions

    Energy Technology Data Exchange (ETDEWEB)

    Durrani, M. [Physics World (United Kingdom)

    2006-01-01

    The future of nuclear power has returned to centre stage. Freezing weather on both sides of the Atlantic and last month's climate-change talks in Montreal have helped to put energy and the future of nuclear power right back on the political agenda. The issue is particularly pressing for those countries where existing nuclear stations are reaching the end of their lives. In the UK, prime minister Tony Blair has commissioned a review of energy, with a view to deciding later this year whether to build new nuclear power plants. The review comes just four years after the Labour government published a White Paper on energy that said the country should keep the nuclear option open but did not follow this up with any concrete action. In Germany, new chancellor and former physicist Angela Merkel is a fan of nuclear energy and had said she would extend the lifetime of its nuclear plants beyond 2020, when they are due to close. However, that commitment has had to be abandoned, at least for the time being, following negotiations with her left-wing coalition partners. The arguments in favour of nuclear power will be familiar to all physicists - it emits almost no carbon dioxide and can play a vital role in maintaining a diverse energy supply. To over-rely on imported supplies of oil and gas can leave a nation hostage to fortune. The arguments against are equally easy to list - the public is scared of nuclear power, it generates dangerous waste with potentially huge clean-up costs, and it is not necessarily cheap. Nuclear plants could also be a target for terrorist attacks. Given political will, many of these problems can be resolved, or at least tackled. China certainly sees the benefits of nuclear power, as does Finland, which is building a new 1600 MW station - the world's most powerful - that is set to open in 2009. Physicists, of course, are essential to such developments. They play a vital role in ensuring the safety of such plants and developing new types of

  1. A study on the nuclear foreign policy analysis

    International Nuclear Information System (INIS)

    Oh, Keun Bae; Choi, Y. M.; Lee, D. J.; Lee, K. S.; Lee, B. W.; Cho, I. H.; Ko, H. S.

    1996-12-01

    This study aims to analyses recent trends of international situation relating to nuclear non-proliferation and the adverse conditions in Korea's pursuing self-support of such technology, so that it may map out effective strategies for the promotion of nuclear energy. This study analyses developments of international nuclear non-proliferation regime, which plays a main role in preventing the international proliferation of nuclear weapons. This study includes NPT, IAEA safeguards system, international export control regimes, CTBT, and NWFZs as the subjects of analysis. Second theme is international organizations concerning nuclear activities. This study mainly analyses IAEA activities which pursues the promotion of peaceful use of nuclear energy and nuclear non-proliferation simultaneously as a pivotal body of international nuclear cooperation. Third focus of this study is Northeast Asian circumstances pertaining to nuclear non-proliferation. The study looks into the DPRK nuclear issues, and reviews the developments of the proposed regional body for nuclear cooperation and the discussion on the Northeast Asian NWFZ. Fourth, but the most influential to Korean nuclear activities, is the U. S. nuclear policy, since U. S. takes the overwhelming initiative in the field of international nuclear non-proliferation. Therefore, this study gives much weight in analyzing the structure, procedures, recent trend, and pending issues of U. S. nuclear policy. (author). 78 refs., 5 tabs., 4 figs

  2. Analysis of Malaysian Nuclear Agency Key Performance Indicator (KPI) 2005-2013

    International Nuclear Information System (INIS)

    Aisya Raihan Abdul Kadir; Hazmimi Kasim; Azlinda Aziz; Noriah Jamal

    2014-01-01

    Malaysia Nuclear Agency (Nuclear Malaysia) was established on 19 September 1972. Since its inception, Nuclear Malaysia has been entrusted with the responsibility to introduce and promote nuclear science and technology for national development. After more than 40 years of operation, Nuclear Malaysia remains significant as an excellent organization of science, technology and innovation. An analysis of the key performance indicator (KPI) achievements in 2005-2013 as indicator to the role of Nuclear Malaysia as a national research institution. It was established to promote, develop and encourage the application of nuclear technology. (author)

  3. Capitalizing the contribution of the nuclear industry

    International Nuclear Information System (INIS)

    Donnadieu, G.

