
Sample records for key developmental genes

  1. Ciona intestinalis as a Marine Model System to Study Some Key Developmental Genes Targeted by the Diatom-Derived Aldehyde Decadienal

    Anna Lettieri


    Full Text Available The anti-proliferative effects of diatoms, described for the first time in copepods, have also been demonstrated in benthic invertebrates such as polychaetes, sea urchins and tunicates. In these organisms PUAs (polyunsaturated aldehydes induce the disruption of gametogenesis, gamete functionality, fertilization, embryonic mitosis, and larval fitness and competence. These inhibitory effects are due to the PUAs, produced by diatoms in response to physical damage as occurs during copepod grazing. The cell targets of these compounds remain largely unknown. Here we identify some of the genes targeted by the diatom PUA 2-trans-4-trans-decadienal (DD using the tunicate Ciona intestinalis. The tools, techniques and genomic resources available for Ciona, as well as the suitability of Ciona embryos for medium-to high-throughput strategies, are key to their employment as model organisms in different fields, including the investigation of toxic agents that could interfere with developmental processes. We demonstrate that DD can induce developmental aberrations in Ciona larvae in a dose-dependent manner. Moreover, through a preliminary analysis, DD is shown to affect the expression level of genes involved in stress response and developmental processes.

  2. Transcriptome analysis elucidates key developmental components of bryozoan lophophore development

    Wong, Yue Him


    The most recent phylogenomic study suggested that Bryozoa (Ectoprocta), Brachiopoda, and Phoronida are monophyletic, implying that the lophophore of bryozoans, phoronids and brachiopods is a synapomorphy. Understanding the molecular mechanisms of the lophophore development of the Lophophorata clade can therefore provide us a new insight into the formation of the diverse morphological traits in metazoans. In the present study, we profiled the transcriptome of the Bryozoan (Ectoproct) Bugula neritina during the swimming larval stage (SW) and the early (4 h) and late (24 h) metamorphic stages using the Illumina HiSeq2000 platform. Various genes that function in development, the immune response and neurogenesis showed differential expression levels during metamorphosis. In situ hybridization of 23 genes that participate in the Wnt, BMP, Notch, and Hedgehog signaling pathways revealed their regulatory roles in the development of the lophophore and the ancestrula digestive tract. Our findings support the hypothesis that developmental precursors of the lophophore and the ancestrula digestive tract are pre-patterned by the differential expression of key developmental genes according to their fate. This study provides a foundation to better understand the developmental divergence and/or convergence among developmental precursors of the lophophore of bryozoans, branchiopods and phoronids.

  3. Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstps1, a key gene in the production of the sesquiterpene aroma compound valencene.

    Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram


    Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.

  4. Transcriptome analysis elucidates key developmental components of bryozoan lophophore development

    Wong, Yue Him; Ryu, Tae Woo; Ghosheh, Yanal; Qian, Pei-Yuan; Seridi, Loqmane; Bougouffa, Salim; Ravasi, Timothy


    metamorphosis. In situ hybridization of 23 genes that participate in the Wnt, BMP, Notch, and Hedgehog signaling pathways revealed their regulatory roles in the development of the lophophore and the ancestrula digestive tract. Our findings support the hypothesis

  5. Mural granulosa cell gene expression associated with oocyte developmental competence

    Jiang Jin-Yi


    Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

  6. Teachers' Explanations of a Key Developmental Understanding of Multiplicative Reasoning

    Rhee, Katherine L.


    This qualitative research study explores teachers' understandings of multiplicative reasoning as a key developmental understanding (KDU). A KDU entails knowingly applying the same mathematical concepts within different contexts. A KDU supports an individual to build a connected understanding of mathematics as opposed to only understanding…

  7. Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

    Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes


    Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to

  8. Developmental gene expression profiles of the human pathogen Schistosoma japonicum

    McManus Donald P


    Full Text Available Abstract Background The schistosome blood flukes are complex trematodes and cause a chronic parasitic disease of significant public health importance worldwide, schistosomiasis. Their life cycle is characterised by distinct parasitic and free-living phases involving mammalian and snail hosts and freshwater. Microarray analysis was used to profile developmental gene expression in the Asian species, Schistosoma japonicum. Total RNAs were isolated from the three distinct environmental phases of the lifecycle – aquatic/snail (eggs, miracidia, sporocysts, cercariae, juvenile (lung schistosomula and paired but pre-egg laying adults and adult (paired, mature males and egg-producing females, both examined separately. Advanced analyses including ANOVA, principal component analysis, and hierarchal clustering provided a global synopsis of gene expression relationships among the different developmental stages of the schistosome parasite. Results Gene expression profiles were linked to the major environmental settings through which the developmental stages of the fluke have to adapt during the course of its life cycle. Gene ontologies of the differentially expressed genes revealed a wide range of functions and processes. In addition, stage-specific, differentially expressed genes were identified that were involved in numerous biological pathways and functions including calcium signalling, sphingolipid metabolism and parasite defence. Conclusion The findings provide a comprehensive database of gene expression in an important human pathogen, including transcriptional changes in genes involved in evasion of the host immune response, nutrient acquisition, energy production, calcium signalling, sphingolipid metabolism, egg production and tegumental function during development. This resource should help facilitate the identification and prioritization of new anti-schistosome drug and vaccine targets for the control of schistosomiasis.

  9. Spatiotemporal network motif reveals the biological traits of developmental gene regulatory networks in Drosophila melanogaster

    Kim Man-Sun


    Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.

  10. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  11. Robustness and accuracy in sea urchin developmental gene regulatory networks

    Smadar eBen-Tabou De-Leon


    Full Text Available Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.

  12. Developmental programming: the concept, large animal models, and the key role of uteroplacental vascular development.

    Reynolds, L P; Borowicz, P P; Caton, J S; Vonnahme, K A; Luther, J S; Hammer, C J; Maddock Carlin, K R; Grazul-Bilska, A T; Redmer, D A


    Developmental programming refers to the programming of various bodily systems and processes by a stressor of the maternal system during pregnancy or during the neonatal period. Such stressors include nutritional stress, multiple pregnancy (i.e., increased numbers of fetuses in the gravid uterus), environmental stress (e.g., high environmental temperature, high altitude, prenatal steroid exposure), gynecological immaturity, and maternal or fetal genotype. Programming refers to impaired function of numerous bodily systems or processes, leading to poor growth, altered body composition, metabolic dysfunction, and poor productivity (e.g., poor growth, reproductive dysfunction) of the offspring throughout their lifespan and even across generations. A key component of developmental programming seems to be placental dysfunction, leading to altered fetal growth and development. We discuss various large animal models of developmental programming and how they have and will continue to contribute to our understanding of the mechanisms underlying altered placental function and developmental programming, and, further, how large animal models also will be critical to the identification and application of therapeutic strategies that will alleviate the negative consequences of developmental programming to improve offspring performance in livestock production and human medicine.

  13. Developmental regulation of Xenopus 5S RNA genes

    Wormington, W.M.; Schlissel, M.; Brown, D.D.


    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  14. Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.

    Susanta K Behura

    Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.

  15. [Elucidation of key genes in sex determination in genetics teaching].

    Li, Meng; He, Zhumei


    Sex is an important and complex feature of organisms, which is controlled by the genetic and environmental factors. The genetic factors, i.e., genes, are vital in sex determination. However, not all the related genes play the same roles, and some key genes play a vital role in the sex determination and differentiation. With the development of the modern genetics, a great progress on the key genes has been made in sex determination. In this review, we summarize the mechanism of sex determination and the strategy of how to study the key genes in sex determination. It will help us to understand the mechanism of sex determination better in the teaching of genetics.

  16. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

    Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas


    The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously

  17. Developmental finite element analysis of cichlid pharyngeal jaws: Quantifying the generation of a key innovation

    Müller, Gerd B.


    Advances in imaging and modeling facilitate the calculation of biomechanical forces in biological specimens. These factors play a significant role during ontogenetic development of cichlid pharyngeal jaws, a key innovation responsible for one of the most prolific species diversifications in recent times. MicroCT imaging of radiopaque-stained vertebrate embryos were used to accurately capture the spatial relationships of the pharyngeal jaw apparatus in two cichlid species (Haplochromis elegans and Amatitlania nigrofasciata) for the purpose of creating a time series of developmental stages using finite element models, which can be used to assess the effects of biomechanical forces present in a system at multiple points of its ontogeny. Changes in muscle vector orientations, bite forces, force on the neurocranium where cartilage originates, and stress on upper pharyngeal jaws are analyzed in a comparative context. In addition, microCT scanning revealed the presence of previously unreported cement glands in A. nigrofasciata. The data obtained provide an underrepresented dimension of information on physical forces present in developmental processes and assist in interpreting the role of developmental dynamics in evolution. PMID:29320528

  18. Developmental finite element analysis of cichlid pharyngeal jaws: Quantifying the generation of a key innovation.

    Tim Peterson

    Full Text Available Advances in imaging and modeling facilitate the calculation of biomechanical forces in biological specimens. These factors play a significant role during ontogenetic development of cichlid pharyngeal jaws, a key innovation responsible for one of the most prolific species diversifications in recent times. MicroCT imaging of radiopaque-stained vertebrate embryos were used to accurately capture the spatial relationships of the pharyngeal jaw apparatus in two cichlid species (Haplochromis elegans and Amatitlania nigrofasciata for the purpose of creating a time series of developmental stages using finite element models, which can be used to assess the effects of biomechanical forces present in a system at multiple points of its ontogeny. Changes in muscle vector orientations, bite forces, force on the neurocranium where cartilage originates, and stress on upper pharyngeal jaws are analyzed in a comparative context. In addition, microCT scanning revealed the presence of previously unreported cement glands in A. nigrofasciata. The data obtained provide an underrepresented dimension of information on physical forces present in developmental processes and assist in interpreting the role of developmental dynamics in evolution.

  19. Identification of the Key Genes and Pathways in Esophageal Carcinoma.

    Su, Peng; Wen, Shiwang; Zhang, Yuefeng; Li, Yong; Xu, Yanzhao; Zhu, Yonggang; Lv, Huilai; Zhang, Fan; Wang, Mingbo; Tian, Ziqiang


    Objective . Esophageal carcinoma (EC) is a frequently common malignancy of gastrointestinal cancer in the world. This study aims to screen key genes and pathways in EC and elucidate the mechanism of it. Methods . 5 microarray datasets of EC were downloaded from Gene Expression Omnibus. Differentially expressed genes (DEGs) were screened by bioinformatics analysis. Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment, and protein-protein interaction (PPI) network construction were performed to obtain the biological roles of DEGs in EC. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to verify the expression level of DEGs in EC. Results . A total of 1955 genes were filtered as DEGs in EC. The upregulated genes were significantly enriched in cell cycle and the downregulated genes significantly enriched in Endocytosis. PPI network displayed CDK4 and CCT3 were hub proteins in the network. The expression level of 8 dysregulated DEGs including CDK4, CCT3, THSD4, SIM2, MYBL2, CENPF, CDCA3, and CDKN3 was validated in EC compared to adjacent nontumor tissues and the results were matched with the microarray analysis. Conclusion . The significantly DEGs including CDK4, CCT3, THSD4, and SIM2 may play key roles in tumorigenesis and development of EC involved in cell cycle and Endocytosis.

  20. Identification of the Key Genes and Pathways in Esophageal Carcinoma

    Peng Su


    Full Text Available Objective. Esophageal carcinoma (EC is a frequently common malignancy of gastrointestinal cancer in the world. This study aims to screen key genes and pathways in EC and elucidate the mechanism of it. Methods. 5 microarray datasets of EC were downloaded from Gene Expression Omnibus. Differentially expressed genes (DEGs were screened by bioinformatics analysis. Gene Ontology (GO enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG enrichment, and protein-protein interaction (PPI network construction were performed to obtain the biological roles of DEGs in EC. Quantitative real-time polymerase chain reaction (qRT-PCR was used to verify the expression level of DEGs in EC. Results. A total of 1955 genes were filtered as DEGs in EC. The upregulated genes were significantly enriched in cell cycle and the downregulated genes significantly enriched in Endocytosis. PPI network displayed CDK4 and CCT3 were hub proteins in the network. The expression level of 8 dysregulated DEGs including CDK4, CCT3, THSD4, SIM2, MYBL2, CENPF, CDCA3, and CDKN3 was validated in EC compared to adjacent nontumor tissues and the results were matched with the microarray analysis. Conclusion. The significantly DEGs including CDK4, CCT3, THSD4, and SIM2 may play key roles in tumorigenesis and development of EC involved in cell cycle and Endocytosis.

  1. Genome-wide identification of key modulators of gene-gene interaction networks in breast cancer.

    Chiu, Yu-Chiao; Wang, Li-Ju; Hsiao, Tzu-Hung; Chuang, Eric Y; Chen, Yidong


    With the advances in high-throughput gene profiling technologies, a large volume of gene interaction maps has been constructed. A higher-level layer of gene-gene interaction, namely modulate gene interaction, is composed of gene pairs of which interaction strengths are modulated by (i.e., dependent on) the expression level of a key modulator gene. Systematic investigations into the modulation by estrogen receptor (ER), the best-known modulator gene, have revealed the functional and prognostic significance in breast cancer. However, a genome-wide identification of key modulator genes that may further unveil the landscape of modulated gene interaction is still lacking. We proposed a systematic workflow to screen for key modulators based on genome-wide gene expression profiles. We designed four modularity parameters to measure the ability of a putative modulator to perturb gene interaction networks. Applying the method to a dataset of 286 breast tumors, we comprehensively characterized the modularity parameters and identified a total of 973 key modulator genes. The modularity of these modulators was verified in three independent breast cancer datasets. ESR1, the encoding gene of ER, appeared in the list, and abundant novel modulators were illuminated. For instance, a prognostic predictor of breast cancer, SFRP1, was found the second modulator. Functional annotation analysis of the 973 modulators revealed involvements in ER-related cellular processes as well as immune- and tumor-associated functions. Here we present, as far as we know, the first comprehensive analysis of key modulator genes on a genome-wide scale. The validity of filtering parameters as well as the conservativity of modulators among cohorts were corroborated. Our data bring new insights into the modulated layer of gene-gene interaction and provide candidates for further biological investigations.

  2. [Key effect genes responding to nerve injury identified by gene ontology and computer pattern recognition].

    Pan, Qian; Peng, Jin; Zhou, Xue; Yang, Hao; Zhang, Wei


    In order to screen out important genes from large gene data of gene microarray after nerve injury, we combine gene ontology (GO) method and computer pattern recognition technology to find key genes responding to nerve injury, and then verify one of these screened-out genes. Data mining and gene ontology analysis of gene chip data GSE26350 was carried out through MATLAB software. Cd44 was selected from screened-out key gene molecular spectrum by comparing genes' different GO terms and positions on score map of principal component. Function interferences were employed to influence the normal binding of Cd44 and one of its ligands, chondroitin sulfate C (CSC), to observe neurite extension. Gene ontology analysis showed that the first genes on score map (marked by red *) mainly distributed in molecular transducer activity, receptor activity, protein binding et al molecular function GO terms. Cd44 is one of six effector protein genes, and attracted us with its function diversity. After adding different reagents into the medium to interfere the normal binding of CSC and Cd44, varying-degree remissions of CSC's inhibition on neurite extension were observed. CSC can inhibit neurite extension through binding Cd44 on the neuron membrane. This verifies that important genes in given physiological processes can be identified by gene ontology analysis of gene chip data.

  3. Developmental transitions in Arabidopsis are regulated by antisense RNAs resulting from bidirectionally transcribed genes.

    Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon


    Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.

  4. Developmental expression of the alpha-skeletal actin gene

    Vonk Freek J


    Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.

  5. Identifying key genes associated with acute myocardial infarction.

    Cheng, Ming; An, Shoukuan; Li, Junquan


    This study aimed to identify key genes associated with acute myocardial infarction (AMI) by reanalyzing microarray data. Three gene expression profile datasets GSE66360, GSE34198, and GSE48060 were downloaded from GEO database. After data preprocessing, genes without heterogeneity across different platforms were subjected to differential expression analysis between the AMI group and the control group using metaDE package. P FI) network. Then, DEGs in each module were subjected to pathway enrichment analysis using DAVID. MiRNAs and transcription factors predicted to regulate target DEGs were identified. Quantitative real-time polymerase chain reaction (RT-PCR) was applied to verify the expression of genes. A total of 913 upregulated genes and 1060 downregulated genes were identified in the AMI group. A FI network consists of 21 modules and DEGs in 12 modules were significantly enriched in pathways. The transcription factor-miRNA-gene network contains 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p. RT-PCR validations showed that expression levels of FOXO3 and MYBL2 were significantly increased in AMI, and expression levels of hsa-miR-21-5p and hsa-miR-30c-5p were obviously decreased in AMI. A total of 41 DEGs, such as SOCS3, VAPA, and COL5A2, are speculated to have roles in the pathogenesis of AMI; 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p may be involved in the regulation of the expression of these DEGs.

  6. Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

    Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène


    Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy

  7. Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

    David Cohen

    Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of

  8. Induction of AGAMOUS gene expression plays a key role in ripening of tomato sepals in vitro.

    Ishida, B K; Jenkins, S M; Say, B


    In vitro culture of VFNT Cherry tomato sepals (calyx) at 16-21 degrees C results in developmental changes that are similar to those that occur in fruit tissue [10]. Sepals become swollen, red, and succulent, produce ethylene, and have increased levels of polygalacturonase RNA. They also produce many flavor volatiles characteristic of ripe tomato fruit and undergo similar changes in sugar content [11]. We examined the expression of the tomato AGAMOUS gene, TAG1, in ripening, in vitro sepal cultures and other tissues from the plant and found that TAG1 RNA accumulates to higher levels than expected from data from other plants. Contrary to reports on the absence of AGAMOUS in sepals, TAG1 RNA levels in green sepals from greenhouse-grown plants is detectable, its concentration increasing with in vitro ripening to levels that were even higher than in red, ripe fruit. Sepals of fruit on transgenic tomato plants that expressed TAG1 ectopically were induced by low temperature to ripen in vivo, producing lycopene and undergoing cell wall softening as is characteristic of pericarpic tissue. We therefore propose that the induction of elevated TAG1 gene expression plays a key role in developmental changes that result in sepal ripening.

  9. A single cis element maintains repression of the key developmental regulator Gata2.

    Jonathan W Snow


    Full Text Available In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.

  10. Detection of genes associated with developmental competence of bovine oocytes

    Němcová, Lucie; Jansová, Denisa; Vodičková Kepková, Kateřina; Vodička, Petr; Jeseta, M.; Machatková, M.; Kaňka, Jiří


    Roč. 166, č. 1 (2016), s. 58-71 ISSN 0378-4320 Institutional support: RVO:67985904 Keywords : oocyte * embryo * bovine * developmental competence * transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.605, year: 2016

  11. Exploring the key genes and pathways in enchondromas using a gene expression microarray.

    Shi, Zhongju; Zhou, Hengxing; Pan, Bin; Lu, Lu; Kang, Yi; Liu, Lu; Wei, Zhijian; Feng, Shiqing


    Enchondromas are the most common primary benign osseous neoplasms that occur in the medullary bone; they can undergo malignant transformation into chondrosarcoma. However, enchondromas are always undetected in patients, and the molecular mechanism is unclear. To identify key genes and pathways associated with the occurrence and development of enchondromas, we downloaded the gene expression dataset GSE22855 and obtained the differentially expressed genes (DEGs) by analyzing high-throughput gene expression in enchondromas. In total, 635 genes were identified as DEGs. Of these, 225 genes (35.43%) were up-regulated, and the remaining 410 genes (64.57%) were down-regulated. We identified the predominant gene ontology (GO) categories and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways that were significantly over-represented in the enchondromas samples compared with the control samples. Subsequently the top 10 core genes were identified from the protein-protein interaction (PPI) network. The enrichment analyses of the genes mainly involved in two significant modules showed that the DEGs were principally related to ribosomes, protein digestion and absorption, ECM-receptor interaction, focal adhesion, amoebiasis and the PI3K-Akt signaling pathway.Together, these data elucidate the molecular mechanisms underlying the occurrence and development of enchondromas and provide promising candidates for therapeutic intervention and prognostic evaluation. However, further experimental studies are needed to confirm these results.

  12. Access to Opportunities for Bilingualism for Individuals with Developmental Disabilities: Key Informant Interviews.

    de Valenzuela, Julia Scherba; Bird, Elizabeth Kay-Raining; Parkington, Karisa; Mirenda, Pat; Cain, Kate; MacLeod, Andrea A N; Segers, Eliane

    The purpose of this article is to describe the results of a thematic analysis of 79 semi-structured interviews collected at six research sites in four countries in relation to the inclusion and exclusion of students with developmental disabilities (DD) in and from special education and bilingual opportunities. The participants were individuals with expertise either in special needs and/or language education to support bilingualism (e.g., second language (L2) instruction), who served as key informants about service delivery and/or policy in these areas. Six themes emerged as salient during the analysis: we include all kids, special needs drives it, time/scheduling conflicts, IEP/IPP/statement drives it, it's up to the parents, and service availability. The results suggested that access to language programs and services is limited for children with DD, even though participants at all sites reported adherence to a philosophy of inclusion. A priority on special education services over language services was identified, as well as barriers to providing children with DD access to programs and services to support bilingual development. Some of these barriers included time and scheduling conflicts and limited service availability. Additionally, the role of parents in decision making was affirmed, although, in contrast to special education services, decision-making about participation or exemption from language programs was typically left up to the parents. Overall, the results suggest a need for greater attention to providing supports for both first (L1) and L2 language development for bilingual children with DD and greater access to available language programs. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Validation of reference genes in Solenopsis invicta in different developmental stages, castes and tissues.

    Daifeng Cheng

    Full Text Available To accurately assess gene expression levels, it is essential to normalize real-time quantitative PCR (RT-qPCR data with suitable internal reference genes. For the red imported fire ant, Solenopsis invicta, reliable reference genes to assess the transcript expression levels of the target genes have not been previously investigated. In this study, we examined the expression levels of five candidate reference genes (rpl18, ef1-beta, act, GAPDH, and tbp in different developmental stages, castes and tissues of S. invicta. To evaluate the suitability of these genes as endogenous controls, three software-based approaches (geNorm, BestKeeper and NormFinder and one web-based comprehensive tool (RefFinder were used to analyze and rank the tested genes. Furthermore, the optimal number of reference gene(s was determined by the pairwise variation value. Our data showed that two of the five candidate genes, rpl18 and ef1-beta, were the most suitable reference genes because they have the most stable expression among different developmental stages, castes and tissues in S. invicta. Although widely used as reference gene in other species, in S. invicta the act gene has high variation in expression and was consequently excluded as a reliable reference gene. The two validated reference genes, rpl18 and ef1-beta, can be widely used for quantification of target gene expression with RT-qPCR technology in S. invicta.

  14. Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

    Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M


    The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

  15. Gene expression profiles reveal key genes for early diagnosis and treatment of adamantinomatous craniopharyngioma.

    Yang, Jun; Hou, Ziming; Wang, Changjiang; Wang, Hao; Zhang, Hongbing


    Adamantinomatous craniopharyngioma (ACP) is an aggressive brain tumor that occurs predominantly in the pediatric population. Conventional diagnosis method and standard therapy cannot treat ACPs effectively. In this paper, we aimed to identify key genes for ACP early diagnosis and treatment. Datasets GSE94349 and GSE68015 were obtained from Gene Expression Omnibus database. Consensus clustering was applied to discover the gene clusters in the expression data of GSE94349 and functional enrichment analysis was performed on gene set in each cluster. The protein-protein interaction (PPI) network was built by the Search Tool for the Retrieval of Interacting Genes, and hubs were selected. Support vector machine (SVM) model was built based on the signature genes identified from enrichment analysis and PPI network. Dataset GSE94349 was used for training and testing, and GSE68015 was used for validation. Besides, RT-qPCR analysis was performed to analyze the expression of signature genes in ACP samples compared with normal controls. Seven gene clusters were discovered in the differentially expressed genes identified from GSE94349 dataset. Enrichment analysis of each cluster identified 25 pathways that highly associated with ACP. PPI network was built and 46 hubs were determined. Twenty-five pathway-related genes that overlapped with the hubs in PPI network were used as signatures to establish the SVM diagnosis model for ACP. The prediction accuracy of SVM model for training, testing, and validation data were 94, 85, and 74%, respectively. The expression of CDH1, CCL2, ITGA2, COL8A1, COL6A2, and COL6A3 were significantly upregulated in ACP tumor samples, while CAMK2A, RIMS1, NEFL, SYT1, and STX1A were significantly downregulated, which were consistent with the differentially expressed gene analysis. SVM model is a promising classification tool for screening and early diagnosis of ACP. The ACP-related pathways and signature genes will advance our knowledge of ACP pathogenesis

  16. Developmentally regulated expression of reporter gene in adult ...

    pression of reporter gene in adult brain specific GAL4 enhancer traps of. Drosophila ... genes based on their expression pattern, thus enabling us to overcome the ... order association and storage centres of olfactory learning and memory, and ...

  17. Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene

    Michael Hadjiargyrou


    Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.

  18. Access to opportunities for bilingualism for individuals with developmental disabilities: Key informant interviews

    Scherba de Valenzuela, J.; Kay-Raining Bird, E.; Parkington, K.; Mirenda, P.; Cain, K.; MacLeod, A.A.N.; Segers, P.C.J.


    The purpose of this article is to describe the results of a thematic analysis of 79 semi-structured interviews collected at six research sites in four countries in relation to the inclusion and exclusion of students with developmental disabilities (DD) in and from special education and bilingual

  19. Prepatterning of developmental gene expression by modified histones before zygotic genome activation

    Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.


    A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...

  20. Importance of globin gene order for correct developmental expression.

    O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)


    textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the

  1. P63 gene mutations and human developmental syndromes.

    Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van


    The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the

  2. Cis-regulatory timers for developmental gene expression.

    Lionel Christiaen


    Full Text Available How does a fertilized egg decode its own genome to eventually develop into a mature animal? Each developing cell must activate a battery of genes in a timely manner and according to the function it will ultimately perform, but how? During development of the notochord--a structure akin to the vertebrate spine--in a simple marine invertebrate, an essential protein called Brachyury binds to specific sites in its target genes. A study just published in PLOS Biology reports that if the target gene contains multiple Brachyury-binding sites it will be activated early in development but if it contains only one site it will be activated later. Genes that contain no binding site can still be activated by Brachyury, but only indirectly by an earlier Brachyury-dependent gene product, so later than the directly activated genes. Thus, this study shows how several genes can interpret the presence of a single factor differently to become active at distinct times in development.

  3. Developmental evolution in social insects: regulatory networks from genes to societies.

    Linksvayer, Timothy A; Fewell, Jennifer H; Gadau, Jürgen; Laubichler, Manfred D


    The evolution and development of complex phenotypes in social insect colonies, such as queen-worker dimorphism or division of labor, can, in our opinion, only be fully understood within an expanded mechanistic framework of Developmental Evolution. Conversely, social insects offer a fertile research area in which fundamental questions of Developmental Evolution can be addressed empirically. We review the concept of gene regulatory networks (GRNs) that aims to fully describe the battery of interacting genomic modules that are differentially expressed during the development of individual organisms. We discuss how distinct types of network models have been used to study different levels of biological organization in social insects, from GRNs to social networks. We propose that these hierarchical networks spanning different organizational levels from genes to societies should be integrated and incorporated into full GRN models to elucidate the evolutionary and developmental mechanisms underlying social insect phenotypes. Finally, we discuss prospects and approaches to achieve such an integration. © 2012 WILEY PERIODICALS, INC.

  4. Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.

    Xiao-Jian Sun

    Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.

  5. Novel Pectate Lyase Genes of Heterodera glycines Play Key Roles in the Early Stage of Parasitism.

    Huan Peng

    Full Text Available Pectate lyases are known to play a key role in pectin degradation by catalyzing the random cleavage of internal polymer linkages (endo-pectinases. In this paper, four novel cDNAs, designated Hg-pel-3, Hg-pel-4, Hg-pel-6 and Hg-pel-7, that encode pectate lyases were cloned and characterized from the soybean cyst nematode, Heterodera glycines. The predicted protein sequences of HG-PEL-3, HG-PEL-4 and HG-PEL-6 differed significantly in both their amino acid sequences and their genomic structures from other pectate lyases of H. glycines (HG-PEL-1, HG-PEL-2 and HG-PEL-7. A phylogenetic study revealed that the pectate lyase proteins of H. glycines are clustered into distinct clades and have distinct numbers and positioning of introns, which suggests that the pectate lyase genes of H. glycines may have evolved from at least two ancestral genes. A Southern blot analysis revealed that multiple Hg-pel-6-like genes were present in the H. glycines genome. In situ hybridization showed that four novel pectate lyases (Hg-pel-3, Hg-pel-4, Hg-pel-6 and Hg-pel-7 were actively transcribed in the subventral esophageal gland cells. A semi-quantitative RT-PCR assay supported the finding that the expression of these genes was strong in the egg, pre-parasitic second-stage juvenile (J2 and early parasitic J2 stages and that it declined in further developmental stages of the nematode. This expression pattern suggests that these proteins play a role in the migratory phase of the nematode life cycle. Knocking down Hg-pel-6 using in vitro RNA interference resulted in a 46.9% reduction of the number of nematodes that invaded the plants and a 61.5% suppression of the development of H. glycines females within roots compared to the GFP-dsRNA control. Plant host-derived RNAi induced the silencing of the Hg-pel-6gene, which significantly reduced the nematode infection levels at 7 Days post inoculation (dpi. Similarly, this procedure reduced the number of female adults at 40 dpi

  6. Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

    Ishida Betty K


    Full Text Available Abstract Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion.

  7. Gene expression analysis in human osteoblasts exposed to dexamethasone identifies altered developmental pathways as putative drivers of osteoporosis

    Sadlier Denise M


    Full Text Available Abstract Background Osteoporosis, a disease of decreased bone mineral density represents a significant and growing burden in the western world. Aging population structure and therapeutic use of glucocorticoids have contributed in no small way to the increase in the incidence of this disease. Despite substantial investigative efforts over the last number of years the exact molecular mechanism underpinning the initiation and progression of osteoporosis remain to be elucidated. This has meant that no significant advances in therapeutic strategies have emerged, with joint replacement surgery being the mainstay of treatment. Methods In this study we have used an integrated genomics profiling and computational biology based strategy to identify the key osteoblast genes and gene clusters whose expression is altered in response to dexamethasone exposure. Primary human osteoblasts were exposed to dexamethasone in vitro and microarray based transcriptome profiling completed. Results These studies identified approximately 500 osteoblast genes whose expression was altered. Functional characterization of the transcriptome identified developmental networks as being reactivated with 106 development associated genes found to be differentially regulated. Pathway reconstruction revealed coordinate alteration of members of the WNT signaling pathway, including frizzled-2, frizzled-7, DKK1 and WNT5B, whose differential expression in this setting was confirmed by real time PCR. Conclusion The WNT pathway is a key regulator of skeletogenesis as well as differentiation of bone cells. Reactivation of this pathway may lead to altered osteoblast activity resulting in decreased bone mineral density, the pathological hallmark of osteoporosis. The data herein lend weight to the hypothesis that alterations in developmental pathways drive the initiation and progression of osteoporosis.

  8. DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions

    Stuckenholz, Carsten; Labhart, Paul; Alexiadis, Vassili; Martin, René; Knölker, Hans-Joachim; Fisher, Alfred L.


    The nuclear receptor DAF-12 has roles in normal development, the decision to pursue dauer development in unfavorable conditions, and the modulation of adult aging. Despite the biologic importance of DAF-12, target genes for this receptor are largely unknown. To identify DAF-12 targets, we performed chromatin immunoprecipitation followed by hybridization to whole-genome tiling arrays. We identified 1,175 genomic regions to be bound in vivo by DAF-12, and these regions are enriched in known DAF-12 binding motifs and act as DAF-12 response elements in transfected cells and in transgenic worms. The DAF-12 target genes near these binding sites include an extensive network of interconnected heterochronic and microRNA genes. We also identify the genes encoding components of the miRISC, which is required for the control of target genes by microRNA, as a target of DAF-12 regulation. During reproductive development, many of these target genes are misregulated in daf-12(0) mutants, but this only infrequently results in developmental phenotypes. In contrast, we and others have found that null daf-12 mutations enhance the phenotypes of many miRISC and heterochronic target genes. We also find that environmental fluctuations significantly strengthen the weak heterochronic phenotypes of null daf-12 alleles. During diapause, DAF-12 represses the expression of many heterochronic and miRISC target genes, and prior work has demonstrated that dauer formation can suppress the heterochronic phenotypes of many of these target genes in post-dauer development. Together these data are consistent with daf-12 acting to ensure developmental robustness by committing the animal to adult or dauer developmental programs despite variable internal or external conditions. PMID:21814518

  9. A tale with a Twist: a developmental gene with potential relevance for metabolic dysfunction and inflammation in adipose tissue

    Anca Dana Dobrian


    Full Text Available The Twist proteins (Twist-1 and -2 are highly conserved developmental proteins with key roles for the transcriptional regulation in mesenchymal cell lineages. They belong to the super-family of bHLH proteins and exhibit bi-functional roles as both activators and repressors of gene transcription. The Twist proteins are expressed at low levels in adult tissues but may become abundantly re-expressed in cells undergoing malignant transformation. This observation prompted extensive research on the roles of Twist proteins in cancer progression and metastasis. Very recent studies indicate a novel role for Twist-1 as a potential regulator of adipose tissue remodeling and inflammation. Several studies suggested that developmental genes are important determinants of obesity, fat distribution and remodeling capacity of different adipose depots. Twist-1 is abundantly and selectively expressed in the adult adipose tissue and its constitutive expression is significantly higher in subcutaneous vs. visceral fat in both mice and humans. Moreover, Twist1 expression is strongly correlated with BMI and insulin resistance in humans. However, the functional roles and transcriptional downstream targets of Twist1 in adipose tissue are largely unexplored. The purpose of this review is to highlight the major findings related to Twist1 expression in different fat depots and cellular components of adipose tissue and to discuss the potential mechanisms suggesting a role for Twist1 in adipose tissue metabolism, inflammation and remodeling.

  10. The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes

    Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas


    Abstract The world’s smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development. PMID:29684203

  11. The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes.

    Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas


    The world's smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development.

  12. The HBZ gene, a key player in HTLV-1 pathogenesis

    Green Patrick L


    Full Text Available Abstract Human T-cell leukemia virus type 1 (HTLV-1 causes adult T-cell leukemia/lymphoma (ATL and is also associated with a variety of lymphocyte-mediated diseases. The HTLV-1 basic leucine zipper (HBZ gene, found to be consistently expressed in ATL, has recently been the subject of intensive research efforts. In this review, we summarize recent findings about HBZ and discuss its roles and functions not only in the virus life cycle, but also in HTLV-1 disease pathogenesis.

  13. Genomics and relative expression analysis identifies key genes associated with high female to male flower ratio in Jatropha curcas L.

    Gangwar, Manali; Sood, Hemant; Chauhan, Rajinder Singh


    Jatropha curcas, has been projected as a major source of biodiesel due to high seed oil content (42 %). A major roadblock for commercialization of Jatropha-based biodiesel is low seed yield per inflorescence, which is affected by low female to male flower ratio (1:25-30). Molecular dissection of female flower development by analyzing genes involved in phase transitions and floral organ development is, therefore, crucial for increasing seed yield. Expression analysis of 42 genes implicated in floral organ development and sex determination was done at six floral developmental stages of a J. curcas genotype (IC561235) with inherently higher female to male flower ratio (1:8-10). Relative expression analysis of these genes was done on low ratio genotype. Genes TFL1, SUP, AP1, CRY2, CUC2, CKX1, TAA1 and PIN1 were associated with reproductive phase transition. Further, genes CUC2, TAA1, CKX1 and PIN1 were associated with female flowering while SUP and CRY2 in female flower transition. Relative expression of these genes with respect to low female flower ratio genotype showed up to ~7 folds increase in transcript abundance of SUP, TAA1, CRY2 and CKX1 genes in intermediate buds but not a significant increase (~1.25 folds) in female flowers, thereby suggesting that these genes possibly play a significant role in increased transition towards female flowering by promoting abortion of male flower primordia. The outcome of study has implications in feedstock improvement of J. curcas through functional validation and eventual utilization of key genes associated with female flowering.

  14. Flg22-Triggered Immunity Negatively Regulates Key BR Biosynthetic Genes.

    Jiménez-Góngora, Tamara; Kim, Seong-Ki; Lozano-Durán, Rosa; Zipfel, Cyril


    In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR) have emerged as negative regulators of pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), promoting growth at the expense of defense. The crosstalk between BR and PTI signaling was described as negative and unidirectional, since activation of PTI does not affect several analyzed steps in the BR signaling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signaling, and occurs within 15 min of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  15. HDAC4: a key factor underlying brain developmental alterations in CDKL5 disorder.

    Trazzi, Stefania; Fuchs, Claudia; Viggiano, Rocchina; De Franceschi, Marianna; Valli, Emanuele; Jedynak, Paulina; Hansen, Finn K; Perini, Giovanni; Rimondini, Roberto; Kurz, Thomas; Bartesaghi, Renata; Ciani, Elisabetta


    Cyclin-dependent kinase-like 5 (CDKL5) is a Ser/Thr protein kinase predominantly expressed in the brain. Mutations of the CDKL5 gene lead to CDKL5 disorder, a neurodevelopmental pathology that shares several features with Rett Syndrome and is characterized by severe intellectual disability. The phosphorylation targets of CDKL5 are largely unknown, which hampers the discovery of therapeutic strategies for improving the neurological phenotype due to CDKL5 mutations. Here, we show that the histone deacetylase 4 (HDAC4) is a direct phosphorylation target of CDKL5 and that CDKL5-dependent phosphorylation promotes HDAC4 cytoplasmic retention. Nuclear HDAC4 binds to chromatin as well as to MEF2A transcription factor, leading to histone deacetylation and altered neuronal gene expression. By using a Cdkl5 knockout (Cdkl5 -/Y) mouse model, we found that hypophosphorylated HDAC4 translocates to the nucleus of neural precursor cells, thereby reducing histone 3 acetylation. This effect was reverted by re-expression of CDKL5 or by inhibition of HDAC4 activity through the HDAC4 inhibitor LMK235. In Cdkl5 -/Y mice treated with LMK235, defective survival and maturation of neuronal precursor cells and hippocampus-dependent memory were fully normalized. These results demonstrate a critical role of HDAC4 in the neurodevelopmental alterations due to CDKL5 mutations and suggest the possibility of HDAC4-targeted pharmacological interventions. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  16. A co-expression gene network associated with developmental regulation of apple fruit acidity.

    Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong


    Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

  17. Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

    Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola


    We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

  18. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich


    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  19. Available nitrogen is the key factor influencing soil microbial functional gene diversity in tropical rainforest.

    Cong, Jing; Liu, Xueduan; Lu, Hui; Xu, Han; Li, Yide; Deng, Ye; Li, Diqiang; Zhang, Yuguang


    Tropical rainforests cover over 50% of all known plant and animal species and provide a variety of key resources and ecosystem services to humans, largely mediated by metabolic activities of soil microbial communities. A deep analysis of soil microbial communities and their roles in ecological processes would improve our understanding on biogeochemical elemental cycles. However, soil microbial functional gene diversity in tropical rainforests and causative factors remain unclear. GeoChip, contained almost all of the key functional genes related to biogeochemical cycles, could be used as a specific and sensitive tool for studying microbial gene diversity and metabolic potential. In this study, soil microbial functional gene diversity in tropical rainforest was analyzed by using GeoChip technology. Gene categories detected in the tropical rainforest soils were related to different biogeochemical processes, such as carbon (C), nitrogen (N) and phosphorus (P) cycling. The relative abundance of genes related to C and P cycling detected mostly derived from the cultured bacteria. C degradation gene categories for substrates ranging from labile C to recalcitrant C were all detected, and gene abundances involved in many recalcitrant C degradation gene categories were significantly (P rainforest. Soil available N could be the key factor in shaping the soil microbial functional gene structure and metabolic potential.

  20. Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

    Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich


    The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

  1. Developmental Deltamethrin Exposure Causes Persistent Changes in Dopaminergic Gene Expression, Neurochemistry, and Locomotor Activity in Zebrafish.

    Kung, Tiffany S; Richardson, Jason R; Cooper, Keith R; White, Lori A


    Pyrethroids are commonly used insecticides that are considered to pose little risk to human health. However, there is an increasing concern that children are more susceptible to the adverse effects of pesticides. We used the zebrafish model to test the hypothesis that developmental exposure to low doses of the pyrethroid deltamethrin results in persistent alterations in dopaminergic gene expression, neurochemistry, and locomotor activity. Zebrafish embryos were treated with deltamethrin (0.25-0.50 μg/l), at concentrations below the LOAEL, during the embryonic period [3-72 h postfertilization (hpf)], after which transferred to fresh water until the larval stage (2-weeks postfertilization). Deltamethrin exposure resulted in decreased transcript levels of the D1 dopamine (DA) receptor (drd1) and increased levels of tyrosine hydroxylase at 72 hpf. The reduction in drd1 transcripts persisted to the larval stage and was associated with decreased D2 dopamine receptor transcripts. Larval fish, exposed developmentally to deltamethrin, had increased levels of homovanillic acid, a DA metabolite. Since the DA system is involved in locomotor activity, we measured the swim activity of larval fish following a transition to darkness. Developmental exposure to deltamethrin significantly increased larval swim activity which was attenuated by concomitant knockdown of the DA transporter. Acute exposure to methylphenidate, a DA transporter inhibitor, increased swim activity in control larva, while reducing swim activity in larva developmentally exposed to deltamethrin. Developmental exposure to deltamethrin causes locomotor deficits in larval zebrafish, which is likely mediated by dopaminergic dysfunction. This highlights the need to understand the persistent effects of low-dose neurotoxicant exposure during development. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail:

  2. Identifying key genes in rheumatoid arthritis by weighted gene co-expression network analysis.

    Ma, Chunhui; Lv, Qi; Teng, Songsong; Yu, Yinxian; Niu, Kerun; Yi, Chengqin


    This study aimed to identify rheumatoid arthritis (RA) related genes based on microarray data using the WGCNA (weighted gene co-expression network analysis) method. Two gene expression profile datasets GSE55235 (10 RA samples and 10 healthy controls) and GSE77298 (16 RA samples and seven healthy controls) were downloaded from Gene Expression Omnibus database. Characteristic genes were identified using metaDE package. WGCNA was used to find disease-related networks based on gene expression correlation coefficients, and module significance was defined as the average gene significance of all genes used to assess the correlation between the module and RA status. Genes in the disease-related gene co-expression network were subject to functional annotation and pathway enrichment analysis using Database for Annotation Visualization and Integrated Discovery. Characteristic genes were also mapped to the Connectivity Map to screen small molecules. A total of 599 characteristic genes were identified. For each dataset, characteristic genes in the green, red and turquoise modules were most closely associated with RA, with gene numbers of 54, 43 and 79, respectively. These genes were enriched in totally enriched in 17 Gene Ontology terms, mainly related to immune response (CD97, FYB, CXCL1, IKBKE, CCR1, etc.), inflammatory response (CD97, CXCL1, C3AR1, CCR1, LYZ, etc.) and homeostasis (C3AR1, CCR1, PLN, CCL19, PPT1, etc.). Two small-molecule drugs sanguinarine and papaverine were predicted to have a therapeutic effect against RA. Genes related to immune response, inflammatory response and homeostasis presumably have critical roles in RA pathogenesis. Sanguinarine and papaverine have a potential therapeutic effect against RA. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  3. Transcriptome analysis reveals key differentially expressed genes involved in wheat grain development

    Yonglong Yu


    Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.

  4. An oscillopathic approach to developmental dyslexia: From genes to speech processing.

    Jiménez-Bravo, Miguel; Marrero, Victoria; Benítez-Burraco, Antonio


    Developmental dyslexia is a heterogeneous condition entailing problems with reading and spelling. Several genes have been linked or associated to the disease, many of which contribute to the development and function of brain areas important for auditory and phonological processing. Nonetheless, a clear link between genes, the brain, and the symptoms of dyslexia is still pending. The goal of this paper is contributing to bridge this gap. With this aim, we have focused on how the dyslexic brain fails to process speech sounds and reading cues. We have adopted an oscillatory perspective, according to which dyslexia may result from a deficient integration of different brain rhythms during reading/spellings tasks. Moreover, we show that some candidate genes for this condition are related to brain rhythms. This fresh approach is expected to provide a better understanding of the aetiology and the clinical presentation of developmental dyslexia, but also to achieve an earlier and more accurate diagnosis of the disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

    Runko Suzan J


    Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and

  6. Transcriptome analysis of pecan seeds at different developing stages and identification of key genes involved in lipid metabolism.

    Xu, Zheng; Ni, Jun; Shah, Faheem Afzal; Wang, Qiaojian; Wang, Zhaocheng; Wu, Lifang; Fu, Songling


    Pecan is an economically important nut crop tree due to its unique texture and flavor properties. The pecan seed is rich of unsaturated fatty acid and protein. However, little is known about the molecular mechanisms of the biosynthesis of fatty acids in the developing seeds. In this study, transcriptome sequencing of the developing seeds was performed using Illumina sequencing technology. Pecan seed embryos at different developmental stages were collected and sequenced. The transcriptomes of pecan seeds at two key developing stages (PA, the initial stage and PS, the fast oil accumulation stage) were also compared. A total of 82,155 unigenes, with an average length of 1,198 bp from seven independent libraries were generated. After functional annotations, we detected approximately 55,854 CDS, among which, 2,807 were Transcription Factor (TF) coding unigenes. Further, there were 13,325 unigenes that showed a 2-fold or greater expression difference between the two groups of libraries (two developmental stages). After transcriptome analysis, we identified abundant unigenes that could be involved in fatty acid biosynthesis, degradation and some other aspects of seed development in pecan. This study presents a comprehensive dataset of transcriptomic changes during the seed development of pecan. It provides insights in understanding the molecular mechanisms responsible for fatty acid biosynthesis in the seed development. The identification of functional genes will also be useful for the molecular breeding work of pecan.

  7. Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

    Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen


    In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

  8. Genetic investigation of ocular developmental genes in 52 patients with anophthalmia/microphthalmia.

    Vidya, Nair Gopinathan; Rajkumar, Sankaranarayanan; Vasavada, Abhay R


    Mutation in eye developmental genes has been reported to cause anophthalmia and microphthalmia. However, in India, especially in the Western Indian population, such reports are scarce. Hence, the present study aims to investigate mutations in 15 ocular developmental genes in patients with anophthalmia and microphthalmia in the western region of India. Genomic DNA was isolated from the blood of 52 individuals affected with microphthalmia and anophthalmia, and 50 healthy normal controls. Polymerase chain reaction (PCR) was carried out for 15 genes including BMP4, CRYBA4, FOXE3, GDF6, GJA3, GJA8, MITF, OTX2, PAX6, PITX3, RAX, SIX3, SIX6, SOX2, and VSX2 using gene-specific primers spanning the exon-intron boundaries and part of a promoter region. The amplified PCR products were purified and then subjected to Sanger's bi-directional sequencing. Nucleotide variations were examined using a basic local alignment search tool (BLAST). Bi-directional sequencing identified 8 novel and 14 known variations. Out of this, the variations GJA3-c.92T>A; p.Ile31Asn, SOX2-c.542C>A; p.Pro181Gln and SOX2-c.541_542delinsGA; p.Pro181Glu were found to be deleterious by in silico analysis. The GJA3-p.Ile31Asn mutation was identified in a patient with bilateral microphthalmia, microcornea, and membranous cataract. The SOX2-p.Pro181Gln and SOX2-p.Pro181Glu mutations were identified in patients with isolated bilateral microphthalmia and microphthalmia with microcornea, respectively. A novel nondeleterious missense variation was identified in the GJA8 gene in a patient with anophthalmia. These results support the crucial role of GJA3 and SOX2 in eye development and indicate a detailed functional study to understand the molecular mechanisms underlying the disease pathology.

  9. Screening key candidate genes and pathways involved in insulinoma by microarray analysis.

    Zhou, Wuhua; Gong, Li; Li, Xuefeng; Wan, Yunyan; Wang, Xiangfei; Li, Huili; Jiang, Bin


    Insulinoma is a rare type tumor and its genetic features remain largely unknown. This study aimed to search for potential key genes and relevant enriched pathways of insulinoma.The gene expression data from GSE73338 were downloaded from Gene Expression Omnibus database. Differentially expressed genes (DEGs) were identified between insulinoma tissues and normal pancreas tissues, followed by pathway enrichment analysis, protein-protein interaction (PPI) network construction, and module analysis. The expressions of candidate key genes were validated by quantitative real-time polymerase chain reaction (RT-PCR) in insulinoma tissues.A total of 1632 DEGs were obtained, including 1117 upregulated genes and 514 downregulated genes. Pathway enrichment results showed that upregulated DEGs were significantly implicated in insulin secretion, and downregulated DEGs were mainly enriched in pancreatic secretion. PPI network analysis revealed 7 hub genes with degrees more than 10, including GCG (glucagon), GCGR (glucagon receptor), PLCB1 (phospholipase C, beta 1), CASR (calcium sensing receptor), F2R (coagulation factor II thrombin receptor), GRM1 (glutamate metabotropic receptor 1), and GRM5 (glutamate metabotropic receptor 5). DEGs involved in the significant modules were enriched in calcium signaling pathway, protein ubiquitination, and platelet degranulation. Quantitative RT-PCR data confirmed that the expression trends of these hub genes were similar to the results of bioinformatic analysis.The present study demonstrated that candidate DEGs and enriched pathways were the potential critical molecule events involved in the development of insulinoma, and these findings were useful for better understanding of insulinoma genesis.

  10. Systematic Prioritization and Integrative Analysis of Copy Number Variations in Schizophrenia Reveal Key Schizophrenia Susceptibility Genes

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin


    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  11. Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

    Traeger, Stefanie; Nowrousian, Minou


    During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

  12. Global Developmental Gene Programing Involves a Nuclear Form of Fibroblast Growth Factor Receptor-1 (FGFR1.

    Christopher Terranova

    Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.

  13. Tomato Fruits Show Wide Phenomic Diversity but Fruit Developmental Genes Show Low Genomic Diversity.

    Vijee Mohan

    Full Text Available Domestication of tomato has resulted in large diversity in fruit phenotypes. An intensive phenotyping of 127 tomato accessions from 20 countries revealed extensive morphological diversity in fruit traits. The diversity in fruit traits clustered the accessions into nine classes and identified certain promising lines having desirable traits pertaining to total soluble salts (TSS, carotenoids, ripening index, weight and shape. Factor analysis of the morphometric data from Tomato Analyzer showed that the fruit shape is a complex trait shared by several factors. The 100% variance between round and flat fruit shapes was explained by one discriminant function having a canonical correlation of 0.874 by stepwise discriminant analysis. A set of 10 genes (ACS2, COP1, CYC-B, RIN, MSH2, NAC-NOR, PHOT1, PHYA, PHYB and PSY1 involved in various plant developmental processes were screened for SNP polymorphism by EcoTILLING. The genetic diversity in these genes revealed a total of 36 non-synonymous and 18 synonymous changes leading to the identification of 28 haplotypes. The average frequency of polymorphism across the genes was 0.038/Kb. Significant negative Tajima'D statistic in two of the genes, ACS2 and PHOT1 indicated the presence of rare alleles in low frequency. Our study indicates that while there is low polymorphic diversity in the genes regulating plant development, the population shows wider phenotype diversity. Nonetheless, morphological and genetic diversity of the present collection can be further exploited as potential resources in future.

  14. Pyrosequencing of Haliotis diversicolor transcriptomes: insights into early developmental molluscan gene expression.

    Zi-Xia Huang

    Full Text Available BACKGROUND: The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. METHODOLOGY/PRINCIPAL FINDINGS: In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the 'lock system' in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM structures within the earliest postlarvae. CONCLUSION: This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level.

  15. Transcription profile data of phorbol esters biosynthetic genes during developmental stages in Jatropha curcas.

    Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa


    Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .

  16. Neonatal maternal deprivation response and developmental changes in gene expression revealed by hypothalamic gene expression profiling in mice.

    Feng Ding

    Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.

  17. Key gene regulating cell wall biosynthesis and recalcitrance in Populus, gene Y

    Chen, Jay; Engle, Nancy; Gunter, Lee E.; Jawdy, Sara; Tschaplinski, Timothy J.; Tuskan, Gerald A.


    This disclosure provides methods and transgenic plants for improved production of renewable biofuels and other plant-derived biomaterials by altering the expression and/or activity of Gene Y, an O-acetyltransferase. This disclosure also provides expression vectors containing a nucleic acid (Gene Y) which encodes the polypeptide of SEQ ID NO: 1 and is operably linked to a heterologous promoter.

  18. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Seong Hwan Park


    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  19. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon


    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  20. Screening key genes for abdominal aortic aneurysm based on gene expression omnibus dataset.

