Sample records for key developmental genes
-
Transcriptome analysis elucidates key developmental components of bryozoan lophophore development
Wong, Yue Him
2014-10-10
The most recent phylogenomic study suggested that Bryozoa (Ectoprocta), Brachiopoda, and Phoronida are monophyletic, implying that the lophophore of bryozoans, phoronids and brachiopods is a synapomorphy. Understanding the molecular mechanisms of the lophophore development of the Lophophorata clade can therefore provide us a new insight into the formation of the diverse morphological traits in metazoans. In the present study, we profiled the transcriptome of the Bryozoan (Ectoproct) Bugula neritina during the swimming larval stage (SW) and the early (4 h) and late (24 h) metamorphic stages using the Illumina HiSeq2000 platform. Various genes that function in development, the immune response and neurogenesis showed differential expression levels during metamorphosis. In situ hybridization of 23 genes that participate in the Wnt, BMP, Notch, and Hedgehog signaling pathways revealed their regulatory roles in the development of the lophophore and the ancestrula digestive tract. Our findings support the hypothesis that developmental precursors of the lophophore and the ancestrula digestive tract are pre-patterned by the differential expression of key developmental genes according to their fate. This study provides a foundation to better understand the developmental divergence and/or convergence among developmental precursors of the lophophore of bryozoans, branchiopods and phoronids.
-
Directory of Open Access Journals (Sweden)
Anna Lettieri
2015-03-01
Full Text Available The anti-proliferative effects of diatoms, described for the first time in copepods, have also been demonstrated in benthic invertebrates such as polychaetes, sea urchins and tunicates. In these organisms PUAs (polyunsaturated aldehydes induce the disruption of gametogenesis, gamete functionality, fertilization, embryonic mitosis, and larval fitness and competence. These inhibitory effects are due to the PUAs, produced by diatoms in response to physical damage as occurs during copepod grazing. The cell targets of these compounds remain largely unknown. Here we identify some of the genes targeted by the diatom PUA 2-trans-4-trans-decadienal (DD using the tunicate Ciona intestinalis. The tools, techniques and genomic resources available for Ciona, as well as the suitability of Ciona embryos for medium-to high-throughput strategies, are key to their employment as model organisms in different fields, including the investigation of toxic agents that could interfere with developmental processes. We demonstrate that DD can induce developmental aberrations in Ciona larvae in a dose-dependent manner. Moreover, through a preliminary analysis, DD is shown to affect the expression level of genes involved in stress response and developmental processes.
-
Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas
2013-12-05
The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously
-
Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.
Directory of Open Access Journals (Sweden)
Susanta K Behura
Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.
-
Directory of Open Access Journals (Sweden)
Kim Man-Sun
2012-05-01
Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.
-
Mural granulosa cell gene expression associated with oocyte developmental competence
Directory of Open Access Journals (Sweden)
Jiang Jin-Yi
2010-03-01
Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and
-
Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M
2015-05-15
The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.
-
Efficient Reverse-Engineering of a Developmental Gene Regulatory Network
Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes
2012-01-01
Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to
-
Developmental gene expression profiles of the human pathogen Schistosoma japonicum
Directory of Open Access Journals (Sweden)
McManus Donald P
2009-03-01
Full Text Available Abstract Background The schistosome blood flukes are complex trematodes and cause a chronic parasitic disease of significant public health importance worldwide, schistosomiasis. Their life cycle is characterised by distinct parasitic and free-living phases involving mammalian and snail hosts and freshwater. Microarray analysis was used to profile developmental gene expression in the Asian species, Schistosoma japonicum. Total RNAs were isolated from the three distinct environmental phases of the lifecycle – aquatic/snail (eggs, miracidia, sporocysts, cercariae, juvenile (lung schistosomula and paired but pre-egg laying adults and adult (paired, mature males and egg-producing females, both examined separately. Advanced analyses including ANOVA, principal component analysis, and hierarchal clustering provided a global synopsis of gene expression relationships among the different developmental stages of the schistosome parasite. Results Gene expression profiles were linked to the major environmental settings through which the developmental stages of the fluke have to adapt during the course of its life cycle. Gene ontologies of the differentially expressed genes revealed a wide range of functions and processes. In addition, stage-specific, differentially expressed genes were identified that were involved in numerous biological pathways and functions including calcium signalling, sphingolipid metabolism and parasite defence. Conclusion The findings provide a comprehensive database of gene expression in an important human pathogen, including transcriptional changes in genes involved in evasion of the host immune response, nutrient acquisition, energy production, calcium signalling, sphingolipid metabolism, egg production and tegumental function during development. This resource should help facilitate the identification and prioritization of new anti-schistosome drug and vaccine targets for the control of schistosomiasis.
-
Teachers' Explanations of a Key Developmental Understanding of Multiplicative Reasoning
Rhee, Katherine L.
2012-01-01
This qualitative research study explores teachers' understandings of multiplicative reasoning as a key developmental understanding (KDU). A KDU entails knowingly applying the same mathematical concepts within different contexts. A KDU supports an individual to build a connected understanding of mathematics as opposed to only understanding…
-
Prepatterning of developmental gene expression by modified histones before zygotic genome activation
DEFF Research Database (Denmark)
Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.
2011-01-01
A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...
-
Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon
2017-07-03
Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.
-
Directory of Open Access Journals (Sweden)
Sadlier Denise M
2007-02-01
Full Text Available Abstract Background Osteoporosis, a disease of decreased bone mineral density represents a significant and growing burden in the western world. Aging population structure and therapeutic use of glucocorticoids have contributed in no small way to the increase in the incidence of this disease. Despite substantial investigative efforts over the last number of years the exact molecular mechanism underpinning the initiation and progression of osteoporosis remain to be elucidated. This has meant that no significant advances in therapeutic strategies have emerged, with joint replacement surgery being the mainstay of treatment. Methods In this study we have used an integrated genomics profiling and computational biology based strategy to identify the key osteoblast genes and gene clusters whose expression is altered in response to dexamethasone exposure. Primary human osteoblasts were exposed to dexamethasone in vitro and microarray based transcriptome profiling completed. Results These studies identified approximately 500 osteoblast genes whose expression was altered. Functional characterization of the transcriptome identified developmental networks as being reactivated with 106 development associated genes found to be differentially regulated. Pathway reconstruction revealed coordinate alteration of members of the WNT signaling pathway, including frizzled-2, frizzled-7, DKK1 and WNT5B, whose differential expression in this setting was confirmed by real time PCR. Conclusion The WNT pathway is a key regulator of skeletogenesis as well as differentiation of bone cells. Reactivation of this pathway may lead to altered osteoblast activity resulting in decreased bone mineral density, the pathological hallmark of osteoporosis. The data herein lend weight to the hypothesis that alterations in developmental pathways drive the initiation and progression of osteoporosis.
-
Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis
Directory of Open Access Journals (Sweden)
Ishida Betty K
2003-08-01
Full Text Available Abstract Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion.
-
Developmental evolution in social insects: regulatory networks from genes to societies.
Linksvayer, Timothy A; Fewell, Jennifer H; Gadau, Jürgen; Laubichler, Manfred D
2012-05-01
The evolution and development of complex phenotypes in social insect colonies, such as queen-worker dimorphism or division of labor, can, in our opinion, only be fully understood within an expanded mechanistic framework of Developmental Evolution. Conversely, social insects offer a fertile research area in which fundamental questions of Developmental Evolution can be addressed empirically. We review the concept of gene regulatory networks (GRNs) that aims to fully describe the battery of interacting genomic modules that are differentially expressed during the development of individual organisms. We discuss how distinct types of network models have been used to study different levels of biological organization in social insects, from GRNs to social networks. We propose that these hierarchical networks spanning different organizational levels from genes to societies should be integrated and incorporated into full GRN models to elucidate the evolutionary and developmental mechanisms underlying social insect phenotypes. Finally, we discuss prospects and approaches to achieve such an integration. © 2012 WILEY PERIODICALS, INC.
-
A co-expression gene network associated with developmental regulation of apple fruit acidity.
Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong
2015-08-01
Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.
-
Genome-wide identification of key modulators of gene-gene interaction networks in breast cancer.
Chiu, Yu-Chiao; Wang, Li-Ju; Hsiao, Tzu-Hung; Chuang, Eric Y; Chen, Yidong
2017-10-03
With the advances in high-throughput gene profiling technologies, a large volume of gene interaction maps has been constructed. A higher-level layer of gene-gene interaction, namely modulate gene interaction, is composed of gene pairs of which interaction strengths are modulated by (i.e., dependent on) the expression level of a key modulator gene. Systematic investigations into the modulation by estrogen receptor (ER), the best-known modulator gene, have revealed the functional and prognostic significance in breast cancer. However, a genome-wide identification of key modulator genes that may further unveil the landscape of modulated gene interaction is still lacking. We proposed a systematic workflow to screen for key modulators based on genome-wide gene expression profiles. We designed four modularity parameters to measure the ability of a putative modulator to perturb gene interaction networks. Applying the method to a dataset of 286 breast tumors, we comprehensively characterized the modularity parameters and identified a total of 973 key modulator genes. The modularity of these modulators was verified in three independent breast cancer datasets. ESR1, the encoding gene of ER, appeared in the list, and abundant novel modulators were illuminated. For instance, a prognostic predictor of breast cancer, SFRP1, was found the second modulator. Functional annotation analysis of the 973 modulators revealed involvements in ER-related cellular processes as well as immune- and tumor-associated functions. Here we present, as far as we know, the first comprehensive analysis of key modulator genes on a genome-wide scale. The validity of filtering parameters as well as the conservativity of modulators among cohorts were corroborated. Our data bring new insights into the modulated layer of gene-gene interaction and provide candidates for further biological investigations.
-
Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.
Directory of Open Access Journals (Sweden)
Xiao-Jian Sun
Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.
-
Robustness and accuracy in sea urchin developmental gene regulatory networks
Directory of Open Access Journals (Sweden)
Smadar eBen-Tabou De-Leon
2016-02-01
Full Text Available Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.
-
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-02-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.
-
DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions
Stuckenholz, Carsten; Labhart, Paul; Alexiadis, Vassili; Martin, René; Knölker, Hans-Joachim; Fisher, Alfred L.
2011-01-01
The nuclear receptor DAF-12 has roles in normal development, the decision to pursue dauer development in unfavorable conditions, and the modulation of adult aging. Despite the biologic importance of DAF-12, target genes for this receptor are largely unknown. To identify DAF-12 targets, we performed chromatin immunoprecipitation followed by hybridization to whole-genome tiling arrays. We identified 1,175 genomic regions to be bound in vivo by DAF-12, and these regions are enriched in known DAF-12 binding motifs and act as DAF-12 response elements in transfected cells and in transgenic worms. The DAF-12 target genes near these binding sites include an extensive network of interconnected heterochronic and microRNA genes. We also identify the genes encoding components of the miRISC, which is required for the control of target genes by microRNA, as a target of DAF-12 regulation. During reproductive development, many of these target genes are misregulated in daf-12(0) mutants, but this only infrequently results in developmental phenotypes. In contrast, we and others have found that null daf-12 mutations enhance the phenotypes of many miRISC and heterochronic target genes. We also find that environmental fluctuations significantly strengthen the weak heterochronic phenotypes of null daf-12 alleles. During diapause, DAF-12 represses the expression of many heterochronic and miRISC target genes, and prior work has demonstrated that dauer formation can suppress the heterochronic phenotypes of many of these target genes in post-dauer development. Together these data are consistent with daf-12 acting to ensure developmental robustness by committing the animal to adult or dauer developmental programs despite variable internal or external conditions. PMID:21814518
-
An oscillopathic approach to developmental dyslexia: From genes to speech processing.
Jiménez-Bravo, Miguel; Marrero, Victoria; Benítez-Burraco, Antonio
2017-06-30
Developmental dyslexia is a heterogeneous condition entailing problems with reading and spelling. Several genes have been linked or associated to the disease, many of which contribute to the development and function of brain areas important for auditory and phonological processing. Nonetheless, a clear link between genes, the brain, and the symptoms of dyslexia is still pending. The goal of this paper is contributing to bridge this gap. With this aim, we have focused on how the dyslexic brain fails to process speech sounds and reading cues. We have adopted an oscillatory perspective, according to which dyslexia may result from a deficient integration of different brain rhythms during reading/spellings tasks. Moreover, we show that some candidate genes for this condition are related to brain rhythms. This fresh approach is expected to provide a better understanding of the aetiology and the clinical presentation of developmental dyslexia, but also to achieve an earlier and more accurate diagnosis of the disease. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Developmental regulation of Xenopus 5S RNA genes
International Nuclear Information System (INIS)
Wormington, W.M.; Schlissel, M.; Brown, D.D.
1983-01-01
In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table
-
Induction of AGAMOUS gene expression plays a key role in ripening of tomato sepals in vitro.
Ishida, B K; Jenkins, S M; Say, B
1998-03-01
In vitro culture of VFNT Cherry tomato sepals (calyx) at 16-21 degrees C results in developmental changes that are similar to those that occur in fruit tissue [10]. Sepals become swollen, red, and succulent, produce ethylene, and have increased levels of polygalacturonase RNA. They also produce many flavor volatiles characteristic of ripe tomato fruit and undergo similar changes in sugar content [11]. We examined the expression of the tomato AGAMOUS gene, TAG1, in ripening, in vitro sepal cultures and other tissues from the plant and found that TAG1 RNA accumulates to higher levels than expected from data from other plants. Contrary to reports on the absence of AGAMOUS in sepals, TAG1 RNA levels in green sepals from greenhouse-grown plants is detectable, its concentration increasing with in vitro ripening to levels that were even higher than in red, ripe fruit. Sepals of fruit on transgenic tomato plants that expressed TAG1 ectopically were induced by low temperature to ripen in vivo, producing lycopene and undergoing cell wall softening as is characteristic of pericarpic tissue. We therefore propose that the induction of elevated TAG1 gene expression plays a key role in developmental changes that result in sepal ripening.
-
International Nuclear Information System (INIS)
Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.; Kodavanti, Prasada Rao S.
2008-01-01
The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND) 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression (≥ 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans
-
Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen
2017-07-01
In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.
-
Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene
Directory of Open Access Journals (Sweden)
Michael Hadjiargyrou
2018-01-01
Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.
-
[Elucidation of key genes in sex determination in genetics teaching].
Li, Meng; He, Zhumei
2014-06-01
Sex is an important and complex feature of organisms, which is controlled by the genetic and environmental factors. The genetic factors, i.e., genes, are vital in sex determination. However, not all the related genes play the same roles, and some key genes play a vital role in the sex determination and differentiation. With the development of the modern genetics, a great progress on the key genes has been made in sex determination. In this review, we summarize the mechanism of sex determination and the strategy of how to study the key genes in sex determination. It will help us to understand the mechanism of sex determination better in the teaching of genetics.
-
Bhatlekar, Seema; Addya, Sankar; Salunek, Moreh; Orr, Christopher R; Surrey, Saul; McKenzie, Steven; Fields, Jeremy Z; Boman, Bruce M
2014-01-15
Our goal was to identify a unique gene expression signature for human colonic stem cells (SCs). Accordingly, we determined the gene expression pattern for a known SC-enriched region--the crypt bottom. Colonic crypts and isolated crypt subsections (top, middle, and bottom) were purified from fresh, normal, human, surgical specimens. We then used an innovative strategy that used two-color microarrays (∼18,500 genes) to compare gene expression in the crypt bottom with expression in the other crypt subsections (middle or top). Array results were validated by PCR and immunostaining. About 25% of genes analyzed were expressed in crypts: 88 preferentially in the bottom, 68 in the middle, and 131 in the top. Among genes upregulated in the bottom, ∼30% were classified as growth and/or developmental genes including several in the PI3 kinase pathway, a six-transmembrane protein STAMP1, and two homeobox (HOXA4, HOXD10) genes. qPCR and immunostaining validated that HOXA4 and HOXD10 are selectively expressed in the normal crypt bottom and are overexpressed in colon carcinomas (CRCs). Immunostaining showed that HOXA4 and HOXD10 are co-expressed with the SC markers CD166 and ALDH1 in cells at the normal crypt bottom, and the number of these co-expressing cells is increased in CRCs. Thus, our findings show that these two HOX genes are selectively expressed in colonic SCs and that HOX overexpression in CRCs parallels the SC overpopulation that occurs during CRC development. Our study suggests that developmental genes play key roles in the maintenance of normal SCs and crypt renewal, and contribute to the SC overpopulation that drives colon tumorigenesis.
-
Reynolds, L P; Borowicz, P P; Caton, J S; Vonnahme, K A; Luther, J S; Hammer, C J; Maddock Carlin, K R; Grazul-Bilska, A T; Redmer, D A
2010-04-01
Developmental programming refers to the programming of various bodily systems and processes by a stressor of the maternal system during pregnancy or during the neonatal period. Such stressors include nutritional stress, multiple pregnancy (i.e., increased numbers of fetuses in the gravid uterus), environmental stress (e.g., high environmental temperature, high altitude, prenatal steroid exposure), gynecological immaturity, and maternal or fetal genotype. Programming refers to impaired function of numerous bodily systems or processes, leading to poor growth, altered body composition, metabolic dysfunction, and poor productivity (e.g., poor growth, reproductive dysfunction) of the offspring throughout their lifespan and even across generations. A key component of developmental programming seems to be placental dysfunction, leading to altered fetal growth and development. We discuss various large animal models of developmental programming and how they have and will continue to contribute to our understanding of the mechanisms underlying altered placental function and developmental programming, and, further, how large animal models also will be critical to the identification and application of therapeutic strategies that will alleviate the negative consequences of developmental programming to improve offspring performance in livestock production and human medicine.
-
Directory of Open Access Journals (Sweden)
Daifeng Cheng
Full Text Available To accurately assess gene expression levels, it is essential to normalize real-time quantitative PCR (RT-qPCR data with suitable internal reference genes. For the red imported fire ant, Solenopsis invicta, reliable reference genes to assess the transcript expression levels of the target genes have not been previously investigated. In this study, we examined the expression levels of five candidate reference genes (rpl18, ef1-beta, act, GAPDH, and tbp in different developmental stages, castes and tissues of S. invicta. To evaluate the suitability of these genes as endogenous controls, three software-based approaches (geNorm, BestKeeper and NormFinder and one web-based comprehensive tool (RefFinder were used to analyze and rank the tested genes. Furthermore, the optimal number of reference gene(s was determined by the pairwise variation value. Our data showed that two of the five candidate genes, rpl18 and ef1-beta, were the most suitable reference genes because they have the most stable expression among different developmental stages, castes and tissues in S. invicta. Although widely used as reference gene in other species, in S. invicta the act gene has high variation in expression and was consequently excluded as a reliable reference gene. The two validated reference genes, rpl18 and ef1-beta, can be widely used for quantification of target gene expression with RT-qPCR technology in S. invicta.
-
Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola
2014-12-01
We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.
-
Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola
2014-01-01
We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918
-
The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes
Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas
2018-01-01
Abstract The world’s smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development. PMID:29684203
-
The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes.
Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas
2018-04-01
The world's smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development.
-
Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène
2013-01-01
Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy
-
Directory of Open Access Journals (Sweden)
David Cohen
Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of
-
Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie
2010-05-16
Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.
-
Ribosomal protein gene knockdown causes developmental defects in zebrafish.
Directory of Open Access Journals (Sweden)
Tamayo Uechi
Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.
-
Epigenetics and the Developmental Origins of Health and ...
Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.
-
Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram
2003-12-01
Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.
-
Favé, Marie-Julie; Johnson, Robert A; Cover, Stefan; Handschuh, Stephan; Metscher, Brian D; Müller, Gerd B; Gopalan, Shyamalika; Abouheif, Ehab
2015-09-04
A fundamental and enduring problem in evolutionary biology is to understand how populations differentiate in the wild, yet little is known about what role organismal development plays in this process. Organismal development integrates environmental inputs with the action of gene regulatory networks to generate the phenotype. Core developmental gene networks have been highly conserved for millions of years across all animals, and therefore, organismal development may bias variation available for selection to work on. Biased variation may facilitate repeatable phenotypic responses when exposed to similar environmental inputs and ecological changes. To gain a more complete understanding of population differentiation in the wild, we integrated evolutionary developmental biology with population genetics, morphology, paleoecology and ecology. This integration was made possible by studying how populations of the ant species Monomorium emersoni respond to climatic and ecological changes across five 'Sky Islands' in Arizona, which are mountain ranges separated by vast 'seas' of desert. Sky Islands represent a replicated natural experiment allowing us to determine how repeatable is the response of M. emersoni populations to climate and ecological changes at the phenotypic, developmental, and gene network levels. We show that a core developmental gene network and its phenotype has kept pace with ecological and climate change on each Sky Island over the last ~90,000 years before present (BP). This response has produced two types of evolutionary change within an ant species: one type is unpredictable and contingent on the pattern of isolation of Sky lsland populations by climate warming, resulting in slight changes in gene expression, organ growth, and morphology. The other type is predictable and deterministic, resulting in the repeated evolution of a novel wingless queen phenotype and its underlying gene network in response to habitat changes induced by climate warming. Our
-
Pan, Qian; Peng, Jin; Zhou, Xue; Yang, Hao; Zhang, Wei
2012-07-01
In order to screen out important genes from large gene data of gene microarray after nerve injury, we combine gene ontology (GO) method and computer pattern recognition technology to find key genes responding to nerve injury, and then verify one of these screened-out genes. Data mining and gene ontology analysis of gene chip data GSE26350 was carried out through MATLAB software. Cd44 was selected from screened-out key gene molecular spectrum by comparing genes' different GO terms and positions on score map of principal component. Function interferences were employed to influence the normal binding of Cd44 and one of its ligands, chondroitin sulfate C (CSC), to observe neurite extension. Gene ontology analysis showed that the first genes on score map (marked by red *) mainly distributed in molecular transducer activity, receptor activity, protein binding et al molecular function GO terms. Cd44 is one of six effector protein genes, and attracted us with its function diversity. After adding different reagents into the medium to interfere the normal binding of CSC and Cd44, varying-degree remissions of CSC's inhibition on neurite extension were observed. CSC can inhibit neurite extension through binding Cd44 on the neuron membrane. This verifies that important genes in given physiological processes can be identified by gene ontology analysis of gene chip data.
-
CEREBELLUM: LINKS BETWEEN DEVELOPMENT, DEVELOPMENTAL DISORDERS AND MOTOR LEARNING
Directory of Open Access Journals (Sweden)
Mario U Manto
2012-01-01
Full Text Available The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodelling are being unravelled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip (RL, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signalling between granule cells and Purkinje neurons. The expression profile of SHH (Sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired development and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders.
-
Müller, Gerd B.
2018-01-01
Advances in imaging and modeling facilitate the calculation of biomechanical forces in biological specimens. These factors play a significant role during ontogenetic development of cichlid pharyngeal jaws, a key innovation responsible for one of the most prolific species diversifications in recent times. MicroCT imaging of radiopaque-stained vertebrate embryos were used to accurately capture the spatial relationships of the pharyngeal jaw apparatus in two cichlid species (Haplochromis elegans and Amatitlania nigrofasciata) for the purpose of creating a time series of developmental stages using finite element models, which can be used to assess the effects of biomechanical forces present in a system at multiple points of its ontogeny. Changes in muscle vector orientations, bite forces, force on the neurocranium where cartilage originates, and stress on upper pharyngeal jaws are analyzed in a comparative context. In addition, microCT scanning revealed the presence of previously unreported cement glands in A. nigrofasciata. The data obtained provide an underrepresented dimension of information on physical forces present in developmental processes and assist in interpreting the role of developmental dynamics in evolution. PMID:29320528
-
Directory of Open Access Journals (Sweden)
Tim Peterson
Full Text Available Advances in imaging and modeling facilitate the calculation of biomechanical forces in biological specimens. These factors play a significant role during ontogenetic development of cichlid pharyngeal jaws, a key innovation responsible for one of the most prolific species diversifications in recent times. MicroCT imaging of radiopaque-stained vertebrate embryos were used to accurately capture the spatial relationships of the pharyngeal jaw apparatus in two cichlid species (Haplochromis elegans and Amatitlania nigrofasciata for the purpose of creating a time series of developmental stages using finite element models, which can be used to assess the effects of biomechanical forces present in a system at multiple points of its ontogeny. Changes in muscle vector orientations, bite forces, force on the neurocranium where cartilage originates, and stress on upper pharyngeal jaws are analyzed in a comparative context. In addition, microCT scanning revealed the presence of previously unreported cement glands in A. nigrofasciata. The data obtained provide an underrepresented dimension of information on physical forces present in developmental processes and assist in interpreting the role of developmental dynamics in evolution.
-
Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long
2017-07-30
The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Directory of Open Access Journals (Sweden)
William P. Bewg
2017-12-01
Full Text Available Sugarcane bagasse is an abundant source of lignocellulosic material for bioethanol production. Utilisation of bagasse for biofuel production would be environmentally and economically beneficial, but the recalcitrance of lignin continues to provide a challenge. Further understanding of lignin production in specific cultivars will provide a basis for modification of genomes for the production of phenotypes with improved processing characteristics. Here we evaluated the expression profile of lignin biosynthetic genes and the cell wall composition along a developmental gradient in KQ228 sugarcane. The expression levels of nine lignin biosynthesis genes were quantified in five stem sections of increasing maturity and in root tissue. Two distinct expression patterns were seen. The first saw highest gene expression in the youngest tissue, with expression decreasing as tissue matured. The second pattern saw little to no change in transcription levels across the developmental gradient. Cell wall compositional analysis of the stem sections showed total lignin content to be significantly higher in more mature tissue than in the youngest section assessed. There were no changes in structural carbohydrates across developmental sections. These gene expression and cell wall compositional patterns can be used, along with other work in grasses, to inform biotechnological approaches to crop improvement for lignocellulosic biofuel production.
-
Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda
2016-02-01
Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.
-
Network-Guided Key Gene Discovery for a Given Cellular Process
DEFF Research Database (Denmark)
He, Feng Q; Ollert, Markus
2018-01-01
Identification of key genes for a given physiological or pathological process is an essential but still very challenging task for the entire biomedical research community. Statistics-based approaches, such as genome-wide association study (GWAS)- or quantitative trait locus (QTL)-related analysis...... have already made enormous contributions to identifying key genes associated with a given disease or phenotype, the success of which is however very much dependent on a huge number of samples. Recent advances in network biology, especially network inference directly from genome-scale data...
-
Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan
2017-01-01
The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.
-
Energy Technology Data Exchange (ETDEWEB)
Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research & Development Institute, Incheon 46083 (Korea, Republic of); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Choe, Joonho [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 34141 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)
2016-08-15
Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47
-
International Nuclear Information System (INIS)
Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong
2016-01-01
Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47
-
Directory of Open Access Journals (Sweden)
Conforto Tara L
2012-04-01
Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.
-
Genetic investigation of ocular developmental genes in 52 patients with anophthalmia/microphthalmia.
Vidya, Nair Gopinathan; Rajkumar, Sankaranarayanan; Vasavada, Abhay R
2018-06-01
Mutation in eye developmental genes has been reported to cause anophthalmia and microphthalmia. However, in India, especially in the Western Indian population, such reports are scarce. Hence, the present study aims to investigate mutations in 15 ocular developmental genes in patients with anophthalmia and microphthalmia in the western region of India. Genomic DNA was isolated from the blood of 52 individuals affected with microphthalmia and anophthalmia, and 50 healthy normal controls. Polymerase chain reaction (PCR) was carried out for 15 genes including BMP4, CRYBA4, FOXE3, GDF6, GJA3, GJA8, MITF, OTX2, PAX6, PITX3, RAX, SIX3, SIX6, SOX2, and VSX2 using gene-specific primers spanning the exon-intron boundaries and part of a promoter region. The amplified PCR products were purified and then subjected to Sanger's bi-directional sequencing. Nucleotide variations were examined using a basic local alignment search tool (BLAST). Bi-directional sequencing identified 8 novel and 14 known variations. Out of this, the variations GJA3-c.92T>A; p.Ile31Asn, SOX2-c.542C>A; p.Pro181Gln and SOX2-c.541_542delinsGA; p.Pro181Glu were found to be deleterious by in silico analysis. The GJA3-p.Ile31Asn mutation was identified in a patient with bilateral microphthalmia, microcornea, and membranous cataract. The SOX2-p.Pro181Gln and SOX2-p.Pro181Glu mutations were identified in patients with isolated bilateral microphthalmia and microphthalmia with microcornea, respectively. A novel nondeleterious missense variation was identified in the GJA8 gene in a patient with anophthalmia. These results support the crucial role of GJA3 and SOX2 in eye development and indicate a detailed functional study to understand the molecular mechanisms underlying the disease pathology.
-
Homeobox Genes in the Rodent Pineal Gland
DEFF Research Database (Denmark)
Rath, Martin Fredensborg; Rohde, Kristian; Klein, David C
2013-01-01
The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential...... for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental...... functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function...
-
Directory of Open Access Journals (Sweden)
Anca Dana Dobrian
2012-08-01
Full Text Available The Twist proteins (Twist-1 and -2 are highly conserved developmental proteins with key roles for the transcriptional regulation in mesenchymal cell lineages. They belong to the super-family of bHLH proteins and exhibit bi-functional roles as both activators and repressors of gene transcription. The Twist proteins are expressed at low levels in adult tissues but may become abundantly re-expressed in cells undergoing malignant transformation. This observation prompted extensive research on the roles of Twist proteins in cancer progression and metastasis. Very recent studies indicate a novel role for Twist-1 as a potential regulator of adipose tissue remodeling and inflammation. Several studies suggested that developmental genes are important determinants of obesity, fat distribution and remodeling capacity of different adipose depots. Twist-1 is abundantly and selectively expressed in the adult adipose tissue and its constitutive expression is significantly higher in subcutaneous vs. visceral fat in both mice and humans. Moreover, Twist1 expression is strongly correlated with BMI and insulin resistance in humans. However, the functional roles and transcriptional downstream targets of Twist1 in adipose tissue are largely unexplored. The purpose of this review is to highlight the major findings related to Twist1 expression in different fat depots and cellular components of adipose tissue and to discuss the potential mechanisms suggesting a role for Twist1 in adipose tissue metabolism, inflammation and remodeling.
-
International Nuclear Information System (INIS)
Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J.; Flaws, Jodi A.; Helferich, William G.; Pan, Yuan-Xiang; Lezmi, Stéphane
2015-01-01
Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a
-
Energy Technology Data Exchange (ETDEWEB)
Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Flaws, Jodi A. [Department of Comparative Biosciences, University of Illinois Urbana-Champaign (United States); Helferich, William G. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Pan, Yuan-Xiang, E-mail: yxpan@illinois.edu [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Lezmi, Stéphane, E-mail: slezmi@illinois.edu [Department of Pathobiology, University of Illinois Urbana-Champaign (United States)
2015-04-15
Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a
-
Arenas-Mena, Cesar; Coffman, James A.
2016-01-01
Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445
-
Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha
2017-01-01
During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...
-
Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip
2017-01-01
ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...
-
Identification of the Key Genes and Pathways in Esophageal Carcinoma.
Su, Peng; Wen, Shiwang; Zhang, Yuefeng; Li, Yong; Xu, Yanzhao; Zhu, Yonggang; Lv, Huilai; Zhang, Fan; Wang, Mingbo; Tian, Ziqiang
2016-01-01
Objective . Esophageal carcinoma (EC) is a frequently common malignancy of gastrointestinal cancer in the world. This study aims to screen key genes and pathways in EC and elucidate the mechanism of it. Methods . 5 microarray datasets of EC were downloaded from Gene Expression Omnibus. Differentially expressed genes (DEGs) were screened by bioinformatics analysis. Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment, and protein-protein interaction (PPI) network construction were performed to obtain the biological roles of DEGs in EC. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to verify the expression level of DEGs in EC. Results . A total of 1955 genes were filtered as DEGs in EC. The upregulated genes were significantly enriched in cell cycle and the downregulated genes significantly enriched in Endocytosis. PPI network displayed CDK4 and CCT3 were hub proteins in the network. The expression level of 8 dysregulated DEGs including CDK4, CCT3, THSD4, SIM2, MYBL2, CENPF, CDCA3, and CDKN3 was validated in EC compared to adjacent nontumor tissues and the results were matched with the microarray analysis. Conclusion . The significantly DEGs including CDK4, CCT3, THSD4, and SIM2 may play key roles in tumorigenesis and development of EC involved in cell cycle and Endocytosis.
-
Identification of the Key Genes and Pathways in Esophageal Carcinoma
Directory of Open Access Journals (Sweden)
Peng Su
2016-01-01
Full Text Available Objective. Esophageal carcinoma (EC is a frequently common malignancy of gastrointestinal cancer in the world. This study aims to screen key genes and pathways in EC and elucidate the mechanism of it. Methods. 5 microarray datasets of EC were downloaded from Gene Expression Omnibus. Differentially expressed genes (DEGs were screened by bioinformatics analysis. Gene Ontology (GO enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG enrichment, and protein-protein interaction (PPI network construction were performed to obtain the biological roles of DEGs in EC. Quantitative real-time polymerase chain reaction (qRT-PCR was used to verify the expression level of DEGs in EC. Results. A total of 1955 genes were filtered as DEGs in EC. The upregulated genes were significantly enriched in cell cycle and the downregulated genes significantly enriched in Endocytosis. PPI network displayed CDK4 and CCT3 were hub proteins in the network. The expression level of 8 dysregulated DEGs including CDK4, CCT3, THSD4, SIM2, MYBL2, CENPF, CDCA3, and CDKN3 was validated in EC compared to adjacent nontumor tissues and the results were matched with the microarray analysis. Conclusion. The significantly DEGs including CDK4, CCT3, THSD4, and SIM2 may play key roles in tumorigenesis and development of EC involved in cell cycle and Endocytosis.
-
Evolution and developmental genetics of floral display-A review of progress
Institute of Scientific and Technical Information of China (English)
Qing Ma; Wenheng Zhang; Qiu-Yun (Jenny) Xiang
2017-01-01
Angiosperms evolved a great diversity of ways to display their flowers for reproductive success by variation in floral color,size,shape,scent,arrangements,and flowering time.The various innovations in floral forms and the aggregation of flowers into different kinds of inflorescences can drive new ecological adaptations,speciation,and angiosperm diversification.Evolutionary developmental biology (evo-devo) seeks to uncover the developmental and genetic basis underlying morphological diversification.Advances in the developmental genetics of floral display have provided a foundation for insights into the genetic basis of floral and inflorescence evolution.A number of regulatory genes controlling floral and inflorescence development have been identified in model plants (e.g.,Arabidopsis thaliana,Antirrhinum majus) using forward genetics and conserved functions of many of these genes across diverse non-model species have been revealed by reverse genetics.Gene-regulatory networks that mediated the developmental progresses of floral and inflorescence development have also been established in some plant species.Meanwhile,phylogeny-based comparative analysis of morphological and genetic character has enabled the identification of key evolutionary events that lead to morphological complexity and diversification.Here we review the recent progress on evo-devo studies of floral display including floral symmetry,petal fusion,floral color,floral scent,and inflorescences.We also review the molecular genetic approaches applied to plant evo-devo studies and highlight the future directions of evo-devo.
-
Directory of Open Access Journals (Sweden)
Shutao Zhang
Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.
-
Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni
2015-08-01
The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable
-
Directory of Open Access Journals (Sweden)
Colgan Thomas J
2011-12-01
Full Text Available Abstract Background Understanding polyphenism, the ability of a single genome to express multiple morphologically and behaviourally distinct phenotypes, is an important goal for evolutionary and developmental biology. Polyphenism has been key to the evolution of the Hymenoptera, and particularly the social Hymenoptera where the genome of a single species regulates distinct larval stages, sexual dimorphism and physical castes within the female sex. Transcriptomic analyses of social Hymenoptera will therefore provide unique insights into how changes in gene expression underlie such complexity. Here we describe gene expression in individual specimens of the pre-adult stages, sexes and castes of the key pollinator, the buff-tailed bumblebee Bombus terrestris. Results cDNA was prepared from mRNA from five life cycle stages (one larva, one pupa, one male, one gyne and two workers and a total of 1,610,742 expressed sequence tags (ESTs were generated using Roche 454 technology, substantially increasing the sequence data available for this important species. Overlapping ESTs were assembled into 36,354 B. terrestris putative transcripts, and functionally annotated. A preliminary assessment of differences in gene expression across non-replicated specimens from the pre-adult stages, castes and sexes was performed using R-STAT analysis. Individual samples from the life cycle stages of the bumblebee differed in the expression of a wide array of genes, including genes involved in amino acid storage, metabolism, immunity and olfaction. Conclusions Detailed analyses of immune and olfaction gene expression across phenotypes demonstrated how transcriptomic analyses can inform our understanding of processes central to the biology of B. terrestris and the social Hymenoptera in general. For example, examination of immunity-related genes identified high conservation of important immunity pathway components across individual specimens from the life cycle stages while
-
LENUS (Irish Health Repository)
Colgan, Thomas J
2011-12-20
Abstract Background Understanding polyphenism, the ability of a single genome to express multiple morphologically and behaviourally distinct phenotypes, is an important goal for evolutionary and developmental biology. Polyphenism has been key to the evolution of the Hymenoptera, and particularly the social Hymenoptera where the genome of a single species regulates distinct larval stages, sexual dimorphism and physical castes within the female sex. Transcriptomic analyses of social Hymenoptera will therefore provide unique insights into how changes in gene expression underlie such complexity. Here we describe gene expression in individual specimens of the pre-adult stages, sexes and castes of the key pollinator, the buff-tailed bumblebee Bombus terrestris. Results cDNA was prepared from mRNA from five life cycle stages (one larva, one pupa, one male, one gyne and two workers) and a total of 1,610,742 expressed sequence tags (ESTs) were generated using Roche 454 technology, substantially increasing the sequence data available for this important species. Overlapping ESTs were assembled into 36,354 B. terrestris putative transcripts, and functionally annotated. A preliminary assessment of differences in gene expression across non-replicated specimens from the pre-adult stages, castes and sexes was performed using R-STAT analysis. Individual samples from the life cycle stages of the bumblebee differed in the expression of a wide array of genes, including genes involved in amino acid storage, metabolism, immunity and olfaction. Conclusions Detailed analyses of immune and olfaction gene expression across phenotypes demonstrated how transcriptomic analyses can inform our understanding of processes central to the biology of B. terrestris and the social Hymenoptera in general. For example, examination of immunity-related genes identified high conservation of important immunity pathway components across individual specimens from the life cycle stages while olfactory
-
Directory of Open Access Journals (Sweden)
Yonglong Yu
2016-04-01
Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.
-
Gangwar, Manali; Sood, Hemant; Chauhan, Rajinder Singh
2016-04-01
Jatropha curcas, has been projected as a major source of biodiesel due to high seed oil content (42 %). A major roadblock for commercialization of Jatropha-based biodiesel is low seed yield per inflorescence, which is affected by low female to male flower ratio (1:25-30). Molecular dissection of female flower development by analyzing genes involved in phase transitions and floral organ development is, therefore, crucial for increasing seed yield. Expression analysis of 42 genes implicated in floral organ development and sex determination was done at six floral developmental stages of a J. curcas genotype (IC561235) with inherently higher female to male flower ratio (1:8-10). Relative expression analysis of these genes was done on low ratio genotype. Genes TFL1, SUP, AP1, CRY2, CUC2, CKX1, TAA1 and PIN1 were associated with reproductive phase transition. Further, genes CUC2, TAA1, CKX1 and PIN1 were associated with female flowering while SUP and CRY2 in female flower transition. Relative expression of these genes with respect to low female flower ratio genotype showed up to ~7 folds increase in transcript abundance of SUP, TAA1, CRY2 and CKX1 genes in intermediate buds but not a significant increase (~1.25 folds) in female flowers, thereby suggesting that these genes possibly play a significant role in increased transition towards female flowering by promoting abortion of male flower primordia. The outcome of study has implications in feedstock improvement of J. curcas through functional validation and eventual utilization of key genes associated with female flowering.
-
Directory of Open Access Journals (Sweden)
Li Dongmei
2009-05-01
Full Text Available Abstract Background Universally accepted landmark stages are necessary to highlight key events in plant reproductive development and to facilitate comparisons among species. Domestication and selection of tomato resulted in many varieties that differ in fruit shape and size. This diversity is useful to unravel underlying molecular and developmental mechanisms that control organ morphology and patterning. The tomato fruit shape gene SUN controls fruit elongation. The most dramatic effect of SUN on fruit shape occurs after pollination and fertilization although a detailed investigation into the timing of the fruit shape change as well as gene expression profiles during critical developmental stages has not been conducted. Results We provide a description of floral and fruit development in a red-fruited closely related wild relative of tomato, Solanum pimpinellifolium accession LA1589. We use established and propose new floral and fruit landmarks to present a framework for tomato developmental studies. In addition, gene expression profiles of three key stages in floral and fruit development are presented, namely floral buds 10 days before anthesis (floral landmark 7, anthesis-stage flowers (floral landmark 10 and fruit landmark 1, and 5 days post anthesis fruit (fruit landmark 3. To demonstrate the utility of the landmarks, we characterize the tomato shape gene SUN in fruit development. SUN controls fruit shape predominantly after fertilization and its effect reaches a maximum at 8 days post-anthesis coinciding with fruit landmark 4 representing the globular embryo stage of seed development. The expression profiles of the NILs that differ at sun show that only 34 genes were differentially expressed and most of them at a less than 2-fold difference. Conclusion The landmarks for flower and fruit development in tomato were outlined and integrated with the effect of SUN on fruit shape. Although we did not identify many genes differentially expressed in
-
Exploring the key genes and pathways in enchondromas using a gene expression microarray.
Shi, Zhongju; Zhou, Hengxing; Pan, Bin; Lu, Lu; Kang, Yi; Liu, Lu; Wei, Zhijian; Feng, Shiqing
2017-07-04
Enchondromas are the most common primary benign osseous neoplasms that occur in the medullary bone; they can undergo malignant transformation into chondrosarcoma. However, enchondromas are always undetected in patients, and the molecular mechanism is unclear. To identify key genes and pathways associated with the occurrence and development of enchondromas, we downloaded the gene expression dataset GSE22855 and obtained the differentially expressed genes (DEGs) by analyzing high-throughput gene expression in enchondromas. In total, 635 genes were identified as DEGs. Of these, 225 genes (35.43%) were up-regulated, and the remaining 410 genes (64.57%) were down-regulated. We identified the predominant gene ontology (GO) categories and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways that were significantly over-represented in the enchondromas samples compared with the control samples. Subsequently the top 10 core genes were identified from the protein-protein interaction (PPI) network. The enrichment analyses of the genes mainly involved in two significant modules showed that the DEGs were principally related to ribosomes, protein digestion and absorption, ECM-receptor interaction, focal adhesion, amoebiasis and the PI3K-Akt signaling pathway.Together, these data elucidate the molecular mechanisms underlying the occurrence and development of enchondromas and provide promising candidates for therapeutic intervention and prognostic evaluation. However, further experimental studies are needed to confirm these results.
-
Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong
2016-08-01
2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Ram Prakash Gupta
2017-11-01
Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.
-
Directory of Open Access Journals (Sweden)
Runko Suzan J
2005-10-01
Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and
-
Developmental expression of the alpha-skeletal actin gene
Directory of Open Access Journals (Sweden)
Vonk Freek J
2008-06-01
Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.
-
Energy Technology Data Exchange (ETDEWEB)
Hsieh, Ru-Lan [Department of Physical Medicine and Rehabilitation, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Department of Physical Medicine and Rehabilitation, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Shiue, Horng-Sheng [Department of Chinese Medicine, Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Taoyuan, Taiwan (China); Chen, Wei-Jen; Huang, Shiau-Rung [School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Lin, Ying-Chin [Department of Family Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Department of Health Examination, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan (China); Division of Family Medicine, School of Medicine, Taipei Medical University, Taipei, Taiwan (China); Lin, Ming-I; Mu, Shu-Chi [Department of Pediatrics, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Chen, Ray-Jade [Department of Digestive Surgery, Taipei Medical University Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: ymhsueh@tmu.edu.tw [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)
2017-04-15
Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA
-
International Nuclear Information System (INIS)
Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei
2017-01-01
Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA/MMA) index. • AS3MT
-
Directory of Open Access Journals (Sweden)
Saamer Akhshabi
2014-07-01
Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.
-
Directory of Open Access Journals (Sweden)
Saamer Akhshabi
2014-12-01
Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.
-
Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.
Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar
2016-02-01
Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Xu, Zheng; Ni, Jun; Shah, Faheem Afzal; Wang, Qiaojian; Wang, Zhaocheng; Wu, Lifang; Fu, Songling
2018-01-01
Pecan is an economically important nut crop tree due to its unique texture and flavor properties. The pecan seed is rich of unsaturated fatty acid and protein. However, little is known about the molecular mechanisms of the biosynthesis of fatty acids in the developing seeds. In this study, transcriptome sequencing of the developing seeds was performed using Illumina sequencing technology. Pecan seed embryos at different developmental stages were collected and sequenced. The transcriptomes of pecan seeds at two key developing stages (PA, the initial stage and PS, the fast oil accumulation stage) were also compared. A total of 82,155 unigenes, with an average length of 1,198 bp from seven independent libraries were generated. After functional annotations, we detected approximately 55,854 CDS, among which, 2,807 were Transcription Factor (TF) coding unigenes. Further, there were 13,325 unigenes that showed a 2-fold or greater expression difference between the two groups of libraries (two developmental stages). After transcriptome analysis, we identified abundant unigenes that could be involved in fatty acid biosynthesis, degradation and some other aspects of seed development in pecan. This study presents a comprehensive dataset of transcriptomic changes during the seed development of pecan. It provides insights in understanding the molecular mechanisms responsible for fatty acid biosynthesis in the seed development. The identification of functional genes will also be useful for the molecular breeding work of pecan.
-
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
-
Directory of Open Access Journals (Sweden)
Heying Zhou
Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.
-
Pajusalu, Sander; Reimand, Tiia; Uibo, Oivi; Vasar, Maire; Talvik, Inga; Zilina, Olga; Tammur, Pille; Õunap, Katrin
2015-01-01
We report a female patient with a complex phenotype consisting of failure to thrive, developmental delay, congenital bronchiectasis, gastroesophageal reflux and bilateral inguinal hernias. Chromosomal microarray analysis revealed a 230 kilobase deletion in chromosomal region 17q21.32 (arr[hg19] 17q21.32(46 550 362-46 784 039)×1) encompassing only 9 genes - HOXB1 to HOXB9. The deletion was not found in her mother or father. This is the first report of a patient with a HOXB gene cluster deletion involving only HOXB1 to HOXB9 genes. By comparing our case to previously reported five patients with larger chromosomal aberrations involving the HOXB gene cluster, we can suppose that HOXB gene cluster deletions are responsible for growth retardation, developmental delay, and specific facial dysmorphic features. Also, we suppose that bilateral inguinal hernias, tracheo-esophageal abnormalities, and lung malformations represent features with incomplete penetrance. Interestingly, previously published knock-out mice with targeted heterozygous deletion comparable to our patient did not show phenotypic alterations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
-
Meyfour, Anna; Pooyan, Paria; Pahlavan, Sara; Rezaei-Tavirani, Mostafa; Gourabi, Hamid; Baharvand, Hossein; Salekdeh, Ghasem Hosseini
2017-12-01
One of the main goals of Chromosome-Centric Human Proteome Project is to identify protein evidence for missing proteins (MPs). Here, we present a case study of the role of Y chromosome genes in organ development and how to overcome the challenges facing MPs identification by employing human pluripotent stem cell differentiation into cells of different organs yielding unprecedented biological insight into adult silenced proteins. Y chromosome is a male-specific sex chromosome which escapes meiotic recombination. From an evolutionary perspective, Y chromosome has preserved 3% of ancestral genes compared to 98% preservation of the X chromosome based on Ohno's law. Male specific region of Y chromosome (MSY) contains genes that contribute to central dogma and govern the expression of various targets throughout the genome. One of the most well-known functions of MSY genes is to decide the male-specific characteristics including sex, testis formation, and spermatogenesis, which are majorly formed by ampliconic gene families. Beyond its role in sex-specific gonad development, MSY genes in coexpression with their X counterparts, as single copy and broadly expressed genes, inhibit haplolethality and play a key role in embryogenesis. The role of X-Y related gene mutations in the development of hereditary syndromes suggests an essential contribution of sex chromosome genes to development. MSY genes, solely and independent of their X counterparts and/or in association with sex hormones, have a considerable impact on organ development. In this Review, we present major recent findings on the contribution of MSY genes to gonad formation, spermatogenesis, and the brain, heart, and kidney development and discuss how Y chromosome proteome project may exploit developmental biology to find missing proteins.
-
Cong, Jing; Liu, Xueduan; Lu, Hui; Xu, Han; Li, Yide; Deng, Ye; Li, Diqiang; Zhang, Yuguang
2015-08-20
Tropical rainforests cover over 50% of all known plant and animal species and provide a variety of key resources and ecosystem services to humans, largely mediated by metabolic activities of soil microbial communities. A deep analysis of soil microbial communities and their roles in ecological processes would improve our understanding on biogeochemical elemental cycles. However, soil microbial functional gene diversity in tropical rainforests and causative factors remain unclear. GeoChip, contained almost all of the key functional genes related to biogeochemical cycles, could be used as a specific and sensitive tool for studying microbial gene diversity and metabolic potential. In this study, soil microbial functional gene diversity in tropical rainforest was analyzed by using GeoChip technology. Gene categories detected in the tropical rainforest soils were related to different biogeochemical processes, such as carbon (C), nitrogen (N) and phosphorus (P) cycling. The relative abundance of genes related to C and P cycling detected mostly derived from the cultured bacteria. C degradation gene categories for substrates ranging from labile C to recalcitrant C were all detected, and gene abundances involved in many recalcitrant C degradation gene categories were significantly (P rainforest. Soil available N could be the key factor in shaping the soil microbial functional gene structure and metabolic potential.
-
Chen, Zhen; Liu, Peize; Li, Zhipeng; Yu, Wencheng; Wang, Zhi; Yao, Haosheng; Wang, Yuanpeng; Li, Qingbiao; Deng, Xu; He, Ning
2017-03-01
The present study reports the sequenced genome of Bacillus licheniformis CGMCC 2876, which is composed of a 4,284,461 bp chromosome that contains 4,188 protein-coding genes, 72 tRNA genes, and 21 rRNA genes. Additional analysis revealed an eps gene cluster with 16 open reading frames. Conserved Domains Database analysis combined with qPCR experiments indicated that all genes in this cluster were involved in polysaccharide bioflocculant synthesis. Phosphoglucomutase and UDP-glucose pyrophosphorylase were supposed to be key enzymes in polysaccharide secretion in B. licheniformis. A biosynthesis pathway for the production of polysaccharide bioflocculant involving the integration of individual genes was proposed based on functional analysis. Overexpression of epsDEF from the eps gene cluster in B. licheniformis CGMCC 2876 increased the flocculating activity of the recombinant strain by 90% compared to the original strain. Similarly, the crude yield of polysaccharide bioflocculant was enhanced by 27.8%. Overexpression of the UDP-glucose pyrophosphorylase gene not only increased the flocculating activity by 71% but also increased bioflocculant yield by 13.3%. Independent of UDP-N-acetyl-D-mannosamine dehydrogenase gene, flocculating activity, and polysaccharide yield were negatively impacted by overexpression of the UDP-N-acetylglucosamine 2-epimerase gene. Overall, epsDEF and gtaB2 were identified as key genes for polysaccharide bioflocculant synthesis in B. licheniformis. These results will be useful for further engineering of B. licheniformis for industrial bioflocculant production. Biotechnol. Bioeng. 2017;114: 645-655. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
-
Screening key candidate genes and pathways involved in insulinoma by microarray analysis.
Zhou, Wuhua; Gong, Li; Li, Xuefeng; Wan, Yunyan; Wang, Xiangfei; Li, Huili; Jiang, Bin
2018-06-01
Insulinoma is a rare type tumor and its genetic features remain largely unknown. This study aimed to search for potential key genes and relevant enriched pathways of insulinoma.The gene expression data from GSE73338 were downloaded from Gene Expression Omnibus database. Differentially expressed genes (DEGs) were identified between insulinoma tissues and normal pancreas tissues, followed by pathway enrichment analysis, protein-protein interaction (PPI) network construction, and module analysis. The expressions of candidate key genes were validated by quantitative real-time polymerase chain reaction (RT-PCR) in insulinoma tissues.A total of 1632 DEGs were obtained, including 1117 upregulated genes and 514 downregulated genes. Pathway enrichment results showed that upregulated DEGs were significantly implicated in insulin secretion, and downregulated DEGs were mainly enriched in pancreatic secretion. PPI network analysis revealed 7 hub genes with degrees more than 10, including GCG (glucagon), GCGR (glucagon receptor), PLCB1 (phospholipase C, beta 1), CASR (calcium sensing receptor), F2R (coagulation factor II thrombin receptor), GRM1 (glutamate metabotropic receptor 1), and GRM5 (glutamate metabotropic receptor 5). DEGs involved in the significant modules were enriched in calcium signaling pathway, protein ubiquitination, and platelet degranulation. Quantitative RT-PCR data confirmed that the expression trends of these hub genes were similar to the results of bioinformatic analysis.The present study demonstrated that candidate DEGs and enriched pathways were the potential critical molecule events involved in the development of insulinoma, and these findings were useful for better understanding of insulinoma genesis.