    1984-01-01

    The main contributions of the French nuclear industry to the country, and ways to make the most of them are presented. The advantages acquired include the nuclear power stations built; mastering of the combustion cycle; a powerful, well structured nuclear construction industry; and a nuclear-industrial complex giving France an important industrial potential. It is recommended that the industrial and research effort be maintained. The proposed strategy consists of defining an electronuclear program and associated economic development program and sticking to them; promoting exports; possibly merging certain industrial capacities; and strengthening the national position and independence concerning the fuel cycle [fr

  4. Nuclear techniques in agriculture in the Philippines

    International Nuclear Information System (INIS)

    Medina, F.I.S. III; Medina, V.F.O.

    1994-01-01

    Nuclear techniques, both isotopic tracers and radiation have been utilized in the Philippine agricultural research and development to improve food production, reduce food losses and protect the environment. The Philippine Nuclear Research Institute (PNRI), a government agency has been mandated to promote the peaceful application of nuclear energy to accelerate national development. It takes the lead role in nuclear assisted agricultural research and development and has adopted a two-pronged approach for food and agricultural R and D by increasing productivity through crop improvement by mutation breeding, soil management and fertilizer uptake studies, livestock improvement; and reducing losses by pest control and food irradiation

  5. Nuclear energy

    International Nuclear Information System (INIS)

    Rippon, S.

    1984-01-01

    Do we need nuclear energy. Is it safe. What are the risks. Will it lead to proliferation. The questions are endless, the answers often confused. In the vigorous debates that surround the siting and operation of nuclear power plants, it is all too easy to lose sight of the central issues amid the mass of arguments and counter-arguments put forward. And there remains the doubt, who do we believe. This book presents the facts, simply, straightforwardly, and comprehensibly. It describes the different types of nuclear reactor, how they work, how energy is produced and transformed into usable power, how nuclear waste is handled, what safeguards are built in to prevent accident, contamination and misuse. More important, it does this in the context of the real world, examining the benefits as well as the dangers of a nuclear power programme, quantifying the risks, and providing an authoritative account of the nuclear industry worldwide. Technically complex and politically controversial, the contribution of nuclear energy to our future energy requirements is a crucial topic of our time. (author)

  6. Nuclear security culture in comparison with nuclear safety culture. Resemblances and differences

    International Nuclear Information System (INIS)

    Kawata, Norio

    2015-01-01

    Since the terrorist attacks on the U.S. on September 11th, 2001, Nuclear Security has been focused on and treated as a global issue in the international community and it has also been discussed as a real and serious threat to nuclear power plants in the world since 'The Great East Japan Earthquake' in March, 2011. The International Atomic Energy Agency (IAEA) issued a document including Nuclear Security Recommendations (INFCIRC/225/Rev.5) (NSS 13) in the Nuclear Security Series and emphasized the necessity of fostering Nuclear Security Culture. Nuclear Security Culture has been frequently discussed at various kinds of seminars and events. Since the officials in charge of Nuclear Security are familiar with the area of Nuclear Safety, the relationships between Nuclear Safety Culture and Nuclear Security Culture have been the point in controversy. This paper clarifies relevance between Nuclear Safety and Security, considers resemblances and differences of their concepts and lessons learned for each culture from nuclear power plant accidents, and promotes deeper understanding of Nuclear Safety and Nuclear Security Culture. (author)

  7. Nuclear Hostages

    International Nuclear Information System (INIS)

    Cooper, C.L.

    1978-01-01

    The global spread of nuclear reactors for the production of energy seems inevitable. Nuclear power plants will be supplied--if not by the United States, then by one of several other exporters. But other aspects of this development are less certain. One is the relationship between proliferation of nuclear energy plants and that of nuclear weapons. Another is the actual constraint that such vulnerable potential targets as nuclear power plants would have on would-be aggressors. In the last analysis, this would depend on the rationality of a nation's leadership. What can be said for the concept of nuclear power plants as potential hostages is that by installing a reactor on its territory, a country increases its vulnerability to grave, possibly unacceptable damage in the event of war. As a result, that nation's leaders might be inclined to raise the threshold of their sensitivity to provocation by neighbors and to restrain their own inclinations toward aggression. Admittedly this is a frail substitute for robust international agreements, but in the present order of things it is not a trivial consideration. Many incidents once regarded by the great powers as easi belli have more recently been either resolved by diplomacy or ignored altogether. The idea must not be pressed too far. The export of a nuclear power plant to a Third World country cannot be advocated simply as a means to constrain its own military adventurism. Aside from the promise of a vast increase in energy supply for developing nations, nuclear powered generating stations could actually improve relations among countries. The risk of widespread radioactive contamination by nuclear power plants hit by even conventional bombs could introduce a positive new element into the military calculations of powers outside the NATO-Warsaw Pact arena. As they balance military and diplomatic solutions to local conflicts, moderation rather than bellicosity might become the better part of valor