    Wan, Li; Huang, Jingyong; Ni, Haizhen; Yu, Guanfeng


    Abdominal aortic aneurysm (AAA) is a common cardiovascular system disease with high mortality. The aim of this study was to identify potential genes for diagnosis and therapy in AAA. We searched and downloaded mRNA expression data from the Gene Expression Omnibus (GEO) database to identify differentially expressed genes (DEGs) from AAA and normal individuals. Then, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analysis, transcriptional factors (TFs) network and protein-protein interaction (PPI) network were used to explore the function of genes. Additionally, immunohistochemical (IHC) staining was used to validate the expression of identified genes. Finally, the diagnostic value of identified genes was accessed by receiver operating characteristic (ROC) analysis in GEO database. A total of 1199 DEGs (188 up-regulated and 1011 down-regulated) were identified between AAA and normal individual. KEGG pathway analysis displayed that vascular smooth muscle contraction and pathways in cancer were significantly enriched signal pathway. The top 10 up-regulated and top 10 down-regulated DEGs were used to construct TFs and PPI networks. Some genes with high degrees such as NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16 and FOXO1 were identified to be related to AAA. The consequences of IHC staining showed that CCR7 and PDGFA were up-regulated in tissue samples of AAA. ROC analysis showed that NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16, FOXO1 and PDGFA had the potential diagnostic value for AAA. The identified genes including NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16, FOXO1 and PDGFA might be involved in the pathology of AAA.

  1. Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

    Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie


    Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

  2. Microarray analysis reveals key genes and pathways in Tetralogy of Fallot

    He, Yue-E; Qiu, Hui-Xian; Jiang, Jian-Bing; Wu, Rong-Zhou; Xiang, Ru-Lian; Zhang, Yuan-Hai


    The aim of the present study was to identify key genes that may be involved in the pathogenesis of Tetralogy of Fallot (TOF) using bioinformatics methods. The GSE26125 microarray dataset, which includes cardiovascular tissue samples derived from 16 children with TOF and five healthy age-matched control infants, was downloaded from the Gene Expression Omnibus database. Differential expression analysis was performed between TOF and control samples to identify differentially expressed genes (DEGs) using Student's t-test, and the R/limma package, with a log2 fold-change of >2 and a false discovery rate of <0.01 set as thresholds. The biological functions of DEGs were analyzed using the ToppGene database. The ReactomeFIViz application was used to construct functional interaction (FI) networks, and the genes in each module were subjected to pathway enrichment analysis. The iRegulon plugin was used to identify transcription factors predicted to regulate the DEGs in the FI network, and the gene-transcription factor pairs were then visualized using Cytoscape software. A total of 878 DEGs were identified, including 848 upregulated genes and 30 downregulated genes. The gene FI network contained seven function modules, which were all comprised of upregulated genes. Genes enriched in Module 1 were enriched in the following three neurological disorder-associated signaling pathways: Parkinson's disease, Alzheimer's disease and Huntington's disease. Genes in Modules 0, 3 and 5 were dominantly enriched in pathways associated with ribosomes and protein translation. The Xbox binding protein 1 transcription factor was demonstrated to be involved in the regulation of genes encoding the subunits of cytoplasmic and mitochondrial ribosomes, as well as genes involved in neurodegenerative disorders. Therefore, dysfunction of genes involved in signaling pathways associated with neurodegenerative disorders, ribosome function and protein translation may contribute to the pathogenesis of TOF

  3. Politics in a New Key: Breaking the Cycle of U.S. Politics with a Generational/Developmental Approach

    Ken White


    Full Text Available Some common, mental models shape how people in the US perceive political changes over time. The one-dimensional pendulum swing model and the two-dimensional cyclical model are prevalent. When generational differences are mapped onto such political change cycles, they orient to cohorts or age groups. This leads to viewing generational cohorts as experiencing one- or two-dimensional cycles without deeper scrutiny. Cohort differences that surface in the Generations Salons that I and others conducted in California suggest a different, three-dimensional model may be more representative of the potential for societal change in the US. Using a musical metaphor, that model is explained in terms of different political “keys” and the value of distinguishing among them as time passes. It also underlies a speculation about a “politics in a new key,” which might prove more useful.Summary-level reporting of the action research conducted with the Generations Salons supports the three-dimensional model. We expect new politics to emerge from the Millennial cohort coming of age now, yet it will not be without the support and wisdom of the cohorts that came of age before it. This must be the case if the burden of expectations we place on the Millennials will indeed pave the way for transformative change in US society. Intergenerational support of Millennials is essential. This initial research and application suggests the potential for the generational/ developmental approach as a wellspring for transformational—and practically successful—political work. It begs the question: What will you do to help?

  4. Politics in a New Key: Breaking the Cycle of U.S. Politics with a Generational/Developmental Approach

    Ken White


    Full Text Available Some common, mental models shape how people in the US perceive political changes over time. The one-dimensional pendulum swing model and the two-dimensional cyclical model are prevalent. When generational differences are mapped onto such political change cycles, they orient to cohorts or age groups. This leads to viewing generational cohorts as experiencing one- or two-dimensional cycles without deeper scrutiny. Cohort differences that surface in the Generations Salons that I and others conducted in California suggest a different, three-dimensional model may be more representative of the potential for societal change in the US. Using a musical metaphor, that model is explained in terms of different political “keys” and the value of distinguishing among them as time passes. It also underlies a speculation about a “politics in a new key,” which might prove more useful. Summary-level reporting of the action research conducted with the Generations Salons supports the three-dimensional model. We expect new politics to emerge from the Millennial cohort coming of age now, yet it will not be without the support and wisdom of the cohorts that came of age before it. This must be the case if the burden of expectations we place on the Millennials will indeed pave the way for transformative change in US society. Intergenerational support of Millennials is essential. This initial research and application suggests the potential for the generational/ developmental approach as a wellspring for transformational—and practically successful—political work. It begs the question: What will you do to help?

  5. Identification of key pathways and genes influencing prognosis in bladder urothelial carcinoma

    Ning X


    Full Text Available Xin Ning, Yaoliang Deng Department of Urology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi Province, People’s Republic of China Background: Genomic profiling can be used to identify the predictive effect of genomic subsets for determining prognosis in bladder urothelial carcinoma (BUC after radical cystectomy. This study aimed to investigate potential gene and pathway markers associated with prognosis in BUC.Methods: A microarray dataset of BUC was obtained from The Cancer Genome Atlas database. Differentially expressed genes (DEGs were identified by DESeq of the R platform. Kaplan–Meier analysis was applied for prognostic markers. Key pathways and genes were identified using bioinformatics tools, such as gene set enrichment analysis, gene ontology, the Kyoto Encyclopedia of Genes and Genomes, gene multiple association network integration algorithm (GeneMANIA, Search Tool for the Retrieval of Interacting Genes/Proteins, and Molecular Complex Detection.Results: A comparative gene set enrichment analysis of tumor and adjacent normal tissues suggested BUC tumorigenesis resulted mainly from enrichment of cell cycle and DNA damage and repair-related biological processes and pathways, including TP53 and mitotic recombination. Two hundred and fifty-six genes were identified as potential prognosis-related DEGs. Gene ontology and Kyoto Encyclopedia of Genes and Genomes analyses showed that the potential prognosis-related DEGs were enriched in angiogenesis, including the cyclic adenosine monophosphate biosynthetic process, cyclic guanosine monophosphate-protein kinase G, mitogen-activated protein kinase, Rap1, and phosphoinositide-3-kinase-AKT signaling pathway. Nine hub genes, TAGLN, ACTA2, MYH11, CALD1, MYLK, GEM, PRELP, TPM2, and OGN, were identified from the intersection of protein–protein interaction and GeneMANIA networks. Module analysis of protein–protein interaction and GeneMANIA networks mainly showed

  6. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha


    During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...

  7. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip


    ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...

  8. The expression of petunia strigolactone pathway genes is altered as part of the endogenous developmental program

    Revel S M Drummond


    Full Text Available Analysis of mutants with increased branching has revealed the strigolactone synthesis/perception pathway which regulates branching in plants. However, whether variation in this well conserved developmental signalling system contributes to the unique plant architectures of different species is yet to be determined. We examined petunia orthologues of the Arabidopsis MAX1 and MAX2 genes to characterise their role in petunia architecture. A single orthologue of MAX1, PhMAX1 which encodes a cytochrome P450, was identified and was able to complement the max1 mutant of Arabidopsis. Petunia has two copies of the MAX2 gene, PhMAX2A and PhMAX2B which encode F-Box proteins. Differences in the transcript levels of these two MAX2-like genes suggest diverging functions. Unlike PhMAX2B, PhMAX2A mRNA levels increase as leaves age. Nonetheless, this gene functionally complements the Arabidopsis max2 mutant indicating that the biochemical activity of the PhMAX2A protein is not significantly different from MAX2. The expression of the petunia strigolactone pathway genes (PhCCD7, PhCCD8, PhMAX1, PhMAX2A, and PhMAX2B was then further investigated throughout the development of wild-type petunia plants. Three of these genes showed changes in mRNA levels over the development series. Alterations to the expression of these genes over time, or in different regions of the plant, may influence the branching growth habit of the plant. Alterations to strigolactone production and/or sensitivity could allow both subtle and dramatic changes to branching within and between species.

  9. Network-Guided Key Gene Discovery for a Given Cellular Process

    He, Feng Q; Ollert, Markus


    Identification of key genes for a given physiological or pathological process is an essential but still very challenging task for the entire biomedical research community. Statistics-based approaches, such as genome-wide association study (GWAS)- or quantitative trait locus (QTL)-related analysis...... have already made enormous contributions to identifying key genes associated with a given disease or phenotype, the success of which is however very much dependent on a huge number of samples. Recent advances in network biology, especially network inference directly from genome-scale data...

  10. The histone variant macroH2A is an epigenetic regulator of key developmental genes

    Buschbeck, Marcus; Uribesalgo, Iris; Wibowo, Indra


    The histone variants macroH2A1 and macroH2A2 are associated with X chromosome inactivation in female mammals. However, the physiological function of macroH2A proteins on autosomes is poorly understood. Microarray-based analysis in human male pluripotent cells uncovered occupancy of both macroH2A ...

  11. Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

    Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T


    Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

  12. Changes in gravitational force affect gene expression in developing organ systems at different developmental times

    Moorman Stephen J


    Full Text Available Abstract Background Little is known about the affect of microgravity on gene expression, particularly in vivo during embryonic development. Using transgenic zebrafish that express the gfp gene under the influence of a β-actin promoter, we examined the affect of simulated-microgravity on GFP expression in the heart, notochord, eye, somites, and rohon beard neurons. We exposed transgenic zebrafish to simulated-microgravity for different durations at a variety of developmental times in an attempt to determine periods of susceptibility for the different developing organ systems. Results The developing heart had a period of maximum susceptibility between 32 and 56 hours after fertilization when there was an approximately 30% increase in gene expression. The notochord, eye, somites, and rohon beard neurons all showed periods of susceptibility occurring between 24 and 72 hours after fertilization. In addition, the notochord showed a second period of susceptibility between 8 and 32 hours after fertilization. Interestingly, all organs appeared to be recovering by 80 hours after fertilization despite continued exposure to simulated-microgravity. Conclusion These results support the idea that exposure to microgravity can cause changes in gene expression in a variety of developing organ systems in live embryos and that there are periods of maximum susceptibility to the effects.

  13. Identification of key genes involved in polysaccharide bioflocculant synthesis in Bacillus licheniformis.

    Chen, Zhen; Liu, Peize; Li, Zhipeng; Yu, Wencheng; Wang, Zhi; Yao, Haosheng; Wang, Yuanpeng; Li, Qingbiao; Deng, Xu; He, Ning


    The present study reports the sequenced genome of Bacillus licheniformis CGMCC 2876, which is composed of a 4,284,461 bp chromosome that contains 4,188 protein-coding genes, 72 tRNA genes, and 21 rRNA genes. Additional analysis revealed an eps gene cluster with 16 open reading frames. Conserved Domains Database analysis combined with qPCR experiments indicated that all genes in this cluster were involved in polysaccharide bioflocculant synthesis. Phosphoglucomutase and UDP-glucose pyrophosphorylase were supposed to be key enzymes in polysaccharide secretion in B. licheniformis. A biosynthesis pathway for the production of polysaccharide bioflocculant involving the integration of individual genes was proposed based on functional analysis. Overexpression of epsDEF from the eps gene cluster in B. licheniformis CGMCC 2876 increased the flocculating activity of the recombinant strain by 90% compared to the original strain. Similarly, the crude yield of polysaccharide bioflocculant was enhanced by 27.8%. Overexpression of the UDP-glucose pyrophosphorylase gene not only increased the flocculating activity by 71% but also increased bioflocculant yield by 13.3%. Independent of UDP-N-acetyl-D-mannosamine dehydrogenase gene, flocculating activity, and polysaccharide yield were negatively impacted by overexpression of the UDP-N-acetylglucosamine 2-epimerase gene. Overall, epsDEF and gtaB2 were identified as key genes for polysaccharide bioflocculant synthesis in B. licheniformis. These results will be useful for further engineering of B. licheniformis for industrial bioflocculant production. Biotechnol. Bioeng. 2017;114: 645-655. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. RNA Sequencing and Coexpression Analysis Reveal Key Genes Involved in α-Linolenic Acid Biosynthesis in Perilla frutescens Seed

    Tianyuan Zhang


    Full Text Available Perilla frutescen is used as traditional food and medicine in East Asia. Its seeds contain high levels of α-linolenic acid (ALA, which is important for health, but is scarce in our daily meals. Previous reports on RNA-seq of perilla seed had identified fatty acid (FA and triacylglycerol (TAG synthesis genes, but the underlying mechanism of ALA biosynthesis and its regulation still need to be further explored. So we conducted Illumina RNA-sequencing in seven temporal developmental stages of perilla seeds. Sequencing generated a total of 127 million clean reads, containing 15.88 Gb of valid data. The de novo assembly of sequence reads yielded 64,156 unigenes with an average length of 777 bp. A total of 39,760 unigenes were annotated and 11,693 unigenes were found to be differentially expressed in all samples. According to Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analysis, 486 unigenes were annotated in the “lipid metabolism” pathway. Of these, 150 unigenes were found to be involved in fatty acid (FA biosynthesis and triacylglycerol (TAG assembly in perilla seeds. A coexpression analysis showed that a total of 104 genes were highly coexpressed (r > 0.95. The coexpression network could be divided into two main subnetworks showing over expression in the medium or earlier and late phases, respectively. In order to identify the putative regulatory genes, a transcription factor (TF analysis was performed. This led to the identification of 45 gene families, mainly including the AP2-EREBP, bHLH, MYB, and NAC families, etc. After coexpression analysis of TFs with highly expression of FAD2 and FAD3 genes, 162 TFs were found to be significantly associated with two FAD genes (r > 0.95. Those TFs were predicted to be the key regulatory factors in ALA biosynthesis in perilla seed. The qRT-PCR analysis also verified the relevance of expression pattern between two FAD genes and partial candidate TFs. Although it has been reported that some TFs

  15. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

    Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.; Kodavanti, Prasada Rao S.


    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND) 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression (≥ 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans

  16. Developmental and growth temperature regulation of two different microsomal omega-6 desaturase genes in soybeans.

    Heppard, E P; Kinney, A J; Stecca, K L; Miao, G H


    The polyunsaturated fatty acid content is one of the major factors influencing the quality of vegetable oils. Edible oils rich in monounsaturated fatty acid provide improved oil stability, flavor, and nutrition for human and animal consumption. In plants, the microsomal omega-6 desaturase-catalyzed pathway is the primary route of production of polyunsaturated lipids. We report the isolation of two different cDNA sequences, FAD2-1 and FAD2-2, encoding microsomal omega-6 desaturase in soybeans and the characterization of their developmental and temperature regulation. The FAD2-1 gene is strongly expressed in developing seeds, whereas the FAD2-2 gene is constitutively expressed in both vegetative tissues and developing seeds. Thus, the FAD2-2 gene-encoded omega-6 desaturase appears to be responsible for production of polyunsaturated fatty acids within membrane lipids in both vegetative tissues and developing seeds. The seed-specifically expressed FAD2-1 gene is likely to play a major role in controlling conversion of oleic acid to linoleic acid within storage lipids during seed development. In both soybean seed and leaf tissues, linoleic acid and linolenic acid levels gradually increase as temperature decreases. However, the levels of transcripts for FAD2-1, FAD2-2, and the plastidial omega-6 desaturase gene (FAD 6) do not increase at low temperature. These results suggest that the elevated polyunsaturated fatty acid levels in developing soybean seeds grown at low temperature are not due to the enhanced expression of omega-6 desaturase genes. PMID:8587990

  17. The Drosophila Perlecan gene trol regulates multiple signaling pathways in different developmental contexts

    Perry Trinity L


    Full Text Available Abstract Background Heparan sulfate proteoglycans modulate signaling by a variety of growth factors. The mammalian proteoglycan Perlecan binds and regulates signaling by Sonic Hedgehog, Fibroblast Growth Factors (FGFs, Vascular Endothelial Growth Factor (VEGF and Platelet Derived Growth Factor (PDGF, among others, in contexts ranging from angiogenesis and cardiovascular development to cancer progression. The Drosophila Perlecan homolog trol has been shown to regulate the activity of Hedgehog and Branchless (an FGF homolog to control the onset of stem cell proliferation in the developing brain during first instar. Here we extend analysis of trol mutant phenotypes to show that trol is required for a variety of developmental events and modulates signaling by multiple growth factors in different situations. Results Different mutations in trol allow developmental progression to varying extents, suggesting that trol is involved in multiple cell-fate and patterning decisions. Analysis of the initiation of neuroblast proliferation at second instar demonstrated that trol regulates this event by modulating signaling by Hedgehog and Branchless, as it does during first instar. Trol protein is distributed over the surface of the larval brain, near the regulated neuroblasts that reside on the cortical surface. Mutations in trol also decrease the number of circulating plasmatocytes. This is likely to be due to decreased expression of pointed, the response gene for VEGF/PDGF signaling that is required for plasmatocyte proliferation. Trol is found on plasmatocytes, where it could regulate VEGF/PDGF signaling. Finally, we show that in second instar brains but not third instar brain lobes and eye discs, mutations in trol affect signaling by Decapentaplegic (a Transforming Growth Factor family member, Wingless (a Wnt growth factor and Hedgehog. Conclusion These studies extend the known functions of the Drosophila Perlecan homolog trol in both developmental and

  18. Identification of a developmental gene expression signature, including HOX genes, for the normal human colonic crypt stem cell niche: overexpression of the signature parallels stem cell overpopulation during colon tumorigenesis.

    Bhatlekar, Seema; Addya, Sankar; Salunek, Moreh; Orr, Christopher R; Surrey, Saul; McKenzie, Steven; Fields, Jeremy Z; Boman, Bruce M


    Our goal was to identify a unique gene expression signature for human colonic stem cells (SCs). Accordingly, we determined the gene expression pattern for a known SC-enriched region--the crypt bottom. Colonic crypts and isolated crypt subsections (top, middle, and bottom) were purified from fresh, normal, human, surgical specimens. We then used an innovative strategy that used two-color microarrays (∼18,500 genes) to compare gene expression in the crypt bottom with expression in the other crypt subsections (middle or top). Array results were validated by PCR and immunostaining. About 25% of genes analyzed were expressed in crypts: 88 preferentially in the bottom, 68 in the middle, and 131 in the top. Among genes upregulated in the bottom, ∼30% were classified as growth and/or developmental genes including several in the PI3 kinase pathway, a six-transmembrane protein STAMP1, and two homeobox (HOXA4, HOXD10) genes. qPCR and immunostaining validated that HOXA4 and HOXD10 are selectively expressed in the normal crypt bottom and are overexpressed in colon carcinomas (CRCs). Immunostaining showed that HOXA4 and HOXD10 are co-expressed with the SC markers CD166 and ALDH1 in cells at the normal crypt bottom, and the number of these co-expressing cells is increased in CRCs. Thus, our findings show that these two HOX genes are selectively expressed in colonic SCs and that HOX overexpression in CRCs parallels the SC overpopulation that occurs during CRC development. Our study suggests that developmental genes play key roles in the maintenance of normal SCs and crypt renewal, and contribute to the SC overpopulation that drives colon tumorigenesis.

  19. The axon guidance receptor gene ROBO1 is a candidate gene for developmental dyslexia.

    Katariina Hannula-Jouppi


    Full Text Available Dyslexia, or specific reading disability, is the most common learning disorder with a complex, partially genetic basis, but its biochemical mechanisms remain poorly understood. A locus on Chromosome 3, DYX5, has been linked to dyslexia in one large family and speech-sound disorder in a subset of small families. We found that the axon guidance receptor gene ROBO1, orthologous to the Drosophila roundabout gene, is disrupted by a chromosome translocation in a dyslexic individual. In a large pedigree with 21 dyslexic individuals genetically linked to a specific haplotype of ROBO1 (not found in any other chromosomes in our samples, the expression of ROBO1 from this haplotype was absent or attenuated in affected individuals. Sequencing of ROBO1 in apes revealed multiple coding differences, and the selection pressure was significantly different between the human, chimpanzee, and gorilla branch as compared to orangutan. We also identified novel exons and splice variants of ROBO1 that may explain the apparent phenotypic differences between human and mouse in heterozygous loss of ROBO1. We conclude that dyslexia may be caused by partial haplo-insufficiency for ROBO1 in rare families. Thus, our data suggest that a slight disturbance in neuronal axon crossing across the midline between brain hemispheres, dendrite guidance, or another function of ROBO1 may manifest as a specific reading disability in humans.

  20. The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia.


    Full Text Available Dyslexia, or specific reading disability, is the most common learning disorder with a complex, partially genetic basis, but its biochemical mechanisms remain poorly understood. A locus on Chromosome 3, DYX5, has been linked to dyslexia in one large family and speech-sound disorder in a subset of small families. We found that the axon guidance receptor gene ROBO1, orthologous to the Drosophila roundabout gene, is disrupted by a chromosome translocation in a dyslexic individual. In a large pedigree with 21 dyslexic individuals genetically linked to a specific haplotype of ROBO1 (not found in any other chromosomes in our samples, the expression of ROBO1 from this haplotype was absent or attenuated in affected individuals. Sequencing of ROBO1 in apes revealed multiple coding differences, and the selection pressure was significantly different between the human, chimpanzee, and gorilla branch as compared to orangutan. We also identified novel exons and splice variants of ROBO1 that may explain the apparent phenotypic differences between human and mouse in heterozygous loss of ROBO1. We conclude that dyslexia may be caused by partial haplo-insufficiency for ROBO1 in rare families. Thus, our data suggest that a slight disturbance in neuronal axon crossing across the midline between brain hemispheres, dendrite guidance, or another function of ROBO1 may manifest as a specific reading disability in humans.

  1. LcMYB1 Is a Key Determinant of Differential Anthocyanin Accumulation among Genotypes, Tissues, Developmental Phases and ABA and Light Stimuli in Litchi chinensis

    Lai, Biao; Li, Xiao-Jing; Hu, Bing; Qin, Yong-Hua; Huang, Xu-Ming; Wang, Hui-Cong; Hu, Gui-Bing


    The red coloration of litchi fruit depends on the accumulation of anthocyanins. The anthocyanins level in litchi fruit varies widely among cultivars, developmental stages and environmental stimuli. Previous studies on various plant species demonstrate that anthocyanin biosynthesis is controlled at the transcriptional level. Here, we describe a litchi R2R3-MYB transcription factor gene, LcMYB1, which demonstrates a similar sequence as other known anthocyanin regulators. The transcription level...

  2. HPRT deficiency coordinately dysregulates canonical Wnt and presenilin-1 signaling: a neuro-developmental regulatory role for a housekeeping gene?

    Tae Hyuk Kang


    Full Text Available We have used microarray-based methods of global gene expression together with quantitative PCR and Western blot analysis to identify dysregulation of genes and aberrant cellular processes in human fibroblasts and in SH-SY5Y neuroblastoma cells made HPRT-deficient by transduction with a retrovirus stably expressing an shRNA targeted against HPRT. Analysis of the microarray expression data by Gene ontology (GO and Gene Set Enrichment Analysis (GSEA as well as significant pathway analysis by GeneSpring GX10 and Panther Classification System reveal that HPRT deficiency is accompanied by aberrations in a variety of pathways known to regulate neurogenesis or to be implicated in neurodegenerative disease, including the canonical Wnt/β-catenin and the Alzheimer's disease/presenilin signaling pathways. Dysregulation of the Wnt/β-catenin pathway is confirmed by Western blot demonstration of cytosolic sequestration of β-catenin during in vitro differentiation of the SH-SY5Y cells toward the neuronal phenotype. We also demonstrate that two key transcription factor genes known to be regulated by Wnt signaling and to be vital for the generation and function of dopaminergic neurons; i.e., Lmx1a and Engrailed 1, are down-regulated in the HPRT knockdown SH-SY5Y cells. In addition to the Wnt signaling aberration, we found that expression of presenilin-1 shows severely aberrant expression in HPRT-deficient SH-SY5Y cells, reflected by marked deficiency of the 23 kDa C-terminal fragment of presenilin-1 in knockdown cells. Western blot analysis of primary fibroblast cultures from two LND patients also shows dysregulated presenilin-1 expression, including aberrant proteolytic processing of presenilin-1. These demonstrations of dysregulated Wnt signaling and presenilin-1 expression together with impaired expression of dopaminergic transcription factors reveal broad pleitropic neuro-regulatory defects played by HPRT expression and suggest new directions for

  3. Developmental and genetic modulation of arsenic biotransformation: A gene by environment interaction?

    Meza, Mercedes; Gandolfi, A. Jay; Klimecki, Walter T.


    The complexity of arsenic toxicology has confounded the identification of specific pathways of disease causation. One focal point of arsenic research is aimed at fully characterizing arsenic biotransformation in humans, a process that appears to be quite variable, producing a mixture of several arsenic species with greatly differing toxic potencies. In an effort to characterize genetic determinants of variability in arsenic biotransformation, a genetic association study of 135 subjects in western Sonora, Mexico was performed by testing 23 polymorphic sites in three arsenic biotransformation candidate genes. One gene, arsenic 3 methyltransferase (AS3MT), was strongly associated with the ratio of urinary dimethylarsinic acid to monomethylarsonic acid (D/M) in children (7-11 years) but not in adults (18-79 years). Subsequent analyses revealed that the high D/M values associated with variant AS3MT alleles were primarily due to lower levels of monomethylarsonic acid as percent of total urinary arsenic (%MMA5). In light of several reports of arsenic-induced disease being associated with relatively high %MMA5 levels, these findings raise the possibility that variant AS3MT individuals may suffer less risk from arsenic exposure than non-variant individuals. These analyses also provide evidence that, in this population, regardless of AS3MT variant status, children tend to have lower %MMA5 values than adults, suggesting that the global developmental regulation of arsenic biotransformation may interact with genetic variants in metabolic genes to result in novel genetic effects such as those in this report

  4. Molecular diagnosis of patients with epilepsy and developmental delay using a customized panel of epilepsy genes.

    Laura Ortega-Moreno

    Full Text Available Pediatric epilepsies are a group of disorders with a broad phenotypic spectrum that are associated with great genetic heterogeneity, thus making sequential single-gene testing an impractical basis for diagnostic strategy. The advent of next-generation sequencing has increased the success rate of epilepsy diagnosis, and targeted resequencing using genetic panels is the a most cost-effective choice. We report the results found in a group of 87 patients with epilepsy and developmental delay using targeted next generation sequencing (custom-designed Haloplex panel. Using this gene panel, we were able to identify disease-causing variants in 17 out of 87 (19.5% analyzed patients, all found in known epilepsy-associated genes (KCNQ2, CDKL5, STXBP1, SCN1A, PCDH19, POLG, SLC2A1, ARX, ALG13, CHD2, SYNGAP1, and GRIN1. Twelve of 18 variants arose de novo and 6 were novel. The highest yield was found in patients with onset in the first years of life, especially in patients classified as having early-onset epileptic encephalopathy. Knowledge of the underlying genetic cause provides essential information on prognosis and could be used to avoid unnecessary studies, which may result in a greater diagnostic cost-effectiveness.

  5. Quantitative transcription dynamic analysis reveals candidate genes and key regulators for ethanol tolerance in Saccharomyces cerevisiae

    Ma Menggen


    Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance

  6. Identification of Key Pathways and Genes in Advanced Coronary Atherosclerosis Using Bioinformatics Analysis

    Xiaowen Tan


    Full Text Available Background. Coronary artery atherosclerosis is a chronic inflammatory disease. This study aimed to identify the key changes of gene expression between early and advanced carotid atherosclerotic plaque in human. Methods. Gene expression dataset GSE28829 was downloaded from Gene Expression Omnibus (GEO, including 16 advanced and 13 early stage atherosclerotic plaque samples from human carotid. Differentially expressed genes (DEGs were analyzed. Results. 42,450 genes were obtained from the dataset. Top 100 up- and downregulated DEGs were listed. Functional enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG identification were performed. The result of functional and pathway enrichment analysis indicted that the immune system process played a critical role in the progression of carotid atherosclerotic plaque. Protein-protein interaction (PPI networks were performed either. Top 10 hub genes were identified from PPI network and top 6 modules were inferred. These genes were mainly involved in chemokine signaling pathway, cell cycle, B cell receptor signaling pathway, focal adhesion, and regulation of actin cytoskeleton. Conclusion. The present study indicated that analysis of DEGs would make a deeper understanding of the molecular mechanisms of atherosclerosis development and they might be used as molecular targets and diagnostic biomarkers for the treatment of atherosclerosis.

  7. Altered cortical expression of GABA-related genes in schizophrenia: illness progression vs developmental disturbance.

    Hoftman, Gil D; Volk, David W; Bazmi, H Holly; Li, Siyu; Sampson, Allan R; Lewis, David A


    Schizophrenia is a neurodevelopmental disorder with altered expression of GABA-related genes in the prefrontal cortex (PFC). However, whether these gene expression abnormalities reflect disturbances in postnatal developmental processes before clinical onset or arise as a consequence of clinical illness remains unclear. Expression levels for 7 GABA-related transcripts (vesicular GABA transporter [vGAT], GABA membrane transporter [GAT1], GABAA receptor subunit α1 [GABRA1] [novel in human and monkey cohorts], glutamic acid decarboxylase 67 [GAD67], parvalbumin, calretinin, and somatostatin [previously reported in human cohort, but not in monkey cohort]) were quantified in the PFC from 42 matched pairs of schizophrenia and comparison subjects and from 49 rhesus monkeys ranging in age from 1 week postnatal to adulthood. Levels of vGAT and GABRA1, but not of GAT1, messenger RNAs (mRNAs) were lower in the PFC of the schizophrenia subjects. As previously reported, levels of GAD67, parvalbumin, and somatostatin, but not of calretinin, mRNAs were also lower in these subjects. Neither illness duration nor age accounted for the levels of the transcripts with altered expression in schizophrenia. In monkey PFC, developmental changes in expression levels of many of these transcripts were in the opposite direction of the changes observed in schizophrenia. For example, mRNA levels for vGAT, GABRA1, GAD67, and parvalbumin all increased with age. Together with published reports, these findings support the interpretation that the altered expression of GABA-related transcripts in schizophrenia reflects a blunting of normal postnatal development changes, but they cannot exclude a decline during the early stages of clinical illness. © The Author 2013. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email:

  8. Developmental expression of "germline"- and "sex determination"-related genes in the ctenophore Mnemiopsis leidyi.

    Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q


    An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also

  9. Chromosome-Centric Human Proteome Project Allies with Developmental Biology: A Case Study of the Role of Y Chromosome Genes in Organ Development.

    Meyfour, Anna; Pooyan, Paria; Pahlavan, Sara; Rezaei-Tavirani, Mostafa; Gourabi, Hamid; Baharvand, Hossein; Salekdeh, Ghasem Hosseini


    One of the main goals of Chromosome-Centric Human Proteome Project is to identify protein evidence for missing proteins (MPs). Here, we present a case study of the role of Y chromosome genes in organ development and how to overcome the challenges facing MPs identification by employing human pluripotent stem cell differentiation into cells of different organs yielding unprecedented biological insight into adult silenced proteins. Y chromosome is a male-specific sex chromosome which escapes meiotic recombination. From an evolutionary perspective, Y chromosome has preserved 3% of ancestral genes compared to 98% preservation of the X chromosome based on Ohno's law. Male specific region of Y chromosome (MSY) contains genes that contribute to central dogma and govern the expression of various targets throughout the genome. One of the most well-known functions of MSY genes is to decide the male-specific characteristics including sex, testis formation, and spermatogenesis, which are majorly formed by ampliconic gene families. Beyond its role in sex-specific gonad development, MSY genes in coexpression with their X counterparts, as single copy and broadly expressed genes, inhibit haplolethality and play a key role in embryogenesis. The role of X-Y related gene mutations in the development of hereditary syndromes suggests an essential contribution of sex chromosome genes to development. MSY genes, solely and independent of their X counterparts and/or in association with sex hormones, have a considerable impact on organ development. In this Review, we present major recent findings on the contribution of MSY genes to gonad formation, spermatogenesis, and the brain, heart, and kidney development and discuss how Y chromosome proteome project may exploit developmental biology to find missing proteins.

  10. The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

    Gutiérrez Rodrigo A


    Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

  11. Developmental and growth defects in mice with combined deficiency of CK2 catalytic genes.

    Landesman-Bollag, Esther; Belkina, Anna; Hovey, Beth; Connors, Edward; Cox, Charles; Seldin, David C


    The CK2 α and α' catalytic gene products have overlapping biochemical activity, but in vivo, their functions are very different. Deletion of both alleles of CK2α leads to mid-gestational embryonic lethality, while deletion of both alleles of CK2α' does not interfere with viability or development of embryos; however, adult CK2α'-/-males are infertile. To further elucidate developmental roles of CK2, and analyze functional overlap between the two catalytic genes, mice with combined knockouts were bred. Mice bearing any two CK2 catalytic alleles were phenotypically normal. However, inheritance of a single CK2α allele, without either CK2α' allele, resulted in partial embryonic lethality. Such mice that survived through embryogenesis were smaller at birth than littermate controls, and weighed less throughout life. However, their cardiac function and lifespan were normal. Fibroblasts derived from CK2α+/-CK2α'-/- embryos grew poorly in culture. These experiments demonstrate that combined loss of one CK2α allele and both CK2α' alleles leads to unique abnormalities of growth and development.

  12. Drought response in wheat: key genes and regulatory mechanisms controlling root system architecture and transpiration efficiency

    Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G.; Kagale, Sateesh


    Abiotic stresses such as drought, heat, salinity and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize and/or Arabidopsis. The overall aim of this review was to provide an overview of candidate genes that have been tested as regulators of drought response in plants. The lack of a reference genome sequence for wheat and nontransgenic approaches for manipulation of gene functions in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold-standard reference genome

  13. Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

    Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long


    The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Integrated bioinformatics analysis reveals key candidate genes and pathways in breast cancer.

    Wang, Yuzhi; Zhang, Yi; Huang, Qian; Li, Chengwen


    Breast cancer (BC) is the leading malignancy in women worldwide, yet relatively little is known about the genes and signaling pathways involved in BC tumorigenesis and progression. The present study aimed to elucidate potential key candidate genes and pathways in BC. Five gene expression profile data sets (GSE22035, GSE3744, GSE5764, GSE21422 and GSE26910) were downloaded from the Gene Expression Omnibus (GEO) database, which included data from 113 tumorous and 38 adjacent non‑tumorous tissue samples. Differentially expressed genes (DEGs) were identified using t‑tests in the limma R package. These DEGs were subsequently investigated by pathway enrichment analysis and a protein‑protein interaction (PPI) network was constructed. The most significant module from the PPI network was selected for pathway enrichment analysis. In total, 227 DEGs were identified, of which 82 were upregulated and 145 were downregulated. Pathway enrichment analysis results revealed that the upregulated DEGs were mainly enriched in 'cell division', the 'proteinaceous extracellular matrix (ECM)', 'ECM structural constituents' and 'ECM‑receptor interaction', whereas downregulated genes were mainly enriched in 'response to drugs', 'extracellular space', 'transcriptional activator activity' and the 'peroxisome proliferator‑activated receptor signaling pathway'. The PPI network contained 174 nodes and 1,257 edges. DNA topoisomerase 2‑a, baculoviral inhibitor of apoptosis repeat‑containing protein 5, cyclin‑dependent kinase 1, G2/mitotic‑specific cyclin‑B1 and kinetochore protein NDC80 homolog were identified as the top 5 hub genes. Furthermore, the genes in the most significant module were predominantly involved in 'mitotic nuclear division', 'mid‑body', 'protein binding' and 'cell cycle'. In conclusion, the DEGs, relative pathways and hub genes identified in the present study may aid in understanding of the molecular mechanisms underlying BC progression and provide

  15. Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

    Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda


    Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database ( and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

  16. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping


    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  17. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping


    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  18. The leukemia-specific fusion gene ETV6/RUNX1 perturbs distinct key biological functions primarily by gene repression.

    Gerhard Fuka

    Full Text Available BACKGROUND: ETV6/RUNX1 (E/R (also known as TEL/AML1 is the most frequent gene fusion in childhood acute lymphoblastic leukemia (ALL and also most likely the crucial factor for disease initiation; its role in leukemia propagation and maintenance, however, remains largely elusive. To address this issue we performed a shRNA-mediated knock-down (KD of the E/R fusion gene and investigated the ensuing consequences on genome-wide gene expression patterns and deducible regulatory functions in two E/R-positive leukemic cell lines. FINDINGS: Microarray analyses identified 777 genes whose expression was substantially altered. Although approximately equal proportions were either up- (KD-UP or down-regulated (KD-DOWN, the effects on biological processes and pathways differed considerably. The E/R KD-UP set was significantly enriched for genes included in the "cell activation", "immune response", "apoptosis", "signal transduction" and "development and differentiation" categories, whereas in the E/R KD-DOWN set only the "PI3K/AKT/mTOR signaling" and "hematopoietic stem cells" categories became evident. Comparable expression signatures obtained from primary E/R-positive ALL samples underline the relevance of these pathways and molecular functions. We also validated six differentially expressed genes representing the categories "stem cell properties", "B-cell differentiation", "immune response", "cell adhesion" and "DNA damage" with RT-qPCR. CONCLUSION: Our analyses provide the first preliminary evidence that the continuous expression of the E/R fusion gene interferes with key regulatory functions that shape the biology of this leukemia subtype. E/R may thus indeed constitute the essential driving force for the propagation and maintenance of the leukemic process irrespective of potential consequences of associated secondary changes. Finally, these findings may also provide a valuable source of potentially attractive therapeutic targets.

  19. Neurogenetics of developmental dyslexia: from genes to behavior through brain neuroimaging and cognitive and sensorial mechanisms

    Mascheretti, S; De Luca, A; Trezzi, V; Peruzzo, D; Nordio, A; Marino, C; Arrigoni, F


    Developmental dyslexia (DD) is a complex neurodevelopmental deficit characterized by impaired reading acquisition, in spite of adequate neurological and sensorial conditions, educational opportunities and normal intelligence. Despite the successful characterization of DD-susceptibility genes, we are far from understanding the molecular etiological pathways underlying the development of reading (dis)ability. By focusing mainly on clinical phenotypes, the molecular genetics approach has yielded mixed results. More optimally reduced measures of functioning, that is, intermediate phenotypes (IPs), represent a target for researching disease-associated genetic variants and for elucidating the underlying mechanisms. Imaging data provide a viable IP for complex neurobehavioral disorders and have been extensively used to investigate both morphological, structural and functional brain abnormalities in DD. Performing joint genetic and neuroimaging studies in humans is an emerging strategy to link DD-candidate genes to the brain structure and function. A limited number of studies has already pursued the imaging–genetics integration in DD. However, the results are still not sufficient to unravel the complexity of the reading circuit due to heterogeneous study design and data processing. Here, we propose an interdisciplinary, multilevel, imaging–genetic approach to disentangle the pathways from genes to behavior. As the presence of putative functional genetic variants has been provided and as genetic associations with specific cognitive/sensorial mechanisms have been reported, new hypothesis-driven imaging–genetic studies must gain momentum. This approach would lead to the optimization of diagnostic criteria and to the early identification of ‘biologically at-risk’ children, supporting the definition of adequate and well-timed prevention strategies and the implementation of novel, specific remediation approach. PMID:28045463

  20. Neurogenetics of developmental dyslexia: from genes to behavior through brain neuroimaging and cognitive and sensorial mechanisms.

    Mascheretti, S; De Luca, A; Trezzi, V; Peruzzo, D; Nordio, A; Marino, C; Arrigoni, F


    Developmental dyslexia (DD) is a complex neurodevelopmental deficit characterized by impaired reading acquisition, in spite of adequate neurological and sensorial conditions, educational opportunities and normal intelligence. Despite the successful characterization of DD-susceptibility genes, we are far from understanding the molecular etiological pathways underlying the development of reading (dis)ability. By focusing mainly on clinical phenotypes, the molecular genetics approach has yielded mixed results. More optimally reduced measures of functioning, that is, intermediate phenotypes (IPs), represent a target for researching disease-associated genetic variants and for elucidating the underlying mechanisms. Imaging data provide a viable IP for complex neurobehavioral disorders and have been extensively used to investigate both morphological, structural and functional brain abnormalities in DD. Performing joint genetic and neuroimaging studies in humans is an emerging strategy to link DD-candidate genes to the brain structure and function. A limited number of studies has already pursued the imaging-genetics integration in DD. However, the results are still not sufficient to unravel the complexity of the reading circuit due to heterogeneous study design and data processing. Here, we propose an interdisciplinary, multilevel, imaging-genetic approach to disentangle the pathways from genes to behavior. As the presence of putative functional genetic variants has been provided and as genetic associations with specific cognitive/sensorial mechanisms have been reported, new hypothesis-driven imaging-genetic studies must gain momentum. This approach would lead to the optimization of diagnostic criteria and to the early identification of 'biologically at-risk' children, supporting the definition of adequate and well-timed prevention strategies and the implementation of novel, specific remediation approach.

  1. Comparative Transcriptome Analysis of Fetal Skin Reveals Key Genes Related to Hair Follicle Morphogenesis in Cashmere Goats.

    Ye Gao

    Full Text Available Cashmere goat skin contains two types of hair follicles (HF: primary hair follicles (PHF and secondary hair follicles (SHF. Although multiple genetic determinants associated with HF formation have been identified, the molecules that determine the independent morphogenesis of HF in cashmere goats remain elusive. The growth and development of SHF directly influence the quantity and quality of cashmere production. Here, we report the transcriptome profiling analysis of nine skin samples from cashmere goats using 60- and 120-day-old embryos (E60 and E120, respectively, as well as newborns (NB, through RNA-sequencing (RNA-seq. HF morphological changes indicated that PHF were initiated at E60, with maturation from E120, while differentiation of SHF was identified at E120 until formation of cashmere occurred after birth (NB. The RNA-sequencing analysis generated over 20.6 million clean reads from each mRNA library. The number of differentially expressed genes (DEGs in E60 vs. E120, E120 vs. NB, and E60 vs. NB were 1,024, 0 and 1,801, respectively, indicating that no significant differences were found at transcriptomic levels between E120 and NB. Key genes including B4GALT4, TNC, a-integrin, and FGFR1, were up-regulated and expressed in HF initiation from E60 to E120, while regulatory genes such as GPRC5D, PAD3, HOXC13, PRR9, VSIG8, LRRC15, LHX2, MSX-2, and FOXN1 were up-regulated and expressed in HF keratinisation and hair shaft differentiation from E120 and NB to E60. Several genes belonging to the KRT and KRTAP gene families were detected throughout the three HF developmental stages. The transcriptional trajectory analyses of all DEGs indicated that immune privilege, glycosaminoglycan biosynthesis, extracellular matrix receptor interaction, and growth factor receptors all played dominant roles in the epithelial-mesenchymal interface and HF formation. We found that the Wnt, transforming growth factor-beta/bone morphogenetic protein, and Notch family

  2. Comparative Transcriptome Analysis of Fetal Skin Reveals Key Genes Related to Hair Follicle Morphogenesis in Cashmere Goats.

    Gao, Ye; Wang, Xiaolong; Yan, Hailong; Zeng, Jie; Ma, Sen; Niu, Yiyuan; Zhou, Guangxian; Jiang, Yu; Chen, Yulin


    Cashmere goat skin contains two types of hair follicles (HF): primary hair follicles (PHF) and secondary hair follicles (SHF). Although multiple genetic determinants associated with HF formation have been identified, the molecules that determine the independent morphogenesis of HF in cashmere goats remain elusive. The growth and development of SHF directly influence the quantity and quality of cashmere production. Here, we report the transcriptome profiling analysis of nine skin samples from cashmere goats using 60- and 120-day-old embryos (E60 and E120, respectively), as well as newborns (NB), through RNA-sequencing (RNA-seq). HF morphological changes indicated that PHF were initiated at E60, with maturation from E120, while differentiation of SHF was identified at E120 until formation of cashmere occurred after birth (NB). The RNA-sequencing analysis generated over 20.6 million clean reads from each mRNA library. The number of differentially expressed genes (DEGs) in E60 vs. E120, E120 vs. NB, and E60 vs. NB were 1,024, 0 and 1,801, respectively, indicating that no significant differences were found at transcriptomic levels between E120 and NB. Key genes including B4GALT4, TNC, a-integrin, and FGFR1, were up-regulated and expressed in HF initiation from E60 to E120, while regulatory genes such as GPRC5D, PAD3, HOXC13, PRR9, VSIG8, LRRC15, LHX2, MSX-2, and FOXN1 were up-regulated and expressed in HF keratinisation and hair shaft differentiation from E120 and NB to E60. Several genes belonging to the KRT and KRTAP gene families were detected throughout the three HF developmental stages. The transcriptional trajectory analyses of all DEGs indicated that immune privilege, glycosaminoglycan biosynthesis, extracellular matrix receptor interaction, and growth factor receptors all played dominant roles in the epithelial-mesenchymal interface and HF formation. We found that the Wnt, transforming growth factor-beta/bone morphogenetic protein, and Notch family members

  3. An in silico analysis of the key genes involved in flavonoid biosynthesis in Citrus sinensis

    Adriano R. Lucheta


    Full Text Available Citrus species are known by their high content of phenolic compounds, including a wide range of flavonoids. In plants, these compounds are involved in protection against biotic and abiotic stresses, cell structure, UV protection, attraction of pollinators and seed dispersal. In humans, flavonoid consumption has been related to increasing overall health and fighting some important diseases. The goals of this study were to identify expressed sequence tags (EST in Citrus sinensis (L. Osbeck corresponding to genes involved in general phenylpropanoid biosynthesis and the key genes involved in the main flavonoids pathways (flavanones, flavones, flavonols, leucoanthocyanidins, anthocyanins and isoflavonoids. A thorough analysis of all related putative genes from the Citrus EST (CitEST database revealed several interesting aspects associated to these pathways and brought novel information with promising usefulness for both basic and biotechnological applications.

  4. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping


    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  5. Developmental Transcriptome Analysis and Identification of Genes Involved in Larval Metamorphosis of the Razor Clam, Sinonovacula constricta.

    Niu, Donghong; Wang, Fei; Xie, Shumei; Sun, Fanyue; Wang, Ze; Peng, Maoxiao; Li, Jiale


    The razor clam Sinonovacula constricta is an important commercial species. The deficiency of developmental transcriptomic data is becoming the bottleneck of further researches on the mechanisms underlying settlement and metamorphosis in early development. In this study, de novo transcriptome sequencing was performed for S. constricta at different early developmental stages by using Illumina HiSeq 2000 paired-end (PE) sequencing technology. A total of 112,209,077 PE clean reads were generated. De novo assembly generated 249,795 contigs with an average length of 585 bp. Gene annotation resulted in the identification of 22,870 unigene hits against the NCBI database. Eight unique sequences related to metamorphosis were identified and analyzed using real-time PCR. The razor clam reference transcriptome would provide useful information on early developmental and metamorphosis mechanisms and could be used in the genetic breeding of shellfish.

  6. Mutation update of transcription factor genes FOXE3, HSF4, MAF, and PITX3 causing cataracts and other developmental ocular defects.

    Anand, Deepti; Agrawal, Smriti A; Slavotinek, Anne; Lachke, Salil A


    Mutations in the transcription factor genes FOXE3, HSF4, MAF, and PITX3 cause congenital lens defects including cataracts that may be accompanied by defects in other components of the eye or in nonocular tissues. We comprehensively describe here all the variants in FOXE3, HSF4, MAF, and PITX3 genes linked to human developmental defects. A total of 52 variants for FOXE3, 18 variants for HSF4, 20 variants for MAF, and 19 variants for PITX3 identified so far in isolated cases or within families are documented. This effort reveals FOXE3, HSF4, MAF, and PITX3 to have 33, 16, 18, and 7 unique causal mutations, respectively. Loss-of-function mutant animals for these genes have served to model the pathobiology of the associated human defects, and we discuss the currently known molecular function of these genes, particularly with emphasis on their role in ocular development. Finally, we make the detailed FOXE3, HSF4, MAF, and PITX3 variant information available in the Leiden Online Variation Database (LOVD) platform at,,, and Thus, this article informs on key variants in transcription factor genes linked to cataract, aphakia, corneal opacity, glaucoma, microcornea, microphthalmia, anterior segment mesenchymal dysgenesis, and Ayme-Gripp syndrome, and facilitates their access through Web-based databases. © 2018 Wiley Periodicals, Inc.

  7. Role of key-regulator genes in melanoma susceptibility and pathogenesis among patients from South Italy

    Casula, Milena; Sini, MariaCristina; Palomba, Grazia; The Italian Melanoma Intergroup; Palmieri, Giuseppe; Muggiano, Antonio; Cossu, Antonio; Budroni, Mario; Caracò, Corrado; Ascierto, Paolo A; Pagani, Elena; Stanganelli, Ignazio; Canzanella, Sergio


    Several genetic alterations have been demonstrated to contribute to the development and progression of melanoma. In this study, we further investigated the impact of key-regulator genes in susceptibility and pathogenesis of such a disease. A large series (N = 846) of sporadic and familial cases originating from South Italy was screened for germline mutations in p16 CDKN2A , BRCA2, and MC1R genes by DHPLC analysis and automated DNA sequencing. Paired primary melanomas and lymph node metastases from same patients (N = 35) as well as melanoma cell lines (N = 18) were analyzed for somatic mutations in NRAS, BRAF, and p16 CDKN2A genes. For melanoma susceptibility, investigations at germline level indicated that p16 CDKN2A was exclusively mutated in 16/545 (2.9%) non-Sardinian patients, whereas BRCA2 germline mutations were observed in 4/91 (4.4%) patients from North Sardinia only. Two MC1R germline variants, Arg151Cys and Asp294His, were significantly associated with melanoma in Sardinia. Regarding genetic events involved in melanoma pathogenesis at somatic level, mutually-exclusive mutations of NRAS and BRAF genes were observed at quite same rate (about two thirds) in cultured and in vivo melanomas (either primary or metastatic lesions). Conversely, p16 CDKN2A gene alterations were observed at increased rates moving from primary to metastatic melanomas and melanoma cell lines. Activation of the ERK gene product was demonstrated to be consistently induced by a combination of molecular alterations (NRAS/BRAF mutations and p16 CDKN2A silencing). Our findings further clarified that: a) mutation prevalence in melanoma susceptibility genes may vary within each specific geographical area; b) multiple molecular events are accumulating during melanomagenesis

  8. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

    Hsieh, Ru-Lan [Department of Physical Medicine and Rehabilitation, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Department of Physical Medicine and Rehabilitation, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Shiue, Horng-Sheng [Department of Chinese Medicine, Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Taoyuan, Taiwan (China); Chen, Wei-Jen; Huang, Shiau-Rung [School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Lin, Ying-Chin [Department of Family Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Department of Health Examination, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan (China); Division of Family Medicine, School of Medicine, Taipei Medical University, Taipei, Taiwan (China); Lin, Ming-I; Mu, Shu-Chi [Department of Pediatrics, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Chen, Ray-Jade [Department of Digestive Surgery, Taipei Medical University Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)


    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA

  9. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

    Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei


    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA/MMA) index. • AS3MT

  10. Key concepts and principles that explain changes in the provision of supports for intellectual and developmental disabilities in Spain

    Miguel Ángel VERDUGO ALONSO


    Full Text Available The study focuses on the analysis of the central concepts that are influencing changes and transformations in the role of professionals and in the work done by organizations supporting people with intellectual and developmental disabilities in Spain. This includes the need for a global and systematic approach to the needs of the person, highlighting the importance of evidence to support professional, organizations and administrations decisions, and the influence that different systems (individual, family, organizational and social have in the life of the person. Finally, some conclusions are presented about the current moment and the immediate future.

  11. Cell wall composition and lignin biosynthetic gene expression along a developmental gradient in an Australian sugarcane cultivar

    William P. Bewg


    Full Text Available Sugarcane bagasse is an abundant source of lignocellulosic material for bioethanol production. Utilisation of bagasse for biofuel production would be environmentally and economically beneficial, but the recalcitrance of lignin continues to provide a challenge. Further understanding of lignin production in specific cultivars will provide a basis for modification of genomes for the production of phenotypes with improved processing characteristics. Here we evaluated the expression profile of lignin biosynthetic genes and the cell wall composition along a developmental gradient in KQ228 sugarcane. The expression levels of nine lignin biosynthesis genes were quantified in five stem sections of increasing maturity and in root tissue. Two distinct expression patterns were seen. The first saw highest gene expression in the youngest tissue, with expression decreasing as tissue matured. The second pattern saw little to no change in transcription levels across the developmental gradient. Cell wall compositional analysis of the stem sections showed total lignin content to be significantly higher in more mature tissue than in the youngest section assessed. There were no changes in structural carbohydrates across developmental sections. These gene expression and cell wall compositional patterns can be used, along with other work in grasses, to inform biotechnological approaches to crop improvement for lignocellulosic biofuel production.