-
Anand, Deepti; Agrawal, Smriti A; Slavotinek, Anne; Lachke, Salil A
2018-04-01
Mutations in the transcription factor genes FOXE3, HSF4, MAF, and PITX3 cause congenital lens defects including cataracts that may be accompanied by defects in other components of the eye or in nonocular tissues. We comprehensively describe here all the variants in FOXE3, HSF4, MAF, and PITX3 genes linked to human developmental defects. A total of 52 variants for FOXE3, 18 variants for HSF4, 20 variants for MAF, and 19 variants for PITX3 identified so far in isolated cases or within families are documented. This effort reveals FOXE3, HSF4, MAF, and PITX3 to have 33, 16, 18, and 7 unique causal mutations, respectively. Loss-of-function mutant animals for these genes have served to model the pathobiology of the associated human defects, and we discuss the currently known molecular function of these genes, particularly with emphasis on their role in ocular development. Finally, we make the detailed FOXE3, HSF4, MAF, and PITX3 variant information available in the Leiden Online Variation Database (LOVD) platform at https://www.LOVD.nl/FOXE3, https://www.LOVD.nl/HSF4, https://www.LOVD.nl/MAF, and https://www.LOVD.nl/PITX3. Thus, this article informs on key variants in transcription factor genes linked to cataract, aphakia, corneal opacity, glaucoma, microcornea, microphthalmia, anterior segment mesenchymal dysgenesis, and Ayme-Gripp syndrome, and facilitates their access through Web-based databases. © 2018 Wiley Periodicals, Inc.
-
Biomarkers of adult and developmental neurotoxicity
International Nuclear Information System (INIS)
Slikker, William; Bowyer, John F.
2005-01-01
Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessary for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations
-
Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi
2016-05-01
The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
-
Directory of Open Access Journals (Sweden)
Seong Hwan Park
2013-01-01
Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.
-
Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon
2013-01-01
Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044
-
Directory of Open Access Journals (Sweden)
Zi-Xia Huang
Full Text Available BACKGROUND: The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. METHODOLOGY/PRINCIPAL FINDINGS: In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the 'lock system' in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM structures within the earliest postlarvae. CONCLUSION: This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level.
-
Identifying key genes associated with acute myocardial infarction.
Cheng, Ming; An, Shoukuan; Li, Junquan
2017-10-01
This study aimed to identify key genes associated with acute myocardial infarction (AMI) by reanalyzing microarray data. Three gene expression profile datasets GSE66360, GSE34198, and GSE48060 were downloaded from GEO database. After data preprocessing, genes without heterogeneity across different platforms were subjected to differential expression analysis between the AMI group and the control group using metaDE package. P FI) network. Then, DEGs in each module were subjected to pathway enrichment analysis using DAVID. MiRNAs and transcription factors predicted to regulate target DEGs were identified. Quantitative real-time polymerase chain reaction (RT-PCR) was applied to verify the expression of genes. A total of 913 upregulated genes and 1060 downregulated genes were identified in the AMI group. A FI network consists of 21 modules and DEGs in 12 modules were significantly enriched in pathways. The transcription factor-miRNA-gene network contains 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p. RT-PCR validations showed that expression levels of FOXO3 and MYBL2 were significantly increased in AMI, and expression levels of hsa-miR-21-5p and hsa-miR-30c-5p were obviously decreased in AMI. A total of 41 DEGs, such as SOCS3, VAPA, and COL5A2, are speculated to have roles in the pathogenesis of AMI; 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p may be involved in the regulation of the expression of these DEGs.
-
Niu, Donghong; Wang, Fei; Xie, Shumei; Sun, Fanyue; Wang, Ze; Peng, Maoxiao; Li, Jiale
2016-04-01
The razor clam Sinonovacula constricta is an important commercial species. The deficiency of developmental transcriptomic data is becoming the bottleneck of further researches on the mechanisms underlying settlement and metamorphosis in early development. In this study, de novo transcriptome sequencing was performed for S. constricta at different early developmental stages by using Illumina HiSeq 2000 paired-end (PE) sequencing technology. A total of 112,209,077 PE clean reads were generated. De novo assembly generated 249,795 contigs with an average length of 585 bp. Gene annotation resulted in the identification of 22,870 unigene hits against the NCBI database. Eight unique sequences related to metamorphosis were identified and analyzed using real-time PCR. The razor clam reference transcriptome would provide useful information on early developmental and metamorphosis mechanisms and could be used in the genetic breeding of shellfish.
-
Reduce, reuse, and recycle: developmental evolution of trait diversification.
Preston, Jill C; Hileman, Lena C; Cubas, Pilar
2011-03-01
A major focus of evolutionary developmental (evo-devo) studies is to determine the genetic basis of variation in organismal form and function, both of which are fundamental to biological diversification. Pioneering work on metazoan and flowering plant systems has revealed conserved sets of genes that underlie the bauplan of organisms derived from a common ancestor. However, the extent to which variation in the developmental genetic toolkit mirrors variation at the phenotypic level is an active area of research. Here we explore evidence from the angiosperm evo-devo literature supporting the frugal use of genes and genetic pathways in the evolution of developmental patterning. In particular, these examples highlight the importance of genetic pleiotropy in different developmental modules, thus reducing the number of genes required in growth and development, and the reuse of particular genes in the parallel evolution of ecologically important traits.
-
Developmental cognitive genetics: How psychology can inform genetics and vice versa
Bishop, Dorothy V. M.
2006-01-01
Developmental neuropsychology is concerned with uncovering the underlying basis of developmental disorders such as specific language impairment (SLI), developmental dyslexia, and autistic disorder. Twin and family studies indicate that genetic influences play an important part in the aetiology of all of these disorders, yet progress in identifying genes has been slow. One way forward is to cut loose from conventional clinical criteria for diagnosing disorders and to focus instead on measures of underlying cognitive mechanisms. Psychology can inform genetics by clarifying what the key dimensions are for heritable phenotypes. However, it is not a one-way street. By using genetically informative designs, one can gain insights about causal relationships between different cognitive deficits. For instance, it has been suggested that low-level auditory deficits cause phonological problems in SLI. However, a twin study showed that, although both types of deficit occur in SLI, they have quite different origins, with environmental factors more important for auditory deficit, and genes more important for deficient phonological short-term memory. Another study found that morphosyntactic deficits in SLI are also highly heritable, but have different genetic origins from impairments of phonological short-term memory. A genetic perspective shows that a search for the underlying cause of developmental disorders may be misguided, because they are complex and heterogeneous and are associated with multiple risk factors that only cause serious disability when they occur in combination. PMID:16769616
-
The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation.
Monfared, Mona M; Carles, Cristel C; Rossignol, Pascale; Pires, Helena R; Fletcher, Jennifer C
2013-09-01
The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing activities of Polycomb group (PcG) factors and trithorax group (trxG) factors. Yet, despite their importance, only a few trxG factors have been characterized in plants and their roles in regulating plant development are poorly defined. In this work, we report that the closely related Arabidopsis trxG genes ULTRAPETALA1 (ULT1) and ULT2 have overlapping functions in regulating shoot and floral stem cell accumulation, with ULT1 playing a major role but ULT2 also making a minor contribution. The two genes also have a novel, redundant activity in establishing the apical–basal polarity axis of the gynoecium, indicating that they function in differentiating tissues. Like ULT1 proteins, ULT2 proteins have a dual nuclear and cytoplasmic localization, and the two proteins physically associate in planta. Finally, we demonstrate that ULT1 and ULT2 have very similar overexpression phenotypes and regulate a common set of key development target genes, including floral MADS-box genes and class I KNOX genes. Our results reveal that chromatin remodeling mediated by the ULT1 and ULT2 proteins is necessary to control the development of meristems and reproductive organs. They also suggest that, like their animal counterparts, plant trxG proteins may function in multi-protein complexes to up-regulate the expression of key stage- and tissue-specific developmental regulatory genes.
-
Kück, Ulrich
2005-10-01
Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.
-
Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich
2005-04-01
The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.
-
Developmental Pathways Are Blueprints for Designing Successful Crops
Directory of Open Access Journals (Sweden)
Ben Trevaskis
2018-06-01
Full Text Available Genes controlling plant development have been studied in multiple plant systems. This has provided deep insights into conserved genetic pathways controlling core developmental processes including meristem identity, phase transitions, determinacy, stem elongation, and branching. These pathways control plant growth patterns and are fundamentally important to crop biology and agriculture. This review describes the conserved pathways that control plant development, using Arabidopsis as a model. Historical examples of how plant development has been altered through selection to improve crop performance are then presented. These examples, drawn from diverse crops, show how the genetic pathways controlling development have been modified to increase yield or tailor growth patterns to suit local growing environments or specialized crop management practices. Strategies to apply current progress in genomics and developmental biology to future crop improvement are then discussed within the broader context of emerging trends in plant breeding. The ways that knowledge of developmental processes and understanding of gene function can contribute to crop improvement, beyond what can be achieved by selection alone, are emphasized. These include using genome re-sequencing, mutagenesis, and gene editing to identify or generate novel variation in developmental genes. The expanding scope for comparative genomics, the possibility to engineer new developmental traits and new approaches to resolve gene–gene or gene–environment interactions are also discussed. Finally, opportunities to integrate fundamental research and crop breeding are highlighted.
-
Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P
2012-03-01
The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.
-
Identification of key pathways and genes influencing prognosis in bladder urothelial carcinoma
Directory of Open Access Journals (Sweden)
Ning X
2017-03-01
Full Text Available Xin Ning, Yaoliang Deng Department of Urology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi Province, People’s Republic of China Background: Genomic profiling can be used to identify the predictive effect of genomic subsets for determining prognosis in bladder urothelial carcinoma (BUC after radical cystectomy. This study aimed to investigate potential gene and pathway markers associated with prognosis in BUC.Methods: A microarray dataset of BUC was obtained from The Cancer Genome Atlas database. Differentially expressed genes (DEGs were identified by DESeq of the R platform. Kaplan–Meier analysis was applied for prognostic markers. Key pathways and genes were identified using bioinformatics tools, such as gene set enrichment analysis, gene ontology, the Kyoto Encyclopedia of Genes and Genomes, gene multiple association network integration algorithm (GeneMANIA, Search Tool for the Retrieval of Interacting Genes/Proteins, and Molecular Complex Detection.Results: A comparative gene set enrichment analysis of tumor and adjacent normal tissues suggested BUC tumorigenesis resulted mainly from enrichment of cell cycle and DNA damage and repair-related biological processes and pathways, including TP53 and mitotic recombination. Two hundred and fifty-six genes were identified as potential prognosis-related DEGs. Gene ontology and Kyoto Encyclopedia of Genes and Genomes analyses showed that the potential prognosis-related DEGs were enriched in angiogenesis, including the cyclic adenosine monophosphate biosynthetic process, cyclic guanosine monophosphate-protein kinase G, mitogen-activated protein kinase, Rap1, and phosphoinositide-3-kinase-AKT signaling pathway. Nine hub genes, TAGLN, ACTA2, MYH11, CALD1, MYLK, GEM, PRELP, TPM2, and OGN, were identified from the intersection of protein–protein interaction and GeneMANIA networks. Module analysis of protein–protein interaction and GeneMANIA networks mainly showed
-
Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).
Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T
2002-09-01
Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.
-
Institute of Scientific and Technical Information of China (English)
HSU Heng; Robert L. CHURCH
2004-01-01
During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.
-
Gene expression regulation in photomorphogenesis from the perspective of the central dogma.
Wu, Shu-Hsing
2014-01-01
Depending on the environment a young seedling encounters, the developmental program following seed germination could be skotomorphogenesis in the dark or photomorphogenesis in the light. Light signals are interpreted by a repertoire of photoreceptors followed by sophisticated gene expression networks, eventually resulting in developmental changes. The expression and functions of photoreceptors and key signaling molecules are highly coordinated and regulated at multiple levels of the central dogma in molecular biology. Light activates gene expression through the actions of positive transcriptional regulators and the relaxation of chromatin by histone acetylation. Small regulatory RNAs help attenuate the expression of light-responsive genes. Alternative splicing, protein phosphorylation/dephosphorylation, the formation of diverse transcriptional complexes, and selective protein degradation all contribute to proteome diversity and change the functions of individual proteins.
-
Hyde, Luke W
2015-05-01
The emerging field of neurogenetics seeks to model the complex pathways from gene to brain to behavior. This field has focused on imaging genetics techniques that examine how variability in common genetic polymorphisms predict differences in brain structure and function. These studies are informed by other complimentary techniques (e.g., animal models and multimodal imaging) and have recently begun to incorporate the environment through examination of Imaging Gene × Environment interactions. Though neurogenetics has the potential to inform our understanding of the development of psychopathology, there has been little integration between principles of neurogenetics and developmental psychopathology. The paper describes a neurogenetics and Imaging Gene × Environment approach and how these approaches have been usefully applied to the study of psychopathology. Six tenets of developmental psychopathology (the structure of phenotypes, the importance of exploring mechanisms, the conditional nature of risk, the complexity of multilevel pathways, the role of development, and the importance of who is studied) are identified, and how these principles can further neurogenetics applications to understanding the development of psychopathology is discussed. A major issue of this piece is how neurogenetics and current imaging and molecular genetics approaches can be incorporated into developmental psychopathology perspectives with a goal of providing models for better understanding pathways from among genes, environments, the brain, and behavior.
-
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
-
Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott
2016-08-01
Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.
-
Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan
2017-01-01
The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...
-
Whibley, Annabel; Urquhart, Jill; Dore, Jonathan; Willatt, Lionel; Parkin, Georgina; Gaunt, Lorraine; Black, Graeme; Donnai, Dian; Raymond, F Lucy
2010-01-01
Monoamine oxidases (MAO-A and MAO-B) have a key role in the degradation of amine neurotransmitters, such as dopamine, norepinephrine and serotonin. We identified an inherited 240 kb deletion on Xp11.3–p11.4, which encompasses both monoamine oxidase genes but, unlike other published reports, does not affect the adjacent Norrie disease gene (NDP). The brothers who inherited the deletion, and thus have no monoamine oxidase function, presented with severe developmental delay, intermittent hypoton...
-
Yang, Jun; Hou, Ziming; Wang, Changjiang; Wang, Hao; Zhang, Hongbing
2018-04-23
Adamantinomatous craniopharyngioma (ACP) is an aggressive brain tumor that occurs predominantly in the pediatric population. Conventional diagnosis method and standard therapy cannot treat ACPs effectively. In this paper, we aimed to identify key genes for ACP early diagnosis and treatment. Datasets GSE94349 and GSE68015 were obtained from Gene Expression Omnibus database. Consensus clustering was applied to discover the gene clusters in the expression data of GSE94349 and functional enrichment analysis was performed on gene set in each cluster. The protein-protein interaction (PPI) network was built by the Search Tool for the Retrieval of Interacting Genes, and hubs were selected. Support vector machine (SVM) model was built based on the signature genes identified from enrichment analysis and PPI network. Dataset GSE94349 was used for training and testing, and GSE68015 was used for validation. Besides, RT-qPCR analysis was performed to analyze the expression of signature genes in ACP samples compared with normal controls. Seven gene clusters were discovered in the differentially expressed genes identified from GSE94349 dataset. Enrichment analysis of each cluster identified 25 pathways that highly associated with ACP. PPI network was built and 46 hubs were determined. Twenty-five pathway-related genes that overlapped with the hubs in PPI network were used as signatures to establish the SVM diagnosis model for ACP. The prediction accuracy of SVM model for training, testing, and validation data were 94, 85, and 74%, respectively. The expression of CDH1, CCL2, ITGA2, COL8A1, COL6A2, and COL6A3 were significantly upregulated in ACP tumor samples, while CAMK2A, RIMS1, NEFL, SYT1, and STX1A were significantly downregulated, which were consistent with the differentially expressed gene analysis. SVM model is a promising classification tool for screening and early diagnosis of ACP. The ACP-related pathways and signature genes will advance our knowledge of ACP pathogenesis
-
Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa
2018-06-01
Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .
-
Directory of Open Access Journals (Sweden)
Tianyuan Zhang
2017-11-01
Full Text Available Perilla frutescen is used as traditional food and medicine in East Asia. Its seeds contain high levels of α-linolenic acid (ALA, which is important for health, but is scarce in our daily meals. Previous reports on RNA-seq of perilla seed had identified fatty acid (FA and triacylglycerol (TAG synthesis genes, but the underlying mechanism of ALA biosynthesis and its regulation still need to be further explored. So we conducted Illumina RNA-sequencing in seven temporal developmental stages of perilla seeds. Sequencing generated a total of 127 million clean reads, containing 15.88 Gb of valid data. The de novo assembly of sequence reads yielded 64,156 unigenes with an average length of 777 bp. A total of 39,760 unigenes were annotated and 11,693 unigenes were found to be differentially expressed in all samples. According to Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analysis, 486 unigenes were annotated in the “lipid metabolism” pathway. Of these, 150 unigenes were found to be involved in fatty acid (FA biosynthesis and triacylglycerol (TAG assembly in perilla seeds. A coexpression analysis showed that a total of 104 genes were highly coexpressed (r > 0.95. The coexpression network could be divided into two main subnetworks showing over expression in the medium or earlier and late phases, respectively. In order to identify the putative regulatory genes, a transcription factor (TF analysis was performed. This led to the identification of 45 gene families, mainly including the AP2-EREBP, bHLH, MYB, and NAC families, etc. After coexpression analysis of TFs with highly expression of FAD2 and FAD3 genes, 162 TFs were found to be significantly associated with two FAD genes (r > 0.95. Those TFs were predicted to be the key regulatory factors in ALA biosynthesis in perilla seed. The qRT-PCR analysis also verified the relevance of expression pattern between two FAD genes and partial candidate TFs. Although it has been reported that some TFs
-
Distinguishing epigenetic marks of developmental and imprinting regulation
Directory of Open Access Journals (Sweden)
McEwen Kirsten R
2010-01-01
Full Text Available Abstract Background The field of epigenetics is developing rapidly, however we are only beginning to comprehend the complexity of its influence on gene regulation. Using genomic imprinting as a model we examine epigenetic profiles associated with different forms of gene regulation. Imprinting refers to the expression of a gene from only one of the chromosome homologues in a parental-origin-specific manner. This is dependent on heritable germline epigenetic control at a cis-acting imprinting control region that influences local epigenetic states. Epigenetic modifications associated with imprinting regulation can be compared to those associated with the more canonical developmental regulation, important for processes such as differentiation and tissue specificity. Here we test the hypothesis that these two mechanisms are associated with different histone modification enrichment patterns. Results Using high-throughput data extraction with subsequent analysis, we have found that particular histone modifications are more likely to be associated with either imprinting repression or developmental repression of imprinted genes. H3K9me3 and H4K20me3 are together enriched at imprinted genes with differentially methylated promoters and do not show a correlation with developmental regulation. H3K27me3 and H3K4me3, however, are more often associated with developmental regulation. We find that imprinted genes are subject to developmental regulation through bivalency with H3K4me3 and H3K27me3 enrichment on the same allele. Furthermore, a specific tri-mark signature comprising H3K4me3, H3K9me3 and H4K20me3 has been identified at all imprinting control regions. Conclusion A large amount of data is produced from whole-genome expression and epigenetic profiling studies of cellular material. We have shown that such publicly available data can be mined and analysed in order to generate novel findings for categories of genes or regulatory elements. Comparing two
-
Kishi, Shuji
2011-09-01
Senescence may be considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena during the process of aging. We investigated whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We conducted experiments to isolate zebrafish mutants expressing an apparent senescence phenotype during embryogenesis (embryonic senescence). Some of the genes we thereby identified had already been associated with cellular senescence and chronological aging in other organisms, but many had not yet been linked to these processes. Complete loss-of-function of developmentally essential genes induce embryonic (or larval) lethality, whereas it seems like their partial loss-of-function (i.e., decrease-of-function by heterozygote or hypomorphic mutations) still remains sufficient to go through the early developmental process because of its adaptive plasticity or rather heterozygote advantage. However, in some cases, such partial loss-of-function of genes compromise normal homeostasis due to haploinsufficiency later in adult life having many environmental stress challenges. By contrast, any heterozygote-advantageous genes might gain a certain benefit(s) (much more fitness) by such partial loss-of-function later in life. Physiological senescence may evolutionarily arise from both genetic and epigenetic drifts as well as from losing adaptive developmental plasticity in face of stress signals from the external environment that interacts with functions of multiple genes rather than effects of only a single gene mutation or defect. Previously uncharacterized developmental genes may thus mediate the aging process and play a pivotal role in senescence. Moreover, unexpected senescence-related genes might also be involved in the early developmental process and
-
Directory of Open Access Journals (Sweden)
Tae Hyuk Kang
2011-01-01
Full Text Available We have used microarray-based methods of global gene expression together with quantitative PCR and Western blot analysis to identify dysregulation of genes and aberrant cellular processes in human fibroblasts and in SH-SY5Y neuroblastoma cells made HPRT-deficient by transduction with a retrovirus stably expressing an shRNA targeted against HPRT. Analysis of the microarray expression data by Gene ontology (GO and Gene Set Enrichment Analysis (GSEA as well as significant pathway analysis by GeneSpring GX10 and Panther Classification System reveal that HPRT deficiency is accompanied by aberrations in a variety of pathways known to regulate neurogenesis or to be implicated in neurodegenerative disease, including the canonical Wnt/β-catenin and the Alzheimer's disease/presenilin signaling pathways. Dysregulation of the Wnt/β-catenin pathway is confirmed by Western blot demonstration of cytosolic sequestration of β-catenin during in vitro differentiation of the SH-SY5Y cells toward the neuronal phenotype. We also demonstrate that two key transcription factor genes known to be regulated by Wnt signaling and to be vital for the generation and function of dopaminergic neurons; i.e., Lmx1a and Engrailed 1, are down-regulated in the HPRT knockdown SH-SY5Y cells. In addition to the Wnt signaling aberration, we found that expression of presenilin-1 shows severely aberrant expression in HPRT-deficient SH-SY5Y cells, reflected by marked deficiency of the 23 kDa C-terminal fragment of presenilin-1 in knockdown cells. Western blot analysis of primary fibroblast cultures from two LND patients also shows dysregulated presenilin-1 expression, including aberrant proteolytic processing of presenilin-1. These demonstrations of dysregulated Wnt signaling and presenilin-1 expression together with impaired expression of dopaminergic transcription factors reveal broad pleitropic neuro-regulatory defects played by HPRT expression and suggest new directions for
-
Li, Shuang; Li, Rui; Wang, Heping; Li, Lisha; Li, Huiyu; Li, Yulin
2018-04-01
An important question in systems biology is what role the underlying molecular mechanisms play in disease progression. The relationship between chronic pancreatitis and pancreatic cancer needs further exploration in a system view. We constructed the disease network based on gene expression data and protein-protein interaction. We proposed an approach to discover the underlying core network and molecular factors in the progression of pancreatic diseases, which contain stages of chronic pancreatitis and pancreatic cancer. The chronic pancreatitis and pancreatic cancer core network and key factors were revealed and then verified by gene set enrichment analysis of pathways and diseases. The key factors provide the microenvironment for tumor initiation and the change of gene expression level of key factors bridge chronic pancreatitis and pancreatic cancer. Some new candidate genes need further verification by experiments. Transcriptome profiling-based network analysis reveals the importance of chronic pancreatitis genes and pathways in pancreatic cancer development on a system level by computational method and they can be therapeutic targets.
-
Directory of Open Access Journals (Sweden)
Shuhua Zhan
Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.
-
Directory of Open Access Journals (Sweden)
Feng Ding
Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.
-
Developmental transcriptome of Aplysia californica'
Heyland, Andreas
2010-12-06
Genome-wide transcriptional changes in development provide important insight into mechanisms underlying growth, differentiation, and patterning. However, such large-scale developmental studies have been limited to a few representatives of Ecdysozoans and Chordates. Here, we characterize transcriptomes of embryonic, larval, and metamorphic development in the marine mollusc Aplysia californica and reveal novel molecular components associated with life history transitions. Specifically, we identify more than 20 signal peptides, putative hormones, and transcription factors in association with early development and metamorphic stages-many of which seem to be evolutionarily conserved elements of signal transduction pathways. We also characterize genes related to biomineralization-a critical process of molluscan development. In summary, our experiment provides the first large-scale survey of gene expression in mollusc development, and complements previous studies on the regulatory mechanisms underlying body plan patterning and the formation of larval and juvenile structures. This study serves as a resource for further functional annotation of transcripts and genes in Aplysia, specifically and molluscs in general. A comparison of the Aplysia developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms that are likely a consequence of the different developmental modes of these organisms. © 2010 Wiley-Liss, Inc., A Wiley Company.
-
Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.
2012-01-01
Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.
-
Novel Pectate Lyase Genes of Heterodera glycines Play Key Roles in the Early Stage of Parasitism.
Directory of Open Access Journals (Sweden)
Huan Peng
Full Text Available Pectate lyases are known to play a key role in pectin degradation by catalyzing the random cleavage of internal polymer linkages (endo-pectinases. In this paper, four novel cDNAs, designated Hg-pel-3, Hg-pel-4, Hg-pel-6 and Hg-pel-7, that encode pectate lyases were cloned and characterized from the soybean cyst nematode, Heterodera glycines. The predicted protein sequences of HG-PEL-3, HG-PEL-4 and HG-PEL-6 differed significantly in both their amino acid sequences and their genomic structures from other pectate lyases of H. glycines (HG-PEL-1, HG-PEL-2 and HG-PEL-7. A phylogenetic study revealed that the pectate lyase proteins of H. glycines are clustered into distinct clades and have distinct numbers and positioning of introns, which suggests that the pectate lyase genes of H. glycines may have evolved from at least two ancestral genes. A Southern blot analysis revealed that multiple Hg-pel-6-like genes were present in the H. glycines genome. In situ hybridization showed that four novel pectate lyases (Hg-pel-3, Hg-pel-4, Hg-pel-6 and Hg-pel-7 were actively transcribed in the subventral esophageal gland cells. A semi-quantitative RT-PCR assay supported the finding that the expression of these genes was strong in the egg, pre-parasitic second-stage juvenile (J2 and early parasitic J2 stages and that it declined in further developmental stages of the nematode. This expression pattern suggests that these proteins play a role in the migratory phase of the nematode life cycle. Knocking down Hg-pel-6 using in vitro RNA interference resulted in a 46.9% reduction of the number of nematodes that invaded the plants and a 61.5% suppression of the development of H. glycines females within roots compared to the GFP-dsRNA control. Plant host-derived RNAi induced the silencing of the Hg-pel-6gene, which significantly reduced the nematode infection levels at 7 Days post inoculation (dpi. Similarly, this procedure reduced the number of female adults at 40 dpi
-
Cuesta, Ines H; Lahiri, Kajori; Lopez-Olmeda, Jose Fernando; Loosli, Felix; Foulkes, Nicholas S; Vallone, Daniela
2014-05-01
One key challenge for the field of chronobiology is to identify how circadian clock function emerges during early embryonic development. Teleosts such as the zebrafish are ideal models for studying circadian clock ontogeny since the entire process of development occurs ex utero in an optically transparent chorion. Medaka (Oryzias latipes) represents another powerful fish model for exploring early clock function with, like the zebrafish, many tools available for detailed genetic analysis. However, to date there have been no reports documenting circadian clock gene expression during medaka development. Here we have characterized the expression of key clock genes in various developmental stages and in adult tissues of medaka. As previously reported for other fish, light dark cycles are required for the emergence of clock gene expression rhythms in this species. While rhythmic expression of per and cry genes is detected very early during development and seems to be light driven, rhythmic clock and bmal expression appears much later around hatching time. Furthermore, the maturation of clock function seems to correlate with the appearance of rhythmic expression of these positive elements of the clock feedback loop. By accelerating development through elevated temperatures or by artificially removing the chorion, we show an earlier onset of rhythmicity in clock and bmal expression. Thus, differential maturation of key elements of the medaka clock mechanism depends on the developmental stage and the presence of the chorion.
-
A study of the role of the FOXP2 and CNTNAP2 genes in persistent developmental stuttering.
Han, Tae-Un; Park, John; Domingues, Carlos F; Moretti-Ferreira, Danilo; Paris, Emily; Sainz, Eduardo; Gutierrez, Joanne; Drayna, Dennis
2014-09-01
A number of speech disorders including stuttering have been shown to have important genetic contributions, as indicated by high heritability estimates from twin and other studies. We studied the potential contribution to stuttering from variants in the FOXP2 gene, which have previously been associated with developmental verbal dyspraxia, and from variants in the CNTNAP2 gene, which have been associated with specific language impairment (SLI). DNA sequence analysis of these two genes in a group of 602 unrelated cases, all with familial persistent developmental stuttering, revealed no excess of potentially deleterious coding sequence variants in the cases compared to a matched group of 487 well characterized neurologically normal controls. This was compared to the distribution of variants in the GNPTAB, GNPTG, and NAGPA genes which have previously been associated with persistent stuttering. Using an expanded subject data set, we again found that NAGPA showed significantly different mutation frequencies in North Americans of European descent (p=0.0091) and a significant difference existed in the mutation frequency of GNPTAB in Brazilians (p=0.00050). No significant differences in mutation frequency in the FOXP2 and CNTNAP2 genes were observed between cases and controls. To examine the pattern of expression of these five genes in the human brain, real time quantitative reverse transcription PCR was performed on RNA purified from 27 different human brain regions. The expression patterns of FOXP2 and CNTNAP2 were generally different from those of GNPTAB, GNPTG and NAPGA in terms of relatively lower expression in the cerebellum. This study provides an improved estimate of the contribution of mutations in GNPTAB, GNPTG and NAGPA to persistent stuttering, and suggests that variants in FOXP2 and CNTNAP2 are not involved in the genesis of familial persistent stuttering. This, together with the different brain expression patterns of GNPTAB, GNPTG, and NAGPA compared to that of
-
International Nuclear Information System (INIS)
Shi, J.B.; Ye, G.J.; Yang, Y.Z.; Wang, F.; Zhou, Y; Wang, J.
2016-01-01
In the present study, the expression patterns of the key genes in the gibberellin synthesis pathway in the potato dwarf mutant M4P-9 were detected using quantitative real-time PCR. Using Actin as an internal control, CPS1, KS, KO, GA20ox1, and GA2ox1, genes for key gibberellin synthesis enzymes, were evaluated, along with a gibberellin receptor gene. The standard curves were obtained from dilutions of PCR product; the correlation coefficient for Actin was 0.995, and those for the target genes varied from 0.994 to 1.000. The expression patterns of gibberellin pathway genes in different growth stages and tissues were calculated according to the method of Pfaffl. These genes showed expression patterns that varied based on growth stage and tissue type. The higher expression levels of CPS1 and GA2ox1 in roots, the lower expression levels of GA20ox1 in roots during tuber formation stage; as well as the increased expression of GA20ox1 and GA2ox1 genes in stems during the tuber formation stage, likely play key roles in the plant height phenotype in M4P-9 mutant materials. This article provides a basis for researching the mechanism of gibberellin synthesis in potato. (author)
-
Microarray analysis reveals key genes and pathways in Tetralogy of Fallot
He, Yue-E; Qiu, Hui-Xian; Jiang, Jian-Bing; Wu, Rong-Zhou; Xiang, Ru-Lian; Zhang, Yuan-Hai
2017-01-01
The aim of the present study was to identify key genes that may be involved in the pathogenesis of Tetralogy of Fallot (TOF) using bioinformatics methods. The GSE26125 microarray dataset, which includes cardiovascular tissue samples derived from 16 children with TOF and five healthy age-matched control infants, was downloaded from the Gene Expression Omnibus database. Differential expression analysis was performed between TOF and control samples to identify differentially expressed genes (DEGs) using Student's t-test, and the R/limma package, with a log2 fold-change of >2 and a false discovery rate of <0.01 set as thresholds. The biological functions of DEGs were analyzed using the ToppGene database. The ReactomeFIViz application was used to construct functional interaction (FI) networks, and the genes in each module were subjected to pathway enrichment analysis. The iRegulon plugin was used to identify transcription factors predicted to regulate the DEGs in the FI network, and the gene-transcription factor pairs were then visualized using Cytoscape software. A total of 878 DEGs were identified, including 848 upregulated genes and 30 downregulated genes. The gene FI network contained seven function modules, which were all comprised of upregulated genes. Genes enriched in Module 1 were enriched in the following three neurological disorder-associated signaling pathways: Parkinson's disease, Alzheimer's disease and Huntington's disease. Genes in Modules 0, 3 and 5 were dominantly enriched in pathways associated with ribosomes and protein translation. The Xbox binding protein 1 transcription factor was demonstrated to be involved in the regulation of genes encoding the subunits of cytoplasmic and mitochondrial ribosomes, as well as genes involved in neurodegenerative disorders. Therefore, dysfunction of genes involved in signaling pathways associated with neurodegenerative disorders, ribosome function and protein translation may contribute to the pathogenesis of TOF
-
Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping
2012-12-01
Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All
-
Robinson, Joshua F; Port, Jesse A; Yu, Xiaozhong; Faustman, Elaine M
2010-10-01
To understand the complex etiology of developmental disorders, an understanding of both genetic and environmental risk factors is needed. Human and rodent genetic studies have identified a multitude of gene candidates for specific developmental disorders such as neural tube defects (NTDs). With the emergence of toxicogenomic-based assessments, scientists now also have the ability to compare and understand the expression of thousands of genes simultaneously across strain, time, and exposure in developmental models. Using a systems-based approach in which we are able to evaluate information from various parts and levels of the developing organism, we propose a framework for integrating genetic information with toxicogenomic-based studies to better understand gene-environmental interactions critical for developmental disorders. This approach has allowed us to characterize candidate genes in the context of variables critical for determining susceptibility such as strain, time, and exposure. Using a combination of toxicogenomic studies and complementary bioinformatic tools, we characterize NTD candidate genes during normal development by function (gene ontology), linked phenotype (disease outcome), location, and expression (temporally and strain-dependent). In addition, we show how environmental exposures (cadmium, methylmercury) can influence expression of these genes in a strain-dependent manner. Using NTDs as an example of developmental disorder, we show how simple integration of genetic information from previous studies into the standard microarray design can enhance analysis of gene-environment interactions to better define environmental exposure-disease pathways in sensitive and resistant mouse strains. © Wiley-Liss, Inc.
-
Directory of Open Access Journals (Sweden)
Ye Gao
Full Text Available Cashmere goat skin contains two types of hair follicles (HF: primary hair follicles (PHF and secondary hair follicles (SHF. Although multiple genetic determinants associated with HF formation have been identified, the molecules that determine the independent morphogenesis of HF in cashmere goats remain elusive. The growth and development of SHF directly influence the quantity and quality of cashmere production. Here, we report the transcriptome profiling analysis of nine skin samples from cashmere goats using 60- and 120-day-old embryos (E60 and E120, respectively, as well as newborns (NB, through RNA-sequencing (RNA-seq. HF morphological changes indicated that PHF were initiated at E60, with maturation from E120, while differentiation of SHF was identified at E120 until formation of cashmere occurred after birth (NB. The RNA-sequencing analysis generated over 20.6 million clean reads from each mRNA library. The number of differentially expressed genes (DEGs in E60 vs. E120, E120 vs. NB, and E60 vs. NB were 1,024, 0 and 1,801, respectively, indicating that no significant differences were found at transcriptomic levels between E120 and NB. Key genes including B4GALT4, TNC, a-integrin, and FGFR1, were up-regulated and expressed in HF initiation from E60 to E120, while regulatory genes such as GPRC5D, PAD3, HOXC13, PRR9, VSIG8, LRRC15, LHX2, MSX-2, and FOXN1 were up-regulated and expressed in HF keratinisation and hair shaft differentiation from E120 and NB to E60. Several genes belonging to the KRT and KRTAP gene families were detected throughout the three HF developmental stages. The transcriptional trajectory analyses of all DEGs indicated that immune privilege, glycosaminoglycan biosynthesis, extracellular matrix receptor interaction, and growth factor receptors all played dominant roles in the epithelial-mesenchymal interface and HF formation. We found that the Wnt, transforming growth factor-beta/bone morphogenetic protein, and Notch family
-
Gao, Ye; Wang, Xiaolong; Yan, Hailong; Zeng, Jie; Ma, Sen; Niu, Yiyuan; Zhou, Guangxian; Jiang, Yu; Chen, Yulin
2016-01-01
Cashmere goat skin contains two types of hair follicles (HF): primary hair follicles (PHF) and secondary hair follicles (SHF). Although multiple genetic determinants associated with HF formation have been identified, the molecules that determine the independent morphogenesis of HF in cashmere goats remain elusive. The growth and development of SHF directly influence the quantity and quality of cashmere production. Here, we report the transcriptome profiling analysis of nine skin samples from cashmere goats using 60- and 120-day-old embryos (E60 and E120, respectively), as well as newborns (NB), through RNA-sequencing (RNA-seq). HF morphological changes indicated that PHF were initiated at E60, with maturation from E120, while differentiation of SHF was identified at E120 until formation of cashmere occurred after birth (NB). The RNA-sequencing analysis generated over 20.6 million clean reads from each mRNA library. The number of differentially expressed genes (DEGs) in E60 vs. E120, E120 vs. NB, and E60 vs. NB were 1,024, 0 and 1,801, respectively, indicating that no significant differences were found at transcriptomic levels between E120 and NB. Key genes including B4GALT4, TNC, a-integrin, and FGFR1, were up-regulated and expressed in HF initiation from E60 to E120, while regulatory genes such as GPRC5D, PAD3, HOXC13, PRR9, VSIG8, LRRC15, LHX2, MSX-2, and FOXN1 were up-regulated and expressed in HF keratinisation and hair shaft differentiation from E120 and NB to E60. Several genes belonging to the KRT and KRTAP gene families were detected throughout the three HF developmental stages. The transcriptional trajectory analyses of all DEGs indicated that immune privilege, glycosaminoglycan biosynthesis, extracellular matrix receptor interaction, and growth factor receptors all played dominant roles in the epithelial-mesenchymal interface and HF formation. We found that the Wnt, transforming growth factor-beta/bone morphogenetic protein, and Notch family members
-
Saffron: Its Phytochemistry, Developmental Processes, and Biotechnological Prospects.
Ahrazem, Oussama; Rubio-Moraga, Angela; Nebauer, Sergio G; Molina, Rosa Victoria; Gómez-Gómez, Lourdes
2015-10-14
The present state of knowledge concerning developmental processes and the secondary metabolism of saffron, Crocus sativus L. (Iridaceae), along with the genes involved in these processes so far known, is reviewed. Flowers and corms constitute the most valuable parts of saffron. Corm and flower development are two key aspects to be studied in saffron to increase the yield and quality of the spice, to raise its reproductive rate, and to implement new production systems. Important knowledge about the physiology of flowering and vegetative growth has been acquired in recent years, but there is still only limited information on molecular mechanisms controlling these processes. Although some genes involved in flower formation and meristem transition in other species have been isolated in saffron, the role of these genes in this species awaits further progress. Also, genes related with the synthesis pathway of abscisic acid and strigolactones, growth regulators related with bud endodormancy and apical dominance (paradormancy), have been isolated. However, the in-depth understanding of these processes as well as of corm development is far from being achieved. By contrast, saffron phytochemicals have been widely studied. The different flower tissues and the corm have been proved to be an important source of phytochemicals with pharmacological properties. The biotechnological prospects for saffron are here reviewed on the basis of the discovery of the enzymes involved in key aspects of saffron secondary metabolism, and we also analyze the possibility of transferring current knowledge about flowering and vegetative propagation in model species to the Crocus genus.
-
Bulimia: A Self-Psychological and Ego-Developmental View.
Brenner-Liss, Deborah
1986-01-01
Discusses key clinical issues in the treatment of bulimia with clinical examples from a self-psychological and ego-developmental point of view. Identifies three developmental issues for bulimia: self-regulatory, differentiation, and self-esteem. (Author/ABB)
-
Trisomy 21 and facial developmental instability.
Starbuck, John M; Cole, Theodore M; Reeves, Roger H; Richtsmeier, Joan T
2013-05-01
The most common live-born human aneuploidy is trisomy 21, which causes Down syndrome (DS). Dosage imbalance of genes on chromosome 21 (Hsa21) affects complex gene-regulatory interactions and alters development to produce a wide range of phenotypes, including characteristic facial dysmorphology. Little is known about how trisomy 21 alters craniofacial morphogenesis to create this characteristic appearance. Proponents of the "amplified developmental instability" hypothesis argue that trisomy 21 causes a generalized genetic imbalance that disrupts evolutionarily conserved developmental pathways by decreasing developmental homeostasis and precision throughout development. Based on this model, we test the hypothesis that DS faces exhibit increased developmental instability relative to euploid individuals. Developmental instability was assessed by a statistical analysis of fluctuating asymmetry. We compared the magnitude and patterns of fluctuating asymmetry among siblings using three-dimensional coordinate locations of 20 anatomic landmarks collected from facial surface reconstructions in four age-matched samples ranging from 4 to 12 years: (1) DS individuals (n = 55); (2) biological siblings of DS individuals (n = 55); 3) and 4) two samples of typically developing individuals (n = 55 for each sample), who are euploid siblings and age-matched to the DS individuals and their euploid siblings (samples 1 and 2). Identification in the DS sample of facial prominences exhibiting increased fluctuating asymmetry during facial morphogenesis provides evidence for increased developmental instability in DS faces. We found the highest developmental instability in facial structures derived from the mandibular prominence and lowest in facial regions derived from the frontal prominence. Copyright © 2013 Wiley Periodicals, Inc.
-
Kung, Tiffany S; Richardson, Jason R; Cooper, Keith R; White, Lori A
2015-08-01
Pyrethroids are commonly used insecticides that are considered to pose little risk to human health. However, there is an increasing concern that children are more susceptible to the adverse effects of pesticides. We used the zebrafish model to test the hypothesis that developmental exposure to low doses of the pyrethroid deltamethrin results in persistent alterations in dopaminergic gene expression, neurochemistry, and locomotor activity. Zebrafish embryos were treated with deltamethrin (0.25-0.50 μg/l), at concentrations below the LOAEL, during the embryonic period [3-72 h postfertilization (hpf)], after which transferred to fresh water until the larval stage (2-weeks postfertilization). Deltamethrin exposure resulted in decreased transcript levels of the D1 dopamine (DA) receptor (drd1) and increased levels of tyrosine hydroxylase at 72 hpf. The reduction in drd1 transcripts persisted to the larval stage and was associated with decreased D2 dopamine receptor transcripts. Larval fish, exposed developmentally to deltamethrin, had increased levels of homovanillic acid, a DA metabolite. Since the DA system is involved in locomotor activity, we measured the swim activity of larval fish following a transition to darkness. Developmental exposure to deltamethrin significantly increased larval swim activity which was attenuated by concomitant knockdown of the DA transporter. Acute exposure to methylphenidate, a DA transporter inhibitor, increased swim activity in control larva, while reducing swim activity in larva developmentally exposed to deltamethrin. Developmental exposure to deltamethrin causes locomotor deficits in larval zebrafish, which is likely mediated by dopaminergic dysfunction. This highlights the need to understand the persistent effects of low-dose neurotoxicant exposure during development. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
-
Directory of Open Access Journals (Sweden)
Christopher Terranova
Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.
-
Signal Transduction Pathways that Regulate CAB Gene Expression
Energy Technology Data Exchange (ETDEWEB)
Chory, Joanne
2004-12-31
The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.
-
Signal Transduction Pathways that Regulate CAB Gene Expression
Energy Technology Data Exchange (ETDEWEB)
Chory, Joanne
2006-01-16
The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.
-
Replication and robustness in developmental research.
Duncan, Greg J; Engel, Mimi; Claessens, Amy; Dowsett, Chantelle J
2014-11-01
Replications and robustness checks are key elements of the scientific method and a staple in many disciplines. However, leading journals in developmental psychology rarely include explicit replications of prior research conducted by different investigators, and few require authors to establish in their articles or online appendices that their key results are robust across estimation methods, data sets, and demographic subgroups. This article makes the case for prioritizing both explicit replications and, especially, within-study robustness checks in developmental psychology. It provides evidence on variation in effect sizes in developmental studies and documents strikingly different replication and robustness-checking practices in a sample of journals in developmental psychology and a sister behavioral science-applied economics. Our goal is not to show that any one behavioral science has a monopoly on best practices, but rather to show how journals from a related discipline address vital concerns of replication and generalizability shared by all social and behavioral sciences. We provide recommendations for promoting graduate training in replication and robustness-checking methods and for editorial policies that encourage these practices. Although some of our recommendations may shift the form and substance of developmental research articles, we argue that they would generate considerable scientific benefits for the field. (PsycINFO Database Record (c) 2014 APA, all rights reserved).
-
Tomato Fruits Show Wide Phenomic Diversity but Fruit Developmental Genes Show Low Genomic Diversity.
Directory of Open Access Journals (Sweden)
Vijee Mohan
Full Text Available Domestication of tomato has resulted in large diversity in fruit phenotypes. An intensive phenotyping of 127 tomato accessions from 20 countries revealed extensive morphological diversity in fruit traits. The diversity in fruit traits clustered the accessions into nine classes and identified certain promising lines having desirable traits pertaining to total soluble salts (TSS, carotenoids, ripening index, weight and shape. Factor analysis of the morphometric data from Tomato Analyzer showed that the fruit shape is a complex trait shared by several factors. The 100% variance between round and flat fruit shapes was explained by one discriminant function having a canonical correlation of 0.874 by stepwise discriminant analysis. A set of 10 genes (ACS2, COP1, CYC-B, RIN, MSH2, NAC-NOR, PHOT1, PHYA, PHYB and PSY1 involved in various plant developmental processes were screened for SNP polymorphism by EcoTILLING. The genetic diversity in these genes revealed a total of 36 non-synonymous and 18 synonymous changes leading to the identification of 28 haplotypes. The average frequency of polymorphism across the genes was 0.038/Kb. Significant negative Tajima'D statistic in two of the genes, ACS2 and PHOT1 indicated the presence of rare alleles in low frequency. Our study indicates that while there is low polymorphic diversity in the genes regulating plant development, the population shows wider phenotype diversity. Nonetheless, morphological and genetic diversity of the present collection can be further exploited as potential resources in future.
-
Developmental changes in the metabolic network of snapdragon flowers.
Directory of Open Access Journals (Sweden)
Joëlle K Muhlemann
Full Text Available Evolutionary and reproductive success of angiosperms, the most diverse group of land plants, relies on visual and olfactory cues for pollinator attraction. Previous work has focused on elucidating the developmental regulation of pathways leading to the formation of pollinator-attracting secondary metabolites such as scent compounds and flower pigments. However, to date little is known about how flowers control their entire metabolic network to achieve the highly regulated production of metabolites attracting pollinators. Integrative analysis of transcripts and metabolites in snapdragon sepals and petals over flower development performed in this study revealed a profound developmental remodeling of gene expression and metabolite profiles in petals, but not in sepals. Genes up-regulated during petal development were enriched in functions related to secondary metabolism, fatty acid catabolism, and amino acid transport, whereas down-regulated genes were enriched in processes involved in cell growth, cell wall formation, and fatty acid biosynthesis. The levels of transcripts and metabolites in pathways leading to scent formation were coordinately up-regulated during petal development, implying transcriptional induction of metabolic pathways preceding scent formation. Developmental gene expression patterns in the pathways involved in scent production were different from those of glycolysis and the pentose phosphate pathway, highlighting distinct developmental regulation of secondary metabolism and primary metabolic pathways feeding into it.
-
DEFF Research Database (Denmark)
Rewitz, Kim; Rybczynski, Robert; Warren, James T.
2006-01-01
this work to the tobacco hornworm Manduca sexta, an established model for endocrinological and developmental studies. cDNA clones were obtained for three Manduca orthologs of CYP306A1 (phantom; phm, the 25-hydroxylase), CYP302A1 (disembodied; dib, the 22-hydroxylase) and CYP315A1 (shadow; sad, the 2...... in the developmentally varying steroidogenic capacities of the prothoracic glands during the fifth instar. The consistent expression of the Halloween genes confirms the importance of the prothoracic glands in pupal-adult development. These studies establish Manduca as an excellent model for examining the regulation...
-
Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling
2015-03-01
Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
-
Bakos, Jan; Lestanova, Zuzana; Strbak, Vladimir; Havranek, Tomas; Bacova, Zuzana
2014-10-01
Oxytocin production and secretion is important for early development of the brain. Long-term consequences of manipulation of oxytocin system might include changes in markers of brain plasticity - cytoskeletal proteins and neurotrophins. The aim of the present study was (1) to determine whether neonatal oxytocin administration affects gene expression of nestin, microtubule-associated protein-2 (MAP-2), brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) in the brain of two developmental stages of rat and (2) to evaluate whether neonatal oxytocin administration protects against lipopolysaccharide (LPS) induced inflammation. Neonatal oxytocin did not prevent a decrease of body weight in the LPS treated animals. Oxytocin significantly increased gene expression of BDNF in the right hippocampus in 21-day and 2-month old rats of both sexes. Gene expression of NGF and MAP-2 significantly increased in males treated with oxytocin. Both, growth factors and intermediate filament-nestin mRNA levels, were reduced in females exposed to LPS. Oxytocin treatment prevented a decrease in the gene expression of only growth factors. In conclusion, neonatal manipulation of oxytocin has developmental and sex-dependent effect on markers of brain plasticity. These results also indicate, that oxytocin may be protective against inflammation particularly in females. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Reproductive and developmental toxicology
National Research Council Canada - National Science Library
Gupta, Ramesh C
2011-01-01
.... With a special focus on placental toxicity, this book is the only available reference to connect the three key risk stages, and is the only resource to include reproductive and developmental toxicity in domestic animals, fish, and wildlife.
-
Moreira, Viviane S; Soares, Virgínia L F; Silva, Raner J S; Sousa, Aurizangela O; Otoni, Wagner C; Costa, Marcio G C
2018-05-01
Bixa orellana L., popularly known as annatto, produces several secondary metabolites of pharmaceutical and industrial interest, including bixin, whose molecular basis of biosynthesis remain to be determined. Gene expression analysis by quantitative real-time PCR (qPCR) is an important tool to advance such knowledge. However, correct interpretation of qPCR data requires the use of suitable reference genes in order to reduce experimental variations. In the present study, we have selected four different candidates for reference genes in B. orellana , coding for 40S ribosomal protein S9 (RPS9), histone H4 (H4), 60S ribosomal protein L38 (RPL38) and 18S ribosomal RNA (18SrRNA). Their expression stabilities in different tissues (e.g. flower buds, flowers, leaves and seeds at different developmental stages) were analyzed using five statistical tools (NormFinder, geNorm, BestKeeper, ΔCt method and RefFinder). The results indicated that RPL38 is the most stable gene in different tissues and stages of seed development and 18SrRNA is the most unstable among the analyzed genes. In order to validate the candidate reference genes, we have analyzed the relative expression of a target gene coding for carotenoid cleavage dioxygenase 1 (CCD1) using the stable RPL38 and the least stable gene, 18SrRNA , for normalization of the qPCR data. The results demonstrated significant differences in the interpretation of the CCD1 gene expression data, depending on the reference gene used, reinforcing the importance of the correct selection of reference genes for normalization.
-
Directory of Open Access Journals (Sweden)
Moorman Stephen J
2005-05-01
Full Text Available Abstract Background Little is known about the affect of microgravity on gene expression, particularly in vivo during embryonic development. Using transgenic zebrafish that express the gfp gene under the influence of a β-actin promoter, we examined the affect of simulated-microgravity on GFP expression in the heart, notochord, eye, somites, and rohon beard neurons. We exposed transgenic zebrafish to simulated-microgravity for different durations at a variety of developmental times in an attempt to determine periods of susceptibility for the different developing organ systems. Results The developing heart had a period of maximum susceptibility between 32 and 56 hours after fertilization when there was an approximately 30% increase in gene expression. The notochord, eye, somites, and rohon beard neurons all showed periods of susceptibility occurring between 24 and 72 hours after fertilization. In addition, the notochord showed a second period of susceptibility between 8 and 32 hours after fertilization. Interestingly, all organs appeared to be recovering by 80 hours after fertilization despite continued exposure to simulated-microgravity. Conclusion These results support the idea that exposure to microgravity can cause changes in gene expression in a variety of developing organ systems in live embryos and that there are periods of maximum susceptibility to the effects.
-
Traeger, Stefanie; Nowrousian, Minou
2015-04-14
During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.
-
A single cis element maintains repression of the key developmental regulator Gata2.
Directory of Open Access Journals (Sweden)
Jonathan W Snow
2010-09-01
Full Text Available In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.
-
Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis
Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong
2011-01-01
Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and
-
Developmental transcriptomic features of the carcinogenic liver fluke, Clonorchis sinensis.
Directory of Open Access Journals (Sweden)
Won Gi Yoo
2011-06-01
Full Text Available Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs. Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development
-
Developmental transcriptome of Aplysia californica'
Heyland, Andreas; Vue, Zer; Voolstra, Christian R.; Medina, Mó nica; Moroz, Leonid L.
2010-01-01
developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms
-
Energy Technology Data Exchange (ETDEWEB)
Brusick, D; Auletta, A
1985-01-01
The Gene-Tox Program was structured around two phases of genetic test data evaluation. The first phase consisted of 36 Work Group reports, each evaluating the results and performance of a specific bioassay. The second phase consisted of a plan to summarize the information provided by the Work Groups. The Gene-Tox Coordinating Committee was to be responsible for Phase II, and several subgroups were assigned specific goals in implementing this analysis. This report deals with Goal I which is to identify the developmental status of the individual bioassays reviewed by the Gene-Tox Work Groups in the first phase of the Program. 5 references, 6 tables.