  8. Nuclear medicine

    International Nuclear Information System (INIS)

    Kand, Purushottam

    2012-01-01

    Nuclear medicine is a specialized area of radiology that uses very small amounts of radioactive materials to examine organ function and structure. Nuclear medicine is older than CT, ultrasound and MRI. It was first used in patients over 60-70 years ago. Today it is an established medical specialty and offers procedures that are essential in many medical specialities like nephrology, pediatrics, cardiology, psychiatry, endocrinology and oncology. Nuclear medicine refers to medicine (a pharmaceutical) that is attached to a small quantity of radioactive material (a radioisotope). This combination is called a radiopharmaceutical. There are many radiopharmaceuticals like DTPA, DMSA, HIDA, MIBI and MDP available to study different parts of the body like kidneys, heart and bones etc. Nuclear medicine uses radiation coming from inside a patient's body where as conventional radiology exposes patients to radiation from outside the body. Thus nuclear imaging study is a physiological imaging, whereas diagnostic radiology is anatomical imaging. It combines many different disciplines like chemistry, physics mathematics, computer technology, and medicine. It helps in diagnosis and to treat abnormalities very early in the progression of a disease. The information provides a quick and accurate diagnosis of wide range of conditions and diseases in a person of any age. These tests are painless and most scans expose patients to only minimal and safe amounts of radiation. The amount of radiation received from a nuclear medicine procedure is comparable to, or often many times less than, that of a diagnostic X-ray. Nuclear medicine provides an effective means of examining whether some tissues/organs are functioning properly. Therapy using nuclear medicine in an effective, safe and relatively inexpensive way of controlling and in some cases eliminating, conditions such as overactive thyroid, thyroid cancer and arthritis. Nuclear medicine imaging is unique because it provides doctors with

  9. Nuclear inheritance

    International Nuclear Information System (INIS)

    Delpech, Therese

    1997-01-01

    Since the end of the East-West confronting, the nuclear weapon issue has been focused in an international debate with obvious repercussions in Europe, because it is the European continent which indicated first the significance of nuclear deterrence. This debate refers first upon the past, as the German unification allowed capturing numerous documents of Warsaw treaty which revealed the intentions and the plans of Soviet Union during the cold war, and secondly concerns the future, since the role of nuclear weapons must be re-thought in a new context. This is the subject of this book, which refers also to the problem of the nuclear proliferation in the world and evolution of different countries in a political and regional context. The extension of the non-proliferation treaty for an undefined duration, in May 1995, is a incontestable victory because this treaty rules the renouncement to nuclear weapons of 185 countries. However, it does not solve most sensible problems like the Iraq case, for which a specific inspection regime has been instituted, or the case of Iran, which is suspected to acquire the bomb, although no clear evidence has been provided up to now. This is also the case of Israel, India and Pakistan which allege plainly their willingness of keeping open, from security reasons, their nuclear option. The content is displayed in five chapters: 1. Introduction; 2. The role of the nuclear weapons after the cold war; 3. The nuclear proliferation at crossroads; 4. Undefined extension of the NPT, a striking but fragile victory; 5. Conclusions. An appendix containing the text of the Nuclear Weapon Non-Proliferation Treaty and a chronology are added

  10. Analysis of nuclear issue and development of policy alternatives

    International Nuclear Information System (INIS)