  12. KIAA0319 gene polymorphisms are associated with developmental dyslexia in Chinese Uyghur children

    Zhao, Hua; Chen, Yun; Zhang, Bao-ping; Zuo, Peng-xiang


    The gene KIAA0319 has been reported to be associated with developmental dyslexia (DD) in previous studies, although the results have not always been consistent. However, few studies have been conducted in Uyghur populations. In the present study, we aimed to investigate the association of KIAA0319 polymorphisms and DD in individuals of Uyghurian descent. We used a custom-by-design 48-Plex SNPscan Kit to genotype 18 single-nucleotide polymorphisms (SNPs) of KIAA0319 in a group of 196 children with dyslexia and 196 controls of Uyghur descent aged 8–12 years. As a result, 7 SNPs (Pmin=0.001) of KIAA0319 had nominal significant differences between the cases and controls under specific genotypic models. The two SNPs rs6935076 (P=0.020 under dominant model; P=0.028 under additive model) and rs3756821 (P=0.021 under additive model) remained significantly associated with dyslexia after Bonferroni correction. Linkage disequilibrium analysis showed three blocks within KIAA0319, and only a 10-SNP haplotype in block 3 was present at significantly different frequencies in the dyslexic children and controls. This study indicated that genetic polymorphisms of KIAA0319 are associated with an increased risk of DD in the Uyghur population. PMID:27098879

  13. Polyphenism in social insects: insights from a transcriptome-wide analysis of gene expression in the life stages of the key pollinator, Bombus terrestris

    Colgan Thomas J


    Full Text Available Abstract Background Understanding polyphenism, the ability of a single genome to express multiple morphologically and behaviourally distinct phenotypes, is an important goal for evolutionary and developmental biology. Polyphenism has been key to the evolution of the Hymenoptera, and particularly the social Hymenoptera where the genome of a single species regulates distinct larval stages, sexual dimorphism and physical castes within the female sex. Transcriptomic analyses of social Hymenoptera will therefore provide unique insights into how changes in gene expression underlie such complexity. Here we describe gene expression in individual specimens of the pre-adult stages, sexes and castes of the key pollinator, the buff-tailed bumblebee Bombus terrestris. Results cDNA was prepared from mRNA from five life cycle stages (one larva, one pupa, one male, one gyne and two workers and a total of 1,610,742 expressed sequence tags (ESTs were generated using Roche 454 technology, substantially increasing the sequence data available for this important species. Overlapping ESTs were assembled into 36,354 B. terrestris putative transcripts, and functionally annotated. A preliminary assessment of differences in gene expression across non-replicated specimens from the pre-adult stages, castes and sexes was performed using R-STAT analysis. Individual samples from the life cycle stages of the bumblebee differed in the expression of a wide array of genes, including genes involved in amino acid storage, metabolism, immunity and olfaction. Conclusions Detailed analyses of immune and olfaction gene expression across phenotypes demonstrated how transcriptomic analyses can inform our understanding of processes central to the biology of B. terrestris and the social Hymenoptera in general. For example, examination of immunity-related genes identified high conservation of important immunity pathway components across individual specimens from the life cycle stages while

  14. Polyphenism in social insects: Insights from a transcriptome-wide analysis of gene expression in the life stages of the key pollinator, Bombus terrestris

    Colgan, Thomas J


    Abstract Background Understanding polyphenism, the ability of a single genome to express multiple morphologically and behaviourally distinct phenotypes, is an important goal for evolutionary and developmental biology. Polyphenism has been key to the evolution of the Hymenoptera, and particularly the social Hymenoptera where the genome of a single species regulates distinct larval stages, sexual dimorphism and physical castes within the female sex. Transcriptomic analyses of social Hymenoptera will therefore provide unique insights into how changes in gene expression underlie such complexity. Here we describe gene expression in individual specimens of the pre-adult stages, sexes and castes of the key pollinator, the buff-tailed bumblebee Bombus terrestris. Results cDNA was prepared from mRNA from five life cycle stages (one larva, one pupa, one male, one gyne and two workers) and a total of 1,610,742 expressed sequence tags (ESTs) were generated using Roche 454 technology, substantially increasing the sequence data available for this important species. Overlapping ESTs were assembled into 36,354 B. terrestris putative transcripts, and functionally annotated. A preliminary assessment of differences in gene expression across non-replicated specimens from the pre-adult stages, castes and sexes was performed using R-STAT analysis. Individual samples from the life cycle stages of the bumblebee differed in the expression of a wide array of genes, including genes involved in amino acid storage, metabolism, immunity and olfaction. Conclusions Detailed analyses of immune and olfaction gene expression across phenotypes demonstrated how transcriptomic analyses can inform our understanding of processes central to the biology of B. terrestris and the social Hymenoptera in general. For example, examination of immunity-related genes identified high conservation of important immunity pathway components across individual specimens from the life cycle stages while olfactory

  15. Past climate change on Sky Islands drives novelty in a core developmental gene network and its phenotype.

    Favé, Marie-Julie; Johnson, Robert A; Cover, Stefan; Handschuh, Stephan; Metscher, Brian D; Müller, Gerd B; Gopalan, Shyamalika; Abouheif, Ehab


    A fundamental and enduring problem in evolutionary biology is to understand how populations differentiate in the wild, yet little is known about what role organismal development plays in this process. Organismal development integrates environmental inputs with the action of gene regulatory networks to generate the phenotype. Core developmental gene networks have been highly conserved for millions of years across all animals, and therefore, organismal development may bias variation available for selection to work on. Biased variation may facilitate repeatable phenotypic responses when exposed to similar environmental inputs and ecological changes. To gain a more complete understanding of population differentiation in the wild, we integrated evolutionary developmental biology with population genetics, morphology, paleoecology and ecology. This integration was made possible by studying how populations of the ant species Monomorium emersoni respond to climatic and ecological changes across five 'Sky Islands' in Arizona, which are mountain ranges separated by vast 'seas' of desert. Sky Islands represent a replicated natural experiment allowing us to determine how repeatable is the response of M. emersoni populations to climate and ecological changes at the phenotypic, developmental, and gene network levels. We show that a core developmental gene network and its phenotype has kept pace with ecological and climate change on each Sky Island over the last ~90,000 years before present (BP). This response has produced two types of evolutionary change within an ant species: one type is unpredictable and contingent on the pattern of isolation of Sky lsland populations by climate warming, resulting in slight changes in gene expression, organ growth, and morphology. The other type is predictable and deterministic, resulting in the repeated evolution of a novel wingless queen phenotype and its underlying gene network in response to habitat changes induced by climate warming. Our

  16. Drought Response in Wheat: Key Genes and Regulatory Mechanisms Controlling Root System Architecture and Transpiration Efficiency

    Manoj Kulkarni


    Full Text Available Abiotic stresses such as, drought, heat, salinity, and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as, DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as, ERF (ethylene response factors, DREB (dehydration responsive element binding, ZFP (zinc finger proteins, WRKY, and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize, and/or Arabidopsis. The overall aim of this review is to provide an overview of candidate genes that have been identified as regulators of drought response in plants. The lack of a reference genome sequence for wheat and non-transgenic approaches for manipulation of gene functions in wheat in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a

  17. Identification of Key Pathways and Genes in the Dynamic Progression of HCC Based on WGCNA.

    Yin, Li; Cai, Zhihui; Zhu, Baoan; Xu, Cunshuan


    Hepatocellular carcinoma (HCC) is a devastating disease worldwide. Though many efforts have been made to elucidate the process of HCC, its molecular mechanisms of development remain elusive due to its complexity. To explore the stepwise carcinogenic process from pre-neoplastic lesions to the end stage of HCC, we employed weighted gene co-expression network analysis (WGCNA) which has been proved to be an effective method in many diseases to detect co-expressed modules and hub genes using eight pathological stages including normal, cirrhosis without HCC, cirrhosis, low-grade dysplastic, high-grade dysplastic, very early and early, advanced HCC and very advanced HCC. Among the eight consecutive pathological stages, five representative modules are selected to perform canonical pathway enrichment and upstream regulator analysis by using ingenuity pathway analysis (IPA) software. We found that cell cycle related biological processes were activated at four neoplastic stages, and the degree of activation of the cell cycle corresponded to the deterioration degree of HCC. The orange and yellow modules enriched in energy metabolism, especially oxidative metabolism, and the expression value of the genes decreased only at four neoplastic stages. The brown module, enriched in protein ubiquitination and ephrin receptor signaling pathways, correlated mainly with the very early stage of HCC. The darkred module, enriched in hepatic fibrosis/hepatic stellate cell activation, correlated with the cirrhotic stage only. The high degree hub genes were identified based on the protein-protein interaction (PPI) network and were verified by Kaplan-Meier survival analysis. The novel five high degree hub genes signature that was identified in our study may shed light on future prognostic and therapeutic approaches. Our study brings a new perspective to the understanding of the key pathways and genes in the dynamic changes of HCC progression. These findings shed light on further investigations.

  18. Developmental programming: gestational bisphenol-A treatment alters trajectory of fetal ovarian gene expression.

    Veiga-Lopez, Almudena; Luense, Lacey J; Christenson, Lane K; Padmanabhan, Vasantha


    Bisphenol-A (BPA), a ubiquitous environmental endocrine disrupting chemical, is a component of polycarbonate plastic and epoxy resins. Because of its estrogenic properties, there is increasing concern relative to risks from exposures during critical periods of early organ differentiation. Prenatal BPA treatment in sheep results in low birth weight, hypergonadotropism, and ovarian cycle disruptions. This study tested the hypothesis that gestational exposure to bisphenol A, at an environmentally relevant dose, induces early perturbations in the ovarian transcriptome (mRNA and microRNA). Pregnant Suffolk ewes were treated with bisphenol A (0.5 mg/kg, sc, daily, produced ∼2.6 ng/mL of unconjugated BPA in umbilical arterial samples of BPA treated fetuses approaching median levels of BPA measured in maternal circulation) from days 30 to 90 of gestation. Expression of steroidogenic enzymes, steroid/gonadotropin receptors, key ovarian regulators, and microRNA biogenesis components were measured by RT-PCR using RNA derived from fetal ovaries collected on gestational days 65 and 90. An age-dependent effect was evident in most steroidogenic enzymes, steroid receptors, and key ovarian regulators. Prenatal BPA increased Cyp19 and 5α-reductase expression in day 65, but not day 90, ovaries. Fetal ovarian microRNA expression was altered by prenatal BPA with 45 down-regulated (>1.5-fold) at day 65 and 11 down-regulated at day 90 of gestation. These included microRNAs targeting Sry-related high-mobility-group box (SOX) family genes, kit ligand, and insulin-related genes. The results of this study demonstrate that exposure to BPA at an environmentally relevant dose alters fetal ovarian steroidogenic gene and microRNA expression of relevance to gonadal differentiation, folliculogenesis, and insulin homeostasis.

  19. Expression of Key Structural Genes of the Phenylpropanoid Pathway Associated with Catechin Epimerization in Tea Cultivars

    Changsong Chen


    Full Text Available Catechin epimerization is an important factor affecting tea catechin compositions and thereby tea quality. However, a lack of tea germplasms with high non-epicatechins limits relative research. Here, a tea cultivar Y510 with high non-epicatechins was firstly reported and used for catechin and RNA sequencing (RNA-Seq analysis. Results showed that the (--gallocatechin gallate and (+-catechin (C contents in Y510 were at least 136 and 6 times higher than those in Fudingdabaicha and 0306I, but the epicatechins (--epigallocatechin and (--epicatechin (EC were significantly lower. Eleven unigenes potentially involved in catechin epimerization were identified by RNA-Seq analysis. Based on a combination of catechin and gene expression analysis, it was hypothesized that two anthocyanidin reductase genes (CsANR1, CsANR2 and an anthocyanidin synthase gene (CsANS are the key genes affecting catechin epimerization in tea. Non-epicatechin formations were hypothesized to be mainly influenced by the expression ratio of CsANR2 to CsANR1 and the expression of CsANS. Overexpression of CsANS in an Arabidopsis mutant tds4-2 led to a significant increase of EC accumulation in seeds, revealing CsANS is important for catechin epimerization. These results shed new light on breeding tea cultivars with special catechin compositions.

  20. A Key Gene, PLIN1, Can Affect Porcine Intramuscular Fat Content Based on Transcriptome Analysis

    Bojiang Li


    Full Text Available Intramuscular fat (IMF content is an important indicator for meat quality evaluation. However, the key genes and molecular regulatory mechanisms affecting IMF deposition remain unclear. In the present study, we identified 75 differentially expressed genes (DEGs between the higher (H and lower (L IMF content of pigs using transcriptome analysis, of which 27 were upregulated and 48 were downregulated. Notably, Kyoto Encyclopedia of Genes and Genomes (KEGG enrichment analysis indicated that the DEG perilipin-1 (PLIN1 was significantly enriched in the fat metabolism-related peroxisome proliferator-activated receptor (PPAR signaling pathway. Furthermore, we determined the expression patterns and functional role of porcine PLIN1. Our results indicate that PLIN1 was highly expressed in porcine adipose tissue, and its expression level was significantly higher in the H IMF content group when compared with the L IMF content group, and expression was increased during adipocyte differentiation. Additionally, our results confirm that PLIN1 knockdown decreases the triglyceride (TG level and lipid droplet (LD size in porcine adipocytes. Overall, our data identify novel candidate genes affecting IMF content and provide new insight into PLIN1 in porcine IMF deposition and adipocyte differentiation.

  1. A Key Gene, PLIN1, Can Affect Porcine Intramuscular Fat Content Based on Transcriptome Analysis.

    Li, Bojiang; Weng, Qiannan; Dong, Chao; Zhang, Zengkai; Li, Rongyang; Liu, Jingge; Jiang, Aiwen; Li, Qifa; Jia, Chao; Wu, Wangjun; Liu, Honglin


    Intramuscular fat (IMF) content is an important indicator for meat quality evaluation. However, the key genes and molecular regulatory mechanisms affecting IMF deposition remain unclear. In the present study, we identified 75 differentially expressed genes (DEGs) between the higher (H) and lower (L) IMF content of pigs using transcriptome analysis, of which 27 were upregulated and 48 were downregulated. Notably, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis indicated that the DEG perilipin-1 ( PLIN1 ) was significantly enriched in the fat metabolism-related peroxisome proliferator-activated receptor (PPAR) signaling pathway. Furthermore, we determined the expression patterns and functional role of porcine PLIN1. Our results indicate that PLIN1 was highly expressed in porcine adipose tissue, and its expression level was significantly higher in the H IMF content group when compared with the L IMF content group, and expression was increased during adipocyte differentiation. Additionally, our results confirm that PLIN1 knockdown decreases the triglyceride (TG) level and lipid droplet (LD) size in porcine adipocytes. Overall, our data identify novel candidate genes affecting IMF content and provide new insight into PLIN1 in porcine IMF deposition and adipocyte differentiation.

  2. Daily Rhythms of the Expression of Key Genes Involved in Steroidogenesis and Gonadal Function in Zebrafish.

    Viviana Di Rosa

    Full Text Available Fish present daily and seasonal rhythms in spawning and plasmatic levels of steroids that control reproduction. However, the existence of the rhythms of expression of the genes that underlie the endocrine mechanisms responsible for processes such as steroidogenesis and reproduction in fish have still been poorly explored to date. Here we investigated the daily pattern of the expression of key genes involved in sex steroid production that ultimately set the sex ratio in fish. Adult zebrafish were maintained under a 12:12 h light-dark cycle at a constant temperature of 27°C and were sampled every 4 h during a 24-hour cycle. The expression of key genes in the gonads and brains of female and male individuals were analyzed. In gonads, the expression of aromatase (cyp19a1a, ovarian aromatase and the antimüllerian hormone (amh, testis was rhythmic, with almost opposite acrophases: ZT 5:13 h (in the light phase and ZT 15:39 h (at night, respectively. The expression of foxl2 (forkhead box L2 was also rhythmic in the ovary (acrophase located at ZT 5:02 h and the expression of dmrt1 (doublesex and mab-3-related transcription factor 1 was rhythmic in testes (acrophase at ZT 18:36 h. In the brain, cyp19a1b (brain aromatase and cyp11b (11beta-hydroxylase presented daily differences, especially in males, where the expression peaked at night. These results provide the first evidence for marked time-of-the-day-dependent differences in the expression of the genes involved in sex ratio control, which should be considered when investigating processes such as reproduction, sex differentiation and steroidogenesis in fish.

  3. Testing for developmental neurotoxicity using a battery of in vitro assays for key cellular events in neurodevelopment.

    Harrill, Joshua A; Freudenrich, Theresa; Wallace, Kathleen; Ball, Kenneth; Shafer, Timothy J; Mundy, William R


    Medium- to high-throughput in vitro assays that recapitulate the critical processes of nervous system development have been proposed as a means to facilitate rapid testing and identification of chemicals which may affect brain development. In vivo neurodevelopment is a complex progression of distinct cellular processes. Therefore, batteries of in vitro assays that model and quantify effects on a variety of neurodevelopmental processes have the potential to identify chemicals which may affect brain development at different developmental stages. In the present study, the results of concentration-response screening of 67 reference chemicals in a battery of high content imaging and microplate reader-based assays that evaluate neural progenitor cell proliferation, neural proginitor cell apoptosis, neurite initiation/outgrowth, neurite maturation and synaptogenesis are summarized and compared. The assay battery had a high degree of combined sensitivity (87%) for categorizing chemicals known to affect neurodevelopment as active and a moderate degree of combined specificity (71%) for categorizing chemicals not associated with affects on neurodevelopment as inactive. The combined sensitivity of the assay battery was higher compared to any individual assay while the combined specificity of the assay battery was lower compared to any individual assay. When selectivity of effects for a neurodevelopmental endpoint as compared to general cytotoxicity was taken into account, the combined sensitivity of the assay battery decreased (68%) while the combined specificity increased (93%). The identity and potency of chemicals identified as active varied across the assay battery, underscoring the need for use of a combination of diverse in vitro models to comprehensively screen chemicals and identify those which potentially affect neurodevelopment. Overall, these data indicate that a battery of assays which address many different processes in nervous system development may be used to

  4. Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

    Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni


    The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

  5. De novo deletion of HOXB gene cluster in a patient with failure to thrive, developmental delay, gastroesophageal reflux and bronchiectasis.

    Pajusalu, Sander; Reimand, Tiia; Uibo, Oivi; Vasar, Maire; Talvik, Inga; Zilina, Olga; Tammur, Pille; Õunap, Katrin


    We report a female patient with a complex phenotype consisting of failure to thrive, developmental delay, congenital bronchiectasis, gastroesophageal reflux and bilateral inguinal hernias. Chromosomal microarray analysis revealed a 230 kilobase deletion in chromosomal region 17q21.32 (arr[hg19] 17q21.32(46 550 362-46 784 039)×1) encompassing only 9 genes - HOXB1 to HOXB9. The deletion was not found in her mother or father. This is the first report of a patient with a HOXB gene cluster deletion involving only HOXB1 to HOXB9 genes. By comparing our case to previously reported five patients with larger chromosomal aberrations involving the HOXB gene cluster, we can suppose that HOXB gene cluster deletions are responsible for growth retardation, developmental delay, and specific facial dysmorphic features. Also, we suppose that bilateral inguinal hernias, tracheo-esophageal abnormalities, and lung malformations represent features with incomplete penetrance. Interestingly, previously published knock-out mice with targeted heterozygous deletion comparable to our patient did not show phenotypic alterations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  6. Developmentally Sensitive Interaction Effects of Genes and the Social Environment on Total and Subcortical Brain Volumes.

    Richards, Jennifer S; Arias Vásquez, Alejandro; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Buitelaar, Jan K; Hartman, Catharina A


    Smaller total brain and subcortical volumes have been linked to psychopathology including attention-deficit/hyperactivity disorder (ADHD). Identifying mechanisms underlying these alterations, therefore, is of great importance. We investigated the role of gene-environment interactions (GxE) in interindividual variability of total gray matter (GM), caudate, and putamen volumes. Brain volumes were derived from structural magnetic resonance imaging scans in participants with (N = 312) and without ADHD (N = 437) from N = 402 families (age M = 17.00, SD = 3.60). GxE effects between DAT1, 5-HTT, and DRD4 and social environments (maternal expressed warmth and criticism; positive and deviant peer affiliation) as well as the possible moderating effect of age were examined using linear mixed modeling. We also tested whether findings depended on ADHD severity. Deviant peer affiliation was associated with lower caudate volume. Participants with low deviant peer affiliations had larger total GM volumes with increasing age. Likewise, developmentally sensitive GxE effects were found on total GM and putamen volume. For total GM, differential age effects were found for DAT1 9-repeat and HTTLPR L/L genotypes, depending on the amount of positive peer affiliation. For putamen volume, DRD4 7-repeat carriers and DAT1 10/10 homozygotes showed opposite age relations depending on positive peer affiliation and maternal criticism, respectively. All results were independent of ADHD severity. The presence of differential age-dependent GxE effects might explain the diverse and sometimes opposing results of environmental and genetic effects on brain volumes observed so far.

  7. Developmentally Sensitive Interaction Effects of Genes and the Social Environment on Total and Subcortical Brain Volumes.

    Jennifer S Richards

    Full Text Available Smaller total brain and subcortical volumes have been linked to psychopathology including attention-deficit/hyperactivity disorder (ADHD. Identifying mechanisms underlying these alterations, therefore, is of great importance. We investigated the role of gene-environment interactions (GxE in interindividual variability of total gray matter (GM, caudate, and putamen volumes. Brain volumes were derived from structural magnetic resonance imaging scans in participants with (N = 312 and without ADHD (N = 437 from N = 402 families (age M = 17.00, SD = 3.60. GxE effects between DAT1, 5-HTT, and DRD4 and social environments (maternal expressed warmth and criticism; positive and deviant peer affiliation as well as the possible moderating effect of age were examined using linear mixed modeling. We also tested whether findings depended on ADHD severity. Deviant peer affiliation was associated with lower caudate volume. Participants with low deviant peer affiliations had larger total GM volumes with increasing age. Likewise, developmentally sensitive GxE effects were found on total GM and putamen volume. For total GM, differential age effects were found for DAT1 9-repeat and HTTLPR L/L genotypes, depending on the amount of positive peer affiliation. For putamen volume, DRD4 7-repeat carriers and DAT1 10/10 homozygotes showed opposite age relations depending on positive peer affiliation and maternal criticism, respectively. All results were independent of ADHD severity. The presence of differential age-dependent GxE effects might explain the diverse and sometimes opposing results of environmental and genetic effects on brain volumes observed so far.

  8. Identification of two key genes controlling chill haze stability of beer in barley (Hordeum vulgare L).

    Ye, Lingzhen; Huang, Yuqing; Dai, Fei; Ning, Huajiang; Li, Chengdao; Zhou, Meixue; Zhang, Guoping


    In bright beer, haze formation is a serious quality problem, degrading beer quality and reducing its shelf life. The quality of barley (Hordeum vulgare L) malt, as the main raw material for beer brewing, largely affects the colloidal stability of beer. In this study, the genetic mechanism of the factors affecting beer haze stability in barley was studied. Quantitative trait loci (QTL) analysis of alcohol chill haze (ACH) in beer was carried out using a Franklin/Yerong double haploid (DH) population. One QTL, named as qACH, was detected for ACH, and it was located on the position of about 108 cM in chromosome 4H and can explain about 20 % of the phenotypic variation. Two key haze active proteins, BATI-CMb and BATI-CMd were identified by proteomics analysis. Bioinformatics analysis showed that BATI-CMb and BATI-CMd had the same position as qACH in the chromosome. It may be deduced that BATI-CMb and BATI-CMd are candidate genes for qACH, controlling colloidal stability of beer. Polymorphism comparison between Yerong and Franklin in the nucleotide and amino acid sequence of BATI-CMb and BATI-CMd detected the corresponding gene specific markers, which could be used in marker-assisted selection for malt barley breeding. We identified a novel QTL, qACH controlling chill haze of beer, and two key haze active proteins, BATI-CMb and BATI-CMd. And further analysis showed that BATI-CMb and BATI-CMd might be the candidate genes associated with beer chill haze.

  9. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    Martin, Ronny


    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  10. Effect of co-culture with enterocinogenic E. faecium on L. monocytogenes key virulence gene expression

    Eleftherios H. Drosinos


    Full Text Available The aim of the present study was to assess the expression of key virulence genes during co-culture of L. monocytogenes with a bacteriocinogenic E. faecium strain in liquid growth medium. For that purpose, BHI broth was inoculated with 7 log CFU·mL–1 L. monocytogenes and 4, 5 or 6 log CFU·mL–1 E. faecium. Sampling took place after 8 and 24 h of incubation, corresponding to the maximum and minimum of enterocin production, respectively. The RNA was extracted, stabilized and expression of prfA, sigB, hly, plcA, plcB, inlA, inlB, inlC and inlJ, was assessed by RT-qPCR. Most of the genes were downregulated during co-culture at 5 °C. Moreover, a statistically significant effect of the inoculum level was evident in most of the cases. On the contrary, no effect on the transcription level of most of the genes was observed during co-culture at 37 °C.

  11. Computational modeling identifies key gene regulatory interactions underlying phenobarbital-mediated tumor promotion

    Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik


    Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994

  12. Transcriptomic analysis reveals key genes related to betalain biosynthesis in pulp coloration of Hylocereus polyrhizus

    Hua eQingzhu


    Full Text Available Betalains have high nutritional value and bioactivities. Red pulp pitaya (Hylocereus polyrhizus is the only fruit containing abundant betalains for consumer. However, no information is available about genes involved in betalain biosynthesis in H. polyrhizus. Herein, two cDNA libraries of pitaya pulps with two different coloration stages (white and red pulp stages of Guanhuahong (H. polyrhizus were constructed. A total of about 12 Gb raw RNA-Seq data was generated and was de novo assembled into 122,677 transcripts with an average length of 1,183 bp and an N50 value of 2008. Approximately 99.99% of all transcripts were annotated based on seven public databases. A total of 8,871 transcripts were significantly regulated. Thirty-three candidate transcripts related to betalain biosynthesis were obtained from the transcriptome data. Transcripts encoding enzymes involved in betalain biosynthesis were analyzed using RT-qPCR at the whole pulp coloration stages of H. Polyrhizus (7-1 and H. Undatus (132-4. Nine key transcripts of betalain biosynthesis were identified. They were assigned to four kinds of genes in betalain biosynthetic pathway, including tyrosinase, 4, 5-DOPA dioxygenase extradiol, cytochrome P450 and glucosyltransferase. Ultimately, a preliminary betalain biosynthetic pathway for pitaya was proposed based on betalain analyses and gene expression profiles.

  13. A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

    Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling


    Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email:

  14. Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

    HSU Heng; Robert L. CHURCH


    During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

  15. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    Ram Prakash Gupta


    Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.

  16. LcMYB1 is a key determinant of differential anthocyanin accumulation among genotypes, tissues, developmental phases and ABA and light stimuli in Litchi chinensis.

    Biao Lai

    Full Text Available The red coloration of litchi fruit depends on the accumulation of anthocyanins. The anthocyanins level in litchi fruit varies widely among cultivars, developmental stages and environmental stimuli. Previous studies on various plant species demonstrate that anthocyanin biosynthesis is controlled at the transcriptional level. Here, we describe a litchi R2R3-MYB transcription factor gene, LcMYB1, which demonstrates a similar sequence as other known anthocyanin regulators. The transcription levels of the LcMYB1 and anthocyanin biosynthetic genes were investigated in samples with different anthocyanin levels. The expression of LcMYB1 was strongly associated with tissue anthocyanin content. LcMYB1 transcripts were only detected in anthocyanin-accumulating tissues and were positively correlated with anthocyanin accumulation in the pericarps of 12 genotypes. ABA and sunlight exposure promoted, whereas CPPU and bagging inhibited the expression of LcMYB1 and anthocyanin accumulation in the pericarp. Cis-elements associated with light responsiveness and abscisic acid responsiveness were identified in the promoter region of LcMYB1. Among the 6 structural genes tested, only LcUFGT was highly correlated with LcMYB1. These results suggest that LcMYB1 controls anthocyanin biosynthesis in litchi and LcUFGT might be the structural gene that is targeted and regulated by LcMYB1. Furthermore, the overexpression of LcMYB1 induced anthocyanin accumulation in all tissues in tobacco, confirming the function of LcMYB1 in the regulation of anthocyanin biosynthesis. The upregulation of NtAn1b in response to LcMYB1 overexpression seems to be essential for anthocyanin accumulation in the leaf and pedicel. In the reproductive tissues of transgenic tobacco, however, increased anthocyanin accumulation is independent of tobacco's endogenous MYB and bHLH transcriptional factors, but associated with the upregulation of specific structural genes.

  17. LcMYB1 is a key determinant of differential anthocyanin accumulation among genotypes, tissues, developmental phases and ABA and light stimuli in Litchi chinensis.

    Lai, Biao; Li, Xiao-Jing; Hu, Bing; Qin, Yong-Hua; Huang, Xu-Ming; Wang, Hui-Cong; Hu, Gui-Bing


    The red coloration of litchi fruit depends on the accumulation of anthocyanins. The anthocyanins level in litchi fruit varies widely among cultivars, developmental stages and environmental stimuli. Previous studies on various plant species demonstrate that anthocyanin biosynthesis is controlled at the transcriptional level. Here, we describe a litchi R2R3-MYB transcription factor gene, LcMYB1, which demonstrates a similar sequence as other known anthocyanin regulators. The transcription levels of the LcMYB1 and anthocyanin biosynthetic genes were investigated in samples with different anthocyanin levels. The expression of LcMYB1 was strongly associated with tissue anthocyanin content. LcMYB1 transcripts were only detected in anthocyanin-accumulating tissues and were positively correlated with anthocyanin accumulation in the pericarps of 12 genotypes. ABA and sunlight exposure promoted, whereas CPPU and bagging inhibited the expression of LcMYB1 and anthocyanin accumulation in the pericarp. Cis-elements associated with light responsiveness and abscisic acid responsiveness were identified in the promoter region of LcMYB1. Among the 6 structural genes tested, only LcUFGT was highly correlated with LcMYB1. These results suggest that LcMYB1 controls anthocyanin biosynthesis in litchi and LcUFGT might be the structural gene that is targeted and regulated by LcMYB1. Furthermore, the overexpression of LcMYB1 induced anthocyanin accumulation in all tissues in tobacco, confirming the function of LcMYB1 in the regulation of anthocyanin biosynthesis. The upregulation of NtAn1b in response to LcMYB1 overexpression seems to be essential for anthocyanin accumulation in the leaf and pedicel. In the reproductive tissues of transgenic tobacco, however, increased anthocyanin accumulation is independent of tobacco's endogenous MYB and bHLH transcriptional factors, but associated with the upregulation of specific structural genes.

  18. Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development[W][OPEN

    Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola


    We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918

  19. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Shutao Zhang

    Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  20. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan


    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  1. ANLN functions as a key candidate gene in cervical cancer as determined by integrated bioinformatic analysis

    Xia L


    DEGs PPI network complex, contained 305 nodes and 4,962 edges, and 8 clusters were calculated according to k-core =2. Among them, cluster 1, which had 65 nodes and 1,780 edges, had the highest score in these clusters. In coexpression analysis, there were 86 hubgenes from the Brown modules that were chosen for further analysis. Sixty-one key genes were identified as the intersecting genes of the Brown module of WGCNA and DEGs. In survival analysis, only ANLN was a prognostic factor, and the survival was significantly better in the low-expression ANLN group.Conclusion: Our study suggested that ANLN may be a potential tumor oncogene and could serve as a biomarker for predicting the prognosis of cervical cancer patients. Keywords: bioinformatics analysis, cervical cancer, WGCNA, ANLN 

  2. Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

    Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi


    The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  3. Developmental Functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Genes in Arabidopsis thaliana.

    Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott


    Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.

  4. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan


    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...

  5. Selection and validation of reference genes for quantitative gene expression analyses in various tissues and seeds at different developmental stages in Bixa orellana L.

    Moreira, Viviane S; Soares, Virgínia L F; Silva, Raner J S; Sousa, Aurizangela O; Otoni, Wagner C; Costa, Marcio G C


    Bixa orellana L., popularly known as annatto, produces several secondary metabolites of pharmaceutical and industrial interest, including bixin, whose molecular basis of biosynthesis remain to be determined. Gene expression analysis by quantitative real-time PCR (qPCR) is an important tool to advance such knowledge. However, correct interpretation of qPCR data requires the use of suitable reference genes in order to reduce experimental variations. In the present study, we have selected four different candidates for reference genes in B. orellana , coding for 40S ribosomal protein S9 (RPS9), histone H4 (H4), 60S ribosomal protein L38 (RPL38) and 18S ribosomal RNA (18SrRNA). Their expression stabilities in different tissues (e.g. flower buds, flowers, leaves and seeds at different developmental stages) were analyzed using five statistical tools (NormFinder, geNorm, BestKeeper, ΔCt method and RefFinder). The results indicated that RPL38 is the most stable gene in different tissues and stages of seed development and 18SrRNA is the most unstable among the analyzed genes. In order to validate the candidate reference genes, we have analyzed the relative expression of a target gene coding for carotenoid cleavage dioxygenase 1 (CCD1) using the stable RPL38 and the least stable gene, 18SrRNA , for normalization of the qPCR data. The results demonstrated significant differences in the interpretation of the CCD1 gene expression data, depending on the reference gene used, reinforcing the importance of the correct selection of reference genes for normalization.

  6. Constitutive expression of ftsZ overrides the whi developmental genes to initiate sporulation of Streptomyces coelicolor.

    Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P


    The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.

  7. Global Transcriptome Analysis of Combined Abiotic Stress Signaling Genes Unravels Key Players in Oryza sativa L.: An In silico Approach

    Pandiyan Muthuramalingam


    Full Text Available Combined abiotic stress (CAbS affects the field grown plants simultaneously. The multigenic and quantitative nature of uncontrollable abiotic stresses complicates the process of understanding the stress response by plants. Considering this, we analyzed the CAbS response of C3 model plant, Oryza sativa by meta-analysis. The datasets of commonly expressed genes by drought, salinity, submergence, metal, natural expression, biotic, and abiotic stresses were data mined through publically accessible transcriptomic abiotic stress (AbS responsive datasets. Of which 1,175, 12,821, and 42,877 genes were commonly expressed in meta differential, individual differential, and unchanged expressions respectively. Highly regulated 100 differentially expressed AbS genes were derived through integrative meta-analysis of expression data (INMEX. Of this 30 genes were identified from AbS gene families through expression atlas that were computationally analyzed for their physicochemical properties. All AbS genes were physically mapped against O. sativa genome. Comparative mapping of these genes demonstrated the orthologous relationship with related C4 panicoid genome. In silico expression analysis of these genes showed differential expression patterns in different developmental tissues. Protein–protein interaction of these genes, represented the complexity of AbS. Computational expression profiling of candidate genes in response to multiple stresses suggested the putative involvement of OS05G0350900, OS02G0612700, OS05G0104200, OS03G0596200, OS12G0225900, OS07G0152000, OS08G0119500, OS06G0594700, and Os01g0393100 in CAbS. These potential candidate genes need to be studied further to decipher their functional roles in AbS dynamics.

  8. A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

    Kück, Ulrich


    Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

  9. Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

    Shuhua Zhan

    Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

  10. Non-uniform distribution pattern for differentially expressed genes of transgenic rice Huahui 1 at different developmental stages and environments.

    Zhi Liu

    Full Text Available DNA microarray analysis is an effective method to detect unintended effects by detecting differentially expressed genes (DEG in safety assessment of genetically modified (GM crops. With the aim to reveal the distribution of DEG of GM crops under different conditions, we performed DNA microarray analysis using transgenic rice Huahui 1 (HH1 and its non-transgenic parent Minghui 63 (MH63 at different developmental stages and environmental conditions. Considerable DEG were selected in each group of HH1 under different conditions. For each group of HH1, the number of DEG was different; however, considerable common DEG were shared between different groups of HH1. These findings suggested that both DEG and common DEG were adequate for investigation of unintended effects. Furthermore, a number of significantly changed pathways were found in all groups of HH1, indicating genetic modification caused everlasting changes to plants. To our knowledge, our study for the first time provided the non-uniformly distributed pattern for DEG of GM crops at different developmental stages and environments. Our result also suggested that DEG selected in GM plants at specific developmental stage and environment could act as useful clues for further evaluation of unintended effects of GM plants.

  11. The differential gene expression of key enzyme in the gibberellin pathway in the potato (solanum tuberosum) mutant

    Shi, J.B.; Ye, G.J.; Yang, Y.Z.; Wang, F.; Zhou, Y; Wang, J.


    In the present study, the expression patterns of the key genes in the gibberellin synthesis pathway in the potato dwarf mutant M4P-9 were detected using quantitative real-time PCR. Using Actin as an internal control, CPS1, KS, KO, GA20ox1, and GA2ox1, genes for key gibberellin synthesis enzymes, were evaluated, along with a gibberellin receptor gene. The standard curves were obtained from dilutions of PCR product; the correlation coefficient for Actin was 0.995, and those for the target genes varied from 0.994 to 1.000. The expression patterns of gibberellin pathway genes in different growth stages and tissues were calculated according to the method of Pfaffl. These genes showed expression patterns that varied based on growth stage and tissue type. The higher expression levels of CPS1 and GA2ox1 in roots, the lower expression levels of GA20ox1 in roots during tuber formation stage; as well as the increased expression of GA20ox1 and GA2ox1 genes in stems during the tuber formation stage, likely play key roles in the plant height phenotype in M4P-9 mutant materials. This article provides a basis for researching the mechanism of gibberellin synthesis in potato. (author)

  12. Abrupt onset of mutations in a developmentally regulated gene during terminal differentiation of post-mitotic photoreceptor neurons in mice.

    Ivette M Sandoval

    Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.

  13. A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

    Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H


    PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Developmental gene regulatory networks in sea urchins and what we can learn from them [version 1; referees: 3 approved

    Megan L. Martik


    Full Text Available Sea urchin embryos begin zygotic transcription shortly after the egg is fertilized.  Throughout the cleavage stages a series of transcription factors are activated and, along with signaling through a number of pathways, at least 15 different cell types are specified by the beginning of gastrulation.  Experimentally, perturbation of contributing transcription factors, signals and receptors and their molecular consequences enabled the assembly of an extensive gene regulatory network model.  That effort, pioneered and led by Eric Davidson and his laboratory, with many additional insights provided by other laboratories, provided the sea urchin community with a valuable resource.  Here we describe the approaches used to enable the assembly of an advanced gene regulatory network model describing molecular diversification during early development.  We then provide examples to show how a relatively advanced authenticated network can be used as a tool for discovery of how diverse developmental mechanisms are controlled and work.

  15. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research & Development Institute, Incheon 46083 (Korea, Republic of); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Choe, Joonho [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 34141 (Korea, Republic of); Lee, Jae-Seong, E-mail: [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)


    Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

  16. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong


    Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

  17. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    David A Garfield


    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  18. Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

    Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou


    Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Identification of conserved drought stress responsive gene-network across tissues and developmental stages in rice.

    Smita, Shuchi; Katiyar, Amit; Pandey, Dev Mani; Chinnusamy, Viswanathan; Archak, Sunil; Bansal, Kailash Chander


    Identification of genes that are coexpressed across various tissues and environmental stresses is biologically interesting, since they may play coordinated role in similar biological processes. Genes with correlated expression patterns can be best identified by using coexpression network analysis of transcriptome data. In the present study, we analyzed the temporal-spatial coordination of gene expression in root, leaf and panicle of rice under drought stress and constructed network using WGCNA and Cytoscape. Total of 2199 differentially expressed genes (DEGs) were identified in at least three or more tissues, wherein 88 genes have coordinated expression profile among all the six tissues under drought stress. These 88 highly coordinated genes were further subjected to module identification in the coexpression network. Based on chief topological properties we identified 18 hub genes such as ABC transporter, ATP-binding protein, dehydrin, protein phosphatase 2C, LTPL153 - Protease inhibitor, phosphatidylethanolaminebinding protein, lactose permease-related, NADP-dependent malic enzyme, etc. Motif enrichment analysis showed the presence of ABRE cis-elements in the promoters of > 62% of the coordinately expressed genes. Our results suggest that drought stress mediated upregulated gene expression was coordinated through an ABA-dependent signaling pathway across tissues, at least for the subset of genes identified in this study, while down regulation appears to be regulated by tissue specific pathways in rice.

  20. Gene networks underlying convergent and pleiotropic phenotypes in a large and systematically-phenotyped cohort with heterogeneous developmental disorders.

    Andrews, Tallulah; Meader, Stephen; Vulto-van Silfhout, Anneke; Taylor, Avigail; Steinberg, Julia; Hehir-Kwa, Jayne; Pfundt, Rolph; de Leeuw, Nicole; de Vries, Bert B A; Webber, Caleb


    Readily-accessible and standardised capture of genotypic variation has revolutionised our understanding of the genetic contribution to disease. Unfortunately, the corresponding systematic capture of patient phenotypic variation needed to fully interpret the impact of genetic variation has lagged far behind. Exploiting deep and systematic phenotyping of a cohort of 197 patients presenting with heterogeneous developmental disorders and whose genomes harbour de novo CNVs, we systematically applied a range of commonly-used functional genomics approaches to identify the underlying molecular perturbations and their phenotypic impact. Grouping patients into 408 non-exclusive patient-phenotype groups, we identified a functional association amongst the genes disrupted in 209 (51%) groups. We find evidence for a significant number of molecular interactions amongst the association-contributing genes, including a single highly-interconnected network disrupted in 20% of patients with intellectual disability, and show using microcephaly how these molecular networks can be used as baits to identify additional members whose genes are variant in other patients with the same phenotype. Exploiting the systematic phenotyping of this cohort, we observe phenotypic concordance amongst patients whose variant genes contribute to the same functional association but note that (i) this relationship shows significant variation across the different approaches used to infer a commonly perturbed molecular pathway, and (ii) that the phenotypic similarities detected amongst patients who share the same inferred pathway perturbation result from these patients sharing many distinct phenotypes, rather than sharing a more specific phenotype, inferring that these pathways are best characterized by their pleiotropic effects.

  1. Gene expression analysis of zebrafish melanocytes, iridophores, and retinal pigmented epithelium reveals indicators of biological function and developmental origin.

    Charles W Higdon

    Full Text Available In order to facilitate understanding of pigment cell biology, we developed a method to concomitantly purify melanocytes, iridophores, and retinal pigmented epithelium from zebrafish, and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co-enrichment in melanocytes and retinal pigmented epithelium, as well as in melanocytes and iridophores. We found 214 genes co-enriched in melanocytes and retinal pigmented epithelium, indicating the shared functions of melanin-producing cells. We found 62 genes significantly co-enriched in melanocytes and iridophores, illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine-based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate-limiting substrate for purine synthesis, phosphoribosyl pyrophosphate, thus constituting a guanine cycle. The purification procedure and expression analysis described here, along with the accompanying transcriptome-wide expression data, provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types, and will be a useful resource for further studies of pigment cell biology.

  2. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong


    2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Effect of ovary induction on bread wheat anther culture: ovary genotype and developmental stage, and candidate gene association.

    Ana María Castillo


    Full Text Available Ovary pre-conditioned medium and ovary co-culture increased the efficiency of green doubled haploid plant production in bread wheat anther culture. The positive effect of this medium led to a 6- and 11-fold increase in the numbers of embryos and green plants, respectively, having a greater effect on a medium-low responding cultivar. Ovary genotype and developmental stage significantly affected microspore embryogenesis. By he use of Caramba ovaries it was possible to reach a 2-fold increase in the number of embryos and green plants, and to decrease the rate of albinism. Mature ovaries from flowers containing microspores at a late binucleate stage raised the number of embryos and green plants by 25% and 46% as compared to immature ovaries (excised from flowers with microspores at a mid-late uninucleate stage. The highest numbers of embryos and green plants were produced when using mature Caramba ovaries. Ovaries from Galeón, Tigre and Kilopondio cultivars successfully induced microspore embryogenesis at the same rate as Caramba ovaries. Moreover, Tigre ovaries raised the percentage of spontaneous chromosome doubling up to 71%. Attempts were made to identify molecular mechanisms associated to the inductive effect of the ovaries on microspore embryogenesis. The genes TAA1b, FLA26 and WALI6 associated to wheat microspore embryogenesis, the CGL1 gene involved in glycan biosynthesis or degradation, and the FER gene involved in the ovary signalling process were expressed and/or induced at different rates during ovary culture. The expression pattern of FLA26 and FER could be related to the differences between genotypes and developmental stages in the inductive effect of the ovary. Our results open opportunities for new approaches to increase bread wheat doubled haploid production by anther culture, and to identify the functional components of the ovary inductive effect on microspore embryogenesis.

  4. A study of the role of the FOXP2 and CNTNAP2 genes in persistent developmental stuttering.

    Han, Tae-Un; Park, John; Domingues, Carlos F; Moretti-Ferreira, Danilo; Paris, Emily; Sainz, Eduardo; Gutierrez, Joanne; Drayna, Dennis


    A number of speech disorders including stuttering have been shown to have important genetic contributions, as indicated by high heritability estimates from twin and other studies. We studied the potential contribution to stuttering from variants in the FOXP2 gene, which have previously been associated with developmental verbal dyspraxia, and from variants in the CNTNAP2 gene, which have been associated with specific language impairment (SLI). DNA sequence analysis of these two genes in a group of 602 unrelated cases, all with familial persistent developmental stuttering, revealed no excess of potentially deleterious coding sequence variants in the cases compared to a matched group of 487 well characterized neurologically normal controls. This was compared to the distribution of variants in the GNPTAB, GNPTG, and NAGPA genes which have previously been associated with persistent stuttering. Using an expanded subject data set, we again found that NAGPA showed significantly different mutation frequencies in North Americans of European descent (p=0.0091) and a significant difference existed in the mutation frequency of GNPTAB in Brazilians (p=0.00050). No significant differences in mutation frequency in the FOXP2 and CNTNAP2 genes were observed between cases and controls. To examine the pattern of expression of these five genes in the human brain, real time quantitative reverse transcription PCR was performed on RNA purified from 27 different human brain regions. The expression patterns of FOXP2 and CNTNAP2 were generally different from those of GNPTAB, GNPTG and NAPGA in terms of relatively lower expression in the cerebellum. This study provides an improved estimate of the contribution of mutations in GNPTAB, GNPTG and NAGPA to persistent stuttering, and suggests that variants in FOXP2 and CNTNAP2 are not involved in the genesis of familial persistent stuttering. This, together with the different brain expression patterns of GNPTAB, GNPTG, and NAGPA compared to that of

  5. In-Silico Integration Approach to Identify a Key miRNA Regulating a Gene Network in Aggressive Prostate Cancer

    Colaprico, Antonio; Bontempi, Gianluca; Castiglioni, Isabella


    Like other cancer diseases, prostate cancer (PC) is caused by the accumulation of genetic alterations in the cells that drives malignant growth. These alterations are revealed by gene profiling and copy number alteration (CNA) analysis. Moreover, recent evidence suggests that also microRNAs have an important role in PC development. Despite efforts to profile PC, the alterations (gene, CNA, and miRNA) and biological processes that correlate with disease development and progression remain partially elusive. Many gene signatures proposed as diagnostic or prognostic tools in cancer poorly overlap. The identification of co-expressed genes, that are functionally related, can identify a core network of genes associated with PC with a better reproducibility. By combining different approaches, including the integration of mRNA expression profiles, CNAs, and miRNA expression levels, we identified a gene signature of four genes overlapping with other published gene signatures and able to distinguish, in silico, high Gleason-scored PC from normal human tissue, which was further enriched to 19 genes by gene co-expression analysis. From the analysis of miRNAs possibly regulating this network, we found that hsa-miR-153 was highly connected to the genes in the network. Our results identify a four-gene signature with diagnostic and prognostic value in PC and suggest an interesting gene network that could play a key regulatory role in PC development and progression. Furthermore, hsa-miR-153, controlling this network, could be a potential biomarker for theranostics in high Gleason-scored PC. PMID:29562723

  6. Developmental and feedforward control of the expression of folate biosynthesis genes in tomato fruit

    Little is known about how plants regulate their folate content, including whether the expression of folate biosynthesis genes is orchestrated during development or modulated by folate levels. Nor is much known about how folate levels impact the expression of other genes. These points were addressed ...

  7. Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

    Conforto Tara L


    Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.

  8. Key tumor suppressor genes inactivated by "greater promoter" methylation and somatic mutations in head and neck cancer

    Guerrero-Preston, Rafael; Michailidi, Christina; Marchionni, Luigi; Pickering, Curtis R.; Frederick, Mitchell J.; Myers, Jeffrey N.; Yegnasubramanian, Srinivasan; Hadar, Tal; Noordhuis, Maartje G.; Zizkova, Veronika; Fertig, Elana; Agrawal, Nishant; Westra, William; Koch, Wayne; Califano, Joseph; Velculescu, Victor E.; Sidransky, David

    Tumor suppressor genes (TSGs) are commonly inactivated by somatic mutation and/or promoter methylation; yet, recent high-throughput genomic studies have not identified key TSGs inactivated by both mechanisms. We pursued an integrated molecular analysis based on methylation binding domain sequencing

  9. The Key Genes of Chronic Pancreatitis which Bridge Chronic Pancreatitis and Pancreatic Cancer Can be Therapeutic Targets.

    Li, Shuang; Li, Rui; Wang, Heping; Li, Lisha; Li, Huiyu; Li, Yulin


    An important question in systems biology is what role the underlying molecular mechanisms play in disease progression. The relationship between chronic pancreatitis and pancreatic cancer needs further exploration in a system view. We constructed the disease network based on gene expression data and protein-protein interaction. We proposed an approach to discover the underlying core network and molecular factors in the progression of pancreatic diseases, which contain stages of chronic pancreatitis and pancreatic cancer. The chronic pancreatitis and pancreatic cancer core network and key factors were revealed and then verified by gene set enrichment analysis of pathways and diseases. The key factors provide the microenvironment for tumor initiation and the change of gene expression level of key factors bridge chronic pancreatitis and pancreatic cancer. Some new candidate genes need further verification by experiments. Transcriptome profiling-based network analysis reveals the importance of chronic pancreatitis genes and pathways in pancreatic cancer development on a system level by computational method and they can be therapeutic targets.

  10. Gene expression profiles reveal key pathways and genes associated with neuropathic pain in patients with spinal cord injury.

    He, Xijing; Fan, Liying; Wu, Zhongheng; He, Jiaxuan; Cheng, Bin


    Previous gene expression profiling studies of neuropathic pain (NP) following spinal cord injury (SCI) have predominantly been performed in animal models. The present study aimed to investigate gene alterations in patients with spinal cord injury and to further examine the mechanisms underlying NP following SCI. The GSE69901 gene expression profile was downloaded from the public Gene Expression Omnibus database. Samples of peripheral blood mononuclear cells (PBMCs) derived from 12 patients with intractable NP and 13 control patients without pain were analyzed to identify the differentially expressed genes (DEGs), followed by functional enrichment analysis and protein‑protein interaction (PPI) network construction. In addition, a transcriptional regulation network was constructed and functional gene clustering was performed. A total of 70 upregulated and 61 downregulated DEGs were identified in the PBMC samples from patients with NP. The upregulated and downregulated genes were significantly involved in different Gene Ontology terms and pathways, including focal adhesion, T cell receptor signaling pathway and mitochondrial function. Glycogen synthase kinase 3 β (GSK3B) was identified as a hub protein in the PPI network. In addition, ornithine decarboxylase 1 (ODC1) and ornithine aminotransferase (OAT) were regulated by additional transcription factors in the regulation network. GSK3B, OAT and ODC1 were significantly enriched in two functional gene clusters, the function of mitochondrial membrane and DNA binding. Focal adhesion and the T cell receptor signaling pathway may be significantly linked with NP, and GSK3B, OAT and ODC1 may be potential targets for the treatment of NP.

  11. Identification of transcriptional factors and key genes in primary osteoporosis by DNA microarray.

    Xie, Wengui; Ji, Lixin; Zhao, Teng; Gao, Pengfei


    A number of genes have been identified to be related with primary osteoporosis while less is known about the comprehensive interactions between regulating genes and proteins. We aimed to identify the differentially expressed genes (DEGs) and regulatory effects of transcription factors (TFs) involved in primary osteoporosis. The gene expression profile GSE35958 was obtained from Gene Expression Omnibus database, including 5 primary osteoporosis and 4 normal bone tissues. The differentially expressed genes between primary osteoporosis and normal bone tissues were identified by the same package in R language. The TFs of these DEGs were predicted with the Essaghir A method. DAVID (The Database for Annotation, Visualization and Integrated Discovery) was applied to perform the GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analysis of DEGs. After analyzing regulatory effects, a regulatory network was built between TFs and the related DEGs. A total of 579 DEGs was screened, including 310 up-regulated genes and 269 down-regulated genes in primary osteoporosis samples. In GO terms, more up-regulated genes were enriched in transcription regulator activity, and secondly in transcription factor activity. A total 10 significant pathways were enriched in KEGG analysis, including colorectal cancer, Wnt signaling pathway, Focal adhesion, and MAPK signaling pathway. Moreover, total 7 TFs were enriched, of which CTNNB1, SP1, and TP53 regulated most up-regulated DEGs. The discovery of the enriched TFs might contribute to the understanding of the mechanism of primary osteoporosis. Further research on genes and TFs related to the WNT signaling pathway and MAPK pathway is urgent for clinical diagnosis and directing treatment of primary osteoporosis.

  12. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian


    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Global developmental gene expression and pathway analysis of normal brain development and mouse models of human neuronal migration defects.