-
Hoftman, Gil D; Volk, David W; Bazmi, H Holly; Li, Siyu; Sampson, Allan R; Lewis, David A
2015-01-01
Schizophrenia is a neurodevelopmental disorder with altered expression of GABA-related genes in the prefrontal cortex (PFC). However, whether these gene expression abnormalities reflect disturbances in postnatal developmental processes before clinical onset or arise as a consequence of clinical illness remains unclear. Expression levels for 7 GABA-related transcripts (vesicular GABA transporter [vGAT], GABA membrane transporter [GAT1], GABAA receptor subunit α1 [GABRA1] [novel in human and monkey cohorts], glutamic acid decarboxylase 67 [GAD67], parvalbumin, calretinin, and somatostatin [previously reported in human cohort, but not in monkey cohort]) were quantified in the PFC from 42 matched pairs of schizophrenia and comparison subjects and from 49 rhesus monkeys ranging in age from 1 week postnatal to adulthood. Levels of vGAT and GABRA1, but not of GAT1, messenger RNAs (mRNAs) were lower in the PFC of the schizophrenia subjects. As previously reported, levels of GAD67, parvalbumin, and somatostatin, but not of calretinin, mRNAs were also lower in these subjects. Neither illness duration nor age accounted for the levels of the transcripts with altered expression in schizophrenia. In monkey PFC, developmental changes in expression levels of many of these transcripts were in the opposite direction of the changes observed in schizophrenia. For example, mRNA levels for vGAT, GABRA1, GAD67, and parvalbumin all increased with age. Together with published reports, these findings support the interpretation that the altered expression of GABA-related transcripts in schizophrenia reflects a blunting of normal postnatal development changes, but they cannot exclude a decline during the early stages of clinical illness. © The Author 2013. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.
-
International Nuclear Information System (INIS)
Meza, Mercedes; Gandolfi, A. Jay; Klimecki, Walter T.
2007-01-01
The complexity of arsenic toxicology has confounded the identification of specific pathways of disease causation. One focal point of arsenic research is aimed at fully characterizing arsenic biotransformation in humans, a process that appears to be quite variable, producing a mixture of several arsenic species with greatly differing toxic potencies. In an effort to characterize genetic determinants of variability in arsenic biotransformation, a genetic association study of 135 subjects in western Sonora, Mexico was performed by testing 23 polymorphic sites in three arsenic biotransformation candidate genes. One gene, arsenic 3 methyltransferase (AS3MT), was strongly associated with the ratio of urinary dimethylarsinic acid to monomethylarsonic acid (D/M) in children (7-11 years) but not in adults (18-79 years). Subsequent analyses revealed that the high D/M values associated with variant AS3MT alleles were primarily due to lower levels of monomethylarsonic acid as percent of total urinary arsenic (%MMA5). In light of several reports of arsenic-induced disease being associated with relatively high %MMA5 levels, these findings raise the possibility that variant AS3MT individuals may suffer less risk from arsenic exposure than non-variant individuals. These analyses also provide evidence that, in this population, regardless of AS3MT variant status, children tend to have lower %MMA5 values than adults, suggesting that the global developmental regulation of arsenic biotransformation may interact with genetic variants in metabolic genes to result in novel genetic effects such as those in this report
-
Heppard, E P; Kinney, A J; Stecca, K L; Miao, G H
1996-01-01
The polyunsaturated fatty acid content is one of the major factors influencing the quality of vegetable oils. Edible oils rich in monounsaturated fatty acid provide improved oil stability, flavor, and nutrition for human and animal consumption. In plants, the microsomal omega-6 desaturase-catalyzed pathway is the primary route of production of polyunsaturated lipids. We report the isolation of two different cDNA sequences, FAD2-1 and FAD2-2, encoding microsomal omega-6 desaturase in soybeans and the characterization of their developmental and temperature regulation. The FAD2-1 gene is strongly expressed in developing seeds, whereas the FAD2-2 gene is constitutively expressed in both vegetative tissues and developing seeds. Thus, the FAD2-2 gene-encoded omega-6 desaturase appears to be responsible for production of polyunsaturated fatty acids within membrane lipids in both vegetative tissues and developing seeds. The seed-specifically expressed FAD2-1 gene is likely to play a major role in controlling conversion of oleic acid to linoleic acid within storage lipids during seed development. In both soybean seed and leaf tissues, linoleic acid and linolenic acid levels gradually increase as temperature decreases. However, the levels of transcripts for FAD2-1, FAD2-2, and the plastidial omega-6 desaturase gene (FAD 6) do not increase at low temperature. These results suggest that the elevated polyunsaturated fatty acid levels in developing soybean seeds grown at low temperature are not due to the enhanced expression of omega-6 desaturase genes. PMID:8587990
-
Developmental and growth defects in mice with combined deficiency of CK2 catalytic genes.
Landesman-Bollag, Esther; Belkina, Anna; Hovey, Beth; Connors, Edward; Cox, Charles; Seldin, David C
2011-10-01
The CK2 α and α' catalytic gene products have overlapping biochemical activity, but in vivo, their functions are very different. Deletion of both alleles of CK2α leads to mid-gestational embryonic lethality, while deletion of both alleles of CK2α' does not interfere with viability or development of embryos; however, adult CK2α'-/-males are infertile. To further elucidate developmental roles of CK2, and analyze functional overlap between the two catalytic genes, mice with combined knockouts were bred. Mice bearing any two CK2 catalytic alleles were phenotypically normal. However, inheritance of a single CK2α allele, without either CK2α' allele, resulted in partial embryonic lethality. Such mice that survived through embryogenesis were smaller at birth than littermate controls, and weighed less throughout life. However, their cardiac function and lifespan were normal. Fibroblasts derived from CK2α+/-CK2α'-/- embryos grew poorly in culture. These experiments demonstrate that combined loss of one CK2α allele and both CK2α' alleles leads to unique abnormalities of growth and development.
-
Directory of Open Access Journals (Sweden)
Xiaowen Tan
2017-01-01
Full Text Available Background. Coronary artery atherosclerosis is a chronic inflammatory disease. This study aimed to identify the key changes of gene expression between early and advanced carotid atherosclerotic plaque in human. Methods. Gene expression dataset GSE28829 was downloaded from Gene Expression Omnibus (GEO, including 16 advanced and 13 early stage atherosclerotic plaque samples from human carotid. Differentially expressed genes (DEGs were analyzed. Results. 42,450 genes were obtained from the dataset. Top 100 up- and downregulated DEGs were listed. Functional enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG identification were performed. The result of functional and pathway enrichment analysis indicted that the immune system process played a critical role in the progression of carotid atherosclerotic plaque. Protein-protein interaction (PPI networks were performed either. Top 10 hub genes were identified from PPI network and top 6 modules were inferred. These genes were mainly involved in chemokine signaling pathway, cell cycle, B cell receptor signaling pathway, focal adhesion, and regulation of actin cytoskeleton. Conclusion. The present study indicated that analysis of DEGs would make a deeper understanding of the molecular mechanisms of atherosclerosis development and they might be used as molecular targets and diagnostic biomarkers for the treatment of atherosclerosis.
-
Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin
2014-01-01
Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and
-
Lai, Biao; Li, Xiao-Jing; Hu, Bing; Qin, Yong-Hua; Huang, Xu-Ming; Wang, Hui-Cong; Hu, Gui-Bing
2014-01-01
The red coloration of litchi fruit depends on the accumulation of anthocyanins. The anthocyanins level in litchi fruit varies widely among cultivars, developmental stages and environmental stimuli. Previous studies on various plant species demonstrate that anthocyanin biosynthesis is controlled at the transcriptional level. Here, we describe a litchi R2R3-MYB transcription factor gene, LcMYB1, which demonstrates a similar sequence as other known anthocyanin regulators. The transcription level...
-
Cizelj, Ivanka; Glavan, Gordana; Božič, Janko; Oven, Irena; Mrak, Vesna; Narat, Mojca
2016-03-01
The Carniolan honey bee, Apis mellifera carnica, is a Slovenian autochthonous subspecies of honey bee. In recent years, the country has recorded an annual loss of bee colonies through mortality of up to 35%. One possible reason for such high mortality could be the exposure of honey bees to xenobiotic residues that have been found in honey bee and beehive products. Acaricides are applied by beekeepers to control varroosis, while the most abundant common agricultural chemicals found in honey bee and beehive products are fungicides, which may enter the system when applied to nearby flowering crops and fruit plants. Acaricides and fungicides are not intrinsically highly toxic to bees but their action in combination might lead to higher honey bee sensitivity or mortality. In the present study we investigated the molecular immune response of honey bee workers at different developmental stages (prepupa, white-eyed pupa, adult) exposed to the acaricide coumaphos and the fungicide prochloraz individually and in combination. Expression of 17 immune-related genes was examined by quantitative RT-PCR. In treated prepupae downregulation of most immune-related genes was observed in all treatments, while in adults upregulation of most of the genes was recorded. Our study shows for the first time that negative impacts of prochloraz and a combination of coumaphos and prochloraz differ among the different developmental stages of honey bees. The main effect of the xenobiotic combination was found to be upregulation of the antimicrobial peptide genes abaecin and defensin-1 in adult honey bees. Changes in immune-related gene expression could result in depressed immunity of honey bees and their increased susceptibility to various pathogens. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H
2016-12-15
PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.
-
A TALE of shrimps: Genome-wide survey of homeobox genes in 120 species from diverse crustacean taxa.
Chang, Wai Hoong; Lai, Alvina G
2018-01-01
The homeodomain-containing proteins are an important group of transcription factors found in most eukaryotes including animals, plants and fungi. Homeobox genes are responsible for a wide range of critical developmental and physiological processes, ranging from embryonic development, innate immune homeostasis to whole-body regeneration. With continued fascination on this key class of proteins by developmental and evolutionary biologists, multiple efforts have thus far focused on the identification and characterization of homeobox orthologs from key model organisms in attempts to infer their evolutionary origin and how this underpins the evolution of complex body plans. Despite their importance, the genetic complement of homeobox genes has yet been described in one of the most valuable groups of animals representing economically important food crops. With crustacean aquaculture being a growing industry worldwide, it is clear that systematic and cross-species identification of crustacean homeobox orthologs is necessary in order to harness this genetic circuitry for the improvement of aquaculture sustainability. Using publicly available transcriptome data sets, we identified a total of 4183 putative homeobox genes from 120 crustacean species that include food crop species, such as lobsters, shrimps, crayfish and crabs. Additionally, we identified 717 homeobox orthologs from 6 other non-crustacean arthropods, which include the scorpion, deer tick, mosquitoes and centipede. This high confidence set of homeobox genes will now serve as a key resource to the broader community for future functional and comparative genomics studies.
-
Directory of Open Access Journals (Sweden)
Perry Trinity L
2007-11-01
Full Text Available Abstract Background Heparan sulfate proteoglycans modulate signaling by a variety of growth factors. The mammalian proteoglycan Perlecan binds and regulates signaling by Sonic Hedgehog, Fibroblast Growth Factors (FGFs, Vascular Endothelial Growth Factor (VEGF and Platelet Derived Growth Factor (PDGF, among others, in contexts ranging from angiogenesis and cardiovascular development to cancer progression. The Drosophila Perlecan homolog trol has been shown to regulate the activity of Hedgehog and Branchless (an FGF homolog to control the onset of stem cell proliferation in the developing brain during first instar. Here we extend analysis of trol mutant phenotypes to show that trol is required for a variety of developmental events and modulates signaling by multiple growth factors in different situations. Results Different mutations in trol allow developmental progression to varying extents, suggesting that trol is involved in multiple cell-fate and patterning decisions. Analysis of the initiation of neuroblast proliferation at second instar demonstrated that trol regulates this event by modulating signaling by Hedgehog and Branchless, as it does during first instar. Trol protein is distributed over the surface of the larval brain, near the regulated neuroblasts that reside on the cortical surface. Mutations in trol also decrease the number of circulating plasmatocytes. This is likely to be due to decreased expression of pointed, the response gene for VEGF/PDGF signaling that is required for plasmatocyte proliferation. Trol is found on plasmatocytes, where it could regulate VEGF/PDGF signaling. Finally, we show that in second instar brains but not third instar brain lobes and eye discs, mutations in trol affect signaling by Decapentaplegic (a Transforming Growth Factor family member, Wingless (a Wnt growth factor and Hedgehog. Conclusion These studies extend the known functions of the Drosophila Perlecan homolog trol in both developmental and
-
Transcriptome Analysis of Two Different Developmental Stages of Paeonia lactiflora Seeds
Directory of Open Access Journals (Sweden)
Yonglei Ma
2017-01-01
Full Text Available Paeonia lactiflora is a herbaceous flower in the family Paeoniaceae with both hypocotyl and epicotyl dormant seeds. We used high-throughput transcriptome sequencing on two different developmental stages of P. lactiflora seeds to identify seed dormancy and germination-related genes. We performed de novo assembly and annotated a total of 123,577 unigenes, which encoded 24,688 putative proteins with 47 GO categories. A total of 10,714 unigenes were annotated in the KEGG database, and 258 pathways were involved in the annotations. A total of 1795 genes were differentially expressed in the functional enrichment analysis. The key genes for seed germination and dormancy, such as GAI1 and ARF, were confirmed by quantitative reverse transcription-polymerase chain reaction analysis. This is the first report of sequencing the P. lactiflora seed transcriptome. Our results provide fundamental frame work and technical support for further selective breeding and cultivation of Paeonia. Our transcriptomic data also serves as the basis for future genetics and genomics research on Paeonia and its closely related species.
-
DEFF Research Database (Denmark)
Danielsen, Erik Thomas
and duration required for juvenile-adult transition. This PhD project demonstrates the power of Drosophila genetics by taking an in vivo genome-wide RNAi screening approach to uncover genes required for the function of steroid producing tissue and developmental maturation. In total, 1909 genes were found...... to be required for the prothoracic gland function and affected the developmental timing for the juvenile-adult transition. Among the screen hits, we focused on an uncharacterized gene, sit (CG5278), which is highly expressed in the gland and is required for ecdysone production. Sit is a homolog of mammalian very...... flux of cholesterol uptake in the gland cells and affected the endosomal trafficking. Therefore this gene was suggested to be named stuck in traffic (sit). Sit’s role in cholesterol uptake was also supported by the observation that the developmental delayed phenotype from loss of sit expression...
-
Directory of Open Access Journals (Sweden)
Gutiérrez Rodrigo A
2008-09-01
Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant
-
Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo
International Nuclear Information System (INIS)
Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu
2016-01-01
Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.
-
Developmental changes in human dopamine neurotransmission: cortical receptors and terminators
Directory of Open Access Journals (Sweden)
Rothmond Debora A
2012-02-01
Full Text Available Abstract Background Dopamine is integral to cognition, learning and memory, and dysfunctions of the frontal cortical dopamine system have been implicated in several developmental neuropsychiatric disorders. The dorsolateral prefrontal cortex (DLPFC is critical for working memory which does not fully mature until the third decade of life. Few studies have reported on the normal development of the dopamine system in human DLPFC during postnatal life. We assessed pre- and postsynaptic components of the dopamine system including tyrosine hydroxylase, the dopamine receptors (D1, D2 short and D2 long isoforms, D4, D5, catechol-O-methyltransferase, and monoamine oxidase (A and B in the developing human DLPFC (6 weeks -50 years. Results Gene expression was first analysed by microarray and then by quantitative real-time PCR. Protein expression was analysed by western blot. Protein levels for tyrosine hydroxylase peaked during the first year of life (p O-methyltransferase (p = 0.024 were significantly higher in neonates and infants as was catechol-O-methyltransferase protein (32 kDa, p = 0.027. In contrast, dopamine D1 receptor mRNA correlated positively with age (p = 0.002 and dopamine D1 receptor protein expression increased throughout development (p Conclusions We find distinct developmental changes in key components of the dopamine system in DLPFC over postnatal life. Those genes that are highly expressed during the first year of postnatal life may influence and orchestrate the early development of cortical neural circuitry while genes portraying a pattern of increasing expression with age may indicate a role in DLPFC maturation and attainment of adult levels of cognitive function.
-
Li, Yongxin; Kikuchi, Mani; Li, Xueyan; Gao, Qionghua; Xiong, Zijun; Ren, Yandong; Zhao, Ruoping; Mao, Bingyu; Kondo, Mariko; Irie, Naoki; Wang, Wen
2018-01-01
Sea cucumbers, one main class of Echinoderms, have a very fast and drastic metamorphosis process during their development. However, the molecular basis under this process remains largely unknown. Here we systematically examined the gene expression profiles of Japanese common sea cucumber (Apostichopus japonicus) for the first time by RNA sequencing across 16 developmental time points from fertilized egg to juvenile stage. Based on the weighted gene co-expression network analysis (WGCNA), we identified 21 modules. Among them, MEdarkmagenta was highly expressed and correlated with the early metamorphosis process from late auricularia to doliolaria larva. Furthermore, gene enrichment and differentially expressed gene analysis identified several genes in the module that may play key roles in the metamorphosis process. Our results not only provide a molecular basis for experimentally studying the development and morphological complexity of sea cucumber, but also lay a foundation for improving its emergence rate. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...
-
Do convergent developmental mechanisms underlie convergent phenotypes?
Wray, Gregory A.
2002-01-01
Convergence is a pervasive evolutionary process, affecting many aspects of phenotype and even genotype. Relatively little is known about convergence in developmental processes, however, nor about the degree to which convergence in development underlies convergence in anatomy. A switch in the ecology of sea urchins from feeding to nonfeeding larvae illustrates how convergence in development can be associated with convergence in anatomy. Comparisons to more distantly related taxa, however, suggest that this association may be limited to relatively close phylogenetic comparisons. Similarities in gene expression during development provide another window into the association between convergence in developmental processes and convergence in anatomy. Several well-studied transcription factors exhibit likely cases of convergent gene expression in distantly related animal phyla. Convergence in regulatory gene expression domains is probably more common than generally acknowledged, and can arise for several different reasons. Copyright 2002 S. Karger AG, Basel.
-
Directory of Open Access Journals (Sweden)
Revel S M Drummond
2012-01-01
Full Text Available Analysis of mutants with increased branching has revealed the strigolactone synthesis/perception pathway which regulates branching in plants. However, whether variation in this well conserved developmental signalling system contributes to the unique plant architectures of different species is yet to be determined. We examined petunia orthologues of the Arabidopsis MAX1 and MAX2 genes to characterise their role in petunia architecture. A single orthologue of MAX1, PhMAX1 which encodes a cytochrome P450, was identified and was able to complement the max1 mutant of Arabidopsis. Petunia has two copies of the MAX2 gene, PhMAX2A and PhMAX2B which encode F-Box proteins. Differences in the transcript levels of these two MAX2-like genes suggest diverging functions. Unlike PhMAX2B, PhMAX2A mRNA levels increase as leaves age. Nonetheless, this gene functionally complements the Arabidopsis max2 mutant indicating that the biochemical activity of the PhMAX2A protein is not significantly different from MAX2. The expression of the petunia strigolactone pathway genes (PhCCD7, PhCCD8, PhMAX1, PhMAX2A, and PhMAX2B was then further investigated throughout the development of wild-type petunia plants. Three of these genes showed changes in mRNA levels over the development series. Alterations to the expression of these genes over time, or in different regions of the plant, may influence the branching growth habit of the plant. Alterations to strigolactone production and/or sensitivity could allow both subtle and dramatic changes to branching within and between species.
-
Integrated bioinformatics analysis reveals key candidate genes and pathways in breast cancer.
Wang, Yuzhi; Zhang, Yi; Huang, Qian; Li, Chengwen
2018-04-19
Breast cancer (BC) is the leading malignancy in women worldwide, yet relatively little is known about the genes and signaling pathways involved in BC tumorigenesis and progression. The present study aimed to elucidate potential key candidate genes and pathways in BC. Five gene expression profile data sets (GSE22035, GSE3744, GSE5764, GSE21422 and GSE26910) were downloaded from the Gene Expression Omnibus (GEO) database, which included data from 113 tumorous and 38 adjacent non‑tumorous tissue samples. Differentially expressed genes (DEGs) were identified using t‑tests in the limma R package. These DEGs were subsequently investigated by pathway enrichment analysis and a protein‑protein interaction (PPI) network was constructed. The most significant module from the PPI network was selected for pathway enrichment analysis. In total, 227 DEGs were identified, of which 82 were upregulated and 145 were downregulated. Pathway enrichment analysis results revealed that the upregulated DEGs were mainly enriched in 'cell division', the 'proteinaceous extracellular matrix (ECM)', 'ECM structural constituents' and 'ECM‑receptor interaction', whereas downregulated genes were mainly enriched in 'response to drugs', 'extracellular space', 'transcriptional activator activity' and the 'peroxisome proliferator‑activated receptor signaling pathway'. The PPI network contained 174 nodes and 1,257 edges. DNA topoisomerase 2‑a, baculoviral inhibitor of apoptosis repeat‑containing protein 5, cyclin‑dependent kinase 1, G2/mitotic‑specific cyclin‑B1 and kinetochore protein NDC80 homolog were identified as the top 5 hub genes. Furthermore, the genes in the most significant module were predominantly involved in 'mitotic nuclear division', 'mid‑body', 'protein binding' and 'cell cycle'. In conclusion, the DEGs, relative pathways and hub genes identified in the present study may aid in understanding of the molecular mechanisms underlying BC progression and provide
-
Directory of Open Access Journals (Sweden)
Velleman Sandra G
2011-03-01
Full Text Available Abstract Background Skeletal muscle growth and development from embryo to adult consists of a series of carefully regulated changes in gene expression. Understanding these developmental changes in agriculturally important species is essential to the production of high quality meat products. For example, consumer demand for lean, inexpensive meat products has driven the turkey industry to unprecedented production through intensive genetic selection. However, achievements of increased body weight and muscle mass have been countered by an increased incidence of myopathies and meat quality defects. In a previous study, we developed and validated a turkey skeletal muscle-specific microarray as a tool for functional genomics studies. The goals of the current study were to utilize this microarray to elucidate functional pathways of genes responsible for key events in turkey skeletal muscle development and to compare differences in gene expression between two genetic lines of turkeys. To achieve these goals, skeletal muscle samples were collected at three critical stages in muscle development: 18d embryo (hyperplasia, 1d post-hatch (shift from myoblast-mediated growth to satellite cell-modulated growth by hypertrophy, and 16wk (market age from two genetic lines: a randombred control line (RBC2 maintained without selection pressure, and a line (F selected from the RBC2 line for increased 16wk body weight. Array hybridizations were performed in two experiments: Experiment 1 directly compared the developmental stages within genetic line, while Experiment 2 directly compared the two lines within each developmental stage. Results A total of 3474 genes were differentially expressed (false discovery rate; FDR Conclusions The current study identified gene pathways and uncovered novel genes important in turkey muscle growth and development. Future experiments will focus further on several of these candidate genes and the expression and mechanism of action of
-
DEFF Research Database (Denmark)
Rasmussen, Malene B; Nielsen, Jakob V; Lourenço, Charles M
2014-01-01
(SRO) involved five RefSeq genes, including the transcription factor gene ZBTB20 and the dopamine receptor gene DRD3, considered as candidate genes for the syndrome. METHODS AND RESULTS: We used array comparative genomic hybridization and next-generation mate-pair sequencing to identify key structural...... patient with developmental delay and autism, we detected the first microdeletion at 3q13.31, which truncated ZBTB20 but did not involve DRD3 or the other genes within the previously defined SRO. Zbtb20 directly represses 346 genes in the developing murine brain. Of the 342 human orthologous ZBTB20...
-
Intraspecific hybridization, developmental stability and fitness in Drosophila mercatorum
DEFF Research Database (Denmark)
Andersen, D.H.; Pertoldi, C.; Scali, V.
2002-01-01
One of the possible effects of intraspecific hybridization is outbreeding depression, due to a breakdown of coadapted gene complexes, which can lead to reduced fitness and decreased developmental stability in hybrids. Alternatively, increased fitness and increased developmental stability in hybrids...... (hybrid vigour) may be a result of hybridization, probably due to increased heterozygosity. Developmental stability is assumed to be correlated with fitness and is commonly measured as fluctuating asymmetry or phenotypic variance. Drosophila mercatorum is capable of reproducing sexually, but also...
-
Directory of Open Access Journals (Sweden)
Catherine Cukras
Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.
-
Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha
2012-01-01
Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.
-
Boland, Mary Regina; Tatonetti, Nicholas P
2016-01-01
Prenatal and perinatal exposures vary seasonally (e.g., sunlight, allergens) and many diseases are linked with variance in exposure. Epidemiologists often measure these changes using birth month as a proxy for seasonal variance. Likewise, Genome-Wide Association Studies have associated or implicated these same diseases with many genes. Both disparate data types (epidemiological and genetic) can provide key insights into the underlying disease biology. We developed an algorithm that links 1) epidemiological data from birth month studies with 2) genetic data from published gene-disease association studies. Our framework uses existing data repositories - PubMed, DisGeNET and Gene Ontology - to produce a bipartite network that connects enriched seasonally varying biofactorss with birth month dependent diseases (BMDDs) through their overlapping developmental gene sets. As a proof-of-concept, we investigate 7 known BMDDs and highlight three important biological networks revealed by our algorithm and explore some interesting genetic mechanisms potentially responsible for the seasonal contribution to BMDDs.
-
Directory of Open Access Journals (Sweden)
Ana María Castillo
2015-06-01
Full Text Available Ovary pre-conditioned medium and ovary co-culture increased the efficiency of green doubled haploid plant production in bread wheat anther culture. The positive effect of this medium led to a 6- and 11-fold increase in the numbers of embryos and green plants, respectively, having a greater effect on a medium-low responding cultivar. Ovary genotype and developmental stage significantly affected microspore embryogenesis. By he use of Caramba ovaries it was possible to reach a 2-fold increase in the number of embryos and green plants, and to decrease the rate of albinism. Mature ovaries from flowers containing microspores at a late binucleate stage raised the number of embryos and green plants by 25% and 46% as compared to immature ovaries (excised from flowers with microspores at a mid-late uninucleate stage. The highest numbers of embryos and green plants were produced when using mature Caramba ovaries. Ovaries from Galeón, Tigre and Kilopondio cultivars successfully induced microspore embryogenesis at the same rate as Caramba ovaries. Moreover, Tigre ovaries raised the percentage of spontaneous chromosome doubling up to 71%. Attempts were made to identify molecular mechanisms associated to the inductive effect of the ovaries on microspore embryogenesis. The genes TAA1b, FLA26 and WALI6 associated to wheat microspore embryogenesis, the CGL1 gene involved in glycan biosynthesis or degradation, and the FER gene involved in the ovary signalling process were expressed and/or induced at different rates during ovary culture. The expression pattern of FLA26 and FER could be related to the differences between genotypes and developmental stages in the inductive effect of the ovary. Our results open opportunities for new approaches to increase bread wheat doubled haploid production by anther culture, and to identify the functional components of the ovary inductive effect on microspore embryogenesis.
-
The silkworm (Bombyx mori microRNAs and their expressions in multiple developmental stages.
Directory of Open Access Journals (Sweden)
Xiaomin Yu
Full Text Available BACKGROUND: MicroRNAs (miRNAs play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. METHODOLOGY/PRINCIPAL FINDINGS: We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs and 14 novel miRNAs (including 11 predicted novel miRNAs. Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5' and/or 3' ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. CONCLUSIONS/SIGNIFICANCE: Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over
-
Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q
2016-01-01
An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also
-
Directory of Open Access Journals (Sweden)
Ma Menggen
2010-06-01
Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance
-
Directory of Open Access Journals (Sweden)
Zhi Liu
Full Text Available DNA microarray analysis is an effective method to detect unintended effects by detecting differentially expressed genes (DEG in safety assessment of genetically modified (GM crops. With the aim to reveal the distribution of DEG of GM crops under different conditions, we performed DNA microarray analysis using transgenic rice Huahui 1 (HH1 and its non-transgenic parent Minghui 63 (MH63 at different developmental stages and environmental conditions. Considerable DEG were selected in each group of HH1 under different conditions. For each group of HH1, the number of DEG was different; however, considerable common DEG were shared between different groups of HH1. These findings suggested that both DEG and common DEG were adequate for investigation of unintended effects. Furthermore, a number of significantly changed pathways were found in all groups of HH1, indicating genetic modification caused everlasting changes to plants. To our knowledge, our study for the first time provided the non-uniformly distributed pattern for DEG of GM crops at different developmental stages and environments. Our result also suggested that DEG selected in GM plants at specific developmental stage and environment could act as useful clues for further evaluation of unintended effects of GM plants.
-
Cis-regulatory timers for developmental gene expression.
Directory of Open Access Journals (Sweden)
Lionel Christiaen
2013-10-01
Full Text Available How does a fertilized egg decode its own genome to eventually develop into a mature animal? Each developing cell must activate a battery of genes in a timely manner and according to the function it will ultimately perform, but how? During development of the notochord--a structure akin to the vertebrate spine--in a simple marine invertebrate, an essential protein called Brachyury binds to specific sites in its target genes. A study just published in PLOS Biology reports that if the target gene contains multiple Brachyury-binding sites it will be activated early in development but if it contains only one site it will be activated later. Genes that contain no binding site can still be activated by Brachyury, but only indirectly by an earlier Brachyury-dependent gene product, so later than the directly activated genes. Thus, this study shows how several genes can interpret the presence of a single factor differently to become active at distinct times in development.
-
Developmental cognitive genetics: How psychology can inform genetics and vice versa
Bishop, Dorothy V. M.
2006-01-01
Developmental neuropsychology is concerned with uncovering the underlying basis of developmental disorders such as specific language impairment (SLI), developmental dyslexia, and autistic disorder. Twin and family studies indicate that genetic influences play an important part in the aetiology of all of these disorders, yet progress in identifying genes has been slow. One way forward is to cut loose from conventional clinical criteria for diagnosing disorders and to focus instead on measures ...
-
Directory of Open Access Journals (Sweden)
Laura Ortega-Moreno
Full Text Available Pediatric epilepsies are a group of disorders with a broad phenotypic spectrum that are associated with great genetic heterogeneity, thus making sequential single-gene testing an impractical basis for diagnostic strategy. The advent of next-generation sequencing has increased the success rate of epilepsy diagnosis, and targeted resequencing using genetic panels is the a most cost-effective choice. We report the results found in a group of 87 patients with epilepsy and developmental delay using targeted next generation sequencing (custom-designed Haloplex panel. Using this gene panel, we were able to identify disease-causing variants in 17 out of 87 (19.5% analyzed patients, all found in known epilepsy-associated genes (KCNQ2, CDKL5, STXBP1, SCN1A, PCDH19, POLG, SLC2A1, ARX, ALG13, CHD2, SYNGAP1, and GRIN1. Twelve of 18 variants arose de novo and 6 were novel. The highest yield was found in patients with onset in the first years of life, especially in patients classified as having early-onset epileptic encephalopathy. Knowledge of the underlying genetic cause provides essential information on prognosis and could be used to avoid unnecessary studies, which may result in a greater diagnostic cost-effectiveness.
-
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
-
Kudapa, Himabindu; Garg, Vanika; Chitikineni, Annapurna; Varshney, Rajeev K
2018-04-10
Chickpea is one of the world's largest cultivated food legume and is an excellent source of high-quality protein to the human diet. Plant growth and development are controlled by programmed expression of a suite of genes at the given time, stage and tissue. Understanding how the underlying genome sequence translates into specific plant phenotypes at key developmental stages, information on gene expression patterns is crucial. Here we present a comprehensive Cicer arietinum Gene Expression Atlas (CaGEA) across the plant developmental stages and organs covering the entire life cycle of chickpea. One of the widely used drought tolerant cultivar, ICC 4958 has been used to generate RNA-Seq data from 27 samples at five major developmental stages of the plant. A total of 816 million raw reads were generated and of these, 794 million filtered reads after QC were subjected to downstream analysis. A total of 15,947 unique number of differentially expressed genes across different pairwise tissue combinations were identified. Significant differences in gene expression patterns contributing in the process of flowering, nodulation, seed and root development were inferred in this study. Furthermore, differentially expressed candidate genes from "QTL-hotspot" region associated with drought stress response in chickpea were validated. This article is protected by copyright. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Gerhard Fuka
Full Text Available BACKGROUND: ETV6/RUNX1 (E/R (also known as TEL/AML1 is the most frequent gene fusion in childhood acute lymphoblastic leukemia (ALL and also most likely the crucial factor for disease initiation; its role in leukemia propagation and maintenance, however, remains largely elusive. To address this issue we performed a shRNA-mediated knock-down (KD of the E/R fusion gene and investigated the ensuing consequences on genome-wide gene expression patterns and deducible regulatory functions in two E/R-positive leukemic cell lines. FINDINGS: Microarray analyses identified 777 genes whose expression was substantially altered. Although approximately equal proportions were either up- (KD-UP or down-regulated (KD-DOWN, the effects on biological processes and pathways differed considerably. The E/R KD-UP set was significantly enriched for genes included in the "cell activation", "immune response", "apoptosis", "signal transduction" and "development and differentiation" categories, whereas in the E/R KD-DOWN set only the "PI3K/AKT/mTOR signaling" and "hematopoietic stem cells" categories became evident. Comparable expression signatures obtained from primary E/R-positive ALL samples underline the relevance of these pathways and molecular functions. We also validated six differentially expressed genes representing the categories "stem cell properties", "B-cell differentiation", "immune response", "cell adhesion" and "DNA damage" with RT-qPCR. CONCLUSION: Our analyses provide the first preliminary evidence that the continuous expression of the E/R fusion gene interferes with key regulatory functions that shape the biology of this leukemia subtype. E/R may thus indeed constitute the essential driving force for the propagation and maintenance of the leukemic process irrespective of potential consequences of associated secondary changes. Finally, these findings may also provide a valuable source of potentially attractive therapeutic targets.
-
Sartor, Maureen A.; Schnekenburger, Michael; Marlowe, Jennifer L.; Reichard, John F.; Wang, Ying; Fan, Yunxia; Ma, Ci; Karyala, Saikumar; Halbleib, Danielle; Liu, Xiangdong; Medvedovic, Mario; Puga, Alvaro
2009-01-01
Background The vertebrate aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that regulates cellular responses to environmental polycyclic and halogenated compounds. The naive receptor is believed to reside in an inactive cytosolic complex that translocates to the nucleus and induces transcription of xenobiotic detoxification genes after activation by ligand. Objectives We conducted an integrative genomewide analysis of AHR gene targets in mouse hepatoma cells and determined whether AHR regulatory functions may take place in the absence of an exogenous ligand. Methods The network of AHR-binding targets in the mouse genome was mapped through a multipronged approach involving chromatin immunoprecipitation/chip and global gene expression signatures. The findings were integrated into a prior functional knowledge base from Gene Ontology, interaction networks, Kyoto Encyclopedia of Genes and Genomes pathways, sequence motif analysis, and literature molecular concepts. Results We found the naive receptor in unstimulated cells bound to an extensive array of gene clusters with functions in regulation of gene expression, differentiation, and pattern specification, connecting multiple morphogenetic and developmental programs. Activation by the ligand displaced the receptor from some of these targets toward sites in the promoters of xenobiotic metabolism genes. Conclusions The vertebrate AHR appears to possess unsuspected regulatory functions that may be potential targets of environmental injury. PMID:19654925
-
Directory of Open Access Journals (Sweden)
Ivette M Sandoval
Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.
-
Portrait of Candida Species Biofilm Regulatory Network Genes.
Araújo, Daniela; Henriques, Mariana; Silva, Sónia
2017-01-01
Most cases of candidiasis have been attributed to Candida albicans, but Candida glabrata, Candida parapsilosis and Candida tropicalis, designated as non-C. albicans Candida (NCAC), have been identified as frequent human pathogens. Moreover, Candida biofilms are an escalating clinical problem associated with significant rates of mortality. Biofilms have distinct developmental phases, including adhesion/colonisation, maturation and dispersal, controlled by complex regulatory networks. This review discusses recent advances regarding Candida species biofilm regulatory network genes, which are key components for candidiasis. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
Rolfe, Rebecca A; Nowlan, Niamh C; Kenny, Elaine M; Cormican, Paul; Morris, Derek W; Prendergast, Patrick J; Kelly, Daniel; Murphy, Paula
2014-01-20
into a transcriptional response. This work identifies key developmental regulatory genes impacted by altered mechanical stimulation, sheds light on the molecular mechanisms that interpret mechanical stimulation during skeletal development and provides valuable resources for further investigation of the mechanistic basis of mechanoregulation. In particular it highlights the Wnt signalling pathway as a potential point of integration of mechanical and molecular signalling and cytoskeletal components as mediators of the response.
-
Veiga-Lopez, Almudena; Luense, Lacey J; Christenson, Lane K; Padmanabhan, Vasantha
2013-05-01
Bisphenol-A (BPA), a ubiquitous environmental endocrine disrupting chemical, is a component of polycarbonate plastic and epoxy resins. Because of its estrogenic properties, there is increasing concern relative to risks from exposures during critical periods of early organ differentiation. Prenatal BPA treatment in sheep results in low birth weight, hypergonadotropism, and ovarian cycle disruptions. This study tested the hypothesis that gestational exposure to bisphenol A, at an environmentally relevant dose, induces early perturbations in the ovarian transcriptome (mRNA and microRNA). Pregnant Suffolk ewes were treated with bisphenol A (0.5 mg/kg, sc, daily, produced ∼2.6 ng/mL of unconjugated BPA in umbilical arterial samples of BPA treated fetuses approaching median levels of BPA measured in maternal circulation) from days 30 to 90 of gestation. Expression of steroidogenic enzymes, steroid/gonadotropin receptors, key ovarian regulators, and microRNA biogenesis components were measured by RT-PCR using RNA derived from fetal ovaries collected on gestational days 65 and 90. An age-dependent effect was evident in most steroidogenic enzymes, steroid receptors, and key ovarian regulators. Prenatal BPA increased Cyp19 and 5α-reductase expression in day 65, but not day 90, ovaries. Fetal ovarian microRNA expression was altered by prenatal BPA with 45 down-regulated (>1.5-fold) at day 65 and 11 down-regulated at day 90 of gestation. These included microRNAs targeting Sry-related high-mobility-group box (SOX) family genes, kit ligand, and insulin-related genes. The results of this study demonstrate that exposure to BPA at an environmentally relevant dose alters fetal ovarian steroidogenic gene and microRNA expression of relevance to gonadal differentiation, folliculogenesis, and insulin homeostasis.
-
Scherba de Valenzuela, J.; Kay-Raining Bird, E.; Parkington, K.; Mirenda, P.; Cain, K.; MacLeod, A.A.N.; Segers, P.C.J.
2016-01-01
The purpose of this article is to describe the results of a thematic analysis of 79 semi-structured interviews collected at six research sites in four countries in relation to the inclusion and exclusion of students with developmental disabilities (DD) in and from special education and bilingual
-
Hoelker, Michael; Rings, Franka; Lund, Qamaruddin; Ghanem, Nasser; Phatsara, Chirawath; Griese, Josef; Schellander, Karl; Tesfaye, Dawit
2009-03-01
The Well of the Well (WOW) system has been developed to culture embryos in small groups or to track the development of single embryos. In the present study, we aimed to examine the effects of the microenvironment provided by the WOW system and embryo density on developmental rates, embryo quality and preimplantative gene expression profile of the resulting embryos. Embryos cultured in a group of 16 reached the blastocyst stage at a significantly lower level than zygotes cultured in a group of 50 (22.2 vs 30.3%), whereas zygotes cultured in WOW were able to compensate against low embryo densities, reaching a blastocyst rate as high as embryos cultured in a group of 50 (31.3 vs 30.3%). Moreover, embryos derived from WOW culture did not differ in terms of differential cell counts and apoptotic cell index compared with controls. The gene expression analysis revealed 62 transcripts to be upregulated and 33 transcripts to be downregulated by WOW culture. Comparing the in vivo derived blastocysts with the blastocysts derived from WOW culture, and group culture, expression of ATP5A1, PLAC8 and KRT8 was more similar to the embryos derived from WOW culture, whereas expression of S100A10 and ZP3 genes was more similar to blastocysts cultured in a group. In conclusion, microenvironment as well as embryo density significantly affected developmental rates. While subsequent blastocysts did not differ in terms of differential cell counts and apoptotic cell index, significant differences were observed in terms of the relative abundance of transcripts in the resulting embryos.
-
A high resolution atlas of gene expression in the domestic sheep (Ovis aries).
Clark, Emily L; Bush, Stephen J; McCulloch, Mary E B; Farquhar, Iseabail L; Young, Rachel; Lefevre, Lucas; Pridans, Clare; Tsang, Hiu G; Wu, Chunlei; Afrasiabi, Cyrus; Watson, Mick; Whitelaw, C Bruce; Freeman, Tom C; Summers, Kim M; Archibald, Alan L; Hume, David A
2017-09-01
Sheep are a key source of meat, milk and fibre for the global livestock sector, and an important biomedical model. Global analysis of gene expression across multiple tissues has aided genome annotation and supported functional annotation of mammalian genes. We present a large-scale RNA-Seq dataset representing all the major organ systems from adult sheep and from several juvenile, neonatal and prenatal developmental time points. The Ovis aries reference genome (Oar v3.1) includes 27,504 genes (20,921 protein coding), of which 25,350 (19,921 protein coding) had detectable expression in at least one tissue in the sheep gene expression atlas dataset. Network-based cluster analysis of this dataset grouped genes according to their expression pattern. The principle of 'guilt by association' was used to infer the function of uncharacterised genes from their co-expression with genes of known function. We describe the overall transcriptional signatures present in the sheep gene expression atlas and assign those signatures, where possible, to specific cell populations or pathways. The findings are related to innate immunity by focusing on clusters with an immune signature, and to the advantages of cross-breeding by examining the patterns of genes exhibiting the greatest expression differences between purebred and crossbred animals. This high-resolution gene expression atlas for sheep is, to our knowledge, the largest transcriptomic dataset from any livestock species to date. It provides a resource to improve the annotation of the current reference genome for sheep, presenting a model transcriptome for ruminants and insight into gene, cell and tissue function at multiple developmental stages.
-
An analysis of the Athetis lepigone transcriptome from four developmental stages.
Directory of Open Access Journals (Sweden)
Li-Tao Li
Full Text Available Athetis lepigone Möschler (Lepidoptera: Noctuidae has recently become an important insect pest of maize (Zea mays crops in China. In order to understand the characteristics of the different developmental stages of this pest, we used Illumina short-read sequences to perform de novo transcriptome assembly and gene expression analysis for egg, larva, pupa and adult developmental stages. We obtained 10.08 Gb of raw data from Illumina sequencing and recovered 81,356 unigenes longer than 100 bp through a de novo assembly. The total sequence length reached 49.75 Mb with 858 bp of N50 and an average unigene length of 612 bp. Annotation analysis of predicted proteins indicate that 33,736 unigenes (41.47% of total unigenes are matches to genes in the Genbank Nr database. The unigene sequences were subjected to GO, COG and KEGG functional classification. A large number of differentially expressed genes were recovered by pairwise comparison of the four developmental stages. The most dramatic differences in gene expression were found in the transitions from one stage to another stage. Some of these differentially expressed genes are related to cuticle and wing formation as well as the growth and development. We identified more than 2,500 microsatellite markers that may be used for population studies of A. lepigone. This study lays the foundation for further research on population genetics and gene function analysis in A. lepigone.
-
Inferring gene expression dynamics via functional regression analysis
Directory of Open Access Journals (Sweden)
Leng Xiaoyan
2008-01-01
Full Text Available Abstract Background Temporal gene expression profiles characterize the time-dynamics of expression of specific genes and are increasingly collected in current gene expression experiments. In the analysis of experiments where gene expression is obtained over the life cycle, it is of interest to relate temporal patterns of gene expression associated with different developmental stages to each other to study patterns of long-term developmental gene regulation. We use tools from functional data analysis to study dynamic changes by relating temporal gene expression profiles of different developmental stages to each other. Results We demonstrate that functional regression methodology can pinpoint relationships that exist between temporary gene expression profiles for different life cycle phases and incorporates dimension reduction as needed for these high-dimensional data. By applying these tools, gene expression profiles for pupa and adult phases are found to be strongly related to the profiles of the same genes obtained during the embryo phase. Moreover, one can distinguish between gene groups that exhibit relationships with positive and others with negative associations between later life and embryonal expression profiles. Specifically, we find a positive relationship in expression for muscle development related genes, and a negative relationship for strictly maternal genes for Drosophila, using temporal gene expression profiles. Conclusion Our findings point to specific reactivation patterns of gene expression during the Drosophila life cycle which differ in characteristic ways between various gene groups. Functional regression emerges as a useful tool for relating gene expression patterns from different developmental stages, and avoids the problems with large numbers of parameters and multiple testing that affect alternative approaches.
-
Mirzaa, Ghayda M; Millen, Kathleen J; Barkovich, A James; Dobyns, William B; Paciorkowski, Alex R
2014-06-01
The number of single genes associated with neurodevelopmental disorders has increased dramatically over the past decade. The identification of causative genes for these disorders is important to clinical outcome as it allows for accurate assessment of prognosis, genetic counseling, delineation of natural history, inclusion in clinical trials, and in some cases determines therapy. Clinicians face the challenge of correctly identifying neurodevelopmental phenotypes, recognizing syndromes, and prioritizing the best candidate genes for testing. However, there is no central repository of definitions for many phenotypes, leading to errors of diagnosis. Additionally, there is no system of levels of evidence linking genes to phenotypes, making it difficult for clinicians to know which genes are most strongly associated with a given condition. We have developed the Developmental Brain Disorders Database (DBDB: https://www.dbdb.urmc.rochester.edu/home), a publicly available, online-curated repository of genes, phenotypes, and syndromes associated with neurodevelopmental disorders. DBDB contains the first referenced ontology of developmental brain phenotypes, and uses a novel system of levels of evidence for gene-phenotype associations. It is intended to assist clinicians in arriving at the correct diagnosis, select the most appropriate genetic test for that phenotype, and improve the care of patients with developmental brain disorders. For researchers interested in the discovery of novel genes for developmental brain disorders, DBDB provides a well-curated source of important genes against which research sequencing results can be compared. Finally, DBDB allows novel observations about the landscape of the neurogenetics knowledge base. © 2014 Wiley Periodicals, Inc.
-
A chronological expression profile of gene activity during embryonic mouse brain development.
Goggolidou, P; Soneji, S; Powles-Glover, N; Williams, D; Sethi, S; Baban, D; Simon, M M; Ragoussis, I; Norris, D P
2013-12-01
The brain is a functionally complex organ, the patterning and development of which are key to adult health. To help elucidate the genetic networks underlying mammalian brain patterning, we conducted detailed transcriptional profiling during embryonic development of the mouse brain. A total of 2,400 genes were identified as showing differential expression between three developmental stages. Analysis of the data identified nine gene clusters to demonstrate analogous expression profiles. A significant group of novel genes of as yet undiscovered biological function were detected as being potentially relevant to brain development and function, in addition to genes that have previously identified roles in the brain. Furthermore, analysis for genes that display asymmetric expression between the left and right brain hemispheres during development revealed 35 genes as putatively asymmetric from a combined data set. Our data constitute a valuable new resource for neuroscience and neurodevelopment, exposing possible functional associations between genes, including novel loci, and encouraging their further investigation in human neurological and behavioural disorders.
-
Dynamic CRM occupancy reflects a temporal map of developmental progression.
Wilczyński, Bartek; Furlong, Eileen E M
2010-06-22
Development is driven by tightly coordinated spatio-temporal patterns of gene expression, which are initiated through the action of transcription factors (TFs) binding to cis-regulatory modules (CRMs). Although many studies have investigated how spatial patterns arise, precise temporal control of gene expression is less well understood. Here, we show that dynamic changes in the timing of CRM occupancy is a prevalent feature common to all TFs examined in a developmental ChIP time course to date. CRMs exhibit complex binding patterns that cannot be explained by the sequence motifs or expression of the TFs themselves. The temporal changes in TF binding are highly correlated with dynamic patterns of target gene expression, which in turn reflect transitions in cellular function during different stages of development. Thus, it is not only the timing of a TF's expression, but also its temporal occupancy in refined time windows, which determines temporal gene expression. Systematic measurement of dynamic CRM occupancy may therefore serve as a powerful method to decode dynamic changes in gene expression driving developmental progression.
-
An ancient dental gene set governs development and continuous regeneration of teeth in sharks.
Rasch, Liam J; Martin, Kyle J; Cooper, Rory L; Metscher, Brian D; Underwood, Charlie J; Fraser, Gareth J
2016-07-15
The evolution of oral teeth is considered a major contributor to the overall success of jawed vertebrates. This is especially apparent in cartilaginous fishes including sharks and rays, which develop elaborate arrays of highly specialized teeth, organized in rows and retain the capacity for life-long regeneration. Perpetual regeneration of oral teeth has been either lost or highly reduced in many other lineages including important developmental model species, so cartilaginous fishes are uniquely suited for deep comparative analyses of tooth development and regeneration. Additionally, sharks and rays can offer crucial insights into the characters of the dentition in the ancestor of all jawed vertebrates. Despite this, tooth development and regeneration in chondrichthyans is poorly understood and remains virtually uncharacterized from a developmental genetic standpoint. Using the emerging chondrichthyan model, the catshark (Scyliorhinus spp.), we characterized the expression of genes homologous to those known to be expressed during stages of early dental competence, tooth initiation, morphogenesis, and regeneration in bony vertebrates. We have found that expression patterns of several genes from Hh, Wnt/β-catenin, Bmp and Fgf signalling pathways indicate deep conservation over ~450 million years of tooth development and regeneration. We describe how these genes participate in the initial emergence of the shark dentition and how they are redeployed during regeneration of successive tooth generations. We suggest that at the dawn of the vertebrate lineage, teeth (i) were most likely continuously regenerative structures, and (ii) utilised a core set of genes from members of key developmental signalling pathways that were instrumental in creating a dental legacy redeployed throughout vertebrate evolution. These data lay the foundation for further experimental investigations utilizing the unique regenerative capacity of chondrichthyan models to answer evolutionary
-
Conservation and co-option in developmental programmes: the importance of homology relationships
Directory of Open Access Journals (Sweden)
Becker May-Britt
2005-10-01
Full Text Available Abstract One of the surprising insights gained from research in evolutionary developmental biology (evo-devo is that increasing diversity in body plans and morphology in organisms across animal phyla are not reflected in similarly dramatic changes at the level of gene composition of their genomes. For instance, simplicity at the tissue level of organization often contrasts with a high degree of genetic complexity. Also intriguing is the observation that the coding regions of several genes of invertebrates show high sequence similarity to those in humans. This lack of change (conservation indicates that evolutionary novelties may arise more frequently through combinatorial processes, such as changes in gene regulation and the recruitment of novel genes into existing regulatory gene networks (co-option, and less often through adaptive evolutionary processes in the coding portions of a gene. As a consequence, it is of great interest to examine whether the widespread conservation of the genetic machinery implies the same developmental function in a last common ancestor, or whether homologous genes acquired new developmental roles in structures of independent phylogenetic origin. To distinguish between these two possibilities one must refer to current concepts of phylogeny reconstruction and carefully investigate homology relationships. Particularly problematic in terms of homology decisions is the use of gene expression patterns of a given structure. In the future, research on more organisms other than the typical model systems will be required since these can provide insights that are not easily obtained from comparisons among only a few distantly related model species.
-
Directory of Open Access Journals (Sweden)
Kalle Magnusson
Full Text Available In Anopheles gambiae, sex-regulated genes are responsible for controlling gender dimorphism and are therefore crucial in determining the ability of female mosquitoes to transmit human malaria. The identification and functional characterization of these genes will shed light on the sexual development and maturation of mosquitoes and provide useful targets for genetic control measures aimed at reducing mosquito fertility and/or distorting the sex ratio.We conducted a genome wide transcriptional analysis of sex-regulated genes from early developmental stages through adulthood combined with functional screening of novel gonadal genes. Our results demonstrate that the male-biased genes undergo a major transcription turnover starting from larval stages to adulthood. The male biased genes at the adult stage include a significant high number of unique sequences compared to the rest of the genome. This is in contrast to female-biased genes that are much more conserved and are mainly activated during late developmental stages.The high frequency of unique sequences would indicate that male-biased genes evolve more rapidly than the rest of the genome. This finding is particularly intriguing because A. gambiae is a strictly female monogamous species suggesting that driving forces in addition to sperm competition must account for the rapid evolution of male-biased genes. We have also identified and functionally characterized a number of previously unknown A. gambiae testis- and ovary-specific genes. Two of these genes, zero population growth and a suppressor of defective silencing 3 domain of the histone deacetylase co-repressor complex, were shown to play a key role in gonad development.
-
Hydroxylated PBDEs induce developmental arrest in zebrafish
Energy Technology Data Exchange (ETDEWEB)
Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu; Bruce, Erica D., E-mail: Erica_bruce@baylor.edu
2012-07-01
The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was not observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.
-
Developmental programming of hypothalamic neuronal circuits: impact on energy balance control
Directory of Open Access Journals (Sweden)
Thanuja eGali Ramamoorthy
2015-04-01
Full Text Available The prevalence of obesity in adults and children has increased globally at an alarming rate. Mounting evidence from both epidemiological studies and animal models indicates that adult obesity and associated metabolic disorders can be programmed by intrauterine and early postnatal environment- a phenomenon known as fetal programming of adult disease. Data from nutritional intervention studies in animals including maternal under- and over-nutrition support the developmental origins of obesity and metabolic syndrome. The hypothalamic neuronal circuits located in the arcuate nucleus controlling appetite and energy expenditure are set early in life and are perturbed by maternal nutritional insults. In this review, we focus on the effects of maternal nutrition in programming permanent changes in these hypothalamic circuits, with experimental evidence from animal models of maternal under- and over-nutrition. We discuss the epigenetic modifications which regulate hypothalamic gene expression as potential molecular mechanisms linking maternal diet during pregnancy to the offspring’s risk of obesity at a later age. Understanding these mechanisms in key metabolic genes may provide insights into the development of preventative intervention strategies.