    Won, Byungchool; Lee, Youngjoon; Yun, Sungwon; Yun, Keehwan; Ko, Wonil

    2012-08-01

    ? Promoted amicably passing a resolution on a general meeting of Atomic Energy Promotion Commission through the preliminary review and opinion gathering ? Mutual understanding and forming a social consensus on nuclear related issues through R and D reporting about the SMART, Decommission and Dis, Future Nuclear System etc Ο Promoted strengthening the work related to the nuclear policy through discovering the 8 policy initiatives prioritized Ο Analyzed the policy process as well as previous research results related to spent fuel for establishment of spent-fuel policy and presented the methods for legislation Ο Suggested the establishment and multi-step implementation strategies of 'Nuclear educational hurb center' Ο Germany, Switzerland, Belgium returned to their former phase-out strategies, except for these three countries, did not change nuclear promotion policies Ο Democratic United Party is currently taking the opposite stance on NPP but it is necessary to make an effort to analyze current domestic energy circumstances on objective and rational grounds

  11. Nuclear energy

    International Nuclear Information System (INIS)

    Hladky, S.

    1985-01-01

    This booklet appeared in a series on technical history. It tries to communicate some of the scientific, technical and social stresses, which have been connected with the application of nuclear energy since its discovery. The individual sections are concerned with the following subjects: the search for the 'smallest particles'; the atomic nucleus; nuclear fission; the 'Manhattan Project'; the time after this - from the euphoria of the 1950's via disillusionment and change of opinion to the state of nuclear energy at the start of the 1980's. The booklet contains many details and is generously illustrated. (HSCH) [de

  12. Nuclear transport

    International Nuclear Information System (INIS)

    Anon.

    2003-01-01

    During january and february 2003, a unique event concerning nuclear transport was reported and rated 1 on the INES scale. This event concerns the absence of a maintenance operation on a shipping cask. This shipping cask was used for several years for nuclear transport inside La-hague site before being re-assigned to transport on public thoroughfare. The re-assignment of the cask should have been preceded and conditioned by a maintenance operation whose purpose is to check the efficiency of its radiation shield. During this period 2 on-site inspections concerning the transport of nuclear materials were performed. (A.C.)

  13. Nuclear energy

    International Nuclear Information System (INIS)

    Luxo, Armand.

    1977-01-01

    The reasons and conditions of utilizing nuclear power in developing countries are examined jointly with the present status and future uses already evaluated by some organizations. Some consequences are deduced in the human, financial scientific and technological fields, with provisional suggestions for preparing the nuclear industry development in these countries. As a conclusion trends are given to show how the industrialized countries having gained a long scientific and technological experience in nuclear energy can afford their assistance in this field, to developing countries [fr

  14. Nuclear questions

    International Nuclear Information System (INIS)

    Hohlfeld, W.

    1977-01-01

    This brochure 'nuclear problems' deals with the attitude of the protestant church in the region around the northern Elbe towards further quantitative economic growth, esp. nuclear energy, with the following essays: preaching the Gospel in an environment in danger: the Christian occident and the problems of the third world, facing the problems of exhausted supplies, the role of the prophet, problem of environment - a problem of theology, the political dimension, against ATW, signal Brokdorf, strange effects (defense of the church from unqualified teachings by non-professionals), Christian liberty, church and nuclear energy, violence and robes. (HP) [de

  15. Rotterdam Nuclear

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    In 1965 Rotterdam Nuclear received an order for the design, supply of materials, manufacture, testing, inspection and preparation for shipment of one 450MW Boiling Water Reactor pressure vessel. This was one of the first orders for a reactor pressure vessel, ever obtained by a European Manufacturer. The Company has since supplied 19 reactor pressure vessels for nuclear power stations, having a total weight of about 10,000,000kg. The nuclear power stations in which these are installed represent an electrical output of about 15,000MW and they are located in seven different countries (USA, Spain, Switzerland, Argentina, Sweden, Germany and the Netherlands). (Auth.)

  16. Nuclear law

    International Nuclear Information System (INIS)

    Bringuier, P.

    2009-01-01

    The object of this report is to present the evolution of the nuclear law during the period from 2006 to 2008, period that was characterized in France by a real rewriting from the implementation of a control authority. The prescriptive backing of nuclear activities has been deeply changed by numerous texts. In this first part are presented: (1) the institutional aspects, (2) openness and public information, (7) radioactive wastes and (9) liability and insurance. In a next publication will be treated: (3) safety and radiation protection; (4) nuclear matter, inspection, physical protection; (5) transports; (6) trade, non-proliferation; (8) radiological accidents. (N.C.)