    Tiziano Pramparo


    Full Text Available Heterozygous LIS1 mutations are the most common cause of human lissencephaly, a human neuronal migration defect, and DCX mutations are the most common cause of X-linked lissencephaly. LIS1 is part of a protein complex including NDEL1 and 14-3-3ε that regulates dynein motor function and microtubule dynamics, while DCX stabilizes microtubules and cooperates with LIS1 during neuronal migration and neurogenesis. Targeted gene mutations of Lis1, Dcx, Ywhae (coding for 14-3-3ε, and Ndel1 lead to neuronal migration defects in mouse and provide models of human lissencephaly, as well as aid the study of related neuro-developmental diseases. Here we investigated the developing brain of these four mutants and wild-type mice using expression microarrays, bioinformatic analyses, and in vivo/in vitro experiments to address whether mutations in different members of the LIS1 neuronal migration complex lead to similar and/or distinct global gene expression alterations. Consistent with the overall successful development of the mutant brains, unsupervised clustering and co-expression analysis suggested that cell cycle and synaptogenesis genes are similarly expressed and co-regulated in WT and mutant brains in a time-dependent fashion. By contrast, focused co-expression analysis in the Lis1 and Ndel1 mutants uncovered substantial differences in the correlation among pathways. Differential expression analysis revealed that cell cycle, cell adhesion, and cytoskeleton organization pathways are commonly altered in all mutants, while synaptogenesis, cell morphology, and inflammation/immune response are specifically altered in one or more mutants. We found several commonly dysregulated genes located within pathogenic deletion/duplication regions, which represent novel candidates of human mental retardation and neurocognitive disabilities. Our analysis suggests that gene expression and pathway analysis in mouse models of a similar disorder or within a common pathway can

  14. Developmental and Functional Expression of miRNA-Stability Related Genes in the Nervous System

    de Sousa, ?rica; Walter, Lais Takata; Higa, Guilherme Shigueto Vilar; Casado, Ot?vio Augusto Nocera; Kihara, Alexandre Hiroaki


    In the nervous system, control of gene expression by microRNAs (miRNAs) has been investigated in fundamental processes, such as development and adaptation to ambient demands. The action of these short nucleotide sequences on specific genes depends on intracellular concentration, which in turn reflects the balance of biosynthesis and degradation. Whereas mechanisms underlying miRNA biogenesis has been investigated in recent studies, little is known about miRNA-stability related proteins. We fi...

  15. Evolutionary history of the recruitment of conserved developmental genes in association to the formation and diversification of a novel trait

    Shirai Leila T


    Full Text Available Abstract Background The origin and modification of novel traits are important aspects of biological diversification. Studies combining concepts and approaches of developmental genetics and evolutionary biology have uncovered many examples of the recruitment, or co-option, of genes conserved across lineages for the formation of novel, lineage-restricted traits. However, little is known about the evolutionary history of the recruitment of those genes, and of the relationship between them -for example, whether the co-option involves whole or parts of existing networks, or whether it occurs by redeployment of individual genes with de novo rewiring. We use a model novel trait, color pattern elements on butterfly wings called eyespots, to explore these questions. Eyespots have greatly diversified under natural and sexual selection, and their formation involves genetic circuitries shared across insects. Results We investigated the evolutionary history of the recruitment and co-recruitment of four conserved transcription regulators to the larval wing disc region where circular pattern elements develop. The co-localization of Antennapedia, Notch, Distal-less, and Spalt with presumptive (eyespot organizers was examined in 13 butterfly species, providing the largest comparative dataset available for the system. We found variation between families, between subfamilies, and between tribes. Phylogenetic reconstructions by parsimony and maximum likelihood methods revealed an unambiguous evolutionary history only for Antennapedia, with a resolved single origin of eyespot-associated expression, and many homoplastic events for Notch, Distal-less, and Spalt. The flexibility in the (co-recruitment of the targeted genes includes cases where different gene combinations are associated with morphologically similar eyespots, as well as cases where identical protein combinations are associated with very different phenotypes. Conclusions The evolutionary history of gene

  16. Developmental expression of “germline”- and “sex determination”-related genes in the ctenophore Mnemiopsis leidyi

    Adam M. Reitzel


    Full Text Available Abstract Background An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The “germline” genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Results Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of “germline genes,” which are areas of high cell proliferation, suggesting that these genes are involved with “stem cell” specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for

  17. DNA microarray revealed and RNAi plants confirmed key genes conferring low Cd accumulation in barley grains

    Sun, Hongyan; Chen, Zhong-Hua; Chen, Fei


    Background Understanding the mechanism of low Cd accumulation in crops is crucial for sustainable safe food production in Cd-contaminated soils. Results Confocal microscopy, atomic absorption spectrometry, gas exchange and chlorophyll fluorescence analyses revealed a distinct difference in Cd...... with a substantial difference between the two genotypes. Cd stress led to higher expression of genes involved in transport, carbohydrate metabolism and signal transduction in the low-grain-Cd-accumulating genotype. Novel transporter genes such as zinc transporter genes were identified as being associated with low Cd...... accumulation. Quantitative RT-PCR confirmed our microarray data. Furthermore, suppression of the zinc transporter genes HvZIP3 and HvZIP8 by RNAi silencing showed increased Cd accumulation and reduced Zn and Mn concentrations in barley grains. Thus, HvZIP3 and HvZIP8 could be candidate genes related to low...

  18. Association of Forced Vital Capacity with the Developmental Gene NCOR2.

    Cosetta Minelli

    Full Text Available Forced Vital Capacity (FVC is an important predictor of all-cause mortality in the absence of chronic respiratory conditions. Epidemiological evidence highlights the role of early life factors on adult FVC, pointing to environmental exposures and genes affecting lung development as risk factors for low FVC later in life. Although highly heritable, a small number of genes have been found associated with FVC, and we aimed at identifying further genetic variants by focusing on lung development genes.Per-allele effects of 24,728 SNPs in 403 genes involved in lung development were tested in 7,749 adults from three studies (NFBC1966, ECRHS, EGEA. The most significant SNP for the top 25 genes was followed-up in 46,103 adults (CHARGE and SpiroMeta consortia and 5,062 children (ALSPAC. Associations were considered replicated if the replication p-value survived Bonferroni correction (p<0.002; 0.05/25, with a nominal p-value considered as suggestive evidence. For SNPs with evidence of replication, effects on the expression levels of nearby genes in lung tissue were tested in 1,111 lung samples (Lung eQTL consortium, with further functional investigation performed using public epigenomic profiling data (ENCODE.NCOR2-rs12708369 showed strong replication in children (p = 0.0002, with replication unavailable in adults due to low imputation quality. This intronic variant is in a strong transcriptional enhancer element in lung fibroblasts, but its eQTL effects could not be tested due to low imputation quality in the eQTL dataset. SERPINE2-rs6754561 replicated at nominal level in both adults (p = 0.036 and children (p = 0.045, while WNT16-rs2707469 replicated at nominal level only in adults (p = 0.026. The eQTL analyses showed association of WNT16-rs2707469 with expression levels of the nearby gene CPED1. We found no statistically significant eQTL effects for SERPINE2-rs6754561.We have identified a new gene, NCOR2, in the retinoic acid signalling pathway pointing

  19. Diversity of immunoglobulin lambda light chain gene usage over developmental stages in the horse.

    Tallmadge, Rebecca L; Tseng, Chia T; Felippe, M Julia B


    To further studies of neonatal immune responses to pathogens and vaccination, we investigated the dynamics of B lymphocyte development and immunoglobulin (Ig) gene diversity. Previously we demonstrated that equine fetal Ig VDJ sequences exhibit combinatorial and junctional diversity levels comparable to those of adult Ig VDJ sequences. Herein, RACE clones from fetal, neonatal, foal, and adult lymphoid tissue were assessed for Ig lambda light chain combinatorial, junctional, and sequence diversity. Remarkably, more lambda variable genes (IGLV) were used during fetal life than later stages and IGLV gene usage differed significantly with time, in contrast to the Ig heavy chain. Junctional diversity measured by CDR3L length was constant over time. Comparison of Ig lambda transcripts to germline revealed significant increases in nucleotide diversity over time, even during fetal life. These results suggest that the Ig lambda light chain provides an additional dimension of diversity to the equine Ig repertoire. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Developmental and functional expression of miRNA-stability related genes in the nervous system.

    de Sousa, Érica; Walter, Lais Takata; Higa, Guilherme Shigueto Vilar; Casado, Otávio Augusto Nocera; Kihara, Alexandre Hiroaki


    In the nervous system, control of gene expression by microRNAs (miRNAs) has been investigated in fundamental processes, such as development and adaptation to ambient demands. The action of these short nucleotide sequences on specific genes depends on intracellular concentration, which in turn reflects the balance of biosynthesis and degradation. Whereas mechanisms underlying miRNA biogenesis has been investigated in recent studies, little is known about miRNA-stability related proteins. We first detected two genes in the retina that have been associated to miRNA stability, XRN2 and PAPD4. These genes are highly expressed during retinal development, however with distinct subcellular localization. We investigated whether these proteins are regulated during specific phases of the cell cycle. Combined analyses of nuclei position in neuroblastic layer and labeling using anti-cyclin D1 revealed that both proteins do not accumulate in S or M phases of the cell cycle, being poorly expressed in progenitor cells. Indeed, XRN2 and PAPD4 were observed mainly after neuronal differentiation, since low expression was also observed in astrocytes, endothelial and microglial cells. XRN2 and PAPD4 are expressed in a wide variety of neurons, including horizontal, amacrine and ganglion cells. To evaluate the functional role of both genes, we carried out experiments addressed to the retinal adaptation in response to different ambient light conditions. PAPD4 is upregulated after 3 and 24 hours of dark- adaptation, revealing that accumulation of this protein is governed by ambient light levels. Indeed, the fast and functional regulation of PAPD4 was not related to changes in gene expression, disclosing that control of protein levels occurs by post-transcriptional mechanisms. Furthermore, we were able to quantify changes in PAPD4 in specific amacrine cells after dark -adaptation, suggesting for circuitry-related roles in visual perception. In summary, in this study we first described the

  1. Early Developmental and Evolutionary Origins of Gene Body DNA Methylation Patterns in Mammalian Placentas.

    Diane I Schroeder


    Full Text Available Over the last 20-80 million years the mammalian placenta has taken on a variety of morphologies through both divergent and convergent evolution. Recently we have shown that the human placenta genome has a unique epigenetic pattern of large partially methylated domains (PMDs and highly methylated domains (HMDs with gene body DNA methylation positively correlating with level of gene expression. In order to determine the evolutionary conservation of DNA methylation patterns and transcriptional regulatory programs in the placenta, we performed a genome-wide methylome (MethylC-seq analysis of human, rhesus macaque, squirrel monkey, mouse, dog, horse, and cow placentas as well as opossum extraembryonic membrane. We found that, similar to human placenta, mammalian placentas and opossum extraembryonic membrane have globally lower levels of methylation compared to somatic tissues. Higher relative gene body methylation was the conserved feature across all mammalian placentas, despite differences in PMD/HMDs and absolute methylation levels. Specifically, higher methylation over the bodies of genes involved in mitosis, vesicle-mediated transport, protein phosphorylation, and chromatin modification was observed compared with the rest of the genome. As in human placenta, higher methylation is associated with higher gene expression and is predictive of genic location across species. Analysis of DNA methylation in oocytes and preimplantation embryos shows a conserved pattern of gene body methylation similar to the placenta. Intriguingly, mouse and cow oocytes and mouse early embryos have PMD/HMDs but their placentas do not, suggesting that PMD/HMDs are a feature of early preimplantation methylation patterns that become lost during placental development in some species and following implantation of the embryo.

  2. Gene Network Construction from Microarray Data Identifies a Key Network Module and Several Candidate Hub Genes in Age-Associated Spatial Learning Impairment.

    Uddin, Raihan; Singh, Shiva M


    As humans age many suffer from a decrease in normal brain functions including spatial learning impairments. This study aimed to better understand the molecular mechanisms in age-associated spatial learning impairment (ASLI). We used a mathematical modeling approach implemented in Weighted Gene Co-expression Network Analysis (WGCNA) to create and compare gene network models of young (learning unimpaired) and aged (predominantly learning impaired) brains from a set of exploratory datasets in rats in the context of ASLI. The major goal was to overcome some of the limitations previously observed in the traditional meta- and pathway analysis using these data, and identify novel ASLI related genes and their networks based on co-expression relationship of genes. This analysis identified a set of network modules in the young, each of which is highly enriched with genes functioning in broad but distinct GO functional categories or biological pathways. Interestingly, the analysis pointed to a single module that was highly enriched with genes functioning in "learning and memory" related functions and pathways. Subsequent differential network analysis of this "learning and memory" module in the aged (predominantly learning impaired) rats compared to the young learning unimpaired rats allowed us to identify a set of novel ASLI candidate hub genes. Some of these genes show significant repeatability in networks generated from independent young and aged validation datasets. These hub genes are highly co-expressed with other genes in the network, which not only show differential expression but also differential co-expression and differential connectivity across age and learning impairment. The known function of these hub genes indicate that they play key roles in critical pathways, including kinase and phosphatase signaling, in functions related to various ion channels, and in maintaining neuronal integrity relating to synaptic plasticity and memory formation. Taken together, they

  3. MeSH key terms for validation and annotation of gene expression clusters

    Rechtsteiner, A. (Andreas); Rocha, L. M. (Luis Mateus)


    Integration of different sources of information is a great challenge for the analysis of gene expression data, and for the field of Functional Genomics in general. As the availability of numerical data from high-throughput methods increases, so does the need for technologies that assist in the validation and evaluation of the biological significance of results extracted from these data. In mRNA assaying with microarrays, for example, numerical analysis often attempts to identify clusters of co-expressed genes. The important task to find the biological significance of the results and validate them has so far mostly fallen to the biological expert who had to perform this task manually. One of the most promising avenues to develop automated and integrative technology for such tasks lies in the application of modern Information Retrieval (IR) and Knowledge Management (KM) algorithms to databases with biomedical publications and data. Examples of databases available for the field are bibliographic databases c ntaining scientific publications (e.g. MEDLINE/PUBMED), databases containing sequence data (e.g. GenBank) and databases of semantic annotations (e.g. the Gene Ontology Consortium and Medical Subject Headings (MeSH)). We present here an approach that uses the MeSH terms and their concept hierarchies to validate and obtain functional information for gene expression clusters. The controlled and hierarchical MeSH vocabulary is used by the National Library of Medicine (NLM) to index all the articles cited in MEDLINE. Such indexing with a controlled vocabulary eliminates some of the ambiguity due to polysemy (terms that have multiple meanings) and synonymy (multiple terms have similar meaning) that would be encountered if terms would be extracted directly from the articles due to differing article contexts or author preferences and background. Further, the hierarchical organization of the MeSH terms can illustrate the conceptuallfunctional relationships of genes

  4. Histone deacetylase inhibition decreases cholesterol levels in neuronal cells by modulating key genes in cholesterol synthesis, uptake and efflux.

    Maria João Nunes

    Full Text Available Cholesterol is an essential component of the central nervous system and increasing evidence suggests an association between brain cholesterol metabolism dysfunction and the onset of neurodegenerative disorders. Interestingly, histone deacetylase inhibitors (HDACi such as trichostatin A (TSA are emerging as promising therapeutic approaches in neurodegenerative diseases, but their effect on brain cholesterol metabolism is poorly understood. We have previously demonstrated that HDACi up-regulate CYP46A1 gene transcription, a key enzyme in neuronal cholesterol homeostasis. In this study, TSA was shown to modulate the transcription of other genes involved in cholesterol metabolism in human neuroblastoma cells, namely by up-regulating genes that control cholesterol efflux and down-regulating genes involved in cholesterol synthesis and uptake, thus leading to an overall decrease in total cholesterol content. Furthermore, co-treatment with the amphipathic drug U18666A that can mimic the intracellular cholesterol accumulation observed in cells of Niemman-Pick type C patients, revealed that TSA can ameliorate the phenotype induced by pathological cholesterol accumulation, by restoring the expression of key genes involved in cholesterol synthesis, uptake and efflux and promoting lysosomal cholesterol redistribution. These results clarify the role of TSA in the modulation of neuronal cholesterol metabolism at the transcriptional level, and emphasize the idea of HDAC inhibition as a promising therapeutic tool in neurodegenerative disorders with impaired cholesterol metabolism.

  5. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica


    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  6. Gene networks underlying convergent and pleiotropic phenotypes in a large and systematically-phenotyped cohort with heterogeneous developmental disorders.

    Tallulah Andrews


    Full Text Available Readily-accessible and standardised capture of genotypic variation has revolutionised our understanding of the genetic contribution to disease. Unfortunately, the corresponding systematic capture of patient phenotypic variation needed to fully interpret the impact of genetic variation has lagged far behind. Exploiting deep and systematic phenotyping of a cohort of 197 patients presenting with heterogeneous developmental disorders and whose genomes harbour de novo CNVs, we systematically applied a range of commonly-used functional genomics approaches to identify the underlying molecular perturbations and their phenotypic impact. Grouping patients into 408 non-exclusive patient-phenotype groups, we identified a functional association amongst the genes disrupted in 209 (51% groups. We find evidence for a significant number of molecular interactions amongst the association-contributing genes, including a single highly-interconnected network disrupted in 20% of patients with intellectual disability, and show using microcephaly how these molecular networks can be used as baits to identify additional members whose genes are variant in other patients with the same phenotype. Exploiting the systematic phenotyping of this cohort, we observe phenotypic concordance amongst patients whose variant genes contribute to the same functional association but note that (i this relationship shows significant variation across the different approaches used to infer a commonly perturbed molecular pathway, and (ii that the phenotypic similarities detected amongst patients who share the same inferred pathway perturbation result from these patients sharing many distinct phenotypes, rather than sharing a more specific phenotype, inferring that these pathways are best characterized by their pleiotropic effects.

  7. Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis

    Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Flaws, Jodi A. [Department of Comparative Biosciences, University of Illinois Urbana-Champaign (United States); Helferich, William G. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Pan, Yuan-Xiang, E-mail: [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Lezmi, Stéphane, E-mail: [Department of Pathobiology, University of Illinois Urbana-Champaign (United States)


    Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a

  8. Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis

    Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J.; Flaws, Jodi A.; Helferich, William G.; Pan, Yuan-Xiang; Lezmi, Stéphane


    Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a

  9. Identification of 2 novel genes developmentally regulated in the mouse aorta-gonad-mesonephros region

    C. Orelio; E.A. Dzierzak (Elaine)


    textabstractThe first adult-repopulating hematopoietic stem cells (HSCs) emerge in the mouse aorta-gonad-mesonephros (AGM) region at embryonic day 10.5 prior to their appearance in the yolk sac and fetal liver. Although several genes are implicated in the regulation of HSCs, there

  10. Developmental Toxicity of Diclofenac and Elucidation of Gene Regulation in zebrafish (Danio rerio)

    Chen, Jia-Bin; Gao, Hong-Wen; Zhang, Ya-Lei; Zhang, Yong; Zhou, Xue-Fei; Li, Chun-Qi; Gao, Hai-Ping


    Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of zebrafish embryos. The association of diclofenac with the embryos conformed to the general partition model at low concentration, the partition coefficient being 0.0033 ml per embryo. At high concentration, the interaction fitted the Freundlich model. Most of the diclofenac remained in the extracellular aqueous solution with less than 5% interacting with the embryo, about half of which was adsorbed on the membranes while the rest entered the cytoplasm. Concentrations of diclofenac over 10.13 μM were lethal to all the embryos, while 3.78 μM diclofenac was teratogenic. The development abnormalities at 4 day post treatment (dpt) include shorter body length, smaller eye, pericardial and body edema, lack of liver, intestine and circulation, muscle degeneration, and abnormal pigmentation. The portion of the diclofenac transferred into the embryo altered the expression of certain genes, e.g. down-regulation of Wnt3a and Gata4 and up-regulation of Wnt8a. The alteration of expression of such genes or the regulation of downstream genes could cause defects in the cardiovascular and nervous systems.

  11. Expression analysis of genes implicated in meiotic resumption in vivo and developmental competence

    Algriany, O.A.


    This thesis investigated the gene expression in bovine oocytes during meiotic resumption, at 6 h post LH surge, coinciding with germinal vesicle breakdown, which was supposed to give a picture of the major cell cycle regulation changes, cytoskeleton rearrangement and chromosome alignment.

  12. Asymmetric division and differential gene expression during a bacterial developmental program requires DivIVA.

    Prahathees Eswaramoorthy


    Full Text Available Sporulation in the bacterium Bacillus subtilis is a developmental program in which a progenitor cell differentiates into two different cell types, the smaller of which eventually becomes a dormant cell called a spore. The process begins with an asymmetric cell division event, followed by the activation of a transcription factor, σF, specifically in the smaller cell. Here, we show that the structural protein DivIVA localizes to the polar septum during sporulation and is required for asymmetric division and the compartment-specific activation of σF. Both events are known to require a protein called SpoIIE, which also localizes to the polar septum. We show that DivIVA copurifies with SpoIIE and that DivIVA may anchor SpoIIE briefly to the assembling polar septum before SpoIIE is subsequently released into the forespore membrane and recaptured at the polar septum. Finally, using super-resolution microscopy, we demonstrate that DivIVA and SpoIIE ultimately display a biased localization on the side of the polar septum that faces the smaller compartment in which σF is activated.

  13. Identification of key genes and molecular mechanisms associated with dedifferentiated liposarcoma based on bioinformatic methods

    Yu H


    Full Text Available Hongliang Yu,1 Dong Pei,2 Longyun Chen,2 Xiaoxiang Zhou,2 Haiwen Zhu2 1Department of Radiation Oncology, Jiangsu Cancer Hospital and Jiangsu Institute of Cancer Research, The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, 2Department of Radiation Oncology, Yancheng Third People’s Hospital, Yancheng, Jiangsu, People’s Republic of China Background: Dedifferentiated liposarcoma (DDLPS is one of the most deadly types of soft tissue sarcoma. To date, there have been few studies dedicated to elucidating the molecular mechanisms behind the disease; therefore, the molecular mechanisms behind this malignancy remain largely unknown.Materials and methods: Microarray profiles of 46 DDLPS samples and nine normal fat controls were extracted from Gene Expression Omnibus (GEO. Quality control for these microarray profiles was performed before analysis. Hierarchical clustering and principal component analysis were used to distinguish the general differences in gene expression between DDLPS samples and the normal fat controls. Differentially expressed genes (DEGs were identified using the Limma package in R. Next, the enriched Gene Ontology (GO terms and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways were obtained using the online tool DAVID ( A protein–protein interaction (PPI network was constructed using the STRING database and Cytoscape software. Furthermore, the hub genes within the PPI network were identified.Results: All 55 microarray profiles were confirmed to be of high quality. The gene expression pattern of DDLPS samples was significantly different from that of normal fat controls. In total, 700 DEGs were identified, and 83 enriched GO terms and three KEGG pathways were obtained. Specifically, within the DEGs of DDLPS samples, several pathways were identified as being significantly enriched, including the PPAR signaling pathway, cell cycle pathway, and pyruvate metabolism pathway

  14. Developmental and functional expression of miRNA-stability related genes in the nervous system.

    Érica de Sousa

    Full Text Available In the nervous system, control of gene expression by microRNAs (miRNAs has been investigated in fundamental processes, such as development and adaptation to ambient demands. The action of these short nucleotide sequences on specific genes depends on intracellular concentration, which in turn reflects the balance of biosynthesis and degradation. Whereas mechanisms underlying miRNA biogenesis has been investigated in recent studies, little is known about miRNA-stability related proteins. We first detected two genes in the retina that have been associated to miRNA stability, XRN2 and PAPD4. These genes are highly expressed during retinal development, however with distinct subcellular localization. We investigated whether these proteins are regulated during specific phases of the cell cycle. Combined analyses of nuclei position in neuroblastic layer and labeling using anti-cyclin D1 revealed that both proteins do not accumulate in S or M phases of the cell cycle, being poorly expressed in progenitor cells. Indeed, XRN2 and PAPD4 were observed mainly after neuronal differentiation, since low expression was also observed in astrocytes, endothelial and microglial cells. XRN2 and PAPD4 are expressed in a wide variety of neurons, including horizontal, amacrine and ganglion cells. To evaluate the functional role of both genes, we carried out experiments addressed to the retinal adaptation in response to different ambient light conditions. PAPD4 is upregulated after 3 and 24 hours of dark- adaptation, revealing that accumulation of this protein is governed by ambient light levels. Indeed, the fast and functional regulation of PAPD4 was not related to changes in gene expression, disclosing that control of protein levels occurs by post-transcriptional mechanisms. Furthermore, we were able to quantify changes in PAPD4 in specific amacrine cells after dark -adaptation, suggesting for circuitry-related roles in visual perception. In summary, in this study we

  15. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    Gazestani, Vahid H; Salavati, Reza


    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  16. Expression of cartilage developmental genes in Hoxc8- and Hoxd4-transgenic mice.

    Claudia Kruger


    Full Text Available Hox genes encode transcription factors, which regulate skeletal patterning and chondrocyte differentiation during the development of cartilage, the precursor to mature bone. Overexpression of the homeobox transcription factors Hoxc8 and Hoxd4 causes severe cartilage defects due to delay in cartilage maturation. Matrix metalloproteinases (MMPs, bone morphogenetic proteins (BMPs and fibroblastic growth factors (FGFs are known to play important roles in skeletal development and endochondral bone formation and remodeling. In order to investigate whether these molecules are aberrantly expressed in Hoxc8- and/or Hoxd4-transgenic cartilage, we performed quantitative RT-PCR on chondrocytes from Hox-transgenic mice. Gene expression levels of Bmp4, Fgf8, Fgf10, Mmp9, Mmp13, Nos3, Timp3, Wnt3a and Wnt5a were altered in Hoxc8-transgenic chondrocytes, and Fgfr3, Ihh, Mmp8, and Wnt3a expression levels were altered in Hoxd4-transgenic chondrocytes, respectively. Notably, Wnt3a expression was elevated in Hoxc8- and reduced in Hoxd4-transgenic cartilage. These results suggest that both transcription factors affect cartilage maturation through different molecular mechanisms, and provide the basis for future studies into the role of these genes and possible interactions in pathogenesis of cartilage defects in Hoxc8- and Hoxd4-transgenic mice.

  17. Gene-environment interaction and behavioral disorders: a developmental perspective based on endophenotypes.

    Battaglia, Marco; Marino, Cecilia; Maziade, Michel; Molteni, Massimo; D'Amato, Francesca


    It has been observed that 'No aspect of human behavioral genetics has caused more confusion and generated more obscurantism than the analysis and interpretation of various types of non-additivity and non-independence of gene and environmental action and interaction' (Eaves LJ et al 1977 Br J Math Stat Psychol 30:1-42). On the other hand, a bulk of newly published studies appear to speak in favour of common and frequent interplay--and possibly interaction--between identified genetic polymorphisms and specified environmental variables in shaping behavior and behavioral disorders. Considerable interest has arisen from the introduction of putative functional 'endophenotypes' which would represent a more proximate biological link to genes, as well as an obligatory intermediate of behavior. While explicit criteria to identify valid endophenotypes have been offered, a number of new 'alternative phenotypes' are now being proposed as possible 'endophenotypes' for behavioral and psychiatric genetics research, sometimes with less than optimal stringency. Nonetheless, we suggest that some endophenotypes can be helpful in investigating several instances of gene-environment interactions and be employed as additional tools to reduce the risk for spurious results in this controversial area.

  18. Overexpressing key component genes of the secretion pathway for enhanced secretion of an Aspergillus niger glucose oxidase in Trichoderma reesei.

    Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun


    Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Thermotolerance and Heat-Shock Protein Gene Expression Patterns in Bemisia tabaci (Hemiptera: Aleyrodidae) Mediterranean in Relation to Developmental Stage.

    Jiang, Rui; Qi, Lan-Da; Du, Yu-Zhou; Li, Yuan-Xi


    Temperature plays an important role in the growth, development, and geographic distribution of insects. There is convincing evidence that heat-shock proteins (HSPs) play important roles in helping organisms adapt to thermal stress. To better understand the physiological and ecological influence of thermal stress on the different development stages of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Mediterranean species (MED), nymphs and adults were shocked with temperatures of 35, 38, and 41℃ for 1 and 2 h, respectively, and the survival rate, fecundity, and developmental duration were investigated in the laboratory. The expression levels of the hsp40, hsp70, and hsp90 genes were assessed using real-time PCR. The results indicate that the survival rates of the nymphs and adults decreased with increased temperature. A 2-h heat shock at 41℃ induced a significant reduction in fecundity in adults and an increase in developmental duration in young nymphs. Hsp90 showed higher temperature responses to thermal stress than hsp40 or hsp70. The expression levels of the hsps in the adults were significantly down-regulated by a 2-h heat shock at 41℃ compared with that by a 1-h treatment. A significant decrease in the expression levels of the hsps also occurred in the adults when the temperature increased from 38 to 41℃ for the 2-h treatment, whereas no significant decrease occurred in the nymphs. Compared with previous studies, we provide some evidence indicating that MED has the potential to adapt to a wider temperature range than the Middle East-Asia Minor 1 species. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  20. Identification, characterization and developmental expression of Halloween genes encoding P450 enzymes mediating ecdysone biosynthesis in the tobacco hornworm, Manduca sexta

    Rewitz, Kim; Rybczynski, Robert; Warren, James T.


    this work to the tobacco hornworm Manduca sexta, an established model for endocrinological and developmental studies. cDNA clones were obtained for three Manduca orthologs of CYP306A1 (phantom; phm, the 25-hydroxylase), CYP302A1 (disembodied; dib, the 22-hydroxylase) and CYP315A1 (shadow; sad, the 2...... in the developmentally varying steroidogenic capacities of the prothoracic glands during the fifth instar. The consistent expression of the Halloween genes confirms the importance of the prothoracic glands in pupal-adult development. These studies establish Manduca as an excellent model for examining the regulation...

  1. Integration of transcriptome and whole genomic resequencing data to identify key genes affecting swine fat deposition.

    Kai Xing

    Full Text Available Fat deposition is highly correlated with the growth, meat quality, reproductive performance and immunity of pigs. Fatty acid synthesis takes place mainly in the adipose tissue of pigs; therefore, in this study, a high-throughput massively parallel sequencing approach was used to generate adipose tissue transcriptomes from two groups of Songliao black pigs that had opposite backfat thickness phenotypes. The total number of paired-end reads produced for each sample was in the range of 39.29-49.36 millions. Approximately 188 genes were differentially expressed in adipose tissue and were enriched for metabolic processes, such as fatty acid biosynthesis, lipid synthesis, metabolism of fatty acids, etinol, caffeine and arachidonic acid and immunity. Additionally, many genetic variations were detected between the two groups through pooled whole-genome resequencing. Integration of transcriptome and whole-genome resequencing data revealed important genomic variations among the differentially expressed genes for fat deposition, for example, the lipogenic genes. Further studies are required to investigate the roles of candidate genes in fat deposition to improve pig breeding programs.

  2. Hybrid Deterministic Views about Genes in Biology Textbooks: A Key Problem in Genetics Teaching

    dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel Nino


    A major source of difficulties in promoting students' understanding of genetics lies in the presentation of gene concepts and models in an inconsistent and largely ahistorical manner, merely amalgamated in hybrid views, as if they constituted linear developments, instead of being built for different purposes and employed in specific contexts. In…

  3. The Gene: Time, Space and Spirit--Keys to Scientific Literacy Series.

    Stonebarger, Bill

    It has only been since the late nineteenth century that people have understood the mechanics of heredity and the discoveries of genes and DNA are even more recent. This booklet considers three aspects of genetics; time, space, and spirit. Time refers to a sense of history; space refers to geography; and spirit refers to life and thought. Several…

  4. Screening Key Genes Associated with the Development and Progression of Non-small Cell Lung Cancer Based on Gene-enrichment Analysis and Meta-analysis

    Wenwu HE


    Full Text Available Background and objective Non-small cell lung cancer (NSCLC is one of the most common malignant tumors; however, its causes are still not completely understood. This study was designed to screen the key genes and pathways related to NSCLC occurrence and development and to establish the scientific foundation for the genetic mechanisms and targeted therapy of NSCLC. Methods Both gene set-enrichment analysis (GSEA and meta-analysis (meta were used to screen the critical pathways and genes that might be corretacted with the development and progression of lung cancer at the transcription level. Results Using the GSEA and meta methods, focal adhesion and regulation of actin cytoskeleton were determined to be the more prominent overlapping significant pathways. In the focal adhesion pathway, 31 genes were statistically significant (P<0.05, whereas in the regulation of actin cytoskeleton pathway, 32 genes were statistically significant (P<0.05. Conclusion The focal adhesion and the regulation of actin cytoskeleton pathways might play important roles in the occurrence and development of NSCLC. Further studies are needed to determine the biological function for the positiue genes.

  5. Genome sequencing of herb Tulsi (Ocimum tenuiflorum) unravels key genes behind its strong medicinal properties.

    Upadhyay, Atul K; Chacko, Anita R; Gandhimathi, A; Ghosh, Pritha; Harini, K; Joseph, Agnel P; Joshi, Adwait G; Karpe, Snehal D; Kaushik, Swati; Kuravadi, Nagesh; Lingu, Chandana S; Mahita, J; Malarini, Ramya; Malhotra, Sony; Malini, Manoharan; Mathew, Oommen K; Mutt, Eshita; Naika, Mahantesha; Nitish, Sathyanarayanan; Pasha, Shaik Naseer; Raghavender, Upadhyayula S; Rajamani, Anantharamanan; Shilpa, S; Shingate, Prashant N; Singh, Heikham Russiachand; Sukhwal, Anshul; Sunitha, Margaret S; Sumathi, Manojkumar; Ramaswamy, S; Gowda, Malali; Sowdhamini, Ramanathan


    Krishna Tulsi, a member of Lamiaceae family, is a herb well known for its spiritual, religious and medicinal importance in India. The common name of this plant is 'Tulsi' (or 'Tulasi' or 'Thulasi') and is considered sacred by Hindus. We present the draft genome of Ocimum tenuiflurum L (subtype Krishna Tulsi) in this report. The paired-end and mate-pair sequence libraries were generated for the whole genome sequenced with the Illumina Hiseq 1000, resulting in an assembled genome of 374 Mb, with a genome coverage of 61 % (612 Mb estimated genome size). We have also studied transcriptomes (RNA-Seq) of two subtypes of O. tenuiflorum, Krishna and Rama Tulsi and report the relative expression of genes in both the varieties. The pathways leading to the production of medicinally-important specialized metabolites have been studied in detail, in relation to similar pathways in Arabidopsis thaliana and other plants. Expression levels of anthocyanin biosynthesis-related genes in leaf samples of Krishna Tulsi were observed to be relatively high, explaining the purple colouration of Krishna Tulsi leaves. The expression of six important genes identified from genome data were validated by performing q-RT-PCR in different tissues of five different species, which shows the high extent of urosolic acid-producing genes in young leaves of the Rama subtype. In addition, the presence of eugenol and ursolic acid, implied as potential drugs in the cure of many diseases including cancer was confirmed using mass spectrometry. The availability of the whole genome of O.tenuiflorum and our sequence analysis suggests that small amino acid changes at the functional sites of genes involved in metabolite synthesis pathways confer special medicinal properties to this herb.

  6. Network analysis of ChIP-Seq data reveals key genes in prostate cancer.

    Zhang, Yu; Huang, Zhen; Zhu, Zhiqiang; Liu, Jianwei; Zheng, Xin; Zhang, Yuhai


    Prostate cancer (PC) is the second most common cancer among men in the United States, and it imposes a considerable threat to human health. A deep understanding of its underlying molecular mechanisms is the premise for developing effective targeted therapies. Recently, deep transcriptional sequencing has been used as an effective genomic assay to obtain insights into diseases and may be helpful in the study of PC. In present study, ChIP-Seq data for PC and normal samples were compared, and differential peaks identified, based upon fold changes (with P-values calculated with t-tests). Annotations of these peaks were performed. Protein-protein interaction (PPI) network analysis was performed with BioGRID and constructed with Cytoscape, following which the highly connected genes were screened. We obtained a total of 5,570 differential peaks, including 3,726 differentially enriched peaks in tumor samples and 1,844 differentially enriched peaks in normal samples. There were eight significant regions of the peaks. The intergenic region possessed the highest score (51%), followed by intronic (31%) and exonic (11%) regions. The analysis revealed the top 35 highly connected genes, which comprised 33 differential genes (such as YWHAQ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein and θ polypeptide) from ChIP-Seq data and 2 differential genes retrieved from the PPI network: UBA52 (ubiquitin A-52 residue ribosomal protein fusion product (1) and SUMO2 (SMT3 suppressor of mif two 3 homolog (2) . Our findings regarding potential PC-related genes increase the understanding of PC and provides direction for future research.

  7. A novel CpG island set identifies tissue-specific methylation at developmental gene loci.

    Robert Illingworth


    Full Text Available CpG islands (CGIs are dense clusters of CpG sequences that punctuate the CpG-deficient human genome and associate with many gene promoters. As CGIs also differ from bulk chromosomal DNA by their frequent lack of cytosine methylation, we devised a CGI enrichment method based on nonmethylated CpG affinity chromatography. The resulting library was sequenced to define a novel human blood CGI set that includes many that are not detected by current algorithms. Approximately half of CGIs were associated with annotated gene transcription start sites, the remainder being intra- or intergenic. Using an array representing over 17,000 CGIs, we established that 6%-8% of CGIs are methylated in genomic DNA of human blood, brain, muscle, and spleen. Inter- and intragenic CGIs are preferentially susceptible to methylation. CGIs showing tissue-specific methylation were overrepresented at numerous genetic loci that are essential for development, including HOX and PAX family members. The findings enable a comprehensive analysis of the roles played by CGI methylation in normal and diseased human tissues.

  8. Key genes involved in desiccation tolerance and dormancy across life forms

    Costa, M.C.D.; Farrant, Jill M.; Oliver, Melvin J.; Ligterink, Wilco; Buitink, Julia; Hilhorst, H.M.W.


    Desiccation tolerance (DT, the ability of certain organisms to survive severe dehydration) was a key trait in the evolution of life in terrestrial environments. Likely, the development of desiccation-tolerant life forms was accompanied by the acquisition of dormancy or a dormancy-like stage as a

  9. Developmental status of bioassays in genetic toxicology: a report of Phase II of the US Environmental Protection Agency Gene-Tox program

    Brusick, D; Auletta, A


    The Gene-Tox Program was structured around two phases of genetic test data evaluation. The first phase consisted of 36 Work Group reports, each evaluating the results and performance of a specific bioassay. The second phase consisted of a plan to summarize the information provided by the Work Groups. The Gene-Tox Coordinating Committee was to be responsible for Phase II, and several subgroups were assigned specific goals in implementing this analysis. This report deals with Goal I which is to identify the developmental status of the individual bioassays reviewed by the Gene-Tox Work Groups in the first phase of the Program. 5 references, 6 tables.

  10. Pollination: a key event controlling the expression of genes related to phytohormone biosynthesis during grapevine berry formation.

    Kühn, Nathalie; Arce-Johnson, Patricio


    Berry formation is the process of ovary conversion into a functional fruit, and is characterized by abrupt changes in the content of several phytohormones, associated with pollination and fertilization. Much effort has been made in order to improve our understanding of berry development, particularly from veraison to post-harvest time. However, the period of berry formation has been poorly investigated, despite its importance. Phytohormones are involved in the control of fruit formation; hence it is important to understand the regulation of their content at this stage. Grapevine is an excellent fleshy-fruit plant model since its fruits have particularities that differentiate them from those of commonly studied organisms. For instance, berries are prepared to cope with stress by producing several antioxidants and they are non-climacteric fruits. Also its genome is fully sequenced, which allows to identify genes involved in developmental processes. In grapevine, no link has been established between pollination and phytohormone biosynthesis, until recently. Here we highlight relevant findings regarding pollination effect on gene expression related to phytohormone biosynthesis, and present unpublished results showing how quickly this effect is achieved.

  11. Developmental Changes In Pain And Spinal Immune Gene Expression After Radicular Trauma In The Rat

    Gordon Alfred Barr


    Full Text Available Neuropathic pain is an example of chronic pain that develops after nerve injury and is less frequent in infants and children than in adults. Likewise, in animal models of neuropathic pain, allodynia and hyperalgesia are non-existent or attenuated in the infant, with a switch during development by which acute nerve injury transitions to chronic pain. Concomitant with the delay in neuropathic pain, there is a parallel delay in the ability of nerve injury to activate the immune system. Models of neuropathic pain in the infant have used various ligation methods and find that neuropathic pain does not occur under after postnatal day 21-28 (PN21-PN28, linked to activation of immune processes and developmental regulation of anti-inflammatory cytokines. We applied a model of neuropathic pain in the adult using a transient compression of the cervical nerve or nerve root in infant rats (injured at 10, 14, 21 or 28 days of age to define transition periods during which injury results in no change in thermal and mechanical pain sensitivity or in short term changes in pain. There was little to no hyperalgesia when the injury was imposed at PN10, but significant thermal hyperalgesia and mechanical allodynia one day after compression injury when performed at PN14, 21 or 28. Thermal withdrawal latencies return to near baseline by 7 days post-surgery (PS7 when the injuries were at PN14, and lasted up to 14 days when imposed at PN28. There was mechanical allodynia following nerve injury at 7 or 14 days after injury at PN14. Measurements of mRNA from spinal cord at 1, 7 and 14 days post-injury at PN14, 21, and 28 showed that both the magnitude and duration of elevated immune markers and chemokines/cytokines were greater in the older animals, corresponding to the development of hyperalgesia. Thus we confirm the late onset of neuropathic pain but found no evidence of emergent hyperalgesia if the injury was before PN21/28. This may be due to the use of a transient

  12. Depletion of Key Meiotic Genes and Transcriptome-Wide Abiotic Stress Reprogramming Mark Early Preparatory Events Ahead of Apomeiotic Transition

    Jubin N Shah


    global DNA methylation exclusively in the apomicts. Variability in stress and transcriptional response in a diploid apomict, which is geographically distinct from the triploid apomict, pinpoints both common and independent features of apomixis evolution. Our study provides a molecular frame-work to investigate how the adaptive traits associated with the evolutionary history of apomicts co-adapted with meiotic gene deregulation at early developmental stage, in order to predate meiotic recombination, which otherwise is thought to be favourable in stress and low-fitness conditions.

  13. Transcriptome Analysis of Three Sheep Intestinal Regions reveals Key Pathways and Hub Regulatory Genes of Large Intestinal Lipid Metabolism.

    Chao, Tianle; Wang, Guizhi; Ji, Zhibin; Liu, Zhaohua; Hou, Lei; Wang, Jin; Wang, Jianmin


    The large intestine, also known as the hindgut, is an important part of the animal digestive system. Recent studies on digestive system development in ruminants have focused on the rumen and the small intestine, but the molecular mechanisms underlying sheep large intestine metabolism remain poorly understood. To identify genes related to intestinal metabolism and to reveal molecular regulation mechanisms, we sequenced and compared the transcriptomes of mucosal epithelial tissues among the cecum, proximal colon and duodenum. A total of 4,221 transcripts from 3,254 genes were identified as differentially expressed transcripts. Between the large intestine and duodenum, differentially expressed transcripts were found to be significantly enriched in 6 metabolism-related pathways, among which PPAR signaling was identified as a key pathway. Three genes, CPT1A, LPL and PCK1, were identified as higher expression hub genes in the large intestine. Between the cecum and colon, differentially expressed transcripts were significantly enriched in 5 lipid metabolism related pathways, and CEPT1 and MBOAT1 were identified as hub genes. This study provides important information regarding the molecular mechanisms of intestinal metabolism in sheep and may provide a basis for further study.

  14. NeuroD1: developmental expression and regulated genes in the rodent pineal gland

    Muñoz, Estela M; Bailey, Michael J; Rath, Martin F


    NeuroD1/BETA2, a member of the bHLH transcription factor family, is known to influence the fate of specific neuronal, endocrine and retinal cells. We report here that NeuroD1 mRNA is highly abundant in the developing and adult rat pineal gland. Pineal expression begins in the 17-day embryo at which...... time it is also detectable in other brain regions. Expression in the pineal gland increases during the embryonic period and is maintained thereafter at levels equivalent to those found in the cerebellum and retina. In contrast, NeuroD1 mRNA decreases markedly in non-cerebellar brain regions during...... development. Pineal NeuroD1 levels are similar during the day and night, and do not appear to be influenced by sympathetic neural input. Gene expression analysis of the pineal glands from neonatal NeuroD1 knockout mice identifies 127 transcripts that are down-regulated (>twofold, p

  15. The Level of AdpA Directly Affects Expression of Developmental Genes in Streptomyces coelicolor ▿ †

    Wolański, Marcin; Donczew, Rafał; Kois-Ostrowska, Agnieszka; Masiewicz, Paweł; Jakimowicz, Dagmara; Zakrzewska-Czerwińska, Jolanta


    AdpA is a key regulator of morphological differentiation in Streptomyces. In contrast to Streptomyces griseus, relatively little is known about AdpA protein functions in Streptomyces coelicolor. Here, we report for the first time the translation accumulation profile of the S. coelicolor adpA (adpASc) gene; the level of S. coelicolor AdpA (AdpASc) increased, reaching a maximum in the early stage of aerial mycelium formation (after 36 h), and remained relatively stable for the next several hour...

  16. Gene expression profiling in Entamoeba histolytica identifies key components in iron uptake and metabolism.

    Nora Adriana Hernández-Cuevas

    Full Text Available Entamoeba histolytica is an ameboid parasite that causes colonic dysentery and liver abscesses in humans. The parasite encounters dramatic changes in iron concentration during its invasion of the host, with relatively low levels in the intestinal lumen and then relatively high levels in the blood and liver. The liver notably contains sources of iron; therefore, the parasite's ability to use these sources might be relevant to its survival in the liver and thus the pathogenesis of liver abscesses. The objective of the present study was to identify factors involved in iron uptake, use and storage in E. histolytica. We compared the respective transcriptomes of E. histolytica trophozoites grown in normal medium (containing around 169 µM iron, low-iron medium (around 123 µM iron, iron-deficient medium (around 91 µM iron, and iron-deficient medium replenished with hemoglobin. The differentially expressed genes included those coding for the ATP-binding cassette transporters and major facilitator transporters (which share homology with bacterial siderophores and heme transporters and genes involved in heme biosynthesis and degradation. Iron deficiency was associated with increased transcription of genes encoding a subset of cell signaling molecules, some of which have previously been linked to adaptation to the intestinal environment and virulence. The present study is the first to have assessed the transcriptome of E. histolytica grown under various iron concentrations. Our results provide insights into the pathways involved in iron uptake and metabolism in this parasite.

  17. Gene expression profiling in Entamoeba histolytica identifies key components in iron uptake and metabolism.

    Hernández-Cuevas, Nora Adriana; Weber, Christian; Hon, Chung-Chau; Guillen, Nancy


    Entamoeba histolytica is an ameboid parasite that causes colonic dysentery and liver abscesses in humans. The parasite encounters dramatic changes in iron concentration during its invasion of the host, with relatively low levels in the intestinal lumen and then relatively high levels in the blood and liver. The liver notably contains sources of iron; therefore, the parasite's ability to use these sources might be relevant to its survival in the liver and thus the pathogenesis of liver abscesses. The objective of the present study was to identify factors involved in iron uptake, use and storage in E. histolytica. We compared the respective transcriptomes of E. histolytica trophozoites grown in normal medium (containing around 169 µM iron), low-iron medium (around 123 µM iron), iron-deficient medium (around 91 µM iron), and iron-deficient medium replenished with hemoglobin. The differentially expressed genes included those coding for the ATP-binding cassette transporters and major facilitator transporters (which share homology with bacterial siderophores and heme transporters) and genes involved in heme biosynthesis and degradation. Iron deficiency was associated with increased transcription of genes encoding a subset of cell signaling molecules, some of which have previously been linked to adaptation to the intestinal environment and virulence. The present study is the first to have assessed the transcriptome of E. histolytica grown under various iron concentrations. Our results provide insights into the pathways involved in iron uptake and metabolism in this parasite.

  18. Virus-Induced Silencing of Key Genes Leads to Differential Impact on Withanolide Biosynthesis in the Medicinal Plant, Withania somnifera.

    Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar


    Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.

  19. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  20. Polypyrimidine Tract Binding Protein Homologs from Arabidopsis Are Key Regulators of Alternative Splicing with Implications in Fundamental Developmental Processes[W

    Rühl, Christina; Stauffer, Eva; Kahles, André; Wagner, Gabriele; Drechsel, Gabriele; Rätsch, Gunnar; Wachter, Andreas


    Alternative splicing (AS) generates transcript variants by variable exon/intron definition and massively expands transcriptome diversity. Changes in AS patterns have been found to be linked to manifold biological processes, yet fundamental aspects, such as the regulation of AS and its functional implications, largely remain to be addressed. In this work, widespread AS regulation by Arabidopsis thaliana Polypyrimidine tract binding protein homologs (PTBs) was revealed. In total, 452 AS events derived from 307 distinct genes were found to be responsive to the levels of the splicing factors PTB1 and PTB2, which predominantly triggered splicing of regulated introns, inclusion of cassette exons, and usage of upstream 5′ splice sites. By contrast, no major AS regulatory function of the distantly related PTB3 was found. Dependent on their position within the mRNA, PTB-regulated events can both modify the untranslated regions and give rise to alternative protein products. We find that PTB-mediated AS events are connected to diverse biological processes, and the functional implications of selected instances were further elucidated. Specifically, PTB misexpression changes AS of PHYTOCHROME INTERACTING FACTOR6, coinciding with altered rates of abscisic acid–dependent seed germination. Furthermore, AS patterns as well as the expression of key flowering regulators were massively changed in a PTB1/2 level-dependent manner. PMID:23192226

  1. Paramecium BBS genes are key to presence of channels in Cilia

    Valentine Megan


    Full Text Available Abstract Background Changes in genes coding for ciliary proteins contribute to complex human syndromes called ciliopathies, such as Bardet-Biedl Syndrome (BBS. We used the model organism Paramecium to focus on ciliary ion channels that affect the beat form and sensory function of motile cilia and evaluate the effects of perturbing BBS proteins on these channels. Methods We used immunoprecipitations and mass spectrometry to explore whether Paramecium proteins interact as in mammalian cells. We used RNA interference (RNAi and swimming behavior assays to examine the effects of BBS depletion on ciliary ion channels that control ciliary beating. Combining RNA interference and epitope tagging, we examined the effects of BBS depletion of BBS 7, 8 and 9 on the location of three channels and a chemoreceptor in cilia. Results We found 10 orthologs of 8 BBS genes in P. tetraurelia. BBS1, 2, 4, 5, 7, 8 and 9 co-immunoprecipitate. While RNAi reduction of BBS 7 and 9 gene products caused loss and shortening of cilia, RNAi for all BBS genes except BBS2 affected patterns of ciliary motility that are governed by ciliary ion channels. Swimming behavior assays pointed to loss of ciliary K+ channel function. Combining RNAi and epitope tagged ciliary proteins we demonstrated that a calcium activated K+ channel was no longer located in the cilia upon depletion of BBS 7, 8 or 9, consistent with the cells’ swimming behavior. The TRPP channel PKD2 was also lost from the cilia. In contrast, the ciliary voltage gated calcium channel was unaffected by BBS depletion, consistent with behavioral assays. The ciliary location of a chemoreceptor for folate was similarly unperturbed by the depletion of BBS 7, 8 or 9. Conclusions The co-immunoprecipitation of BBS 1,2,4,5,7,8, and 9 suggests a complex of BBS proteins. RNAi for BBS 7, 8 or 9 gene products causes the selective loss of K+ and PKD2 channels from the cilia while the critical voltage gated calcium channel and a

  2. Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish.

    Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E


    Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the

  3. The Arabidopsis Transcription Factor AtTCP15 Regulates Endoreduplication by Modulating Expression of Key Cell-cycle Genes

    Zi-Yu Li; Bin Li; Ai-Wu Dong


    Plant cells frequently undergo endoreduplication,a modified cell cycle in which genome is repeatedly replicated without cytokinesis.As the key step to achieve final size and function for cells,endoreduplication is prevalent during plant development.However,mechanisms to control the balance between endoreduplication and mitotic cell division are still poorly understood.Here,we show that the Arabidopsis TCP (CINCINNATA-like TEOSINTE BRANCHED1-CYCLOIDEA-PCF)-family transcription factor gene AtTCP15 is expressed in trichomes,as well as in rapidly dividing and vascular tissues.Expression of AtTCP15SRDX,AtTCP15 fused with a SRDX repressor domain,induces extra endoreduplication in trichomes and cotyledon cells in transgenic Arabidopsis.On the contrary,overexpression of AtTCP15 suppresses endoreduplication in trichomes and other examined cells.Misregulation of AtTCP15 affects the expression of several important genes involved in cell-cycle regulation.AtTCP15 protein binds directly to the promoter regions of CYCA2;3 and RETINOBLASTOMA-RELATED (RBR) genes,which play key roles in endoreduplication.Taken together,AtTCP15 plays an important role in regulating endoreduplication during Arabidopsis development.

  4. Developmental pathways from child maltreatment to adolescent marijuana dependence: Examining moderation by FK506 binding protein 5 gene (FKBP5).