-
Developmental programming of hypothalamic neuronal circuits: impact on energy balance control
Gali Ramamoorthy, Thanuja; Begum, Ghazala; Harno, Erika; White, Anne
2015-01-01
The prevalence of obesity in adults and children has increased globally at an alarming rate. Mounting evidence from both epidemiological studies and animal models indicates that adult obesity and associated metabolic disorders can be programmed by intrauterine and early postnatal environment- a phenomenon known as “fetal programming of adult disease.” Data from nutritional intervention studies in animals including maternal under- and over-nutrition support the developmental origins of obesity and metabolic syndrome. The hypothalamic neuronal circuits located in the arcuate nucleus controlling appetite and energy expenditure are set early in life and are perturbed by maternal nutritional insults. In this review, we focus on the effects of maternal nutrition in programming permanent changes in these hypothalamic circuits, with experimental evidence from animal models of maternal under- and over-nutrition. We discuss the epigenetic modifications which regulate hypothalamic gene expression as potential molecular mechanisms linking maternal diet during pregnancy to the offspring's risk of obesity at a later age. Understanding these mechanisms in key metabolic genes may provide insights into the development of preventative intervention strategies. PMID:25954145
-
Sampling in Developmental Science: Situations, Shortcomings, Solutions, and Standards
Bornstein, Marc H.; Jager, Justin; Putnick, Diane L.
2013-01-01
Sampling is a key feature of every study in developmental science. Although sampling has far-reaching implications, too little attention is paid to sampling. Here, we describe, discuss, and evaluate four prominent sampling strategies in developmental science: population-based probability sampling, convenience sampling, quota sampling, and homogeneous sampling. We then judge these sampling strategies by five criteria: whether they yield representative and generalizable estimates of a study’s t...
-
Mishra, A; Reddy, I J; Dhali, A; Javvaji, P K
2018-04-02
SummaryThe objective of the study was to investigate the effect of l-ergothioneine (l-erg) (5 mM or 10 mM) supplementation in maturation medium on the developmental potential and OCTN1-dependant l-erg-mediated (10 mM) change in mRNA abundance of apoptotic (Bcl2, Bax, Casp3 and PCNA) and antioxidant (GPx, SOD1, SOD2 and CAT) genes in sheep oocytes and developmental stages of embryos produced in vitro. Oocytes matured with l-erg (10 mM) reduced their embryo toxicity by decreasing intracellular ROS and increasing intracellular GSH in matured oocytes that in turn improved developmental potential, resulting in significantly (P l-erg without change in maturation rate. l-Erg (10 mM) treatment did not influence the mRNA abundance of the majority of apoptotic and antioxidant genes studied in the matured oocytes and developmental stages of embryo. A gene expression study found that the SLC22A4 gene that encodes OCTN1, an integral membrane protein and specific transporter of l-erg was not expressed in oocytes and developmental stages of embryos. Therefore it was concluded from the study that although there was improvement in the developmental potential of sheep embryos by l-erg supplementation in maturation medium, there was no change in the expression of the majority of the genes studied due to the absence of the SLC22A4 gene in oocytes and embryos that encode OCTN1, which is responsible for transportation of l-erg across the membrane to alter gene expression.
-
Developmental evolution: this side of paradise.
Graham, A; McGonnell, I
1999-09-09
It has long been appreciated that the evolution of snakes involved the loss of limbs and axis elongation, but their developmental basis has been obscure. It has now been shown that alterations in the deployment of Hox genes and an early block in the formation of hindlimb primordia underpin these modifications.
-
Replication and Robustness in Developmental Research
Duncan, Greg J.; Engel, Mimi; Claessens, Amy; Dowsett, Chantelle J.
2014-01-01
Replications and robustness checks are key elements of the scientific method and a staple in many disciplines. However, leading journals in developmental psychology rarely include explicit replications of prior research conducted by different investigators, and few require authors to establish in their articles or online appendices that their key…
-
Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik
2014-01-01
Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994
-
Developmental disorders: what can be learned from cognitive neuropsychology?
Castles, Anne; Kohnen, Saskia; Nickels, Lyndsey; Brock, Jon
2014-01-01
The discipline of cognitive neuropsychology has been important for informing theories of cognition and describing the nature of acquired cognitive disorders, but its applicability in a developmental context has been questioned. Here, we revisit this issue, asking whether the cognitive neuropsychological approach can be helpful for exploring the nature and causes of developmental disorders and, if so, how. We outline the key features of the cognitive neuropsychological approach, and then consider how some of the major challenges to this approach from a developmental perspective might be met. In doing so, we distinguish between challenges to the methods of cognitive neuropsychology and those facing its deeper conceptual underpinnings. We conclude that the detailed investigation of patterns of both associations and dissociations, and across both developmental and acquired cases, can assist in describing the cognitive deficits within developmental disorders and in delineating possible causal pathways to their acquisition.
-
Energy Technology Data Exchange (ETDEWEB)
Henrique Barreta, Marcos [Universidade Federal de Santa Catarina, Campus Universitario de Curitibanos, Curitibanos, SC (Brazil); Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Ferreira, Rogerio [Centro de Educacao Superior do Oeste-Universidade do Estado de Santa Catarina, Chapeco, SC (Brazil); Oliveira, Joao Francisco de; Goncalves, Paulo Bayard Dias [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Bordignon, Vilceu, E-mail: vilceu.bordignon@mcgill.ca [Department of Animal Science, McGill University, Ste-Anne-De-Bellevue, QC (Canada)
2012-10-01
This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.
-
International Nuclear Information System (INIS)
Henrique Barreta, Marcos; Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de; Ferreira, Rogério; Oliveira, João Francisco de; Gonçalves, Paulo Bayard Dias; Bordignon, Vilceu
2012-01-01
This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.
-
Directory of Open Access Journals (Sweden)
Manoj Kulkarni
2017-12-01
Full Text Available Abiotic stresses such as, drought, heat, salinity, and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as, DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as, ERF (ethylene response factors, DREB (dehydration responsive element binding, ZFP (zinc finger proteins, WRKY, and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize, and/or Arabidopsis. The overall aim of this review is to provide an overview of candidate genes that have been identified as regulators of drought response in plants. The lack of a reference genome sequence for wheat and non-transgenic approaches for manipulation of gene functions in wheat in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a
-
Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G.; Kagale, Sateesh
2017-12-01
Abiotic stresses such as drought, heat, salinity and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize and/or Arabidopsis. The overall aim of this review was to provide an overview of candidate genes that have been tested as regulators of drought response in plants. The lack of a reference genome sequence for wheat and nontransgenic approaches for manipulation of gene functions in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold-standard reference genome
-
de Valenzuela, Julia Scherba; Bird, Elizabeth Kay-Raining; Parkington, Karisa; Mirenda, Pat; Cain, Kate; MacLeod, Andrea A N; Segers, Eliane
The purpose of this article is to describe the results of a thematic analysis of 79 semi-structured interviews collected at six research sites in four countries in relation to the inclusion and exclusion of students with developmental disabilities (DD) in and from special education and bilingual opportunities. The participants were individuals with expertise either in special needs and/or language education to support bilingualism (e.g., second language (L2) instruction), who served as key informants about service delivery and/or policy in these areas. Six themes emerged as salient during the analysis: we include all kids, special needs drives it, time/scheduling conflicts, IEP/IPP/statement drives it, it's up to the parents, and service availability. The results suggested that access to language programs and services is limited for children with DD, even though participants at all sites reported adherence to a philosophy of inclusion. A priority on special education services over language services was identified, as well as barriers to providing children with DD access to programs and services to support bilingual development. Some of these barriers included time and scheduling conflicts and limited service availability. Additionally, the role of parents in decision making was affirmed, although, in contrast to special education services, decision-making about participation or exemption from language programs was typically left up to the parents. Overall, the results suggest a need for greater attention to providing supports for both first (L1) and L2 language development for bilingual children with DD and greater access to available language programs. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Energy Technology Data Exchange (ETDEWEB)
Lichtensteiger, W; Faass, O; Ceccatelli, R; Schlumpf, M [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology
2004-09-15
We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.
-
Directory of Open Access Journals (Sweden)
Marianne Rooman
Full Text Available Available DNA microarray time series that record gene expression along the developmental stages of multicellular eukaryotes, or in unicellular organisms subject to external perturbations such as stress and diauxie, are analyzed. By pairwise comparison of the gene expression profiles on the basis of a translation-invariant and scale-invariant distance measure corresponding to least-rectangle regression, it is shown that peaks in the average distance values are noticeable and are localized around specific time points. These points systematically coincide with the transition points between developmental phases or just follow the external perturbations. This approach can thus be used to identify automatically, from microarray time series alone, the presence of external perturbations or the succession of developmental stages in arbitrary cell systems. Moreover, our results show that there is a striking similarity between the gene expression responses to these a priori very different phenomena. In contrast, the cell cycle does not involve a perturbation-like phase, but rather continuous gene expression remodeling. Similar analyses were conducted using three other standard distance measures, showing that the one we introduced was superior. Based on these findings, we set up an adapted clustering method that uses this distance measure and classifies the genes on the basis of their expression profiles within each developmental stage or between perturbation phases.
-
Detection of genes associated with developmental competence of bovine oocytes
Czech Academy of Sciences Publication Activity Database
Němcová, Lucie; Jansová, Denisa; Vodičková Kepková, Kateřina; Vodička, Petr; Jeseta, M.; Machatková, M.; Kaňka, Jiří
2016-01-01
Roč. 166, č. 1 (2016), s. 58-71 ISSN 0378-4320 Institutional support: RVO:67985904 Keywords : oocyte * embryo * bovine * developmental competence * transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.605, year: 2016
-
Directory of Open Access Journals (Sweden)
Charles W Higdon
Full Text Available In order to facilitate understanding of pigment cell biology, we developed a method to concomitantly purify melanocytes, iridophores, and retinal pigmented epithelium from zebrafish, and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co-enrichment in melanocytes and retinal pigmented epithelium, as well as in melanocytes and iridophores. We found 214 genes co-enriched in melanocytes and retinal pigmented epithelium, indicating the shared functions of melanin-producing cells. We found 62 genes significantly co-enriched in melanocytes and iridophores, illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine-based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate-limiting substrate for purine synthesis, phosphoribosyl pyrophosphate, thus constituting a guanine cycle. The purification procedure and expression analysis described here, along with the accompanying transcriptome-wide expression data, provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types, and will be a useful resource for further studies of pigment cell biology.
-
Directory of Open Access Journals (Sweden)
Pandiyan Muthuramalingam
2017-05-01
Full Text Available Combined abiotic stress (CAbS affects the field grown plants simultaneously. The multigenic and quantitative nature of uncontrollable abiotic stresses complicates the process of understanding the stress response by plants. Considering this, we analyzed the CAbS response of C3 model plant, Oryza sativa by meta-analysis. The datasets of commonly expressed genes by drought, salinity, submergence, metal, natural expression, biotic, and abiotic stresses were data mined through publically accessible transcriptomic abiotic stress (AbS responsive datasets. Of which 1,175, 12,821, and 42,877 genes were commonly expressed in meta differential, individual differential, and unchanged expressions respectively. Highly regulated 100 differentially expressed AbS genes were derived through integrative meta-analysis of expression data (INMEX. Of this 30 genes were identified from AbS gene families through expression atlas that were computationally analyzed for their physicochemical properties. All AbS genes were physically mapped against O. sativa genome. Comparative mapping of these genes demonstrated the orthologous relationship with related C4 panicoid genome. In silico expression analysis of these genes showed differential expression patterns in different developmental tissues. Protein–protein interaction of these genes, represented the complexity of AbS. Computational expression profiling of candidate genes in response to multiple stresses suggested the putative involvement of OS05G0350900, OS02G0612700, OS05G0104200, OS03G0596200, OS12G0225900, OS07G0152000, OS08G0119500, OS06G0594700, and Os01g0393100 in CAbS. These potential candidate genes need to be studied further to decipher their functional roles in AbS dynamics.
-
Evaluation of suitable reference genes for gene expression studies ...
Indian Academy of Sciences (India)
2011-12-14
Dec 14, 2011 ... MADS family of TFs control floral organ identity within each whorl of the flower by activating downstream genes. Measuring gene expression in different tissue types and developmental stages is of fundamental importance in TFs functional research. In last few years, quantitative real-time. PCR (qRT-PCR) ...
-
Codon bias and gene ontology in holometabolous and hemimetabolous insects.
Carlini, David B; Makowski, Matthew
2015-12-01
The relationship between preferred codon use (PCU), developmental mode, and gene ontology (GO) was investigated in a sample of nine insect species with sequenced genomes. These species were selected to represent two distinct modes of insect development, holometabolism and hemimetabolism, with an aim toward determining whether the differences in developmental timing concomitant with developmental mode would be mirrored by differences in PCU in their developmental genes. We hypothesized that the developmental genes of holometabolous insects should be under greater selective pressure for efficient translation, manifest as increased PCU, than those of hemimetabolous insects because holometabolism requires abundant protein expression over shorter time intervals than hemimetabolism, where proteins are required more uniformly in time. Preferred codon sets were defined for each species, from which the frequency of PCU for each gene was obtained. Although there were substantial differences in the genomic base composition of holometabolous and hemimetabolous insects, both groups exhibited a general preference for GC-ending codons, with the former group having higher PCU averaged across all genes. For each species, the biological process GO term for each gene was assigned that of its Drosophila homolog(s), and PCU was calculated for each GO term category. The top two GO term categories for PCU enrichment in the holometabolous insects were anatomical structure development and cell differentiation. The increased PCU in the developmental genes of holometabolous insects may reflect a general strategy to maximize the protein production of genes expressed in bursts over short time periods, e.g., heat shock proteins. J. Exp. Zool. (Mol. Dev. Evol.) 324B: 686-698, 2015. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.
-
An in silico analysis of the key genes involved in flavonoid biosynthesis in Citrus sinensis
Directory of Open Access Journals (Sweden)
Adriano R. Lucheta
2007-01-01
Full Text Available Citrus species are known by their high content of phenolic compounds, including a wide range of flavonoids. In plants, these compounds are involved in protection against biotic and abiotic stresses, cell structure, UV protection, attraction of pollinators and seed dispersal. In humans, flavonoid consumption has been related to increasing overall health and fighting some important diseases. The goals of this study were to identify expressed sequence tags (EST in Citrus sinensis (L. Osbeck corresponding to genes involved in general phenylpropanoid biosynthesis and the key genes involved in the main flavonoids pathways (flavanones, flavones, flavonols, leucoanthocyanidins, anthocyanins and isoflavonoids. A thorough analysis of all related putative genes from the Citrus EST (CitEST database revealed several interesting aspects associated to these pathways and brought novel information with promising usefulness for both basic and biotechnological applications.
-
Developmental dyscalculia: a dysconnection syndrome?
Kucian, Karin; Ashkenazi, Simone Schwizer; Hänggi, Jürgen; Rotzer, Stephanie; Jäncke, Lutz; Martin, Ernst; von Aster, Michael
2014-09-01
Numerical understanding is important for everyday life. For children with developmental dyscalculia (DD), numbers and magnitudes present profound problems which are thought to be based upon neuronal impairments of key regions for numerical understanding. The aim of the present study was to investigate possible differences in white matter fibre integrity between children with DD and controls using diffusion tensor imaging. White matter integrity and behavioural measures were evaluated in 15 children with developmental dyscalculia aged around 10 years and 15 matched controls. The main finding, obtained by a whole brain group comparison, revealed reduced fractional anisotropy in the superior longitudinal fasciculus in children with developmental dyscalculia. In addition, a region of interest analysis exhibited prominent deficits in fibres of the superior longitudinal fasciculus adjacent to the intraparietal sulcus, which is thought to be the core region for number processing. To conclude, our results outline deficient fibre projection between parietal, temporal and frontal regions in children with developmental dyscalculia, and therefore raise the question of whether dyscalculia can be seen as a dysconnection syndrome. Since the superior longitudinal fasciculus is involved in the integration and control of distributed brain processes, the present results highlight the importance of considering broader domain-general mechanisms in the diagnosis and therapy of dyscalculia.
-
Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian
2016-07-01
Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Human pluripotent stem cells: an emerging model in developmental biology.
Zhu, Zengrong; Huangfu, Danwei
2013-02-01
Developmental biology has long benefited from studies of classic model organisms. Recently, human pluripotent stem cells (hPSCs), including human embryonic stem cells and human induced pluripotent stem cells, have emerged as a new model system that offers unique advantages for developmental studies. Here, we discuss how studies of hPSCs can complement classic approaches using model organisms, and how hPSCs can be used to recapitulate aspects of human embryonic development 'in a dish'. We also summarize some of the recently developed genetic tools that greatly facilitate the interrogation of gene function during hPSC differentiation. With the development of high-throughput screening technologies, hPSCs have the potential to revolutionize gene discovery in mammalian development.
-
Directory of Open Access Journals (Sweden)
Wai Hoong Chang
2018-01-01
Full Text Available The homeodomain-containing proteins are an important group of transcription factors found in most eukaryotes including animals, plants and fungi. Homeobox genes are responsible for a wide range of critical developmental and physiological processes, ranging from embryonic development, innate immune homeostasis to whole-body regeneration. With continued fascination on this key class of proteins by developmental and evolutionary biologists, multiple efforts have thus far focused on the identification and characterization of homeobox orthologs from key model organisms in attempts to infer their evolutionary origin and how this underpins the evolution of complex body plans. Despite their importance, the genetic complement of homeobox genes has yet been described in one of the most valuable groups of animals representing economically important food crops. With crustacean aquaculture being a growing industry worldwide, it is clear that systematic and cross-species identification of crustacean homeobox orthologs is necessary in order to harness this genetic circuitry for the improvement of aquaculture sustainability. Using publicly available transcriptome data sets, we identified a total of 4183 putative homeobox genes from 120 crustacean species that include food crop species, such as lobsters, shrimps, crayfish and crabs. Additionally, we identified 717 homeobox orthologs from 6 other non-crustacean arthropods, which include the scorpion, deer tick, mosquitoes and centipede. This high confidence set of homeobox genes will now serve as a key resource to the broader community for future functional and comparative genomics studies.
-
Guerrero-Preston, Rafael; Michailidi, Christina; Marchionni, Luigi; Pickering, Curtis R.; Frederick, Mitchell J.; Myers, Jeffrey N.; Yegnasubramanian, Srinivasan; Hadar, Tal; Noordhuis, Maartje G.; Zizkova, Veronika; Fertig, Elana; Agrawal, Nishant; Westra, William; Koch, Wayne; Califano, Joseph; Velculescu, Victor E.; Sidransky, David
Tumor suppressor genes (TSGs) are commonly inactivated by somatic mutation and/or promoter methylation; yet, recent high-throughput genomic studies have not identified key TSGs inactivated by both mechanisms. We pursued an integrated molecular analysis based on methylation binding domain sequencing
-
Kühn, Nathalie; Arce-Johnson, Patricio
2012-01-01
Berry formation is the process of ovary conversion into a functional fruit, and is characterized by abrupt changes in the content of several phytohormones, associated with pollination and fertilization. Much effort has been made in order to improve our understanding of berry development, particularly from veraison to post-harvest time. However, the period of berry formation has been poorly investigated, despite its importance. Phytohormones are involved in the control of fruit formation; hence it is important to understand the regulation of their content at this stage. Grapevine is an excellent fleshy-fruit plant model since its fruits have particularities that differentiate them from those of commonly studied organisms. For instance, berries are prepared to cope with stress by producing several antioxidants and they are non-climacteric fruits. Also its genome is fully sequenced, which allows to identify genes involved in developmental processes. In grapevine, no link has been established between pollination and phytohormone biosynthesis, until recently. Here we highlight relevant findings regarding pollination effect on gene expression related to phytohormone biosynthesis, and present unpublished results showing how quickly this effect is achieved.
-
Directory of Open Access Journals (Sweden)
Wenwu HE
2012-07-01
Full Text Available Background and objective Non-small cell lung cancer (NSCLC is one of the most common malignant tumors; however, its causes are still not completely understood. This study was designed to screen the key genes and pathways related to NSCLC occurrence and development and to establish the scientific foundation for the genetic mechanisms and targeted therapy of NSCLC. Methods Both gene set-enrichment analysis (GSEA and meta-analysis (meta were used to screen the critical pathways and genes that might be corretacted with the development and progression of lung cancer at the transcription level. Results Using the GSEA and meta methods, focal adhesion and regulation of actin cytoskeleton were determined to be the more prominent overlapping significant pathways. In the focal adhesion pathway, 31 genes were statistically significant (P<0.05, whereas in the regulation of actin cytoskeleton pathway, 32 genes were statistically significant (P<0.05. Conclusion The focal adhesion and the regulation of actin cytoskeleton pathways might play important roles in the occurrence and development of NSCLC. Further studies are needed to determine the biological function for the positiue genes.
-
On the role of sparseness in the evolution of modularity in gene regulatory networks.
Espinosa-Soto, Carlos
2018-05-01
Modularity is a widespread property in biological systems. It implies that interactions occur mainly within groups of system elements. A modular arrangement facilitates adjustment of one module without perturbing the rest of the system. Therefore, modularity of developmental mechanisms is a major factor for evolvability, the potential to produce beneficial variation from random genetic change. Understanding how modularity evolves in gene regulatory networks, that create the distinct gene activity patterns that characterize different parts of an organism, is key to developmental and evolutionary biology. One hypothesis for the evolution of modules suggests that interactions between some sets of genes become maladaptive when selection favours additional gene activity patterns. The removal of such interactions by selection would result in the formation of modules. A second hypothesis suggests that modularity evolves in response to sparseness, the scarcity of interactions within a system. Here I simulate the evolution of gene regulatory networks and analyse diverse experimentally sustained networks to study the relationship between sparseness and modularity. My results suggest that sparseness alone is neither sufficient nor necessary to explain modularity in gene regulatory networks. However, sparseness amplifies the effects of forms of selection that, like selection for additional gene activity patterns, already produce an increase in modularity. That evolution of new gene activity patterns is frequent across evolution also supports that it is a major factor in the evolution of modularity. That sparseness is widespread across gene regulatory networks indicates that it may have facilitated the evolution of modules in a wide variety of cases.
-
Identifying key genes in rheumatoid arthritis by weighted gene co-expression network analysis.
Ma, Chunhui; Lv, Qi; Teng, Songsong; Yu, Yinxian; Niu, Kerun; Yi, Chengqin
2017-08-01
This study aimed to identify rheumatoid arthritis (RA) related genes based on microarray data using the WGCNA (weighted gene co-expression network analysis) method. Two gene expression profile datasets GSE55235 (10 RA samples and 10 healthy controls) and GSE77298 (16 RA samples and seven healthy controls) were downloaded from Gene Expression Omnibus database. Characteristic genes were identified using metaDE package. WGCNA was used to find disease-related networks based on gene expression correlation coefficients, and module significance was defined as the average gene significance of all genes used to assess the correlation between the module and RA status. Genes in the disease-related gene co-expression network were subject to functional annotation and pathway enrichment analysis using Database for Annotation Visualization and Integrated Discovery. Characteristic genes were also mapped to the Connectivity Map to screen small molecules. A total of 599 characteristic genes were identified. For each dataset, characteristic genes in the green, red and turquoise modules were most closely associated with RA, with gene numbers of 54, 43 and 79, respectively. These genes were enriched in totally enriched in 17 Gene Ontology terms, mainly related to immune response (CD97, FYB, CXCL1, IKBKE, CCR1, etc.), inflammatory response (CD97, CXCL1, C3AR1, CCR1, LYZ, etc.) and homeostasis (C3AR1, CCR1, PLN, CCL19, PPT1, etc.). Two small-molecule drugs sanguinarine and papaverine were predicted to have a therapeutic effect against RA. Genes related to immune response, inflammatory response and homeostasis presumably have critical roles in RA pathogenesis. Sanguinarine and papaverine have a potential therapeutic effect against RA. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.
-
Institute of Scientific and Technical Information of China (English)
Zi-Yu Li; Bin Li; Ai-Wu Dong
2012-01-01
Plant cells frequently undergo endoreduplication,a modified cell cycle in which genome is repeatedly replicated without cytokinesis.As the key step to achieve final size and function for cells,endoreduplication is prevalent during plant development.However,mechanisms to control the balance between endoreduplication and mitotic cell division are still poorly understood.Here,we show that the Arabidopsis TCP (CINCINNATA-like TEOSINTE BRANCHED1-CYCLOIDEA-PCF)-family transcription factor gene AtTCP15 is expressed in trichomes,as well as in rapidly dividing and vascular tissues.Expression of AtTCP15SRDX,AtTCP15 fused with a SRDX repressor domain,induces extra endoreduplication in trichomes and cotyledon cells in transgenic Arabidopsis.On the contrary,overexpression of AtTCP15 suppresses endoreduplication in trichomes and other examined cells.Misregulation of AtTCP15 affects the expression of several important genes involved in cell-cycle regulation.AtTCP15 protein binds directly to the promoter regions of CYCA2;3 and RETINOBLASTOMA-RELATED (RBR) genes,which play key roles in endoreduplication.Taken together,AtTCP15 plays an important role in regulating endoreduplication during Arabidopsis development.
-
VIII. THE PAST, PRESENT, AND FUTURE OF DEVELOPMENTAL METHODOLOGY.
Little, Todd D; Wang, Eugene W; Gorrall, Britt K
2017-06-01
This chapter selectively reviews the evolution of quantitative practices in the field of developmental methodology. The chapter begins with an overview of the past in developmental methodology, discussing the implementation and dissemination of latent variable modeling and, in particular, longitudinal structural equation modeling. It then turns to the present state of developmental methodology, highlighting current methodological advances in the field. Additionally, this section summarizes ample quantitative resources, ranging from key quantitative methods journal articles to the various quantitative methods training programs and institutes. The chapter concludes with the future of developmental methodology and puts forth seven future innovations in the field. The innovations discussed span the topics of measurement, modeling, temporal design, and planned missing data designs. Lastly, the chapter closes with a brief overview of advanced modeling techniques such as continuous time models, state space models, and the application of Bayesian estimation in the field of developmental methodology. © 2017 The Society for Research in Child Development, Inc.
-
Directory of Open Access Journals (Sweden)
Tathyana Rachel Palo Mello
2014-12-01
Full Text Available Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH, control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1. EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g. miR-133 and miR-375, as well honeybee-specific ones (e.g. miR-3745 and miR-3761. Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect.
-
Directory of Open Access Journals (Sweden)
Adam M. Reitzel
2016-08-01
Full Text Available Abstract Background An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The “germline” genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Results Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of “germline genes,” which are areas of high cell proliferation, suggesting that these genes are involved with “stem cell” specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for
-
Directory of Open Access Journals (Sweden)
Daniel P S Osborn
Full Text Available Common intronic variants in the Human fat mass and obesity-associated gene (FTO are found to be associated with an increased risk of obesity. Overexpression of FTO correlates with increased food intake and obesity, whilst loss-of-function results in lethality and severe developmental defects. Despite intense scientific discussions around the role of FTO in energy metabolism, the function of FTO during development remains undefined. Here, we show that loss of Fto leads to developmental defects such as growth retardation, craniofacial dysmorphism and aberrant neural crest cells migration in Zebrafish. We find that the important developmental pathway, Wnt, is compromised in the absence of FTO, both in vivo (zebrafish and in vitro (Fto(-/- MEFs and HEK293T. Canonical Wnt signalling is down regulated by abrogated β-Catenin translocation to the nucleus whilst non-canonical Wnt/Ca(2+ pathway is activated via its key signal mediators CaMKII and PKCδ. Moreover, we demonstrate that loss of Fto results in short, absent or disorganised cilia leading to situs inversus, renal cystogenesis, neural crest cell defects and microcephaly in Zebrafish. Congruently, Fto knockout mice display aberrant tissue specific cilia. These data identify FTO as a protein-regulator of the balanced activation between canonical and non-canonical branches of the Wnt pathway. Furthermore, we present the first evidence that FTO plays a role in development and cilia formation/function.
-
Tian, Caihong; Tek Tay, Wee; Feng, Hongqiang; Wang, Ying; Hu, Yongmin; Li, Guoping
2015-06-01
Adelphocoris suturalis is one of the most serious pest insects of Bt cotton in China, however its molecular genetics, biochemistry and physiology are poorly understood. We used high throughput sequencing platform to perform de novo transcriptome assembly and gene expression analyses across different developmental stages (eggs, 2nd and 5th instar nymphs, female and male adults). We obtained 20 GB of clean data and revealed 88,614 unigenes, including 23,830 clusters and 64,784 singletons. These unigene sequences were annotated and classified by Gene Ontology, Clusters of Orthologous Groups, and Kyoto Encyclopedia of Genes and Genomes databases. A large number of differentially expressed genes were discovered through pairwise comparisons between these developmental stages. Gene expression profiles were dramatically different between life stage transitions, with some of these most differentially expressed genes being associated with sex difference, metabolism and development. Quantitative real-time PCR results confirm deep-sequencing findings based on relative expression levels of nine randomly selected genes. Furthermore, over 791,390 single nucleotide polymorphisms and 2,682 potential simple sequence repeats were identified. Our study provided comprehensive transcriptional gene expression information for A. suturalis that will form the basis to better understanding of development pathways, hormone biosynthesis, sex differences and wing formation in mirid bugs.
-
Bråte, Jon; Adamski, Marcin; Neumann, Ralf S; Shalchian-Tabrizi, Kamran; Adamska, Maja
2015-12-22
Long non-coding RNAs (lncRNAs) play important regulatory roles during animal development, and it has been hypothesized that an RNA-based gene regulation was important for the evolution of developmental complexity in animals. However, most studies of lncRNA gene regulation have been performed using model animal species, and very little is known about this type of gene regulation in non-bilaterians. We have therefore analysed RNA-Seq data derived from a comprehensive set of embryogenesis stages in the calcareous sponge Sycon ciliatum and identified hundreds of developmentally expressed intergenic lncRNAs (lincRNAs) in this species. In situ hybridization of selected lincRNAs revealed dynamic spatial and temporal expression during embryonic development. More than 600 lincRNAs constitute integral parts of differentially expressed gene modules, which also contain known developmental regulatory genes, e.g. transcription factors and signalling molecules. This study provides insights into the non-coding gene repertoire of one of the earliest evolved animal lineages, and suggests that RNA-based gene regulation was probably present in the last common ancestor of animals. © 2015 The Authors.
-
Developmental biology of Streptomyces from the perspective of 100 actinobacterial genome sequences
Chandra, Govind; Chater, Keith F
2014-01-01
To illuminate the evolution and mechanisms of actinobacterial complexity, we evaluate the distribution and origins of known Streptomyces developmental genes and the developmental significance of actinobacteria-specific genes. As an aid, we developed the Actinoblast database of reciprocal blastp best hits between the Streptomyces coelicolor genome and more than 100 other actinobacterial genomes (http://streptomyces.org.uk/actinoblast/). We suggest that the emergence of morphological complexity was underpinned by special features of early actinobacteria, such as polar growth and the coupled participation of regulatory Wbl proteins and the redox-protecting thiol mycothiol in transducing a transient nitric oxide signal generated during physiologically stressful growth transitions. It seems that some cell growth and division proteins of early actinobacteria have acquired greater importance for sporulation of complex actinobacteria than for mycelial growth, in which septa are infrequent and not associated with complete cell separation. The acquisition of extracellular proteins with structural roles, a highly regulated extracellular protease cascade, and additional regulatory genes allowed early actinobacterial stationary phase processes to be redeployed in the emergence of aerial hyphae from mycelial mats and in the formation of spore chains. These extracellular proteins may have contributed to speciation. Simpler members of morphologically diverse clades have lost some developmental genes. PMID:24164321
-
Directory of Open Access Journals (Sweden)
Xiaolei Liu
Full Text Available BACKGROUND: Trichinellosis is a typical food-borne zoonotic disease which is epidemic worldwide and the nematode Trichinella spiralis is the main pathogen. The life cycle of T. spiralis contains three developmental stages, i.e. adult worms, new borne larva (new borne L1 larva and muscular larva (infective L1 larva. Stage-specific gene expression in the parasites has been investigated with various immunological and cDNA cloning approaches, whereas the genome-wide transcriptome and expression features of the parasite have been largely unknown. The availability of the genome sequence information of T. spiralis has made it possible to deeply dissect parasite biology in association with global gene expression and pathogenesis. METHODOLOGY AND PRINCIPAL FINDINGS: In this study, we analyzed the global gene expression patterns in the three developmental stages of T. spiralis using digital gene expression (DGE analysis. Almost 15 million sequence tags were generated with the Illumina RNA-seq technology, producing expression data for more than 9,000 genes, covering 65% of the genome. The transcriptome analysis revealed thousands of differentially expressed genes within the genome, and importantly, a panel of genes encoding functional proteins associated with parasite invasion and immuno-modulation were identified. More than 45% of the genes were found to be transcribed from both strands, indicating the importance of RNA-mediated gene regulation in the development of the parasite. Further, based on gene ontological analysis, over 3000 genes were functionally categorized and biological pathways in the three life cycle stage were elucidated. CONCLUSIONS AND SIGNIFICANCE: The global transcriptome of T. spiralis in three developmental stages has been profiled, and most gene activity in the genome was found to be developmentally regulated. Many metabolic and biological pathways have been revealed. The findings of the differential expression of several protein
-
Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E.; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder
2018-01-01
Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops. PMID:29672525
-
Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder; Murphy, Denis J
2018-01-01
Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops.
-
Developmental programming: the role of growth hormone.
Oberbauer, Anita M
2015-01-01
Developmental programming of the fetus has consequences for physiologic responses in the offspring as an adult and, more recently, is implicated in the expression of altered phenotypes of future generations. Some phenotypes, such as fertility, bone strength, and adiposity are highly relevant to food animal production and in utero factors that impinge on those traits are vital to understand. A key systemic regulatory hormone is growth hormone (GH), which has a developmental role in virtually all tissues and organs. This review catalogs the impact of GH on tissue programming and how perturbations early in development influence GH function.
-
Badia, Marta; Orgaz, María Begoña; Verdugo, Miguel Á.; Ullán, Ana M.; Martínez, Magdalena
2013-01-01
Background: Studies of people with developmental disabilities suggest that participation in leisure activities might be a key factor for good quality of life. This study explores the relationships between objective and subjective quality of life and leisure participation of adults with developmental disabilities. Materials and Methods: A…
-
Energy Technology Data Exchange (ETDEWEB)
Lichtensteiger, W.; Faass, O.; Ceccatelli, R.; Schlumpf, M. [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology
2004-09-15
We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.
-
Directory of Open Access Journals (Sweden)
Megan L. Martik
2016-02-01
Full Text Available Sea urchin embryos begin zygotic transcription shortly after the egg is fertilized. Throughout the cleavage stages a series of transcription factors are activated and, along with signaling through a number of pathways, at least 15 different cell types are specified by the beginning of gastrulation. Experimentally, perturbation of contributing transcription factors, signals and receptors and their molecular consequences enabled the assembly of an extensive gene regulatory network model. That effort, pioneered and led by Eric Davidson and his laboratory, with many additional insights provided by other laboratories, provided the sea urchin community with a valuable resource. Here we describe the approaches used to enable the assembly of an advanced gene regulatory network model describing molecular diversification during early development. We then provide examples to show how a relatively advanced authenticated network can be used as a tool for discovery of how diverse developmental mechanisms are controlled and work.
-
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
-
Family Decision Making: Benefits to Persons with Developmental Disabilities and Their Family Members
Neely-Barnes, Susan; Graff, J. Carolyn; Marcenko, Maureen; Weber, Lisa
2008-01-01
Family involvement in planning and choosing services has become a key intervention concept in developmental disability services. This study (N = 547) modeled patterns of family decision making and assessed benefits to persons with developmental disabilities (DDs) and their family members. A latent profile analysis identified 4 classes that were…
-
DEFF Research Database (Denmark)
Thomas Danielsen, E.; E. Møller, Morten; Yamanaka, Naoki
2016-01-01
Steroid hormones control important developmental processes and are linked to many diseases. To systematically identify genes and pathways required for steroid production, we performed a Drosophila genome-wide in vivo RNAi screen and identified 1,906 genes with potential roles in steroidogenesis...... and developmental timing. Here, we use our screen as a resource to identify mechanisms regulating intracellular levels of cholesterol, a substrate for steroidogenesis. We identify a conserved fatty acid elongase that underlies a mechanism that adjusts cholesterol trafficking and steroidogenesis with nutrition...... and developmental programs. In addition, we demonstrate the existence of an autophagosomal cholesterol mobilization mechanism and show that activation of this system rescues Niemann-Pick type C1 deficiency that causes a disorder characterized by cholesterol accumulation. These cholesterol-trafficking mechanisms...
-
The Drosophila melanogaster methuselah gene: a novel gene with ancient functions.
Directory of Open Access Journals (Sweden)
Ana Rita Araújo
Full Text Available The Drosophila melanogaster G protein-coupled receptor gene, methuselah (mth, has been described as a novel gene that is less than 10 million years old. Nevertheless, it shows a highly specific expression pattern in embryos, larvae, and adults, and has been implicated in larval development, stress resistance, and in the setting of adult lifespan, among others. Although mth belongs to a gene subfamily with 16 members in D. melanogaster, there is no evidence for functional redundancy in this subfamily. Therefore, it is surprising that a novel gene influences so many traits. Here, we explore the alternative hypothesis that mth is an old gene. Under this hypothesis, in species distantly related to D. melanogaster, there should be a gene with features similar to those of mth. By performing detailed phylogenetic, synteny, protein structure, and gene expression analyses we show that the D. virilis GJ12490 gene is the orthologous of mth in species distantly related to D. melanogaster. We also show that, in D. americana (a species of the virilis group of Drosophila, a common amino acid polymorphism at the GJ12490 orthologous gene is significantly associated with developmental time, size, and lifespan differences. Our results imply that GJ12490 orthologous genes are candidates for developmental time and lifespan differences in Drosophila in general.
-
DEFF Research Database (Denmark)
Liu, Ying; Lucas-Hahn, Andrea; Petersen, Bjoern
2017-01-01
on conventionally produced embryos. The goal of this study was to unravel putative differences between two cloning methods, with regard to developmental competence, expression profile of a panel of developmentally important genes and epigenetic profile of porcine cloned embryos produced by either CNT or HMC, either...
-
Busch, Hauke; Boerries, Melanie; Bao, Jie; Hanke, Sebastian T; Hiss, Manuel; Tiko, Theodhor; Rensing, Stefan A
2013-01-01
Transcription factors (TFs) often trigger developmental decisions, yet, their transcripts are often only moderately regulated and thus not easily detected by conventional statistics on expression data. Here we present a method that allows to determine such genes based on trajectory analysis of time-resolved transcriptome data. As a proof of principle, we have analysed apical stem cells of filamentous moss (P. patens) protonemata that develop from leaflets upon their detachment from the plant. By our novel correlation analysis of the post detachment transcriptome kinetics we predict five out of 1,058 TFs to be involved in the signaling leading to the establishment of pluripotency. Among the predicted regulators is the basic helix loop helix TF PpRSL1, which we show to be involved in the establishment of apical stem cells in P. patens. Our methodology is expected to aid analysis of key players of developmental decisions in complex plant and animal systems.
-
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
-
Gong, Wuming; Koyano-Nakagawa, Naoko; Li, Tongbin; Garry, Daniel J
2015-03-07
Decoding the temporal control of gene expression patterns is key to the understanding of the complex mechanisms that govern developmental decisions during heart development. High-throughput methods have been employed to systematically study the dynamic and coordinated nature of cardiac differentiation at the global level with multiple dimensions. Therefore, there is a pressing need to develop a systems approach to integrate these data from individual studies and infer the dynamic regulatory networks in an unbiased fashion. We developed a two-step strategy to integrate data from (1) temporal RNA-seq, (2) temporal histone modification ChIP-seq, (3) transcription factor (TF) ChIP-seq and (4) gene perturbation experiments to reconstruct the dynamic network during heart development. First, we trained a logistic regression model to predict the probability (LR score) of any base being bound by 543 TFs with known positional weight matrices. Second, four dimensions of data were combined using a time-varying dynamic Bayesian network model to infer the dynamic networks at four developmental stages in the mouse [mouse embryonic stem cells (ESCs), mesoderm (MES), cardiac progenitors (CP) and cardiomyocytes (CM)]. Our method not only infers the time-varying networks between different stages of heart development, but it also identifies the TF binding sites associated with promoter or enhancers of downstream genes. The LR scores of experimentally verified ESCs and heart enhancers were significantly higher than random regions (p network inference model identified a region with an elevated LR score approximately -9400 bp upstream of the transcriptional start site of Nkx2-5, which overlapped with a previously reported enhancer region (-9435 to -8922 bp). TFs such as Tead1, Gata4, Msx2, and Tgif1 were predicted to bind to this region and participate in the regulation of Nkx2-5 gene expression. Our model also predicted the key regulatory networks for the ESC-MES, MES-CP and CP
-
Functional mapping imprinted quantitative trait loci underlying developmental characteristics
Directory of Open Access Journals (Sweden)
Li Gengxin
2008-03-01
Full Text Available Abstract Background Genomic imprinting, a phenomenon referring to nonequivalent expression of alleles depending on their parental origins, has been widely observed in nature. It has been shown recently that the epigenetic modification of an imprinted gene can be detected through a genetic mapping approach. Such an approach is developed based on traditional quantitative trait loci (QTL mapping focusing on single trait analysis. Recent studies have shown that most imprinted genes in mammals play an important role in controlling embryonic growth and post-natal development. For a developmental character such as growth, current approach is less efficient in dissecting the dynamic genetic effect of imprinted genes during individual ontology. Results Functional mapping has been emerging as a powerful framework for mapping quantitative trait loci underlying complex traits showing developmental characteristics. To understand the genetic architecture of dynamic imprinted traits, we propose a mapping strategy by integrating the functional mapping approach with genomic imprinting. We demonstrate the approach through mapping imprinted QTL controlling growth trajectories in an inbred F2 population. The statistical behavior of the approach is shown through simulation studies, in which the parameters can be estimated with reasonable precision under different simulation scenarios. The utility of the approach is illustrated through real data analysis in an F2 family derived from LG/J and SM/J mouse stains. Three maternally imprinted QTLs are identified as regulating the growth trajectory of mouse body weight. Conclusion The functional iQTL mapping approach developed here provides a quantitative and testable framework for assessing the interplay between imprinted genes and a developmental process, and will have important implications for elucidating the genetic architecture of imprinted traits.
-
The function and evolution of Wnt genes in arthropods.
Murat, Sophie; Hopfen, Corinna; McGregor, Alistair P
2010-11-01
Wnt signalling is required for a wide range of developmental processes, from cleavage to patterning and cell migration. There are 13 subfamilies of Wnt ligand genes and this diverse repertoire appeared very early in metazoan evolution. In this review, we first summarise the known Wnt gene repertoire in various arthropods. Insects appear to have lost several Wnt subfamilies, either generally, such as Wnt3, or in lineage specific patterns, for example, the loss of Wnt7 in Anopheles. In Drosophila and Acyrthosiphon, only seven and six Wnt subfamilies are represented, respectively; however, the finding of nine Wnt genes in Tribolium suggests that arthropods had a larger repertoire ancestrally. We then discuss what is currently known about the expression and developmental function of Wnt ligands in Drosophila and other insects in comparison to other arthropods, such as the spiders Achaearanea and Cupiennius. We conclude that studies of Wnt genes have given us much insight into the developmental roles of some of these ligands. However, given the frequent loss of Wnt genes in insects and the derived development of Drosophila, further studies of these important genes are required in a broader range of arthropods to fully understand their developmental function and evolution. Copyright © 2010 Elsevier Ltd. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Eleftherios H. Drosinos
2016-08-01
Full Text Available The aim of the present study was to assess the expression of key virulence genes during co-culture of L. monocytogenes with a bacteriocinogenic E. faecium strain in liquid growth medium. For that purpose, BHI broth was inoculated with 7 log CFU·mL–1 L. monocytogenes and 4, 5 or 6 log CFU·mL–1 E. faecium. Sampling took place after 8 and 24 h of incubation, corresponding to the maximum and minimum of enterocin production, respectively. The RNA was extracted, stabilized and expression of prfA, sigB, hly, plcA, plcB, inlA, inlB, inlC and inlJ, was assessed by RT-qPCR. Most of the genes were downregulated during co-culture at 5 °C. Moreover, a statistically significant effect of the inoculum level was evident in most of the cases. On the contrary, no effect on the transcription level of most of the genes was observed during co-culture at 37 °C.
-
Directory of Open Access Journals (Sweden)
Maria João Nunes
Full Text Available Cholesterol is an essential component of the central nervous system and increasing evidence suggests an association between brain cholesterol metabolism dysfunction and the onset of neurodegenerative disorders. Interestingly, histone deacetylase inhibitors (HDACi such as trichostatin A (TSA are emerging as promising therapeutic approaches in neurodegenerative diseases, but their effect on brain cholesterol metabolism is poorly understood. We have previously demonstrated that HDACi up-regulate CYP46A1 gene transcription, a key enzyme in neuronal cholesterol homeostasis. In this study, TSA was shown to modulate the transcription of other genes involved in cholesterol metabolism in human neuroblastoma cells, namely by up-regulating genes that control cholesterol efflux and down-regulating genes involved in cholesterol synthesis and uptake, thus leading to an overall decrease in total cholesterol content. Furthermore, co-treatment with the amphipathic drug U18666A that can mimic the intracellular cholesterol accumulation observed in cells of Niemman-Pick type C patients, revealed that TSA can ameliorate the phenotype induced by pathological cholesterol accumulation, by restoring the expression of key genes involved in cholesterol synthesis, uptake and efflux and promoting lysosomal cholesterol redistribution. These results clarify the role of TSA in the modulation of neuronal cholesterol metabolism at the transcriptional level, and emphasize the idea of HDAC inhibition as a promising therapeutic tool in neurodegenerative disorders with impaired cholesterol metabolism.
-
Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin
McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.
2015-01-01
Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202
-
Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna
2016-08-01
Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the
-
Mascheretti, S; De Luca, A; Trezzi, V; Peruzzo, D; Nordio, A; Marino, C; Arrigoni, F
2017-01-03
Developmental dyslexia (DD) is a complex neurodevelopmental deficit characterized by impaired reading acquisition, in spite of adequate neurological and sensorial conditions, educational opportunities and normal intelligence. Despite the successful characterization of DD-susceptibility genes, we are far from understanding the molecular etiological pathways underlying the development of reading (dis)ability. By focusing mainly on clinical phenotypes, the molecular genetics approach has yielded mixed results. More optimally reduced measures of functioning, that is, intermediate phenotypes (IPs), represent a target for researching disease-associated genetic variants and for elucidating the underlying mechanisms. Imaging data provide a viable IP for complex neurobehavioral disorders and have been extensively used to investigate both morphological, structural and functional brain abnormalities in DD. Performing joint genetic and neuroimaging studies in humans is an emerging strategy to link DD-candidate genes to the brain structure and function. A limited number of studies has already pursued the imaging-genetics integration in DD. However, the results are still not sufficient to unravel the complexity of the reading circuit due to heterogeneous study design and data processing. Here, we propose an interdisciplinary, multilevel, imaging-genetic approach to disentangle the pathways from genes to behavior. As the presence of putative functional genetic variants has been provided and as genetic associations with specific cognitive/sensorial mechanisms have been reported, new hypothesis-driven imaging-genetic studies must gain momentum. This approach would lead to the optimization of diagnostic criteria and to the early identification of 'biologically at-risk' children, supporting the definition of adequate and well-timed prevention strategies and the implementation of novel, specific remediation approach.
-
A Key Gene, PLIN1, Can Affect Porcine Intramuscular Fat Content Based on Transcriptome Analysis.
Li, Bojiang; Weng, Qiannan; Dong, Chao; Zhang, Zengkai; Li, Rongyang; Liu, Jingge; Jiang, Aiwen; Li, Qifa; Jia, Chao; Wu, Wangjun; Liu, Honglin
2018-04-04
Intramuscular fat (IMF) content is an important indicator for meat quality evaluation. However, the key genes and molecular regulatory mechanisms affecting IMF deposition remain unclear. In the present study, we identified 75 differentially expressed genes (DEGs) between the higher (H) and lower (L) IMF content of pigs using transcriptome analysis, of which 27 were upregulated and 48 were downregulated. Notably, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis indicated that the DEG perilipin-1 ( PLIN1 ) was significantly enriched in the fat metabolism-related peroxisome proliferator-activated receptor (PPAR) signaling pathway. Furthermore, we determined the expression patterns and functional role of porcine PLIN1. Our results indicate that PLIN1 was highly expressed in porcine adipose tissue, and its expression level was significantly higher in the H IMF content group when compared with the L IMF content group, and expression was increased during adipocyte differentiation. Additionally, our results confirm that PLIN1 knockdown decreases the triglyceride (TG) level and lipid droplet (LD) size in porcine adipocytes. Overall, our data identify novel candidate genes affecting IMF content and provide new insight into PLIN1 in porcine IMF deposition and adipocyte differentiation.
-
A Key Gene, PLIN1, Can Affect Porcine Intramuscular Fat Content Based on Transcriptome Analysis
Directory of Open Access Journals (Sweden)
Bojiang Li
2018-04-01
Full Text Available Intramuscular fat (IMF content is an important indicator for meat quality evaluation. However, the key genes and molecular regulatory mechanisms affecting IMF deposition remain unclear. In the present study, we identified 75 differentially expressed genes (DEGs between the higher (H and lower (L IMF content of pigs using transcriptome analysis, of which 27 were upregulated and 48 were downregulated. Notably, Kyoto Encyclopedia of Genes and Genomes (KEGG enrichment analysis indicated that the DEG perilipin-1 (PLIN1 was significantly enriched in the fat metabolism-related peroxisome proliferator-activated receptor (PPAR signaling pathway. Furthermore, we determined the expression patterns and functional role of porcine PLIN1. Our results indicate that PLIN1 was highly expressed in porcine adipose tissue, and its expression level was significantly higher in the H IMF content group when compared with the L IMF content group, and expression was increased during adipocyte differentiation. Additionally, our results confirm that PLIN1 knockdown decreases the triglyceride (TG level and lipid droplet (LD size in porcine adipocytes. Overall, our data identify novel candidate genes affecting IMF content and provide new insight into PLIN1 in porcine IMF deposition and adipocyte differentiation.
-
Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng
2018-05-01
Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.
-
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
-
Developmental studies of avian brain organization.
Puelles, Luis
2018-01-01
Avian brain organization or brain Bauplan is identical with that of vertebrates in general. This essay visits avian studies that contained advances or discussions about brain organization, trying to explain critically what they contributed. In order to start from a specific background, the new prevailing paradigm as regards brain organization, the prosomeric model, is presented first. Next a brief historic survey is made of how ideas on this topic evolved from the start of modern neuromorphology at the end of the 19th century. Longitudinal zonal organization with or without transverse segmentation (neuromeres) was the first overall concept applied to the brain. The idea of neuromeric structure later decayed in favour of a columnar model. This emphasized functional correlations rather than causal developmental content, assimilating forebrain functions to hindbrain ones. Though it became prevalent in the post-world-war period of neuroscience, in the last decades of the 20th century advances in molecular biology allowed developmental genes to be mapped, and it became evident that gene expression patterns support the old neuromeric model rather than the columnar one. This was also corroborated by modern experimental approaches (fate-mapping and analysis of patterning).
-
Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth
2012-06-06
As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.
-
Rapp, Ryan A; Haigler, Candace H; Flagel, Lex; Hovav, Ran H; Udall, Joshua A; Wendel, Jonathan F
2010-11-15
Understanding the evolutionary genetics of modern crop phenotypes has a dual relevance to evolutionary biology and crop improvement. Modern upland cotton (Gossypium hirsutum L.) was developed following thousands of years of artificial selection from a wild form, G. hirsutum var. yucatanense, which bears a shorter, sparser, layer of single-celled, ovular trichomes ('fibre'). In order to gain an insight into the nature of the developmental genetic transformations that accompanied domestication and crop improvement, we studied the transcriptomes of cotton fibres from wild and domesticated accessions over a developmental time course. Fibre cells were harvested between 2 and 25 days post-anthesis and encompassed the primary and secondary wall synthesis stages. Using amplified messenger RNA and a custom microarray platform designed to interrogate expression for 40,430 genes, we determined global patterns of expression during fibre development. The fibre transcriptome of domesticated cotton is far more dynamic than that of wild cotton, with over twice as many genes being differentially expressed during development (12,626 versus 5273). Remarkably, a total of 9465 genes were diagnosed as differentially expressed between wild and domesticated fibres when summed across five key developmental time points. Human selection during the initial domestication and subsequent crop improvement has resulted in a biased upregulation of components of the transcriptional network that are important for agronomically advanced fibre, especially in the early stages of development. About 15% of the differentially expressed genes in wild versus domesticated cotton fibre have no homology to the genes in databases. We show that artificial selection during crop domestication can radically alter the transcriptional developmental network of even a single-celled structure, affecting nearly a quarter of the genes in the genome. Gene expression during fibre development within accessions and expression
-
Uddin, Raihan; Singh, Shiva M
2017-01-01
As humans age many suffer from a decrease in normal brain functions including spatial learning impairments. This study aimed to better understand the molecular mechanisms in age-associated spatial learning impairment (ASLI). We used a mathematical modeling approach implemented in Weighted Gene Co-expression Network Analysis (WGCNA) to create and compare gene network models of young (learning unimpaired) and aged (predominantly learning impaired) brains from a set of exploratory datasets in rats in the context of ASLI. The major goal was to overcome some of the limitations previously observed in the traditional meta- and pathway analysis using these data, and identify novel ASLI related genes and their networks based on co-expression relationship of genes. This analysis identified a set of network modules in the young, each of which is highly enriched with genes functioning in broad but distinct GO functional categories or biological pathways. Interestingly, the analysis pointed to a single module that was highly enriched with genes functioning in "learning and memory" related functions and pathways. Subsequent differential network analysis of this "learning and memory" module in the aged (predominantly learning impaired) rats compared to the young learning unimpaired rats allowed us to identify a set of novel ASLI candidate hub genes. Some of these genes show significant repeatability in networks generated from independent young and aged validation datasets. These hub genes are highly co-expressed with other genes in the network, which not only show differential expression but also differential co-expression and differential connectivity across age and learning impairment. The known function of these hub genes indicate that they play key roles in critical pathways, including kinase and phosphatase signaling, in functions related to various ion channels, and in maintaining neuronal integrity relating to synaptic plasticity and memory formation. Taken together, they
-
Directory of Open Access Journals (Sweden)
Brian E Eisinger
Full Text Available Coordinated gene expression changes across the CNS are required to produce the mammalian maternal phenotype. Lateral septum (LS is a brain region critically involved with aspects of maternal care, and we recently examined gene expression of whole septum (LS and medial septum in selectively bred maternal mice. Here, we expand on the prior study by 1 conducting microarray analysis solely on LS in virgin and postpartum mice, 2 using outbred mice, and 3 evaluating the role of sensory input on gene expression changes. Large scale changes in genes related to neuronal signaling were identified, including four GABAA receptor subunits. Subunits α4 and δ were downregulated in maternal LS, likely reflecting a reduction in the extrasynaptic, neurosteroid-sensitive α4/δ containing receptor subtype. Conversely, subunits ε and θ were increased in maternal LS. Fifteen K+ channel related genes showed altered expression, as did dopamine receptors Drd1a and Drd2 (both downregulated, hypocretin receptor 1 (Hcrtr1, kappa opioid receptor 1 (Oprk1, and transient receptor potential channel 4 (Trpc4. Expression of a large number of genes linked to developmental processes or cell differentiation were also altered in postpartum LS, including chemokine (C-X-C motif ligand 12 (Cxcl12, fatty acid binding protein 7 (Fabp7, plasma membrane proteolipid (Pllp, and suppressor of cytokine signaling 2 (Socs2. Additional genes that are linked to anxiety, such as glutathione reductase (Gsr, exhibited altered expression. Pathway analysis also identified changes in genes related to cyclic nucleotide metabolism, chromatin structure, and the Ras gene family. The sensory presence of pups was found to contribute to the altered expression of a subset of genes across all categories. This study suggests that both large changes in neuronal signaling and the possible terminal differentiation of neuronal and/or glial cells play important roles in producing the maternal state.