  17. Nuclear fuel

    International Nuclear Information System (INIS)

    D Hondt, P.

    1998-01-01

    The research and development programme on nuclear fuel at the Belgian Nuclear Research Centre SCK/CEN is described. The objective of this programme is to enhance the quantitative prediction of the operational limits of nuclear fuel and to assess the behaviour of fuel under incidental and accidental conditions. Progress is described in different domains including the modelling of fission gas release in LWR fuel, thermal conductivity, basic physical phenomena, post-irradiation examination for fuel performance assessment, and conceptual studies of incidental and accidental fuel experiments

  18. Nuclear energy

    International Nuclear Information System (INIS)

    Wethe, Per Ivar

    2009-01-01

    Today we know two forms of nuclear energy: fission and fusion. Fission is the decomposition of heavy nuclei, while fusion is the melting together of light nuclei. Both processes create a large surplus of energy. Technologically, we can currently only use fission to produce energy in today's nuclear power plants, but there is intense research worldwide in order to realize a controlled fusion process. In a practical context, today's nuclear energy is a sustained source of energy since the resource base is virtually unlimited. When fusion technology is realized, the resource supply will be a marginal problem. (AG)

  19. Nuclear electronics

    International Nuclear Information System (INIS)

    Lucero B, E.

    1989-01-01

    The rapid technical development of Colombia over the past years, resulted among others, a considerable increase in the number of measuring instrumentation and testing laboratories, scientific research and metrology centers, in industry, agriculture, public health, education on the nuclear field, etc. IAN is a well organized institution with qualified management, trained staff and reasonably equipped laboratories to carry out tasks as: Metrology, standardization, quality control and maintenance and repair of nuclear instruments. The government of Colombia has adopted a policy to establish and operate through the country maintenance and repair facilities for nuclear instrumentation. This policy is reflected in the organization of electronic laboratories in Bogota-IAN

  20. K-ray nuclear densitometer at PETRONAS Carigali

    International Nuclear Information System (INIS)

    Zainudin Othman

    1985-01-01

    The hydrology and tracer studies Group of Nuclear Energy Unit was requested to overcome the calibration problems of nuclear density gauges which was installed at the condensate - natural gas pipeline at the PETRONAS Carigali in Kerteh, Trengganu in February 1984. The roles and application of k-ray nuclear densitometer are included. Similar activities have also been performed by the Unit to promote the application at nuclear techniques in local industries. (A.J.)

  1. World warms to nuclear power

    International Nuclear Information System (INIS)

    Mortimer, N.

    1989-01-01

    The greenhouse effect and global warming is a major environmental issue. The nuclear industry has taken this opportunity to promote itself as providing clean energy without implication in either the greenhouse effect or acid rain. However, it is acknowledged that nuclear power does have its own environment concerns. Two questions are posed -does nuclear power contribute to carbon dioxide emissions and can nuclear power provide a realistic long-term solution to global warming? Although nuclear power stations do not emit carbon dioxide, emissions occur during the manufacture of reactor components, the operation of the nuclear fuel cycle and especially, during the mining and processing of the uranium ore. It is estimated that the supply of high grade ores will last only 23 years, beyond that the carbon dioxide emitted during the processing is estimated to be as great as the carbon dioxide emitted from an coal-fired reactor. Fast breeder reactors are dismissed as unable to provide an answer, so it is concluded that nuclear technology has only a very limited role to play in countering global warming.(UK)

  2. Nuclear power, society and environment

    International Nuclear Information System (INIS)

    Anon.

    1997-01-01

    This rubric reports on 12 short notes about sociological and environmental aspects of nuclear power in France and other countries: the epidemiological inquiry widened to all French nuclear sites; the sanitary and radioecological effects of nuclear activities in Northern Cotentin (France); the WONUC (World National Council of Nuclear Workers) anger with the French government about the shutdown of Superphenix reactor; the new more informative promotional campaign of Electricite de France (EdF) for nuclear power; the scientific and research prices attributed by the French Atomic Energy Commission (CEA) to its searchers; the creation of a committee of inquiry in the French senate for the careful examination of the economical, social and financial consequences of the shutdown of Superphenix; the 31.2% increase of CEA-Industrie benefits for 1997; the decrease of nuclear contestation in Germany; the French-German communication efficiency during the Fessenheim accident simulation in October 7, 1997; the 3.5% increase of CO 2 emissions in the USA; the decommissioning of 3 Russian reactors for military plutonium production; Greenpeace condemnation for abusive purposes against British Nuclear Fuel plc (BNFL) and its activities at Sellafield (UK). (J.S.)