    Handley, Elizabeth D; Rogosch, Fred A; Cicchetti, Dante


    The current study examined the prospective association between child maltreatment and the development of substance use disorder in adolescence with the aim of investigating pathways underlying this relation, as well as genetic moderation of these developmental mechanisms. Specifically, we tested whether youth who experienced maltreatment prior to age 8 were at risk for the development of marijuana dependence in adolescence by way of a childhood externalizing pathway and a childhood internalizing pathway. Moreover, we tested whether variation in FK506 binding protein 5 gene (FKBP5) CATT haplotype moderated these pathways. The participants were 326 children (n =179 maltreated; n = 147 nonmaltreated) assessed across two waves of data collection (childhood: ages 7-9 and adolescence: ages 15-18). Results indicated that higher levels of child externalizing symptoms significantly mediated the effect of child maltreatment on adolescent marijuana dependence symptoms for individuals with one or two copies of the FKBP5 CATT haplotype only. We did not find support for an internalizing pathway from child maltreatment to adolescent marijuana dependence, nor did we find evidence of moderation of the internalizing pathway by FKBP5 haplotype variation. Findings extend previous research by demonstrating that whether a maltreated child will traverse an externalizing pathway toward substance use disorder in adolescence is dependent on FKBP5 genetic variation.

  5. Developmental and sex-specific differences in expression of neuropeptides derived from allatotropin gene in the silkmoth Bombyx mori.

    Bednár, Branislav; Roller, Ladislav; Čižmár, Daniel; Mitrová, Diana; Žitňan, Dušan


    Allatotropin (AT) and related neuropeptides are widespread bioactive molecules that regulate development, food intake and muscle contractions in insects and other invertebrates. In moths, alternative splicing of the at gene generates three mRNA precursors encoding AT with different combinations of three structurally similar AT-like peptides (ATLI-III). We used in situ hybridization and immunohistochemistry to map the differential expression of these transcripts during the postembryonic development of Bombyx mori. Transcript encoding AT alone was expressed in numerous neurons of the central nervous system and frontal ganglion, whereas transcripts encoding AT with ATLs were produced by smaller specific subgroups of neurons in larval stages. Metamorphosis was associated with considerable developmental changes and sex-specific differences in the expression of all transcripts. The most notable was the appearance of AT/ATL transcripts (1) in the brain lateral neurosecretory cells producing prothoracicotropic hormone; (2) in the male-specific cluster of about 20 neurons in the posterior region of the terminal abdominal ganglion; (3) in the female-specific medial neurons in the abdominal ganglia AG2-7. Immunohistochemical staining showed that these neurons produced a mixture of various neuropeptides and innervated diverse peripheral organs. Our data suggest that AT/ATL neuropeptides are involved in multiple stage- and sex-specific functions during the development of B. mori.

  6. A peroxidase gene expressed during early developmental stages of the parasitic plant Orobanche ramosa.

    González-Verdejo, Clara Isabel; Barandiaran, Xabier; Moreno, Maria Teresa; Cubero, José Ignacio; Di Pietro, Antonio


    Broomrapes (Orobanche spp.) are holoparasitic weeds that cause devastating losses in many economically important crops. The molecular mechanisms that control the early stages of host infection in Orobanche are poorly understood. In the present study, the role of peroxidase has been examined during pre-infection growth and development of O. ramosa, using an in vitro model system. Peroxidase activity was histochemically localized at the tips of actively growing radicles and nascent attachment organs. Addition of exogenous catalase resulted in a significant reduction in the apical growth rate of the radicle. The prx1 gene encoding a putative class III peroxidase was cloned from a cDNA library of O. ramosa and was found to be expressed specifically during the early stages of the parasitic life cycle. The exogenous addition of sucrose resulted in significantly reduced prx1 transcript levels and in a dramatic change in radicle development from polarized apical growth to isotropic growth and the formation of tubercle-like structures. The results indicate an important role of peroxidases during the early parasitic stages of Orobanche.

  7. Developmental pathway genes and neural plasticity underlying emotional learning and stress-related disorders.

    Maheu, Marissa E; Ressler, Kerry J


    The manipulation of neural plasticity as a means of intervening in the onset and progression of stress-related disorders retains its appeal for many researchers, despite our limited success in translating such interventions from the laboratory to the clinic. Given the challenges of identifying individual genetic variants that confer increased risk for illnesses like depression and post-traumatic stress disorder, some have turned their attention instead to focusing on so-called "master regulators" of plasticity that may provide a means of controlling these potentially impaired processes in psychiatric illnesses. The mammalian homolog of Tailless (TLX), Wnt, and the homeoprotein Otx2 have all been proposed to constitute master regulators of different forms of plasticity which have, in turn, each been implicated in learning and stress-related disorders. In the present review, we provide an overview of the changing distribution of these genes and their roles both during development and in the adult brain. We further discuss how their distinct expression profiles provide clues as to their function, and may inform their suitability as candidate drug targets in the treatment of psychiatric disorders. © 2017 Maheu and Ressler; Published by Cold Spring Harbor Laboratory Press.

  8. Exposure to atrazine affects the expression of key genes in metabolic pathways integral to energy homeostasis in Xenopus laevis tadpoles.

    Zaya, Renee M; Amini, Zakariya; Whitaker, Ashley S; Ide, Charles F


    In our laboratory, Xenopus laevis tadpoles exposed throughout development to 200 or 400 μg/L atrazine, concentrations reported to periodically occur in puddles, vernal ponds and runoff soon after application, were smaller and had smaller fat bodies (the tadpole's lipid storage organ) than controls. It was hypothesized that these changes were due to atrazine-related perturbations of energy homeostasis. To investigate this hypothesis, selected metabolic responses to exposure at the transcriptional and biochemical levels in atrazine-exposed tadpoles were measured. DNA microarray technology was used to determine which metabolic pathways were affected after developmental exposure to 400 μg/L atrazine. From these data, genes representative of the affected pathways were selected for assay using quantitative real time polymerase chain reaction (qRT-PCR) to measure changes in expression during a 2-week exposure to 400 μg/L. Finally, ATP levels were measured from tadpoles both early in and at termination of exposure to 200 and 400 μg/L. Microarray analysis revealed significant differential gene expression in metabolic pathways involved with energy homeostasis. Pathways with increased transcription were associated with the conversion of lipids and proteins into energy. Pathways with decreased transcription were associated with carbohydrate metabolism, fat storage, and protein synthesis. Using qRT-PCR, changes in gene expression indicative of an early stress response to atrazine were noted. Exposed tadpoles had significant decreases in acyl-CoA dehydrogenase (AD) and glucocorticoid receptor protein (GR) mRNA after 24 h of exposure, and near-significant (p=0.07) increases in peroxisome proliferator-activated receptor β (PPAR-β) mRNA by 72 h. Decreases in AD suggested decreases in fatty acid β-oxidation while decreases in GR may have been a receptor desensitization response to a glucocorticoid surge. Involvement of PPAR-β, an energy homeostasis regulatory molecule, also

  9. Exposure to atrazine affects the expression of key genes in metabolic pathways integral to energy homeostasis in Xenopus laevis tadpoles

    Zaya, Renee M.; Amini, Zakariya; Whitaker, Ashley S.; Ide, Charles F.


    In our laboratory, Xenopus laevis tadpoles exposed throughout development to 200 or 400 μg/L atrazine, concentrations reported to periodically occur in puddles, vernal ponds and runoff soon after application, were smaller and had smaller fat bodies (the tadpole's lipid storage organ) than controls. It was hypothesized that these changes were due to atrazine-related perturbations of energy homeostasis. To investigate this hypothesis, selected metabolic responses to exposure at the transcriptional and biochemical levels in atrazine-exposed tadpoles were measured. DNA microarray technology was used to determine which metabolic pathways were affected after developmental exposure to 400 μg/L atrazine. From these data, genes representative of the affected pathways were selected for assay using quantitative real time polymerase chain reaction (qRT-PCR) to measure changes in expression during a 2-week exposure to 400 μg/L. Finally, ATP levels were measured from tadpoles both early in and at termination of exposure to 200 and 400 μg/L. Microarray analysis revealed significant differential gene expression in metabolic pathways involved with energy homeostasis. Pathways with increased transcription were associated with the conversion of lipids and proteins into energy. Pathways with decreased transcription were associated with carbohydrate metabolism, fat storage, and protein synthesis. Using qRT-PCR, changes in gene expression indicative of an early stress response to atrazine were noted. Exposed tadpoles had significant decreases in acyl-CoA dehydrogenase (AD) and glucocorticoid receptor protein (GR) mRNA after 24 h of exposure, and near-significant (p = 0.07) increases in peroxisome proliferator-activated receptor β (PPAR-β) mRNA by 72 h. Decreases in AD suggested decreases in fatty acid β-oxidation while decreases in GR may have been a receptor desensitization response to a glucocorticoid surge. Involvement of PPAR-β, an energy homeostasis regulatory molecule

  10. Exposure to atrazine affects the expression of key genes in metabolic pathways integral to energy homeostasis in Xenopus laevis tadpoles

    Zaya, Renee M., E-mail: [Great Lakes Environmental and Molecular Sciences Center, Department of Biological Sciences, 3425 Wood Hall, Western Michigan University, 1903 West Michigan Avenue, Kalamazoo, MI 49008 (United States); Amini, Zakariya, E-mail: [Great Lakes Environmental and Molecular Sciences Center, Department of Biological Sciences, 3425 Wood Hall, Western Michigan University, 1903 West Michigan Avenue, Kalamazoo, MI 49008 (United States); Whitaker, Ashley S., E-mail: [Great Lakes Environmental and Molecular Sciences Center, Department of Biological Sciences, 3425 Wood Hall, Western Michigan University, 1903 West Michigan Avenue, Kalamazoo, MI 49008 (United States); Ide, Charles F., E-mail: [Great Lakes Environmental and Molecular Sciences Center, Department of Biological Sciences, 3425 Wood Hall, Western Michigan University, 1903 West Michigan Avenue, Kalamazoo, MI 49008 (United States)


    In our laboratory, Xenopus laevis tadpoles exposed throughout development to 200 or 400 {mu}g/L atrazine, concentrations reported to periodically occur in puddles, vernal ponds and runoff soon after application, were smaller and had smaller fat bodies (the tadpole's lipid storage organ) than controls. It was hypothesized that these changes were due to atrazine-related perturbations of energy homeostasis. To investigate this hypothesis, selected metabolic responses to exposure at the transcriptional and biochemical levels in atrazine-exposed tadpoles were measured. DNA microarray technology was used to determine which metabolic pathways were affected after developmental exposure to 400 {mu}g/L atrazine. From these data, genes representative of the affected pathways were selected for assay using quantitative real time polymerase chain reaction (qRT-PCR) to measure changes in expression during a 2-week exposure to 400 {mu}g/L. Finally, ATP levels were measured from tadpoles both early in and at termination of exposure to 200 and 400 {mu}g/L. Microarray analysis revealed significant differential gene expression in metabolic pathways involved with energy homeostasis. Pathways with increased transcription were associated with the conversion of lipids and proteins into energy. Pathways with decreased transcription were associated with carbohydrate metabolism, fat storage, and protein synthesis. Using qRT-PCR, changes in gene expression indicative of an early stress response to atrazine were noted. Exposed tadpoles had significant decreases in acyl-CoA dehydrogenase (AD) and glucocorticoid receptor protein (GR) mRNA after 24 h of exposure, and near-significant (p = 0.07) increases in peroxisome proliferator-activated receptor {beta} (PPAR-{beta}) mRNA by 72 h. Decreases in AD suggested decreases in fatty acid {beta}-oxidation while decreases in GR may have been a receptor desensitization response to a glucocorticoid surge. Involvement of PPAR-{beta}, an energy

  11. Dietary supplementation with arginine and glutamic acid enhances key lipogenic gene expression in growing pigs.

    Hu, C J; Jiang, Q Y; Zhang, T; Yin, Y L; Li, F N; Su, J Y; Wu, G Y; Kong, X F


    Our previous study showed dietary supplementation with Arg and Glu increased intramuscular fat deposition and decreased back fat thickness in pigs, suggesting that the genes involved in lipid metabolism might be regulated differently in muscle and s.c. adipose (SA) tissues. Sixty Duroc × Large White × Landrace pigs with an average initial BW of 77.1 ± 1.3 kg were randomly assigned to 1 of 5 treatment groups (castrated male to female ratio = 1:1). Pigs in the control group were fed a basic diet, and those in experimental groups were fed the basic diet supplemented with 2.05% alanine (isonitrogenous group), 1.00% arginine (Arg group), 1.00% glutamic acid + 1.44% alanine (Glu group), or 1.00% arginine + 1.00% glutamic acid (Arg+Glu group). Fatty acid percentages and mRNA expression levels of the genes involved in lipid metabolism in muscle and SA tissues were examined. The percentages of C14:0 and C16:0 in the SA tissue of Glu group pigs and C14:0 in the longissimus dorsi (LD) muscle of Glu and Arg+Glu groups decreased ( acid synthase in the Arg+Glu group was more upregulated ( < 0.05) than that of the Arg group. An increase in the mRNA level of in the biceps femoris muscle was also observed in the Arg+Glu group ( < 0.05) compared with the basic diet and isonitrogenous groups. Collectively, these findings suggest that dietary supplementation with Arg and Glu upregulates the expression of genes involved in adipogenesis in muscle tissues and lipolysis in SA tissues.

  12. De novo Assembly of the Camellia nitidissima Transcriptome Reveals Key Genes of Flower Pigment Biosynthesis

    Xingwen Zhou


    Full Text Available The golden camellia, Camellia nitidissima Chi., is a well-known ornamental plant that is known as “the queen of camellias” because of its golden yellow flowers. The principal pigments in the flowers are carotenoids and flavonol glycosides. Understanding the biosynthesis of the golden color and its regulation is important in camellia breeding. To obtain a comprehensive understanding of flower development in C. nitidissima, a number of cDNA libraries were independently constructed during flower development. Using the Illumina Hiseq2500 platform, approximately 71.8 million raw reads (about 10.8 gigabase pairs were obtained and assembled into 583,194 transcripts and 466, 594 unigenes. A differentially expressed genes (DEGs and co-expression network was constructed to identify unigenes correlated with flower color. The analysis of DEGs and co-expressed network involved in the carotenoid pathway indicated that the biosynthesis of carotenoids is regulated mainly at the transcript level and that phytoene synthase (PSY, β -carotene 3-hydroxylase (CrtZ, and capsanthin synthase (CCS1 exert synergistic effects in carotenoid biosynthesis. The analysis of DEGs and co-expressed network involved in the flavonoid pathway indicated that chalcone synthase (CHS, naringenin 3-dioxygenase (F3H, leucoanthocyanidin dioxygenase(ANS, and flavonol synthase (FLS play critical roles in regulating the formation of flavonols and anthocyanidin. Based on the gene expression analysis of the carotenoid and flavonoid pathways, and determinations of the pigments, we speculate that the high expression of PSY and CrtZ ensures the production of adequate levels of carotenoids, while the expression of CHS, FLS ensures the production of flavonols. The golden yellow color is then the result of the accumulation of carotenoids and flavonol glucosides in the petals. This study of the mechanism of color formation in golden camellia points the way to breeding strategies that exploit gene

  13. Early developmental gene enhancers affect subcortical volumes in the adult human brain.

    Becker, Martin; Guadalupe, Tulio; Franke, Barbara; Hibar, Derrek P; Renteria, Miguel E; Stein, Jason L; Thompson, Paul M; Francks, Clyde; Vernes, Sonja C; Fisher, Simon E


    Genome-wide association screens aim to identify common genetic variants contributing to the phenotypic variability of complex traits, such as human height or brain morphology. The identified genetic variants are mostly within noncoding genomic regions and the biology of the genotype-phenotype association typically remains unclear. In this article, we propose a complementary targeted strategy to reveal the genetic underpinnings of variability in subcortical brain volumes, by specifically selecting genomic loci that are experimentally validated forebrain enhancers, active in early embryonic development. We hypothesized that genetic variation within these enhancers may affect the development and ultimately the structure of subcortical brain regions in adults. We tested whether variants in forebrain enhancer regions showed an overall enrichment of association with volumetric variation in subcortical structures of >13,000 healthy adults. We observed significant enrichment of genomic loci that affect the volume of the hippocampus within forebrain enhancers (empirical P = 0.0015), a finding which robustly passed the adjusted threshold for testing of multiple brain phenotypes (cutoff of P < 0.0083 at an alpha of 0.05). In analyses of individual single nucleotide polymorphisms (SNPs), we identified an association upstream of the ID2 gene with rs7588305 and variation in hippocampal volume. This SNP-based association survived multiple-testing correction for the number of SNPs analyzed but not for the number of subcortical structures. Targeting known regulatory regions offers a way to understand the underlying biology that connects genotypes to phenotypes, particularly in the context of neuroimaging genetics. This biology-driven approach generates testable hypotheses regarding the functional biology of identified associations. Hum Brain Mapp 37:1788-1800, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Sub-circuits of a gene regulatory network control a developmental epithelial-mesenchymal transition.

    Saunders, Lindsay R; McClay, David R


    Epithelial-mesenchymal transition (EMT) is a fundamental cell state change that transforms epithelial to mesenchymal cells during embryonic development, adult tissue repair and cancer metastasis. EMT includes a complex series of intermediate cell state changes including remodeling of the basement membrane, apical constriction, epithelial de-adhesion, directed motility, loss of apical-basal polarity, and acquisition of mesenchymal adhesion and polarity. Transcriptional regulatory state changes must ultimately coordinate the timing and execution of these cell biological processes. A well-characterized gene regulatory network (GRN) in the sea urchin embryo was used to identify the transcription factors that control five distinct cell changes during EMT. Single transcription factors were perturbed and the consequences followed with in vivo time-lapse imaging or immunostaining assays. The data show that five different sub-circuits of the GRN control five distinct cell biological activities, each part of the complex EMT process. Thirteen transcription factors (TFs) expressed specifically in pre-EMT cells were required for EMT. Three TFs highest in the GRN specified and activated EMT (alx1, ets1, tbr) and the 10 TFs downstream of those (tel, erg, hex, tgif, snail, twist, foxn2/3, dri, foxb, foxo) were also required for EMT. No single TF functioned in all five sub-circuits, indicating that there is no EMT master regulator. Instead, the resulting sub-circuit topologies suggest EMT requires multiple simultaneous regulatory mechanisms: forward cascades, parallel inputs and positive-feedback lock downs. The interconnected and overlapping nature of the sub-circuits provides one explanation for the seamless orchestration by the embryo of cell state changes leading to successful EMT.

  15. ADP-glucose pyrophosphorylase gene plays a key role in the quality of corm and yield of cormels in gladiolus

    Seng, Shanshan; Wu, Jian; Sui, Juanjuan; Wu, Chenyu; Zhong, Xionghui; Liu, Chen; Liu, Chao; Gong, Benhe; Zhang, Fengqin; He, Junna; Yi, Mingfang


    Starch is the main storage compound in underground organs like corms. ADP-glucose pyrophosphorylase (AGPase) plays a key role in regulating starch biosynthesis in storage organs and is likely one of the most important determinant of sink strength. Here, we identify an AGPase gene (GhAGPS1) from gladiolus. The highest transcriptional levels of GhAGPS1 were observed in cormels and corms. Transformation of GhAGPS1 into Arabidopsis rescued the phenotype of aps1 mutant. Silencing GhAGPS1 in gladiolus corms by virus-induced gene silencing (VIGS) decreased the transcriptional levels of two genes and starch content. Transmission electron microscopy analyses of leaf and corm sections confirmed that starch biosynthesis was inhibited. Corm weight and cormel number reduced significantly in the silenced plants. Taken together, these results indicate that inhibiting the expression of AGPase gene could impair starch synthesis, which results in the lowered corm quality and cormel yield in gladiolus. -- Highlights: •Cormel quantity was reduced significantly in silenced Gladiolus plants. •Corm quality was declined significantly in silenced Gladiolus plants. •Starch synthesis was inhibited in silenced Gladiolus plants.

  16. Adaptive evolution of a key gene affecting queen and worker traits in the honey bee, Apis mellifera.

    Kent, Clement F; Issa, Amer; Bunting, Alexandra C; Zayed, Amro


    The vitellogenin egg yolk precursor protein represents a well-studied case of social pleiotropy in the model organism Apis mellifera. Vitellogenin is associated with fecundity in queens and plays a major role in controlling division of labour in workers, thereby affecting both individual and colony-level fitness. We studied the molecular evolution of vitellogenin and seven other genes sequenced in a large population panel of Apis mellifera and several closely related species to investigate the role of social pleiotropy on adaptive protein evolution. We found a significant excess of nonsynonymous fixed differences between A. mellifera, A. cerana and A. florea relative to synonymous sites indicating high rates of adaptive evolution at vitellogenin. Indeed, 88% of amino acid changes were fixed by selection in some portions of the gene. Further, vitellogenin exhibited hallmark signatures of selective sweeps in A. mellifera, including a significant skew in the allele frequency spectrum, extreme levels of genetic differentiation and linkage disequilibrium. Finally, replacement polymorphisms in vitellogenin were significantly enriched in parts of the protein involved in binding lipid, establishing a link between the gene's structure, function and effects on fitness. Our case study provides unequivocal evidence of historical and ongoing bouts of adaptive evolution acting on a key socially pleiotropic gene in the honey bee. © 2011 Blackwell Publishing Ltd.

  17. ADP-glucose pyrophosphorylase gene plays a key role in the quality of corm and yield of cormels in gladiolus

    Seng, Shanshan, E-mail: [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); Wu, Jian [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); Sui, Juanjuan [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); College of Biology, Fuyang Normal College, Qinghe Western Road 100#, Fuyang 236037, Anhui (China); Wu, Chenyu; Zhong, Xionghui; Liu, Chen; Liu, Chao; Gong, Benhe; Zhang, Fengqin; He, Junna [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); Yi, Mingfang, E-mail: [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China)


    Starch is the main storage compound in underground organs like corms. ADP-glucose pyrophosphorylase (AGPase) plays a key role in regulating starch biosynthesis in storage organs and is likely one of the most important determinant of sink strength. Here, we identify an AGPase gene (GhAGPS1) from gladiolus. The highest transcriptional levels of GhAGPS1 were observed in cormels and corms. Transformation of GhAGPS1 into Arabidopsis rescued the phenotype of aps1 mutant. Silencing GhAGPS1 in gladiolus corms by virus-induced gene silencing (VIGS) decreased the transcriptional levels of two genes and starch content. Transmission electron microscopy analyses of leaf and corm sections confirmed that starch biosynthesis was inhibited. Corm weight and cormel number reduced significantly in the silenced plants. Taken together, these results indicate that inhibiting the expression of AGPase gene could impair starch synthesis, which results in the lowered corm quality and cormel yield in gladiolus. -- Highlights: •Cormel quantity was reduced significantly in silenced Gladiolus plants. •Corm quality was declined significantly in silenced Gladiolus plants. •Starch synthesis was inhibited in silenced Gladiolus plants.

  18. Key Microbiota Identification Using Functional Gene Analysis during Pepper (Piper nigrum L.) Peeling.

    Zhang, Jiachao; Hu, Qisong; Xu, Chuanbiao; Liu, Sixin; Li, Congfa


    Pepper pericarp microbiota plays an important role in the pepper peeling process for the production of white pepper. We collected pepper samples at different peeling time points from Hainan Province, China, and used a metagenomic approach to identify changes in the pericarp microbiota based on functional gene analysis. UniFrac distance-based principal coordinates analysis revealed significant changes in the pericarp microbiota structure during peeling, which were attributed to increases in bacteria from the genera Selenomonas and Prevotella. We identified 28 core operational taxonomic units at each time point, mainly belonging to Selenomonas, Prevotella, Megasphaera, Anaerovibrio, and Clostridium genera. The results were confirmed by quantitative polymerase chain reaction. At the functional level, we observed significant increases in microbial features related to acetyl xylan esterase and pectinesterase for pericarp degradation during peeling. These findings offer a new insight into biodegradation for pepper peeling and will promote the development of the white pepper industry.

  19. NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

    Xingguo Zhu

    Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

  20. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    Yu Agnes


    Full Text Available Abstract Background Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying potential targets for plant breeding. Drought tolerance in the field was successfully conferred to crops by transferring genes from this model species. While involved in a plant genomics programme, which aims to identify new genes responsible for plant response to abiotic stress, we identified ESKIMO1 as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE, which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis of one mutant line and its wild-type background was carried out. Under control watering conditions a number of genes were differentially expressed between the mutant and the wild type whereas under mild drought stress this list of genes was reduced. Among the genes that were differentially expressed between the wild type and mutant, two functional categories related to the response to stress or biotic and abiotic stimulus were over-represented. Under salt stress conditions, all gene functional categories were represented equally in both the mutant and wild type. Based on this transcriptome analysis we hypothesise that in control conditions the esk1 mutant behaves as if it was exposed to drought stress. Conclusion Overall our findings suggest that the

  1. Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

    Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.


    Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

  2. Expression pattern of glycoside hydrolase genes in Lutzomyia longipalpis reveals key enzymes involved in larval digestion

    Caroline da Silva Moraes


    Full Text Available The sand fly Lutzomyia longipalpis is the most important vector of American Visceral Leishmaniasis. Adults are phytophagous (males and females or blood feeders (females only, and larvae feed on solid detritus. Digestion in sand fly larvae has scarcely been studied, but some glycosidase activities putatively involved in microorganism digestion were already described. Nevertheless, the molecular nature of these enzymes, as the corresponding genes and transcripts, were not explored yet. Catabolism of microbial carbohydrates in insects generally involves β-1,3-glucanases, chitinases and digestive lysozymes. In this work, the transcripts of digestive β-1,3-glucanase and chitinases were identified in the L. longipalpis larvae throughout analysis of sequences and expression patterns of glycoside hydrolases families 16, 18 and 22. The activity of one i-type lysozyme was also registered. Interestingly, this lysozyme seems to play a role in immunity, rather than digestion. This is the first attempt to identify the molecular nature of sand fly larval digestive enzymes.

  3. Expression pattern of glycoside hydrolase genes in Lutzomyia longipalpis reveals key enzymes involved in larval digestion

    Moraes, Caroline da Silva; Diaz-Albiter, Hector M.; Faria, Maiara do Valle; Sant'Anna, Maurício R. V.; Dillon, Rod J.; Genta, Fernando A.


    The sand fly Lutzomyia longipalpis is the most important vector of American Visceral Leishmaniasis. Adults are phytophagous (males and females) or blood feeders (females only), and larvae feed on solid detritus. Digestion in sand fly larvae has scarcely been studied, but some glycosidase activities putatively involved in microorganism digestion were already described. Nevertheless, the molecular nature of these enzymes, as the corresponding genes and transcripts, were not explored yet. Catabolism of microbial carbohydrates in insects generally involves β-1,3-glucanases, chitinases, and digestive lysozymes. In this work, the transcripts of digestive β-1,3-glucanase and chitinases were identified in the L. longipalpis larvae throughout analysis of sequences and expression patterns of glycoside hydrolases families 16, 18, and 22. The activity of one i-type lysozyme was also registered. Interestingly, this lysozyme seems to play a role in immunity, rather than digestion. This is the first attempt to identify the molecular nature of sand fly larval digestive enzymes. PMID:25140153

  4. Study on the Effect of Wing Bud Chitin Metabolism and Its Developmental Network Genes in the Brown Planthopper, Nilaparvata lugens, by Knockdown of TRE Gene

    Lu Zhang


    Full Text Available The brown planthopper, Nilaparvata lugens is one of the most serious pests of rice, and there is so far no effective way to manage this pest. However, RNA interference not only can be used to study gene function, but also provide potential opportunities for novel pest management. The development of wing plays a key role in insect physiological activities and mainly involves chitin. Hence, the regulating role of trehalase (TRE genes on wing bud formation has been studied by RNAi. In this paper, the activity levels of TRE and the contents of the two sugars trehalose and glucose were negatively correlated indicating the potential role of TRE in the molting process. In addition, NlTRE1-1 and NlTRE2 were expressed at higher levels in wing bud tissue than in other tissues, and abnormal molting and wing deformity or curling were noted 48 h after the insect was injected with any double-stranded TRE (dsTRE, even though different TREs have compensatory functions. The expression levels of NlCHS1b, NlCht1, NlCht2, NlCht6, NlCht7, NlCht8, NlCht10, NlIDGF, and NlENGase decreased significantly 48 h after the insect was injected with a mixture of three kinds of dsTREs. Similarly, the TRE inhibitor validamycin can inhibit NlCHS1 and NlCht gene expression. However, the wing deformity was the result of the NlIDGF, NlENGase, NlAP, and NlTSH genes being inhibited when a single dsTRE was injected. These results demonstrate that silencing of TRE gene expression can lead to wing deformities due to the down-regulation of the AP and TSH genes involved in wing development and that the TRE inhibitor validamycin can co-regulate chitin metabolism and the expression of wing development-related genes in wing bud tissue. The results provide a new approach for the prevention and management of N. lugens.

  5. Study on the Effect of Wing Bud Chitin Metabolism and Its Developmental Network Genes in the Brown Planthopper, Nilaparvata lugens, by Knockdown of TRE Gene.

    Zhang, Lu; Qiu, Ling-Yu; Yang, Hui-Li; Wang, Hui-Juan; Zhou, Min; Wang, Shi-Gui; Tang, Bin


    The brown planthopper, Nilaparvata lugens is one of the most serious pests of rice, and there is so far no effective way to manage this pest. However, RNA interference not only can be used to study gene function, but also provide potential opportunities for novel pest management. The development of wing plays a key role in insect physiological activities and mainly involves chitin. Hence, the regulating role of trehalase (TRE) genes on wing bud formation has been studied by RNAi. In this paper, the activity levels of TRE and the contents of the two sugars trehalose and glucose were negatively correlated indicating the potential role of TRE in the molting process. In addition, NlTRE1-1 and NlTRE2 were expressed at higher levels in wing bud tissue than in other tissues, and abnormal molting and wing deformity or curling were noted 48 h after the insect was injected with any double-stranded TRE ( dsTRE ), even though different TREs have compensatory functions. The expression levels of NlCHS1b, NlCht1, NlCht2, NlCht6, NlCht7, NlCht8, NlCht10, NlIDGF , and NlENGase decreased significantly 48 h after the insect was injected with a mixture of three kinds of dsTREs . Similarly, the TRE inhibitor validamycin can inhibit NlCHS1 and NlCht gene expression. However, the wing deformity was the result of the NlIDGF, NlENGase, NlAP , and NlTSH genes being inhibited when a single dsTRE was injected. These results demonstrate that silencing of TRE gene expression can lead to wing deformities due to the down-regulation of the AP and TSH genes involved in wing development and that the TRE inhibitor validamycin can co-regulate chitin metabolism and the expression of wing development-related genes in wing bud tissue. The results provide a new approach for the prevention and management of N. lugens .

  6. Regulation of Neph3 gene in podocytes - key roles of transcription factors NF-kappaB and Sp1

    Ristola, Mervi


    Abstract Background Neph3 (filtrin) is expressed in the glomerular podocytes where it localizes at the specialized cell adhesion structures of the foot processes called slit diaphragms which form the outermost layer of the glomerular filtration barrier. Neph3 protein shows homology and structural similarity to Neph1, Neph2 and nephrin, which all are crucial for maintaining the normal glomerular ultrafiltration function. The exact function of Neph3 in the kidney is not known but we have previously shown that the level of Neph3 mRNA is decreased in proteinuric diseases. This suggests that Neph3 may play a role in the pathogenesis of kidney damage, and emphasizes the need to analyze the regulatory mechanisms of Neph3 gene. In this study we investigated the transcriptional regulation of Neph3 gene by identifying transcription factors that control Neph3 expression. Results We cloned and characterized approximately 5 kb fragment upstream of the Neph3 gene. Neph3 proximal promoter near the transcription start site was found to be devoid of TATA and CAAT boxes, but to contain a highly GC-rich area. Using promoter reporter gene constructs, we localized the main activating regulatory region of Neph3 gene in its proximal promoter region from -105 to -57. Within this region, putative transcription factor binding sites for NF-κB and Sp1 were found by computational analysis. Mutational screening indicated that NF-κB and Sp1 response elements are essential for the basal transcriptional activity of the Neph3 promoter. Co-transfection studies further showed that NF-κB and Sp1 regulate Neph3 promoter activity. In addition, overexpression of NF-κB increased endogenous Neph3 gene expression. Chromatin immunoprecipitation assay using cultured human podocytes demonstrated that both NF-κB and Sp1 interact with the Neph3 promoter. Conclusion Our results show that NF-κB and Sp1 are key regulators of Neph3 expression at the basal level in podocytes, therefore providing new insight

  7. Upregulation of inflammatory genes and downregulation of sclerostin gene expression are key elements in the early phase of fragility fracture healing.

    Joana Caetano-Lopes

    Full Text Available BACKGROUND: Fracture healing is orchestrated by a specific set of events that culminates in the repair of bone and reachievement of its biomechanical properties. The aim of our work was to study the sequence of gene expression events involved in inflammation and bone remodeling occurring in the early phases of callus formation in osteoporotic patients. METHODOLOGY/PRINCIPAL FINDINGS: Fifty-six patients submitted to hip replacement surgery after a low-energy hip fracture were enrolled in this study. The patients were grouped according to the time interval between fracture and surgery: bone collected within 3 days after fracture (n = 13; between the 4(th and 7(th day (n = 33; and after one week from the fracture (n = 10. Inflammation- and bone metabolism-related genes were assessed at the fracture site. The expression of pro-inflammatory cytokines was increased in the first days after fracture. The genes responsible for bone formation and resorption were upregulated one week after fracture. The increase in RANKL expression occurred just before that, between the 4(th-7(th days after fracture. Sclerostin expression diminished during the first days after fracture. CONCLUSIONS: The expression of inflammation-related genes, especially IL-6, is highest at the very first days after fracture but from day 4 onwards there is a shift towards bone remodeling genes, suggesting that the inflammatory phase triggers bone healing. We propose that an initial inflammatory stimulus and a decrease in sclerostin-related effects are the key components in fracture healing. In osteoporotic patients, cellular machinery seems to adequately react to the inflammatory stimulus, therefore local promotion of these events might constitute a promising medical intervention to accelerate fracture healing.

  8. Evolution of the bHLH genes involved in stomatal development: implications for the expansion of developmental complexity of stomata in land plants.

    Jin-Hua Ran

    Full Text Available Stomata play significant roles in plant evolution. A trio of closely related basic Helix-Loop-Helix (bHLH subgroup Ia genes, SPCH, MUTE and FAMA, mediate sequential steps of stomatal development, and their functions may be conserved in land plants. However, the evolutionary history of the putative SPCH/MUTE/FAMA genes is still greatly controversial, especially the phylogenetic positions of the bHLH Ia members from basal land plants. To better understand the evolutionary pattern and functional diversity of the bHLH genes involved in stomatal development, we made a comprehensive evolutionary analysis of the homologous genes from 54 species representing the major lineages of green plants. The phylogenetic analysis indicated: (1 All bHLH Ia genes from the two basal land plants Physcomitrella and Selaginella were closely related to the FAMA genes of seed plants; and (2 the gymnosperm 'SPCH' genes were sister to a clade comprising the angiosperm SPCH and MUTE genes, while the FAMA genes of gymnosperms and angiosperms had a sister relationship. The revealed phylogenetic relationships are also supported by the distribution of gene structures and previous functional studies. Therefore, we deduce that the function of FAMA might be ancestral in the bHLH Ia subgroup. In addition, the gymnosperm "SPCH" genes may represent an ancestral state and have a dual function of SPCH and MUTE, two genes that could have originated from a duplication event in the common ancestor of angiosperms. Moreover, in angiosperms, SPCHs have experienced more duplications and harbor more copies than MUTEs and FAMAs, which, together with variation of the stomatal development in the entry division, implies that SPCH might have contributed greatly to the diversity of stomatal development. Based on the above, we proposed a model for the correlation between the evolution of stomatal development and the genes involved in this developmental process in land plants.

  9. Tomato UDP-Glucose Sterol Glycosyltransferases: A Family of Developmental and Stress Regulated Genes that Encode Cytosolic and Membrane-Associated Forms of the Enzyme

    Karla Ramirez-Estrada


    Full Text Available Sterol glycosyltransferases (SGTs catalyze the glycosylation of the free hydroxyl group at C-3 position of sterols to produce sterol glycosides. Glycosylated sterols and free sterols are primarily located in cell membranes where in combination with other membrane-bound lipids play a key role in modulating their properties and functioning. In contrast to most plant species, those of the genus Solanum contain very high levels of glycosylated sterols, which in the case of tomato may account for more than 85% of the total sterol content. In this study, we report the identification and functional characterization of the four members of the tomato (Solanum lycopersicum cv. Micro-Tom SGT gene family. Expression of recombinant SlSGT proteins in E. coli cells and N. benthamiana leaves demonstrated the ability of the four enzymes to glycosylate different sterol species including cholesterol, brassicasterol, campesterol, stigmasterol, and β-sitosterol, which is consistent with the occurrence in their primary structure of the putative steroid-binding domain found in steroid UDP-glucuronosyltransferases and the UDP-sugar binding domain characteristic for a superfamily of nucleoside diphosphosugar glycosyltransferases. Subcellular localization studies based on fluorescence recovery after photobleaching and cell fractionation analyses revealed that the four tomato SGTs, like the Arabidopsis SGTs UGT80A2 and UGT80B1, localize into the cytosol and the PM, although there are clear differences in their relative distribution between these two cell fractions. The SlSGT genes have specialized but still largely overlapping expression patterns in different organs of tomato plants and throughout the different stages of fruit development and ripening. Moreover, they are differentially regulated in response to biotic and abiotic stress conditions. SlSGT4 expression increases markedly in response to osmotic, salt, and cold stress, as well as upon treatment with abscisic

  10. Comparative transcriptome analysis reveals key genes potentially related to soluble sugar and organic acid accumulation in watermelon.

    Lei Gao

    Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.

  11. Comparative transcriptome analysis reveals key genes potentially related to soluble sugar and organic acid accumulation in watermelon.

    Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge


    Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.

  12. Comparative transcriptome analysis reveals key genes potentially related to soluble sugar and organic acid accumulation in watermelon

    Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling


    Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867

  13. Reproductive and developmental toxicology

    Gupta, Ramesh C


    .... With a special focus on placental toxicity, this book is the only available reference to connect the three key risk stages, and is the only resource to include reproductive and developmental toxicity in domestic animals, fish, and wildlife.

  14. Genomewide Analysis of Aryl Hydrocarbon Receptor Binding Targets Reveals an Extensive Array of Gene Clusters that Control Morphogenetic and Developmental Programs

    Sartor, Maureen A.; Schnekenburger, Michael; Marlowe, Jennifer L.; Reichard, John F.; Wang, Ying; Fan, Yunxia; Ma, Ci; Karyala, Saikumar; Halbleib, Danielle; Liu, Xiangdong; Medvedovic, Mario; Puga, Alvaro


    Background The vertebrate aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that regulates cellular responses to environmental polycyclic and halogenated compounds. The naive receptor is believed to reside in an inactive cytosolic complex that translocates to the nucleus and induces transcription of xenobiotic detoxification genes after activation by ligand. Objectives We conducted an integrative genomewide analysis of AHR gene targets in mouse hepatoma cells and determined whether AHR regulatory functions may take place in the absence of an exogenous ligand. Methods The network of AHR-binding targets in the mouse genome was mapped through a multipronged approach involving chromatin immunoprecipitation/chip and global gene expression signatures. The findings were integrated into a prior functional knowledge base from Gene Ontology, interaction networks, Kyoto Encyclopedia of Genes and Genomes pathways, sequence motif analysis, and literature molecular concepts. Results We found the naive receptor in unstimulated cells bound to an extensive array of gene clusters with functions in regulation of gene expression, differentiation, and pattern specification, connecting multiple morphogenetic and developmental programs. Activation by the ligand displaced the receptor from some of these targets toward sites in the promoters of xenobiotic metabolism genes. Conclusions The vertebrate AHR appears to possess unsuspected regulatory functions that may be potential targets of environmental injury. PMID:19654925

  15. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects.

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive developm...

  16. Genome-Wide Analysis of the Expression of WRKY Family Genes in Different Developmental Stages of Wild Strawberry (Fragaria vesca Fruit.

    Heying Zhou

    Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.

  17. Neonatal manipulation of oxytocin prevents lipopolysaccharide-induced decrease in gene expression of growth factors in two developmental stages of the female rat.

    Bakos, Jan; Lestanova, Zuzana; Strbak, Vladimir; Havranek, Tomas; Bacova, Zuzana


    Oxytocin production and secretion is important for early development of the brain. Long-term consequences of manipulation of oxytocin system might include changes in markers of brain plasticity - cytoskeletal proteins and neurotrophins. The aim of the present study was (1) to determine whether neonatal oxytocin administration affects gene expression of nestin, microtubule-associated protein-2 (MAP-2), brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) in the brain of two developmental stages of rat and (2) to evaluate whether neonatal oxytocin administration protects against lipopolysaccharide (LPS) induced inflammation. Neonatal oxytocin did not prevent a decrease of body weight in the LPS treated animals. Oxytocin significantly increased gene expression of BDNF in the right hippocampus in 21-day and 2-month old rats of both sexes. Gene expression of NGF and MAP-2 significantly increased in males treated with oxytocin. Both, growth factors and intermediate filament-nestin mRNA levels, were reduced in females exposed to LPS. Oxytocin treatment prevented a decrease in the gene expression of only growth factors. In conclusion, neonatal manipulation of oxytocin has developmental and sex-dependent effect on markers of brain plasticity. These results also indicate, that oxytocin may be protective against inflammation particularly in females. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  19. ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance

    Bouchabke-Coussa, O.; Quashie, M.L.; Seoane, Jose Miguel


    's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE), which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis......Background: Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying...... as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results: All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant...

  20. The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

    Qiu, Zhengkun; Wang, Xiaoxuan; Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen


    Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

  1. The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

    Zhengkun Qiu

    Full Text Available Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF gene, which corresponds to the ah (Hoffman's anthocyaninless locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

  2. The Tomato Hoffman’s Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures

    Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen


    Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses. PMID:26943362

  3. Large scale expression changes of genes related to neuronal signaling and developmental processes found in lateral septum of postpartum outbred mice.

    Brian E Eisinger

    Full Text Available Coordinated gene expression changes across the CNS are required to produce the mammalian maternal phenotype. Lateral septum (LS is a brain region critically involved with aspects of maternal care, and we recently examined gene expression of whole septum (LS and medial septum in selectively bred maternal mice. Here, we expand on the prior study by 1 conducting microarray analysis solely on LS in virgin and postpartum mice, 2 using outbred mice, and 3 evaluating the role of sensory input on gene expression changes. Large scale changes in genes related to neuronal signaling were identified, including four GABAA receptor subunits. Subunits α4 and δ were downregulated in maternal LS, likely reflecting a reduction in the extrasynaptic, neurosteroid-sensitive α4/δ containing receptor subtype. Conversely, subunits ε and θ were increased in maternal LS. Fifteen K+ channel related genes showed altered expression, as did dopamine receptors Drd1a and Drd2 (both downregulated, hypocretin receptor 1 (Hcrtr1, kappa opioid receptor 1 (Oprk1, and transient receptor potential channel 4 (Trpc4. Expression of a large number of genes linked to developmental processes or cell differentiation were also altered in postpartum LS, including chemokine (C-X-C motif ligand 12 (Cxcl12, fatty acid binding protein 7 (Fabp7, plasma membrane proteolipid (Pllp, and suppressor of cytokine signaling 2 (Socs2. Additional genes that are linked to anxiety, such as glutathione reductase (Gsr, exhibited altered expression. Pathway analysis also identified changes in genes related to cyclic nucleotide metabolism, chromatin structure, and the Ras gene family. The sensory presence of pups was found to contribute to the altered expression of a subset of genes across all categories. This study suggests that both large changes in neuronal signaling and the possible terminal differentiation of neuronal and/or glial cells play important roles in producing the maternal state.

  4. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  5. The Motivational Foundations of Prosocial Behavior from a Developmental Perspective--Evolutionary Roots and Key Psychological Mechanisms: Introduction to the Special Section

    Davidov, Maayan; Vaish, Amrisha; Knafo-Noam, Ariel; Hastings, Paul D.


    Prosocial behavior is versatile, multifaceted, and complex. This special section seeks to advance coherent, integrative understanding of prosocial development by addressing this topic through the prism of motivations. This conceptual Introduction presents key ideas that provide a framework for thinking about motivation for prosocial behavior and…

  6. Prochloraz and coumaphos induce different gene expression patterns in three developmental stages of the Carniolan honey bee (Apis mellifera carnica Pollmann).

    Cizelj, Ivanka; Glavan, Gordana; Božič, Janko; Oven, Irena; Mrak, Vesna; Narat, Mojca


    The Carniolan honey bee, Apis mellifera carnica, is a Slovenian autochthonous subspecies of honey bee. In recent years, the country has recorded an annual loss of bee colonies through mortality of up to 35%. One possible reason for such high mortality could be the exposure of honey bees to xenobiotic residues that have been found in honey bee and beehive products. Acaricides are applied by beekeepers to control varroosis, while the most abundant common agricultural chemicals found in honey bee and beehive products are fungicides, which may enter the system when applied to nearby flowering crops and fruit plants. Acaricides and fungicides are not intrinsically highly toxic to bees but their action in combination might lead to higher honey bee sensitivity or mortality. In the present study we investigated the molecular immune response of honey bee workers at different developmental stages (prepupa, white-eyed pupa, adult) exposed to the acaricide coumaphos and the fungicide prochloraz individually and in combination. Expression of 17 immune-related genes was examined by quantitative RT-PCR. In treated prepupae downregulation of most immune-related genes was observed in all treatments, while in adults upregulation of most of the genes was recorded. Our study shows for the first time that negative impacts of prochloraz and a combination of coumaphos and prochloraz differ among the different developmental stages of honey bees. The main effect of the xenobiotic combination was found to be upregulation of the antimicrobial peptide genes abaecin and defensin-1 in adult honey bees. Changes in immune-related gene expression could result in depressed immunity of honey bees and their increased susceptibility to various pathogens. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Key Inflammatory Processes in Human NASH Are Reflected in Ldlr-/-.Leiden Mice: A Translational Gene Profiling Study.

    Morrison, Martine C; Kleemann, Robert; van Koppen, Arianne; Hanemaaijer, Roeland; Verschuren, Lars


    Introduction: It is generally accepted that metabolic inflammation in the liver is an important driver of disease progression in NASH and associated matrix remodeling/fibrosis. However, the exact molecular inflammatory mechanisms are poorly defined in human studies. Investigation of key pathogenic mechanisms requires the use of pre-clinical models, for instance for time-resolved studies. Such models must reflect molecular disease processes of importance in patients. Herein we characterized inflammation in NASH patients on the molecular level by transcriptomics and investigated whether key human disease pathways can be recapitulated experimentally in Ldlr -/- .Leiden mice, an established pre-clinical model of NASH. Methods: Human molecular inflammatory processes were defined using a publicly available NASH gene expression profiling dataset (GSE48452) allowing the comparison of biopsy-confirmed NASH patients with normal controls. Gene profiling data from high-fat diet (HFD)-fed Ldlr -/- .Leiden mice (GSE109345) were used for assessment of the translational value of these mice. Results: In human NASH livers, we observed regulation of 65 canonical pathways of which the majority was involved in inflammation (32%), lipid metabolism (16%), and extracellular matrix/remodeling (12%). A similar distribution of pathways across these categories, inflammation (36%), lipid metabolism (24%) and extracellular matrix/remodeling (8%) was observed in HFD-fed Ldlr -/- .Leiden mice. Detailed evaluation of these pathways revealed that a substantial proportion (11 out of 13) of human NASH inflammatory pathways was recapitulated in Ldlr -/- .Leiden mice. Furthermore, the activation state of identified master regulators of inflammation (i.e., specific transcription factors, cytokines, and growth factors) in human NASH was largely reflected in Ldlr -/- .Leiden mice, further substantiating its translational value. Conclusion: Human NASH is characterized by upregulation of specific

  8. Key Inflammatory Processes in Human NASH Are Reflected in Ldlr−/−.Leiden Mice: A Translational Gene Profiling Study

    Morrison, Martine C.; Kleemann, Robert; van Koppen, Arianne; Hanemaaijer, Roeland; Verschuren, Lars


    Introduction: It is generally accepted that metabolic inflammation in the liver is an important driver of disease progression in NASH and associated matrix remodeling/fibrosis. However, the exact molecular inflammatory mechanisms are poorly defined in human studies. Investigation of key pathogenic mechanisms requires the use of pre-clinical models, for instance for time-resolved studies. Such models must reflect molecular disease processes of importance in patients. Herein we characterized inflammation in NASH patients on the molecular level by transcriptomics and investigated whether key human disease pathways can be recapitulated experimentally in Ldlr−/−.Leiden mice, an established pre-clinical model of NASH. Methods: Human molecular inflammatory processes were defined using a publicly available NASH gene expression profiling dataset (GSE48452) allowing the comparison of biopsy-confirmed NASH patients with normal controls. Gene profiling data from high-fat diet (HFD)-fed Ldlr−/−.Leiden mice (GSE109345) were used for assessment of the translational value of these mice. Results: In human NASH livers, we observed regulation of 65 canonical pathways of which the majority was involved in inflammation (32%), lipid metabolism (16%), and extracellular matrix/remodeling (12%). A similar distribution of pathways across these categories, inflammation (36%), lipid metabolism (24%) and extracellular matrix/remodeling (8%) was observed in HFD-fed Ldlr−/−.Leiden mice. Detailed evaluation of these pathways revealed that a substantial proportion (11 out of 13) of human NASH inflammatory pathways was recapitulated in Ldlr−/−.Leiden mice. Furthermore, the activation state of identified master regulators of inflammation (i.e., specific transcription factors, cytokines, and growth factors) in human NASH was largely reflected in Ldlr−/−.Leiden mice, further substantiating its translational value. Conclusion: Human NASH is characterized by upregulation of specific

  9. RNA-Seq reveals dynamic changes of gene expression in key stages of intestine regeneration in the sea cucumber Apostichopus japonicus. [corrected].

    Lina Sun

    Full Text Available BACKGROUND: Sea cucumbers (Holothuroidea; Echinodermata have the capacity to regenerate lost tissues and organs. Although the histological and cytological aspects of intestine regeneration have been extensively studied, little is known of the genetic mechanisms involved. There has, however, been a renewed effort to develop a database of Expressed Sequence Tags (ESTs in Apostichopus japonicus, an economically-important species that occurs in China. This is important for studies on genetic breeding, molecular markers and special physiological phenomena. We have also constructed a library of ESTs obtained from the regenerative body wall and intestine of A. japonicus. The database has increased to ~30000 ESTs. RESULTS: We used RNA-Seq to determine gene expression profiles associated with intestinal regeneration in A. japonicus at 3, 7, 14 and 21 days post evisceration (dpe. This was compared to profiles obtained from a normally-functioning intestine. Approximately 5 million (M reads were sequenced in every library. Over 2400 up-regulated genes (>10% and over 1000 down-regulated genes (~5% were observed at 3 and 7dpe (log2Ratio ≥ 1, FDR ≤ 0.001. Specific "Go terms" revealed that the DEGs (Differentially Expressed Genes performed an important function at every regeneration stage. Besides some expected pathways (for example, Ribosome and Spliceosome pathway term, the "Notch signaling pathway," the "ECM-receptor interaction" and the "Cytokine-cytokine receptor interaction" were significantly enriched. We also investigated the expression profiles of developmental genes, ECM-associated genes and Cytoskeletal genes. Twenty of the most important differentially expressed genes (DEGs were verified by Real-time PCR, which resulted in a trend concordance of almost 100% between the two techniques. CONCLUSION: Our studies demonstrated dynamic changes in global gene expression during intestine regeneration and presented a series of candidate genes and enriched

  10. Maternal undernutrition does not alter Sertoli cell numbers or the expression of key developmental markers in the mid-gestation ovine fetal testis

    Andrade Luis P


    Full Text Available Abstract Background The aim of this study was to determine the effects of maternal undernutrition on ovine fetal testis morphology and expression of relevant histological indicators. Maternal undernutrition, in sheep, has been reported, previously, to alter fetal ovary development, as indicated by delayed folliculogenesis and the altered expression of ovarian apoptosis-regulating gene products, at day 110 of gestation. It is not known whether or not maternal undernutrition alters the same gene products in the day 110 fetal testis. Design and methods Mature Scottish Blackface ewes were fed either 100% (Control; C or 50% (low; L of estimated metabolisable energy requirements of a pregnant ewe, from mating to day 110 of gestation. All pregnant ewes were euthanized at day 110 and a sub-set of male fetuses was randomly selected (6 C and 9 L for histology studies designed to address the effect of nutritional state on several indices of testis development. Sertoli cell numbers were measured using a stereological method and Ki67 (cell proliferation index, Bax (pro-apoptosis, Mcl-1 (anti-apoptosis, SCF and c-kit ligand (development and apoptosis gene expression was measured in Bouins-fixed fetal testis using immunohistochemistry. Results No significant differences were observed in numbers of Sertoli cells or testicular Ki67 positive cells. The latter were localised to the testicular cords and interstitium. Bax and Mcl-1 were localised specifically to the germ cells whereas c-kit was localised to both the cords and interstitium. SCF staining was very sparse. No treatment effects were observed for any of the markers examined. Conclusions These data suggest that, unlike in the fetal ovary, maternal undernutrition for the first 110 days of gestation affects neither the morphology of the fetal testis nor the expression of gene products which regulate apoptosis. It is postulated that the effects of fetal undernutrition on testis function may be expressed

  11. The Motivational Foundations of Prosocial Behavior From A Developmental Perspective-Evolutionary Roots and Key Psychological Mechanisms: Introduction to the Special Section.