-
Directory of Open Access Journals (Sweden)
Jin-Hua Ran
Full Text Available Stomata play significant roles in plant evolution. A trio of closely related basic Helix-Loop-Helix (bHLH subgroup Ia genes, SPCH, MUTE and FAMA, mediate sequential steps of stomatal development, and their functions may be conserved in land plants. However, the evolutionary history of the putative SPCH/MUTE/FAMA genes is still greatly controversial, especially the phylogenetic positions of the bHLH Ia members from basal land plants. To better understand the evolutionary pattern and functional diversity of the bHLH genes involved in stomatal development, we made a comprehensive evolutionary analysis of the homologous genes from 54 species representing the major lineages of green plants. The phylogenetic analysis indicated: (1 All bHLH Ia genes from the two basal land plants Physcomitrella and Selaginella were closely related to the FAMA genes of seed plants; and (2 the gymnosperm 'SPCH' genes were sister to a clade comprising the angiosperm SPCH and MUTE genes, while the FAMA genes of gymnosperms and angiosperms had a sister relationship. The revealed phylogenetic relationships are also supported by the distribution of gene structures and previous functional studies. Therefore, we deduce that the function of FAMA might be ancestral in the bHLH Ia subgroup. In addition, the gymnosperm "SPCH" genes may represent an ancestral state and have a dual function of SPCH and MUTE, two genes that could have originated from a duplication event in the common ancestor of angiosperms. Moreover, in angiosperms, SPCHs have experienced more duplications and harbor more copies than MUTEs and FAMAs, which, together with variation of the stomatal development in the entry division, implies that SPCH might have contributed greatly to the diversity of stomatal development. Based on the above, we proposed a model for the correlation between the evolution of stomatal development and the genes involved in this developmental process in land plants.
-
Directory of Open Access Journals (Sweden)
Tallulah Andrews
2015-03-01
Full Text Available Readily-accessible and standardised capture of genotypic variation has revolutionised our understanding of the genetic contribution to disease. Unfortunately, the corresponding systematic capture of patient phenotypic variation needed to fully interpret the impact of genetic variation has lagged far behind. Exploiting deep and systematic phenotyping of a cohort of 197 patients presenting with heterogeneous developmental disorders and whose genomes harbour de novo CNVs, we systematically applied a range of commonly-used functional genomics approaches to identify the underlying molecular perturbations and their phenotypic impact. Grouping patients into 408 non-exclusive patient-phenotype groups, we identified a functional association amongst the genes disrupted in 209 (51% groups. We find evidence for a significant number of molecular interactions amongst the association-contributing genes, including a single highly-interconnected network disrupted in 20% of patients with intellectual disability, and show using microcephaly how these molecular networks can be used as baits to identify additional members whose genes are variant in other patients with the same phenotype. Exploiting the systematic phenotyping of this cohort, we observe phenotypic concordance amongst patients whose variant genes contribute to the same functional association but note that (i this relationship shows significant variation across the different approaches used to infer a commonly perturbed molecular pathway, and (ii that the phenotypic similarities detected amongst patients who share the same inferred pathway perturbation result from these patients sharing many distinct phenotypes, rather than sharing a more specific phenotype, inferring that these pathways are best characterized by their pleiotropic effects.
-
Andrews, Tallulah; Meader, Stephen; Vulto-van Silfhout, Anneke; Taylor, Avigail; Steinberg, Julia; Hehir-Kwa, Jayne; Pfundt, Rolph; de Leeuw, Nicole; de Vries, Bert B A; Webber, Caleb
2015-03-01
Readily-accessible and standardised capture of genotypic variation has revolutionised our understanding of the genetic contribution to disease. Unfortunately, the corresponding systematic capture of patient phenotypic variation needed to fully interpret the impact of genetic variation has lagged far behind. Exploiting deep and systematic phenotyping of a cohort of 197 patients presenting with heterogeneous developmental disorders and whose genomes harbour de novo CNVs, we systematically applied a range of commonly-used functional genomics approaches to identify the underlying molecular perturbations and their phenotypic impact. Grouping patients into 408 non-exclusive patient-phenotype groups, we identified a functional association amongst the genes disrupted in 209 (51%) groups. We find evidence for a significant number of molecular interactions amongst the association-contributing genes, including a single highly-interconnected network disrupted in 20% of patients with intellectual disability, and show using microcephaly how these molecular networks can be used as baits to identify additional members whose genes are variant in other patients with the same phenotype. Exploiting the systematic phenotyping of this cohort, we observe phenotypic concordance amongst patients whose variant genes contribute to the same functional association but note that (i) this relationship shows significant variation across the different approaches used to infer a commonly perturbed molecular pathway, and (ii) that the phenotypic similarities detected amongst patients who share the same inferred pathway perturbation result from these patients sharing many distinct phenotypes, rather than sharing a more specific phenotype, inferring that these pathways are best characterized by their pleiotropic effects.
-
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
-
Directory of Open Access Journals (Sweden)
Paulo M G Rodrigues
Full Text Available Nibrin (NBN or NBS1 and ATM are key factors for DNA Double Strand Break (DSB signaling and repair. Mutations in NBN or ATM result in Nijmegen Breakage Syndrome and Ataxia telangiectasia. These syndromes share common features such as radiosensitivity, neurological developmental defects and cancer predisposition. However, the functional synergy of Nbn and Atm in different tissues and developmental stages is not yet understood. Here, we show in vivo consequences of conditional inactivation of both genes in neural stem/progenitor cells using Nestin-Cre mice. Genetic inactivation of Atm in the central nervous system of Nbn-deficient mice led to reduced life span and increased DSBs, resulting in increased apoptosis during neural development. Surprisingly, the increase of DSBs and apoptosis was found only in few tissues including cerebellum, ganglionic eminences and lens. In sharp contrast, we showed that apoptosis associated with Nbn deletion was prevented by simultaneous inactivation of Atm in developing retina. Therefore, we propose that Nbn and Atm collaborate to prevent DSB accumulation and apoptosis during development in a tissue- and developmental stage-specific manner.
-
Directory of Open Access Journals (Sweden)
Shuming Zou
Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.
-
Screening key genes for abdominal aortic aneurysm based on gene expression omnibus dataset.
Wan, Li; Huang, Jingyong; Ni, Haizhen; Yu, Guanfeng
2018-02-13
Abdominal aortic aneurysm (AAA) is a common cardiovascular system disease with high mortality. The aim of this study was to identify potential genes for diagnosis and therapy in AAA. We searched and downloaded mRNA expression data from the Gene Expression Omnibus (GEO) database to identify differentially expressed genes (DEGs) from AAA and normal individuals. Then, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analysis, transcriptional factors (TFs) network and protein-protein interaction (PPI) network were used to explore the function of genes. Additionally, immunohistochemical (IHC) staining was used to validate the expression of identified genes. Finally, the diagnostic value of identified genes was accessed by receiver operating characteristic (ROC) analysis in GEO database. A total of 1199 DEGs (188 up-regulated and 1011 down-regulated) were identified between AAA and normal individual. KEGG pathway analysis displayed that vascular smooth muscle contraction and pathways in cancer were significantly enriched signal pathway. The top 10 up-regulated and top 10 down-regulated DEGs were used to construct TFs and PPI networks. Some genes with high degrees such as NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16 and FOXO1 were identified to be related to AAA. The consequences of IHC staining showed that CCR7 and PDGFA were up-regulated in tissue samples of AAA. ROC analysis showed that NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16, FOXO1 and PDGFA had the potential diagnostic value for AAA. The identified genes including NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16, FOXO1 and PDGFA might be involved in the pathology of AAA.
-
The High/Scope Preschool Key Experiences: Essential Elements of Young Children's Learning.
Hohmann, Mary
2002-01-01
Discusses High/Scope's preschool key experiences (a set of 58 statements that describe young children's social, cognitive, and physical development). The key experiences are grouped into 10 major developmental areas (creative representation, language and literacy, social relations, movement, music, classification, seriation, number, space, and…
-
A developmental perspective on early-life exposure to neurotoxicants.
Bellinger, David C; Matthews-Bellinger, Julia A; Kordas, Katarzyna
2016-09-01
Studies of early-life neurotoxicant exposure have not been designed, analyzed, or interpreted in the context of a fully developmental perspective. The goal of this paper is to describe the key principles of a developmental perspective and to use examples from the literature to illustrate the relevance of these principles to early-life neurotoxicant exposures. Four principles are discussed: 1) the effects of early-life neurotoxicant exposure depend on a child's developmental context; 2) deficits caused by early-life exposure initiate developmental cascades that can lead to pathologies that differ from those observed initially; 3) early-life neurotoxicant exposure has intra-familial and intergenerational impacts; 4) the impacts of early-life neurotoxicant exposure influence a child's ability to respond to future insults. The first principle is supported by considerable evidence, but the other three have received much less attention. Incorporating a developmental perspective in studies of early-life neurotoxicant exposures requires prospective collection of data on a larger array of covariates than usually considered, using analytical approaches that acknowledge the transactional processes between a child and the environment and the phenomenon of developmental cascades. Consideration of early-life neurotoxicant exposure within a developmental perspective reveals that many issues remain to be explicated if we are to achieve a deep understanding of the societal health burden associated with early-life neurotoxicant exposures. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Viviana Di Rosa
Full Text Available Fish present daily and seasonal rhythms in spawning and plasmatic levels of steroids that control reproduction. However, the existence of the rhythms of expression of the genes that underlie the endocrine mechanisms responsible for processes such as steroidogenesis and reproduction in fish have still been poorly explored to date. Here we investigated the daily pattern of the expression of key genes involved in sex steroid production that ultimately set the sex ratio in fish. Adult zebrafish were maintained under a 12:12 h light-dark cycle at a constant temperature of 27°C and were sampled every 4 h during a 24-hour cycle. The expression of key genes in the gonads and brains of female and male individuals were analyzed. In gonads, the expression of aromatase (cyp19a1a, ovarian aromatase and the antimüllerian hormone (amh, testis was rhythmic, with almost opposite acrophases: ZT 5:13 h (in the light phase and ZT 15:39 h (at night, respectively. The expression of foxl2 (forkhead box L2 was also rhythmic in the ovary (acrophase located at ZT 5:02 h and the expression of dmrt1 (doublesex and mab-3-related transcription factor 1 was rhythmic in testes (acrophase at ZT 18:36 h. In the brain, cyp19a1b (brain aromatase and cyp11b (11beta-hydroxylase presented daily differences, especially in males, where the expression peaked at night. These results provide the first evidence for marked time-of-the-day-dependent differences in the expression of the genes involved in sex ratio control, which should be considered when investigating processes such as reproduction, sex differentiation and steroidogenesis in fish.
-
Developmental Hypothyroidism Reduces the Expression of ...
Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neurotrophins are also implicated in activity-dependent plasticity, a process critical for appropriate use-dependent connectivity in the developing brain and for memory formation in the adult. This study examined activity-induced expression of neurotrophin gene products in the hippocampus using the long-term potentiation (LTP) after developmental hypothyroidism induced by propylthiouracil (PTU). Pregnant rats were exposed to PTU (0 or I0ppm) via the drinking water from early gestation to weaning. Adult male offspring were anesthetized with urethane and implanted with electrodes in the dentate gyrus (00) and perforant path (PP). LTP was induced by PP stimulation and responses from 00 were monitored at 15m intervals until sacrifice of the animals 5 h later. The 00 was dissected from the stimulated and nonstimulated hemispheres for rtPCR analysis of the neurotrophins Bdnf, Ngf, Ntf3 and related genes Egrl, Arc, Klf9. We found no PTU-induced difference in basal levels of expression of any of these genes in the nonstimulated 00. LTP increased expression of Bdnf, Ngf, Arc and Klj9 in the control DG, and reduced expression of Ntf3. LTP in DG from PTU animals failed to increase expression of Bdnf,
-
Preliminary analysis of Psoroptes ovis transcriptome in different developmental stages
Directory of Open Access Journals (Sweden)
Man-Li He
2016-11-01
Full Text Available Abstract Background Psoroptic mange is a chronic, refractory, contagious and infectious disease mainly caused by the mange mite Psoroptes ovis, which can infect horses, sheep, buffaloes, rabbits, other domestic animals, deer, wild camels, foxes, minks, lemurs, alpacas, elks and other wild animals. Features of the disease include intense pruritus and dermatitis, depilation and hyperkeratosis, which ultimately result in emaciation or death caused by secondary bacterial infections. The infestation is usually transmitted by close contact between animals. Psoroptic mange is widespread in the world. In this paper, the transcriptome of P. ovis is described following sequencing and analysis of transcripts from samples of larvae (i.e. the Pso_L group and nymphs and adults (i.e. the Pso_N_A group. The study describes differentially expressed genes (DEGs and genes encoding allergens, which help understanding the biology of P. ovis and lay foundations for the development of vaccine antigens and drug target screening. Methods The transcriptome of P. ovis was assembled and analyzed using bioinformatic tools. The unigenes of P. ovis from each developmental stage and the unigenes differentially between developmental stages were compared with allergen protein sequences contained in the allergen database website to predict potential allergens. Results We identified 38,836 unigenes, whose mean length was 825 bp. On the basis of sequence similarity with seven databases, a total of 17,366 unigenes were annotated. A total of 1,316 DEGs were identified, including 496 upregulated and 820 downregulated in the Pso_L group compared with the Pso_N_A group. We predicted 205 allergens genes in the two developmental stages similar to genes from other mites and ticks, of these, 14 were among the upregulated DEGs and 26 among the downregulated DEGs. Conclusion This study provides a reference transcriptome of P. ovis in absence of a reference genome. The analysis of DEGs and
-
Molecular analysis of an actin gene, CarACT1, from chickpea (Cicer arietinum L.).
Peng, Hui; Cheng, Huiying; Yu, Xingwang; Shi, Qinghua; Zhang, Hua; Li, Jiangui; Ma, Hao
2010-02-01
Actins are ubiquitous and highly conserved proteins that play key roles in cell formation and cellular activities. In this study, an actin gene was isolated from chickpea for the first time and designated as CarACT1 (for Cicer arietinum L. actin gene 1; Genbank accession no. EU529707). It encoded a putative protein with 377 amino acids and contained five exons and four introns within genomic DNA sequence. CarACT1 was localized in cytoplasm and showed high similarity to other well known actins from various species. Reverse transcription-polymerase chain reaction (RT-PCR) assay proved that CarACT1 transcripts were ubiquitously accumulated in all major organs, such as seedling roots, stems, leaves, flowers, young pods, and seeds, as well as in diverse developmental stages, such as leaf senescence, seed development and germination. Our results suggested that CarACT1 is an actin gene with physiological functions and may be served as a potential reference gene for transcription level of interesting genes in chickpea.
-
2015-01-01
Background Selection of the best oocyte for subsequent steps of fertilization and embryo transfer was shown to be the crucial step in human infertility treatment procedure. Oocyte selection using morphological criteria mainly Zona pellucida (ZP) has been the gold standard method in assisted reproductive technologies (ART) clinics, but this selection approach has limitations in terms of accuracy, objectivity and constancy. Recent studies using OMICs-based approaches have allowed the identification of key molecular markers that quantitatively and non-invasively predict the oocyte quality for higher pregnancy rates and efficient infertility treatment. These biomarkers are a valuable reinforcement of the morphological selection criteria widely used in in vitro fertilization (IVF) clinics. In this context, this study was designed to investigate the relationship between transcriptomic predictors of oocyte quality found by our group and the conventional morphological parameters of oocyte quality mainly the ZP birefringence. Results Microarray data revealed that 48 and 27 differentially expressed candidate genes in cumulus cells (CCs) were respectively overexpressed and underexpressed in the ZGP (Zona Good Pregnant) versus ZBNP (Zona Bad Non Pregnant) groups. More than 70% of previously reported transcriptomic biomarkers of oocyte developmental competence were confirmed in this study. The analysis of possible association between ZP birefringence versus molecular markers approach showed an absence of correlation between them using the current set of markers. Conclusions This study suggested a new integrative approach that matches morphological and molecular approaches used to select developmentally competent oocytes able to lead to successful pregnancy and the delivery of healthy baby. For each ZP birefringence score, oocytes displayed a particular CCs' gene expression pattern. However, no correlations were found between the 7 gene biomarkers of oocyte developmental
-
Developmentally regulated expression of reporter gene in adult ...
Indian Academy of Sciences (India)
pression of reporter gene in adult brain specific GAL4 enhancer traps of. Drosophila ... genes based on their expression pattern, thus enabling us to overcome the ... order association and storage centres of olfactory learning and memory, and ...
-
DEFF Research Database (Denmark)
Humblot, P; Holm, Peter; Lonergan, P
2005-01-01
. Follicular characteristics were measured and oocyte quality was assessed by morphology, mRNA expression of eight marker genes or developmental ability after in vitro/in vivo maturation and subsequent in vitro fertilization and culture. Approaching ovulation, expected increases in follicular size and cumulus...... expansion suggested progression of oocyte maturation. No differences were found in the expression patterns of analyzed genes, except for heat-shock-protein (Hsp) that was lower in in vivo matured oocytes collected shortly before ovulation. Oocytes collected at this time also had higher developmental ability...... measured as blastocyst rates (57.6 after in vitro production while no differences were found between oocytes recovered earlier at the first three time points (39.3-41.5. We conclude that oocytes recovered late in the preovulatory period are more developmentally competent than oocytes recovered at the pre...
-
Mascheretti, S; De Luca, A; Trezzi, V; Peruzzo, D; Nordio, A; Marino, C; Arrigoni, F
2017-01-01
Developmental dyslexia (DD) is a complex neurodevelopmental deficit characterized by impaired reading acquisition, in spite of adequate neurological and sensorial conditions, educational opportunities and normal intelligence. Despite the successful characterization of DD-susceptibility genes, we are far from understanding the molecular etiological pathways underlying the development of reading (dis)ability. By focusing mainly on clinical phenotypes, the molecular genetics approach has yielded mixed results. More optimally reduced measures of functioning, that is, intermediate phenotypes (IPs), represent a target for researching disease-associated genetic variants and for elucidating the underlying mechanisms. Imaging data provide a viable IP for complex neurobehavioral disorders and have been extensively used to investigate both morphological, structural and functional brain abnormalities in DD. Performing joint genetic and neuroimaging studies in humans is an emerging strategy to link DD-candidate genes to the brain structure and function. A limited number of studies has already pursued the imaging–genetics integration in DD. However, the results are still not sufficient to unravel the complexity of the reading circuit due to heterogeneous study design and data processing. Here, we propose an interdisciplinary, multilevel, imaging–genetic approach to disentangle the pathways from genes to behavior. As the presence of putative functional genetic variants has been provided and as genetic associations with specific cognitive/sensorial mechanisms have been reported, new hypothesis-driven imaging–genetic studies must gain momentum. This approach would lead to the optimization of diagnostic criteria and to the early identification of ‘biologically at-risk’ children, supporting the definition of adequate and well-timed prevention strategies and the implementation of novel, specific remediation approach. PMID:28045463
-
Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library
Directory of Open Access Journals (Sweden)
Eddy Edward M
2007-07-01
Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.
-
Transcriptome analysis elucidates key developmental components of bryozoan lophophore development
Wong, Yue Him; Ryu, Tae Woo; Ghosheh, Yanal; Qian, Pei-Yuan; Seridi, Loqmane; Bougouffa, Salim; Ravasi, Timothy
2014-01-01
metamorphosis. In situ hybridization of 23 genes that participate in the Wnt, BMP, Notch, and Hedgehog signaling pathways revealed their regulatory roles in the development of the lophophore and the ancestrula digestive tract. Our findings support the hypothesis
-
Ye, Lingzhen; Huang, Yuqing; Dai, Fei; Ning, Huajiang; Li, Chengdao; Zhou, Meixue; Zhang, Guoping
2015-06-11
In bright beer, haze formation is a serious quality problem, degrading beer quality and reducing its shelf life. The quality of barley (Hordeum vulgare L) malt, as the main raw material for beer brewing, largely affects the colloidal stability of beer. In this study, the genetic mechanism of the factors affecting beer haze stability in barley was studied. Quantitative trait loci (QTL) analysis of alcohol chill haze (ACH) in beer was carried out using a Franklin/Yerong double haploid (DH) population. One QTL, named as qACH, was detected for ACH, and it was located on the position of about 108 cM in chromosome 4H and can explain about 20 % of the phenotypic variation. Two key haze active proteins, BATI-CMb and BATI-CMd were identified by proteomics analysis. Bioinformatics analysis showed that BATI-CMb and BATI-CMd had the same position as qACH in the chromosome. It may be deduced that BATI-CMb and BATI-CMd are candidate genes for qACH, controlling colloidal stability of beer. Polymorphism comparison between Yerong and Franklin in the nucleotide and amino acid sequence of BATI-CMb and BATI-CMd detected the corresponding gene specific markers, which could be used in marker-assisted selection for malt barley breeding. We identified a novel QTL, qACH controlling chill haze of beer, and two key haze active proteins, BATI-CMb and BATI-CMd. And further analysis showed that BATI-CMb and BATI-CMd might be the candidate genes associated with beer chill haze.
-
Directory of Open Access Journals (Sweden)
Ruby Chandna
Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.
-
DEFF Research Database (Denmark)
List, Markus; Alcaraz, Nicolas; Dissing-Hansen, Martin
2016-01-01
, for instance), KeyPathwayMiner extracts connected sub-networks containing a high number of active or differentially regulated genes (proteins, metabolites) in the molecular profiles. The web interface at (http://keypathwayminer.compbio.sdu.dk) implements all core functionalities of the KeyPathwayMiner tool set......We present KeyPathwayMinerWeb, the first online platform for de novo pathway enrichment analysis directly in the browser. Given a biological interaction network (e.g. protein-protein interactions) and a series of molecular profiles derived from one or multiple OMICS studies (gene expression...... such as data integration, input of background knowledge, batch runs for parameter optimization and visualization of extracted pathways. In addition to an intuitive web interface, we also implemented a RESTful API that now enables other online developers to integrate network enrichment as a web service...
-
KIAA0319 gene polymorphisms are associated with developmental dyslexia in Chinese Uyghur children
Zhao, Hua; Chen, Yun; Zhang, Bao-ping; Zuo, Peng-xiang
2016-01-01
The gene KIAA0319 has been reported to be associated with developmental dyslexia (DD) in previous studies, although the results have not always been consistent. However, few studies have been conducted in Uyghur populations. In the present study, we aimed to investigate the association of KIAA0319 polymorphisms and DD in individuals of Uyghurian descent. We used a custom-by-design 48-Plex SNPscan Kit to genotype 18 single-nucleotide polymorphisms (SNPs) of KIAA0319 in a group of 196 children with dyslexia and 196 controls of Uyghur descent aged 8–12 years. As a result, 7 SNPs (Pmin=0.001) of KIAA0319 had nominal significant differences between the cases and controls under specific genotypic models. The two SNPs rs6935076 (P=0.020 under dominant model; P=0.028 under additive model) and rs3756821 (P=0.021 under additive model) remained significantly associated with dyslexia after Bonferroni correction. Linkage disequilibrium analysis showed three blocks within KIAA0319, and only a 10-SNP haplotype in block 3 was present at significantly different frequencies in the dyslexic children and controls. This study indicated that genetic polymorphisms of KIAA0319 are associated with an increased risk of DD in the Uyghur population. PMID:27098879
-
Convergent occurrence of the developmental hourglass in plant and animal embryogenesis?
Cridge, Andrew G; Dearden, Peter K; Brownfield, Lynette R
2016-04-01
The remarkable similarity of animal embryos at particular stages of development led to the proposal of a developmental hourglass. In this model, early events in development are less conserved across species but lead to a highly conserved 'phylotypic period'. Beyond this stage, the model suggests that development once again becomes less conserved, leading to the diversity of forms. Recent comparative studies of gene expression in animal groups have provided strong support for the hourglass model. How and why might such an hourglass pattern be generated? More importantly, how might early acting events in development evolve while still maintaining a later conserved stage? The discovery that an hourglass pattern may also exist in the embryogenesis of plants provides comparative data that may help us explain this phenomenon. Whether the developmental hourglass occurs in plants, and what this means for our understanding of embryogenesis in plants and animals is discussed. Models by which conserved early-acting genes might change their functional role in the evolution of gene networks, how networks buffer these changes, and how that might constrain, or confer diversity, of the body plan are also discused. Evidence of a morphological and molecular hourglass in plant and animal embryogenesis suggests convergent evolution. This convergence is likely due to developmental constraints imposed upon embryogenesis by the need to produce a viable embryo with an established body plan, controlled by the architecture of the underlying gene regulatory networks. As the body plan is largely laid down during the middle phases of embryo development in plants and animals, then it is perhaps not surprising this stage represents the narrow waist of the hourglass where the gene regulatory networks are the oldest and most robust and integrated, limiting species diversity and constraining morphological space. © The Author 2016. Published by Oxford University Press on behalf of the Annals of
-
Attachment in Middle Childhood: An Evolutionary-Developmental Perspective
Del Giudice, Marco
2015-01-01
Middle childhood is a key transitional stage in the development of attachment processes and representations. Here I discuss the middle childhood transition from an evolutionary-developmental perspective and show how this approach offers fresh insight into the function and organization of attachment in this life stage. I begin by presenting an…
-
Directory of Open Access Journals (Sweden)
Biao Lai
Full Text Available The red coloration of litchi fruit depends on the accumulation of anthocyanins. The anthocyanins level in litchi fruit varies widely among cultivars, developmental stages and environmental stimuli. Previous studies on various plant species demonstrate that anthocyanin biosynthesis is controlled at the transcriptional level. Here, we describe a litchi R2R3-MYB transcription factor gene, LcMYB1, which demonstrates a similar sequence as other known anthocyanin regulators. The transcription levels of the LcMYB1 and anthocyanin biosynthetic genes were investigated in samples with different anthocyanin levels. The expression of LcMYB1 was strongly associated with tissue anthocyanin content. LcMYB1 transcripts were only detected in anthocyanin-accumulating tissues and were positively correlated with anthocyanin accumulation in the pericarps of 12 genotypes. ABA and sunlight exposure promoted, whereas CPPU and bagging inhibited the expression of LcMYB1 and anthocyanin accumulation in the pericarp. Cis-elements associated with light responsiveness and abscisic acid responsiveness were identified in the promoter region of LcMYB1. Among the 6 structural genes tested, only LcUFGT was highly correlated with LcMYB1. These results suggest that LcMYB1 controls anthocyanin biosynthesis in litchi and LcUFGT might be the structural gene that is targeted and regulated by LcMYB1. Furthermore, the overexpression of LcMYB1 induced anthocyanin accumulation in all tissues in tobacco, confirming the function of LcMYB1 in the regulation of anthocyanin biosynthesis. The upregulation of NtAn1b in response to LcMYB1 overexpression seems to be essential for anthocyanin accumulation in the leaf and pedicel. In the reproductive tissues of transgenic tobacco, however, increased anthocyanin accumulation is independent of tobacco's endogenous MYB and bHLH transcriptional factors, but associated with the upregulation of specific structural genes.
-
Lai, Biao; Li, Xiao-Jing; Hu, Bing; Qin, Yong-Hua; Huang, Xu-Ming; Wang, Hui-Cong; Hu, Gui-Bing
2014-01-01
The red coloration of litchi fruit depends on the accumulation of anthocyanins. The anthocyanins level in litchi fruit varies widely among cultivars, developmental stages and environmental stimuli. Previous studies on various plant species demonstrate that anthocyanin biosynthesis is controlled at the transcriptional level. Here, we describe a litchi R2R3-MYB transcription factor gene, LcMYB1, which demonstrates a similar sequence as other known anthocyanin regulators. The transcription levels of the LcMYB1 and anthocyanin biosynthetic genes were investigated in samples with different anthocyanin levels. The expression of LcMYB1 was strongly associated with tissue anthocyanin content. LcMYB1 transcripts were only detected in anthocyanin-accumulating tissues and were positively correlated with anthocyanin accumulation in the pericarps of 12 genotypes. ABA and sunlight exposure promoted, whereas CPPU and bagging inhibited the expression of LcMYB1 and anthocyanin accumulation in the pericarp. Cis-elements associated with light responsiveness and abscisic acid responsiveness were identified in the promoter region of LcMYB1. Among the 6 structural genes tested, only LcUFGT was highly correlated with LcMYB1. These results suggest that LcMYB1 controls anthocyanin biosynthesis in litchi and LcUFGT might be the structural gene that is targeted and regulated by LcMYB1. Furthermore, the overexpression of LcMYB1 induced anthocyanin accumulation in all tissues in tobacco, confirming the function of LcMYB1 in the regulation of anthocyanin biosynthesis. The upregulation of NtAn1b in response to LcMYB1 overexpression seems to be essential for anthocyanin accumulation in the leaf and pedicel. In the reproductive tissues of transgenic tobacco, however, increased anthocyanin accumulation is independent of tobacco's endogenous MYB and bHLH transcriptional factors, but associated with the upregulation of specific structural genes.
-
International Nuclear Information System (INIS)
Casula, Milena; Sini, MariaCristina; Palomba, Grazia; The Italian Melanoma Intergroup; Palmieri, Giuseppe; Muggiano, Antonio; Cossu, Antonio; Budroni, Mario; Caracò, Corrado; Ascierto, Paolo A; Pagani, Elena; Stanganelli, Ignazio; Canzanella, Sergio
2009-01-01
Several genetic alterations have been demonstrated to contribute to the development and progression of melanoma. In this study, we further investigated the impact of key-regulator genes in susceptibility and pathogenesis of such a disease. A large series (N = 846) of sporadic and familial cases originating from South Italy was screened for germline mutations in p16 CDKN2A , BRCA2, and MC1R genes by DHPLC analysis and automated DNA sequencing. Paired primary melanomas and lymph node metastases from same patients (N = 35) as well as melanoma cell lines (N = 18) were analyzed for somatic mutations in NRAS, BRAF, and p16 CDKN2A genes. For melanoma susceptibility, investigations at germline level indicated that p16 CDKN2A was exclusively mutated in 16/545 (2.9%) non-Sardinian patients, whereas BRCA2 germline mutations were observed in 4/91 (4.4%) patients from North Sardinia only. Two MC1R germline variants, Arg151Cys and Asp294His, were significantly associated with melanoma in Sardinia. Regarding genetic events involved in melanoma pathogenesis at somatic level, mutually-exclusive mutations of NRAS and BRAF genes were observed at quite same rate (about two thirds) in cultured and in vivo melanomas (either primary or metastatic lesions). Conversely, p16 CDKN2A gene alterations were observed at increased rates moving from primary to metastatic melanomas and melanoma cell lines. Activation of the ERK gene product was demonstrated to be consistently induced by a combination of molecular alterations (NRAS/BRAF mutations and p16 CDKN2A silencing). Our findings further clarified that: a) mutation prevalence in melanoma susceptibility genes may vary within each specific geographical area; b) multiple molecular events are accumulating during melanomagenesis
-
Directory of Open Access Journals (Sweden)
Qiusheng Kong
Full Text Available Gene expression analysis in watermelon (Citrullus lanatus fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC, β-actin (ClACT, and alpha tubulin 5 (ClTUA5 as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1, a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.
-
Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Zhao, Liqiang; Cheng, Fei; Huang, Yuan; Bie, Zhilong
2015-01-01
Gene expression analysis in watermelon (Citrullus lanatus) fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR) is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC), β-actin (ClACT), and alpha tubulin 5 (ClTUA5) as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND) was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1), a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.
-
Gao, Lijie; Wang, Yunqi; Li, Yi; Dong, Ya; Yang, Aimin; Zhang, Jie; Li, Fengying; Zhang, Rongqiang
2018-07-01
Comprehensive bioinformatics analyses were performed to explore the key biomarkers in response to HIV infection of CD4 + and CD8 + T cells. The numbers of CD4 + and CD8 + T cells of HIV infected individuals were analyzed and the GEO database (GSE6740) was screened for differentially expressed genes (DEGs) in HIV infected CD4 + and CD8 + T cells. Gene Ontology enrichment, KEGG pathway analyses, and protein-protein interaction (PPI) network were performed to identify the key pathway and core proteins in anti-HIV virus process of CD4 + and CD8 + T cells. Finally, we analyzed the expressions of key proteins in HIV-infected T cells (GSE6740 dataset) and peripheral blood mononuclear cells(PBMCs) (GSE511 dataset). 1) CD4 + T cells counts and ratio of CD4 + /CD8 + T cells decreased while CD8 + T cells counts increased in HIV positive individuals; 2) 517 DEGs were found in HIV infected CD4 + and CD8 + T cells at acute and chronic stage with the criterial of P-value T cells. The main biological processes of the DEGs were response to virus and defense response to virus. At chronic stage, ISG15 protein, in conjunction with IFN-1 pathway might play key roles in anti-HIV responses of CD4 + T cells; and 4) The expression of ISG15 increased in both T cells and PBMCs after HIV infection. Gene expression profile of CD4 + and CD8 + T cells changed significantly in HIV infection, in which ISG15 gene may play a central role in activating the natural antiviral process of immune cells. © 2018 Wiley Periodicals, Inc.
-
Colaprico, Antonio; Bontempi, Gianluca; Castiglioni, Isabella
2018-01-01
Like other cancer diseases, prostate cancer (PC) is caused by the accumulation of genetic alterations in the cells that drives malignant growth. These alterations are revealed by gene profiling and copy number alteration (CNA) analysis. Moreover, recent evidence suggests that also microRNAs have an important role in PC development. Despite efforts to profile PC, the alterations (gene, CNA, and miRNA) and biological processes that correlate with disease development and progression remain partially elusive. Many gene signatures proposed as diagnostic or prognostic tools in cancer poorly overlap. The identification of co-expressed genes, that are functionally related, can identify a core network of genes associated with PC with a better reproducibility. By combining different approaches, including the integration of mRNA expression profiles, CNAs, and miRNA expression levels, we identified a gene signature of four genes overlapping with other published gene signatures and able to distinguish, in silico, high Gleason-scored PC from normal human tissue, which was further enriched to 19 genes by gene co-expression analysis. From the analysis of miRNAs possibly regulating this network, we found that hsa-miR-153 was highly connected to the genes in the network. Our results identify a four-gene signature with diagnostic and prognostic value in PC and suggest an interesting gene network that could play a key regulatory role in PC development and progression. Furthermore, hsa-miR-153, controlling this network, could be a potential biomarker for theranostics in high Gleason-scored PC. PMID:29562723
-
Developmental control of hypoxia during bud burst in grapevine.
Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J
2018-05-01
Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.
-
Liu, Feiling; Guo, Dianhao; Yuan, Zhuting; Chen, Chen; Xiao, Huamei
2017-11-20
Long non-coding RNA (lncRNA) is a class of noncoding RNA >200 bp in length that has essential roles in regulating a variety of biological processes. Here, we constructed a computational pipeline to identify lncRNA genes in the diamondback moth (Plutella xylostella), a major insect pest of cruciferous vegetables. In total, 3,324 lncRNAs corresponding to 2,475 loci were identified from 13 RNA-Seq datasets, including samples from parasitized, insecticide-resistant strains and different developmental stages. The identified P. xylostella lncRNAs had shorter transcripts and fewer exons than protein-coding genes. Seven out of nine randomly selected lncRNAs were validated by strand-specific RT-PCR. In total, 54-172 lncRNAs were specifically expressed in the insecticide resistant strains, among which one lncRNA was located adjacent to the sodium channel gene. In addition, 63-135 lncRNAs were specifically expressed in different developmental stages, among which three lncRNAs overlapped or were located adjacent to the metamorphosis-associated genes. These lncRNAs were either strongly or weakly co-expressed with their overlapping or neighboring mRNA genes. In summary, we identified thousands of lncRNAs and presented evidence that lncRNAs might have key roles in conferring insecticide resistance and regulating the metamorphosis development in P. xylostella.
-
Directory of Open Access Journals (Sweden)
Gaora Peadar Ó
2010-10-01
Full Text Available Abstract Background Currently, a number of bioinformatics methods are available to generate appropriate lists of genes from a microarray experiment. While these lists represent an accurate primary analysis of the data, fewer options exist to contextualise those lists. The development and validation of such methods is crucial to the wider application of microarray technology in the clinical setting. Two key challenges in clinical bioinformatics involve appropriate statistical modelling of dynamic transcriptomic changes, and extraction of clinically relevant meaning from very large datasets. Results Here, we apply an approach to gene set enrichment analysis that allows for detection of bi-directional enrichment within a gene set. Furthermore, we apply canonical correlation analysis and Fisher's exact test, using plasma marker data with known clinical relevance to aid identification of the most important gene and pathway changes in our transcriptomic dataset. After a 28-day dietary intervention with high-CLA beef, a range of plasma markers indicated a marked improvement in the metabolic health of genetically obese mice. Tissue transcriptomic profiles indicated that the effects were most dramatic in liver (1270 genes significantly changed; p Conclusion Bi-directional gene set enrichment analysis more accurately reflects dynamic regulatory behaviour in biochemical pathways, and as such highlighted biologically relevant changes that were not detected using a traditional approach. In such cases where transcriptomic response to treatment is exceptionally large, canonical correlation analysis in conjunction with Fisher's exact test highlights the subset of pathways showing strongest correlation with the clinical markers of interest. In this case, we have identified selenoamino acid metabolism and steroid biosynthesis as key pathways mediating the observed relationship between metabolic health and high-CLA beef. These results indicate that this type of
-
Developmental Plasticity in Child Growth and Maturation
Directory of Open Access Journals (Sweden)
Ze'ev eHochberg
2011-09-01
Full Text Available The ability of a given genotype to produce different phenotypes in response to different environments is termed "plasticity", and is part of the organism's "adaptability" to environmental cues. The expressions of suites of genes, particularly during development or life-history transitions, probably underlie the fundamental plasticity of an organism. Plasticity in developmental programming has evolved in order to provide the best chances of survival and reproductive success to organisms under changing environments. Environmental conditions that are experienced in early life can profoundly influence human biology, child growth and maturation, and long-term health and longevity. Developmental origins of health and disease and life history transitions are purported to use placental, nutritional, and endocrine cues for setting long-term biological, mental, and behavioral strategies for child growth and maturation in response to local ecological and/or social conditions. The window of developmental plasticity extends from conception to early childhood, and even beyond to the transition from juvenility to adoelscence, and could be transmitted transgenerationally. It involves epigenetic responses to environmental changes, which exert their effects during life history phase-transitions.
-
P63 gene mutations and human developmental syndromes.
Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van
2002-01-01
The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the
-
Peng, Hui; Cheng, Hui-Ying; Yu, Xin-Wang; Shi, Qing-Hua; Zhang, Hua; Li, Jian-Gui; Ma, Hao
2009-01-01
It has been documented that the plant-specific NAC (for NAM, ATAF1,2 and CUC2) transcription factors play an important role in plant development and stress responses. In this study, a chickpea NAC gene CarNAC5 (for Cicer arietinum L. NAC gene 5) was isolated from a cDNA library from chickpea leaves treated by polyethylene glycol (PEG). CarNAC5, as a single/low copy gene, contained three exons and two introns within genomic DNA sequence and encoded a polypeptide with 291 amino acids. CarNAC5 protein had a conserved NAC domain in the N-terminus and showed high similarity to other NACs, especially ATAF subgroup members. The CarNAC5:GFP fusion protein was localized in the nucleus of onion epidermal cells. Furthermore, CarNAC5 protein activated the reporter genes LacZ and HIS3 in yeast. The transactivation activity was mapped to the C-terminal region. The transcripts of CarNAC5 appeared in many chickpea tissues including seedling leaves, stems, roots, flowers, seeds and pods, but mostly accumulated in flowers. Meanwhile, CarNAC5 was strongly expressed during seed maturation and in embryos of the early germinating seeds. It was also significantly induced by drought, heat, wounding, salicylic acid (SA), and indole-3-acetic acid (IAA) treatments. Our results suggest that CarNAC5 encodes a novel NAC-domain protein and acts as a transcriptional activator involved in plant developmental regulation and various stress responses.
-
Novel interactions between vertebrate Hox genes
Hooiveld, MHW; Morgan, R; Rieden, PID; Houtzager, E; Pannese, M; Damen, K; Boncinelli, E; Durston, AJ
1999-01-01
Understanding why metazoan Hox/HOM-C genes are expressed in spatiotemporal sequences showing colinearity with their genomic sequence is a central challenge in developmental biology. Here, we studied the consequences of ectopically expressing Hox genes to investigate whether Hox-Hox interactions
-
Hoelting, Lisa; Scheinhardt, Benjamin; Bondarenko, Olesja; Schildknecht, Stefan; Kapitza, Marion; Tanavde, Vivek; Tan, Betty; Lee, Qian Yi; Mecking, Stefan; Leist, Marcel; Kadereit, Suzanne
2013-04-01
Nanoparticles (NPs) have been shown to accumulate in organs, cross the blood-brain barrier and placenta, and have the potential to elicit developmental neurotoxicity (DNT). Here, we developed a human embryonic stem cell (hESC)-derived 3-dimensional (3-D) in vitro model that allows for testing of potential developmental neurotoxicants. Early central nervous system PAX6(+) precursor cells were generated from hESCs and differentiated further within 3-D structures. The 3-D model was characterized for neural marker expression revealing robust differentiation toward neuronal precursor cells, and gene expression profiling suggested a predominantly forebrain-like development. Altered neural gene expression due to exposure to non-cytotoxic concentrations of the known developmental neurotoxicant, methylmercury, indicated that the 3-D model could detect DNT. To test for specific toxicity of NPs, chemically inert polyethylene NPs (PE-NPs) were chosen. They penetrated deep into the 3-D structures and impacted gene expression at non-cytotoxic concentrations. NOTCH pathway genes such as HES5 and NOTCH1 were reduced in expression, as well as downstream neuronal precursor genes such as NEUROD1 and ASCL1. FOXG1, a patterning marker, was also reduced. As loss of function of these genes results in severe nervous system impairments in mice, our data suggest that the 3-D hESC-derived model could be used to test for Nano-DNT.
-
Chen, Jingchao; Huang, Zhaofeng; Huang, Hongjuan; Wei, Shouhui; Liu, Yan; Jiang, Cuilan; Zhang, Jie; Zhang, Chaoxian
2017-04-21
Goosegrass (Eleusine indica) is one of the most serious annual grassy weeds worldwide, and its evolved herbicide-resistant populations are more difficult to control. Quantitative real-time PCR (qPCR) is a common technique for investigating the resistance mechanism; however, there is as yet no report on the systematic selection of stable reference genes for goosegrass. This study proposed to test the expression stability of 9 candidate reference genes in goosegrass in different tissues and developmental stages and under stress from three types of herbicide. The results show that for different developmental stages and organs (control), eukaryotic initiation factor 4 A (eIF-4) is the most stable reference gene. Chloroplast acetolactate synthase (ALS) is the most stable reference gene under glyphosate stress. Under glufosinate stress, eIF-4 is the best reference gene. Ubiquitin-conjugating enzyme (UCE) is the most stable reference gene under quizalofop-p-ethyl stress. The gene eIF-4 is the recommended reference gene for goosegrass under the stress of all three herbicides. Moreover, pairwise analysis showed that seven reference genes were sufficient to normalize the gene expression data under three herbicides treatment. This study provides a list of reliable reference genes for transcript normalization in goosegrass, which will facilitate resistance mechanism studies in this weed species.
-
Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.
Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad
2018-02-01
The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.
-
Constructivist developmental theory is needed in developmental neuroscience
Arsalidou, Marie; Pascual-Leone, Juan
2016-12-01
Neuroscience techniques provide an open window previously unavailable to the origin of thoughts and actions in children. Developmental cognitive neuroscience is booming, and knowledge from human brain mapping is finding its way into education and pediatric practice. Promises of application in developmental cognitive neuroscience rests however on better theory-guided data interpretation. Massive amounts of neuroimaging data from children are being processed, yet published studies often do not frame their work within developmental models—in detriment, we believe, to progress in this field. Here we describe some core challenges in interpreting the data from developmental cognitive neuroscience, and advocate the use of constructivist developmental theories of human cognition with a neuroscience interpretation.
-
Directory of Open Access Journals (Sweden)
Tiziano Pramparo
2011-03-01
Full Text Available Heterozygous LIS1 mutations are the most common cause of human lissencephaly, a human neuronal migration defect, and DCX mutations are the most common cause of X-linked lissencephaly. LIS1 is part of a protein complex including NDEL1 and 14-3-3ε that regulates dynein motor function and microtubule dynamics, while DCX stabilizes microtubules and cooperates with LIS1 during neuronal migration and neurogenesis. Targeted gene mutations of Lis1, Dcx, Ywhae (coding for 14-3-3ε, and Ndel1 lead to neuronal migration defects in mouse and provide models of human lissencephaly, as well as aid the study of related neuro-developmental diseases. Here we investigated the developing brain of these four mutants and wild-type mice using expression microarrays, bioinformatic analyses, and in vivo/in vitro experiments to address whether mutations in different members of the LIS1 neuronal migration complex lead to similar and/or distinct global gene expression alterations. Consistent with the overall successful development of the mutant brains, unsupervised clustering and co-expression analysis suggested that cell cycle and synaptogenesis genes are similarly expressed and co-regulated in WT and mutant brains in a time-dependent fashion. By contrast, focused co-expression analysis in the Lis1 and Ndel1 mutants uncovered substantial differences in the correlation among pathways. Differential expression analysis revealed that cell cycle, cell adhesion, and cytoskeleton organization pathways are commonly altered in all mutants, while synaptogenesis, cell morphology, and inflammation/immune response are specifically altered in one or more mutants. We found several commonly dysregulated genes located within pathogenic deletion/duplication regions, which represent novel candidates of human mental retardation and neurocognitive disabilities. Our analysis suggests that gene expression and pathway analysis in mouse models of a similar disorder or within a common pathway can
-
Key gene regulating cell wall biosynthesis and recalcitrance in Populus, gene Y
Chen, Jay; Engle, Nancy; Gunter, Lee E.; Jawdy, Sara; Tschaplinski, Timothy J.; Tuskan, Gerald A.
2015-12-08
This disclosure provides methods and transgenic plants for improved production of renewable biofuels and other plant-derived biomaterials by altering the expression and/or activity of Gene Y, an O-acetyltransferase. This disclosure also provides expression vectors containing a nucleic acid (Gene Y) which encodes the polypeptide of SEQ ID NO: 1 and is operably linked to a heterologous promoter.
-
Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun
2017-11-01
Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Lina Sun
Full Text Available BACKGROUND: Sea cucumbers (Holothuroidea; Echinodermata have the capacity to regenerate lost tissues and organs. Although the histological and cytological aspects of intestine regeneration have been extensively studied, little is known of the genetic mechanisms involved. There has, however, been a renewed effort to develop a database of Expressed Sequence Tags (ESTs in Apostichopus japonicus, an economically-important species that occurs in China. This is important for studies on genetic breeding, molecular markers and special physiological phenomena. We have also constructed a library of ESTs obtained from the regenerative body wall and intestine of A. japonicus. The database has increased to ~30000 ESTs. RESULTS: We used RNA-Seq to determine gene expression profiles associated with intestinal regeneration in A. japonicus at 3, 7, 14 and 21 days post evisceration (dpe. This was compared to profiles obtained from a normally-functioning intestine. Approximately 5 million (M reads were sequenced in every library. Over 2400 up-regulated genes (>10% and over 1000 down-regulated genes (~5% were observed at 3 and 7dpe (log2Ratio ≥ 1, FDR ≤ 0.001. Specific "Go terms" revealed that the DEGs (Differentially Expressed Genes performed an important function at every regeneration stage. Besides some expected pathways (for example, Ribosome and Spliceosome pathway term, the "Notch signaling pathway," the "ECM-receptor interaction" and the "Cytokine-cytokine receptor interaction" were significantly enriched. We also investigated the expression profiles of developmental genes, ECM-associated genes and Cytoskeletal genes. Twenty of the most important differentially expressed genes (DEGs were verified by Real-time PCR, which resulted in a trend concordance of almost 100% between the two techniques. CONCLUSION: Our studies demonstrated dynamic changes in global gene expression during intestine regeneration and presented a series of candidate genes and enriched
-
Developmental Programming of Adult Disease: Reprogramming by Melatonin?
Directory of Open Access Journals (Sweden)
You-Lin Tain
2017-02-01
Full Text Available Adult-onset chronic non-communicable diseases (NCDs can originate from early life through so-called the “developmental origins of health and disease” (DOHaD or “developmental programming”. The DOHaD concept offers the “reprogramming” strategy to shift the treatment from adulthood to early life, before clinical disease is apparent. Melatonin, an endogenous indoleamine produced by the pineal gland, has pleiotropic bioactivities those are beneficial in a variety of human diseases. Emerging evidence support that melatonin is closely inter-related to other proposed mechanisms contributing to the developmental programming of a variety of chronic NCDs. Recent animal studies have begun to unravel the multifunctional roles of melatonin in many experimental models of developmental programming. Even though some progress has been made in research on melatonin as a reprogramming strategy to prevent DOHaD-related NCDs, future human studies should aim at filling the translational gap between animal models and clinical trials. Here, we review several key themes on the reprogramming effects of melatonin in DOHaD research. We have particularly focused on the following areas: mechanisms of developmental programming; the interrelationship between melatonin and mechanisms underlying developmental programming; pathophysiological roles of melatonin in pregnancy and fetal development; and insight provided by animal models to support melatonin as a reprogramming therapy. Rates of NCDs are increasing faster than anticipated all over the world. Hence, there is an urgent need to understand reprogramming mechanisms of melatonin and to translate experimental research into clinical practice for halting a growing list of DOHaD-related NCDs.
-
Developmental Programming of Adult Disease: Reprogramming by Melatonin?
Tain, You-Lin; Huang, Li-Tung; Hsu, Chien-Ning
2017-02-16
Adult-onset chronic non-communicable diseases (NCDs) can originate from early life through so-called the "developmental origins of health and disease" (DOHaD) or "developmental programming". The DOHaD concept offers the "reprogramming" strategy to shift the treatment from adulthood to early life, before clinical disease is apparent. Melatonin, an endogenous indoleamine produced by the pineal gland, has pleiotropic bioactivities those are beneficial in a variety of human diseases. Emerging evidence support that melatonin is closely inter-related to other proposed mechanisms contributing to the developmental programming of a variety of chronic NCDs. Recent animal studies have begun to unravel the multifunctional roles of melatonin in many experimental models of developmental programming. Even though some progress has been made in research on melatonin as a reprogramming strategy to prevent DOHaD-related NCDs, future human studies should aim at filling the translational gap between animal models and clinical trials. Here, we review several key themes on the reprogramming effects of melatonin in DOHaD research. We have particularly focused on the following areas: mechanisms of developmental programming; the interrelationship between melatonin and mechanisms underlying developmental programming; pathophysiological roles of melatonin in pregnancy and fetal development; and insight provided by animal models to support melatonin as a reprogramming therapy. Rates of NCDs are increasing faster than anticipated all over the world. Hence, there is an urgent need to understand reprogramming mechanisms of melatonin and to translate experimental research into clinical practice for halting a growing list of DOHaD-related NCDs.
-
Identification of Key Pathways and Genes in the Dynamic Progression of HCC Based on WGCNA.