  3. Nuclear power and climate change

    International Nuclear Information System (INIS)

    1998-04-01

    In the Kyoto Protocol, agreed upon by the Parties to the United Nations Framework Convention on Climate Change (UNFCCC) in December 1997, Annex I countries committed to reduce their greenhouse gas (GHG) emissions. Also, the Protocol states that Annex I countries shall undertake promotion, research, development and increased use of new and renewable forms of energy, of carbon dioxide sequestration technologies and of advanced and innovative environmentally sound technologies. One important option that could be covered by the last phrase, and is not specifically mentioned, is nuclear energy which is essentially carbon-free. Nuclear Energy Agency (NEA) has investigated the role that nuclear power could play in alleviating the risk of global climate change. The main objective of the study is to provide a quantitative basis for assessing the consequences for the nuclear sector and for the reduction of GHG emissions of alternative nuclear development paths. The analysis covers the economic, financial, industrial and potential environmental effects of three alternative nuclear power development paths ('nuclear variants'). (K.A.)

  4. Nuclear technology: katulong sa pag-unlad ng masa [support for the progress of the masses

    International Nuclear Information System (INIS)

    1999-01-01

    The topics discussed during the convention is the usefulness of nuclear science and technology in national development and to promote the beneficial uses of nuclear science and technology to support for the progress of the masses

  5. Knowledge Management In Malaysian Nuclear Agency: The first 40 years

    International Nuclear Information System (INIS)

    Habibah Adnan; Norzehan Ngadiron; Iberahim Ali

    2012-01-01

    This paper gives an overview of nuclear knowledge management practices in Malaysian Nuclear Agency (Nuclear Malaysia) in the first 40 years of its operation. Nuclear Malaysia is established in 1972 and its main responsibility is to promote the application of nuclear technology in various socioeconomic sectors including industry, medical, agriculture, manufacturing, health, radiation safety and the environment. Nuclear Malaysia's core competency is R and D in nuclear science and technology. The explanation emphasizes on the activities and challenges in implementing NKM at the Nuclear Malaysia and in particular; nuclear knowledge management practices, the needs for Nuclear Malaysia to strengthen his KM activities and the evolvement and development of KM to enhance the ability of the organization. (Author)

  6. Nuclear wastes

    International Nuclear Information System (INIS)

    2002-01-01

    This scientific document presents an introduction to the nuclear wastes problems, the separation process and the transmutation, the political and technical aspects of the storage, the radioprotection standards and the biological effects. (A.L.B.)

  7. Nuclear Disarmament.

    Science.gov (United States)

    Johnson, Christopher

    1982-01-01

    Material about nuclear disarmament and the arms race should be included in secondary school curricula. Teachers can present this technical, controversial, and frightening material in a balanced and comprehensible way. Resources for instructional materials are listed. (PP)

  8. Nuclear analysis

    International Nuclear Information System (INIS)

    1988-01-01

    Basic studies in nuclear analytical techniques include the examination of underlying assumptions and the development and extention of techniques involving the use of ion beams for elemental and mass analysis. 1 ref., 1 tab

  9. Nuclear reaction

    CERN Multimedia

    Penwarden, C

    2001-01-01

    At the European Research Organization for Nuclear Research, Nobel laureates delve into the mysteries of particle physics. But when they invited artists from across the continent to visit their site in Geneva, they wanted a new kind of experiment.

  10. [Nuclear theory

    International Nuclear Information System (INIS)

    1989-06-01

    This report discusses concepts in nuclear theory such as: neutrino nucleosynthesis; double beta decay; neutrino oscillations; chiral symmetry breaking; T invariance; quark propagator; cold fusion; and other related topics

  11. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 1 to 56. (A.L.B.)