    Davidov, Maayan; Vaish, Amrisha; Knafo-Noam, Ariel; Hastings, Paul D


    Prosocial behavior is versatile, multifaceted, and complex. This special section seeks to advance coherent, integrative understanding of prosocial development by addressing this topic through the prism of motivations. This conceptual Introduction presents key ideas that provide a framework for thinking about motivation for prosocial behavior and its development. It outlines the evolutionary roots of prosocial behavior, underscoring the interdependent roles of nature and nurture. This is followed by a discussion of several key psychological mechanisms reflecting different motivations for prosocial action (empathy for a distressed other, concern about another's goal, desire to act in accordance with internalized prosocial norms, and guilt). We discuss the critical components of each motivation and highlight pertinent contributions of the special section articles. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.

  12. A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood "resident" monocytes, and embryonic macrophages suggests common functions and developmental relationships.

    Pucci, Ferdinando; Venneri, Mary Anna; Biziato, Daniela; Nonis, Alessandro; Moi, Davide; Sica, Antonio; Di Serio, Clelia; Naldini, Luigi; De Palma, Michele


    We previously showed that Tie2-expressing monocytes (TEMs) have nonredundant proangiogenic activity in tumors. Here, we compared the gene expression profile of tumor-infiltrating TEMs with that of tumor-associated macrophages (TAMs), spleen-derived Gr1(+)Cd11b(+) neutrophils/myeloid-derived suppressor cells, circulating "inflammatory" and "resident" monocytes, and tumor-derived endothelial cells (ECs) by quantitative polymerase chain reaction-based gene arrays. TEMs sharply differed from ECs and Gr1(+)Cd11b(+) cells but were highly related to TAMs. Nevertheless, several genes were differentially expressed between TEMs and TAMs, highlighting a TEM signature consistent with enhanced proangiogenic/tissue-remodeling activity and lower proinflammatory activity. We validated these findings in models of oncogenesis and transgenic mice expressing a microRNA-regulated Tie2-GFP reporter. Remarkably, resident monocytes and TEMs on one hand, and inflammatory monocytes and TAMs on the other hand, expressed coordinated gene expression profiles, suggesting that the 2 blood monocyte subsets are committed to distinct extravascular fates in the tumor microenvironment. We further showed that a prominent proportion of embryonic/fetal macrophages, which participate in tissue morphogenesis, expressed distinguishing TEM genes. It is tempting to speculate that Tie2(+) embryonic/fetal macrophages, resident blood monocytes, and tumor-infiltrating TEMs represent distinct developmental stages of a TEM lineage committed to execute physiologic proangiogenic and tissue-remodeling programs, which can be co-opted by tumors.

  13. The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

    Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng


    Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Catherine Cukras

    Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  15. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha


    Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  16. Developmental fluoxetine exposure increases behavioral despair and alters epigenetic regulation of the hippocampal BDNF gene in adult female offspring.

    Boulle, Fabien; Pawluski, Jodi L; Homberg, Judith R; Machiels, Barbie; Kroeze, Yvet; Kumar, Neha; Steinbusch, Harry W M; Kenis, Gunter; van den Hove, Daniel L A


    A growing number of infants are exposed to selective serotonin reuptake inhibitor (SSRI) medications during the perinatal period. Perinatal exposure to SSRI medications alter neuroplasticity and increase depressive- and anxiety-related behaviors, particularly in male offspring as little work has been done in female offspring to date. The long-term effects of SSRI on development can also differ with previous exposure to prenatal stress, a model of maternal depression. Because of the limited work done on the role of developmental SSRI exposure on neurobehavioral outcomes in female offspring, the aim of the present study was to investigate how developmental fluoxetine exposure affects anxiety and depression-like behavior, as well as the regulation of hippocampal brain-derived neurotrophic factor (BDNF) signaling in the hippocampus of adult female offspring. To do this female Sprague-Dawley rat offspring were exposed to prenatal stress and fluoxetine via the dam, for a total of four groups of female offspring: 1) No Stress+Vehicle, 2) No Stress+Fluoxetine, 3) Prenatal Stress+Vehicle, and 4) Prenatal Stress+Fluoxetine. Primary results show that, in adult female offspring, developmental SSRI exposure significantly increases behavioral despair measures on the forced swim test, decreases hippocampal BDNF exon IV mRNA levels, and increases levels of the repressive histone 3 lysine 27 tri-methylated mark at the corresponding promoter. There was also a significant negative correlation between hippocampal BDNF exon IV mRNA levels and immobility in the forced swim test. No effects of prenatal stress or developmental fluoxetine exposure were seen on tests of anxiety-like behavior. This research provides important evidence for the long-term programming effects of early-life exposure to SSRIs on female offspring, particularily with regard to affect-related behaviors and their underlying molecular mechanisms. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Structural and functional studies of a family of Dictyostelium discoideum developmentally regulated, prestalk genes coding for small proteins

    Escalante Ricardo


    Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.

  18. Developmental exposure to PBDE 99 and PCB affects estrogen sensitivity of target genes in rat brain regions and female sexual behavior

    Lichtensteiger, W; Faass, O; Ceccatelli, R; Schlumpf, M [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology


    We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.

  19. Developmental exposure to PBDE 99 and PCB affects estrogen sensitivity of target genes in rat brain regions and female sexual behavior

    Lichtensteiger, W.; Faass, O.; Ceccatelli, R.; Schlumpf, M. [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology


    We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.

  20. Effect of the microenvironment and embryo density on developmental characteristics and gene expression profile of bovine preimplantative embryos cultured in vitro.

    Hoelker, Michael; Rings, Franka; Lund, Qamaruddin; Ghanem, Nasser; Phatsara, Chirawath; Griese, Josef; Schellander, Karl; Tesfaye, Dawit


    The Well of the Well (WOW) system has been developed to culture embryos in small groups or to track the development of single embryos. In the present study, we aimed to examine the effects of the microenvironment provided by the WOW system and embryo density on developmental rates, embryo quality and preimplantative gene expression profile of the resulting embryos. Embryos cultured in a group of 16 reached the blastocyst stage at a significantly lower level than zygotes cultured in a group of 50 (22.2 vs 30.3%), whereas zygotes cultured in WOW were able to compensate against low embryo densities, reaching a blastocyst rate as high as embryos cultured in a group of 50 (31.3 vs 30.3%). Moreover, embryos derived from WOW culture did not differ in terms of differential cell counts and apoptotic cell index compared with controls. The gene expression analysis revealed 62 transcripts to be upregulated and 33 transcripts to be downregulated by WOW culture. Comparing the in vivo derived blastocysts with the blastocysts derived from WOW culture, and group culture, expression of ATP5A1, PLAC8 and KRT8 was more similar to the embryos derived from WOW culture, whereas expression of S100A10 and ZP3 genes was more similar to blastocysts cultured in a group. In conclusion, microenvironment as well as embryo density significantly affected developmental rates. While subsequent blastocysts did not differ in terms of differential cell counts and apoptotic cell index, significant differences were observed in terms of the relative abundance of transcripts in the resulting embryos.

  1. Dual DNA methylation patterns in the CNS reveal developmentally poised chromatin and monoallelic expression of critical genes.

    Jinhui Wang

    Full Text Available As a first step towards discovery of genes expressed from only one allele in the CNS, we used a tiling array assay for DNA sequences that are both methylated and unmethylated (the MAUD assay. We analyzed regulatory regions of the entire mouse brain transcriptome, and found that approximately 10% of the genes assayed showed dual DNA methylation patterns. They include a large subset of genes that display marks of both active and silent, i.e., poised, chromatin during development, consistent with a link between differential DNA methylation and lineage-specific differentiation within the CNS. Sixty-five of the MAUD hits and 57 other genes whose function is of relevance to CNS development and/or disorders were tested for allele-specific expression in F(1 hybrid clonal neural stem cell (NSC lines. Eight MAUD hits and one additional gene showed such expression. They include Lgi1, which causes a subtype of inherited epilepsy that displays autosomal dominance with incomplete penetrance; Gfra2, a receptor for glial cell line-derived neurotrophic factor GDNF that has been linked to kindling epilepsy; Unc5a, a netrin-1 receptor important in neurodevelopment; and Cspg4, a membrane chondroitin sulfate proteoglycan associated with malignant melanoma and astrocytoma in human. Three of the genes, Camk2a, Kcnc4, and Unc5a, show preferential expression of the same allele in all clonal NSC lines tested. The other six genes show a stochastic pattern of monoallelic expression in some NSC lines and bi-allelic expression in others. These results support the estimate that 1-2% of genes expressed in the CNS may be subject to allelic exclusion, and demonstrate that the group includes genes implicated in major disorders of the CNS as well as neurodevelopment.

  2. Characterization of housekeeping genes in zebrafish: male-female differences and effects of tissue type, developmental stage and chemical treatment

    Callard Gloria V


    Full Text Available Abstract Background Research using the zebrafish model has experienced a rapid growth in recent years. Although real-time reverse transcription PCR (QPCR, normalized to an internal reference ("housekeeping" gene, is a frequently used method for quantifying gene expression changes in zebrafish, many commonly used housekeeping genes are known to vary with experimental conditions. To identify housekeeping genes that are stably expressed under different experimental conditions, and thus suitable as normalizers for QPCR in zebrafish, the present study evaluated the expression of eight commonly used housekeeping genes as a function of stage and hormone/toxicant exposure during development, and by tissue type and sex in adult fish. Results QPCR analysis was used to quantify mRNA levels of bactin1, tubulin alpha 1(tuba1, glyceraldehyde-3-phosphate dehydrogenase (gapdh, glucose-6-phosphate dehydrogenase (g6pd, TATA-box binding protein (tbp, beta-2-microglobulin (b2m, elongation factor 1 alpha (elfa, and 18s ribosomal RNA (18s during development (2 – 120 hr postfertilization, hpf; in different tissue types (brain, eye, liver, heart, muscle, gonads of adult males and females; and after treatment of embryos/larvae (24 – 96 hpf with commonly used vehicles for administration and agents that represent known environmental endocrine disruptors. All genes were found to have some degree of variability under the conditions tested here. Rank ordering of expression stability using geNorm analysis identified 18s, b2m, and elfa as most stable during development and across tissue types, while gapdh, tuba1, and tpb were the most variable. Following chemical treatment, tuba1, bactin1, and elfa were the most stably expressed whereas tbp, 18s, and b2m were the least stable. Data also revealed sex differences that are gene- and tissue-specific, and treatment effects that are gene-, vehicle- and ligand-specific. When the accuracy of QPCR analysis was tested using

  3. Developmental switching in Physarum polycephalum : Petri net analysis of single cell trajectories of gene expression indicates responsiveness and genetic plasticity of the Waddington quasipotential landscape

    Werthmann, Britta; Marwan, Wolfgang


    The developmental switch to sporulation in Physarum polycephalum is a phytochrome-mediated far-red light-induced cell fate decision that synchronously encompasses the entire multinucleate plasmodial cell and is associated with extensive reprogramming of the transcriptome. By repeatedly taking samples of single cells after delivery of a light stimulus pulse, we analysed differential gene expression in two mutant strains and in a heterokaryon of the two strains all of which display a different propensity for making the cell fate decision. Multidimensional scaling of the gene expression data revealed individually different single cell trajectories eventually leading to sporulation. Characterization of the trajectories as walks through states of gene expression discretized by hierarchical clustering allowed the reconstruction of Petri nets that model and predict the observed behavior. Structural analyses of the Petri nets indicated stimulus- and genotype-dependence of both, single cell trajectories and of the quasipotential landscape through which these trajectories are taken. The Petri net-based approach to the analysis and decomposition of complex cellular responses and of complex mutant phenotypes may provide a scaffold for the data-driven reconstruction of causal molecular mechanisms that shape the topology of the quasipotential landscape. (paper)

  4. Developmental switching in Physarum polycephalum: Petri net analysis of single cell trajectories of gene expression indicates responsiveness and genetic plasticity of the Waddington quasipotential landscape

    Werthmann, Britta; Marwan, Wolfgang


    The developmental switch to sporulation in Physarum polycephalum is a phytochrome-mediated far-red light-induced cell fate decision that synchronously encompasses the entire multinucleate plasmodial cell and is associated with extensive reprogramming of the transcriptome. By repeatedly taking samples of single cells after delivery of a light stimulus pulse, we analysed differential gene expression in two mutant strains and in a heterokaryon of the two strains all of which display a different propensity for making the cell fate decision. Multidimensional scaling of the gene expression data revealed individually different single cell trajectories eventually leading to sporulation. Characterization of the trajectories as walks through states of gene expression discretized by hierarchical clustering allowed the reconstruction of Petri nets that model and predict the observed behavior. Structural analyses of the Petri nets indicated stimulus- and genotype-dependence of both, single cell trajectories and of the quasipotential landscape through which these trajectories are taken. The Petri net-based approach to the analysis and decomposition of complex cellular responses and of complex mutant phenotypes may provide a scaffold for the data-driven reconstruction of causal molecular mechanisms that shape the topology of the quasipotential landscape.

  5. The regulation of alfalfa saponin extract on key genes involved in hepatic cholesterol metabolism in hyperlipidemic rats.

    Yinghua Shi

    Full Text Available To investigate the cholesterol-lowering effects of alfalfa saponin extract (ASE and its regulation mechanism on some key genes involved in cholesterol metabolism, 40 healthy 7 weeks old male Sprague Dawley (SD rats were randomly divided into four groups with 10 rats in each group: control group, hyperlipidemic group, ASE treatment group, ASE prevention group. The body weight gain, relative liver weight and serum lipid 1evels of rats were determined. Total cholesterol (TC and total bile acids (TBA levels in liver and feces were also measured. Furthermore, the activity and mRNA expressions of Hmgcr, Acat2, Cyp7a1 and Ldlr were investigated. The results showed the following: (1 The abnormal serum lipid levels in hyperlipidemic rats were ameliorated by ASE administration (both ASE prevention group and treatment group (P<0.05. (2 Both ASE administration to hyperlipidemic rats significantly reduced liver TC and increased liver TBA level (P<0.05. TC and TBA levels in feces of hyperlipidemic rats were remarkably elevated by both ASE administration (P<0.05. (3 mRNA expressions of Hmgcr and Acat2 in the liver of hyperlipidemic rats were remarkably down-regulated (P<0.05, as well as mRNA expressions of Cyp7a1 and Ldlr were dramatically up-regulated by both ASE administration (P<0.05. The activities of these enzymes also paralleled the observed changes in mRNA levels. (4 There was no significant difference between ASE treatment and ASE prevention group for most parameters evaluated. Our present study indicated that ASE had cholesterol-lowering effects. The possible mechanism could be attributed to (1 the down-regulation of Hmgcr and Acat2, as well as up-regulation of Cyp7a1 and Ldlr in the liver of hyperlipidemic rats, which was involved in cholesterol biosynthesis, uptake, and efflux pathway; (2 the increase in excretion of cholesterol. The findings in our study suggested ASE had great potential usefulness as a natural agent for treating hyperlipidemia.

  6. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Capra Valeria


    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  7. Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

    Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L


    The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

  8. A novel lens epithelium gene, LEP503, is highly conserved in different vertebrate species and is developmentally regulated in postnatal rat lens.

    Wen, Y; Sachs, G; Athmann, C


    The development of the lens is dependent on the proliferation of lens epithelial cells and their differentiation into fiber cells near the lens bow/equator. Identification of genes specifically expressed in the lens epithelial cells and their functions may provide insight into molecular events that regulate the processes of lens epithelial cell differentiation. In this study, a novel lens epithelium gene product, LEP503, identified from rat by a subtractive cDNA cloning strategy was investigated in the genome organization, mRNA expression and protein localization. The genomic sequences for LEP503 isolated from rat, mouse and human span 1754 bp, 1694 bp and 1895 bp regions encompassing the 5'-flanking region, two exons, one intron and 3'-flanking region. All exon-intron junction sequences conform to the GT/AG rule. Both mouse and human LEP503 genes show very high identity (93% for mouse and 79% for human) to rat LEP503 gene in the exon 1 that contains an open reading frame coding for a protein of 61 amino acid residues with a leucine-rich domain. The deduced protein sequences also show high identity (91% between mouse and rat and 77% between human and rat). Western blot shows that LEP503 is present as a specific approximately 6.9 kDa band in the water-insoluble-urea-soluble fraction of lens cortex where lens epithelium is included. Immuno-staining shows that LEP503 is localized in the epithelial cells along the entire anterior surface of rat lens. Developmentally, LEP503 is expressed at a low level at newborn, and then the expression level increases by about ten-fold around postnatal day 14 and remains at this high level for about 25 days before it drops back to the low level by postnatal day 84. These data suggest that the LEP503 may be an important lens epithelial cell gene involving the processes of epithelial cell differentiation. Copyright 2000 Academic Press.

  9. Identification of a key recombinant which assigns the incomplete congenital stationary night blindness gene proximal to MAOB

    Bergen, A. A.; Kestelyn, P.; Leys, M.; Meire, F.


    The gene for complete congenital stationary night blindness (CSNB1) has been assigned to the Xp11.3 region. However, little evidence has been provided for the assignment of the incomplete congenital stationary night blindness gene (CSNB2). Here we present the clinical and molecular data from a CSNB2

  10. Developmental regulation of ecdysone receptor (EcR and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera.

    Tathyana Rachel Palo Mello


    Full Text Available Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH, control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1. EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g. miR-133 and miR-375, as well honeybee-specific ones (e.g. miR-3745 and miR-3761. Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect.

  11. A retinoblastoma orthologue is a major regulator of S-phase, mitotic, and developmental gene expression in Dictyostelium.

    Kimchi Strasser

    Full Text Available The retinoblastoma tumour suppressor, Rb, has two major functions. First, it represses genes whose products are required for S-phase entry and progression thus stabilizing cells in G1. Second, Rb interacts with factors that induce cell-cycle exit and terminal differentiation. Dictyostelium lacks a G1 phase in its cell cycle but it has a retinoblastoma orthologue, rblA.Using microarray analysis and mRNA-Seq transcriptional profiling, we show that RblA strongly represses genes whose products are involved in S phase and mitosis. Both S-phase and mitotic genes are upregulated at a single point in late G2 and again in mid-development, near the time when cell cycling is reactivated. RblA also activates a set of genes unique to slime moulds that function in terminal differentiation.Like its mammalian counterpart Dictyostelium, RblA plays a dual role, regulating cell-cycle progression and transcriptional events leading to terminal differentiation. In the absence of a G1 phase, however, RblA functions in late G2 controlling the expression of both S-phase and mitotic genes.

  12. Identification of Transcriptional Modules and Key Genes in Chickens Infected with Salmonella enterica Serovar Pullorum Using Integrated Coexpression Analyses

    Bao-Hong Liu


    Full Text Available Salmonella enterica Pullorum is one of the leading causes of mortality in poultry. Understanding the molecular response in chickens in response to the infection by S. enterica is important in revealing the mechanisms of pathogenesis and disease progress. There have been studies on identifying genes associated with Salmonella infection by differential expression analysis, but the relationships among regulated genes have not been investigated. In this study, we employed weighted gene coexpression network analysis (WGCNA and differential coexpression analysis (DCEA to identify coexpression modules by exploring microarray data derived from chicken splenic tissues in response to the S. enterica infection. A total of 19 modules from 13,538 genes were associated with the Jak-STAT signaling pathway, the extracellular matrix, cytoskeleton organization, the regulation of the actin cytoskeleton, G-protein coupled receptor activity, Toll-like receptor signaling pathways, and immune system processes; among them, 14 differentially coexpressed modules (DCMs and 2,856 differentially coexpressed genes (DCGs were identified. The global expression of module genes between infected and uninfected chickens showed slight differences but considerable changes for global coexpression. Furthermore, DCGs were consistently linked to the hubs of the modules. These results will help prioritize candidate genes for future studies of Salmonella infection.

  13. The olive DGAT2 gene is developmentally regulated and shares overlapping but distinct expression patterns with DGAT1

    Banilas, Georgios; Karampelias, Michael; Makariti, Ifigenia; Kourti, Anna; Hatzopoulos, Polydefkis


    Diacylglycerol acyltransferases (DGATs) catalyse the final step of the triacylglycerol (TAG) biosynthesis of the Kennedy pathway. Two major gene families have been shown to encode DGATs, DGAT1 (type-1) and DGAT2 (type-2). Both genes encode membrane-bound proteins, with no sequence homology to each other. In this study, the molecular cloning and characterization of a type-2 DGAT cDNA from olive is presented. Southern blot analysis showed that OeDGAT2 is represented by a single copy in the oliv...

  14. Study on the Correlation between Gene Expression and Enzyme Activity of Seven Key Enzymes and Ginsenoside Content in Ginseng in Over Time in Ji'an, China.

    Yin, Juxin; Zhang, Daihui; Zhuang, Jianjian; Huang, Yi; Mu, Ying; Lv, Shaowu


    Panax ginseng is a traditional medicine. Fresh ginseng is one of the most important industries related to ginseng development, and fresh ginseng of varying ages has different medicinal properties. Previous research has not systematically reported the correlation between changes in key enzyme activity with changes in ginsenoside content in fresh ginseng over time. In this study, for the first time, we use ginseng samples of varying ages in Ji'an and systematically reported the changes in the activity of seven key enzymes (HMGR, FPS, SS, SE, DS, CYP450, and GT). We investigated the content of ginsenoside and gene expression of these key enzymes. Ginsenoside content was measured using HPLC. HPLC, GC-MS, and LC-MS were combined to measure the enzyme activity of the key enzymes. Quantitative PCR was used in the investigation of gene expression. By analyzing the correlation between the enzyme activity and the transcription level of the key enzymes with ginsenoside content, we found that DS and GT enzyme activities are significantly correlated with the ginsenoside content in different ages of ginseng. Our findings might provide a new strategy to discriminate between ginseng of different years. Meanwhile, this research provides important information for the in-depth study of ginsenoside biosynthesis.

  15. Deletion of exon 20 of the Familial Dysautonomia gene Ikbkap in mice causes developmental delay, cardiovascular defects, and early embryonic lethality.

    Paula Dietrich

    Full Text Available Familial Dysautonomia (FD is an autosomal recessive disorder that affects 1/3,600 live births in the Ashkenazi Jewish population, and leads to death before the age of 40. The disease is characterized by abnormal development and progressive degeneration of the sensory and autonomic nervous system. A single base pair substitution in intron 20 of the Ikbkap gene accounts for 98% of FD cases, and results in the expression of low levels of the full-length mRNA with simultaneous expression of an aberrantly spliced mRNA in which exon 20 is missing. To date, there is no animal model for the disease, and the essential cellular functions of IKAP--the protein encoded by Ikbkap--remain unknown. To better understand the normal function of IKAP and in an effort to generate a mouse model for FD, we have targeted the mouse Ikbkap gene by homologous recombination. We created two distinct alleles that result in either loss of Ikbkap expression, or expression of an mRNA lacking only exon 20. Homozygosity for either mutation leads to developmental delay, cardiovascular and brain malformations, accompanied with early embryonic lethality. Our analyses indicate that IKAP is essential for expression of specific genes involved in cardiac morphogenesis, and that cardiac failure is the likely cause of abnormal vascular development and embryonic lethality. Our results also indicate that deletion of exon 20 abolishes gene function. This implies that the truncated IKAP protein expressed in FD patients does not retain any significant biological function.

  16. Characterization of a chickpea (Cicer arietinum L.) NAC family gene, CarNAC5, which is both developmentally- and stress-regulated.

    Peng, Hui; Cheng, Hui-Ying; Yu, Xin-Wang; Shi, Qing-Hua; Zhang, Hua; Li, Jian-Gui; Ma, Hao


    It has been documented that the plant-specific NAC (for NAM, ATAF1,2 and CUC2) transcription factors play an important role in plant development and stress responses. In this study, a chickpea NAC gene CarNAC5 (for Cicer arietinum L. NAC gene 5) was isolated from a cDNA library from chickpea leaves treated by polyethylene glycol (PEG). CarNAC5, as a single/low copy gene, contained three exons and two introns within genomic DNA sequence and encoded a polypeptide with 291 amino acids. CarNAC5 protein had a conserved NAC domain in the N-terminus and showed high similarity to other NACs, especially ATAF subgroup members. The CarNAC5:GFP fusion protein was localized in the nucleus of onion epidermal cells. Furthermore, CarNAC5 protein activated the reporter genes LacZ and HIS3 in yeast. The transactivation activity was mapped to the C-terminal region. The transcripts of CarNAC5 appeared in many chickpea tissues including seedling leaves, stems, roots, flowers, seeds and pods, but mostly accumulated in flowers. Meanwhile, CarNAC5 was strongly expressed during seed maturation and in embryos of the early germinating seeds. It was also significantly induced by drought, heat, wounding, salicylic acid (SA), and indole-3-acetic acid (IAA) treatments. Our results suggest that CarNAC5 encodes a novel NAC-domain protein and acts as a transcriptional activator involved in plant developmental regulation and various stress responses.

  17. Distribution and relative quantification of key genes involved in fixed nitrogen loss from the Arabian Sea oxygen minimum zone

    Jayakumar, A.; Naqvi, S.W.A.; Ward, B.B.

    diversity than the very high diversities reported from estuarine and sedimentary environments. 16S rRNA partial gene sequences revealed very limited diversity among anammox sequences. All the anammox sequences were greater than or equal to 98% identical...

  18. Transcription of Key Genes Regulating Gonadal Steroidogenesis in Control and Ketoconazole- or Vinclozolin-exposed Fathead Minnows

    This paper provides the first report on the effects of two endocrine-active fungicides, ketoconazole and vinclozolin, on the expression of steroidogenesis-related genes in the testis of male fathead minnows.

  19. Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium

    Pelch, Katherine E.; Tokar, Erik J. [National Toxicology Program Laboratory, Division of the National Toxicology Program, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States); Merrick, B. Alex [Molecular Toxicology and Informatics Group, Biomolecular Screening Branch, Division of the National Toxicology Program, National Institute of Environmental Health Sciences, Morrisville, NC 27560 (United States); Waalkes, Michael P., E-mail: [National Toxicology Program Laboratory, Division of the National Toxicology Program, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States)


    Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular

  20. Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium

    Pelch, Katherine E.; Tokar, Erik J.; Merrick, B. Alex; Waalkes, Michael P.


    Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular

  1. Altered cellular redox status, sirtuin abundance and clock gene expression in a mouse model of developmentally primed NASH.

    Bruce, Kimberley D; Szczepankiewicz, Dawid; Sihota, Kiran K; Ravindraanandan, Manoj; Thomas, Hugh; Lillycrop, Karen A; Burdge, Graham C; Hanson, Mark A; Byrne, Christopher D; Cagampang, Felino R


    We have previously shown that high fat (HF) feeding during pregnancy primes the development of non-alcoholic steatohepatits (NASH) in the adult offspring. However, the underlying mechanisms are unclear. Since the endogenous molecular clock can regulate hepatic lipid metabolism, we investigated whether exposure to a HF diet during development could alter hepatic clock gene expression and contribute to NASH onset in later life. Female mice were fed either a control (C, 7%kcal fat) or HF (45%kcal fat) diet. Offspring were fed either a C or HF diet resulting in four offspring groups: C/C, C/HF, HF/C and HF/HF. NAFLD progression, cellular redox status, sirtuin expression (Sirt1, Sirt3), and the expression of core clock genes (Clock, Bmal1, Per2, Cry2) and clock-controlled genes involved in lipid metabolism (Rev-Erbα, Rev-Erbβ, RORα, and Srebp1c) were measured in offspring livers. Offspring fed a HF diet developed NAFLD. However HF fed offspring of mothers fed a HF diet developed NASH, coupled with significantly reduced NAD(+)/NADH (pNASH in adulthood, involving altered cellular redox status, reduced sirtuin abundance, and desynchronized clock gene expression. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Developmental transcriptome of Aplysia californica'

    Heyland, Andreas; Vue, Zer; Voolstra, Christian R.; Medina, Mó nica; Moroz, Leonid L.


    developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms

  3. Developmentally-Regulated Excision of the SPβ Prophage Reconstitutes a Gene Required for Spore Envelope Maturation in Bacillus subtilis

    Abe, Kimihiro; Kawano, Yuta; Iwamoto, Keito; Arai, Kenji; Maruyama, Yuki; Eichenberger, Patrick; Sato, Tsutomu


    Temperate phages infect bacteria by injecting their DNA into bacterial cells, where it becomes incorporated into the host genome as a prophage. In the genome of Bacillus subtilis 168, an active prophage, SPβ, is inserted into a polysaccharide synthesis gene, spsM. Here, we show that a rearrangement occurs during sporulation to reconstitute a functional composite spsM gene by precise excision of SPβ from the chromosome. SPβ excision requires a putative site-specific recombinase, SprA, and an accessory protein, SprB. A minimized SPβ, where all the SPβ genes were deleted, except sprA and sprB, retained the SPβ excision activity during sporulation, demonstrating that sprA and sprB are necessary and sufficient for the excision. While expression of sprA was observed during vegetative growth, sprB was induced during sporulation and upon mitomycin C treatment, which triggers the phage lytic cycle. We also demonstrated that overexpression of sprB (but not of sprA) resulted in SPβ prophage excision without triggering the lytic cycle. These results suggest that sprB is the factor that controls the timing of phage excision. Furthermore, we provide evidence that spsM is essential for the addition of polysaccharides to the spore envelope. The presence of polysaccharides on the spore surface renders the spore hydrophilic in water. This property may be beneficial in allowing spores to disperse in natural environments via water flow. A similar rearrangement occurs in Bacillus amyloliquefaciens FZB42, where a SPβ-like element is excised during sporulation to reconstitute a polysaccharide synthesis gene, suggesting that this type of gene rearrangement is common in spore-forming bacteria because it can be spread by phage infection. PMID:25299644

  4. Sexually dimorphic gene regulation in brain as a target for endocrine disrupters: Developmental exposure of rats to 4-methylbenzylidene camphor

    Maerkel, Kirsten; Durrer, Stefan; Henseler, Manuel; Schlumpf, Margret; Lichtensteiger, Walter


    The developing neuroendocrine brain represents a potential target for endocrine active chemicals. The UV filter 4-methylbenzylidene camphor (4-MBC) exhibits estrogenic activity, but also interferes with the thyroid axis. We investigated effects of pre- and postnatal exposure to 4-MBC in the same rat offspring at brain and reproductive organ levels. 4-MBC (7, 24, 47 mg/kg/day) was administered in chow to the parent generation before mating, during gestation and lactation, and to the offspring until adulthood. mRNA of estrogen target genes involved in control of sexual behavior and gonadal functions was measured by real-time RT-PCR in ventromedial hypothalamic nucleus (VMH) and medial preoptic area (MPO) of adult offspring. 4-MBC exposure affected mRNA levels of ER alpha, progesterone receptor (PR), preproenkephalin (PPE) and insulin-like growth factor-I (IGF-I) in a sex- and region-specific manner. In order to assess possible changes in sensitivity of target genes to estrogens, offspring were gonadectomized on day 70, injected with estradiol (E2, 10 or 50 μg/kg s.c.) or vehicle on day 84, and sacrificed 6 h later. The acute induction of PR mRNA, and repression (at 6 h) of PPE mRNA by E2 was enhanced by 4-MBC in male and female VMH and female MPO, whereas male MPO exhibited reduced responsiveness of both genes. Steroid receptor coactivator SRC-1 mRNA levels were increased in female VMH and MPO. The data indicate profound sex- and region-specific alterations in the regulation of estrogen target genes at brain level. Effect patterns in baseline and E2-induced gene expression differ from those in uterus and prostate

  5. Developmental role of phenylalanine-ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) genes during adventitious rooting of Juglans regia L. microshoots.

    Cheniany, Monireh; Ganjeali, Ali


    Phenylalanine-ammonia-lyase and cinnamate-4-hydroxylase play important role in the phenylpropanoid pathway, which produces many biologically important secondary metabolites participating in normal plant development. Flavonol quercetin is the main representant of these compounds that has been identified in numerous Juglans spp. In this survey, the developmental expression patterns of PAL and C4H genes during in vitro rooting of two walnut cultivars 'Sunland' and 'Howard' was examined by RT-PCR. To understand the potential role in rooting, the changing pattern of endogenous content of quercetin was also analyzed by HPLC. The 'Sunland' with better capacity to root had more quercetin content during the "inductive phase" of rooting than 'Howard'. In each cultivar, the level of PAL transcripts showed the same behavior with the changing patterns of quercetin during root formation of microshoots. The positive correlation between the changes of quercetin and PAL-mRNA indicated that PAL gene may have an immediate effect on flavonoid pathway metabolites including quercetin. Although the behavioral change of C4H expression was similar in both cultivars during root formation (with significantly more level for 'Howard'), it was not coincide with the changes of quercerin concentrations. Our results showed that C4H function is important for the normal development, but its transcriptional regulation does not correlate with quercetin as an efficient phenolic compound for walnut rhizogenesis.

  6. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    Julkowska, Magdalena


    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  7. Genome-wide expression profiling analysis to identify key genes in the anti-HIV mechanism of CD4+ and CD8+ T cells.

    Gao, Lijie; Wang, Yunqi; Li, Yi; Dong, Ya; Yang, Aimin; Zhang, Jie; Li, Fengying; Zhang, Rongqiang


    Comprehensive bioinformatics analyses were performed to explore the key biomarkers in response to HIV infection of CD4 + and CD8 + T cells. The numbers of CD4 + and CD8 + T cells of HIV infected individuals were analyzed and the GEO database (GSE6740) was screened for differentially expressed genes (DEGs) in HIV infected CD4 + and CD8 + T cells. Gene Ontology enrichment, KEGG pathway analyses, and protein-protein interaction (PPI) network were performed to identify the key pathway and core proteins in anti-HIV virus process of CD4 + and CD8 + T cells. Finally, we analyzed the expressions of key proteins in HIV-infected T cells (GSE6740 dataset) and peripheral blood mononuclear cells(PBMCs) (GSE511 dataset). 1) CD4 + T cells counts and ratio of CD4 + /CD8 + T cells decreased while CD8 + T cells counts increased in HIV positive individuals; 2) 517 DEGs were found in HIV infected CD4 + and CD8 + T cells at acute and chronic stage with the criterial of P-value T cells. The main biological processes of the DEGs were response to virus and defense response to virus. At chronic stage, ISG15 protein, in conjunction with IFN-1 pathway might play key roles in anti-HIV responses of CD4 + T cells; and 4) The expression of ISG15 increased in both T cells and PBMCs after HIV infection. Gene expression profile of CD4 + and CD8 + T cells changed significantly in HIV infection, in which ISG15 gene may play a central role in activating the natural antiviral process of immune cells. © 2018 Wiley Periodicals, Inc.

  8. Identification of a Key Gene Involved in Branched-Chain Short Fatty Acids Formation in Natto by Transcriptional Analysis and Enzymatic Characterization in Bacillus subtilis.

    Hong, Chenlu; Chen, Yangyang; Li, Lu; Chen, Shouwen; Wei, Xuetuan


    Natto as a fermented soybean product has many health benefits for human due to its rich nutritional and functional components. However, the unpleasant odor of natto, caused by the formation of branched-chain short fatty acids (BCFAs), prohibits the wide acceptance of natto products. This work is to identify the key gene of BCFAs formation and develop the guidance to reduce natto odor. Transcriptional analysis of BCFAs synthesis pathway genes was conducted in two Bacillus subtilis strains with obvious different BCFAs synthesis abilities. The transcriptional levels of bcd, bkdAA, and ptb in B. subtilis H-9 were 2.7-fold, 0.7-fold, and 8.9-fold higher than that of B. subtilis H-4, respectively. Therefore, the ptb gene with the highest transcriptional change was considered as the key gene in BCFAs synthesis. The ptb encoded enzyme Ptb was further characterized by inducible expression in Escherichia coli. The recombinant Ptb protein (about 32 kDa) was verified by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis analysis. The catalysis functions of Ptb were confirmed on substrates of isovaleryl-CoA and isobutyryl-CoA, and the higher catalysis efficiency of Ptb on isovaleryl-CoA explained the higher level of isovaleric acid in natto. The optimal activities of Ptb were observed at 50 °C and pH 8.0, and the enzymatic activity was inhibited by Ca 2+ , Zn 2+ , Ba 2+ , Mn 2+ , Cu 2+ , SDS, and EDTA. Collectively, this study reports a key gene responsible for BCFAs formation in natto fermentation and provides potential strategies to solve the odor problem.

  9. Interconnection of Key Microbial Functional Genes for Enhanced Benzo[a]pyrene Biodegradation in Sediments by Microbial Electrochemistry.

    Yan, Zaisheng; He, Yuhong; Cai, Haiyuan; Van Nostrand, Joy D; He, Zhili; Zhou, Jizhong; Krumholz, Lee R; Jiang, He-Long


    Sediment microbial fuel cells (SMFCs) can stimulate the degradation of polycyclic aromatic hydrocarbons in sediments, but the mechanism of this process is poorly understood at the microbial functional gene level. Here, the use of SMFC resulted in 92% benzo[a]pyrene (BaP) removal over 970 days relative to 54% in the controls. Sediment functions, microbial community structure, and network interactions were dramatically altered by the SMFC employment. Functional gene analysis showed that c-type cytochrome genes for electron transfer, aromatic degradation genes, and extracellular ligninolytic enzymes involved in lignin degradation were significantly enriched in bulk sediments during SMFC operation. Correspondingly, chemical analysis of the system showed that these genetic changes resulted in increases in the levels of easily oxidizable organic carbon and humic acids which may have resulted in increased BaP bioavailability and increased degradation rates. Tracking microbial functional genes and corresponding organic matter responses should aid mechanistic understanding of BaP enhanced biodegradation by microbial electrochemistry and development of sustainable bioremediation strategies.

  10. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.


    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  11. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L


    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  12. Temporal network based analysis of cell specific vein graft transcriptome defines key pathways and hub genes in implantation injury.

    Manoj Bhasin

    Full Text Available Vein graft failure occurs between 1 and 6 months after implantation due to obstructive intimal hyperplasia, related in part to implantation injury. The cell-specific and temporal response of the transcriptome to vein graft implantation injury was determined by transcriptional profiling of laser capture microdissected endothelial cells (EC and medial smooth muscle cells (SMC from canine vein grafts, 2 hours (H to 30 days (D following surgery. Our results demonstrate a robust genomic response beginning at 2 H, peaking at 12-24 H, declining by 7 D, and resolving by 30 D. Gene ontology and pathway analyses of differentially expressed genes indicated that implantation injury affects inflammatory and immune responses, apoptosis, mitosis, and extracellular matrix reorganization in both cell types. Through backpropagation an integrated network was built, starting with genes differentially expressed at 30 D, followed by adding upstream interactive genes from each prior time-point. This identified significant enrichment of IL-6, IL-8, NF-κB, dendritic cell maturation, glucocorticoid receptor, and Triggering Receptor Expressed on Myeloid Cells (TREM-1 signaling, as well as PPARα activation pathways in graft EC and SMC. Interactive network-based analyses identified IL-6, IL-8, IL-1α, and Insulin Receptor (INSR as focus hub genes within these pathways. Real-time PCR was used for the validation of two of these genes: IL-6 and IL-8, in addition to Collagen 11A1 (COL11A1, a cornerstone of the backpropagation. In conclusion, these results establish causality relationships clarifying the pathogenesis of vein graft implantation injury, and identifying novel targets for its prevention.

  13. Transcription of key genes regulating gonadal steroidogenesis in control and ketoconazole- or vinclozolin-exposed fathead minnows

    Villeneuve, Daniel L.; Blake, Lindsey S.; Brodin, Jeffrey; Greene, Katie J.; Knoebl, Iris; Miracle, Ann L.; Martinovic, Dalma; Ankley, Gerald T.


    This study evaluated changes in the expression of steroidogenesis-related genes in male fathead minnows exposed to ketoconazole (KTC) or vinclozolin (VZ) for 21 days. The aim was to evaluate links between molecular changes and higher level outcomes after exposure to endocrine-active chemicals (EACs) with different modes of action. To aid our analysis and interpretation of EAC-related effects, we first examined variation in the relative abundance of steroidogenesis-related gene transcripts in the gonads of male and female fathead minnows as a function of age, gonad development, and spawning status, independent of EAC exposure. Gonadal expression of several genes varied with age and/or gonadal somatic index in either males or females. However, with the exception of aromatase, steroidogenesis-related gene expression did not vary with spawning status. Following the baseline experiments, expression of the selected genes in male fathead minnows exposed to KTC or VZ was evaluated in the context of effects observed at higher levels of organization. Exposure to KTC elicited changes in gene transcription that were consistent with an apparent compensatory response to the chemical's anticipated direct inhibition of steroidogenic enzyme activity. Exposure to VZ, an antiandrogen expected to indirectly impact steroidogenesis, increased pituitary expression of follicle-stimulating hormone beta-subunit as well as testis expression of 20beta-hydroxysteroid dehydrogenase and luteinizing hormone receptor transcripts. Results of this study contribute to ongoing research aimed at understanding responses of the teleost hypothalamic-pituitary-gonadal axis to different types of EACs and how changes in molecular endpoints translate into apical outcomes reflective of either adverse effect or compensation.

  14. Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium.

    Pelch, Katherine E; Tokar, Erik J; Merrick, B Alex; Waalkes, Michael P


    Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10μM Cd for 11weeks (CTPE) or 5μM iAs for 29weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (>25-fold) and S100P (>40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (>15-fold) and NTM (>1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. Published by Elsevier Inc.

  15. Homocysteine and the C677T Gene Polymorphism of Its Key Metabolic Enzyme MTHFR Are Risk Factors of Early Renal Damage in Hypertension in a Chinese Han Population.

    Yun, Lin; Xu, Rui; Li, Guohua; Yao, Yucai; Li, Jiamin; Cong, Dehong; Xu, Xingshun; Zhang, Lihua


    The combined hyperhomocysteinemia condition is a feature of the Chinese hypertensive population. This study used the case-control method to investigate the association between plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme, 5, 10-methylenetetrahydrofolate reductase (MTHFR), and early renal damage in a hypertensive Chinese Han population.A total of 379 adult essential hypertensive patients were selected as the study subjects. The personal information, clinical indicators, and the C677T gene polymorphism of MTHFR were texted. This study used the urine microalbumin/urine creatinine ratio (UACR) as a grouping basis: the hypertension without renal damage group (NRD group) and the hypertension combined with early renal damage group (ERD group).Early renal damage in the Chinese hypertensive population was associated with body weight, systolic pressure, diastolic pressure, urea nitrogen, serum creatinine, cystatin C, uric acid, aldosterone, and glomerular filtration rate. The homocysteine level and the UACR in the TT genotype group were higher than those in the CC genotype group. The binary logistic regression analysis results showed that after sex and age were adjusted, the MTHFR C677T gene polymorphism was correlated with early renal damage in hypertension in both the recessive model and in the additive model.Plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme MTHFR might be independent risk factors of early renal damage in the hypertensive Chinese Han population.

  16. One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

    Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas


    Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

  17. Bi-directional gene set enrichment and canonical correlation analysis identify key diet-sensitive pathways and biomarkers of metabolic syndrome

    Gaora Peadar Ó


    Full Text Available Abstract Background Currently, a number of bioinformatics methods are available to generate appropriate lists of genes from a microarray experiment. While these lists represent an accurate primary analysis of the data, fewer options exist to contextualise those lists. The development and validation of such methods is crucial to the wider application of microarray technology in the clinical setting. Two key challenges in clinical bioinformatics involve appropriate statistical modelling of dynamic transcriptomic changes, and extraction of clinically relevant meaning from very large datasets. Results Here, we apply an approach to gene set enrichment analysis that allows for detection of bi-directional enrichment within a gene set. Furthermore, we apply canonical correlation analysis and Fisher's exact test, using plasma marker data with known clinical relevance to aid identification of the most important gene and pathway changes in our transcriptomic dataset. After a 28-day dietary intervention with high-CLA beef, a range of plasma markers indicated a marked improvement in the metabolic health of genetically obese mice. Tissue transcriptomic profiles indicated that the effects were most dramatic in liver (1270 genes significantly changed; p Conclusion Bi-directional gene set enrichment analysis more accurately reflects dynamic regulatory behaviour in biochemical pathways, and as such highlighted biologically relevant changes that were not detected using a traditional approach. In such cases where transcriptomic response to treatment is exceptionally large, canonical correlation analysis in conjunction with Fisher's exact test highlights the subset of pathways showing strongest correlation with the clinical markers of interest. In this case, we have identified selenoamino acid metabolism and steroid biosynthesis as key pathways mediating the observed relationship between metabolic health and high-CLA beef. These results indicate that this type of

  18. Nitrogen transporter and assimilation genes exhibit developmental stage-selective expression in maize (Zea mays L.) associated with distinct cis-acting promoter motifs.

    Liseron-Monfils, Christophe; Bi, Yong-Mei; Downs, Gregory S; Wu, Wenqing; Signorelli, Tara; Lu, Guangwen; Chen, Xi; Bondo, Eddie; Zhu, Tong; Lukens, Lewis N; Colasanti, Joseph; Rothstein, Steven J; Raizada, Manish N


    Nitrogen is considered the most limiting nutrient for maize (Zea mays L.), but there is limited understanding of the regulation of nitrogen-related genes during maize development. An Affymetrix 82K maize array was used to analyze the expression of ≤ 46 unique nitrogen uptake and assimilation probes in 50 maize tissues from seedling emergence to 31 d after pollination. Four nitrogen-related expression clusters were identified in roots and shoots corresponding to, or overlapping, juvenile, adult, and reproductive phases of development. Quantitative real time PCR data was consistent with the existence of these distinct expression clusters. Promoters corresponding to each cluster were screened for over-represented cis-acting elements. The 8-bp distal motif of the Arabidopsis 43-bp nitrogen response element (NRE) was over-represented in nitrogen-related maize gene promoters. This conserved motif, referred to here as NRE43-d8, was previously shown to be critical for nitrate-activated transcription of nitrate reductase (NIA1) and nitrite reductase (NIR1) by the NIN-LIKE PROTEIN 6 (NLP6) in Arabidopsis. Here, NRE43-d8 was over-represented in the promoters of maize nitrate and ammonium transporter genes, specifically those that showed peak expression during early-stage vegetative development. This result predicts an expansion of the NRE-NLP6 regulon and suggests that it may have a developmental component in maize. We also report leaf expression of putative orthologs of nitrite transporters (NiTR1), a transporter not previously reported in maize. We conclude by discussing how each of the four transcriptional modules may be responsible for the different nitrogen uptake and assimilation requirements of leaves and roots at different stages of maize development.

  19. Successional patterns of key genes and processes involved in the microbial nitrogen cycle in a salt marsh chronosequence

    Salles, Joana Falcao; Cassia Pereira e Silva , de Michele; Dini-Andreote, Francisco; Dias, Armando C. F.; Guillaumaud, Nadine; Poly, Franck; van Elsas, Jan Dirk

    Here, we investigated the patterns of microbial nitrogen cycling communities along a chronosequence of soil development in a salt marsh. The focus was on the abundance and structure of genes involved in N fixation (nifH), bacterial and archaeal ammonium oxidation (amoA; AOB and AOA), and the

  20. RNA-Seq analysis identifies key genes associated with haustorial development in the root hemiparasite Santalum album

    Xinhua eZhang


    Full Text Available Santalum album (sandalwood is one of the economically important plant species in the Santalaceae for its production of highly valued perfume oils. Sandalwood is also a hemiparasitic tree that obtains some of its water and simple nutrients by tapping into other plants through haustoria which are highly specialized organs in parasitic angiosperms. However, an understanding of the molecular mechanisms involved in haustorium development is limited. In this study, RNA sequencing (RNA-seq analyses were performed to identify changes in gene expression and metabolic pathways associated with the development of the S. album haustorium. A total of 56,011 non-redundant contigs with a mean contig size of 618 bp were obtained by de novo assembly of the transcriptome of haustoria and non-haustorial seedling roots. A substantial number of the identified differentially expressed genes were involved in cell wall metabolism and protein metabolism, as well as mitochondrial electron transport functions. Phytohormone-mediated regulation might play an important role during haustorial development. Especially, auxin signaling is likely to be essential for haustorial initiation, and genes related to cytokinin and gibberellin biosynthesis and metabolism are involved in haustorial development. Our results suggest that genes encoding nodulin-like proteins may be important for haustorial morphogenesis in S. album. The obtained sequence data will become a rich resource for future research in this interesting species. This information improves our understanding of haustorium development in root hemiparasitic species and will allow further exploration of the detailed molecular mechanisms underlying plant parasitism.

  1. Deciphering the function and regulation of SbCAD2: A key lignin gene to improve sorghum biomass degradability

    Genetic modification of lignin biosynthesis in the cell wall of biofuel feedstocks is likely one of the most effective ways to improve the conversion efficiency of cellulosic biomass to biofuel for the bioenergy industry. As a key enzyme that catalyzes the last step of monolignol synthesis, cinnamy...

  2. Key Inflammatory Processes in Human NASH Are Reflected in Ldlr−/−.Leiden Mice: A Translational Gene Profiling Study

    Morrison, M.C.; Kleemann, R.; Koppen, A. van; Hanemaaijer, R.; Verschuren, L.


    Introduction: It is generally accepted that metabolic inflammation in the liver is an important driver of disease progression in NASH and associated matrix remodeling/fibrosis. However, the exact molecular inflammatory mechanisms are poorly defined in human studies. Investigation of key pathogenic

  3. Early gene Broad complex plays a key role in regulating the immune response triggered by ecdysone in the Malpighian tubules of Drosophila melanogaster.

    Verma, Puja; Tapadia, Madhu G


    In insects, humoral response to injury is accomplished by the production of antimicrobial peptides (AMPs) which are secreted in the hemolymph to eliminate the pathogen. Drosophila Malpighian tubules (MTs), however, are unique immune organs that show constitutive expression of AMPs even in unchallenged conditions and the onset of immune response is developmental stage dependent. Earlier reports have shown ecdysone positively regulates immune response after pathogenic challenge however, a robust response requires prior potentiation by the hormone. Here we provide evidence to show that MTs do not require prior potentiation with ecdysone hormone for expression of AMPs and they respond to ecdysone very fast even without immune challenge, although the different AMPs Diptericin, Cecropin, Attacin, Drosocin show differential expression in response to ecdysone. We show that early gene Broad complex (BR-C) could be regulating the IMD pathway by activating Relish and physically interacting with it to activate AMPs expression. BR-C depletion from Malpighian tubules renders the flies susceptible to infection. We also show that in MTs ecdysone signaling is transduced by EcR-B1 and B2. In the absence of ecdysone signaling the IMD pathway associated genes are down regulated and activation and translocation of transcription factor Relish is also affected. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. [Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

    Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M


    Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic

  5. Knockdown of Fanconi anemia genes in human embryonic stem cells reveals early developmental defects in the hematopoietic lineage.

    Tulpule, Asmin; Lensch, M William; Miller, Justine D; Austin, Karyn; D'Andrea, Alan; Schlaeger, Thorsten M; Shimamura, Akiko; Daley, George Q


    Fanconi anemia (FA) is a genetically heterogeneous, autosomal recessive disorder characterized by pediatric bone marrow failure and congenital anomalies. The effect of FA gene deficiency on hematopoietic development in utero remains poorly described as mouse models of FA do not develop hematopoietic failure and such studies cannot be performed on patients. We have created a human-specific in vitro system to study early hematopoietic development in FA using a lentiviral RNA interference (RNAi) strategy in human embryonic stem cells (hESCs). We show that knockdown of FANCA and FANCD2 in hESCs leads to a reduction in hematopoietic fates and progenitor numbers that can be rescued by FA gene complementation. Our data indicate that hematopoiesis is impaired in FA from the earliest stages of development, suggesting that deficiencies in embryonic hematopoiesis may underlie the progression to bone marrow failure in FA. This work illustrates how hESCs can provide unique insights into human development and further our understanding of genetic disease.

  6. In the Gray Zone in the Fragile X Gene: What are the Key Unanswered Clinical and Biological Questions?

    Deborah A. Hall


    Full Text Available Smaller expansions (41–54 CGG repeats in the fragile X mental retardation 1 (FMR1 gene are termed "gray zone" alleles. Only recently has interest in these expansions increased due to reporting of phenotypes unique to gray zone carriers or similar to those seen in individuals with larger expansions. As minimal research has focused on gray zone expansions, this paper asks several questions related to this topic. These include the following: What is the definition of the gray zone? Is there a risk of developing neurological signs in these carriers? Are there secondary gene effects that impact gray zone alleles or a biologic advantage to carrying these repeats? How do we counsel patients with gray zone expansions? The answers to these questions will help to determine the significance of these expansions and provide needed information to the research community and clinicians.

  7. The suppression of tomato defence response genes upon potato cyst nematode infection indicates a key regulatory role of miRNAs.