Yin, Li; Cai, Zhihui; Zhu, Baoan; Xu, Cunshuan
2018-02-14
Hepatocellular carcinoma (HCC) is a devastating disease worldwide. Though many efforts have been made to elucidate the process of HCC, its molecular mechanisms of development remain elusive due to its complexity. To explore the stepwise carcinogenic process from pre-neoplastic lesions to the end stage of HCC, we employed weighted gene co-expression network analysis (WGCNA) which has been proved to be an effective method in many diseases to detect co-expressed modules and hub genes using eight pathological stages including normal, cirrhosis without HCC, cirrhosis, low-grade dysplastic, high-grade dysplastic, very early and early, advanced HCC and very advanced HCC. Among the eight consecutive pathological stages, five representative modules are selected to perform canonical pathway enrichment and upstream regulator analysis by using ingenuity pathway analysis (IPA) software. We found that cell cycle related biological processes were activated at four neoplastic stages, and the degree of activation of the cell cycle corresponded to the deterioration degree of HCC. The orange and yellow modules enriched in energy metabolism, especially oxidative metabolism, and the expression value of the genes decreased only at four neoplastic stages. The brown module, enriched in protein ubiquitination and ephrin receptor signaling pathways, correlated mainly with the very early stage of HCC. The darkred module, enriched in hepatic fibrosis/hepatic stellate cell activation, correlated with the cirrhotic stage only. The high degree hub genes were identified based on the protein-protein interaction (PPI) network and were verified by Kaplan-Meier survival analysis. The novel five high degree hub genes signature that was identified in our study may shed light on future prognostic and therapeutic approaches. Our study brings a new perspective to the understanding of the key pathways and genes in the dynamic changes of HCC progression. These findings shed light on further investigations.
-
Directory of Open Access Journals (Sweden)
Ana Lúcia Anversa Segatto
Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.
-
Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi
2016-10-01
This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus ; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus .
-
Directory of Open Access Journals (Sweden)
Changsong Chen
2017-05-01
Full Text Available Catechin epimerization is an important factor affecting tea catechin compositions and thereby tea quality. However, a lack of tea germplasms with high non-epicatechins limits relative research. Here, a tea cultivar Y510 with high non-epicatechins was firstly reported and used for catechin and RNA sequencing (RNA-Seq analysis. Results showed that the (--gallocatechin gallate and (+-catechin (C contents in Y510 were at least 136 and 6 times higher than those in Fudingdabaicha and 0306I, but the epicatechins (--epigallocatechin and (--epicatechin (EC were significantly lower. Eleven unigenes potentially involved in catechin epimerization were identified by RNA-Seq analysis. Based on a combination of catechin and gene expression analysis, it was hypothesized that two anthocyanidin reductase genes (CsANR1, CsANR2 and an anthocyanidin synthase gene (CsANS are the key genes affecting catechin epimerization in tea. Non-epicatechin formations were hypothesized to be mainly influenced by the expression ratio of CsANR2 to CsANR1 and the expression of CsANS. Overexpression of CsANS in an Arabidopsis mutant tds4-2 led to a significant increase of EC accumulation in seeds, revealing CsANS is important for catechin epimerization. These results shed new light on breeding tea cultivars with special catechin compositions.
-
Directory of Open Access Journals (Sweden)
Joana Caetano-Lopes
Full Text Available BACKGROUND: Fracture healing is orchestrated by a specific set of events that culminates in the repair of bone and reachievement of its biomechanical properties. The aim of our work was to study the sequence of gene expression events involved in inflammation and bone remodeling occurring in the early phases of callus formation in osteoporotic patients. METHODOLOGY/PRINCIPAL FINDINGS: Fifty-six patients submitted to hip replacement surgery after a low-energy hip fracture were enrolled in this study. The patients were grouped according to the time interval between fracture and surgery: bone collected within 3 days after fracture (n = 13; between the 4(th and 7(th day (n = 33; and after one week from the fracture (n = 10. Inflammation- and bone metabolism-related genes were assessed at the fracture site. The expression of pro-inflammatory cytokines was increased in the first days after fracture. The genes responsible for bone formation and resorption were upregulated one week after fracture. The increase in RANKL expression occurred just before that, between the 4(th-7(th days after fracture. Sclerostin expression diminished during the first days after fracture. CONCLUSIONS: The expression of inflammation-related genes, especially IL-6, is highest at the very first days after fracture but from day 4 onwards there is a shift towards bone remodeling genes, suggesting that the inflammatory phase triggers bone healing. We propose that an initial inflammatory stimulus and a decrease in sclerostin-related effects are the key components in fracture healing. In osteoporotic patients, cellular machinery seems to adequately react to the inflammatory stimulus, therefore local promotion of these events might constitute a promising medical intervention to accelerate fracture healing.
-
International Nuclear Information System (INIS)
Dartel, Dorien A.M. van; Pennings, Jeroen L.A.; Schooten, Frederik J. van; Piersma, Aldert H.
2010-01-01
The embryonic stem cell test (EST) predicts developmental toxicity based on the inhibition of cardiomyocyte differentiation of embryonic stem cells (ESC). The subjective endpoint, the long culture duration together with the undefined applicability domain and related predictivity need further improvement to facilitate implementation of the EST into regulatory strategies. These aspects may be improved by studying gene expression changes in the ESC differentiation cultures and their modulation by compound exposure using transcriptomics. Here, we tested the developmental toxicants monobutyl phthalate and 6-aminonicotinamide. ESC were allowed to differentiated, and cardiomyocyte differentiation was assessed after 10 days of culture. RNA of solvent controls was collected after 0, 24, 48, 72 and 96 h of exposure, and RNA of developmental-toxicant-exposed cultures was collected after 24 and 96 h. Samples were hybridized to DNA microarrays, and 1355 genes were found differentially expressed among the unexposed experimental groups. These regulated genes were involved in differentiation-related processes, and Principal Component Analysis (PCA) based on these genes showed that the unexposed experimental groups appeared in chronological order in the PCA, which can therefore be regarded as a continuous representation of the differentiation track. The developmental-toxicant-exposed cultures appeared to deviate significantly from this differentiation track, which confirms the compound-modulating effects on the differentiation process. The incorporation of transcriptomics in the EST is expected to provide a more informative and improved endpoint in the EST as compared with morphology, allowing early detection of differentiation modulation. Furthermore, this approach may improve the definition of the applicability domain and predictivity of the EST.
-
Molecular and Chemical Genetic Approaches to Developmental Origins of Aging and Disease in Zebrafish
Sasaki, Tomoyuki; Kishi, Shuji
2013-01-01
The incidence of diseases increases rapidly with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but mostly inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states in response to different environmental or genetic perturbations. On the one hand, we hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds of adaptive plasticity by chemical genetic approaches, we have been investigating whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during embryogenesis (“embryonic senescence”), subsequently showing shortened lifespan in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other hand, unexpected senescence-related genes might also be involved in the early developmental process and regulation. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype, and thereby facilitates searching for the evolutionary and developmental origins
-
Lin, Chien-Yu; Chang, Yu-Ming
2014-09-01
In this study, we employed Flash- and Scratch-based multimedia by using a MaKey-MaKey-based task system to increase the motivation level of children with cerebral palsy to perform physical activities. MaKey MaKey is a circuit board that converts physical touch to a digital signal, which is interpreted by a computer as a keyboard message. In this study, we used conductive materials to control this interaction. This study followed single-case design using ABAB models in which A indicated the baseline and B indicated the intervention. The experiment period comprised 1 month and a half. The experimental results demonstrated that in the case of two kindergarten children with cerebral palsy, their scores were considerably increased during the intervention phrases. The developmental applications of the results are also discussed. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
The Level of AdpA Directly Affects Expression of Developmental Genes in Streptomyces coelicolor ▿ †
Wolański, Marcin; Donczew, Rafał; Kois-Ostrowska, Agnieszka; Masiewicz, Paweł; Jakimowicz, Dagmara; Zakrzewska-Czerwińska, Jolanta
2011-01-01
AdpA is a key regulator of morphological differentiation in Streptomyces. In contrast to Streptomyces griseus, relatively little is known about AdpA protein functions in Streptomyces coelicolor. Here, we report for the first time the translation accumulation profile of the S. coelicolor adpA (adpASc) gene; the level of S. coelicolor AdpA (AdpASc) increased, reaching a maximum in the early stage of aerial mycelium formation (after 36 h), and remained relatively stable for the next several hour...
-
Qiu, Zhengkun; Wang, Xiaoxuan; Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen
2016-01-01
Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.
-
Directory of Open Access Journals (Sweden)
Zhengkun Qiu
Full Text Available Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF gene, which corresponds to the ah (Hoffman's anthocyaninless locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.
-
Directory of Open Access Journals (Sweden)
Elvis Genbo Xu
Full Text Available Mahi-mahi (Coryphaena hippurus is a commercially and ecologically important species of fish occurring in tropical and temperate waters worldwide. Understanding early life events is crucial for predicting effects of environmental stress, which is largely restricted by a lack of genetic resources regarding expression of early developmental genes and regulation of pathways. The need for anchoring developmental stages to transcriptional activities is highlighted by increasing evidence on the impacts of recurrent worldwide oil spills in this sensitive species during early development. By means of high throughput sequencing, we characterized the developmental transcriptome of mahi-mahi at three critical developmental stages, from pharyngula embryonic stage (24 hpf to 48 hpf yolk-sac larva (transition 1, and to 96 hpf free-swimming larva (transition 2. With comparative analysis by multiple bioinformatic tools, a larger number of significantly altered genes and more diverse gene ontology terms were observed during transition 2 than transition 1. Cellular and tissue development terms were more significantly enriched in transition 1, while metabolism related terms were more enriched in transition 2, indicating a switch progressing from general embryonic development to metabolism during the two transitions. Special focus was given on the most significant common canonical pathways (e.g. calcium signaling, glutamate receptor signaling, cAMP response element-binding protein signaling, cardiac β-adrenergic signaling, etc. and expression of developmental genes (e.g. collagens, myosin, notch, glutamate metabotropic receptor etc., which were associated with morphological changes of nervous, muscular, and cardiovascular system. These data will provide an important basis for understanding embryonic development and identifying molecular mechanisms of abnormal development in fish species.
-
A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research
Directory of Open Access Journals (Sweden)
Lutz Kockel
2016-10-01
Full Text Available Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila. However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals.
-
Epilepsy in Rett syndrome, and CDKL5- and FOXG1-gene-related encephalopathies.
Guerrini, Renzo; Parrini, Elena
2012-12-01
Rett syndrome is an X-linked neurodevelopmental disorder that manifests in early childhood with developmental stagnation, and loss of spoken language and hand use, with the development of distinctive hand stereotypies, severe cognitive impairment, and autistic features. About 60% of patients have epilepsy. Seizure onset before the age of 3 years is unlikely, and onset after age 20 is rare. Diagnosis of Rett syndrome is based on key clinical elements that identify "typical" Rett syndrome but also "variant" or "atypical" forms. Diagnostic criteria have been modified only slightly over time, even after discovering that MECP2 gene alterations are present in >90% of patients with typical Rett syndrome but only in 50-70% of atypical cases. Over the last several years, intragenic or genomic alterations of the CDKL5 and FOXG1 genes have been associated with severe cognitive impairment, early onset epilepsy and, often, dyskinetic movement disorders, which have variably been defined as Rett variants. It is now clearly emerging that epilepsy has distinctive characteristics in typical Rett syndrome and in the different syndromes caused by CDKL5 and FOXG1 gene alterations. The progressive parting of CDKL5- and FOXG1-gene-related encephalopathies from the core Rett syndrome is reflected by the effort to produce clearer diagnostic criteria for typical and atypical Rett syndrome. Efforts to characterize the molecular pathology underlying these developmental encephalopathies are pointing to abnormalities of telencephalic development, neuronal morphogenesis, maturation and maintenance, and dendritic arborization. Wiley Periodicals, Inc. © 2012 International League Against Epilepsy.
-
Developmental imaging: the avian embryo hatches to the challenge.
Kulesa, Paul M; McKinney, Mary C; McLennan, Rebecca
2013-06-01
The avian embryo provides a multifaceted model to study developmental mechanisms because of its accessibility to microsurgery, fluorescence cell labeling, in vivo imaging, and molecular manipulation. Early two-dimensional planar growth of the avian embryo mimics human development and provides unique access to complex cell migration patterns using light microscopy. Later developmental events continue to permit access to both light and other imaging modalities, making the avian embryo an excellent model for developmental imaging. For example, significant insights into cell and tissue behaviors within the primitive streak, craniofacial region, and cardiovascular and peripheral nervous systems have come from avian embryo studies. In this review, we provide an update to recent advances in embryo and tissue slice culture and imaging, fluorescence cell labeling, and gene profiling. We focus on how technical advances in the chick and quail provide a clearer understanding of how embryonic cell dynamics are beautifully choreographed in space and time to sculpt cells into functioning structures. We summarize how these technical advances help us to better understand basic developmental mechanisms that may lead to clinical research into human birth defects and tissue repair. Copyright © 2013 Wiley Periodicals, Inc.
-
‘Developmental Delay’ Reconsidered: The Critical Role of Age-Dependent, Co-variant Development
Directory of Open Access Journals (Sweden)
Yonata Levy
2018-04-01
Full Text Available In memory of Annette Karmiloff-Smith.This paper reviews recent neurobiological research reporting structural co-variance and temporal dependencies in age-dependent gene expression, parameters of cortical maturation, long range connectivity and interaction of the biological network with the environment. This research suggests that age by size trajectories of brain structures relate to functional properties more than absolute sizes. In line with these findings, recent behavioral studies of typically developing children whose language development was delayed reported long term consequences of such delays. As for neurodevelopmental disorders, disrupted developmental timing and slow acquisitional pace are hallmarks of these populations. It is argued that these behavioral and neuro-biological results highlight the need to commit to a developmental model which will reflect the fact that temporal dependencies overseeing structural co-variance among developmental components are major regulatory factors of typical development of the brain/mind network. Consequently, the concept of ‘developmental delay’ in developmental theorizing needs to be reconsidered.
-
Heritable and lineage-specific gene knockdown in zebrafish embryo.
Directory of Open Access Journals (Sweden)
Mei Dong
Full Text Available BACKGROUND: Reduced expression of developmentally important genes and tumor suppressors due to haploinsufficiency or epigenetic suppression has been shown to contribute to the pathogenesis of various malignancies. However, methodology that allows spatio-temporally knockdown of gene expression in various model organisms such as zebrafish has not been well established, which largely limits the potential of zebrafish as a vertebrate model of human malignant disorders. PRINCIPAL FINDING: Here, we report that multiple copies of small hairpin RNA (shRNA are expressed from a single transcript that mimics the natural microRNA-30e precursor (mir-shRNA. The mir-shRNA, when microinjected into zebrafish embryos, induced an efficient knockdown of two developmentally essential genes chordin and alpha-catenin in a dose-controllable fashion. Furthermore, we designed a novel cassette vector to simultaneously express an intronic mir-shRNA and a chimeric red fluorescent protein driven by lineage-specific promoter, which efficiently reduced the expression of a chromosomally integrated reporter gene and an endogenously expressed gata-1 gene in the developing erythroid progenitors and hemangioblasts, respectively. SIGNIFICANCE: This methodology provides an invaluable tool to knockdown developmental important genes in a tissue-specific manner or to establish animal models, in which the gene dosage is critically important in the pathogenesis of human disorders. The strategy should be also applicable to other model organisms.
-
Functional Profiling of Transcription Factor Genes in Neurospora crassa
Directory of Open Access Journals (Sweden)
Alexander J. Carrillo
2017-09-01
Full Text Available Regulation of gene expression by DNA-binding transcription factors is essential for proper control of growth and development in all organisms. In this study, we annotate and characterize growth and developmental phenotypes for transcription factor genes in the model filamentous fungus Neurospora crassa. We identified 312 transcription factor genes, corresponding to 3.2% of the protein coding genes in the genome. The largest class was the fungal-specific Zn2Cys6 (C6 binuclear cluster, with 135 members, followed by the highly conserved C2H2 zinc finger group, with 61 genes. Viable knockout mutants were produced for 273 genes, and complete growth and developmental phenotypic data are available for 242 strains, with 64% possessing at least one defect. The most prominent defect observed was in growth of basal hyphae (43% of mutants analyzed, followed by asexual sporulation (38%, and the various stages of sexual development (19%. Two growth or developmental defects were observed for 21% of the mutants, while 8% were defective in all three major phenotypes tested. Analysis of available mRNA expression data for a time course of sexual development revealed mutants with sexual phenotypes that correlate with transcription factor transcript abundance in wild type. Inspection of this data also implicated cryptic roles in sexual development for several cotranscribed transcription factor genes that do not produce a phenotype when mutated.
-
Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E
2001-12-01
Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the
-
Jung, Jee-Hyun; Lee, Eun-Hee; Choi, Kwang-Min; Yim, Un Hyuk; Ha, Sung Yong; An, Joon Geon; Kim, Moonkoo
2017-06-01
Crude oils from distinct geographical regions have distinct chemical compositions, and, as a result, their toxicity may be different. However, developmental toxicity of crude oils derived from different geographical regions has not been extensively characterized. In this study, flounder embryos were separately exposed to effluents contaminated by three crude oils including: Basrah Light (BLO), Pyrenees (PCO), and Sakhalin Vityaz (SVO), in addition to a processed fuel oil (MFO-380), to measure developmental toxicity and for gene expressions. Each oil possessed a distinct chemical composition. Edema defect was highest in embryos exposed to PCO and MFO-380 that both have a greater fraction of three-ring PAHs (33% and 22%, respectively) compared to BLO and SVO. Observed caudal fin defects were higher in embryos exposed to SVO and MFO-380, which are both dominated by naphthalenes (81% and 52%, respectively). CYP1A gene expressions were also highest in embryos exposed to SVO and MFO-380. Higher incidence of cardiotoxicity and lower nkx 2.5 expression were detected in embryos exposed to PCO. Unique gene expression profiles were observed in embryos exposed to crude oils with distinct compositions. This study demonstrates that crude oils of different geographical origins with different compositional characteristics induce developmental toxicity to different degrees. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Eco-Evo-Devo: developmental symbiosis and developmental plasticity as evolutionary agents.
Gilbert, Scott F; Bosch, Thomas C G; Ledón-Rettig, Cristina
2015-10-01
The integration of research from developmental biology and ecology into evolutionary theory has given rise to a relatively new field, ecological evolutionary developmental biology (Eco-Evo-Devo). This field integrates and organizes concepts such as developmental symbiosis, developmental plasticity, genetic accommodation, extragenic inheritance and niche construction. This Review highlights the roles that developmental symbiosis and developmental plasticity have in evolution. Developmental symbiosis can generate particular organs, can produce selectable genetic variation for the entire animal, can provide mechanisms for reproductive isolation, and may have facilitated evolutionary transitions. Developmental plasticity is crucial for generating novel phenotypes, facilitating evolutionary transitions and altered ecosystem dynamics, and promoting adaptive variation through genetic accommodation and niche construction. In emphasizing such non-genomic mechanisms of selectable and heritable variation, Eco-Evo-Devo presents a new layer of evolutionary synthesis.
-
Calcisponges have a ParaHox gene and dynamic expression of dispersed NK homeobox genes.
Fortunato, Sofia A V; Adamski, Marcin; Ramos, Olivia Mendivil; Leininger, Sven; Liu, Jing; Ferrier, David E K; Adamska, Maja
2014-10-30
Sponges are simple animals with few cell types, but their genomes paradoxically contain a wide variety of developmental transcription factors, including homeobox genes belonging to the Antennapedia (ANTP) class, which in bilaterians encompass Hox, ParaHox and NK genes. In the genome of the demosponge Amphimedon queenslandica, no Hox or ParaHox genes are present, but NK genes are linked in a tight cluster similar to the NK clusters of bilaterians. It has been proposed that Hox and ParaHox genes originated from NK cluster genes after divergence of sponges from the lineage leading to cnidarians and bilaterians. On the other hand, synteny analysis lends support to the notion that the absence of Hox and ParaHox genes in Amphimedon is a result of secondary loss (the ghost locus hypothesis). Here we analysed complete suites of ANTP-class homeoboxes in two calcareous sponges, Sycon ciliatum and Leucosolenia complicata. Our phylogenetic analyses demonstrate that these calcisponges possess orthologues of bilaterian NK genes (Hex, Hmx and Msx), a varying number of additional NK genes and one ParaHox gene, Cdx. Despite the generation of scaffolds spanning multiple genes, we find no evidence of clustering of Sycon NK genes. All Sycon ANTP-class genes are developmentally expressed, with patterns suggesting their involvement in cell type specification in embryos and adults, metamorphosis and body plan patterning. These results demonstrate that ParaHox genes predate the origin of sponges, thus confirming the ghost locus hypothesis, and highlight the need to analyse the genomes of multiple sponge lineages to obtain a complete picture of the ancestral composition of the first animal genome.
-
Directory of Open Access Journals (Sweden)
Hua eQingzhu
2016-01-01
Full Text Available Betalains have high nutritional value and bioactivities. Red pulp pitaya (Hylocereus polyrhizus is the only fruit containing abundant betalains for consumer. However, no information is available about genes involved in betalain biosynthesis in H. polyrhizus. Herein, two cDNA libraries of pitaya pulps with two different coloration stages (white and red pulp stages of Guanhuahong (H. polyrhizus were constructed. A total of about 12 Gb raw RNA-Seq data was generated and was de novo assembled into 122,677 transcripts with an average length of 1,183 bp and an N50 value of 2008. Approximately 99.99% of all transcripts were annotated based on seven public databases. A total of 8,871 transcripts were significantly regulated. Thirty-three candidate transcripts related to betalain biosynthesis were obtained from the transcriptome data. Transcripts encoding enzymes involved in betalain biosynthesis were analyzed using RT-qPCR at the whole pulp coloration stages of H. Polyrhizus (7-1 and H. Undatus (132-4. Nine key transcripts of betalain biosynthesis were identified. They were assigned to four kinds of genes in betalain biosynthetic pathway, including tyrosinase, 4, 5-DOPA dioxygenase extradiol, cytochrome P450 and glucosyltransferase. Ultimately, a preliminary betalain biosynthetic pathway for pitaya was proposed based on betalain analyses and gene expression profiles.
-
DEFF Research Database (Denmark)
Alcaraz, Nicolas; Pauling, Josch; Batra, Richa
2014-01-01
release of KeyPathwayMiner (version 4.0) that is not limited to analyses of single omics data sets, e.g. gene expression, but is able to directly combine several different omics data types. Version 4.0 can further integrate existing knowledge by adding a search bias towards sub-networks that contain...... (avoid) genes provided in a positive (negative) list. Finally the new release now also provides a set of novel visualization features and has been implemented as an app for the standard bioinformatics network analysis tool: Cytoscape. CONCLUSION: With KeyPathwayMiner 4.0, we publish a Cytoscape app...
-
Directory of Open Access Journals (Sweden)
Cong-Hui Yang
Full Text Available The pine moth Dendrolimus punctatus (Walker is a common insect pest that confers serious damage to conifer forests in south of China. Extensive physiology and ecology studies on D. punctatus have been carried out, but the lack of genetic information has limited our understanding of the molecular mechanisms behind its development and resistance. Using RNA-seq approach, we characterized the transcriptome of this pine moth and investigated its developmental expression profiles during egg, larval, pupal, and adult stages. A total of 107.6 million raw reads were generated that were assembled into 70,664 unigenes. More than 30% unigenes were annotated by searching for homology in protein databases. To better understand the process of metamorphosis, we pairwise compared four developmental phases and obtained 17,624 differential expression genes. Functional enrichment analysis of differentially expressed genes showed positive correlation with specific physiological activities of each stage, and these results were confirmed by qRT-PCR experiments. This study provides a valuable genomic resource of D. punctatus covering all its developmental stages, and will promote future studies on biological processes at the molecular level.
-
Suleiman, Ahna Ballonoff; Dahl, Ronald E
2017-03-01
In this article, we consider how to leverage some of the rapid advances in developmental neuroscience in ways that can improve adolescent health. We provide a brief overview of several key areas of scientific progress relevant to these issues. We then focus on two examples of important health problems that increase sharply during adolescence: sleep problems and affective disorders. These examples illustrate how an integrative, developmental science approach provides new insights into treatment and intervention. They also highlight a cornerstone principle: how a deeper understanding of potentially modifiable factors-at key developmental inflection points along the trajectory toward clinical disorders-is beginning to inform, and may eventually transform, a broad range of innovative early intervention strategies to improve adolescent health. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
-
Extended evolutionary psychology: the importance of transgenerational developmental plasticity
Directory of Open Access Journals (Sweden)
Karola eStotz
2014-08-01
Full Text Available What kind mechanisms one deems central for the evolutionary process deeply influences one’s understanding of the nature of organisms, including cognition. Reversely, adopting a certain approach to the nature of life and cognition and the relationship between them or between the organism and its environment should affect one’s view of evolutionary theory. This paper explores this reciprocal relationship in more detail. In particular it argues that the view of living and cognitive systems, especially humans, as deeply integrated beings embedded in and transformed by their genetic, epigenetic (molecular and cellular, behavioral, ecological, socio-cultural and cognitive-symbolic legacies calls for an extended evolutionary synthesis that goes beyond either a theory of genes juxtaposed against a theory of cultural evolution and or even more sophisticated theories of gene-culture coevolution and niche construction. Environments, particularly in the form of developmental environments, do not just select for variation, they also create new variation by influencing development through the reliable transmission of non-genetic but heritable information. This paper stresses particularly views of embodied, embedded, enacted and extended cognition, and their relationship to those aspects of extended inheritance that lie between genetic and cultural inheritance, the still grey area of epigenetic and behavioral inheritance systems that play a role in parental effect. These are the processes that can be regarded as transgenerational developmental plasticity and that I think can most fruitfully contribute to, and be investigated by, developmental psychology.
-
Extended evolutionary psychology: the importance of transgenerational developmental plasticity.
Stotz, Karola
2014-01-01
What kind mechanisms one deems central for the evolutionary process deeply influences one's understanding of the nature of organisms, including cognition. Reversely, adopting a certain approach to the nature of life and cognition and the relationship between them or between the organism and its environment should affect one's view of evolutionary theory. This paper explores this reciprocal relationship in more detail. In particular it argues that the view of living and cognitive systems, especially humans, as deeply integrated beings embedded in and transformed by their genetic, epigenetic (molecular and cellular), behavioral, ecological, socio-cultural and cognitive-symbolic legacies calls for an extended evolutionary synthesis that goes beyond either a theory of genes juxtaposed against a theory of cultural evolution and or even more sophisticated theories of gene-culture coevolution and niche construction. Environments, particularly in the form of developmental environments, do not just select for variation, they also create new variation by influencing development through the reliable transmission of non-genetic but heritable information. This paper stresses particularly views of embodied, embedded, enacted and extended cognition, and their relationship to those aspects of extended inheritance that lie between genetic and cultural inheritance, the still gray area of epigenetic and behavioral inheritance systems that play a role in parental effect. These are the processes that can be regarded as transgenerational developmental plasticity and that I think can most fruitfully contribute to, and be investigated by, developmental psychology.
-
Quillien, Aurelie; Abdalla, Mary; Yu, Jun; Ou, Jianhong; Zhu, Lihua Julie; Lawson, Nathan D
2017-07-18
Identification of tissue-specific and developmentally active enhancers provides insights into mechanisms that control gene expression during embryogenesis. However, robust detection of these regulatory elements remains challenging, especially in vertebrate genomes. Here, we apply fluorescent-activated nuclei sorting (FANS) followed by Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) to identify developmentally active endothelial enhancers in the zebrafish genome. ATAC-seq of nuclei from Tg(fli1a:egfp) y1 transgenic embryos revealed expected patterns of nucleosomal positioning at transcriptional start sites throughout the genome and association with active histone modifications. Comparison of ATAC-seq from GFP-positive and -negative nuclei identified more than 5,000 open elements specific to endothelial cells. These elements flanked genes functionally important for vascular development and that displayed endothelial-specific gene expression. Importantly, a majority of tested elements drove endothelial gene expression in zebrafish embryos. Thus, FANS-assisted ATAC-seq using transgenic zebrafish embryos provides a robust approach for genome-wide identification of active tissue-specific enhancer elements. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Barker Gary LA
2009-07-01
Full Text Available Abstract Background The free-living nematode Caenorhabditis elegans makes a developmental decision based on environmental conditions: larvae either arrest as dauer larva, or continue development into reproductive adults. There is natural variation among C. elegans lines in the sensitivity of this decision to environmental conditions; that is, there is variation in the phenotypic plasticity of dauer larva development. We hypothesised that these differences may be transcriptionally controlled in early stage larvae. We investigated this by microarray analysis of different C. elegans lines under different environmental conditions, specifically the presence and absence of dauer larva-inducing pheromone. Results There were substantial transcriptional differences between four C. elegans lines under the same environmental conditions. The expression of approximately 2,000 genes differed between genetically different lines, with each line showing a largely line-specific transcriptional profile. The expression of genes that are markers of larval moulting suggested that the lines may be developing at different rates. The expression of a total of 89 genes was putatively affected by dauer larva or non-dauer larva-inducing conditions. Among the upstream regions of these genes there was an over-representation of DAF-16-binding motifs. Conclusion Under the same environmental conditions genetically different lines of C. elegans had substantial transcriptional differences. This variation may be due to differences in the developmental rates of the lines. Different environmental conditions had a rather smaller effect on transcription. The preponderance of DAF-16-binding motifs upstream of these genes was consistent with these genes playing a key role in the decision between development into dauer or into non-dauer larvae. There was little overlap between the genes whose expression was affected by environmental conditions and previously identified loci involved in
-
Directory of Open Access Journals (Sweden)
Candy M Taylor
Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other
-
Directory of Open Access Journals (Sweden)
Neutelings Godfrey
2010-04-01
Full Text Available Abstract Background Quantitative real-time PCR (qRT-PCR is currently the most accurate method for detecting differential gene expression. Such an approach depends on the identification of uniformly expressed 'housekeeping genes' (HKGs. Extensive transcriptomic data mining and experimental validation in different model plants have shown that the reliability of these endogenous controls can be influenced by the plant species, growth conditions and organs/tissues examined. It is therefore important to identify the best reference genes to use in each biological system before using qRT-PCR to investigate differential gene expression. In this paper we evaluate different candidate HKGs for developmental transcriptomic studies in the economically-important flax fiber- and oil-crop (Linum usitatissimum L. Results Specific primers were designed in order to quantify the expression levels of 20 different potential housekeeping genes in flax roots, internal- and external-stem tissues, leaves and flowers at different developmental stages. After calculations of PCR efficiencies, 13 HKGs were retained and their expression stabilities evaluated by the computer algorithms geNorm and NormFinder. According to geNorm, 2 Transcriptional Elongation Factors (TEFs and 1 Ubiquitin gene are necessary for normalizing gene expression when all studied samples are considered. However, only 2 TEFs are required for normalizing expression in stem tissues. In contrast, NormFinder identified glyceraldehyde-3-phosphate dehydrogenase (GADPH as the most stably expressed gene when all samples were grouped together, as well as when samples were classed into different sub-groups. qRT-PCR was then used to investigate the relative expression levels of two splice variants of the flax LuMYB1 gene (homologue of AtMYB59. LuMYB1-1 and LuMYB1-2 were highly expressed in the internal stem tissues as compared to outer stem tissues and other samples. This result was confirmed with both ge
-
Huis, Rudy; Hawkins, Simon; Neutelings, Godfrey
2010-04-19
Quantitative real-time PCR (qRT-PCR) is currently the most accurate method for detecting differential gene expression. Such an approach depends on the identification of uniformly expressed 'housekeeping genes' (HKGs). Extensive transcriptomic data mining and experimental validation in different model plants have shown that the reliability of these endogenous controls can be influenced by the plant species, growth conditions and organs/tissues examined. It is therefore important to identify the best reference genes to use in each biological system before using qRT-PCR to investigate differential gene expression. In this paper we evaluate different candidate HKGs for developmental transcriptomic studies in the economically-important flax fiber- and oil-crop (Linum usitatissimum L). Specific primers were designed in order to quantify the expression levels of 20 different potential housekeeping genes in flax roots, internal- and external-stem tissues, leaves and flowers at different developmental stages. After calculations of PCR efficiencies, 13 HKGs were retained and their expression stabilities evaluated by the computer algorithms geNorm and NormFinder. According to geNorm, 2 Transcriptional Elongation Factors (TEFs) and 1 Ubiquitin gene are necessary for normalizing gene expression when all studied samples are considered. However, only 2 TEFs are required for normalizing expression in stem tissues. In contrast, NormFinder identified glyceraldehyde-3-phosphate dehydrogenase (GADPH) as the most stably expressed gene when all samples were grouped together, as well as when samples were classed into different sub-groups.qRT-PCR was then used to investigate the relative expression levels of two splice variants of the flax LuMYB1 gene (homologue of AtMYB59). LuMYB1-1 and LuMYB1-2 were highly expressed in the internal stem tissues as compared to outer stem tissues and other samples. This result was confirmed with both geNorm-designated- and Norm
-
Sampling in Developmental Science: Situations, Shortcomings, Solutions, and Standards.
Bornstein, Marc H; Jager, Justin; Putnick, Diane L
2013-12-01
Sampling is a key feature of every study in developmental science. Although sampling has far-reaching implications, too little attention is paid to sampling. Here, we describe, discuss, and evaluate four prominent sampling strategies in developmental science: population-based probability sampling, convenience sampling, quota sampling, and homogeneous sampling. We then judge these sampling strategies by five criteria: whether they yield representative and generalizable estimates of a study's target population, whether they yield representative and generalizable estimates of subsamples within a study's target population, the recruitment efforts and costs they entail, whether they yield sufficient power to detect subsample differences, and whether they introduce "noise" related to variation in subsamples and whether that "noise" can be accounted for statistically. We use sample composition of gender, ethnicity, and socioeconomic status to illustrate and assess the four sampling strategies. Finally, we tally the use of the four sampling strategies in five prominent developmental science journals and make recommendations about best practices for sample selection and reporting.
-
Regulation of root hair initiation and expansin gene expression in Arabidopsis
Cho, Hyung-Taeg; Cosgrove, Daniel J.
2002-01-01
The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.
-
Directory of Open Access Journals (Sweden)
Shirai Leila T
2012-02-01
Full Text Available Abstract Background The origin and modification of novel traits are important aspects of biological diversification. Studies combining concepts and approaches of developmental genetics and evolutionary biology have uncovered many examples of the recruitment, or co-option, of genes conserved across lineages for the formation of novel, lineage-restricted traits. However, little is known about the evolutionary history of the recruitment of those genes, and of the relationship between them -for example, whether the co-option involves whole or parts of existing networks, or whether it occurs by redeployment of individual genes with de novo rewiring. We use a model novel trait, color pattern elements on butterfly wings called eyespots, to explore these questions. Eyespots have greatly diversified under natural and sexual selection, and their formation involves genetic circuitries shared across insects. Results We investigated the evolutionary history of the recruitment and co-recruitment of four conserved transcription regulators to the larval wing disc region where circular pattern elements develop. The co-localization of Antennapedia, Notch, Distal-less, and Spalt with presumptive (eyespot organizers was examined in 13 butterfly species, providing the largest comparative dataset available for the system. We found variation between families, between subfamilies, and between tribes. Phylogenetic reconstructions by parsimony and maximum likelihood methods revealed an unambiguous evolutionary history only for Antennapedia, with a resolved single origin of eyespot-associated expression, and many homoplastic events for Notch, Distal-less, and Spalt. The flexibility in the (co-recruitment of the targeted genes includes cases where different gene combinations are associated with morphologically similar eyespots, as well as cases where identical protein combinations are associated with very different phenotypes. Conclusions The evolutionary history of gene
-
Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L
1994-12-20
The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.
-
Wan, Cen; Lees, Jonathan G; Minneci, Federico; Orengo, Christine A; Jones, David T
2017-10-01
Accurate gene or protein function prediction is a key challenge in the post-genome era. Most current methods perform well on molecular function prediction, but struggle to provide useful annotations relating to biological process functions due to the limited power of sequence-based features in that functional domain. In this work, we systematically evaluate the predictive power of temporal transcription expression profiles for protein function prediction in Drosophila melanogaster. Our results show significantly better performance on predicting protein function when transcription expression profile-based features are integrated with sequence-derived features, compared with the sequence-derived features alone. We also observe that the combination of expression-based and sequence-based features leads to further improvement of accuracy on predicting all three domains of gene function. Based on the optimal feature combinations, we then propose a novel multi-classifier-based function prediction method for Drosophila melanogaster proteins, FFPred-fly+. Interpreting our machine learning models also allows us to identify some of the underlying links between biological processes and developmental stages of Drosophila melanogaster.
-
Directory of Open Access Journals (Sweden)
Cen Wan
2017-10-01
Full Text Available Accurate gene or protein function prediction is a key challenge in the post-genome era. Most current methods perform well on molecular function prediction, but struggle to provide useful annotations relating to biological process functions due to the limited power of sequence-based features in that functional domain. In this work, we systematically evaluate the predictive power of temporal transcription expression profiles for protein function prediction in Drosophila melanogaster. Our results show significantly better performance on predicting protein function when transcription expression profile-based features are integrated with sequence-derived features, compared with the sequence-derived features alone. We also observe that the combination of expression-based and sequence-based features leads to further improvement of accuracy on predicting all three domains of gene function. Based on the optimal feature combinations, we then propose a novel multi-classifier-based function prediction method for Drosophila melanogaster proteins, FFPred-fly+. Interpreting our machine learning models also allows us to identify some of the underlying links between biological processes and developmental stages of Drosophila melanogaster.
-
Pucci, Ferdinando; Venneri, Mary Anna; Biziato, Daniela; Nonis, Alessandro; Moi, Davide; Sica, Antonio; Di Serio, Clelia; Naldini, Luigi; De Palma, Michele
2009-07-23
We previously showed that Tie2-expressing monocytes (TEMs) have nonredundant proangiogenic activity in tumors. Here, we compared the gene expression profile of tumor-infiltrating TEMs with that of tumor-associated macrophages (TAMs), spleen-derived Gr1(+)Cd11b(+) neutrophils/myeloid-derived suppressor cells, circulating "inflammatory" and "resident" monocytes, and tumor-derived endothelial cells (ECs) by quantitative polymerase chain reaction-based gene arrays. TEMs sharply differed from ECs and Gr1(+)Cd11b(+) cells but were highly related to TAMs. Nevertheless, several genes were differentially expressed between TEMs and TAMs, highlighting a TEM signature consistent with enhanced proangiogenic/tissue-remodeling activity and lower proinflammatory activity. We validated these findings in models of oncogenesis and transgenic mice expressing a microRNA-regulated Tie2-GFP reporter. Remarkably, resident monocytes and TEMs on one hand, and inflammatory monocytes and TAMs on the other hand, expressed coordinated gene expression profiles, suggesting that the 2 blood monocyte subsets are committed to distinct extravascular fates in the tumor microenvironment. We further showed that a prominent proportion of embryonic/fetal macrophages, which participate in tissue morphogenesis, expressed distinguishing TEM genes. It is tempting to speculate that Tie2(+) embryonic/fetal macrophages, resident blood monocytes, and tumor-infiltrating TEMs represent distinct developmental stages of a TEM lineage committed to execute physiologic proangiogenic and tissue-remodeling programs, which can be co-opted by tumors.
-
Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko
2002-07-26
Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.
-
Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen
2016-01-01
Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses. PMID:26943362
-
Serial analysis of gene expression in the silkworm, Bombyx mori.
Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping
2005-08-01
The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.
-
Adaptive evolution of a key gene affecting queen and worker traits in the honey bee, Apis mellifera.
Kent, Clement F; Issa, Amer; Bunting, Alexandra C; Zayed, Amro
2011-12-01
The vitellogenin egg yolk precursor protein represents a well-studied case of social pleiotropy in the model organism Apis mellifera. Vitellogenin is associated with fecundity in queens and plays a major role in controlling division of labour in workers, thereby affecting both individual and colony-level fitness. We studied the molecular evolution of vitellogenin and seven other genes sequenced in a large population panel of Apis mellifera and several closely related species to investigate the role of social pleiotropy on adaptive protein evolution. We found a significant excess of nonsynonymous fixed differences between A. mellifera, A. cerana and A. florea relative to synonymous sites indicating high rates of adaptive evolution at vitellogenin. Indeed, 88% of amino acid changes were fixed by selection in some portions of the gene. Further, vitellogenin exhibited hallmark signatures of selective sweeps in A. mellifera, including a significant skew in the allele frequency spectrum, extreme levels of genetic differentiation and linkage disequilibrium. Finally, replacement polymorphisms in vitellogenin were significantly enriched in parts of the protein involved in binding lipid, establishing a link between the gene's structure, function and effects on fitness. Our case study provides unequivocal evidence of historical and ongoing bouts of adaptive evolution acting on a key socially pleiotropic gene in the honey bee. © 2011 Blackwell Publishing Ltd.
-
Energy Technology Data Exchange (ETDEWEB)
Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands); Pronk, Tessa E. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Brandhof, Evert-Jan van den [Centre for Environmental Quality, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Ven, Leo T.M. van der [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Piersma, Aldert H. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands)
2013-10-01
The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol and saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.
-
Importance of globin gene order for correct developmental expression.
O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)
1991-01-01
textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the
-
Directory of Open Access Journals (Sweden)
Timothy Mohun
2013-05-01
International efforts to test gene function in the mouse by the systematic knockout of each gene are creating many lines in which embryonic development is compromised. These homozygous lethal mutants represent a potential treasure trove for the biomedical community. Developmental biologists could exploit them in their studies of tissue differentiation and organogenesis; for clinical researchers they offer a powerful resource for investigating the origins of developmental diseases that affect newborns. Here, we outline a new programme of research in the UK aiming to kick-start research with embryonic lethal mouse lines. The ‘Deciphering the Mechanisms of Developmental Disorders’ (DMDD programme has the ambitious goal of identifying all embryonic lethal knockout lines made in the UK over the next 5 years, and will use a combination of comprehensive imaging and transcriptomics to identify abnormalities in embryo structure and development. All data will be made freely available, enabling individual researchers to identify lines relevant to their research. The DMDD programme will coordinate its work with similar international efforts through the umbrella of the International Mouse Phenotyping Consortium [see accompanying Special Article (Adams et al., 2013] and, together, these programmes will provide a novel database for embryonic development, linking gene identity with molecular profiles and morphology phenotypes.
-
Diaphanous gene mutation affects spiral cleavage and chirality in snails
Kuroda, Reiko; Fujikura, Kohei; Abe, Masanori; Hosoiri, Yuji; Asakawa, Shuichi; Shimizu, Miho; Umeda, Shin; Ichikawa, Futaba; Takahashi, Hiromi
2016-01-01
L-R (left and right) symmetry breaking during embryogenesis and the establishment of asymmetric body plan are key issues in developmental biology, but the onset including the handedness-determining gene locus still remains unknown. Using pure dextral (DD) and sinistral (dd) strains of the pond snail Lymnaea stagnalis as well as its F2 through to F10 backcrossed lines, the single handedness-determining-gene locus was mapped by genetic linkage analysis, BAC cloning and chromosome walking. We have identified the actin-related diaphanous gene Lsdia1 as the strongest candidate. Although the cDNA and derived amino acid sequences of the tandemly duplicated Lsdia1 and Lsdia2 genes are very similar, we could discriminate the two genes/proteins in our molecular biology experiments. The Lsdia1 gene of the sinistral strain carries a frameshift mutation that abrogates full-length LsDia1 protein expression. In the dextral strain, it is already translated prior to oviposition. Expression of Lsdia1 (only in the dextral strain) and Lsdia2 (in both chirality) decreases after the 1-cell stage, with no asymmetric localization throughout. The evolutionary relationships among body handedness, SD/SI (spiral deformation/spindle inclination) at the third cleavage, and expression of diaphanous proteins are discussed in comparison with three other pond snails (L. peregra, Physa acuta and Indoplanorbis exustus). PMID:27708420
-
Directory of Open Access Journals (Sweden)
Jin Soo Choi
Full Text Available Zinc oxide nanoparticles (ZnO NPs are being utilized in an increasing number of fields and commercial applications. While their general toxicity and associated oxidative stress have been extensively studied, the toxicological pathways that they induce in developmental stages are still largely unknown. In this study, the developmental toxicity of ZnO NPs to embryonic/larval zebrafish was investigated. The transcriptional expression profiles induced by ZnO NPs were also investigated to ascertain novel genomic responses related to their specific toxicity pathway. Zebrafish embryos were exposed to 0.01, 0.1, 1, and 10 mg/L ZnO NPs for 96 h post-fertilization. The toxicity of ZnO NPs, based on their Zn concentration, was quite similar to that in embryonic/larval zebrafish exposed to corresponding ZnSO4 concentrations. Pericardial edema and yolk-sac edema were the principal malformations induced by ZnO NPs. Gene-expression profiling using microarrays demonstrated 689 genes that were differentially regulated (fold change >1.5 following exposure to ZnO NPs (498 upregulated, 191 downregulated. Several genes that were differentially regulated following ZnO NP exposure shared similar biological pathways with those observed with ZnSO4 exposure, but six genes (aicda, cyb5d1, edar, intl2, ogfrl2 and tnfsf13b associated with inflammation and the immune system responded specifically to ZnO NPs (either in the opposite direction or were unchanged in ZnSO4 exposure. Real-time reverse-transcription quantitative polymerase chain reaction confirmed that the responses of these genes to ZnO NPs were significantly different from their response to ZnSO4 exposure. ZnO NPs may affect genes related to inflammation and the immune system, resulting in yolk-sac edema and pericardia edema in embryonic/larval developmental stages. These results will assist in elucidating the mechanisms of toxicity of ZnO NPs during development of zebrafish.
-
Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family
Directory of Open Access Journals (Sweden)
Jill Christine Preston
2013-04-01
Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.
-
Chao, Tianle; Wang, Guizhi; Ji, Zhibin; Liu, Zhaohua; Hou, Lei; Wang, Jin; Wang, Jianmin
2017-07-13
The large intestine, also known as the hindgut, is an important part of the animal digestive system. Recent studies on digestive system development in ruminants have focused on the rumen and the small intestine, but the molecular mechanisms underlying sheep large intestine metabolism remain poorly understood. To identify genes related to intestinal metabolism and to reveal molecular regulation mechanisms, we sequenced and compared the transcriptomes of mucosal epithelial tissues among the cecum, proximal colon and duodenum. A total of 4,221 transcripts from 3,254 genes were identified as differentially expressed transcripts. Between the large intestine and duodenum, differentially expressed transcripts were found to be significantly enriched in 6 metabolism-related pathways, among which PPAR signaling was identified as a key pathway. Three genes, CPT1A, LPL and PCK1, were identified as higher expression hub genes in the large intestine. Between the cecum and colon, differentially expressed transcripts were significantly enriched in 5 lipid metabolism related pathways, and CEPT1 and MBOAT1 were identified as hub genes. This study provides important information regarding the molecular mechanisms of intestinal metabolism in sheep and may provide a basis for further study.
-
Directory of Open Access Journals (Sweden)
Paula Dietrich
Full Text Available Familial Dysautonomia (FD is an autosomal recessive disorder that affects 1/3,600 live births in the Ashkenazi Jewish population, and leads to death before the age of 40. The disease is characterized by abnormal development and progressive degeneration of the sensory and autonomic nervous system. A single base pair substitution in intron 20 of the Ikbkap gene accounts for 98% of FD cases, and results in the expression of low levels of the full-length mRNA with simultaneous expression of an aberrantly spliced mRNA in which exon 20 is missing. To date, there is no animal model for the disease, and the essential cellular functions of IKAP--the protein encoded by Ikbkap--remain unknown. To better understand the normal function of IKAP and in an effort to generate a mouse model for FD, we have targeted the mouse Ikbkap gene by homologous recombination. We created two distinct alleles that result in either loss of Ikbkap expression, or expression of an mRNA lacking only exon 20. Homozygosity for either mutation leads to developmental delay, cardiovascular and brain malformations, accompanied with early embryonic lethality. Our analyses indicate that IKAP is essential for expression of specific genes involved in cardiac morphogenesis, and that cardiac failure is the likely cause of abnormal vascular development and embryonic lethality. Our results also indicate that deletion of exon 20 abolishes gene function. This implies that the truncated IKAP protein expressed in FD patients does not retain any significant biological function.
-
Directory of Open Access Journals (Sweden)
Vanessa C McFadden
2017-02-01
Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.
-
Directory of Open Access Journals (Sweden)
Ken White
2010-03-01
Full Text Available Some common, mental models shape how people in the US perceive political changes over time. The one-dimensional pendulum swing model and the two-dimensional cyclical model are prevalent. When generational differences are mapped onto such political change cycles, they orient to cohorts or age groups. This leads to viewing generational cohorts as experiencing one- or two-dimensional cycles without deeper scrutiny. Cohort differences that surface in the Generations Salons that I and others conducted in California suggest a different, three-dimensional model may be more representative of the potential for societal change in the US. Using a musical metaphor, that model is explained in terms of different political “keys” and the value of distinguishing among them as time passes. It also underlies a speculation about a “politics in a new key,” which might prove more useful.Summary-level reporting of the action research conducted with the Generations Salons supports the three-dimensional model. We expect new politics to emerge from the Millennial cohort coming of age now, yet it will not be without the support and wisdom of the cohorts that came of age before it. This must be the case if the burden of expectations we place on the Millennials will indeed pave the way for transformative change in US society. Intergenerational support of Millennials is essential. This initial research and application suggests the potential for the generational/ developmental approach as a wellspring for transformational—and practically successful—political work. It begs the question: What will you do to help?
-
Directory of Open Access Journals (Sweden)
Ken White
2010-03-01
Full Text Available Some common, mental models shape how people in the US perceive political changes over time. The one-dimensional pendulum swing model and the two-dimensional cyclical model are prevalent. When generational differences are mapped onto such political change cycles, they orient to cohorts or age groups. This leads to viewing generational cohorts as experiencing one- or two-dimensional cycles without deeper scrutiny. Cohort differences that surface in the Generations Salons that I and others conducted in California suggest a different, three-dimensional model may be more representative of the potential for societal change in the US. Using a musical metaphor, that model is explained in terms of different political “keys” and the value of distinguishing among them as time passes. It also underlies a speculation about a “politics in a new key,” which might prove more useful. Summary-level reporting of the action research conducted with the Generations Salons supports the three-dimensional model. We expect new politics to emerge from the Millennial cohort coming of age now, yet it will not be without the support and wisdom of the cohorts that came of age before it. This must be the case if the burden of expectations we place on the Millennials will indeed pave the way for transformative change in US society. Intergenerational support of Millennials is essential. This initial research and application suggests the potential for the generational/ developmental approach as a wellspring for transformational—and practically successful—political work. It begs the question: What will you do to help?
-
Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes
Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee
2012-01-01
Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758
-
Wang, Yunshu; Hu, Zongli; Zhang, Jianling; Yu, XiaoHui; Guo, Jun-E; Liang, Honglian; Liao, Changguang; Chen, Guoping
2018-02-19
Mediator complex, a conserved multi-protein, is necessary for controlling RNA polymerase II (Pol II) transcription in eukaryotes. Given little is known about them in tomato, a tomato Mediator subunit 18 gene was isolated and named SlMED18. To further explore the function of SlMED18, the transgenic tomato plants targeting SlMED18 by RNAi-mediated gene silencing were generated. The SlMED18-RNAi lines exhibited multiple developmental defects, including smaller size and slower growth rate of plant and significantly smaller compound leaves. The contents of endogenous bioactive GA 3 in SlMED18 silenced lines were slightly less than that in wild type. Furthermore, qRT-PCR analysis indicated that expression of gibberellins biosynthesis genes such as SlGACPS and SlGA20x2, auxin transport genes (PIN1, PIN4, LAX1 and LAX2) and several key regulators, KNOX1, KNOX2, PHAN and LANCEOLATE(LA), which involved in the leaf morphogenesis were significantly down-regulated in SlMED18-RNAi lines. These results illustrated that SlMED18 plays an essential role in regulating plant internode elongation and leaf expansion in tomato plants and it acts as a key positive regulator of gibberellins biosynthesis and signal transduction as well as auxin proper transport signalling. These findings are the basis for understanding the function of the individual Mediator subunits in tomato.
-
Hong, Chenlu; Chen, Yangyang; Li, Lu; Chen, Shouwen; Wei, Xuetuan
2017-03-01
Natto as a fermented soybean product has many health benefits for human due to its rich nutritional and functional components. However, the unpleasant odor of natto, caused by the formation of branched-chain short fatty acids (BCFAs), prohibits the wide acceptance of natto products. This work is to identify the key gene of BCFAs formation and develop the guidance to reduce natto odor. Transcriptional analysis of BCFAs synthesis pathway genes was conducted in two Bacillus subtilis strains with obvious different BCFAs synthesis abilities. The transcriptional levels of bcd, bkdAA, and ptb in B. subtilis H-9 were 2.7-fold, 0.7-fold, and 8.9-fold higher than that of B. subtilis H-4, respectively. Therefore, the ptb gene with the highest transcriptional change was considered as the key gene in BCFAs synthesis. The ptb encoded enzyme Ptb was further characterized by inducible expression in Escherichia coli. The recombinant Ptb protein (about 32 kDa) was verified by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis analysis. The catalysis functions of Ptb were confirmed on substrates of isovaleryl-CoA and isobutyryl-CoA, and the higher catalysis efficiency of Ptb on isovaleryl-CoA explained the higher level of isovaleric acid in natto. The optimal activities of Ptb were observed at 50 °C and pH 8.0, and the enzymatic activity was inhibited by Ca 2+ , Zn 2+ , Ba 2+ , Mn 2+ , Cu 2+ , SDS, and EDTA. Collectively, this study reports a key gene responsible for BCFAs formation in natto fermentation and provides potential strategies to solve the odor problem.
-
Applied Developmental Biology: Making Human Pancreatic Beta Cells for Diabetics.