  12. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    2000-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  13. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1998-01-01

    This paper is made of two tables. The first table describes the different particles (bosons and fermions) while the second one gives the nuclear constants of isotopes from the different elements with Z = 1 to 25. (J.S.)

  14. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  15. Nuclear transmutations

    International Nuclear Information System (INIS)

    Mikulaj, V.

    1992-01-01

    Two types of nuclear transmutations are outlined, namely the radioactive transmutations and nuclear reactions. The basic characteristics are given of radioactive transmutations (gamma transmutations and isomeric transitions, beta, alpha transmutations, spontaneous fission and spontaneous emission of nucleons), their kinetics and the influence of the physical and chemical state of the radionuclide on the transmutation rate. The basic characteristics are described of nuclear reactions (reactions of neutrons including fission, reactions induced by charged particles and photons), their kinetics, effective cross sections and their mechanism. Chemical reactions caused by nuclear transmutations are discussed (recoil energy, properties of hot atoms, Szilard-Chalmers effect). A brief information is given on the behavior of radionuclides in trace concentrations. (Z.S.) 2 tabs., 19 figs., 12 refs

  16. Nuclear waste

    International Nuclear Information System (INIS)

    1992-05-01

    The Nuclear Waste Policy Act of 1982, as amended in 1987, directed the Secretary of Energy to, among other things, investigate Yucca Mountain, Nevada, as a potential site for permanently disposing of highly radioactive wastes in an underground repository. In April 1991, the authors testified on Yucca Mountain project expenditures before your Subcommittee. Because of the significance of the authors findings regrading DOE's program management and expenditures, you asked the authors to continue reviewing program expenditures in depth. As agreed with your office, the authors reviewed the expenditures of project funds made available to the Department of Energy's (DOE) Lawrence Livermore National Laboratory, which is the lead project contractor for developing a nuclear waste package that wold be used for disposing of nuclear waste at Yucca Mountain. This report discusses the laboratory's use of nuclear waste funds to support independent research projects and to manage Yucca Mountain project activities. It also discusses the laboratory's project contracting practices

  17. Nuclear shields

    International Nuclear Information System (INIS)

    Linares, R.C.; Nienart, L.F.; Toelcke, G.A.

    1976-01-01

    A process is described for preparing melt-processable nuclear shielding compositions from chloro-fluoro substituted ethylene polymers, particularly PCTFE and E-CTFE, containing 1 to 75 percent by weight of a gadolinium compound. 13 claims, no drawings

  18. Nuclear option

    International Nuclear Information System (INIS)

    Olson, P.S.

    1983-01-01

    The energy demand complexion of this country is always changing and promises to change in the future. The nuclear industry is responding to changing energy demands through standards writing activities. Since the oil embargo of 1973, there has been a change in the mix of fuels contributing to energy growth in this country; virtually all of the energy growth has come from coal and nuclear power. The predicted expansion of coal use by 1985, over 1977 level, is 37%, while the use of oil is expected to decline by 17%. Use of nuclear power is expected to increase 62% from the 1977 level. The feasibility of using nuclear energy to meet the needs of the USA for electric power is discussed

  19. Nuclear safety

    International Nuclear Information System (INIS)

    Tarride, Bruno

    2015-10-01

    The author proposes an overview of methods and concepts used in the nuclear industry, at the design level as well as at the exploitation level, to ensure an acceptable safety level, notably in the case of nuclear reactors. He first addresses the general objectives of nuclear safety and the notion of acceptable risk: definition and organisation of nuclear safety (relationships between safety authorities and operators), notion of acceptable risk, deterministic safety approach and main safety principles (safety functions and confinement barriers, concept of defence in depth). Then, the author addresses the safety approach at the design level: studies of operational situations, studies of internal and external aggressions, safety report, design principles for important-for-safety systems (failure criterion, redundancy, failure prevention, safety classification). The next part addresses safety during exploitation and general exploitation rules: definition of the operation domain and of its limits, periodic controls and tests, management in case of incidents, accidents or aggressions

  20. Nuclear fission

    International Nuclear Information System (INIS)

    Kodama, T.

    1981-01-01

    The nuclear fission process is pedagogically reviewed from a macroscopic-microscopic point of view. The Droplet model is considered. The fission dynamics is discussed utilizing path integrals and semiclassical methods. (L.C.) [pt