    Święcicka, Magdalena; Skowron, Waldemar; Cieszyński, Piotr; Dąbrowska-Bronk, Joanna; Matuszkiewicz, Mateusz; Filipecki, Marcin; Koter, Marek Daniel


    Potato cyst nematode Globodera rostochiensis is an obligate parasite of solanaceous plants, triggering metabolic and morphological changes in roots which may result in substantial crop yield losses. Previously, we used the cDNA-AFLP to study the transcriptional dynamics in nematode infected tomato roots. Now, we present the rescreening of already published, upregulated transcript-derived fragment dataset using the most current tomato transcriptome sequences. Our reanalysis allowed to add 54 novel genes to 135, already found as upregulated in tomato roots upon G. rostochiensis infection (in total - 189). We also created completely new catalogue of downregulated sequences leading to the discovery of 76 novel genes. Functional classification of candidates showed that the 'wound, stress and defence response' category was enriched in the downregulated genes. We confirmed the transcriptional dynamics of six genes by qRT-PCR. To place our results in a broader context, we compared the tomato data with Arabidopsis thaliana, revealing similar proportions of upregulated and downregulated genes as well as similar enrichment of defence related transcripts in the downregulated group. Since transcript suppression is quite common in plant-nematode interactions, we assessed the possibility of miRNA-mediated inverse correlation on several tomato sequences belonging to NB-LRR and receptor-like kinase families. The qRT-PCR of miRNAs and putative target transcripts showed an opposite expression pattern in 9 cases. These results together with in silico analyses of potential miRNA targeting to the full repertoire of tomato R-genes show that miRNA mediated gene suppression may be a key regulatory mechanism during nematode parasitism. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Direct transcriptional activation of BT genes by NLP transcription factors is a key component of the nitrate response in Arabidopsis.

    Sato, Takeo; Maekawa, Shugo; Konishi, Mineko; Yoshioka, Nozomi; Sasaki, Yuki; Maeda, Haruna; Ishida, Tetsuya; Kato, Yuki; Yamaguchi, Junji; Yanagisawa, Shuichi


    Nitrate modulates growth and development, functioning as a nutrient signal in plants. Although many changes in physiological processes in response to nitrate have been well characterized as nitrate responses, the molecular mechanisms underlying the nitrate response are not yet fully understood. Here, we show that NLP transcription factors, which are key regulators of the nitrate response, directly activate the nitrate-inducible expression of BT1 and BT2 encoding putative scaffold proteins with a plant-specific domain structure in Arabidopsis. Interestingly, the 35S promoter-driven expression of BT2 partially rescued growth inhibition caused by reductions in NLP activity in Arabidopsis. Furthermore, simultaneous disruption of BT1 and BT2 affected nitrate-dependent lateral root development. These results suggest that direct activation of BT1 and BT2 by NLP transcriptional activators is a key component of the molecular mechanism underlying the nitrate response in Arabidopsis. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Nogo-receptor gene activity: cellular localization and developmental regulation of mRNA in mice and humans.

    Josephson, Anna; Trifunovski, Alexandra; Widmer, Hans Ruedi; Widenfalk, Johan; Olson, Lars; Spenger, Christian


    Nogo (reticulon-4) is a myelin-associated protein that is expressed in three different splice variants, Nogo-A, Nogo-B, and Nogo-C. Nogo-A inhibits neurite regeneration in the central nervous system. Messenger RNA encoding Nogo is expressed in oligodendrocytes and central and peripheral neurons, but not in astrocytes or Schwann cells. Nogo is a transmembraneous protein; the extracellular domain is termed Nogo-66, and a Nogo-66-receptor (Nogo-R) has been identified. We performed in situ hybridization in human and mouse nervous tissues to map the cellular distribution of Nogo-R gene activity patterns in fetal and adult human spinal cord and sensory ganglia, adult human brain, and the nervous systems of developing and adult mice. In the human fetus Nogo-R was transcribed in the ventral horn of the spinal cord and in dorsal root ganglia. In adult human tissues Nogo-R gene activity was found in neocortex, hippocampus, amygdala, and a subset of large and medium-sized neurons of the dorsal root ganglia. Nogo-R mRNA was not expressed in the adult human spinal cord at detectable levels. In the fetal mouse, Nogo-R was diffusely expressed in brain, brainstem, trigeminal ganglion, spinal cord, and dorsal root ganglia at all stages. In the adult mouse strong Nogo-R mRNA expression was found in neurons in neocortex, hippocampus, amygdala, habenula, thalamic nuclei, brainstem, the granular cell layer of cerebellum, and the mitral cell layer of the olfactory bulb. Neurons in the adult mouse striatum, the medial septal nucleus, and spinal cord did not express Nogo-R mRNA at detectable levels. In summary, Nogo-66-R mRNA expression in humans and mice was observed in neurons of the developing nervous system Expression was downregulated in the adult spinal cord of both species, and specific expression patterns were seen in the adult brain. Copyright 2002 Wiley-Liss, Inc.

  10. Identification of key genes and pathways associated with neuropathic pain in uninjured dorsal root ganglion by using bioinformatic analysis

    Chen CJ


    Full Text Available Chao-Jin Chen,* De-Zhao Liu,* Wei-Feng Yao, Yu Gu, Fei Huang, Zi-Qing Hei, Xiang Li Department of Anesthesiology, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, People’s Republic of China *These authors contributed equally to this work Purpose: Neuropathic pain is a complex chronic condition occurring post-nervous system damage. The transcriptional reprogramming of injured dorsal root ganglia (DRGs drives neuropathic pain. However, few comparative analyses using high-throughput platforms have investigated uninjured DRG in neuropathic pain, and potential interactions among differentially expressed genes (DEGs and pathways were not taken into consideration. The aim of this study was to identify changes in genes and pathways associated with neuropathic pain in uninjured L4 DRG after L5 spinal nerve ligation (SNL by using bioinformatic analysis.Materials and methods: The microarray profile GSE24982 was downloaded from the Gene Expression Omnibus database to identify DEGs between DRGs in SNL and sham rats. The prioritization for these DEGs was performed using the Toppgene database followed by gene ontology and pathway enrichment analyses. The relationships among DEGs from the protein interactive perspective were analyzed using protein–protein interaction (PPI network and module analysis. Real-time polymerase chain reaction (PCR and Western blotting were used to confirm the expression of DEGs in the rodent neuropathic pain model.Results: A total of 206 DEGs that might play a role in neuropathic pain were identified in L4 DRG, of which 75 were upregulated and 131 were downregulated. The upregulated DEGs were enriched in biological processes related to transcription regulation and molecular functions such as DNA binding, cell cycle, and the FoxO signaling pathway. Ctnnb1 protein had the highest connectivity degrees in the PPI network. The in vivo studies also validated that mRNA and protein levels of Ctnnb1 were

  11. Developmental Decline in the MicroRNA 199a (miR-199a)/miR-214 Cluster in Human Fetal Lung Promotes Type II Cell Differentiation by Upregulating Key Transcription Factors.

    Mishra, Ritu; Benlhabib, Houda; Guo, Wei; Lerma Cervantes, Connie B; Mendelson, Carole R


    The major surfactant protein, SP-A (a product of the SFTPA gene), serves as a marker of type II pneumocyte differentiation and surfactant synthesis. SFTPA expression in cultured human fetal lung (HFL) epithelial cells is upregulated by hormones that increase cyclic AMP (cAMP) and activate TTF-1/NKX2.1 and NF-κB. To further define mechanisms for type II cell differentiation and induction of SP-A, we investigated roles of microRNAs (miRNAs). Using microarray to identify differentially expressed miRNAs in HFL epithelial cells during type II cell differentiation in culture, we observed that members of the miRNA 199a (miR-199a)/miR-214 cluster were significantly downregulated during differentiation. Validated and predicted targets of miR-199a-3p/miR-199a-5p and miR-214, which serve roles in type II cell differentiation (COX-2, NF-κB p50/p65, and CREB1), and the CREB1 target, C/EBPβ, were coordinately upregulated. Accordingly, overexpression of miR-199a-5p, miR-199a-3p, or miR-214 mimics in cultured HFL epithelial cells decreased COX-2, NF-κB p50/p65, CREB1, and C/EBPβ proteins, with an associated inhibition of SP-A expression. Interestingly, overexpression of the EMT factor, ZEB1, which declines during cAMP-induced type II cell differentiation, increased pri-miR-199a and reduced the expression of the targets NF-κB/p50 and COX-2. Collectively, these findings suggest that the developmental decline in miR-199a/miR-214 in HFL causes increased expression of critical targets that enhance type II cell differentiation and SP-A expression. Copyright © 2018 American Society for Microbiology.

  12. Developmental Immunotoxicity

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  13. Ultraviolet filters differentially impact the expression of key endocrine and stress genes in embryos and larvae of Chironomus riparius.

    Ozáez, Irene; Morcillo, Gloria; Martínez-Guitarte, José-Luis


    Several organic UV filters have hormonal activity in vertebrates, as demonstrated in fishes, rodents and human cells. Despite the accumulation of filter contaminants in aquatic systems, research on their effects on the endocrine systems of freshwaters invertebrates is scarce. In this work, the effects of five frequently used UV filters were investigated in embryos and larvae of Chironomus riparius, which is a reference organism in ecotoxicology. LC50 values for larvae as well as the percentage of eclosion of eggs were determined following exposures to: octyl-p-methoxycinnamate (OMC) also known as 2-ethylhexyl-4-methoxycinnamate (EHMC); 4-methylbenzylidene camphor (4MBC); 4-hydroxybenzophenone (4HB); octocrylene (OC); and octyldimethyl-p-aminobenzoate (OD-PABA). To assess sublethal effects, expression levels of the genes coding for the ecdysone receptor (EcR) and heat shock protein HSP70 were investigated as biomarkers for endocrine and stress effects at the cellular level. Life-stage-dependent sensitivity was found. In embryos, all of the UV filters provoked a significant overexpression of EcR at 24h after exposure. OC, 4MBC and OD-PABA also triggered transcriptional activation of the hsp70 stress gene in embryos. In contrast, in larvae, only 4MBC and OMC/EHMC increased EcR and hsp70 mRNA levels and OD-PABA upregulated only the EcR gene. These results revealed that embryos are particularly sensitive to UV filters, which affect endocrine regulation during development. Most UV filters also triggered the cellular stress response, and thus exhibit proteotoxic effects. The differences observed between embryos and larvae and the higher sensitivity of embryos highlight the importance of considering different life stages when evaluating the environmental risks of pollutants, particularly when analyzing endocrine effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. A NAC transcription factor gene of Chickpea (Cicer arietinum), CarNAC3, is involved in drought stress response and various developmental processes.

    Peng, Hui; Cheng, Hui-Ying; Chen, Chen; Yu, Xin-Wang; Yang, Jia-Ni; Gao, Wen-Rui; Shi, Qing-Hua; Zhang, Hua; Li, Jian-Gui; Ma, Hao


    NAC transcription factors have been found to play important roles in plant development and responses to environmental stresses. Based on two cDNA libraries constructed from the PEG-treated and -nontreated seedling leaves of chickpea, a NAC gene, CarNAC3, was isolated and characterized. The results indicated that CarNAC3 contained 285 amino acids and had a conserved NAC domain. It was localized in the nucleus and possessed trans-activation activity in the C-terminus. Phylogenetic analysis showed that CarNAC3 belonged to the NAP (NAC-like, activated by APETALA3/PISTILLATA) subgroup of the NAC protein family. CarNAC3 exhibited organ-specific expression and its induction was strongly dependent on leaf age. CarNAC3 showed differential expression patterns during seed development and germination, and could be significantly induced by drought stress, abscisic acid (ABA), ethephon (Et) and indole-3-acetic acid (IAA), but was inhibited by N-6-benzyl-adenine (6-BA). Our data suggest that CarNAC3 may be a transcriptional activator involved in drought stress response and various developmental processes.

  15. A cheZ-Like Gene in Azorhizobium caulinodans Is a Key Gene in the Control of Chemotaxis and Colonization of the Host Plant.

    Liu, Xiaolin; Liu, Wei; Sun, Yu; Xia, Chunlei; Elmerich, Claudine; Xie, Zhihong


    Chemotaxis can provide bacteria with competitive advantages for survival in complex environments. The CheZ chemotaxis protein is a phosphatase, affecting the flagellar motor in Escherichia coli by dephosphorylating the response regulator phosphorylated CheY protein (CheY∼P) responsible for clockwise rotation. A cheZ gene has been found in Azorhizobium caulinodans ORS571, in contrast to other rhizobial species studied so far. The CheZ protein in strain ORS571 has a conserved motif similar to that corresponding to the phosphatase active site in E. coli The construction of a cheZ deletion mutant strain and of cheZ mutant strains carrying a mutation in residues of the putative phosphatase active site showed that strain ORS571 participates in chemotaxis and motility, causing a hyperreversal behavior. In addition, the properties of the cheZ deletion mutant revealed that ORS571 CheZ is involved in other physiological processes, since it displayed increased flocculation, biofilm formation, exopolysaccharide (EPS) production, and host root colonization. In particular, it was observed that the expression of several exp genes, involved in EPS synthesis, was upregulated in the cheZ mutant compared to that in the wild type, suggesting that CheZ negatively controls exp gene expression through an unknown mechanism. It is proposed that CheZ influences the Azorhizobium -plant association by negatively regulating early colonization via the regulation of EPS production. This report established that CheZ in A. caulinodans plays roles in chemotaxis and the symbiotic association with the host plant. IMPORTANCE Chemotaxis allows bacteria to swim toward plant roots and is beneficial to the establishment of various plant-microbe associations. The level of CheY phosphorylation (CheY∼P) is central to the chemotaxis signal transduction. The mechanism of the signal termination of CheY∼P remains poorly characterized among Alphaproteobacteria , except for Sinorhizobium meliloti , which

  16. Genetic analysis of interferon induced thyroiditis (IIT): evidence for a key role for MHC and apoptosis related genes and pathways.

    Hasham, Alia; Zhang, Weijia; Lotay, Vaneet; Haggerty, Shannon; Stefan, Mihaela; Concepcion, Erlinda; Dieterich, Douglas T; Tomer, Yaron


    Autoimmune thyroid diseases (AITD) have become increasingly recognized as a complication of interferon-alpha (IFNα) therapy in patients with chronic Hepatitis C virus (HCV) infection. Interferon-induced thyroiditis (IIT) can manifest as clinical thyroiditis in approximately 15% of HCV patients receiving IFNα and subclinical thyroiditis in up to 40% of patients, possibly resulting in either dose reduction or discontinuation of IFNα treatment. However, the exact mechanisms that lead to the development of IIT are unknown and may include IFNα-mediated immune-recruitment as well as direct toxic effects on thyroid follicular cells. We hypothesized that IIT develops in genetically predisposed individuals whose threshold for developing thyroiditis is lowered by IFNα. Therefore, our aim was to identify the susceptibility genes for IIT. We used a genomic convergence approach combining genetic association data with transcriptome analysis of genes upregulated by IFNα. Integrating results of genetic association, transcriptome data, pathway, and haplotype analyses enabled the identification of 3 putative loci, SP100/110/140 (2q37.1), HLA (6p21.3), and TAP1 (6p21.3) that may be involved in the pathogenesis of IIT. Immune-regulation and apoptosis emerged as the predominant mechanisms underlying the etiology of IIT. Published by Elsevier Ltd.

  17. Key KdSOC1 gene expression profiles during plantlet morphogenesis under hormone, photoperiod, and drought treatments.

    Liu, C; Zhu, C; Zeng, H M


    Kalanchoe daigremontiana utilizes plantlet formation between its zigzag leaf margins as its method of asexual reproduction. In this study, K. daigremontiana SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (KdSOC1), a key intermediate in the transition from vegetative to asexual growth, was cloned. Furthermore, its expression profiles during plantlet formation under different environmental and hormone induction conditions were analyzed. The full-KdSOC1 cDNA sequence length was 1410 bp with 70% shared homology with Carya cathayensis SOC1. The conserved domain search of KdSOC1 showed the absence of I and C domains, which might indicate novel biological functions in K. daigremontiana. The full-KdSOC1 promoter sequence was 1401 bp long and contained multiple-hormone-responsive cis-acting elements. Hormone induction assays showed that gibberellins and salicylic acid mainly regulated KdSOC1 expression. The swift change from low to high KdSOC1 expression levels during long-day induction was accompanied by the rapid emergence of plantlets. Drought stress stimulated KdSOC1 expression in leaves both with and without plantlet formation. Together, the results suggested that KdSOC1 was closely involved in environmental stimulation signal perception and the transduction of K. daigremontiana plantlet formation. Therefore, future identification of KdSOC1 functions might reveal key information that will help elucidate the transition network between embryogenesis and organogenesis during plantlet formation.

  18. Developmental gene discovery in a hemimetabolous insect: de novo assembly and annotation of a transcriptome for the cricket Gryllus bimaculatus.

    Victor Zeng

    Full Text Available Most genomic resources available for insects represent the Holometabola, which are insects that undergo complete metamorphosis like beetles and flies. In contrast, the Hemimetabola (direct developing insects, representing the basal branches of the insect tree, have very few genomic resources. We have therefore created a large and publicly available transcriptome for the hemimetabolous insect Gryllus bimaculatus (cricket, a well-developed laboratory model organism whose potential for functional genetic experiments is currently limited by the absence of genomic resources. cDNA was prepared using mRNA obtained from adult ovaries containing all stages of oogenesis, and from embryo samples on each day of embryogenesis. Using 454 Titanium pyrosequencing, we sequenced over four million raw reads, and assembled them into 21,512 isotigs (predicted transcripts and 120,805 singletons with an average coverage per base pair of 51.3. We annotated the transcriptome manually for over 400 conserved genes involved in embryonic patterning, gametogenesis, and signaling pathways. BLAST comparison of the transcriptome against the NCBI non-redundant protein database (nr identified significant similarity to nr sequences for 55.5% of transcriptome sequences, and suggested that the transcriptome may contain 19,874 unique transcripts. For predicted transcripts without significant similarity to known sequences, we assessed their similarity to other orthopteran sequences, and determined that these transcripts contain recognizable protein domains, largely of unknown function. We created a searchable, web-based database to allow public access to all raw, assembled and annotated data. This database is to our knowledge the largest de novo assembled and annotated transcriptome resource available for any hemimetabolous insect. We therefore anticipate that these data will contribute significantly to more effective and higher-throughput deployment of molecular analysis tools in

  19. High-throughput sequencing reveals key genes and immune homeostatic pathways activated in myeloid dendritic cells by Porphyromonas gingivalis 381 and its fimbrial mutants.

    Arjunan, P; El-Awady, A; Dannebaum, R O; Kunde-Ramamoorthy, G; Cutler, C W


    The human microbiome consists of highly diverse microbial communities that colonize our skin and mucosal surfaces, aiding in maintenance of immune homeostasis. The keystone pathogen Porphyromonas gingivalis induces a dysbiosis and disrupts immune homeostasis through as yet unclear mechanisms. The fimbrial adhesins of P. gingivalis facilitate biofilm formation, invasion of and dissemination by blood dendritic cells; hence, fimbriae may be key factors in disruption of immune homeostasis. In this study we employed RNA-sequencing transcriptome profiling to identify differentially expressed genes (DEGs) in human monocyte-derived dendritic cells (MoDCs) in response to in vitro infection/exposure by Pg381 or its isogenic mutant strains that solely express minor-Mfa1 fimbriae (DPG3), major-FimA fimbriae (MFI) or are deficient in both fimbriae (MFB) relative to uninfected control. Our results yielded a total of 479 DEGs that were at least two-fold upregulated and downregulated in MoDCs significantly (P ≤ 0.05) by all four strains and certain DEGs that were strain-specific. Interestingly, the gene ontology biological and functional analysis shows that the upregulated genes in DPG3-induced MoDCs were more significant than other strains and associated with inflammation, immune response, anti-apoptosis, cell proliferation, and other homeostatic functions. Both transcriptome and quantitative polymerase chain reaction results show that DPG3, which solely expresses Mfa1, increased ZNF366, CD209, LOX1, IDO1, IL-10, CCL2, SOCS3, STAT3 and FOXO1 gene expression. In conclusion, we have identified key DC-mediated immune homeostatic pathways that could contribute to dysbiosis in periodontal infection with P. gingivalis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Genetic variations in key inflammatory cytokines exacerbates the risk of diabetic nephropathy by influencing the gene expression.

    Hameed, Iqra; Masoodi, Shariq R; Malik, Perveez A; Mir, Shahnaz A; Ghazanfar, Khalid; Ganai, Bashir A


    Diabetic nephropathy is the single strongest predictor of mortality in patients with diabetes. The development of overt nephropathy involves important inter-individual variations, even after adjusting for potential confounding influences of modifiable and non-modifiable risk factors. Genome-wide transcriptome studies have reported the activation of inflammatory signaling pathways and there is mounting indication of the role of genetic factors. We screened nine genetic variations in three cytokine genes (TNF-α, IL-6 and IL-β) in 1326 unrelated subjects comprising of healthy controls (n = 464), type 2 diabetics with nephropathy (DN, n = 448) and type 2 diabetes without nephropathy (T2D, n = 414) by sequence-specific amplification. Functional implication of SNPs was elucidated by correlation studies and relative gene expression using Realtime-Quantitative PCR (RT-qPCR). Individual SNP analysis showed highest association of IL-1β rs16944-TT genotype (OR = 3.51, 95%CI = 2.36-5.21, P = 0.001) and TNF-α rs1800629-AA genotype (OR = 2.75, 95% CI = 1.64-4.59, P = 0.001) with T2D and DN respectively. The haplotype frequency showed significant risk of seven combinations among T2D and four combinations among DN subjects. The highest risk of T2D and DN was associated with GGTGAGTTT (OR = 4.25, 95%CI = 3.3-14.20, P = 0.0016) and GACGACCTT (OR = 21.3, 95%CI = 15.1-28.33, P = 0.026) haplotypes respectively. Relative expression by RT-qPCR showed increased cytokine expression in cases as compared to controls. TNF-α expression was increased by more than four-folds (n-fold = 4.43 ± 1.11) in DN. TNF-α, IL-6 and IL-1β transcript levels were significantly modulated by promoter region SNPs. The present study implicates a strong association between cytokine TNF-α, IL-6 and IL-1β gene promoter polymorphisms and modulation of transcript levels with susceptibility to nephropathy in diabetes subjects. Copyright

  1. RUNX1 promotes cell growth in human T-cell acute lymphoblastic leukemia by transcriptional regulation of key target genes.

    Jenkins, Catherine E; Gusscott, Samuel; Wong, Rachel J; Shevchuk, Olena O; Rana, Gurneet; Giambra, Vincenzo; Tyshchenko, Kateryna; Islam, Rashedul; Hirst, Martin; Weng, Andrew P


    RUNX1 is frequently mutated in T-cell acute lymphoblastic leukemia (T-ALL). The spectrum of RUNX1 mutations has led to the notion that it acts as a tumor suppressor in this context; however, other studies have placed RUNX1 along with transcription factors TAL1 and NOTCH1 as core drivers of an oncogenic transcriptional program. To reconcile these divergent roles, we knocked down RUNX1 in human T-ALL cell lines and deleted Runx1 or Cbfb in primary mouse T-cell leukemias. RUNX1 depletion consistently resulted in reduced cell proliferation and increased apoptosis. RUNX1 upregulated variable sets of target genes in each cell line, but consistently included a core set of oncogenic effectors including IGF1R and NRAS. Our results support the conclusion that RUNX1 has a net positive effect on cell growth in the context of established T-ALL. Copyright © 2018. Published by Elsevier Inc.

  2. c-Myc Antagonises the Transcriptional Activity of the Androgen Receptor in Prostate Cancer Affecting Key Gene Networks.

    Barfeld, Stefan J; Urbanucci, Alfonso; Itkonen, Harri M; Fazli, Ladan; Hicks, Jessica L; Thiede, Bernd; Rennie, Paul S; Yegnasubramanian, Srinivasan; DeMarzo, Angelo M; Mills, Ian G


    Prostate cancer (PCa) is the most common non-cutaneous cancer in men. The androgen receptor (AR), a ligand-activated transcription factor, constitutes the main drug target for advanced cases of the disease. However, a variety of other transcription factors and signaling networks have been shown to be altered in patients and to influence AR activity. Amongst these, the oncogenic transcription factor c-Myc has been studied extensively in multiple malignancies and elevated protein levels of c-Myc are commonly observed in PCa. Its impact on AR activity, however, remains elusive. In this study, we assessed the impact of c-Myc overexpression on AR activity and transcriptional output in a PCa cell line model and validated the antagonistic effect of c-MYC on AR-targets in patient samples. We found that c-Myc overexpression partially reprogrammed AR chromatin occupancy and was associated with altered histone marks distribution, most notably H3K4me1 and H3K27me3. We found c-Myc and the AR co-occupy a substantial number of binding sites and these exhibited enhancer-like characteristics. Interestingly, c-Myc overexpression antagonised clinically relevant AR target genes. Therefore, as an example, we validated the antagonistic relationship between c-Myc and two AR target genes, KLK3 (alias PSA, prostate specific antigen), and Glycine N-Methyltransferase (GNMT), in patient samples. Our findings provide unbiased evidence that MYC overexpression deregulates the AR transcriptional program, which is thought to be a driving force in PCa. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  3. c-Myc Antagonises the Transcriptional Activity of the Androgen Receptor in Prostate Cancer Affecting Key Gene Networks

    Stefan J. Barfeld


    Full Text Available Prostate cancer (PCa is the most common non-cutaneous cancer in men. The androgen receptor (AR, a ligand-activated transcription factor, constitutes the main drug target for advanced cases of the disease. However, a variety of other transcription factors and signaling networks have been shown to be altered in patients and to influence AR activity. Amongst these, the oncogenic transcription factor c-Myc has been studied extensively in multiple malignancies and elevated protein levels of c-Myc are commonly observed in PCa. Its impact on AR activity, however, remains elusive. In this study, we assessed the impact of c-Myc overexpression on AR activity and transcriptional output in a PCa cell line model and validated the antagonistic effect of c-MYC on AR-targets in patient samples. We found that c-Myc overexpression partially reprogrammed AR chromatin occupancy and was associated with altered histone marks distribution, most notably H3K4me1 and H3K27me3. We found c-Myc and the AR co-occupy a substantial number of binding sites and these exhibited enhancer-like characteristics. Interestingly, c-Myc overexpression antagonised clinically relevant AR target genes. Therefore, as an example, we validated the antagonistic relationship between c-Myc and two AR target genes, KLK3 (alias PSA, prostate specific antigen, and Glycine N-Methyltransferase (GNMT, in patient samples. Our findings provide unbiased evidence that MYC overexpression deregulates the AR transcriptional program, which is thought to be a driving force in PCa.

  4. Effect of Co-overexpression of Nisin Key Genes on Nisin Production Improvement in Lactococcus lactis LS01.

    Ni, Zhi-Jian; Zhang, Xiao-Yuan; Liu, Fei; Wang, Miao; Hao, Rong-Hua; Ling, Pei-Xue; Zhu, Xi-Qiang


    Nisin is a small antimicrobial peptide produced by several subset strains of Lactococcus lactis. To improve nisin yield in the producer L. lactis LS01, we proposed a successive fusion of nisA with nisRK and nisFEG into a single shuttle expression vector pMG36e under the control of the native strong constitutive promoter p32. Subsequently, the recombinant vectors were transplanted into the producer cell through electroporation. Nisin productivity was determined through sodium dodecyl sulfate-polyacrylamide gel electrophoresis and bioactivity assays. Expression of nisin peptide was detected by agar diffusion bioassay, and the transcriptional levels of the target genes involved in nisin biosynthesis were investigated via semi-quantitative reverse transcription PCR expression analysis using 16S ribosomal RNA (rRNA) as an internal control. Results suggested that the introduction of empty plasmid did not affect nisin production of L. lactis LS01, whereas by our rational construction and screening, the engineered strain co-overexpressing nisA, nisRK, and nisFEG achieved a maximum increment in bioactive nisin production with a yield of 2470 IU/ml in shake flasks and 4857 IU/ml in 1.0-l fermenters, which increased by approximately 66.3 and 52.6% (P < 0.05), respectively, compared with that of the original strain under the given fermentation conditions. Meanwhile, the transcriptional analysis revealed that the expression of most of these multicopy genes except nisE at transcriptional level were upregulated in the two recombinant strains (LS01/pAR and LS01/pARF), possibly contributing to the improved nisin production. Therefore, this study would provide a potential strategy to improve the economic benefits of nisin manufacture for large-scale industrial production.

  5. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Abercrombie Jason M


    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression


    Mario U Manto


    Full Text Available The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodelling are being unravelled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip (RL, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signalling between granule cells and Purkinje neurons. The expression profile of SHH (Sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired development and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders.

  7. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny


    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  8. Comparison of 454-ESTs from Huperzia serrata and Phlegmariurus carinatus reveals putative genes involved in lycopodium alkaloid biosynthesis and developmental regulation

    Steinmetz André


    . serrata and P. carinatus 454-ESTs and real-time PCR analysis. Four unique putative CYP450 transcripts (Hs01891, Hs04010, Hs13557 and Hs00093 which are the most likely to be involved in the biosynthesis of lycopodium alkaloids were selected based on a phylogenetic analysis. Approximately 115 H. serrata and 98 P. carinatus unique putative transcripts associated with the biosynthesis of triterpenoids, alkaloids and flavones/flavonoids were located in the 454-EST datasets. Transcripts related to phytohormone biosynthesis and signal transduction as well as transcription factors were also obtained. In addition, we discovered 2,729 and 1,573 potential SSR-motif microsatellite loci in the H. serrata and P. carinatus 454-ESTs, respectively. Conclusions The 454-EST resource allowed for the first large-scale acquisition of ESTs from H. serrata and P. carinatus, which are representative members of the Huperziaceae family. We discovered many genes likely to be involved in the biosynthesis of bioactive compounds and transcriptional regulation as well as a large number of potential microsatellite markers. These results constitute an essential resource for understanding the molecular basis of developmental regulation and secondary metabolite biosynthesis (especially that of lycopodium alkaloids in the Huperziaceae, and they provide an overview of the genetic diversity of this family.

  9. A horizontal gene transfer at the origin of phenylpropanoid metabolism: a key adaptation of plants to land.

    Emiliani, Giovanni; Fondi, Marco; Fani, Renato; Gribaldo, Simonetta


    The pioneering ancestor of land plants that conquered terrestrial habitats around 500 million years ago had to face dramatic stresses including UV radiation, desiccation, and microbial attack. This drove a number of adaptations, among which the emergence of the phenylpropanoid pathway was crucial, leading to essential compounds such as flavonoids and lignin. However, the origin of this specific land plant secondary metabolism has not been clarified. We have performed an extensive analysis of the taxonomic distribution and phylogeny of Phenylalanine Ammonia Lyase (PAL), which catalyses the first and essential step of the general phenylpropanoid pathway, leading from phenylalanine to p-Coumaric acid and p-Coumaroyl-CoA, the entry points of the flavonoids and lignin routes. We obtained robust evidence that the ancestor of land plants acquired a PAL via horizontal gene transfer (HGT) during symbioses with soil bacteria and fungi that are known to have established very early during the first steps of land colonization. This horizontally acquired PAL represented then the basis for further development of the phenylpropanoid pathway and plant radiation on terrestrial environments. Our results highlight a possible crucial role of HGT from soil bacteria in the path leading to land colonization by plants and their subsequent evolution. The few functional characterizations of sediment/soil bacterial PAL (production of secondary metabolites with powerful antimicrobial activity or production of pigments) suggest that the initial advantage of this horizontally acquired PAL in the ancestor of land plants might have been either defense against an already developed microbial community and/or protection against UV.

  10. A horizontal gene transfer at the origin of phenylpropanoid metabolism: a key adaptation of plants to land

    Gribaldo Simonetta


    Full Text Available Abstract Background The pioneering ancestor of land plants that conquered terrestrial habitats around 500 million years ago had to face dramatic stresses including UV radiation, desiccation, and microbial attack. This drove a number of adaptations, among which the emergence of the phenylpropanoid pathway was crucial, leading to essential compounds such as flavonoids and lignin. However, the origin of this specific land plant secondary metabolism has not been clarified. Results We have performed an extensive analysis of the taxonomic distribution and phylogeny of Phenylalanine Ammonia Lyase (PAL, which catalyses the first and essential step of the general phenylpropanoid pathway, leading from phenylalanine to p-Coumaric acid and p-Coumaroyl-CoA, the entry points of the flavonoids and lignin routes. We obtained robust evidence that the ancestor of land plants acquired a PAL via horizontal gene transfer (HGT during symbioses with soil bacteria and fungi that are known to have established very early during the first steps of land colonization. This horizontally acquired PAL represented then the basis for further development of the phenylpropanoid pathway and plant radiation on terrestrial environments. Conclusion Our results highlight a possible crucial role of HGT from soil bacteria in the path leading to land colonization by plants and their subsequent evolution. The few functional characterizations of sediment/soil bacterial PAL (production of secondary metabolites with powerful antimicrobial activity or production of pigments suggest that the initial advantage of this horizontally acquired PAL in the ancestor of land plants might have been either defense against an already developed microbial community and/or protection against UV. Reviewers This article was reviewed by Purificación López-García, Janet Siefert, and Eugene Koonin.

  11. The human lipodystrophy gene product Berardinelli-Seip congenital lipodystrophy 2/seipin plays a key role in adipocyte differentiation.

    Chen, Weiqin; Yechoor, Vijay K; Chang, Benny Hung-Junn; Li, Ming V; March, Keith L; Chan, Lawrence


    Mutations in the Berardinelli-Seip congenital lipodystrophy 2 gene (BSCL2) are the underlying defect in patients with congenital generalized lipodystrophy type 2. BSCL2 encodes a protein called seipin, whose function is largely unknown. In this study, we investigated the role of Bscl2 in the regulation of adipocyte differentiation. Bscl2 mRNA is highly up-regulated during standard hormone-induced adipogenesis in 3T3-L1 cells in vitro. However, this up-regulation does not occur during mesenchymal stem cell (C3H10T1/2 cells) commitment to the preadipocyte lineage. Knockdown of Bscl2 by short hairpin RNA in C3H10T1/2 cells has no effect on bone morphogenetic protein-4-induced preadipocyte commitment. However, knockdown in 3T3-L1 cells prevents adipogenesis induced by a standard hormone cocktail, but adipogenesis can be rescued by the addition of peroxisome proliferator-activated receptor-gamma agonist pioglitazone at an early stage of differentiation. Interestingly, pioglitazone-induced differentiation in the absence of standard hormone is not associated with up-regulated Bscl2 expression. On the other hand, short hairpin RNA-knockdown of Bscl2 largely blocks pioglitazone-induced adipose differentiation. These experiments suggest that Bscl2 may be essential for normal adipogenesis; it works upstream or at the level of peroxisome proliferator-activated receptor-gamma, enabling the latter to exert its full activity during adipogenesis. Loss of Bscl2 function thus interferes with the normal transcriptional cascade of adipogenesis during fat cell differentiation, resulting in near total loss of fat or lipodystrophy.

  12. Developmental Scaffolding

    Giorgi, Franco; Bruni, Luis Emilio


    . Within the developmental hierarchy, each module yields an inter-level relationship that makes it possible for the scaffolding to mediate the production of selectable variations. Awide range of genetic, cellular and morphological mechanisms allows the scaffolding to integrate these modular variations...... to the complexity of sign recognition proper of a cellular community. In this semiotic perspective, the apparent goal directness of any developmental strategy should no longer be accounted for by a predetermined genetic program, but by the gradual definition of the relationships selected amongst the ones...

  13. Voltage-gated Na+ channel SCN5A is a key regulator of a gene transcriptional network that controls colon cancer invasion

    House, Carrie D.; Vaske, Charles J.; Schwartz, Arnold M.; Obias, Vincent; Frank, Bryan; Luu, Truong; Sarvazyan, Narine; Irby, Rosalyn; Strausberg, Robert L.; Hales, Tim G.; Stuart, Joshua M.; Lee, Norman H.


    Voltage-gated Na+ channels (VGSCs) have been implicated in the metastatic potential of human breast, prostate and lung cancer cells. Specifically, the SCN5A gene encoding the VGSC isotype Nav1.5 has been defined as a key driver of human cancer cell invasion. In this study, we examined the expression and function of VGSCs in a panel of colon cancer cell lines by electrophysiological recordings. Na+ channel activity and invasive potential were inhibited pharmacologically by tetrodotoxin or genetically by siRNAs specifically targeting SCN5A. Clinical relevance was established by immunohistochemistry of patient biopsies, where there was strong Nav1.5 protein staining in colon cancer specimens but little to no staining in matched-paired normal colon tissues. We explored the mechanism of VGSC-mediated invasive potential on the basis of reported links between VGSC activity and gene expression in excitable cells. Probabilistic modeling of loss-of-function screens and microarray data established an unequivocal role of VGSC SCN5A as a high level regulator of a colon cancer invasion network, involving genes that encompass Wnt signaling, cell migration, ectoderm development, response to biotic stimulus, steroid metabolic process and cell cycle control. siRNA-mediated knockdown of predicted downstream network components caused a loss of invasive behavior, demonstrating network connectivity and its function in driving colon cancer invasion. PMID:20651255

  14. Developmental delay

    Nutrition support is essential for the care of the child with developmental delay. After a thorough evaluation, an individualized intervention plan that accounts for the child’s nutrition status, feeding ability, and medical condition may be determined. Nutrition assessments may be performed at leas...

  15. Developmental Work

    Møller, Niels; Hvid, Helge; Kristensen, Tage Søndergaard


    Human Deveoplment and Working Life - Work for Welfare explores whether the development of human resources at company level can improve individuals' quality of life, companies' possibilities of development, and welfare and democracy in society. Chapter two discuss the concept "developmental work...

  16. Developmental Hypothyroidism Reduces the Expression of Activity-Dependent Plasticity Genes in Denate Gyrus of the Adult Following Long Term Potentiation

    Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neuro...

  17. IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

    Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna


    Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the

  18. Cloning and functional analysis of 9-cis-epoxycarotenoid dioxygenase (NCED) genes encoding a key enzyme during abscisic acid biosynthesis from peach and grape fruits.

    Zhang, Mei; Leng, Ping; Zhang, Guanglian; Li, Xiangxin


    Ripening and senescence are generally controlled by ethylene in climacteric fruits like peaches, and the ripening process of grape, a non-climacteric fruit, may have some relationship to abscisic acid (ABA) function. In order to better understand the role of ABA in ripening and senescence of these two types of fruits, we cloned the 9-cis-epoxycarotenoid dioxygenase (NCED) gene that encodes a key enzyme in ABA biosynthesis from peaches and grapes using an RT-PCR approach. The NCED gene fragments were cloned from peaches (PpNCED1and PpNCED2, each 740bp) and grapes (VVNCED1, 741bp) using degenerate primers designed based on the conserved amino acids sequence of NCEDs in other plants. PpNCED1 showed 78.54% homology with PpNCED2, 74.90% homology with VVNCED1, and both showed high homology to NCEDs from other plants. The expression patterns of PpNCED1 and VVNCED1 were very similar. Both were highly expressed at the beginning of ripening when ABA content becomes high. The maximum ABA preceded ethylene production in peach fruit. ABA in the grape gradually increased from the beginning of ripening and reached the highest level at 20d before the harvest stage. However, ethylene remained at low levels during the entire process of fruit development, including ripening and senescence. ABA content, and ripening and softening of both types of fruits, were promoted or delayed by exogenous ABA or Fluridone (or NDGA) treatment. The roles of ABA and ethylene in the later ripening of fruit are complex. Based on results obtained in this study, we concluded that PpNCED1 and VVNCED1 initiate ABA biosynthesis at the beginning of fruit ripening, and that ABA accumulation might play a key role in the regulation of ripeness and senescence of both peach and grape fruits.

  19. The effect of age at exposure on the inactivating mechanisms and relative contributions of key tumor suppressor genes in radiation-induced mouse T-cell lymphomas

    Sunaoshi, Masaaki [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Department of Biological Sciences, College of Science, Ibaraki University, Bunkyo 2-1-1, Mito, Ibaraki 310-8512 (Japan); Amasaki, Yoshiko; Hirano-Sakairi, Shinobu; Blyth, Benjamin J. [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Morioka, Takamitsu [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Radiation Effect Accumulation and Prevention Project, Fukushima Project Headquarters, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kaminishi, Mutsumi [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Shang, Yi [Radiation Effect Accumulation and Prevention Project, Fukushima Project Headquarters, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Nishimura, Mayumi; Shimada, Yoshiya [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Radiation Effect Accumulation and Prevention Project, Fukushima Project Headquarters, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Tachibana, Akira [Department of Biological Sciences, College of Science, Ibaraki University, Bunkyo 2-1-1, Mito, Ibaraki 310-8512 (Japan); and others


    Highlights: • T-cell lymphoma incidence, latency and weight did not change with age at exposure. • Lymphomas had frequent loss of heterozygosity on chromosomes 4, 11 and 19. • These lesions targeted the Cdkn2a, Ikaros and Pten tumor suppressor genes. • Age at exposure may influence which tumor suppressor genes are lost in each tumor. • The mechanisms of tumor suppressor gene loss were different at each locus. - Abstract: Children are considered more sensitive to radiation-induced cancer than adults, yet any differences in genomic alterations associated with age-at-exposure and their underlying mechanisms remain unclear. We assessed genome-wide DNA copy number and mutation of key tumor suppressor genes in T-cell lymphomas arising after weekly irradiation of female B6C3F1 mice with 1.2 Gy X-rays for 4 consecutive weeks starting during infancy (1 week old), adolescence (4 weeks old) or as young adults (8 weeks old). Although T-cell lymphoma incidence was similar, loss of heterozygosity at Cdkn2a on chromosome 4 and at Ikaros on chromosome 11 was more frequent in the two older groups, while loss at the Pten locus on chromosome 19 was more frequent in the infant-irradiated group. Cdkn2a and Ikaros mutation/loss was a common feature of the young adult-irradiation group, with Ikaros frequently (50%) incurring multiple independent hits (including deletions and mutations) or suffering a single hit predicted to result in a dominant negative protein (such as those lacking exon 4, an isoform we have designated Ik12, which lacks two DNA binding zinc-finger domains). Conversely, Pten mutations were more frequent after early irradiation (60%) than after young adult-irradiation (30%). Homozygous Pten mutations occurred without DNA copy number change after irradiation starting in infancy, suggesting duplication of the mutated allele by chromosome mis-segregation or mitotic recombination. Our findings demonstrate that while deletions on chromosomes 4 and 11 affecting Cdkn2

  20. Expression kinetics of key genes in the early innate immune response to Great Lakes viral hemorrhagic septicemia virus IVb infection in yellow perch (Perca flavescens)

    Olson, Wendy; Emmenegger, Eveline; Glenn, Jolene; Simchick, Crystal; Winton, Jim; Goetz, Frederick


    The recently discovered strain of viral hemorrhagic septicemia virus, VHSV-IVb, represents an example of the introduction of an extremely pathogenic rhabdovirus capable of infecting a wide variety of new fish species in a new host-environment. The goal of the present study was to delineate the expression kinetics of key genes in the innate immune response relative to the very early stages of VHSV-IVb infection using the yellow perch (Perca flavescens) as a model. Administration of VHSV-IVb by IP-injection into juvenile yellow perch resulted in 84% cumulative mortality, indicating their high susceptibility to this disease. In fish sampled in the very early stages of infection, a significant up-regulation of Mx gene expression in the liver, as well as IL-1β and SAA activation in the head kidney, spleen, and liver was directly correlated to viral load. The potential down-regulation of Mx in the hematopoietic tissues, head kidney and spleen, may represent a strategy utilized by the virus to increase replication.

  1. Homeobox Genes in the Rodent Pineal Gland

    Rath, Martin Fredensborg; Rohde, Kristian; Klein, David C


    The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential...... for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental...... functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function...

  2. Quantitative expression of regulatory and differentiation-related genes in the key steps of human hematopoiesis: The LeukoStage Database.

    Polgárová, K; Vášková, M; Froňková, E; Slámová, L; Kalina, T; Mejstříková, E; Dobiášová, A; Fišer, K; Hrušák, O


    Differentiation during hematopoiesis leads to the generation of many cell types with specific functions. At various stages of maturation, the cells may change pathologically, leading to diseases including acute leukemias (ALs). Expression levels of regulatory molecules (such as the IKZF, GATA, HOX, FOX, NOTCH and CEBP families, as well as SPI-1/PU1 and PAX5) and lineage-specific molecules (including CD2, CD14, CD79A, and BLNK) may be compared between pathological and physiological cells. Although the key steps of differentiation are known, the available databases focus mainly on fully differentiated cells as a reference. Precursor cells may be a more appropriate reference point for diseases that evolve at immature stages. Therefore, we developed a quantitative real-time polymerase chain reaction (qPCR) array to investigate 90 genes that are characteristic of the lymphoid or myeloid lineages and/or are thought to be involved in their regulation. Using this array, sorted cells of granulocytic, monocytic, T and B lineages were analyzed. For each of these lineages, 3-5 differentiation stages were selected (17 stages total), and cells were sorted from 3 different donors per stage. The qPCR results were compared to similarly processed AL cells of lymphoblastic (n=18) or myeloid (n=6) origins and biphenotypic AL cells of B cell origin with myeloid involvement (n=5). Molecules characteristic of each lineage were found. In addition, cells of a newly discovered switching lymphoblastic AL (swALL) were sorted at various phases during the supposed transdifferentiation from an immature B cell to a monocytic phenotype. As demonstrated previously, gene expression changed along with the immunophenotype. The qPCR data are publicly available in the LeukoStage Database in which gene expression in malignant and non-malignant cells of different lineages can be explored graphically and differentially expressed genes can be identified. In addition, the LeukoStage Database can aid the

  3. Developmental patterns of emission of scent compounds and related gene expression in roses of the cultivar Rosa x hybrida cv. 'Yves Piaget'.

    Chen, Xiaomin; Baldermann, Susanne; Cao, Shuyan; Lu, Yao; Liu, Caixia; Hirata, Hiroshi; Watanabe, Naoharu


    2-Phenylethanol (2PE) and 3,5-dimethoxytoluene (DMT) are characteristic scent compounds in specific roses such as Rosa x hybrida cv. 'Yves Piaget'. We analyzed the endogenous concentrations and emission of 2PE and DMT during the unfurling process in different floral organs, as well as changes in transcript levels of the two key genes, PAR and OOMT2. The emission of both 2PE and DMT increased during floral development to reach peaks at the fully unfurled stage. The relative transcripts of PAR and OOMT2 also increased during floral development. Whereas the maximum for OOMT2 was found at the fully unfurled stage (stage 4), similar expression levels of PAR were detected at stage 4 and the senescence stage (stage 6). The results demonstrate a positive correlation between the expression levels of PAR and OOMT2 and the emission of 2PE and DMT. In addition, endogenous volatiles and relative transcripts showed tissue- and development-specific patterns. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  4. Cold atmospheric plasma (CAP changes gene expression of key molecules of the wound healing machinery and improves wound healing in vitro and in vivo.

    Stephanie Arndt

    Full Text Available Cold atmospheric plasma (CAP has the potential to interact with tissue or cells leading to fast, painless and efficient disinfection and furthermore has positive effects on wound healing and tissue regeneration. For clinical implementation it is necessary to examine how CAP improves wound healing and which molecular changes occur after the CAP treatment. In the present study we used the second generation MicroPlaSter ß® in analogy to the current clinical standard (2 min treatment time in order to determine molecular changes induced by CAP using in vitro cell culture studies with human fibroblasts and an in vivo mouse skin wound healing model. Our in vitro analysis revealed that the CAP treatment induces the expression of important key genes crucial for the wound healing response like IL-6, IL-8, MCP-1, TGF-ß1, TGF-ß2, and promotes the production of collagen type I and alpha-SMA. Scratch wound healing assays showed improved cell migration, whereas cell proliferation analyzed by XTT method, and the apoptotic machinery analyzed by protein array technology, was not altered by CAP in dermal fibroblasts. An in vivo wound healing model confirmed that the CAP treatment affects above mentioned genes involved in wound healing, tissue injury and repair. Additionally, we observed that the CAP treatment improves wound healing in mice, no relevant side effects were detected. We suggest that improved wound healing might be due to the activation of a specified panel of cytokines and growth factors by CAP. In summary, our in vitro human and in vivo animal data suggest that the 2 min treatment with the MicroPlaSter ß® is an effective technique for activating wound healing relevant molecules in dermal fibroblasts leading to improved wound healing, whereas the mechanisms which contribute to these observed effects have to be further investigated.

  5. Drosophila mutants of the autism candidate gene neurobeachin (rugose) exhibit neuro-developmental disorders, aberrant synaptic properties, altered locomotion, impaired adult social behavior and activity patterns

    Wise, Alexandra; Tenezaca, Luis; Fernandez, Robert W.; Schatoff, Emma; Flores, Julian; Ueda, Atsushi; Zhong, Xiaotian; Wu, Chun-Fang; Simon, Anne F.; Venkatesh, Tadmiri


    Autism spectrum disorder (ASD) is a neurodevelopmental disorder in humans characterized by complex behavioral deficits, including intellectual disability, impaired social interactions and hyperactivity. ASD exhibits a strong genetic component with underlying multi-gene interactions. Candidate gene studies have shown that the neurobeachin gene is disrupted in human patients with idiopathic autism (Castermans et al., 2003). The gene for neurobeachin (NBEA) spans the common fragile site FRA 13A ...

  6. Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them.

    Sushil Kumar Mohapatra

    Full Text Available Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT has had a limited applicability due to very low (>1% live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF and Hand-made cloning (TE-HMC, and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF.

  7. Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis) Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them

    Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat


    Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF. PMID:26053554

  8. Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis) Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them.

    Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat


    Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF.

  9. Epigenetics and the Developmental Origins of Health and ...

    Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.

  10. Expression of StAR and Key Genes Regulating Cortisol Biosynthesis in Near Term Ovine Fetal Adrenocortical Cells: Effects of Long-Term Hypoxia.

    Vargas, Vladimir E; Myers, Dean A; Kaushal, Kanchan M; Ducsay, Charles A


    We previously demonstrated decreased expression of key genes regulating cortisol biosynthesis in long-term hypoxic (LTH) sheep fetal adrenals compared to controls. We also showed that inhibition of the extracellular signal-regulated kinases (ERKs) with the mitogen-activated protein kinase (MEK)/ERK inhibitor UO126 limited adrenocorticotropic (ACTH)-induced cortisol production in ovine fetal adrenocortical cells (FACs), suggesting a role for ERKs in cortisol synthesis. This study was designed to determine whether the previously observed decrease in LTH cytochrome P45011A1/cytochrome P450c17 (CYP11A1/CYP17) in adrenal glands was maintained in vitro, and whether ACTH alone with or without UO126 treatment had altered the expression of CYP11A1, CYP17, and steroidogenic acute regulatory protein (StAR) in control versus LTH FACs. Ewes were maintained at high altitude (3820 m) from ∼40 days of gestation (dG). At 138 to 141 dG, fetal adrenal glands were collected from LTH (n = 5) and age-matched normoxic controls (n = 6). Fetal adrenocortical cells were challenged with ACTH (10 -8 M) with or without UO126 (10 µM) for 18 hours. Media samples were collected for cortisol analysis and messenger RNA (mRNA) for CYP11A1, CYP17, and StAR was quantified by quantitative real-time polymerase chain reaction. Cortisol was higher in the LTH versus control ( P StAR mRNA was decreased in LTH versus control ( P StAR expression.

  11. The effect of ultraviolet-B radiation on gene expression and pigment composition in etiolated and green pea leaf tissue: UV-B-induced changes are gene-specific and dependent upon the developmental stage

    Jordan, B.R.; James, P.E.; Strid, A.; Anthony, R.G.


    present in low or undetectable amounts in control tissues. In green leaf tissue exposed to supplementary UV-B, a transient increase was detected. The transcripts for chs reached a maximum level after approximately 8 h UV-B exposure, and then declined to lower levels over subsequent days of diurnal photoperiods. However, a constant increase in chs was found after continuous exposure to UV-B for up to 30 h. In etiolated tissue, either white-light, supplementary UV-B or UV-B alone gave small increases in chs, only 8 h of UV-B radiation alone gave any substantial increase in chs expression. Overall, these results clearly demonstrate that the response to increased levels of UV-B radiation is dependent upon the developmental stage of the tissue and involves complex changes in gene expression. (author)

  12. Developmental dyscalculia.

    Kucian, Karin; von Aster, Michael


    Numerical skills are essential in our everyday life, and impairments in the development of number processing and calculation have a negative impact on schooling and professional careers. Approximately 3 to 6 % of children are affected from specific disorders of numerical understanding (developmental dyscalculia (DD)). Impaired development of number processing skills in these children is characterized by problems in various aspects of numeracy as well as alterations of brain activation and brain structure. Moreover, DD is assumed to be a very heterogeneous disorder putting special challenges to define homogeneous diagnostic criteria. Finally, interdisciplinary perspectives from psychology, neuroscience and education can contribute to the design for interventions, and although results are still sparse, they are promising and have shown positive effects on behaviour as well as brain function. In the current review, we are going to give an overview about typical and atypical development of numerical abilities at the behavioural and neuronal level. Furthermore, current status and obstacles in the definition and diagnostics of DD are discussed, and finally, relevant points that should be considered to make an intervention as successful as possible are summarized.

  13. Evolution and developmental genetics of floral display-A review of progress

    Qing Ma; Wenheng Zhang; Qiu-Yun (Jenny) Xiang


    Angiosperms evolved a great diversity of ways to display their flowers for reproductive success by variation in floral color,size,shape,scent,arrangements,and flowering time.The various innovations in floral forms and the aggregation of flowers into different kinds of inflorescences can drive new ecological adaptations,speciation,and angiosperm diversification.Evolutionary developmental biology (evo-devo) seeks to uncover the developmental and genetic basis underlying morphological diversification.Advances in the developmental genetics of floral display have provided a foundation for insights into the genetic basis of floral and inflorescence evolution.A number of regulatory genes controlling floral and inflorescence development have been identified in model plants (e.g.,Arabidopsis thaliana,Antirrhinum majus) using forward genetics and conserved functions of many of these genes across diverse non-model species have been revealed by reverse genetics.Gene-regulatory networks that mediated the developmental progresses of floral and inflorescence development have also been established in some plant species.Meanwhile,phylogeny-based comparative analysis of morphological and genetic character has enabled the identification of key evolutionary events that lead to morphological complexity and diversification.Here we review the recent progress on evo-devo studies of floral display including floral symmetry,petal fusion,floral color,floral scent,and inflorescences.We also review the molecular genetic approaches applied to plant evo-devo studies and highlight the future directions of evo-devo.