Melton, Douglas A
2016-01-01
Understanding the genes and signaling pathways that determine the differentiation and fate of a cell is a central goal of developmental biology. Using that information to gain mastery over the fates of cells presents new approaches to cell transplantation and drug discovery for human diseases including diabetes. © 2016 Elsevier Inc. All rights reserved.
-
Tamplin, Owen J; Cox, Brian J; Rossant, Janet
2011-12-15
The node and notochord are key tissues required for patterning of the vertebrate body plan. Understanding the gene regulatory network that drives their formation and function is therefore important. Foxa2 is a key transcription factor at the top of this genetic hierarchy and finding its targets will help us to better understand node and notochord development. We performed an extensive microarray-based gene expression screen using sorted embryonic notochord cells to identify early notochord-enriched genes. We validated their specificity to the node and notochord by whole mount in situ hybridization. This provides the largest available resource of notochord-expressed genes, and therefore candidate Foxa2 target genes in the notochord. Using existing Foxa2 ChIP-seq data from adult liver, we were able to identify a set of genes expressed in the notochord that had associated regions of Foxa2-bound chromatin. Given that Foxa2 is a pioneer transcription factor, we reasoned that these sites might represent notochord-specific enhancers. Candidate Foxa2-bound regions were tested for notochord specific enhancer function in a zebrafish reporter assay and 7 novel notochord enhancers were identified. Importantly, sequence conservation or predictive models could not have readily identified these regions. Mutation of putative Foxa2 binding elements in two of these novel enhancers abrogated reporter expression and confirmed their Foxa2 dependence. The combination of highly specific gene expression profiling and genome-wide ChIP analysis is a powerful means of understanding developmental pathways, even for small cell populations such as the notochord. Copyright © 2011 Elsevier Inc. All rights reserved.
-
Functional Dysregulation of CDC42 Causes Diverse Developmental Phenotypes.
Martinelli, Simone; Krumbach, Oliver H F; Pantaleoni, Francesca; Coppola, Simona; Amin, Ehsan; Pannone, Luca; Nouri, Kazem; Farina, Luciapia; Dvorsky, Radovan; Lepri, Francesca; Buchholzer, Marcel; Konopatzki, Raphael; Walsh, Laurence; Payne, Katelyn; Pierpont, Mary Ella; Vergano, Samantha Schrier; Langley, Katherine G; Larsen, Douglas; Farwell, Kelly D; Tang, Sha; Mroske, Cameron; Gallotta, Ivan; Di Schiavi, Elia; Della Monica, Matteo; Lugli, Licia; Rossi, Cesare; Seri, Marco; Cocchi, Guido; Henderson, Lindsay; Baskin, Berivan; Alders, Mariëlle; Mendoza-Londono, Roberto; Dupuis, Lucie; Nickerson, Deborah A; Chong, Jessica X; Meeks, Naomi; Brown, Kathleen; Causey, Tahnee; Cho, Megan T; Demuth, Stephanie; Digilio, Maria Cristina; Gelb, Bruce D; Bamshad, Michael J; Zenker, Martin; Ahmadian, Mohammad Reza; Hennekam, Raoul C; Tartaglia, Marco; Mirzaa, Ghayda M
2018-01-17
Exome sequencing has markedly enhanced the discovery of genes implicated in Mendelian disorders, particularly for individuals in whom a known clinical entity could not be assigned. This has led to the recognition that phenotypic heterogeneity resulting from allelic mutations occurs more commonly than previously appreciated. Here, we report that missense variants in CDC42, a gene encoding a small GTPase functioning as an intracellular signaling node, underlie a clinically heterogeneous group of phenotypes characterized by variable growth dysregulation, facial dysmorphism, and neurodevelopmental, immunological, and hematological anomalies, including a phenotype resembling Noonan syndrome, a developmental disorder caused by dysregulated RAS signaling. In silico, in vitro, and in vivo analyses demonstrate that mutations variably perturb CDC42 function by altering the switch between the active and inactive states of the GTPase and/or affecting CDC42 interaction with effectors, and differentially disturb cellular and developmental processes. These findings reveal the remarkably variable impact that dominantly acting CDC42 mutations have on cell function and development, creating challenges in syndrome definition, and exemplify the importance of functional profiling for syndrome recognition and delineation. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
-
Mechanistic Investigations Into the Developmental Toxicity of Nitrated and Heterocyclic PAHs
Chlebowski, Anna C.; Garcia, Gloria R.; La Du, Jane K.; Bisson, William H.; Truong, Lisa; Massey Simonich, Staci L.
2017-01-01
Abstract Nitrated polycyclic aromatic hydrocarbons (NPAHs) and heterocyclic PAHs (HPAHs) are recognized environmental pollutants. However, the health risks of NPAHs and HPAHs to humans and environmental systems are not well-studied. The developmental zebrafish (Danio rerio) model was used to evaluate the toxicity of a structurally diverse set of 27 NPAHs and 10 HPAHs. The individual activity of each compound towards the aryl hydrocarbon receptor (AHR), including the role of the AHR in observed toxicity, and genetic markers of oxidative stress and cardiac toxicity were evaluated. Zebrafish embryos were exposed from 6 to 120 hours post fertilization (hpf), to a broad concentration range of individual compounds, and evaluated for 22 developmental endpoints. The potential role of AHR was determined using the transgenic Tg(cyp1a:nls-egfp) reporter zebrafish line. All compounds were screened computationally through molecular docking using a previously developed AHR models of zebrafish isoforms 1A, 1B, and 2. Some compounds did not induce observable developmental toxic responses, whereas others produced statistically significant concentration-dependent toxicity. The tested compounds also exhibited a range of predicted AHR binding and cyp1a/GFP induction patterns, including cyp1a expression in the liver, vasculature, skin, and yolk, which we determined to be due to distinct isoforms of the AHR, using morpholino oligonucleotide knockdown. Furthermore, we investigated mRNA expression of oxidative and cardiac stress genes at 48 and 120 hpf, which indicated several potential mechanisms-of-action for NPAHs. Overall, we observed a range of developmental toxicities, cyp1a/GFP expression patterns, and gene expression profiles, suggestive of several potential mechanisms of action. PMID:28186253
-
Directory of Open Access Journals (Sweden)
Jubin N Shah
2016-10-01
global DNA methylation exclusively in the apomicts. Variability in stress and transcriptional response in a diploid apomict, which is geographically distinct from the triploid apomict, pinpoints both common and independent features of apomixis evolution. Our study provides a molecular frame-work to investigate how the adaptive traits associated with the evolutionary history of apomicts co-adapted with meiotic gene deregulation at early developmental stage, in order to predate meiotic recombination, which otherwise is thought to be favourable in stress and low-fitness conditions.
-
[Neurotransmission in developmental disorders].
Takeuchi, Yoshihiro
2008-11-01
Attention deficit/hyperactivity disorder (AD/HD) is a heterogeneous developmental disorder with an etiology that is not fully understood. AD/HD has been considered to occur due to a disturbance in cathecholaminergic neurotransmission, with particular emphasis on dopamine. The neurotransmission of dopamine in subcortical regions such as the basal ganglia and limbic areas is synaptic; on the other hand, dopamine neurotransmission in the frontal cortex is quite different, because there are very few dopamine transporters (DAT) in the frontal cortex that allow dopamine to diffuse away from the dopamine synapse ("volume transmission"). It is now clear that noradrenergic neurons play a key regulatory role in dopaminergic function in the frontal cortex. Furthermore, serotonergic neurons exert an inhibitory effect on midbrain dopamine cell bodies, and they have an influence on dopamine release in terminal regions. There is accumulating neurobiological evidence pointing toward a role of the serotonin system in AD/HD. The etiology of autism spectrum disorders (ASD) is still unclear, but information from genetics, neuropathology, brain imaging, and basic neuroscience has provided insights into the understanding of this developmental disorder. In addition to abnormal circuitry in specific limbic and neocortical areas of the cerebral cortex, impairments in brainstem, cerebellar, thalamic, and basal ganglia connections have been reported. Numerous studies have pointed to abnormalities in serotonin and glutamate neurotransmission. Three important aspects involved in the pathophysiology of ASD have been proposed. The first is cell migration, the second is unbalanced excitatory-inhibitory networks, and the third is synapse formation and pruning, the key factors being reelin, neurexin, and neuroligin. Serotonin is considered to play an important role in all of these aspects of the pathophysiology of ASD. Finally, I would like to emphasize that it is crucial in the field of child
-
Human developmental enhancers conserved between deuterostomes and protostomes.
Directory of Open Access Journals (Sweden)
Shoa L Clarke
Full Text Available The identification of homologies, whether morphological, molecular, or genetic, is fundamental to our understanding of common biological principles. Homologies bridging the great divide between deuterostomes and protostomes have served as the basis for current models of animal evolution and development. It is now appreciated that these two clades share a common developmental toolkit consisting of conserved transcription factors and signaling pathways. These patterning genes sometimes show common expression patterns and genetic interactions, suggesting the existence of similar or even conserved regulatory apparatus. However, previous studies have found no regulatory sequence conserved between deuterostomes and protostomes. Here we describe the first such enhancers, which we call bilaterian conserved regulatory elements (Bicores. Bicores show conservation of sequence and gene synteny. Sequence conservation of Bicores reflects conserved patterns of transcription factor binding sites. We predict that Bicores act as response elements to signaling pathways, and we show that Bicores are developmental enhancers that drive expression of transcriptional repressors in the vertebrate central nervous system. Although the small number of identified Bicores suggests extensive rewiring of cis-regulation between the protostome and deuterostome clades, additional Bicores may be revealed as our understanding of cis-regulatory logic and sample of bilaterian genomes continue to grow.
-
Directory of Open Access Journals (Sweden)
Gaofeng Wang
Full Text Available The soybean cyst nematode, Heterodera glycines, is an important pest of soybeans. Although resistance is available against this nematode, selection for virulent races can occur, allowing the nematode to overcome the resistance of cultivars. There are abundant field populations, however, little is known about their genetic diversity. In order to elucidate the differences between races, we investigated the transcriptional diversity within race 3 and race 4 inbred lines during their compatible interactions with the soybean host Zhonghuang 13. Six different race-enriched cDNA libraries were constructed with limited nematode samples collected from the three sedentary stages, parasitic J2, J3 and J4 female, respectively. Among 689 putative race-enriched genes isolated from the six libraries with functional annotations, 92 were validated by quantitative RT-PCR (qRT-PCR, including eight putative effector encoding genes. Further race-enriched genes were validated within race 3 and race 4 during development in soybean roots. Gene Ontology (GO analysis of all the race-enriched genes at J3 and J4 female stages showed that most of them functioned in metabolic processes. Relative transcript level analysis of 13 selected race-enriched genes at four developmental stages showed that the differences in their expression abundance took place at either one or more developmental stages. This is the first investigation into the transcript diversity of H. glycines races throughout their sedentary stages, increasing the understanding of the genetic diversity of H. glycines.
-
DEFF Research Database (Denmark)
Markussen, Mette; Heiberg, Ann-Charlotte; Fredholm, Merete
2008-01-01
over-express the Cyp2a1 gene. TGhe altered gene expression has been suggested to be involved in the bromadiolone resistance by facilitating enhanced anticoagulant metabolism. To investigate the gene expression of these cytochrome P450 genes in rats of different developmental stages we compared...... expression profiles, from 8-, 12- and 20-week-old resistant rats of the Danish strain to profiles of anticoagulant-susceptible rats of same ages. The three age-groups were selected to represent a group of pre-pubertal, pubertal and adult rats. We found expression profiles of the pre-pubertal and pubertal...... resistant rats to concur with profiles of the adults suggesting that cytochrome P450 enzymes are involved in the Danish bromadiolone resistance regardless of developmental stage. We also investigated the relative importance of the six cytochrome P450s in the different development stages of the resistant...
-
Genome-wide identification of the SWEET gene family in wheat.
Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu
2018-02-05
The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Differentiating the Neural Response to Intervention in Children with Developmental Dyslexia
Odegard, Timothy N.; Ring, Jeremiah; Smith, Stephanie; Biggan, John; Black, Jeff
2008-01-01
Developmental dyslexia is associated with functional abnormalities within reading areas of the brain. For some children diagnosed with dyslexia, phonologically based remediation programs appear to rehabilitate brain function in key reading areas (Shaywitz et al., Biological Psychiatry 55: 101-110, 2004; Simos et al., Neuroscience 58: 1203-1213,…
-
DEFF Research Database (Denmark)
Kirkegaard, Kirstine; Hindkjær, Johnny Juhl; Ingerslev, Hans Jakob
2012-01-01
expression differs between viable and non-viable embryos in both human and non-humans, suggesting transcriptome analysis of trophectoderm (TE) as a novel method of improving embryo selection. Potential candidate marker genes have been identified with array studies on animal blastocysts. The aim of this study...... was to investigate the expression of selected genes in human blastocysts in relation to the outcome of implantation. Materials and methods: Embryos from 10 oatients undergoing in vitro fertilization treatment were included in the project. A single blastocyst was chosen for biopsy on the morning of day 5 after oocyte...... of 15 key genes associated with developmental competence in animals were evaluated in high quality human embryos with monogenic or chromosomal disorders from a pre-implantation genetic disorder program. Triplicate cDNA amplifications for quantitative (q) RT-PCR were performed using pre-designed gene...
-
Building clinical networks: a developmental evaluation framework.
Carswell, Peter; Manning, Benjamin; Long, Janet; Braithwaite, Jeffrey
2014-05-01
Clinical networks have been designed as a cross-organisational mechanism to plan and deliver health services. With recent concerns about the effectiveness of these structures, it is timely to consider an evidence-informed approach for how they can be developed and evaluated. To document an evaluation framework for clinical networks by drawing on the network evaluation literature and a 5-year study of clinical networks. We searched literature in three domains: network evaluation, factors that aid or inhibit network development, and on robust methods to measure network characteristics. This material was used to build a framework required for effective developmental evaluation. The framework's architecture identifies three stages of clinical network development; partner selection, network design and network management. Within each stage is evidence about factors that act as facilitators and barriers to network growth. These factors can be used to measure progress via appropriate methods and tools. The framework can provide for network growth and support informed decisions about progress. For the first time in one place a framework incorporating rigorous methods and tools can identify factors known to affect the development of clinical networks. The target user group is internal stakeholders who need to conduct developmental evaluation to inform key decisions along their network's developmental pathway.
-
Schneider, Susan M
2007-01-01
Nature–nurture views that smack of genetic determinism remain prevalent. Yet, the increasing knowledge base shows ever more clearly that environmental factors and genes form a fully interactional system at all levels. Moore's book covers the major topics of discovery and dispute, including behavior genetics and the twin studies, developmental psychobiology, and developmental systems theory. Knowledge of this larger life-sciences context for behavior principles will become increasingly importa...
-
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
-
I. DEVELOPMENTAL METHODOLOGY AS A CENTRAL SUBDISCIPLINE OF DEVELOPMENTAL SCIENCE.
Card, Noel A
2017-06-01
This first chapter introduces the main goals of the monograph and previews the remaining chapters. The goals of this monograph are to provide summaries of our current understanding of advanced developmental methodologies, provide information that can advance our understanding of human development, identify shortcomings in our understanding of developmental methodology, and serve as a flagpost for organizing developmental methodology as a subdiscipline within the broader field of developmental science. The remaining chapters in this monograph address issues in design (sampling and big data), longitudinal data analysis, and issues of replication and research accumulation. The final chapter describes the history of developmental methodology, considers how the previous chapters in this monograph fit within this subdiscipline, and offers recommendations for further advancement. © 2017 The Society for Research in Child Development, Inc.
-
Tarone, Aaron M; Foran, David R
2011-01-01
Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.
-
Sampling in Developmental Science: Situations, Shortcomings, Solutions, and Standards
Bornstein, Marc H.; Jager, Justin; Putnick, Diane L.
2014-01-01
Sampling is a key feature of every study in developmental science. Although sampling has far-reaching implications, too little attention is paid to sampling. Here, we describe, discuss, and evaluate four prominent sampling strategies in developmental science: population-based probability sampling, convenience sampling, quota sampling, and homogeneous sampling. We then judge these sampling strategies by five criteria: whether they yield representative and generalizable estimates of a study’s target population, whether they yield representative and generalizable estimates of subsamples within a study’s target population, the recruitment efforts and costs they entail, whether they yield sufficient power to detect subsample differences, and whether they introduce “noise” related to variation in subsamples and whether that “noise” can be accounted for statistically. We use sample composition of gender, ethnicity, and socioeconomic status to illustrate and assess the four sampling strategies. Finally, we tally the use of the four sampling strategies in five prominent developmental science journals and make recommendations about best practices for sample selection and reporting. PMID:25580049
-
Venkatesh, Ishwariya; Simpson, Matthew T; Coley, Denise M; Blackmore, Murray G
2016-12-01
Axon regeneration in adult central nervous system (CNS) is limited in part by a developmental decline in the ability of injured neurons to re-express needed regeneration associated genes (RAGs). Adult CNS neurons may lack appropriate pro-regenerative transcription factors, or may display chromatin structure that restricts transcriptional access to RAGs. Here we performed epigenetic profiling around the promoter regions of key RAGs, and found progressive restriction across a time course of cortical maturation. These data identify a potential intrinsic constraint to axon growth in adult CNS neurons. Neurite outgrowth from cultured postnatal cortical neurons, however, proved insensitive to treatments that improve axon growth in other cell types, including combinatorial overexpression of AP1 factors, overexpression of histone acetyltransferases, and pharmacological inhibitors of histone deacetylases. This insensitivity could be due to intermediate chromatin closure at the time of culture, and highlights important differences in cell culture models used to test potential pro-regenerative interventions.
-
Eickelberg, Garrett J; Fisher, Alison J
2013-01-01
We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the FLOWERING LOCUS C gene, a key regulator of floral timing in Arabidopsis thaliana plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate students in biochemistry or molecular biology courses. The project provides students with hands-on experience with RT-qPCR, the current "gold standard" for gene expression analysis, including detailed data analysis using the common 2-ΔΔCT method. Moreover, it provides a convenient starting point for many inquiry-driven projects addressing diverse questions concerning ecological biochemistry, naturally occurring genetic variation, developmental biology, and the regulation of gene expression in nature. Copyright © 2013 Wiley Periodicals, Inc.
-
Bhullar, Bhart-Anjan S; Morris, Zachary S; Sefton, Elizabeth M; Tok, Atalay; Tokita, Masayoshi; Namkoong, Bumjin; Camacho, Jasmin; Burnham, David A; Abzhanov, Arhat
2015-07-01
The avian beak is a key evolutionary innovation whose flexibility has permitted birds to diversify into a range of disparate ecological niches. We approached the problem of the mechanism behind this innovation using an approach bridging paleontology, comparative anatomy, and experimental developmental biology. First, we used fossil and extant data to show the beak is distinctive in consisting of fused premaxillae that are geometrically distinct from those of ancestral archosaurs. To elucidate underlying developmental mechanisms, we examined candidate gene expression domains in the embryonic face: the earlier frontonasal ectodermal zone (FEZ) and the later midfacial WNT-responsive region, in birds and several reptiles. This permitted the identification of an autapomorphic median gene expression region in Aves. To test the mechanism, we used inhibitors of both pathways to replicate in chicken the ancestral amniote expression. Altering the FEZ altered later WNT responsiveness to the ancestral pattern. Skeletal phenotypes from both types of experiments had premaxillae that clustered geometrically with ancestral fossil forms instead of beaked birds. The palatal region was also altered to a more ancestral phenotype. This is consistent with the fossil record and with the tight functional association of avian premaxillae and palate in forming a kinetic beak. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.
-
Reporter-Based Isolation of Developmental Myogenic Progenitors
Directory of Open Access Journals (Sweden)
Eyemen Kheir
2018-04-01
Full Text Available The formation and activity of mammalian tissues entail finely regulated processes, involving the concerted organization and interaction of multiple cell types. In recent years the prospective isolation of distinct progenitor and stem cell populations has become a powerful tool in the hands of developmental biologists and has rendered the investigation of their intrinsic properties possible. In this protocol, we describe how to purify progenitors with different lineage history and degree of differentiation from embryonic and fetal skeletal muscle by fluorescence-activated cell sorting (FACS. The approach takes advantage of a panel of murine strains expressing fluorescent reporter genes specifically in the myogenic progenitors. We provide a detailed description of the dissection procedures and of the enzymatic dissociation required to maximize the yield of mononucleated cells for subsequent FACS-based purification. The procedure takes ~6–7 h to complete and allows for the isolation and the subsequent molecular and phenotypic characterization of developmental myogenic progenitors.
-
Ethylene, a key factor in the regulation of seed dormancy
Directory of Open Access Journals (Sweden)
Françoise eCORBINEAU
2014-10-01
Full Text Available Ethylene is an important component of the gaseous environment, and regulates numerous plant developmental processes including seed germination and seedling establishment. Dormancy, the inability to germinate in apparently favorable conditions, has been demonstrated to be regulated by the hormonal balance between abscisic acid (ABA and gibberellins (GAs. Ethylene plays a key role in dormancy release in numerous species, the effective concentrations allowing the germination of dormant seeds ranging between 0.1 and 200 μL L-1. Studies using inhibitors of ethylene biosynthesis or of ethylene action and analysis of mutant lines altered in genes involved in the ethylene signaling pathway (etr1, ein2, ain1, etr1, and erf1 demonstrate the involvement of ethylene in the regulation of germination and dormancy. Ethylene counteracts ABA effects through a regulation of ABA metabolism and signaling pathways. Moreover, ethylene insensitive mutants in Arabidopsis are more sensitive to ABA and the seeds are more dormant. Numerous data also show an interaction between ABA, GAs and ethylene metabolism and signaling pathways. It has been increasingly demonstrated that reactive oxygen species (ROS may play a significant role in the regulation of seed germination interacting with hormonal signaling pathways. In the present review the responsiveness of seeds to ethylene will be described, and the key role of ethylene in the regulation of seed dormancy via a cross-talk between hormones and other signals will be discussed.
-
Energy Technology Data Exchange (ETDEWEB)
Keranen, Soile V.E.
2003-04-02
The developmental increase in structural complexity in multicellular life forms depends on local, often non-periodic differences in gene expression. These depend on a network of gene-gene interactions coded within the organismal genome. To better understand how genomic information generates complex expression patterns, I have modeled the pattern forming behavior of small artificial genomes in virtual blastoderm embryos. I varied several basic properties of these genomic signaling networks, such as the number of genes, the distributions of positive (inductive) and negative (repressive) interactions, and the strengths of gene-gene interactions, and analyzed their effects on developmental pattern formation. The results show how even simple genomes can generate complex non-periodic patterns under suitable conditions. They also show how the frequency of complex patterns depended on the numbers and relative arrangements of positive and negative interactions. For example, negative co-regulation of signaling pathway components increased the likelihood of (complex) patterns relative to differential negative regulation of the pathway components. Interestingly, neither quantitative differences either in strengths of signaling interactions nor multiple response thresholds to signal concentration (as in morphogen gradients) were essential for formation of multiple, spatially unique cell types. Thus, with combinatorial code of gene regulation and hierarchical signaling interactions, it is theoretically possible to organize metazoan embryogenesis with just a small fraction of the metazoan genome. Because even small networks can generate complex patterns when they contain a suitable set of connections, evolution of metazoan complexity may have depended more on selection for favourable configurations of signaling interactions than on the increase in numbers of regulatory genes.
-
Hale, Matthew C; McKinney, Garrett J; Thrower, Frank P; Nichols, Krista M
2018-01-01
Sex-bias in gene expression is a mechanism that can generate phenotypic variance between the sexes, however, relatively little is known about how patterns of sex-bias vary during development, and how variable sex-bias is between different populations. To that end, we measured sex-bias in gene expression in the brain transcriptome of rainbow trout (Oncorhynchus mykiss) during the first two years of development. Our sampling included from the fry stage through to when O. mykiss either migrate to the ocean or remain resident and undergo sexual maturation. Samples came from two F1 lines: One from migratory steelhead trout and one from resident rainbow trout. All samples were reared in a common garden environment and RNA sequencing (RNA-seq) was used to estimate patterns of gene expression. A total of 1,716 (4.6% of total) genes showed evidence of sex-bias in gene expression in at least one time point. The majority (96.7%) of sex-biased genes were differentially expressed during the second year of development, indicating that patterns of sex-bias in expression are tied to key developmental events, such as migration and sexual maturation. Mapping of differentially expressed genes to the O. mykiss genome revealed that the X chromosome is enriched for female upregulated genes, and this may indicate a lack of dosage compensation in rainbow trout. There were many more sex-biased genes in the migratory line than the resident line suggesting differences in patterns of gene expression in the brain between populations subjected to different forces of selection. Overall, our results suggest that there is considerable variation in the extent and identity of genes exhibiting sex-bias during the first two years of life. These differentially expressed genes may be connected to developmental differences between the sexes, and/or between adopting a resident or migratory life history.
-
Cignetti, Fabien; Vaugoyeau, Marianne; Fontan, Aurelie; Jover, Marianne; Livet, Marie-Odile; Hugonenq, Catherine; Audic, Frédérique; Chabrol, Brigitte; Assaiante, Christine
2018-05-01
Feedforward and online controls are two facets of predictive motor control from internal models, which is suspected to be impaired in learning disorders. We examined whether the feedforward component is affected in children (8-12 years) with developmental dyslexia (DD) and/or with developmental coordination disorder (DCD) compared to typically developing (TD) children. Children underwent a bimanual unloading paradigm during which a load supported to one arm, the postural arm, was either unexpectedly unloaded by a computer or voluntary unloaded by the subject with the other arm. All children showed a better stabilization (lower flexion) of the postural arm and an earlier inhibition of the arm flexors during voluntary unloading, indicating anticipation of unloading. Between-group comparisons of kinematics and electromyographic activity of the postural arm revealed that the difference during voluntary unloading was between DD-DCD children and the other groups, with the former showing a delayed inhibition of the flexor muscles. Deficit of the feedforward component of motor control may particularly apply to comorbid subtypes, here the DD-DCD subtype. The development of a comprehensive framework for motor performance deficits in children with learning disorders will be achieved only by dissociating key components of motor prediction and focusing on subtypes and comorbidities. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
DEFF Research Database (Denmark)
Søgaard-Andersen, L.; Overgaard, M.; Lobedanz, S.
2003-01-01
xanthus illustrates this coupling in the construction of a multicellular structure. Fruiting body formation involves two stages: aggregation of cells into mounds and the position-specific sporulation of cells that have accumulated inside mounds. Developmental gene expression propels these two processes...... morphogenesis. Accumulation of the C-signal is tightly regulated and involves transcriptional activation of the csgA gene and proteolysis of the full-length CsgA protein to produce the shorter cell surface-associated 17 kDa C-signal protein. The C-signal induces aggregation, sporulation and developmental gene...
-
The developmental and genetic bases of apetaly in Bocconia frutescens (Chelidonieae: Papaveraceae
Directory of Open Access Journals (Sweden)
Cristina Arango-Ocampo
2016-08-01
Full Text Available Abstract Background Bocconia and Macleaya are the only genera of the poppy family (Papaveraceae lacking petals; however, the developmental and genetic processes underlying such evolutionary shift have not yet been studied. Results We studied floral development in two species of petal-less poppies Bocconia frutescens and Macleaya cordata as well as in the closely related petal-bearing Stylophorum diphyllum. We generated a floral transcriptome of B. frutescens to identify MADS-box ABCE floral organ identity genes expressed during early floral development. We performed phylogenetic analyses of these genes across Ranunculales as well as RT-PCR and qRT-PCR to assess loci-specific expression patterns. We found that petal-to-stamen homeosis in petal-less poppies occurs through distinct developmental pathways. Transcriptomic analyses of B. frutescens floral buds showed that homologs of all MADS-box genes are expressed except for the APETALA3-3 ortholog. Species-specific duplications of other ABCE genes in B. frutescens have resulted in functional copies with expanded expression patterns than those predicted by the model. Conclusions Petal loss in B. frutescens is likely associated with the lack of expression of AP3-3 and an expanded expression of AGAMOUS. The genetic basis of petal identity is conserved in Ranunculaceae and Papaveraceae although they have different number of AP3 paralogs and exhibit dissimilar floral groundplans.
-
Applying Developmental Theory and Research to the Creation of Educational Games
Revelle, Glenda
2013-01-01
The field of developmental psychology has produced abundant theory and research about the physical, cognitive, social, and emotional development of children; however, to date there has been limited use of this wealth of knowledge by developers creating games for children. This chapter provides an overview of key theoretical observations and…
-
Imaging the developing heart: synchronized time-lapse microscopy during developmental changes
Nelson, Carl J.; Buckley, Charlotte; Mullins, John J.; Denvir, Martin A.; Taylor, Jonathan
2018-02-01
How do you use imaging to analyse the development of the heart, which not only changes shape but also undergoes constant, high-speed, quasi-periodic changes? We have integrated ideas from prospective and retrospective optical gating to capture long-term, phase-locked developmental time-lapse videos. In this paper we demonstrate the success of this approach over a key developmental time period: heart looping, where large changes in heart shape prevent previous prospective gating approaches from capturing phase- locked videos. We use the comparison with other approaches to in vivo heart imaging to highlight the importance of collecting the most appropriate data for the biological question.
-
Kishi, Shuji
2014-01-01
Can we reset, reprogram, rejuvenate or reverse the organismal aging process? Certain genetic manipulations could at least reset and reprogram epigenetic dynamics beyond phenotypic plasticity and elasticity in cells, which can be further manipulated into organisms. However, in a whole complex aging organism, how can we rejuvenate intrinsic resources and infrastructures in an intact/noninvasive manner? The incidence of diseases increases exponentially with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but essentially inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena to rejuvenate over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states based on diverse epigenotypes, in response to intrinsic or extrinsic environmental cues and genetic perturbations. We hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds and windows of plasticity and its robustness by molecular genetic and chemical epigenetic approaches, we have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during their embryonic and/or larval stages (“embryonic/larval senescence”). Subsequently, at least some of these mutant animals were found to show shortened lifespan, while some others would be expected to live longer in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other
-
Directory of Open Access Journals (Sweden)
2006-02-01
Full Text Available An important but largely unmet challenge in understanding the mechanisms that govern the formation of specific organs is to decipher the complex and dynamic genetic programs exhibited by the diversity of cell types within the tissue of interest. Here, we use an integrated genetic, genomic, and computational strategy to comprehensively determine the molecular identities of distinct myoblast subpopulations within the Drosophila embryonic mesoderm at the time that cell fates are initially specified. A compendium of gene expression profiles was generated for primary mesodermal cells purified by flow cytometry from appropriately staged wild-type embryos and from 12 genotypes in which myogenesis was selectively and predictably perturbed. A statistical meta-analysis of these pooled datasets--based on expected trends in gene expression and on the relative contribution of each genotype to the detection of known muscle genes--provisionally assigned hundreds of differentially expressed genes to particular myoblast subtypes. Whole embryo in situ hybridizations were then used to validate the majority of these predictions, thereby enabling true-positive detection rates to be estimated for the microarray data. This combined analysis reveals that myoblasts exhibit much greater gene expression heterogeneity and overall complexity than was previously appreciated. Moreover, it implicates the involvement of large numbers of uncharacterized, differentially expressed genes in myogenic specification and subsequent morphogenesis. These findings also underscore a requirement for considerable regulatory specificity for generating diverse myoblast identities. Finally, to illustrate how the developmental functions of newly identified myoblast genes can be efficiently surveyed, a rapid RNA interference assay that can be scored in living embryos was developed and applied to selected genes. This integrated strategy for examining embryonic gene expression and function provides
-
Distinct developmental defense activations in barley embryos identified by transcriptome profiling
DEFF Research Database (Denmark)
Nielsen, ME; Lok, F; Nielsen, Henrik Bjørn
2006-01-01
analyses of > 22,000 genes, which together with measurements of jasmonic acid and salicylic acid during embryo development provide new information on the initiation in the developing barley embryo of at least two distinct types of developmental defense activation (DDA). Early DDA is characterized by the up......-regulation of several PR genes is notable. Throughout barley embryo development, there are no indications of an increased biosynthesis of either jasmonic acid or salicylic acid. Collectively, the results help explain how the proposed DDA enables protection of the developing barley embryo and grain for purposes...
-
Cheating by exploitation of developmental prestalk patterning in Dictyostelium discoideum.
Directory of Open Access Journals (Sweden)
Anupama Khare
2010-02-01
Full Text Available The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters-strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC, a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway.
-
Cheating by Exploitation of Developmental Prestalk Patterning in Dictyostelium discoideum
Khare, Anupama; Shaulsky, Gad
2010-01-01
The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters—strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC), a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway. PMID:20195510
-
Alternative Models to Deliver Developmental Math: Issues of Use and Student Access
Kosiewicz, Holly; Ngo, Federick; Fong, Kristen
2016-01-01
Objective: Changing how community colleges deliver developmental education has become a key policy lever to increase student achievement. Alternative development education models reduce the amount of time a student spends in remediation, provide students with supplemental instruction and support, and contextualize content to align with student…
-
Effects of Phytosterol in Feed on Growth and Related Gene ...
African Journals Online (AJOL)
depressed antioxidant defence systems in the broiler chickens. Myogen, eIF4E, and S6k1 gene ... Furthermore, the data suggest that developmental decline in skeletal muscle protein synthesis, may be partly attributed to developmental regulation of the activation of growth factor and nutrient components. Keywords: Broiler ...
-
Directory of Open Access Journals (Sweden)
Jinyi Liu
Full Text Available Growth regulating factors (GRFs are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.
-
International Nuclear Information System (INIS)
Seng, Shanshan; Wu, Jian; Sui, Juanjuan; Wu, Chenyu; Zhong, Xionghui; Liu, Chen; Liu, Chao; Gong, Benhe; Zhang, Fengqin; He, Junna; Yi, Mingfang
2016-01-01
Starch is the main storage compound in underground organs like corms. ADP-glucose pyrophosphorylase (AGPase) plays a key role in regulating starch biosynthesis in storage organs and is likely one of the most important determinant of sink strength. Here, we identify an AGPase gene (GhAGPS1) from gladiolus. The highest transcriptional levels of GhAGPS1 were observed in cormels and corms. Transformation of GhAGPS1 into Arabidopsis rescued the phenotype of aps1 mutant. Silencing GhAGPS1 in gladiolus corms by virus-induced gene silencing (VIGS) decreased the transcriptional levels of two genes and starch content. Transmission electron microscopy analyses of leaf and corm sections confirmed that starch biosynthesis was inhibited. Corm weight and cormel number reduced significantly in the silenced plants. Taken together, these results indicate that inhibiting the expression of AGPase gene could impair starch synthesis, which results in the lowered corm quality and cormel yield in gladiolus. -- Highlights: •Cormel quantity was reduced significantly in silenced Gladiolus plants. •Corm quality was declined significantly in silenced Gladiolus plants. •Starch synthesis was inhibited in silenced Gladiolus plants.
-
Energy Technology Data Exchange (ETDEWEB)
Seng, Shanshan, E-mail: seshsh108@126.com [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); Wu, Jian [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); Sui, Juanjuan [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); College of Biology, Fuyang Normal College, Qinghe Western Road 100#, Fuyang 236037, Anhui (China); Wu, Chenyu; Zhong, Xionghui; Liu, Chen; Liu, Chao; Gong, Benhe; Zhang, Fengqin; He, Junna [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China); Yi, Mingfang, E-mail: ymfang@cau.edu.cn [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Yuan Mingyuan Western Road 2#, Beijing 100193 (China)
2016-05-20
Starch is the main storage compound in underground organs like corms. ADP-glucose pyrophosphorylase (AGPase) plays a key role in regulating starch biosynthesis in storage organs and is likely one of the most important determinant of sink strength. Here, we identify an AGPase gene (GhAGPS1) from gladiolus. The highest transcriptional levels of GhAGPS1 were observed in cormels and corms. Transformation of GhAGPS1 into Arabidopsis rescued the phenotype of aps1 mutant. Silencing GhAGPS1 in gladiolus corms by virus-induced gene silencing (VIGS) decreased the transcriptional levels of two genes and starch content. Transmission electron microscopy analyses of leaf and corm sections confirmed that starch biosynthesis was inhibited. Corm weight and cormel number reduced significantly in the silenced plants. Taken together, these results indicate that inhibiting the expression of AGPase gene could impair starch synthesis, which results in the lowered corm quality and cormel yield in gladiolus. -- Highlights: •Cormel quantity was reduced significantly in silenced Gladiolus plants. •Corm quality was declined significantly in silenced Gladiolus plants. •Starch synthesis was inhibited in silenced Gladiolus plants.
-
Directory of Open Access Journals (Sweden)
Lu Zhang
2017-09-01
Full Text Available The brown planthopper, Nilaparvata lugens is one of the most serious pests of rice, and there is so far no effective way to manage this pest. However, RNA interference not only can be used to study gene function, but also provide potential opportunities for novel pest management. The development of wing plays a key role in insect physiological activities and mainly involves chitin. Hence, the regulating role of trehalase (TRE genes on wing bud formation has been studied by RNAi. In this paper, the activity levels of TRE and the contents of the two sugars trehalose and glucose were negatively correlated indicating the potential role of TRE in the molting process. In addition, NlTRE1-1 and NlTRE2 were expressed at higher levels in wing bud tissue than in other tissues, and abnormal molting and wing deformity or curling were noted 48 h after the insect was injected with any double-stranded TRE (dsTRE, even though different TREs have compensatory functions. The expression levels of NlCHS1b, NlCht1, NlCht2, NlCht6, NlCht7, NlCht8, NlCht10, NlIDGF, and NlENGase decreased significantly 48 h after the insect was injected with a mixture of three kinds of dsTREs. Similarly, the TRE inhibitor validamycin can inhibit NlCHS1 and NlCht gene expression. However, the wing deformity was the result of the NlIDGF, NlENGase, NlAP, and NlTSH genes being inhibited when a single dsTRE was injected. These results demonstrate that silencing of TRE gene expression can lead to wing deformities due to the down-regulation of the AP and TSH genes involved in wing development and that the TRE inhibitor validamycin can co-regulate chitin metabolism and the expression of wing development-related genes in wing bud tissue. The results provide a new approach for the prevention and management of N. lugens.
-
Zhang, Lu; Qiu, Ling-Yu; Yang, Hui-Li; Wang, Hui-Juan; Zhou, Min; Wang, Shi-Gui; Tang, Bin
2017-01-01
The brown planthopper, Nilaparvata lugens is one of the most serious pests of rice, and there is so far no effective way to manage this pest. However, RNA interference not only can be used to study gene function, but also provide potential opportunities for novel pest management. The development of wing plays a key role in insect physiological activities and mainly involves chitin. Hence, the regulating role of trehalase (TRE) genes on wing bud formation has been studied by RNAi. In this paper, the activity levels of TRE and the contents of the two sugars trehalose and glucose were negatively correlated indicating the potential role of TRE in the molting process. In addition, NlTRE1-1 and NlTRE2 were expressed at higher levels in wing bud tissue than in other tissues, and abnormal molting and wing deformity or curling were noted 48 h after the insect was injected with any double-stranded TRE ( dsTRE ), even though different TREs have compensatory functions. The expression levels of NlCHS1b, NlCht1, NlCht2, NlCht6, NlCht7, NlCht8, NlCht10, NlIDGF , and NlENGase decreased significantly 48 h after the insect was injected with a mixture of three kinds of dsTREs . Similarly, the TRE inhibitor validamycin can inhibit NlCHS1 and NlCht gene expression. However, the wing deformity was the result of the NlIDGF, NlENGase, NlAP , and NlTSH genes being inhibited when a single dsTRE was injected. These results demonstrate that silencing of TRE gene expression can lead to wing deformities due to the down-regulation of the AP and TSH genes involved in wing development and that the TRE inhibitor validamycin can co-regulate chitin metabolism and the expression of wing development-related genes in wing bud tissue. The results provide a new approach for the prevention and management of N. lugens .
-
Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar
2018-02-01
Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.
-
International Nuclear Information System (INIS)
Werthmann, Britta; Marwan, Wolfgang
2017-01-01
The developmental switch to sporulation in Physarum polycephalum is a phytochrome-mediated far-red light-induced cell fate decision that synchronously encompasses the entire multinucleate plasmodial cell and is associated with extensive reprogramming of the transcriptome. By repeatedly taking samples of single cells after delivery of a light stimulus pulse, we analysed differential gene expression in two mutant strains and in a heterokaryon of the two strains all of which display a different propensity for making the cell fate decision. Multidimensional scaling of the gene expression data revealed individually different single cell trajectories eventually leading to sporulation. Characterization of the trajectories as walks through states of gene expression discretized by hierarchical clustering allowed the reconstruction of Petri nets that model and predict the observed behavior. Structural analyses of the Petri nets indicated stimulus- and genotype-dependence of both, single cell trajectories and of the quasipotential landscape through which these trajectories are taken. The Petri net-based approach to the analysis and decomposition of complex cellular responses and of complex mutant phenotypes may provide a scaffold for the data-driven reconstruction of causal molecular mechanisms that shape the topology of the quasipotential landscape. (paper)
-
Werthmann, Britta; Marwan, Wolfgang
2017-11-01
The developmental switch to sporulation in Physarum polycephalum is a phytochrome-mediated far-red light-induced cell fate decision that synchronously encompasses the entire multinucleate plasmodial cell and is associated with extensive reprogramming of the transcriptome. By repeatedly taking samples of single cells after delivery of a light stimulus pulse, we analysed differential gene expression in two mutant strains and in a heterokaryon of the two strains all of which display a different propensity for making the cell fate decision. Multidimensional scaling of the gene expression data revealed individually different single cell trajectories eventually leading to sporulation. Characterization of the trajectories as walks through states of gene expression discretized by hierarchical clustering allowed the reconstruction of Petri nets that model and predict the observed behavior. Structural analyses of the Petri nets indicated stimulus- and genotype-dependence of both, single cell trajectories and of the quasipotential landscape through which these trajectories are taken. The Petri net-based approach to the analysis and decomposition of complex cellular responses and of complex mutant phenotypes may provide a scaffold for the data-driven reconstruction of causal molecular mechanisms that shape the topology of the quasipotential landscape.
-
Utility of Small Animal Models of Developmental Programming.
Reynolds, Clare M; Vickers, Mark H
2018-01-01
Any effective strategy to tackle the global obesity and rising noncommunicable disease epidemic requires an in-depth understanding of the mechanisms that underlie these conditions that manifest as a consequence of complex gene-environment interactions. In this context, it is now well established that alterations in the early life environment, including suboptimal nutrition, can result in an increased risk for a range of metabolic, cardiovascular, and behavioral disorders in later life, a process preferentially termed developmental programming. To date, most of the mechanistic knowledge around the processes underpinning development programming has been derived from preclinical research performed mostly, but not exclusively, in laboratory mouse and rat strains. This review will cover the utility of small animal models in developmental programming, the limitations of such models, and potential future directions that are required to fully maximize information derived from preclinical models in order to effectively translate to clinical use.
-
Directory of Open Access Journals (Sweden)
Jeanne A. Robert
2016-07-01
Full Text Available Cold-induced mortality has historically been a key aspect of mountain pine beetle, Dendroctonus ponderosae Hopkins (Coleoptera: Curculionidae, population control, but little is known about the molecular basis for cold tolerance in this insect. We used RNA-seq analysis to monitor gene expression patterns of mountain pine beetle larvae at four time points during their overwintering period—early-autumn, late-autumn, early-spring, and late-spring. Changing transcript profiles over the winter indicates a multipronged physiological response from larvae that is broadly characterized by gene transcripts involved in insect immune responses and detoxification during the autumn. In the spring, although transcripts associated with developmental process are present, there was no particular biological process dominating the transcriptome.
-
Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut
2014-01-01
Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional
-
Directory of Open Access Journals (Sweden)
Shazia Micheal
Full Text Available Primary congenital glaucoma (PCG is the most common form of glaucoma in children. PCG occurs due to the developmental defects in the trabecular meshwork and anterior chamber of the eye. The purpose of this study is to identify the causative genetic variants in three families with developmental and primary congenital glaucoma (PCG with a recessive inheritance pattern.DNA samples were obtained from consanguineous families of Pakistani ancestry. The CYP1B1 gene was sequenced in the affected probands by conventional Sanger DNA sequencing. Whole exome sequencing (WES was performed in DNA samples of four individuals belonging to three different CYP1B1-negative families. Variants identified by WES were validated by Sanger sequencing.WES identified potentially causative novel mutations in the latent transforming growth factor beta binding protein 2 (LTBP2 gene in two PCG families. In the first family a novel missense mutation (c.4934G>A; p.Arg1645Glu co-segregates with the disease phenotype, and in the second family a novel frameshift mutation (c.4031_4032insA; p.Asp1345Glyfs*6 was identified. In a third family with developmental glaucoma a novel mutation (c.3496G>A; p.Gly1166Arg was identified in the PXDN gene, which segregates with the disease.We identified three novel mutations in glaucoma families using WES; two in the LTBP2 gene and one in the PXDN gene. The results will not only enhance our current understanding of the genetic basis of glaucoma, but may also contribute to a better understanding of the diverse phenotypic consequences caused by mutations in these genes.
-
Deak, Terrence; Quinn, Matt; Cidlowski, John A; Victoria, Nicole C; Murphy, Anne Z; Sheridan, John F
2015-01-01
The last decade has witnessed profound growth in studies examining the role of fundamental neuroimmune processes as key mechanisms that might form a natural bridge between normal physiology and pathological outcomes. Rooted in core concepts from psychoneuroimmunology, this review utilizes a succinct, exemplar-driven approach of several model systems that contribute significantly to our knowledge of the mechanisms by which neuroimmune processes interact with stress physiology. Specifically, we review recent evidence showing that (i) stress challenges produce time-dependent and stressor-specific patterns of cytokine/chemokine expression in the CNS; (ii) inflammation-related genes exhibit unique expression profiles in males and females depending upon individual, cooperative or antagonistic interactions between steroid hormone receptors (estrogen and glucocorticoid receptors); (iii) adverse social experiences incurred through repeated social defeat engage a dynamic process of immune cell migration from the bone marrow to brain and prime neuroimmune function and (iv) early developmental exposure to an inflammatory stimulus (carageenin injection into the hindpaw) has a lasting influence on stress reactivity across the lifespan. As such, the present review provides a theoretical framework for understanding the role that neuroimmune mechanisms might play in stress plasticity and pathological outcomes, while at the same time pointing toward features of the individual (sex, developmental experience, stress history) that might ultimately be used for the development of personalized strategies for therapeutic intervention in stress-related pathologies.
-
Development of Fourier domain optical coherence tomography for applications in developmental biology
Davis, Anjul Maheshwari
Developmental biology is a field in which explorations are made to answer how an organism transforms from a single cell to a complex system made up of trillions of highly organized and highly specified cells. This field, however, is not just for discovery, it is crucial for unlocking factors that lead to diseases, defects, or malformations. The one key ingredient that contributes to the success of studies in developmental biology is the technology that is available for use. Optical coherence tomography (OCT) is one such technology. OCT fills a niche between the high resolution of confocal microscopy and deep imaging penetration of ultrasound. Developmental studies of the chicken embryo heart are of great interest. Studies in mature hearts, zebrafish animal models, and to a more limited degree chicken embryos, indicate a relationship between blood flow and development. It is believed that at the earliest stages, when the heart is still a tube, the purpose of blood flow is not for convective transport of oxygen, nutrients and waster, bur rather to induce shear-related gene expressions to induce further development. Yet, to this date, the simple question of "what makes blood flow?" has not been answered. This is mainly due limited availability to adequate imaging and blood flow measurement tools. Earlier work has demonstrated the potential of OCT for use in studying chicken embryo heart development, however quantitative measurement techniques still needed to be developed. In this dissertation I present technological developments I have made towards building an OCT system to study chick embryo heart development. I will describe: (1) a swept-source OCT with extended imaging depth; (2) a spectral domain OCT system for non-invasive small animal imaging; (3) Doppler flow imaging and techniques for quantitative blood flow measurement in living chicken embryos; and (4) application of the OCT system that was developed in the Specific Aims 2-5 to test hypotheses generated by a
-
When words fail us: insights into language processing from developmental and acquired disorders.
Bishop, Dorothy V M; Nation, Kate; Patterson, Karalyn
2014-01-01
Acquired disorders of language represent loss of previously acquired skills, usually with relatively specific impairments. In children with developmental disorders of language, we may also see selective impairment in some skills; but in this case, the acquisition of language or literacy is affected from the outset. Because systems for processing spoken and written language change as they develop, we should beware of drawing too close a parallel between developmental and acquired disorders. Nevertheless, comparisons between the two may yield new insights. A key feature of connectionist models simulating acquired disorders is the interaction of components of language processing with each other and with other cognitive domains. This kind of model might help make sense of patterns of comorbidity in developmental disorders. Meanwhile, the study of developmental disorders emphasizes learning and change in underlying representations, allowing us to study how heterogeneity in cognitive profile may relate not just to neurobiology but also to experience. Children with persistent language difficulties pose challenges both to our efforts at intervention and to theories of learning of written and spoken language. Future attention to learning in individuals with developmental and acquired disorders could be of both theoretical and applied value.
-
Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat
2015-01-01
Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF.
-
Directory of Open Access Journals (Sweden)
Sushil Kumar Mohapatra
Full Text Available Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT has had a limited applicability due to very low (>1% live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF and Hand-made cloning (TE-HMC, and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF.
-
Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat
2015-01-01
Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF. PMID:26053554
-
N-3 polyunsaturated fatty acid DHA during IVM affected oocyte developmental competence in cattle.
Oseikria, Mouhamad; Elis, Sébastien; Maillard, Virginie; Corbin, Emilie; Uzbekova, Svetlana
2016-06-01
The positive effect of n-3 polyunsaturated fatty acids (FAs) on fertility in ruminants seems to be partly mediated through direct effects on the oocyte developmental potential. We aimed to investigate whether supplementation with physiological levels of docosahexaenoic acid (DHA, C22:6 n-3 polyunsaturated fatty acids) during IVM has an effect on oocyte maturation and in vitro embryo development in cattle. We reported that DHA (0, 1, 10, or 100 μM) had no effect on oocyte viability or maturation rate after 22-hour IVM. Incubation of oocyte-cumulus complexes with 1-μM DHA during IVM significantly increased (P DHA during IVM also induced a significant increase in the blastocyst rate at Day 7 after IVF as compared with control (30.6% vs. 17.6%, respectively) and tended to increase the number of cells in the blastocysts (97.1 ± 4.9 vs. 81.2 ± 5.3, respectively; P = 0.08). On the contrary, 10-μM DHA had no effects, whereas 100-μM DHA significantly decreased the cleavage rate compared with control (69.5% vs.78.8%, respectively) and the greater than 4-cell embryo rate at Day 2 after parthenogenetic activation (19.5% vs. 29.7%). As was shown by real-time polymerase chain reaction, negative effects of 100-μM DHA were associated with significant increase of progesterone synthesis by oocyte-cumulus complexes, a three-fold increase in expression level of FA transporter CD36 and a two-fold decrease of FA synthase FASN genes in cumulus cells (CCs) of corresponding oocytes. Docosahexaenoic acid at 1 and 10 μM had no effect on expression of those and other key lipid metabolism-related genes in CC. In conclusion, administration of a low physiological dose of DHA (1 μM) during IVM may have beneficial effects on oocyte developmental competence in vitro without affecting lipid metabolism gene expression in surrounding CCs, contrarily to 100 μM DHA which diminished oocyte quality associated with perturbation of lipid and steroid metabolism in CC. Copyright © 2016
-
Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M
2015-01-08
Hookworms infect nearly 700 million people, causing anemia and developmental stunting in heavy infections. Little is known about the genomic structure or gene regulation in hookworms, although recent publication of draft genome assemblies has allowed the first investigations of these topics to be undertaken. The transcription factor DAF-16 mediates multiple developmental pathways in the free living nematode Caenorhabditis elegans, and is involved in the recovery from the developmentally arrested L3 in hookworms. Identification of downstream targets of DAF-16 will provide a better understanding of the molecular mechanism of hookworm infection. Genomic Fragment 2.23 containing a DAF-16 binding element (DBE) was used to identify overlapping complementary expressed sequence tags (ESTs). These sequences were used to search a draft assembly of the Ancylostoma caninum genome, and identified two neighboring genes, snr-3 and lpp-1, in a tail-to-tail orientation. Expression patterns of both genes during parasitic development were determined by qRT-PCR. DAF-16 dependent cis-regulatory activity of fragment 2.23 was investigated using an in vitro reporter system. The snr-3 gene spans approximately 5.6 kb in the genome and contains 3 exons and 2 introns, and contains the DBE in its 3' untranslated region. Downstream from snr-3 in a tail-to-tail arrangement is the gene lpp-1. The lpp-1 gene spans more than 6 kb and contains 10 exons and 9 introns. The A. caninum genome contains 2 apparent splice variants, but there are 7 splice variants in the A. ceylanicum genome. While the gene order is similar, the gene structures of the hookworm genes differ from their C. elegans orthologs. Both genes show peak expression in the late L4 stage. Using a cell culture based expression system, fragment 2.23 was found to have both DAF-16-dependent promoter and enhancer activity that required an intact DBE. Two putative DAF-16 targets were identified by genome wide screening for DAF-16 binding
-
Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture
Energy Technology Data Exchange (ETDEWEB)
Robinson, Joshua F. [National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, Maastricht (Netherlands); Verhoef, Aart; Beelen, Vincent A. van; Pennings, Jeroen L.A. [National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Piersma, Aldert H., E-mail: aldert.piersma@rivm.nl [National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, Utrecht (Netherlands)
2012-10-01
The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing gene expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.