  14. DNA methylation differences at growth related genes correlate with birth weight: a molecular signature linked to developmental origins of adult disease?

    Turan Nahid


    Full Text Available Abstract Background Infant birth weight is a complex quantitative trait associated with both neonatal and long-term health outcomes. Numerous studies have been published in which candidate genes (IGF1, IGF2, IGF2R, IGF binding proteins, PHLDA2 and PLAGL1 have been associated with birth weight, but these studies are difficult to reproduce in man and large cohort studies are needed due to the large inter individual variance in transcription levels. Also, very little of the trait variance is explained. We decided to identify additional candidates without regard for what is known about the genes. We hypothesize that DNA methylation differences between individuals can serve as markers of gene "expression potential" at growth related genes throughout development and that these differences may correlate with birth weight better than single time point measures of gene expression. Methods We performed DNA methylation and transcript profiling on cord blood and placenta from newborns. We then used novel computational approaches to identify genes correlated with birth weight. Results We identified 23 genes whose methylation levels explain 70-87% of the variance in birth weight. Six of these (ANGPT4, APOE, CDK2, GRB10, OSBPL5 and REG1B are associated with growth phenotypes in human or mouse models. Gene expression profiling explained a much smaller fraction of variance in birth weight than did DNA methylation. We further show that two genes, the transcriptional repressor MSX1 and the growth factor receptor adaptor protein GRB10, are correlated with transcriptional control of at least seven genes reported to be involved in fetal or placental growth, suggesting that we have identified important networks in growth control. GRB10 methylation is also correlated with genes involved in reactive oxygen species signaling, stress signaling and oxygen sensing and more recent data implicate GRB10 in insulin signaling. Conclusions Single time point measurements of gene

  15. Developmental transcriptome of Aplysia californica'

    Heyland, Andreas


    Genome-wide transcriptional changes in development provide important insight into mechanisms underlying growth, differentiation, and patterning. However, such large-scale developmental studies have been limited to a few representatives of Ecdysozoans and Chordates. Here, we characterize transcriptomes of embryonic, larval, and metamorphic development in the marine mollusc Aplysia californica and reveal novel molecular components associated with life history transitions. Specifically, we identify more than 20 signal peptides, putative hormones, and transcription factors in association with early development and metamorphic stages-many of which seem to be evolutionarily conserved elements of signal transduction pathways. We also characterize genes related to biomineralization-a critical process of molluscan development. In summary, our experiment provides the first large-scale survey of gene expression in mollusc development, and complements previous studies on the regulatory mechanisms underlying body plan patterning and the formation of larval and juvenile structures. This study serves as a resource for further functional annotation of transcripts and genes in Aplysia, specifically and molluscs in general. A comparison of the Aplysia developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms that are likely a consequence of the different developmental modes of these organisms. © 2010 Wiley-Liss, Inc., A Wiley Company.

  16. Developmental processes and responses to hormonal stimuli in tea plant (Camellia sinensis) leaves are controlled by GRF and GIF gene families.

    Wu, Zhi-Jun; Wang, Wen-Li; Zhuang, Jing


    Tea plant (Camellia sinensis (L.) O. Kuntze) is an important leaf-type woody crop used for producing of non-alcoholic beverages worldwide. The GROWTH-REGULATING FACTOR (GRF) transcription factors cooperated with GRF-INTERACTING FACTOR (GIF) transcriptional coactivators positively regulate leaf development. In the present study, six GRF and two GIF genes were identified and characterized in the leaf transcriptome of C. sinensis, respectively. The alignment results showed that the feature structures of the predicted homologous GRF and GIF proteins of C. sinensis hold a high identity with Arabidopsis and rice. The presence of C. sinensis miR396 target sites suggested that these miR396 members are the potential post-transcriptional regulators of CsGRF genes. The expression profiles of CsGRF and CsGIF1 genes were higher in tender leaves and consistently downregulated during tea plant leaf development. Those results suggested that these genes may be actively involved in the early stage leaf tissue formation in tea plant. The divergence of CsGRF and CsGIF genes in response to different hormonal stimuli revealed the possible multiple functions of these genes in hormonal regulation. This study provided the potential molecular basis of the CsGRF and CsGIF family genes for future functional research on leaf development and hormonal stimuli in C. sinensis.

  17. Differential gene expression in soybean leaf tissues at late developmental stages under drought stress revealed by genome-wide transcriptome analysis.

    Dung Tien Le

    Full Text Available The availability of complete genome sequence of soybean has allowed research community to design the 66 K Affymetrix Soybean Array GeneChip for genome-wide expression profiling of soybean. In this study, we carried out microarray analysis of leaf tissues of soybean plants, which were subjected to drought stress from late vegetative V6 and from full bloom reproductive R2 stages. Our data analyses showed that out of 46,093 soybean genes, which were predicted with high confidence among approximately 66,000 putative genes, 41,059 genes could be assigned with a known function. Using the criteria of a ratio change > = 2 and a q-value<0.05, we identified 1458 and 1818 upregulated and 1582 and 1688 downregulated genes in drought-stressed V6 and R2 leaves, respectively. These datasets were classified into 19 most abundant biological categories with similar proportions. There were only 612 and 463 genes that were overlapped among the upregulated and downregulated genes, respectively, in both stages, suggesting that both conserved and unconserved pathways might be involved in regulation of drought response in different stages of plant development. A comparative expression analysis using our datasets and that of drought stressed Arabidopsis leaves revealed the existence of both conserved and species-specific mechanisms that regulate drought responses. Many upregulated genes encode either regulatory proteins, such as transcription factors, including those with high homology to Arabidopsis DREB, NAC, AREB and ZAT/STZ transcription factors, kinases and two-component system members, or functional proteins, e.g. late embryogenesis-abundant proteins, glycosyltransferases, glycoside hydrolases, defensins and glyoxalase I family proteins. A detailed analysis of the GmNAC family and the hormone-related gene category showed that expression of many GmNAC and hormone-related genes was altered by drought in V6 and/or R2 leaves. Additionally, the downregulation of

  18. Gene

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  19. Bursal transcriptome profiling of different inbred chicken lines reveals key differentially expressed genes at 3 days post-infection with very virulent infectious bursal disease virus.

    Farhanah, Mohd Isa; Yasmin, Abd Rahaman; Mat Isa, Nurulfiza; Hair-Bejo, Mohd; Ideris, Aini; Powers, Claire; Oladapo, Omobolanle; Nair, Venugopal; Khoo, Jia-Shiun; Ghazali, Ahmad-Kamal; Yee, Wai-Yan; Omar, Abdul Rahman


    Infectious bursal disease is a highly contagious disease in the poultry industry and causes immunosuppression in chickens. Genome-wide regulations of immune response genes of inbred chickens with different genetic backgrounds, following very virulent infectious bursal disease virus (vvIBDV) infection are poorly characterized. Therefore, this study aims to analyse the bursal tissue transcriptome of six inbred chicken lines 6, 7, 15, N, O and P following infection with vvIBDV strain UK661 using strand-specific next-generation sequencing, by highlighting important genes and pathways involved in the infected chicken during peak infection at 3 days post-infection. All infected chickens succumbed to the infection without major variations among the different lines. However, based on the viral loads and bursal lesion scoring, lines P and 6 can be considered as the most susceptible lines, while lines 15 and N were regarded as the least affected lines. Transcriptome profiling of the bursa identified 4588 genes to be differentially expressed, with 2985 upregulated and 1642 downregulated genes, in which these genes were commonly or uniquely detected in all or several infected lines. Genes that were upregulated are primarily pro-inflammatory cytokines, chemokines and IFN-related. Various genes that are associated with B-cell functions and genes related to apoptosis were downregulated, together with the genes involved in p53 signalling. In conclusion, bursal transcriptome profiles of different inbred lines showed differential expressions of pro-inflammatory cytokines and chemokines, Th1 cytokines, JAK-STAT signalling genes, MAPK signalling genes, and their related pathways following vvIBDV infection.

  20. A gene transfer agent and a dynamic repertoire of secretion systems hold the keys to the explosive radiation of the emerging pathogen Bartonella.

    Lionel Guy


    Full Text Available Gene transfer agents (GTAs randomly transfer short fragments of a bacterial genome. A novel putative GTA was recently discovered in the mouse-infecting bacterium Bartonella grahamii. Although GTAs are widespread in phylogenetically diverse bacteria, their role in evolution is largely unknown. Here, we present a comparative analysis of 16 Bartonella genomes ranging from 1.4 to 2.6 Mb in size, including six novel genomes from Bartonella isolated from a cow, two moose, two dogs, and a kangaroo. A phylogenetic tree inferred from 428 orthologous core genes indicates that the deadly human pathogen B. bacilliformis is related to the ruminant-adapted clade, rather than being the earliest diverging species in the genus as previously thought. A gene flux analysis identified 12 genes for a GTA and a phage-derived origin of replication as the most conserved innovations. These are located in a region of a few hundred kb that also contains 8 insertions of gene clusters for type III, IV, and V secretion systems, and genes for putatively secreted molecules such as cholera-like toxins. The phylogenies indicate a recent transfer of seven genes in the virB gene cluster for a type IV secretion system from a cat-adapted B. henselae to a dog-adapted B. vinsonii strain. We show that the B. henselae GTA is functional and can transfer genes in vitro. We suggest that the maintenance of the GTA is driven by selection to increase the likelihood of horizontal gene transfer and argue that this process is beneficial at the population level, by facilitating adaptive evolution of the host-adaptation systems and thereby expansion of the host range size. The process counters gene loss and forces all cells to contribute to the production of the GTA and the secreted molecules. The results advance our understanding of the role that GTAs play for the evolution of bacterial genomes.

  1. Dental developmental abnormalities in a patient with subtelomeric 7q36 deletion syndrome may confirm a novel role for the SHH gene ?

    Linhares, Nat?lia D.; Svartman, Marta; Salgado, Mauro Ivan; Rodrigues, Tatiane C.; da Costa, Silvia S.; Rosenberg, Carla; Valadares, Eug?nia R.


    Studies in mice demonstrated that the Shh gene is crucial for normal development of both incisors and molars, causing a severe retardation in tooth growth, which leads to abnormal placement of the tooth in the jaw and disrupted tooth morphogenesis. In humans the SHH gene is located on chromosome 7q36. Defects in its protein or signaling pathway may cause holoprosencephaly spectrum, a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres and tha...

  2. Expression analysis of cell wall assembly and remodelling-related genes in Arabidopsis roots subjected to boron stress and brassinosteroid at different developmental stages

    Rabia İşkil


    Full Text Available ABSTRACT Plant cell walls are affected by many biotic and abiotic stress conditions. The aim of this study is to determine the effects of 24-Epibrassinolide (EBL on some cell wall-related genes in root tissue of five- and ten-week-old Arabidopsis thaliana plants exposed to boron (B deficiency (0 µM or toxicity (3000 µM at the transcriptional level. Expressions of the genes that encode cellulose synthase (CESA1, CESA4, CESA6 and CESA8, cellulose synthase-like (CSLB5, expansin (EXPA5, EXPA8 and EXPA14 and cell wall protein (SEB1 decreased under conditions of B deficiency and toxicity. EBL treatments, in general, led the expressions of these genes to reduce significantly. Expressions of xyloglucan endotransglucosylase/hydrolase genes (XTH21 and XTH23 changed only under conditions of B toxicity. Boron stress and/or EBL treatments caused different responses in expression of pectin methylesterase (PME2 and PME41 genes. As a result of B stress, the expression levels of investigated genes changed more in roots of five-week-old plants than in roots of ten-week-old plants. Results of the present study include new findings that support the ability of BRs to increase molecular aspects of tolerance to stress in plants.

  3. Developmental engineering: a new paradigm for the design and manufacturing of cell-based products. Part II: from genes to networks: tissue engineering from the viewpoint of systems biology and network science.

    Lenas, Petros; Moos, Malcolm; Luyten, Frank P


    The field of tissue engineering is moving toward a new concept of "in vitro biomimetics of in vivo tissue development." In Part I of this series, we proposed a theoretical framework integrating the concepts of developmental biology with those of process design to provide the rules for the design of biomimetic processes. We named this methodology "developmental engineering" to emphasize that it is not the tissue but the process of in vitro tissue development that has to be engineered. To formulate the process design rules in a rigorous way that will allow a computational design, we should refer to mathematical methods to model the biological process taking place in vitro. Tissue functions cannot be attributed to individual molecules but rather to complex interactions between the numerous components of a cell and interactions between cells in a tissue that form a network. For tissue engineering to advance to the level of a technologically driven discipline amenable to well-established principles of process engineering, a scientifically rigorous formulation is needed of the general design rules so that the behavior of networks of genes, proteins, or cells that govern the unfolding of developmental processes could be related to the design parameters. Now that sufficient experimental data exist to construct plausible mathematical models of many biological control circuits, explicit hypotheses can be evaluated using computational approaches to facilitate process design. Recent progress in systems biology has shown that the empirical concepts of developmental biology that we used in Part I to extract the rules of biomimetic process design can be expressed in rigorous mathematical terms. This allows the accurate characterization of manufacturing processes in tissue engineering as well as the properties of the artificial tissues themselves. In addition, network science has recently shown that the behavior of biological networks strongly depends on their topology and has

  4. [Neurotransmission in developmental disorders].

    Takeuchi, Yoshihiro


    Attention deficit/hyperactivity disorder (AD/HD) is a heterogeneous developmental disorder with an etiology that is not fully understood. AD/HD has been considered to occur due to a disturbance in cathecholaminergic neurotransmission, with particular emphasis on dopamine. The neurotransmission of dopamine in subcortical regions such as the basal ganglia and limbic areas is synaptic; on the other hand, dopamine neurotransmission in the frontal cortex is quite different, because there are very few dopamine transporters (DAT) in the frontal cortex that allow dopamine to diffuse away from the dopamine synapse ("volume transmission"). It is now clear that noradrenergic neurons play a key regulatory role in dopaminergic function in the frontal cortex. Furthermore, serotonergic neurons exert an inhibitory effect on midbrain dopamine cell bodies, and they have an influence on dopamine release in terminal regions. There is accumulating neurobiological evidence pointing toward a role of the serotonin system in AD/HD. The etiology of autism spectrum disorders (ASD) is still unclear, but information from genetics, neuropathology, brain imaging, and basic neuroscience has provided insights into the understanding of this developmental disorder. In addition to abnormal circuitry in specific limbic and neocortical areas of the cerebral cortex, impairments in brainstem, cerebellar, thalamic, and basal ganglia connections have been reported. Numerous studies have pointed to abnormalities in serotonin and glutamate neurotransmission. Three important aspects involved in the pathophysiology of ASD have been proposed. The first is cell migration, the second is unbalanced excitatory-inhibitory networks, and the third is synapse formation and pruning, the key factors being reelin, neurexin, and neuroligin. Serotonin is considered to play an important role in all of these aspects of the pathophysiology of ASD. Finally, I would like to emphasize that it is crucial in the field of child

  5. Significant differences in gene expression and key genetic components associated with high growth vigor in populus section tacamahaca as revealed by comparative transcriptome analysis

    Cheng, S.; Chen, M.; Li, Y.; Wang, J.; Sun, X.; Wang, J.


    To identify genetic components involved in high growth vigor in F1 Populus section Tacamahaca hybrid plants, high and low vigor plants showing significant differences in apical dominance during a rapid growth period were selected. Apical bud transcriptomes of high and low-growth-vigor hybrids and their parents were analyzed using high-throughput RNA sequencing on an Illumina HiSeq 2000 platform. A total of 5,542 genes were differently expressed between high growth vigor hybrid and its parents, the genes were significantly enriched in pathways related to processes such as photosynthesis, pyrimidine ribonucleotide biosynthetic processes and nucleoside metabolic processes. There were 1410 differentially expressed genes between high and low growth vigor hybrid, the genes were mainly involved in photosynthesis, chlorophyll biosynthetic process, carbon fixation in photosynthetic organisms, porphyrin and chlorophyll metabolism and nitrogen metabolism. Moreover, a k-core of a gene co-expression network analysis was performed to identify the potential functions of genes related to high growth vigor. The functions of 8 selected candidate genes were associated mainly with circadian rhythm, water transport, cellulose catabolic processes, sucrose biosynthesis, pyrimidine ribonucleotide biosynthesis, purine nucleotide biosynthesis, meristem maintenance, and carbohydrate metabolism. Our results may contribute to a better understanding of the molecular basis of high growth vigor in hybrids and its regulation. (author)

  6. Increased insulin sensitivity and changes in the expression profile of key insulin regulatory genes and beta cell transcription factors in diabetic KKAy-mice after feeding with a soy bean protein rich diet high in isoflavone content.

    Nordentoft, I; Jeppesen, P B; Hong, J; Abudula, R; Hermansen, K


    High content isoflavone soy protein (SBP) (Abalon) has been found in animal studies to possess beneficial effects on a number of the characteristic features of the insulin resistance syndrome. The aim of this study was to investigate whether SBP exerts beneficial effects on metabolism in the diabetic KKAy-mouse. Furthermore, we investigated the long-term in vivo effect of SBP on the expression profile in islets of key insulin regulatory genes. Twenty KKAy-mice, aged 5 weeks, were divided into 2 groups and treated for 9 weeks with either (A) standard chow diet (control) or (B) chow + 50% SBP. Twenty normal C57BL-mice fed with standard chow diet served as nondiabetic controls (C). Blood samples were collected and analyzed before and after intervention. Gene expression was determined in islets by quantitative real-time RT-PCR and Affymetrix microarray. It was demonstrated that long-term treatment with SBP improves glucose homeostasis, increases insulin sensitivity, and lowers plasma triglycerides in diabetic KKAy-mice. SBP reduces fasting plasma glucose, insulin, triglycerides, and total cholesterol. Furthermore, SBP markedly changes the gene expression profile of key insulin regulatory genes GLUT2, GLUT3, Ins1, Ins2, IGF1, Beta2/Neurod1, cholecystokinin, and LDLr, and proliferative genes in islets isolated from KKAy-mice. After 9 weeks of treatment with SBP, plasma glucose and insulin homeostasis was normalized compared to start levels. The results indicate that SBP improves glucose and insulin sensitivity and up-regulates the expression of key insulin regulatory genes.

  7. Genome-wide analysis of brain and gonad transcripts reveals changes of key sex reversal-related genes expression and signaling pathways in three stages of Monopterus albus.

    Wei Chi

    Full Text Available The natural sex reversal severely affects the sex ratio and thus decreases the productivity of the rice field eel (Monopterus albus. How to understand and manipulate this process is one of the major issues for the rice field eel stocking. So far the genomics and transcriptomics data available for this species are still scarce. Here we provide a comprehensive study of transcriptomes of brain and gonad tissue in three sex stages (female, intersex and male from the rice field eel to investigate changes in transcriptional level during the sex reversal process.Approximately 195 thousand unigenes were generated and over 44.4 thousand were functionally annotated. Comparative study between stages provided multiple differentially expressed genes in brain and gonad tissue. Overall 4668 genes were found to be of unequal abundance between gonad tissues, far more than that of the brain tissues (59 genes. These genes were enriched in several different signaling pathways. A number of 231 genes were found with different levels in gonad in each stage, with several reproduction-related genes included. A total of 19 candidate genes that could be most related to sex reversal were screened out, part of these genes' expression patterns were validated by RT-qPCR. The expression of spef2, maats1, spag6 and dmc1 were abundant in testis, but was barely detected in females, while the 17β-hsd12, zpsbp3, gal3 and foxn5 were only expressed in ovary.This study investigated the complexity of brain and gonad transcriptomes in three sex stages of the rice field eel. Integrated analysis of different gene expression and changes in signaling pathways, such as PI3K-Akt pathway, provided crucial data for further study of sex transformation mechanisms.

  8. Comparative Bioinformatics Analysis of Transcription Factor Genes Indicates Conservation of Key Regulatory Domains among Babesia bovis, Babesia microti, and Theileria equi.

    Alzan, Heba F; Knowles, Donald P; Suarez, Carlos E


    Apicomplexa tick-borne hemoparasites, including Babesia bovis, Babesia microti, and Theileria equi are responsible for bovine and human babesiosis and equine theileriosis, respectively. These parasites of vast medical, epidemiological, and economic impact have complex life cycles in their vertebrate and tick hosts. Large gaps in knowledge concerning the mechanisms used by these parasites for gene regulation remain. Regulatory genes coding for DNA binding proteins such as members of the Api-AP2, HMG, and Myb families are known to play crucial roles as transcription factors. Although the repertoire of Api-AP2 has been defined and a HMG gene was previously identified in the B. bovis genome, these regulatory genes have not been described in detail in B. microti and T. equi. In this study, comparative bioinformatics was used to: (i) identify and map genes encoding for these transcription factors among three parasites' genomes; (ii) identify a previously unreported HMG gene in B. microti; (iii) define a repertoire of eight conserved Myb genes; and (iv) identify AP2 correlates among B. bovis and the better-studied Plasmodium parasites. Searching the available transcriptome of B. bovis defined patterns of transcription of these three gene families in B. bovis erythrocyte stage parasites. Sequence comparisons show conservation of functional domains and general architecture in the AP2, Myb, and HMG proteins, which may be significant for the regulation of common critical parasite life cycle transitions in B. bovis, B. microti, and T. equi. A detailed understanding of the role of gene families encoding DNA binding proteins will provide new tools for unraveling regulatory mechanisms involved in B. bovis, B. microti, and T. equi life cycles and environmental adaptive responses and potentially contributes to the development of novel convergent strategies for improved control of babesiosis and equine piroplasmosis.

  9. Comparative Bioinformatics Analysis of Transcription Factor Genes Indicates Conservation of Key Regulatory Domains among Babesia bovis, Babesia microti, and Theileria equi.

    Heba F Alzan


    Full Text Available Apicomplexa tick-borne hemoparasites, including Babesia bovis, Babesia microti, and Theileria equi are responsible for bovine and human babesiosis and equine theileriosis, respectively. These parasites of vast medical, epidemiological, and economic impact have complex life cycles in their vertebrate and tick hosts. Large gaps in knowledge concerning the mechanisms used by these parasites for gene regulation remain. Regulatory genes coding for DNA binding proteins such as members of the Api-AP2, HMG, and Myb families are known to play crucial roles as transcription factors. Although the repertoire of Api-AP2 has been defined and a HMG gene was previously identified in the B. bovis genome, these regulatory genes have not been described in detail in B. microti and T. equi. In this study, comparative bioinformatics was used to: (i identify and map genes encoding for these transcription factors among three parasites' genomes; (ii identify a previously unreported HMG gene in B. microti; (iii define a repertoire of eight conserved Myb genes; and (iv identify AP2 correlates among B. bovis and the better-studied Plasmodium parasites. Searching the available transcriptome of B. bovis defined patterns of transcription of these three gene families in B. bovis erythrocyte stage parasites. Sequence comparisons show conservation of functional domains and general architecture in the AP2, Myb, and HMG proteins, which may be significant for the regulation of common critical parasite life cycle transitions in B. bovis, B. microti, and T. equi. A detailed understanding of the role of gene families encoding DNA binding proteins will provide new tools for unraveling regulatory mechanisms involved in B. bovis, B. microti, and T. equi life cycles and environmental adaptive responses and potentially contributes to the development of novel convergent strategies for improved control of babesiosis and equine piroplasmosis.

  10. Saffron: Its Phytochemistry, Developmental Processes, and Biotechnological Prospects.

    Ahrazem, Oussama; Rubio-Moraga, Angela; Nebauer, Sergio G; Molina, Rosa Victoria; Gómez-Gómez, Lourdes


    The present state of knowledge concerning developmental processes and the secondary metabolism of saffron, Crocus sativus L. (Iridaceae), along with the genes involved in these processes so far known, is reviewed. Flowers and corms constitute the most valuable parts of saffron. Corm and flower development are two key aspects to be studied in saffron to increase the yield and quality of the spice, to raise its reproductive rate, and to implement new production systems. Important knowledge about the physiology of flowering and vegetative growth has been acquired in recent years, but there is still only limited information on molecular mechanisms controlling these processes. Although some genes involved in flower formation and meristem transition in other species have been isolated in saffron, the role of these genes in this species awaits further progress. Also, genes related with the synthesis pathway of abscisic acid and strigolactones, growth regulators related with bud endodormancy and apical dominance (paradormancy), have been isolated. However, the in-depth understanding of these processes as well as of corm development is far from being achieved. By contrast, saffron phytochemicals have been widely studied. The different flower tissues and the corm have been proved to be an important source of phytochemicals with pharmacological properties. The biotechnological prospects for saffron are here reviewed on the basis of the discovery of the enzymes involved in key aspects of saffron secondary metabolism, and we also analyze the possibility of transferring current knowledge about flowering and vegetative propagation in model species to the Crocus genus.

  11. Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

    Arenas-Mena, Cesar; Coffman, James A.


    Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

  12. Genome-Wide Identification of Glyoxalase Genes in Medicago truncatula and Their Expression Profiling in Response to Various Developmental and Environmental Stimuli

    Ajit Ghosh


    Full Text Available Glyoxalase is an evolutionary highly conserved pathway present in all organisms. Conventional glyoxalase pathway has two enzymes, glyoxalase I (GLYI and glyoxalase II (GLYII that act sequentially to detoxify a highly cytotoxic compound methylglyoxal (MG to D-lactate with the help of reduced glutathione. Recently, proteins with DJ-1/PfpI domain have been reported to perform the same conversion in a single step without the help of any cofactor and thus termed as “unique glyoxalase III” enzyme. Genome-wide analysis of glyoxalase genes have been previously conducted in Arabidopsis, rice and Soybean plants, but no such study was performed for one of the agricultural important model legume species, Medicago truncatula. A comprehensive genome-wide analysis of Medicago identified a total of putative 29 GLYI, 14 GLYII genes, and 5 glyoxalase III (DJ-1 genes. All these identified genes and their corresponding proteins were analyzed in detail including their chromosomal distribution, gene duplication, phylogenetic relationship, and the presence of conserved domain(s. Expression of all these genes was analyzed in different tissues as well as under two devastating abiotic stresses- salinity and drought using publicly available transcript data. This study revealed that MtGLYI-4, MtGLYII-6, and MtDJ-1A are the constitutive members with a high level of expression at all 17 analyzed tissues; while MtGLYI-1, MtGLYI-11, MtGLYI-5, MtGLYI-7, and MtGLYII-13 showed tissue-specific expression. Moreover, most of the genes displayed similar pattern of expression in response to both salinity and drought stress, irrespective of stress duration and tissue type. MtGLYI-8, MtGLYI-11, MtGLYI-6, MtGLYI-16, MtGLYI-21, and MtGLYII-9 showed up-regulation, while MtGLYI-17 and MtGLYI-7/9 showed down-regulation in response to both stresses. Interestingly, MtGLYI-14/15 showed completely opposite pattern of expression in these two stresses. This study provides an initial basis

  13. An explanatory evo-devo model for the developmental hourglass [v1; ref status: indexed,

    Saamer Akhshabi


    Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.

  14. An explanatory evo-devo model for the developmental hourglass [v2; ref status: indexed,

    Saamer Akhshabi


    Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.

  15. Evidence that phosphatidylcholine-specific phospholipase C is a key molecule mediating insulin-induced enhancement of gene expression from human cytomegalovirus promoter in CHO cells

    Zhang, Yingpei; Katakura, Yoshinori; Seto, Perry; Shirahata, Sanetaka


    The signal transduction from insulin to its receptors and Ras has been extensively studied, while little has been reported beyond these steps. We found that the expression of human interleukin 6 gene under the control of immediate early gene promoter of human cytomegalovirus was enhanced by insulin sitmulation in Chinese hamster ovary cells. The induction effect of insulin was not significantly affected by inhibitors or activators of conventional protein kinase C, cAMP dependent protein kinas...

  16. Comparative Transcriptome Analysis of Mink (Neovison vison) Skin Reveals the Key Genes Involved in the Melanogenesis of Black and White Coat Colour.

    Song, Xingchao; Xu, Chao; Liu, Zongyue; Yue, Zhigang; Liu, Linling; Yang, Tongao; Cong, Bo; Yang, Fuhe


    Farmed mink (Neovison vison) is one of the most important fur-bearing species worldwide, and coat colour is a crucial qualitative characteristic that contributes to the economic value of the fur. To identify additional genes that may play important roles in coat colour regulation, Illumina/Solexa high-throughput sequencing technology was used to catalogue the global gene expression profiles in mink skin with two different coat colours (black and white). RNA-seq analysis indicated that a total of 12,557 genes were differentially expressed in black versus white minks, with 3,530 genes up-regulated and 9,027 genes down-regulated in black minks. Significant differences were not observed in the expression of MC1R and TYR between the two different coat colours, and the expression of ASIP was not detected in the mink skin of either coat colour. The expression levels of KITLG, LEF1, DCT, TYRP1, PMEL, Myo5a, Rab27a and SLC7A11 were validated by qRT-PCR, and the results were consistent with RNA-seq analysis. This study provides several candidate genes that may be associated with the development of two coat colours in mink skin. These results will expand our understanding of the complex molecular mechanisms underlying skin physiology and melanogenesis in mink and will provide a foundation for future studies.

  17. Towards mastering CRISPR-induced gene knock-in in plants: Survey of key features and focus on the model Physcomitrella patens.

    Collonnier, Cécile; Guyon-Debast, Anouchka; Maclot, François; Mara, Kostlend; Charlot, Florence; Nogué, Fabien


    Beyond its predominant role in human and animal therapy, the CRISPR-Cas9 system has also become an essential tool for plant research and plant breeding. Agronomic applications rely on the mastery of gene inactivation and gene modification. However, if the knock-out of genes by non-homologous end-joining (NHEJ)-mediated repair of the targeted double-strand breaks (DSBs) induced by the CRISPR-Cas9 system is rather well mastered, the knock-in of genes by homology-driven repair or end-joining remains difficult to perform efficiently in higher plants. In this review, we describe the different approaches that can be tested to improve the efficiency of CRISPR-induced gene modification in plants, which include the use of optimal transformation and regeneration protocols, the design of appropriate guide RNAs and donor templates and the choice of nucleases and means of delivery. We also present what can be done to orient DNA repair pathways in the target cells, and we show how the moss Physcomitrella patens can be used as a model plant to better understand what DNA repair mechanisms are involved, and how this knowledge could eventually be used to define more performant strategies of CRISPR-induced gene knock-in. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Site-specific variation in gene expression from Symbiodinium spp. associated with offshore and inshore Porites astreoides in the lower Florida Keys is lost with bleaching and disease stress.

    Briana Hauff Salas

    Full Text Available Scleractinian coral are experiencing unprecedented rates of mortality due to increases in sea surface temperatures in response to global climate change. Some coral species however, survive high temperature events due to a reduced susceptibility to bleaching. We investigated the relationship between bleaching susceptibility and expression of five metabolically related genes of Symbiodinium spp. from the coral Porites astreoides originating from an inshore and offshore reef in the Florida Keys. The acclimatization potential of Symbiodinium spp. to changing temperature regimes was also measured via a two-year reciprocal transplant between the sites. Offshore coral fragments displayed significantly higher expression in Symbiodinium spp. genes PCNA, SCP2, G3PDH, PCP and psaE than their inshore counterparts (p<0.05, a pattern consistent with increased bleaching susceptibility in offshore corals. Additionally, gene expression patterns in Symbiodinium spp. from site of origin were conserved throughout the two-year reciprocal transplant, indicating acclimatization did not occur within this multi-season time frame. Further, laboratory experiments were used to investigate the influence of acute high temperature (32°C for eight hours and disease (lipopolysaccharide of Serratia marcescens on the five metabolically related symbiont genes from the same offshore and inshore P. astreoides fragments. Gene expression did not differ between reef fragments, or as a consequence of acute exposure to heat or heat and disease, contrasting to results found in the field. Gene expression reported here indicates functional variation in populations of Symbiodinium spp. associated with P. astreoides in the Florida Keys, and is likely a result of localized adaptation. However, gene expression patterns observed in the lab imply that functional variation in zooxanthellae observed under conditions of chronic moderate stress is lost under the acute extreme conditions studied here.

  19. Developmental Psycho- Neurological Research Trends and Their Importance for Reassessing Key Decision-Making Assumptions for Children, Adolescents, and Young Adults in Juvenile/Youth and Adult Criminal Justice Systems

    Raymond Corrado


    Full Text Available One of the underlying foundations of Western criminal justice is the notion that human behavior is the product of rational choice. The creation of separate justice systems for juveniles and adults is based on the idea that fundamental differences in rationality exist between these two groups. Since its inception, the establishment of upper and lower boundaries demarking the juvenile justice system has been a highly contentious issue, both scientifically and politically. Critically, this debate stems from the largely arbitrary nature of the boundaries. Over the last thirty years a sufficiently large body of psychological and neurological empirical work has examined the development of decision-making and rational choice in late childhood, adolescents, and adulthood. The current article discusses the implications of this research on the establishment of upper and lower age jurisdictions for the juvenile justice system, as well as how adolescent decision-making influences other key aspects of the justice process such as competency to stand trial.

  20. Expression and developmental control of platelet-derived growth factor A-chain and B-chain/Sis genes in rat aortic smooth muscle cells

    Majesky, M.W.; Benditt, E.P.; Schwartz, S.M.


    Cultured arterial smooth muscle cells (SMC) can produce platelet-derived growth factor (PDGF)-like molecules. This property raises the possibility that SMC-derived PDGFs function as autocrine/paracrine regulators in the formation and maintenance of the artery wall. In this study the authors have asked if levels of mRNAs directing synthesis of PDFG are modulated in aortic SMC during postnatal development. The authors report here that genes encoding PDGF A- and B-chain precursors are expressed at similar low levels in intact aortas from newborn and adult rats. Marked differences in regulation of transcript abundance of these genes were revealed when aortic SMC were grown in cell culture. PDGF B-chain transcripts accumulated in passaged newborn rat SMC but not adult rat SMC, whereas PDGF A-chain RNA was found in comparable amounts in SMC from both age groups. Similarly, SMC from newborn rats secreted at least 60-fold more PDGF-like activity into conditioned medium than did adult rat SMC. These results show that PDGF A- and B-chain genes are transcribed in the normal rat aorta and provide evidence for age-related change in the control of PDGF B-chain gene expression in aortic SMC. Independent regulation of transcript levels in cultured SMC leaves open the possibility that PDGFs of different composition (AA, AB, BB) play different roles in normal function of the artery wall

  1. Aberrant Epigenetic Gene Regulation in GABAergic Interneuron Subpopulations in the Hippocampal Dentate Gyrus of Mouse Offspring Following Developmental Exposure to Hexachlorophene.

    Watanabe, Yousuke; Abe, Hajime; Nakajima, Kota; Ideta-Otsuka, Maky; Igarashi, Katsuhide; Woo, Gye-Hyeong; Yoshida, Toshinori; Shibutani, Makoto


    Maternal hexachlorophene (HCP) exposure causes transient disruption of hippocampal neurogenesis in mouse offspring. We examined epigenetically hypermethylated and downregulated genes related to this HCP-induced disrupted neurogenesis. Mated female mice were dietary exposed to 0 or 100 ppm HCP from gestational day 6 to postnatal day (PND) 21 on weaning. The hippocampal dentate gyrus of male offspring was subjected to methyl-capture sequencing and real-time reverse transcription-polymerase chain reaction analyses on PND 21. Validation analyses on methylation identified three genes, Dlx4, Dmrt1, and Plcb4, showing promoter-region hypermethylation. Immunohistochemically, DLX4+, DMRT1+, and PLCB4+ cells in the dentate hilus co-expressed GAD67, a γ-aminobutyric acid (GABA)ergic neuron marker. HCP decreased all of three subpopulations as well as GAD67+ cells on PND 21. PLCB4+ cells also co-expressed the metabotropic glutamate receptor, GRM1. HCP also decreased transcript level of synaptic plasticity-related genes in the dentate gyrus and immunoreactive granule cells for synaptic plasticity-related ARC. On PND 77, all immunohistochemical cellular density changes were reversed, whereas the transcript expression of the synaptic plasticity-related genes fluctuated. Thus, HCP-exposed offspring transiently reduced the number of GABAergic interneurons. Among them, subpopulations expressing DLX4, DMRT1, or PLCB4 were transiently reduced in number through an epigenetic mechanism. Considering the role of the Dlx gene family in GABAergic interneuron migration and differentiation, the decreased number of DLX4+ cells may be responsible for reducing those GABAergic interneurons regulating neurogenesis. The effect on granule cell synaptic plasticity was sustained until the adult stage, and reduced GABAergic interneurons active in GRM1-PLCB4 signaling may be responsible for the suppression on weaning.

  2. Proteome and Transcriptome Analysis of Ovary, Intersex Gonads, and Testis Reveals Potential Key Sex Reversal/Differentiation Genes and Mechanism in Scallop Chlamys nobilis.

    Shi, Yu; Liu, Wenguang; He, Maoxian


    Bivalve mollusks exhibit hermaphroditism and sex reversal/differentiation. Studies generally focus on transcriptional profiling and specific genes related to sex determination and differentiation. Few studies on sex reversal/differentiation have been reported. A combination analysis of gonad proteomics and transcriptomics was conducted on Chlamys nobilis to provide a systematic understanding of sex reversal/differentiation in bivalves. We obtained 4258 unique peptides and 93,731 unigenes with good correlation between messenger RNA and protein levels. Candidate genes in sex reversal/differentiation were found: 15 genes differentially expressed between sexes were identified and 12 had obvious sexual functions. Three novel genes (foxl2, β-catenin, and sry) were expressed highly in intersex individuals and were likely involved in the control of gonadal sex in C. nobilis. High expression of foxl2 or β-catenin may inhibit sry and activate 5-HT receptor and vitellogenin to maintain female development. High expression of sry may inhibit foxl2 and β-catenin and activate dmrt2, fem-1, sfp2, sa6, Amy-1, APCP4, and PLK to maintain male function. High expression of sry, foxl2, and β-catenin in C. nobilis may be involved in promoting and maintaining sex reversal/differentiation. The downstream regulator may not be dimorphic expressed genes, but genes expressed in intersex individuals, males and females. Different expression patterns of sex-related genes and gonadal histological characteristics suggested that C. nobilis may change its sex from male to female. These findings suggest highly conserved sex reversal/differentiation with diverged regulatory pathways during C. nobilis evolution. This study provides valuable genetic resources for understanding sex reversal/differentiation (intersex) mechanisms and pathways underlying bivalve reproductive regulation.

  3. Developmental cognitive genetics: How psychology can inform genetics and vice versa

    Bishop, Dorothy V. M.


    Developmental neuropsychology is concerned with uncovering the underlying basis of developmental disorders such as specific language impairment (SLI), developmental dyslexia, and autistic disorder. Twin and family studies indicate that genetic influences play an important part in the aetiology of all of these disorders, yet progress in identifying genes has been slow. One way forward is to cut loose from conventional clinical criteria for diagnosing disorders and to focus instead on measures of underlying cognitive mechanisms. Psychology can inform genetics by clarifying what the key dimensions are for heritable phenotypes. However, it is not a one-way street. By using genetically informative designs, one can gain insights about causal relationships between different cognitive deficits. For instance, it has been suggested that low-level auditory deficits cause phonological problems in SLI. However, a twin study showed that, although both types of deficit occur in SLI, they have quite different origins, with environmental factors more important for auditory deficit, and genes more important for deficient phonological short-term memory. Another study found that morphosyntactic deficits in SLI are also highly heritable, but have different genetic origins from impairments of phonological short-term memory. A genetic perspective shows that a search for the underlying cause of developmental disorders may be misguided, because they are complex and heterogeneous and are associated with multiple risk factors that only cause serious disability when they occur in combination. PMID:16769616

  4. Neurodevelopmental disorders associated with dosage imbalance of ZBTB20 correlate with the morbidity spectrum of ZBTB20 candidate target genes

    Rasmussen, Malene B; Nielsen, Jakob V; Lourenço, Charles M


    (SRO) involved five RefSeq genes, including the transcription factor gene ZBTB20 and the dopamine receptor gene DRD3, considered as candidate genes for the syndrome. METHODS AND RESULTS: We used array comparative genomic hybridization and next-generation mate-pair sequencing to identify key structural...... patient with developmental delay and autism, we detected the first microdeletion at 3q13.31, which truncated ZBTB20 but did not involve DRD3 or the other genes within the previously defined SRO. Zbtb20 directly represses 346 genes in the developing murine brain. Of the 342 human orthologous ZBTB20...

  5. Identification of the key bitter compounds in our daily diet is a prerequisite for the understanding of the hTAS2R gene polymorphisms affecting food choice.

    Hofmann, Thomas


    In order to decode genetic variations affecting food choice and to determine whether to accept or to reject certain food products, it is a necessary prerequisite to deorphanize the hTAS2R/ligand pairs using the key bitter compounds in foods as stimuli rather than doing this either by using artificial molcules, to which the normal consumer had never been exposed, or by using food-born molecules which do not at all contribute to the overall bitterness. Therefore, the chemical structure of the most active bitter molecules in foods needs to be unequivocally determined in order to be sure that hTAS2R polymorphisms are related to the key molecules which really contribute to the overall bitterness perception of food products. As most studies focused primarily on quantitatively predominating compounds, rather than selecting the target compounds to be identified with regard to taste-activity, it seems that yet unknown components play a key role in evoking the bitter taste of food products. Driven by the need to discover the key players inducing the food taste, the research area "sensomics" made tremendous efforts in recent years to map the sensometabolome and to identify the most intense taste-active metabolites in fresh and processed foods. The present article summarizes recent studies on the identification of orphan key bitter stimuli in fresh, fermented, and thermally processed foods using carrots, cheese, and roasted coffee as examples.

  6. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo


    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

  7. Differential developmental expression of transcription factors GATA-4 and GATA-6, their cofactor FOG-2 and downstream target genes in testicular carcinoma in situ and germ cell tumors

    Salonen, Jonna; Rajpert-De Meyts, E; Mannisto, Susanna


    Testicular germ cell cancer is the most common malignancy among young males. The pre-invasive precursor, carcinoma in situ testis (CIS), presumably originates from arrested and transformed fetal gonocytes. Given that GATA transcription factors have essential roles in embryonic and testicular deve...... development, we explored the expression of GATA-4, GATA-6, cofactor friend of GATA (FOG)-2, and downstream target genes during human testis development and addressed the question whether changes in this pathway may contribute to germ cell neoplasms....

  8. UPLC/Q-TOF MS-based metabolomics and qRT-PCR in enzyme gene screening with key role in triterpenoid saponin biosynthesis of Polygala tenuifolia.

    Zhang, Fusheng; Li, Xiaowei; Li, Zhenyu; Xu, Xiaoshuang; Peng, Bing; Qin, Xuemei; Du, Guanhua


    The dried root of Polygala tenuifolia, named Radix Polygalae, is a well-known traditional Chinese medicine. Triterpenoid saponins are some of the most important components of Radix Polygalae extracts and are widely studied because of their valuable pharmacological properties. However, the relationship between gene expression and triterpenoid saponin biosynthesis in P. tenuifolia is unclear. In this study, ultra-performance liquid chromatography (UPLC) coupled with quadrupole time-of-flight mass spectrometry (Q-TOF MS)-based metabolomic analysis was performed to identify and quantify the different chemical constituents of the roots, stems, leaves, and seeds of P. tenuifolia. A total of 22 marker compounds (VIP>1) were explored, and significant differences in all 7 triterpenoid saponins among the different tissues were found. We also observed an efficient reference gene GAPDH for different tissues in this plant and determined the expression level of some genes in the triterpenoid saponin biosynthetic pathway. Results showed that MVA pathway has more important functions in the triterpenoid saponin biosynthesis of P. tenuifolia. The expression levels of squalene synthase (SQS), squalene monooxygenase (SQE), and beta-amyrin synthase (β-AS) were highly correlated with the peak area intensity of triterpenoid saponins compared with data from UPLC/Q-TOF MS-based metabolomic analysis. This finding suggested that a combination of UPLC/Q-TOF MS-based metabolomics and gene expression analysis can effectively elucidate the mechanism of triterpenoid saponin biosynthesis and can provide useful information on gene discovery. These findings can serve as a reference for using the overexpression of genes encoding for SQS, SQE, and/or β-AS to increase the triterpenoid saponin production of P. tenuifolia.

  9. UPLC/Q-TOF MS-based metabolomics and qRT-PCR in enzyme gene screening with key role in triterpenoid saponin biosynthesis of Polygala tenuifolia.

    Fusheng Zhang

    Full Text Available The dried root of Polygala tenuifolia, named Radix Polygalae, is a well-known traditional Chinese medicine. Triterpenoid saponins are some of the most important components of Radix Polygalae extracts and are widely studied because of their valuable pharmacological properties. However, the relationship between gene expression and triterpenoid saponin biosynthesis in P. tenuifolia is unclear.In this study, ultra-performance liquid chromatography (UPLC coupled with quadrupole time-of-flight mass spectrometry (Q-TOF MS-based metabolomic analysis was performed to identify and quantify the different chemical constituents of the roots, stems, leaves, and seeds of P. tenuifolia. A total of 22 marker compounds (VIP>1 were explored, and significant differences in all 7 triterpenoid saponins among the different tissues were found. We also observed an efficient reference gene GAPDH for different tissues in this plant and determined the expression level of some genes in the triterpenoid saponin biosynthetic pathway. Results showed that MVA pathway has more important functions in the triterpenoid saponin biosynthesis of P. tenuifolia. The expression levels of squalene synthase (SQS, squalene monooxygenase (SQE, and beta-amyrin synthase (β-AS were highly correlated with the peak area intensity of triterpenoid saponins compared with data from UPLC/Q-TOF MS-based metabolomic analysis.This finding suggested that a combination of UPLC/Q-TOF MS-based metabolomics and gene expression analysis can effectively elucidate the mechanism of triterpenoid saponin biosynthesis and can provide useful information on gene discovery. These findings can serve as a reference for using the overexpression of genes encoding for SQS, SQE, and/or β-AS to increase the triterpenoid saponin production of P. tenuifolia.

  10. Drosophila mutants of the autism candidate gene neurobeachin (rugose) exhibit neuro-developmental disorders, aberrant synaptic properties, altered locomotion, and impaired adult social behavior and activity patterns.

    Wise, Alexandria; Tenezaca, Luis; Fernandez, Robert W; Schatoff, Emma; Flores, Julian; Ueda, Atsushi; Zhong, Xiaotian; Wu, Chun-Fang; Simon, Anne F; Venkatesh, Tadmiri


    Autism spectrum disorder (ASD) is a neurodevelopmental disorder in humans characterized by complex behavioral deficits, including intellectual disability, impaired social interactions, and hyperactivity. ASD exhibits a strong genetic component with underlying multigene interactions. Candidate gene studies have shown that the neurobeachin (NBEA) gene is disrupted in human patients with idiopathic autism ( Castermans et al., 2003 ). The NBEA gene spans the common fragile site FRA 13A and encodes a signal scaffold protein ( Savelyeva et al., 2006 ). In mice, NBEA has been shown to be involved in the trafficking and function of a specific subset of synaptic vesicles. ( Medrihan et al., 2009 ; Savelyeva et al., 2006 ). Rugose (rg) is the Drosophila homolog of the mammalian and human NBEA. Our previous genetic and molecular analyses have shown that rg encodes an A kinase anchor protein (DAKAP 550), which interacts with components of the epidermal growth factor receptor or EGFR and Notch-mediated signaling pathways, facilitating cross talk between these and other pathways ( Shamloula et al., 2002 ). We now present functional data from studies on the larval neuromuscular junction that reveal abnormal synaptic architecture and physiology. In addition, adult rg loss-of-function mutants exhibit defective social interactions, impaired habituation, aberrant locomotion, and hyperactivity. These results demonstrate that Drosophila NBEA (rg) mutants exhibit phenotypic characteristics reminiscent of human ASD and thus could serve as a genetic model for studying ASDs.

  11. Sense and antisense transcripts of the developmentally regulated murine hsp70.2 gene are expressed in distinct and only partially overlapping areas in the adult brain

    Murashov, A. K.; Wolgemuth, D. J.


    We have examined the spatial pattern of expression of a member of the hsp70 gene family, hsp70.2, in the mouse central nervous system. Surprisingly, RNA blot analysis and in situ hybridization revealed abundant expression of an 'antisense' hsp70.2 transcript in several areas of adult mouse brain. Two different transcripts recognized by sense and antisense riboprobes for the hsp70.2 gene were expressed in distinct and only partially overlapping neuronal populations. RNA blot analysis revealed low levels of the 2.7 kb transcript of hsp70.2 in several areas of the brain, with highest signal in the hippocampus. Abundant expression of a slightly larger (approximately 2.8 kb) 'antisense' transcript was detected in several brain regions, notably in the brainstem, cerebellum, mesencephalic tectum, thalamus, cortex, and hippocampus. In situ hybridization revealed that the sense and antisense transcripts were both predominantly neuronal and localized to the same cell types in the granular layer of the cerebellum, trapezoid nucleus of the superior olivary complex, locus coeruleus and hippocampus. The hsp70.2 antisense transcripts were particularly abundant in the frontal cortex, dentate gyrus, subthalamic nucleus, zona incerta, superior and inferior colliculi, central gray, brainstem, and cerebellar Purkinje cells. Our findings have revealed a distinct cellular and spatial localization of both sense and antisense transcripts, demonstrating a new level of complexity in the function of the heat shock genes.

  12. Developmental dyscalculia: a dysconnection syndrome?

    Kucian, Karin; Ashkenazi, Simone Schwizer; Hänggi, Jürgen; Rotzer, Stephanie; Jäncke, Lutz; Martin, Ernst; von Aster, Michael


    Numerical understanding is important for everyday life. For children with developmental dyscalculia (DD), numbers and magnitudes present profound problems which are thought to be based upon neuronal impairments of key regions for numerical understanding. The aim of the present study was to investigate possible differences in white matter fibre integrity between children with DD and controls using diffusion tensor imaging. White matter integrity and behavioural measures were evaluated in 15 children with developmental dyscalculia aged around 10 years and 15 matched controls. The main finding, obtained by a whole brain group comparison, revealed reduced fractional anisotropy in the superior longitudinal fasciculus in children with developmental dyscalculia. In addition, a region of interest analysis exhibited prominent deficits in fibres of the superior longitudinal fasciculus adjacent to the intraparietal sulcus, which is thought to be the core region for number processing. To conclude, our results outline deficient fibre projection between parietal, temporal and frontal regions in children with developmental dyscalculia, and therefore raise the question of whether dyscalculia can be seen as a dysconnection syndrome. Since the superior longitudinal fasciculus is involved in the integration and control of distributed brain processes, the present results highlight the importance of considering broader domain-general mechanisms in the diagnosis and therapy of dyscalculia.

  13. Buffalo embryos produced by handmade cloning from oocytes selected using brilliant cresyl blue staining have better developmental competence and quality and are closer to embryos produced by in vitro fertilization in terms of their epigenetic status and gene expression pattern.

    Mohapatra, Sushil K; Sandhu, Anjit; Neerukattu, Venkata S; Singh, Karn P; Selokar, Naresh L; Singla, Suresh K; Chauhan, Manmohan S; Manik, Radhey S; Palta, Prabhat


    We compared handmade cloned (HMC) buffalo blastocysts produced from oocytes stained with Brilliant Cresyl Blue (BCB) and classified into those with blue (BCB+) or colorless cytoplasm (BCB-). The blastocyst rate was higher (p<0.001) for BCB+ than for BCB- oocytes (43.41 ± 2.54 vs. 22.74 ± 1.76%). BCB+ blastocysts had inner cell mass (ICM) cell number, ICM-to-trophectoderm ratio, global level of H3K18ac, apoptotic index, and expression level of BCL-XL, but not that of CASPASE-3, similar to that of blastocysts produced through in vitro fertilization (IVF), which was higher (p<0.05) than that of BCB- blastocysts. The global level of H3K9me2, which was similar in BCB+ and BCB- blastocysts, was higher (p<0.01) than that in IVF blastocysts. The expression level of OCT4 and SOX2 was higher (p<0.05) and that of GATA2 was lower (p<0.05) in BCB+ than that in BCB- blastocysts, whereas that of DNMT1, DNMT3a, NANOG, and CDX2 was not significantly different between the two groups. The expression level of DNMT1, OCT4, NANOG, and SOX2 was lower (p<0.05) and that of CDX2 was higher (p<0.05) in BCB+ than in IVF blastocysts. In conclusion, because BCB+ blastocysts have better developmental competence and are closer to IVF blastocysts in terms of quality, epigenetic status, and gene expression than BCB- blastocysts, BCB staining can be used effectively for selection of developmentally competent oocytes for HMC.

  14. The Domain of Developmental Psychopathology.

    Sroufe, L. Alan; Rutter, Michael


    Describes how developmental psychopathology differs from related disciplines, including abnormal psychology, psychiatry, clinical child psychology, and developmental psychology. Points out propositions underlying a developmental perspective and discusses implications for research in developmental psychopathology. (Author/RH)

  15. AtGA3ox2, a key gene</