-
De Tiège, Alexis; Van de Peer, Yves; Braeckman, Johan; Tanghe, Koen B
2017-11-22
Although classical evolutionary theory, i.e., population genetics and the Modern Synthesis, was already implicitly 'gene-centred', the organism was, in practice, still generally regarded as the individual unit of which a population is composed. The gene-centred approach to evolution only reached a logical conclusion with the advent of the gene-selectionist or gene's eye view in the 1960s and 1970s. Whereas classical evolutionary theory can only work with (genotypically represented) fitness differences between individual organisms, gene-selectionism is capable of working with fitness differences among genes within the same organism and genome. Here, we explore the explanatory potential of 'intra-organismic' and 'intra-genomic' gene-selectionism, i.e., of a behavioural-ecological 'gene's eye view' on genetic, genomic and organismal evolution. First, we give a general outline of the framework and how it complements the-to some extent-still 'organism-centred' approach of classical evolutionary theory. Secondly, we give a more in-depth assessment of its explanatory potential for biological evolution, i.e., for Darwin's 'common descent with modification' or, more specifically, for 'historical continuity or homology with modular evolutionary change' as it has been studied by evolutionary developmental biology (evo-devo) during the last few decades. In contrast with classical evolutionary theory, evo-devo focuses on 'within-organism' developmental processes. Given the capacity of gene-selectionism to adopt an intra-organismal gene's eye view, we outline the relevance of the latter model for evo-devo. Overall, we aim for the conceptual integration between the gene's eye view on the one hand, and more organism-centred evolutionary models (both classical evolutionary theory and evo-devo) on the other.
-
Ozernov-Palchik, Ola; Gaab, Nadine
2016-01-01
Developmental dyslexia is an unexplained inability to acquire accurate or fluent reading that affects approximately 5–17% of children. Dyslexia is associated with structural and functional alterations in various brain regions that support reading. Neuroimaging studies in infants and pre-reading children suggest that these alterations predate reading instruction and reading failure, supporting the hypothesis that variant function in dyslexia susceptibility genes lead to atypical neural migration and/or axonal growth during early, most likely in utero, brain development. Yet, dyslexia is typically not diagnosed until a child has failed to learn to read as expected (usually in second grade or later). There is emerging evidence that neuroimaging measures, when combined with key behavioral measures, can enhance the accuracy of identification of dyslexia risk in prereading children but its sensitivity, specificity, and cost-efficiency is still unclear. Early identification of dyslexia risk carries important implications for dyslexia remediation and the amelioration of the psychosocial consequences commonly associated with reading failure. PMID:26836227
-
Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C
2002-05-01
Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.
-
Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M
2016-11-01
We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
Mutations of PTPN23 in developmental and epileptic encephalopathy
Sowada, Nadine
2017-10-31
Developmental and epileptic encephalopathies (DEE) are a heterogeneous group of neurodevelopmental disorders with poor prognosis. Recent discoveries have greatly expanded the repertoire of genes that are mutated in epileptic encephalopathies and DEE, often in a de novo fashion, but in many patients, the disease remains molecularly uncharacterized. Here, we describe a new form of DEE in patients with likely deleterious biallelic variants in PTPN23. The phenotype is characterized by early onset drug-resistant epilepsy, severe and global developmental delay, microcephaly, and sometimes premature death. PTPN23 encodes a tyrosine phosphatase with strong brain expression, and its knockout in mouse is embryonically lethal. Structural modeling supports a deleterious effect of the identified alleles. Our data suggest that PTPN23 mutations cause a rare severe form of autosomal-recessive DEE in humans, a finding that requires confirmation.
-
Directory of Open Access Journals (Sweden)
Karla Ramirez-Estrada
2017-06-01
Full Text Available Sterol glycosyltransferases (SGTs catalyze the glycosylation of the free hydroxyl group at C-3 position of sterols to produce sterol glycosides. Glycosylated sterols and free sterols are primarily located in cell membranes where in combination with other membrane-bound lipids play a key role in modulating their properties and functioning. In contrast to most plant species, those of the genus Solanum contain very high levels of glycosylated sterols, which in the case of tomato may account for more than 85% of the total sterol content. In this study, we report the identification and functional characterization of the four members of the tomato (Solanum lycopersicum cv. Micro-Tom SGT gene family. Expression of recombinant SlSGT proteins in E. coli cells and N. benthamiana leaves demonstrated the ability of the four enzymes to glycosylate different sterol species including cholesterol, brassicasterol, campesterol, stigmasterol, and β-sitosterol, which is consistent with the occurrence in their primary structure of the putative steroid-binding domain found in steroid UDP-glucuronosyltransferases and the UDP-sugar binding domain characteristic for a superfamily of nucleoside diphosphosugar glycosyltransferases. Subcellular localization studies based on fluorescence recovery after photobleaching and cell fractionation analyses revealed that the four tomato SGTs, like the Arabidopsis SGTs UGT80A2 and UGT80B1, localize into the cytosol and the PM, although there are clear differences in their relative distribution between these two cell fractions. The SlSGT genes have specialized but still largely overlapping expression patterns in different organs of tomato plants and throughout the different stages of fruit development and ripening. Moreover, they are differentially regulated in response to biotic and abiotic stress conditions. SlSGT4 expression increases markedly in response to osmotic, salt, and cold stress, as well as upon treatment with abscisic
-
GENETIC ANALYSIS OF ABSCISIC ACID BIOSYNTHESIS
Energy Technology Data Exchange (ETDEWEB)
MCCARTY D R
2012-01-10
The carotenoid cleavage dioxygenases (CCD) catalyze synthesis of a variety of apo-carotenoid secondary metabolites in plants, animals and bacteria. In plants, the reaction catalyzed by the 11, 12, 9-cis-epoxy carotenoid dioxygenase (NCED) is the first committed and key regulated step in synthesis of the plant hormone, abscisic acid (ABA). ABA is a key regulator of plant stress responses and has critical functions in normal root and seed development. The molecular mechanisms responsible for developmental control of ABA synthesis in plant tissues are poorly understood. Five of the nine CCD genes present in the Arabidopsis genome encode NCED's involved in control of ABA synthesis in the plant. This project is focused on functional analysis of these five AtNCED genes as a key to understanding developmental regulation of ABA synthesis and dissecting the role of ABA in plant development. For this purpose, the project developed a comprehensive set of gene knockouts in the AtNCED genes that facilitate genetic dissection of ABA synthesis. These mutants were used in combination with key molecular tools to address the following specific objectives: (1) the role of ABA synthesis in root development; (2) developmental control of ABA synthesis in seeds; (3) analysis of ATNCED over-expressers; (4) preliminary crystallography of the maize VP14 protein.
-
DNA demethylation activates genes in seed maternal integument development in rice (Oryza sativa L.).
Wang, Yifeng; Lin, Haiyan; Tong, Xiaohong; Hou, Yuxuan; Chang, Yuxiao; Zhang, Jian
2017-11-01
DNA methylation is an important epigenetic modification that regulates various plant developmental processes. Rice seed integument determines the seed size. However, the role of DNA methylation in its development remains largely unknown. Here, we report the first dynamic DNA methylomic profiling of rice maternal integument before and after pollination by using a whole-genome bisulfite deep sequencing approach. Analysis of DNA methylation patterns identified 4238 differentially methylated regions underpin 4112 differentially methylated genes, including GW2, DEP1, RGB1 and numerous other regulators participated in maternal integument development. Bisulfite sanger sequencing and qRT-PCR of six differentially methylated genes revealed extensive occurrence of DNA hypomethylation triggered by double fertilization at IAP compared with IBP, suggesting that DNA demethylation might be a key mechanism to activate numerous maternal controlling genes. These results presented here not only greatly expanded the rice methylome dataset, but also shed novel insight into the regulatory roles of DNA methylation in rice seed maternal integument development. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
-
Alteration of gene expression by alcohol exposure at early neurulation.
Zhou, Feng C; Zhao, Qianqian; Liu, Yunlong; Goodlett, Charles R; Liang, Tiebing; McClintick, Jeanette N; Edenberg, Howard J; Li, Lang
2011-02-21
We have previously demonstrated that alcohol exposure at early neurulation induces growth retardation, neural tube abnormalities, and alteration of DNA methylation. To explore the global gene expression changes which may underline these developmental defects, microarray analyses were performed in a whole embryo mouse culture model that allows control over alcohol and embryonic variables. Alcohol caused teratogenesis in brain, heart, forelimb, and optic vesicle; a subset of the embryos also showed cranial neural tube defects. In microarray analysis (accession number GSM9545), adopting hypothesis-driven Gene Set Enrichment Analysis (GSEA) informatics and intersection analysis of two independent experiments, we found that there was a collective reduction in expression of neural specification genes (neurogenin, Sox5, Bhlhe22), neural growth factor genes [Igf1, Efemp1, Klf10 (Tieg), and Edil3], and alteration of genes involved in cell growth, apoptosis, histone variants, eye and heart development. There was also a reduction of retinol binding protein 1 (Rbp1), and de novo expression of aldehyde dehydrogenase 1B1 (Aldh1B1). Remarkably, four key hematopoiesis genes (glycophorin A, adducin 2, beta-2 microglobulin, and ceruloplasmin) were absent after alcohol treatment, and histone variant genes were reduced. The down-regulation of the neurospecification and the neurotrophic genes were further confirmed by quantitative RT-PCR. Furthermore, the gene expression profile demonstrated distinct subgroups which corresponded with two distinct alcohol-related neural tube phenotypes: an open (ALC-NTO) and a closed neural tube (ALC-NTC). Further, the epidermal growth factor signaling pathway and histone variants were specifically altered in ALC-NTO, and a greater number of neurotrophic/growth factor genes were down-regulated in the ALC-NTO than in the ALC-NTC embryos. This study revealed a set of genes vulnerable to alcohol exposure and genes that were associated with neural tube
-
Berberine exposure triggers developmental effects on planarian regeneration.
Balestrini, Linda; Isolani, Maria Emilia; Pietra, Daniele; Borghini, Alice; Bianucci, Anna Maria; Deri, Paolo; Batistoni, Renata
2014-05-09
The mechanisms of action underlying the pharmacological properties of the natural alkaloid berberine still need investigation. Planarian regeneration is instrumental in deciphering developmental responses following drug exposure. Here we report the effects of berberine on regeneration in the planarian Dugesia japonica. Our findings demonstrate that this compound perturbs the regenerative pattern. By real-time PCR screening for the effects of berberine exposure on gene expression, we identified alterations in the transcriptional profile of genes representative of different tissues, as well as of genes involved in extracellular matrix (ECM) remodeling. Although berberine does not influence cell proliferation/apoptosis, our experiments prove that this compound causes abnormal regeneration of the planarian visual system. Potential berberine-induced cytotoxic effects were noticed in the intestine. Although we were unable to detect abnormalities in other structures, our findings, sustained by RNAi-based investigations, support the possibility that berberine effects are critically linked to anomalous ECM remodeling in treated planarians.
-
Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha
2008-04-01
The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.
-
Narla, S T; Lee, Y-W; Benson, C A; Sarder, P; Brennand, K J; Stachowiak, E K; Stachowiak, M K
2017-07-01
The watershed-hypothesis of schizophrenia asserts that over 200 different mutations dysregulate distinct pathways that converge on an unspecified common mechanism(s) that controls disease ontogeny. Consistent with this hypothesis, our RNA-sequencing of neuron committed cells (NCCs) differentiated from established iPSCs of 4 schizophrenia patients and 4 control subjects uncovered a dysregulated transcriptome of 1349 mRNAs common to all patients. Data reveals a global dysregulation of developmental genome, deconstruction of coordinated mRNA networks, and the formation of aberrant, new coordinated mRNA networks indicating a concerted action of the responsible factor(s). Sequencing of miRNA transcriptomes demonstrated an overexpression of 16 miRNAs and deconstruction of interactive miRNA-mRNA networks in schizophrenia NCCs. ChiPseq revealed that the nuclear (n) form of FGFR1, a pan-ontogenic regulator, is overexpressed in schizophrenia NCCs and overtargets dysregulated mRNA and miRNA genes. The nFGFR1 targeted 54% of all human gene promoters and 84.4% of schizophrenia dysregulated genes. The upregulated genes reside within major developmental pathways that control neurogenesis and neuron formation, whereas downregulated genes are involved in oligodendrogenesis. Our results indicate (i) an early (preneuronal) genomic etiology of schizophrenia, (ii) dysregulated genes and new coordinated gene networks are common to unrelated cases of schizophrenia, (iii) gene dysregulations are accompanied by increased nFGFR1-genome interactions, and (iv) modeling of increased nFGFR1 by an overexpression of a nFGFR1 lead to up or downregulation of selected genes as observed in schizophrenia NCCs. Together our results designate nFGFR1 signaling as a potential common dysregulated mechanism in investigated patients and potential therapeutic target in schizophrenia. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
-
Branjerdporn, Grace; Meredith, Pamela; Strong, Jenny; Garcia, Jenniffer
2017-03-01
Objectives Infant developmental outcomes may be influenced by a range of prenatal maternal characteristics. While there is some evidence to suggest that maternal-foetal attachment may be associated with infant developmental outcomes, there is a need to systematically review this evidence to guide future research and clinical practice. Methods Five electronic databases were systematically scanned. Key journals and reference lists were hand-searched. Papers were included if: (1) pregnant women were assessed for maternal-foetal attachment; (2) the infants were later assessed, under 2 years old, for any developmental outcome (e.g., social-emotional, cognition, motor, language, adaptive behaviour); and (3) they were published in English. Two independent reviewers used the STROBE checklist to appraise the quality of each paper. Results Of the 968 papers identified, eight were included in the review, and four of these were of low quality (infant temperament (n = 5), adaptive behaviour (e.g., colic, sleep) (n = 2), and milestone attainment (n = 1). There is some evidence to suggest that lower maternal-foetal attachment is related to suboptimal developmental outcomes. However, these results should be interpreted with caution due to the limited and low quality studies available. Conclusions Although maternal-foetal attachment may be associated with infant developmental outcomes, future research is required which: (1) considers a range of developmental outcomes, (2) has increased scientific rigour, (3) assesses mother-infant dyads at different prenatal and postnatal time points, and (4) examines different target populations.
-
Modularity of gene-regulatory networks revealed in sea-star development
Directory of Open Access Journals (Sweden)
Degnan Bernard M
2011-01-01
Full Text Available Abstract Evidence that conserved developmental gene-regulatory networks can change as a unit during deutersostome evolution emerges from a study published in BMC Biology. This shows that genes consistently expressed in anterior brain patterning in hemichordates and chordates are expressed in a similar spatial pattern in another deuterostome, an asteroid echinoderm (sea star, but in a completely different developmental context (the animal-vegetal axis. This observation has implications for hypotheses on the type of development present in the deuterostome common ancestor. See research article: http://www.biomedcentral.com/1741-7007/8/143/abstract
-
Yin, Juxin; Zhang, Daihui; Zhuang, Jianjian; Huang, Yi; Mu, Ying; Lv, Shaowu
2017-12-11
Panax ginseng is a traditional medicine. Fresh ginseng is one of the most important industries related to ginseng development, and fresh ginseng of varying ages has different medicinal properties. Previous research has not systematically reported the correlation between changes in key enzyme activity with changes in ginsenoside content in fresh ginseng over time. In this study, for the first time, we use ginseng samples of varying ages in Ji'an and systematically reported the changes in the activity of seven key enzymes (HMGR, FPS, SS, SE, DS, CYP450, and GT). We investigated the content of ginsenoside and gene expression of these key enzymes. Ginsenoside content was measured using HPLC. HPLC, GC-MS, and LC-MS were combined to measure the enzyme activity of the key enzymes. Quantitative PCR was used in the investigation of gene expression. By analyzing the correlation between the enzyme activity and the transcription level of the key enzymes with ginsenoside content, we found that DS and GT enzyme activities are significantly correlated with the ginsenoside content in different ages of ginseng. Our findings might provide a new strategy to discriminate between ginseng of different years. Meanwhile, this research provides important information for the in-depth study of ginsenoside biosynthesis.
-
Gene Expression Patterns Underlying the Reinstatement of Plasticity in the Adult Visual System
Directory of Open Access Journals (Sweden)
Ettore Tiraboschi
2013-01-01
Full Text Available The nervous system is highly sensitive to experience during early postnatal life, but this phase of heightened plasticity decreases with age. Recent studies have demonstrated that developmental-like plasticity can be reactivated in the visual cortex of adult animals through environmental or pharmacological manipulations. These findings provide a unique opportunity to study the cellular and molecular mechanisms of adult plasticity. Here we used the monocular deprivation paradigm to investigate large-scale gene expression patterns underlying the reinstatement of plasticity produced by fluoxetine in the adult rat visual cortex. We found changes, confirmed with RT-PCRs, in gene expression in different biological themes, such as chromatin structure remodelling, transcription factors, molecules involved in synaptic plasticity, extracellular matrix, and excitatory and inhibitory neurotransmission. Our findings reveal a key role for several molecules such as the metalloproteases Mmp2 and Mmp9 or the glycoprotein Reelin and open up new insights into the mechanisms underlying the reopening of the critical periods in the adult brain.
-
Julkowska, Magdalena
2016-02-11
Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.
-
Kaneko-Ishino, Tomoko; Ishino, Fumitoshi
2015-01-01
Mammals, including human beings, have evolved a unique viviparous reproductive system and a highly developed central nervous system. How did these unique characteristics emerge in mammalian evolution, and what kinds of changes did occur in the mammalian genomes as evolution proceeded? A key conceptual term in approaching these issues is "mammalian-specific genomic functions", a concept covering both mammalian-specific epigenetics and genetics. Genomic imprinting and LTR retrotransposon-derived genes are reviewed as the representative, mammalian-specific genomic functions that are essential not only for the current mammalian developmental system, but also mammalian evolution itself. First, the essential roles of genomic imprinting in mammalian development, especially related to viviparous reproduction via placental function, as well as the emergence of genomic imprinting in mammalian evolution, are discussed. Second, we introduce the novel concept of "mammalian-specific traits generated by mammalian-specific genes from LTR retrotransposons", based on the finding that LTR retrotransposons served as a critical driving force in the mammalian evolution via generating mammalian-specific genes.
-
Jockusch, Elizabeth L
2017-09-01
Jointed, segmented appendages are a key innovation of arthropods. The subsequent diversification of these appendages, both along the body axis and across taxa, has contributed to the evolutionary success of arthropods. Both developmental and fossil data are informative for understanding how these transitions occurred. Comparative analyses help to pinpoint the developmental novelties that distinguish arthropod appendages from the lobopodous appendages of other panarthropods, and that distinguish different appendage types. The fossil record of stem group arthropods is diverse and preserves intermediate steps in these evolutionary transitions, including some that cannot be directly inferred based on extant taxa. These lead to hypotheses that can be tested with comparative developmental data, as well as to reinterpretations of developmental results. One developmental novelty of arthropods is the reiterated deployment of the joint formation network, which divides the appendages into segments. The fossil record raises questions about how this joint formation network was first deployed, given the contrasting morphologies of appendages in stem group versus extant arthropods. The fossil record supports a character tree for appendage diversification showing progressive individuation of appendages in an anterior-to-posterior sequence. However, to date, developmental evidence provides at best limited support for this character tree. Recent interpretations of the fossil record suggest that the labrum of extant arthropods is a greatly reduced protocerebral appendage pair; this hypothesis is consistent with the extensive shared developmental patterning of the labrum and jointed appendages. Reciprocal illumination from fossils and developmental patterning in a phylogenetic context both makes sense of some results and helps motivates questions for future research. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative
-
Ikram, Sobia; Durandet, Monique; Vesa, Simona; Pereira, Serge; Guerche, Philippe; Bonhomme, Sandrine
2014-06-01
F-box protein genes family is one of the largest gene families in plants, with almost 700 predicted genes in the model plant Arabidopsis. F-box proteins are key components of the ubiquitin proteasome system that allows targeted protein degradation. Transcriptome analyses indicate that half of these F-box protein genes are found expressed in microspore and/or pollen, i.e., during male gametogenesis. To assess the role of F-box protein genes during this crucial developmental step, we selected 34 F-box protein genes recorded as highly and specifically expressed in pollen and isolated corresponding insertion mutants. We checked the expression level of each selected gene by RT-PCR and confirmed pollen expression for 25 genes, but specific expression for only 10 of the 34 F-box protein genes. In addition, we tested the expression level of selected F-box protein genes in 24 mutant lines and showed that 11 of them were null mutants. Transmission analysis of the mutations to the progeny showed that none of the single mutations was gametophytic lethal. These unaffected transmission efficiencies suggested leaky mutations or functional redundancy among F-box protein genes. Cytological observation of the gametophytes in the mutants confirmed these results. Combinations of mutations in F-box protein genes from the same subfamily did not lead to transmission defect either, further highlighting functional redundancy and/or a high proportion of pseudogenes among these F-box protein genes.
-
Mueller, Michael M; Castells-Roca, Laia; Babu, Vipin; Ermolaeva, Maria A; Müller, Roman-Ulrich; Frommolt, Peter; Williams, Ashley B; Greiss, Sebastian; Schneider, Jennifer I; Benzing, Thomas; Schermer, Bernhard; Schumacher, Björn
2014-12-01
Genome maintenance defects cause complex disease phenotypes characterized by developmental failure, cancer susceptibility and premature ageing. It remains poorly understood how DNA damage responses function during organismal development and maintain tissue functionality when DNA damage accumulates with ageing. Here we show that the FOXO transcription factor DAF-16 is activated in response to DNA damage during development, whereas the DNA damage responsiveness of DAF-16 declines with ageing. We find that in contrast to its established role in mediating starvation arrest, DAF-16 alleviates DNA-damage-induced developmental arrest and even in the absence of DNA repair promotes developmental growth and enhances somatic tissue functionality. We demonstrate that the GATA transcription factor EGL-27 co-regulates DAF-16 target genes in response to DNA damage and together with DAF-16 promotes developmental growth. We propose that EGL-27/GATA activity specifies DAF-16-mediated DNA damage responses to enable developmental progression and to prolong tissue functioning when DNA damage persists.
-
The Domain of Developmental Psychopathology.
Sroufe, L. Alan; Rutter, Michael
1984-01-01
Describes how developmental psychopathology differs from related disciplines, including abnormal psychology, psychiatry, clinical child psychology, and developmental psychology. Points out propositions underlying a developmental perspective and discusses implications for research in developmental psychopathology. (Author/RH)
-
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867
-
Directory of Open Access Journals (Sweden)
Lei Gao
Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
-
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
-
Selection of Reference Genes for Expression Studies in Diaphorina citri (Hemiptera: Liviidae).
Bassan, Meire Menezes; Angelotti-Mendonc A, Je Ssika; Alves, Gustavo Rodrigues; Yamamoto, Pedro Takao; Moura O Filho, Francisco de Assis Alves
2017-12-05
The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is considered the main vector of the bacteria associated with huanglongbing, a very serious disease that has threatened the world citrus industry. The absence of efficient control management protocols, including a lack of resistant cultivars, has led to the development of different approaches to study this pathosystem. The production of resistant genotypes relies on D. citri gene expression analyses by RT-qPCR to assess control of the vector population. High-quality, reliable RT-qPCR analyses depend upon proper reference gene selection and validation. However, adequate D. citri reference genes have not yet been identified. In the present study, we evaluated the genes EF 1-α, ACT, GAPDH, RPL7, RPL17, and TUB as candidate reference genes for this insect. Gene expression stability was evaluated using the mathematical algorithms deltaCt, NormFinder, BestKeeper, and geNorm, at five insect developmental stages, grown on two different plant hosts [Citrus sinensis (L.) Osbeck (Sapindales: Rutaceae) and Murraya paniculata (L.) Jack (Sapindales: Rutaceae)]. The final gene ranking was calculated using RefFinder software, and the V-ATPase-A gene was selected for validation. According to our results, two reference genes are recommended when different plant hosts and developmental stages are considered. Considering gene expression studies in D. citri grown on M. paniculata, regardless of the insect developmental stage, GAPDH and RPL7 have the best fit as reference genes in RT-qPCR analyses, whereas GAPDH and EF 1-α are recommended as reference genes in insect studies using C. sinensis. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
-
Life Span Developmental Approach
Directory of Open Access Journals (Sweden)
Ali Eryilmaz
2011-03-01
Full Text Available The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of individuals with respect to developmental stages. This developmental approach suggests that scientific disciplines should not explain developmental facts only with age changes. Along with aging, cognitive, biological, and socioemotional development throughout life should also be considered to provide a reasonable and acceptable context, guideposts, and reasonable expectations for the person. There are three important subjects whom life span developmental approach deals with. These are nature vs nurture, continuity vs discontinuity, and change vs stability. Researchers using life span developmental approach gather and produce knowledge on these three most important domains of individual development with their unique scientific methodology.
-
International Nuclear Information System (INIS)
Aluru, Neelakanteswar; Kuo, Elaine; Helfrich, Lily W.; Karchner, Sibel I.; Linney, Elwood A.; Pais, June E.; Franks, Diana G.
2015-01-01
DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNA methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt
-
Energy Technology Data Exchange (ETDEWEB)
Aluru, Neelakanteswar, E-mail: naluru@whoi.edu [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Kuo, Elaine [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stanford University, 450 Serra Mall, Stanford, CA 94305 (United States); Helfrich, Lily W. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Northwestern University, 633 Clark St, Evanston, IL 60208 (United States); Karchner, Sibel I. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Linney, Elwood A. [Department of Molecular Genetics and Microbiology, Duke University Medical Center, Box 3020, Durham, NC 27710 (United States); Pais, June E. [New England Biolabs, 240 County Road, Ipswich, MA 01938 (United States); Franks, Diana G. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)
2015-04-15
DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNA methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt
-
International Nuclear Information System (INIS)
Colman, Joan; Rice, Glenn E.; Wright, J. Michael; Hunter, E. Sidney; Teuschler, Linda K.; Lipscomb, John C.; Hertzberg, Richard C.; Simmons, Jane Ellen; Fransen, Margaret; Osier, Mark; Narotsky, Michael G.
2011-01-01
Reactions between chemicals used to disinfect drinking water and compounds present in source waters produce chemical mixtures containing hundreds of disinfection byproducts (DBPs). Although the results have been somewhat inconsistent, some epidemiological studies suggest associations may exist between DBP exposures and adverse developmental outcomes. The potencies of individual DBPs in rodent and rabbit developmental bioassays suggest that no individual DBP can account for the relative risk estimates reported in the positive epidemiologic studies, leading to the hypothesis that these outcomes could result from the toxicity of DBP mixtures. As a first step in a mixtures risk assessment for DBP developmental effects, this paper identifies developmentally toxic DBPs and examines data relevant to the mode of action (MOA) for DBP developmental toxicity. We identified 24 developmentally toxic DBPs and four adverse developmental outcomes associated with human DBP exposures: spontaneous abortion, cardiovascular defects, neural tube defects, and low birth weight infancy. A plausible MOA, involving hormonal disruption of pregnancy, is delineated for spontaneous abortion, which some epidemiologic studies associate with total trihalomethane and bromodichloromethane exposures. The DBP data for the other three outcomes were inadequate to define key MOA steps.
-
Keifer, Joyce
2017-02-11
Learning genes in mature neurons are uniquely suited to respond rapidly to specific environmental stimuli. Expression of individual learning genes, therefore, requires regulatory mechanisms that have the flexibility to respond with transcriptional activation or repression to select appropriate physiological and behavioral responses. Among the mechanisms that equip genes to respond adaptively are bivalent domains. These are specific histone modifications localized to gene promoters that are characteristic of both gene activation and repression, and have been studied primarily for developmental genes in embryonic stem cells. In this review, studies of the epigenetic regulation of learning genes in neurons, particularly the brain-derived neurotrophic factor gene ( BDNF ), by methylation/demethylation and chromatin modifications in the context of learning and memory will be highlighted. Because of the unique function of learning genes in the mature brain, it is proposed that bivalent domains are a characteristic feature of the chromatin landscape surrounding their promoters. This allows them to be "poised" for rapid response to activate or repress gene expression depending on environmental stimuli.
-
Ruiz-Estévez, Mercedes; Bakkali, Mohammed; Martín-Blázquez, Rubén; Garrido-Ramos, Manuel A
2017-10-17
We report and discuss the results of a quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of the expression patterns of seven three amino acid loop extension ( TALE ) homeobox genes (four KNOTTED-like homeobox ( KNOX ) and three BEL1-like homeobox ( BELL ) genes) identified after next generation sequencing (NGS) and assembly of the sporophyte and gametophyte transcriptomes of the endangered fern species Vandenboschia speciosa . Among the four KNOX genes, two belonged to the KNOX1 class and the other two belonged to the KNOX2 class. Analysis of the deduced amino acid sequences supported the typical domain structure of both types of TALE proteins, and the homology to TALE proteins of mosses, lycophytes, and seed plant species. The expression analyses demonstrate that these homeodomain proteins appear to have a key role in the establishment and development of the gametophyte and sporophyte phases of V. speciosa lifecycle, as well as in the control of the transition between both phases. Vandenboschia speciosa VsKNAT3 (a KNOX2 class protein) as well as VsBELL4 and VsBELL10 proteins have higher expression levels during the sporophyte program. On the contrary, one V. speciosa KNOX1 protein (VsKNAT6) and one KNOX2 protein (VsKNAT4) seem important during the development of the gametophyte phase. TALE homeobox genes might be among the key regulators in the gametophyte-to-sporophyte developmental transition in regular populations that show alternation of generations, since some of the genes analyzed here ( VsKNAT3 , VsKNAT6 , VsBELL4 , and VsBELL6 ) are upregulated in a non-alternating population in which only independent gametophytes are found (they grow by vegetative reproduction outside of the range of sporophyte distribution). Thus, these four genes might trigger the vegetative propagation of the gametophyte and the repression of the sexual development in populations composed of independent gametophytes. This study represents a comprehensive
-
Jiang, Rui; Qi, Lan-Da; Du, Yu-Zhou; Li, Yuan-Xi
2017-10-01
Temperature plays an important role in the growth, development, and geographic distribution of insects. There is convincing evidence that heat-shock proteins (HSPs) play important roles in helping organisms adapt to thermal stress. To better understand the physiological and ecological influence of thermal stress on the different development stages of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Mediterranean species (MED), nymphs and adults were shocked with temperatures of 35, 38, and 41℃ for 1 and 2 h, respectively, and the survival rate, fecundity, and developmental duration were investigated in the laboratory. The expression levels of the hsp40, hsp70, and hsp90 genes were assessed using real-time PCR. The results indicate that the survival rates of the nymphs and adults decreased with increased temperature. A 2-h heat shock at 41℃ induced a significant reduction in fecundity in adults and an increase in developmental duration in young nymphs. Hsp90 showed higher temperature responses to thermal stress than hsp40 or hsp70. The expression levels of the hsps in the adults were significantly down-regulated by a 2-h heat shock at 41℃ compared with that by a 1-h treatment. A significant decrease in the expression levels of the hsps also occurred in the adults when the temperature increased from 38 to 41℃ for the 2-h treatment, whereas no significant decrease occurred in the nymphs. Compared with previous studies, we provide some evidence indicating that MED has the potential to adapt to a wider temperature range than the Middle East-Asia Minor 1 species. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
-
Can Nucleoli Be Markers of Developmental Potential in Human Zygotes?
Fulka, Helena; Kyogoku, Hirohisa; Zatsepina, Olga; Langerova, Alena; Fulka, Josef
2015-11-01
In 1999, Tesarik and Greco reported that they could predict the developmental potential of human zygotes from a single static evaluation of their pronuclei. This was based on the distribution and number of specific nuclear organelles - the nucleoli. Recent studies in mice show that nucleoli play a key role in parental genome restructuring after fertilization, and that interfering with this process may lead to developmental failure. These studies thus support the Tesarik-Greco evaluation as a potentially useful method for selecting high-quality embryos in human assisted reproductive technologies. In this opinion article we discuss recent evidence linking nucleoli to parental genome reprogramming, and ask whether nucleoli can mirror or be used as representative markers of embryonic parameters such as chromosome content or DNA fragmentation. Copyright © 2015 Elsevier Ltd. All rights reserved.
-
Burdon, Kathryn P; McKay, James D; Sale, Michèle M; Russell-Eggitt, Isabelle M; Mackey, David A; Wirth, M Gabriela; Elder, James E; Nicoll, Alan; Clarke, Michael P; FitzGerald, Liesel M; Stankovich, James M; Shaw, Marie A; Sharma, Shiwani; Gajovic, Srecko; Gruss, Peter; Ross, Shelley; Thomas, Paul; Voss, Anne K; Thomas, Tim; Gécz, Jozef; Craig, Jamie E
2003-11-01
Nance-Horan syndrome (NHS) is an X-linked disorder characterized by congenital cataracts, dental anomalies, dysmorphic features, and, in some cases, mental retardation. NHS has been mapped to a 1.3-Mb interval on Xp22.13. We have confirmed the same localization in the original, extended Australian family with NHS and have identified protein-truncating mutations in a novel gene, which we have called "NHS," in five families. The NHS gene encompasses approximately 650 kb of genomic DNA, coding for a 1,630-amino acid putative nuclear protein. NHS orthologs were found in other vertebrates, but no sequence similarity to known genes was identified. The murine developmental expression profile of the NHS gene was studied using in situ hybridization and a mouse line containing a lacZ reporter-gene insertion in the Nhs locus. We found a complex pattern of temporally and spatially regulated expression, which, together with the pleiotropic features of NHS, suggests that this gene has key functions in the regulation of eye, tooth, brain, and craniofacial development.
-
Superior Cross-Species Reference Genes: A Blueberry Case Study
Die, Jose V.; Rowland, Lisa J.
2013-01-01
The advent of affordable Next Generation Sequencing technologies has had major impact on studies of many crop species, where access to genomic technologies and genome-scale data sets has been extremely limited until now. The recent development of genomic resources in blueberry will enable the application of high throughput gene expression approaches that should relatively quickly increase our understanding of blueberry physiology. These studies, however, require a highly accurate and robust workflow and make necessary the identification of reference genes with high expression stability for correct target gene normalization. To create a set of superior reference genes for blueberry expression analyses, we mined a publicly available transcriptome data set from blueberry for orthologs to a set of Arabidopsis genes that showed the most stable expression in a developmental series. In total, the expression stability of 13 putative reference genes was evaluated by qPCR and a set of new references with high stability values across a developmental series in fruits and floral buds of blueberry were identified. We also demonstrated the need to use at least two, preferably three, reference genes to avoid inconsistencies in results, even when superior reference genes are used. The new references identified here provide a valuable resource for accurate normalization of gene expression in Vaccinium spp. and may be useful for other members of the Ericaceae family as well. PMID:24058469
-
Superior cross-species reference genes: a blueberry case study.
Directory of Open Access Journals (Sweden)
Jose V Die
Full Text Available The advent of affordable Next Generation Sequencing technologies has had major impact on studies of many crop species, where access to genomic technologies and genome-scale data sets has been extremely limited until now. The recent development of genomic resources in blueberry will enable the application of high throughput gene expression approaches that should relatively quickly increase our understanding of blueberry physiology. These studies, however, require a highly accurate and robust workflow and make necessary the identification of reference genes with high expression stability for correct target gene normalization. To create a set of superior reference genes for blueberry expression analyses, we mined a publicly available transcriptome data set from blueberry for orthologs to a set of Arabidopsis genes that showed the most stable expression in a developmental series. In total, the expression stability of 13 putative reference genes was evaluated by qPCR and a set of new references with high stability values across a developmental series in fruits and floral buds of blueberry were identified. We also demonstrated the need to use at least two, preferably three, reference genes to avoid inconsistencies in results, even when superior reference genes are used. The new references identified here provide a valuable resource for accurate normalization of gene expression in Vaccinium spp. and may be useful for other members of the Ericaceae family as well.
-
Role of developmental factors in hypothalamic function
Directory of Open Access Journals (Sweden)
Jakob eBiran
2015-04-01
Full Text Available The hypothalamus is a brain region which regulates homeostasis by mediating endocrine, autonomic and behavioral functions. It is comprised of several nuclei containing distinct neuronal populations producing neuropeptides and neurotransmitters that regulate fundamental body functions including temperature and metabolic rate, thirst and hunger, sexual behavior and reproduction, circadian rhythm, and emotional responses. The identity, number and connectivity of these neuronal populations are established during the organism’s development and are of crucial importance for normal hypothalamic function. Studies have suggested that developmental abnormalities in specific hypothalamic circuits can lead to obesity, sleep disorders, anxiety, depression and autism. At the molecular level, the development of the hypothalamus is regulated by transcription factors, secreted growth factors, neuropeptides and their receptors. Recent studies in zebrafish and mouse have demonstrated that some of these molecules maintain their expression in the adult brain and subsequently play a role in the physiological functions that are regulated by hypothalamic neurons. Here, we summarize the involvement of some of the key developmental factors in hypothalamic development and function by focusing on the mouse and zebrafish genetic model organisms.
-
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
-
Coughlin, Mary; Gibbins, Sharyn; Hoath, Steven
2009-10-01
This paper is a discussion of evidence-based core measures for developmental care in neonatal intensive care units. Inconsistent definition, application and evaluation of developmental care have resulted in criticism of its scientific merit. The key concept guiding data organization in this paper is the United States of America's Joint Commission's concept of 'core measures' for evaluating and accrediting healthcare organizations. This concept is applied to five disease- and procedure-independent measures based on the Universe of Developmental Care model. Electronically accessible, peer reviewed studies on developmental care published in English were culled for data supporting the selected objective core measures between 1978 and 2008. The quality of evidence was based on a structured predetermined format that included three independent reviewers. Systematic reviews and randomized control trials were considered the strongest level of evidence. When unavailable, cohort, case control, consensus statements and qualitative methods were considered the strongest level of evidence for a particular clinical issue. Five core measure sets for evidence-based developmental care were evaluated: (1) protected sleep, (2) pain and stress assessment and management, (3) developmental activities of daily living, (4) family-centred care, and (5) the healing environment. These five categories reflect recurring themes that emerged from the literature review regarding developmentally supportive care and quality caring practices in neonatal populations. This practice model provides clear metrics for nursing actions having an impact on the hospital experience of infant-family dyads. Standardized disease-independent core measures for developmental care establish minimum evidence-based practice expectations and offer an objective basis for cross-institutional comparison of developmental care programmes.
-
Association of Forced Vital Capacity with the Developmental Gene NCOR2.
Directory of Open Access Journals (Sweden)
Cosetta Minelli
Full Text Available Forced Vital Capacity (FVC is an important predictor of all-cause mortality in the absence of chronic respiratory conditions. Epidemiological evidence highlights the role of early life factors on adult FVC, pointing to environmental exposures and genes affecting lung development as risk factors for low FVC later in life. Although highly heritable, a small number of genes have been found associated with FVC, and we aimed at identifying further genetic variants by focusing on lung development genes.Per-allele effects of 24,728 SNPs in 403 genes involved in lung development were tested in 7,749 adults from three studies (NFBC1966, ECRHS, EGEA. The most significant SNP for the top 25 genes was followed-up in 46,103 adults (CHARGE and SpiroMeta consortia and 5,062 children (ALSPAC. Associations were considered replicated if the replication p-value survived Bonferroni correction (p<0.002; 0.05/25, with a nominal p-value considered as suggestive evidence. For SNPs with evidence of replication, effects on the expression levels of nearby genes in lung tissue were tested in 1,111 lung samples (Lung eQTL consortium, with further functional investigation performed using public epigenomic profiling data (ENCODE.NCOR2-rs12708369 showed strong replication in children (p = 0.0002, with replication unavailable in adults due to low imputation quality. This intronic variant is in a strong transcriptional enhancer element in lung fibroblasts, but its eQTL effects could not be tested due to low imputation quality in the eQTL dataset. SERPINE2-rs6754561 replicated at nominal level in both adults (p = 0.036 and children (p = 0.045, while WNT16-rs2707469 replicated at nominal level only in adults (p = 0.026. The eQTL analyses showed association of WNT16-rs2707469 with expression levels of the nearby gene CPED1. We found no statistically significant eQTL effects for SERPINE2-rs6754561.We have identified a new gene, NCOR2, in the retinoic acid signalling pathway pointing
-
Preliminary characterization of a death-related gene in silkworm ...
African Journals Online (AJOL)
Through RT-PCR analysis of death-related protein gene in different tissues and different developmental stage of B. mori, it showed the distributed condition of the gene. It was widely expressed in various tissues and mainly expressed in testis, malphigian vessels, posterior intestine, silk gland. Meanwhile, it was widely ...
-
Tracking and Quantifying Developmental Processes in C. elegans Using Open-source Tools.
Dutta, Priyanka; Lehmann, Christina; Odedra, Devang; Singh, Deepika; Pohl, Christian
2015-12-16
Quantitatively capturing developmental processes is crucial to derive mechanistic models and key to identify and describe mutant phenotypes. Here protocols are presented for preparing embryos and adult C. elegans animals for short- and long-term time-lapse microscopy and methods for tracking and quantification of developmental processes. The methods presented are all based on C. elegans strains available from the Caenorhabditis Genetics Center and on open-source software that can be easily implemented in any laboratory independently of the microscopy system used. A reconstruction of a 3D cell-shape model using the modelling software IMOD, manual tracking of fluorescently-labeled subcellular structures using the multi-purpose image analysis program Endrov, and an analysis of cortical contractile flow using PIVlab (Time-Resolved Digital Particle Image Velocimetry Tool for MATLAB) are shown. It is discussed how these methods can also be deployed to quantitatively capture other developmental processes in different models, e.g., cell tracking and lineage tracing, tracking of vesicle flow.
-
Autism Spectrum Disorder and High Confidence Gene Factors
Mai, MOCHIZUKI
2017-01-01
Autism spectrum disorder (ASD) is a neurological developmental disorder whose mechanism isyet unclear. However, recent ASD studies, which employ exome- and genome-wide sequencing,have identified some high-confidence ASD genes. Those ASD studies have revealed that CHD8is likely associated with ASD. In this article, we highlight that CHD8 may regulate othercandidate ASD risk genes. Current research indicates that there exist some thousand autismsusceptibility candidate genes. Moreover, we sugge...
-
Effect of Developmental Stimulation Program on the Developmental Measures of Toddlers
Directory of Open Access Journals (Sweden)
Elahe Ghayebie
2018-04-01
Full Text Available Background: The variability in the developmental skills is reduced after the first three years of life; therefore, it is necessary to identify and manage early developmental delays. Aim: The aim of this study was to investigate the effect of developmental stimulation program on the developmental measures of the toddlers. Method: The present randomized controlled clinical trial was conducted on 31 toddlers aged 1-3 years residing at Ali Asghar Foster Care Center within 2016-2017. Developmental interventions were carried out based on the modified guidelines of West Virginia Early Learning Standards Framework for eight weeks (three 2-hour sessions a week. The interventions included a range of age- and developmental-specific activities described in the given guidelines. Child development age was measured based on motor dimensions (i.e., gross and fine and language development (i.e., receptive and expressive before and after the intervention. The data were analyzed in SPSS software (version 11 using independent t-test and Chi-square test. Results: The mean ages of the participants in the control and intervention groups were 19.9±5.5 and 20±6.02, respectively (P=0.62. The mean ages of receptive language development (P=0.003, expressive language development (P
-
Analysis of flavonoids and the flavonoid structural genes in brown fiber of upland cotton.
Directory of Open Access Journals (Sweden)
Hongjie Feng
Full Text Available BACKGROUND: As a result of changing consumer preferences, cotton (Gossypium Hirsutum L. from varieties with naturally colored fibers is becoming increasingly sought after in the textile industry. The molecular mechanisms leading to colored fiber development are still largely unknown, although it is expected that the color is derived from flavanoids. EXPERIMENTAL DESIGN: Firstly, four key genes of the flavonoid biosynthetic pathway in cotton (GhC4H, GhCHS, GhF3'H, and GhF3'5'H were cloned and studied their expression profiles during the development of brown- and white cotton fibers by QRT-PCR. And then, the concentrations of four components of the flavonoid biosynthetic pathway, naringenin, quercetin, kaempferol and myricetin in brown- and white fibers were analyzed at different developmental stages by HPLC. RESULT: The predicted proteins of the four flavonoid structural genes corresponding to these genes exhibit strong sequence similarity to their counterparts in various plant species. Transcript levels for all four genes were considerably higher in developing brown fibers than in white fibers from a near isogenic line (NIL. The contents of four flavonoids (naringenin, quercetin, kaempferol and myricetin were significantly higher in brown than in white fibers and corresponding to the biosynthetic gene expression levels. CONCLUSIONS: Flavonoid structural gene expression and flavonoid metabolism are important in the development of pigmentation in brown cotton fibers.
-
Effect of triiodothyronine on developmental competence of bovine oocytes.
Costa, N N; Cordeiro, M S; Silva, T V G; Sastre, D; Santana, P P B; Sá, A L A; Sampaio, R V; Santos, S S D; Adona, P R; Miranda, M S; Ohashi, O M
2013-09-01
Developmental competence of in vitro-matured bovine oocytes is a limiting factor in production of embryos in vitro. Several studies have suggested a potential positive effect of thyroid hormones on cultured oocytes and/or their supporting cells. Therefore, the aim of the present study was to ascertain whether medium supplementation with triiodothyronine (T3) improved subsequent developmental competence of in vitro-matured bovine oocytes. For this purpose, we first documented (using reverse transcription PCR) that whereas bovine cumulus cells expressed both thyroid hormone receptor (TR)-α and TRβ, immature bovine oocytes expressed TRα only. Thereafter, to test the effects of TH on developmental competence, abattoir-derived oocytes were matured in vitro in a medium containing 0, 25, 50, or 100 nM T3 and subjected to in vitro fertilization. Embryo quality was evaluated by assessing cleavage and blastocyst rates, morphological quality, development kinetics, and total cell number on Day 8 of culture. Notably, addition of 50 or 100 nM T3 to the in vitro maturation medium increased (P 0.05) on gene expression. We concluded that supplementation of bovine oocyte in vitro maturation medium with T3 may have a beneficial effect on the kinetics of embryo development. Copyright © 2013 Elsevier Inc. All rights reserved.
-
Developmental programming of long non-coding RNAs during postnatal liver maturation in mice.
Directory of Open Access Journals (Sweden)
Lai Peng
Full Text Available The liver is a vital organ with critical functions in metabolism, protein synthesis, and immune defense. Most of the liver functions are not mature at birth and many changes happen during postnatal liver development. However, it is unclear what changes occur in liver after birth, at what developmental stages they occur, and how the developmental processes are regulated. Long non-coding RNAs (lncRNAs are involved in organ development and cell differentiation. Here, we analyzed the transcriptome of lncRNAs in mouse liver from perinatal (day -2 to adult (day 60 by RNA-Sequencing, with an attempt to understand the role of lncRNAs in liver maturation. We found around 15,000 genes expressed, including about 2,000 lncRNAs. Most lncRNAs were expressed at a lower level than coding RNAs. Both coding RNAs and lncRNAs displayed three major ontogenic patterns: enriched at neonatal, adolescent, or adult stages. Neighboring coding and non-coding RNAs showed the trend to exhibit highly correlated ontogenic expression patterns. Gene ontology (GO analysis revealed that some lncRNAs enriched at neonatal ages have their neighbor protein coding genes also enriched at neonatal ages and associated with cell proliferation, immune activation related processes, tissue organization pathways, and hematopoiesis; other lncRNAs enriched at adolescent ages have their neighbor protein coding genes associated with different metabolic processes. These data reveal significant functional transition during postnatal liver development and imply the potential importance of lncRNAs in liver maturation.
-
Key, Brian; Nurcombe, Victor
2003-01-01
This report describes the road map we followed at our university to accommodate three main factors: financial pressure within the university system; desire to enhance the learning experience of undergraduates; and motivation to increase the prominence of the discipline of developmental biology in our university. We engineered a novel, multi-year undergraduate developmental biology program which was "student-oriented," ensuring that students were continually exposed to the underlying principles and philosophy of this discipline throughout their undergraduate career. Among its key features are introductory lectures in core courses in the first year, which emphasize the relevance of developmental biology to tissue engineering, reproductive medicine, therapeutic approaches in medicine, agriculture and aquaculture. State-of-the-art animated computer graphics and images of high visual impact are also used. In addition, students are streamed into the developmental biology track in the second year, using courses like human embryology and courses shared with cell biology, which include practicals based on modern experimental approaches. Finally, fully dedicated third-year courses in developmental biology are undertaken in conjunction with stand-alone practical courses where students experiencefirst-hand work in a research laboratory. Our philosophy is a "cradle-to-grave" approach to the education of undergraduates so as to prepare highly motivated, enthusiastic and well-educated developmental biologists for entry into graduate programs and ultimately post-doctoral research.
-
DEFF Research Database (Denmark)
Szabo, Roman; Uzzun Sales, Katiuchia; Kosa, Peter
2012-01-01
is a critical developmental target for both protease inhibitors. Here, we performed a genetic epistasis analysis to identify additional components of this pathway by generating mice with combined deficiency in either HAI-1 or HAI-2, along with genes encoding developmentally co-expressed candidate matriptase......-prostasin activity causes developmental failure independent of aberrant c-Met and PAR-2 signaling or impaired epithelial sodium transport. Furthermore, phenotypic analysis of PAR-1 and matriptase double-deficient embryos suggests that the protease may not be critical for focal proteolytic activation of PAR-2 during...
-
ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance
Directory of Open Access Journals (Sweden)
Yu Agnes
2008-12-01
Full Text Available Abstract Background Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying potential targets for plant breeding. Drought tolerance in the field was successfully conferred to crops by transferring genes from this model species. While involved in a plant genomics programme, which aims to identify new genes responsible for plant response to abiotic stress, we identified ESKIMO1 as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE, which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis of one mutant line and its wild-type background was carried out. Under control watering conditions a number of genes were differentially expressed between the mutant and the wild type whereas under mild drought stress this list of genes was reduced. Among the genes that were differentially expressed between the wild type and mutant, two functional categories related to the response to stress or biotic and abiotic stimulus were over-represented. Under salt stress conditions, all gene functional categories were represented equally in both the mutant and wild type. Based on this transcriptome analysis we hypothesise that in control conditions the esk1 mutant behaves as if it was exposed to drought stress. Conclusion Overall our findings suggest that the
-
Wen, Y; Sachs, G; Athmann, C
2000-02-01
The development of the lens is dependent on the proliferation of lens epithelial cells and their differentiation into fiber cells near the lens bow/equator. Identification of genes specifically expressed in the lens epithelial cells and their functions may provide insight into molecular events that regulate the processes of lens epithelial cell differentiation. In this study, a novel lens epithelium gene product, LEP503, identified from rat by a subtractive cDNA cloning strategy was investigated in the genome organization, mRNA expression and protein localization. The genomic sequences for LEP503 isolated from rat, mouse and human span 1754 bp, 1694 bp and 1895 bp regions encompassing the 5'-flanking region, two exons, one intron and 3'-flanking region. All exon-intron junction sequences conform to the GT/AG rule. Both mouse and human LEP503 genes show very high identity (93% for mouse and 79% for human) to rat LEP503 gene in the exon 1 that contains an open reading frame coding for a protein of 61 amino acid residues with a leucine-rich domain. The deduced protein sequences also show high identity (91% between mouse and rat and 77% between human and rat). Western blot shows that LEP503 is present as a specific approximately 6.9 kDa band in the water-insoluble-urea-soluble fraction of lens cortex where lens epithelium is included. Immuno-staining shows that LEP503 is localized in the epithelial cells along the entire anterior surface of rat lens. Developmentally, LEP503 is expressed at a low level at newborn, and then the expression level increases by about ten-fold around postnatal day 14 and remains at this high level for about 25 days before it drops back to the low level by postnatal day 84. These data suggest that the LEP503 may be an important lens epithelial cell gene involving the processes of epithelial cell differentiation. Copyright 2000 Academic Press.
-
Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin
Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro
2013-01-01
The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192
-
MeSH key terms for validation and annotation of gene expression clusters
Energy Technology Data Exchange (ETDEWEB)
Rechtsteiner, A. (Andreas); Rocha, L. M. (Luis Mateus)
2004-01-01
Integration of different sources of information is a great challenge for the analysis of gene expression data, and for the field of Functional Genomics in general. As the availability of numerical data from high-throughput methods increases, so does the need for technologies that assist in the validation and evaluation of the biological significance of results extracted from these data. In mRNA assaying with microarrays, for example, numerical analysis often attempts to identify clusters of co-expressed genes. The important task to find the biological significance of the results and validate them has so far mostly fallen to the biological expert who had to perform this task manually. One of the most promising avenues to develop automated and integrative technology for such tasks lies in the application of modern Information Retrieval (IR) and Knowledge Management (KM) algorithms to databases with biomedical publications and data. Examples of databases available for the field are bibliographic databases c ntaining scientific publications (e.g. MEDLINE/PUBMED), databases containing sequence data (e.g. GenBank) and databases of semantic annotations (e.g. the Gene Ontology Consortium and Medical Subject Headings (MeSH)). We present here an approach that uses the MeSH terms and their concept hierarchies to validate and obtain functional information for gene expression clusters. The controlled and hierarchical MeSH vocabulary is used by the National Library of Medicine (NLM) to index all the articles cited in MEDLINE. Such indexing with a controlled vocabulary eliminates some of the ambiguity due to polysemy (terms that have multiple meanings) and synonymy (multiple terms have similar meaning) that would be encountered if terms would be extracted directly from the articles due to differing article contexts or author preferences and background. Further, the hierarchical organization of the MeSH terms can illustrate the conceptuallfunctional relationships of genes
-
allele of the noncoding hsrω gene of Drosophila melanogaster is not ...
Indian Academy of Sciences (India)
, Martinez P. et al. 2000 Identification of genes that modify ataxin-1-induced neurodegeneration. Nature 408, 101–. 106. Lakhotia S. C. 2003 The non-coding, developmentally active and stress inducible hsrω gene of Drosophila melanogaster ...