About an adaptively weighted Kaplan-Meier estimate.
Plante, Jean-François
2009-09-01
The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.
Gerds, Thomas A.
2016-01-01
Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.
The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method
Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia
2011-01-01
Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the
Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A
2015-11-01
Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and
Modified Weighted Kaplan-Meier Estimator
Directory of Open Access Journals (Sweden)
Mohammad Shafiq
2007-01-01
Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A
2018-01-01
Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.
The Kaplan-Meier Integral in the Presence of Covariates
DEFF Research Database (Denmark)
Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis
2017-01-01
In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...
DEFF Research Database (Denmark)
Gerds, Thomas Alexander
2016-01-01
Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...
van Walraven, Carl; McAlister, Finlay A
2016-01-01
Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.
Understanding survival analysis: Kaplan-Meier estimate.
Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal
2010-10-01
Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.
Directory of Open Access Journals (Sweden)
Arnd Gross
Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912
International Nuclear Information System (INIS)
Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.
1996-01-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs
Energy Technology Data Exchange (ETDEWEB)
Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)
1996-12-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.
J. Szymszal; A. Gierek; J. Kliś
2010-01-01
The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...
International Nuclear Information System (INIS)
Mould, Richard F.
1995-01-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method
Energy Technology Data Exchange (ETDEWEB)
Mould, Richard F
1995-07-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.
Directory of Open Access Journals (Sweden)
Guyot Patricia
2012-02-01
Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J
2012-02-01
The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J
2015-12-10
With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Béranger Lueza
2016-03-01
Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect
Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System
Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola
2011-01-01
Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…
Directory of Open Access Journals (Sweden)
Javier Llorca
2004-10-01
Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
Applying Kaplan-Meier to Item Response Data
McNeish, Daniel
2018-01-01
Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…
[Survival analysis with competing risks: estimating failure probability].
Llorca, Javier; Delgado-Rodríguez, Miguel
2004-01-01
To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel
2009-01-01
To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.
Unsteady load on an oscillating Kaplan turbine runner
Puolakka, O.; Keto-Tokoi, J.; Matusiak, J.
2013-02-01
A Kaplan turbine runner oscillating in turbine waterways is subjected to a varying hydrodynamic load. Numerical simulation of the related unsteady flow is time-consuming and research is very limited. In this study, a simplified method based on unsteady airfoil theory is presented for evaluation of the unsteady load for vibration analyses of the turbine shaft line. The runner is assumed to oscillate as a rigid body in spin and axial heave, and the reaction force is resolved into added masses and dampings. The method is applied on three Kaplan runners at nominal operating conditions. Estimates for added masses and dampings are considered to be of a magnitude significant for shaft line vibration. Moderate variation in the added masses and minor variation in the added dampings is found in the frequency range of interest. Reference results for added masses are derived by solving the boundary value problem for small motions of inviscid fluid using the finite element method. Good correspondence is found in the added mass estimates of the two methods. The unsteady airfoil method is considered accurate enough for design purposes. Experimental results are needed for validation of unsteady load analyses.
Directory of Open Access Journals (Sweden)
Bender Ralf
2011-09-01
Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.
Energy Technology Data Exchange (ETDEWEB)
Sevcik, Petr
2009-07-01
The Kaplan turbine has the best theoretical efficiency chart in the total range of operation. In order to achieve these good properties, the turbine has to be adjusted optimally. In general, these settings are performed by the manufacturer of turbines during commissioning. In practice one often meets Kaplan turbines where the scenery does not correspond to the optimal control line. The author of the contribution under consideration reports on possible causes for these errors and also methods of how this scenery can be optimized cost-effectively and how to minimize power losses.
Analysis of the Kaplan turbine draft tube effect
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Obrovsky, J
2010-01-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Energy Technology Data Exchange (ETDEWEB)
Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)
2010-08-15
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Motycak, L.; Skotak, A.; Obrovsky, J.
2010-08-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...
International Nuclear Information System (INIS)
Ko, P; Kurosawa, S
2014-01-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine
Ko, P.; Kurosawa, S.
2014-03-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine.
The development of a new algorithm to calculate a survival function in non-parametric ways
International Nuclear Information System (INIS)
Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo
2001-01-01
In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Directory of Open Access Journals (Sweden)
Jie Zhao
2015-01-01
Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.
Adamkowski, A.; Krzemianowski, Z.
2012-11-01
The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.
International Nuclear Information System (INIS)
Adamkowski, A; Krzemianowski, Z
2012-01-01
The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.
Directory of Open Access Journals (Sweden)
Pablo Martínez-Camblor
2009-12-01
sobrestimación tanto de la probabilidad de recidiva como de la mortalidad debida a la enfermedad.Objective: To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. Methods: All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival were also studied. Results: Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Conclusions: Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.
Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A
2018-06-01
Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Genetics Home Reference: Meier-Gorlin syndrome
... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...
DEFF Research Database (Denmark)
Cannon, Christopher P; Husted, Steen; Harrington, Robert A
2007-01-01
, or clopidogrel 300-mg loading dose plus 75 mg once daily for up to 12 weeks. RESULTS: The primary end point, the Kaplan-Meier rate of major or minor bleeding through 4 weeks, was 8.1% in the clopidogrel group, 9.8% in the AZD6140 90-mg group, and 8.0% in the AZD6140 180-mg group (p = 0.43 and p = 0.......96, respectively, vs. clopidogrel); the major bleeding rates were 6.9%, 7.1%, and 5.1%, respectively (p = 0.91 and p = 0.35, respectively, vs. clopidogrel). Although not statistically significant, favorable trends were seen in the Kaplan-Meier rates of myocardial infarction (MI) over the entire study period (MI: 5...
Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky
2017-01-01
The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n = 304) and 11-25 ( n = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.
Multi-objective shape optimization of runner blade for Kaplan turbine
International Nuclear Information System (INIS)
Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V
2014-01-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads
Multi-objective shape optimization of runner blade for Kaplan turbine
Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.
2014-03-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.
International Nuclear Information System (INIS)
Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan
2009-01-01
This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)
MAINTAINANCE OF KAPLAN TURBINE TO ENHANCE THE EFFICIENCY
Mr. Shakti Prasanna Khadanga*; Nitish Kumar; Milind Kumar Singh; L. Raj Kumar
2016-01-01
Hydro power plant is the source of renewable energy which leads to reduction in burning of fossil fuels. So the environment is no longer polluted. This project depicts how sediment erosion occurs in Kaplan turbine and the various components of Kaplan turbine where actually erosion takes place. It reduces efficiency [7] and life of hydro power turbine but also causes problems in operations and maintenance. We conducted some necessary test on Kaplan turbine in fluid power laboratory. We are d...
Perturbative analysis for Kaplan's lattice chiral fermions
International Nuclear Information System (INIS)
Aoki, S.; Hirose, H.
1994-01-01
Perturbation theory for lattice fermions with domain wall mass terms is developed and is applied to investigate the chiral Schwinger model formulated on the lattice by Kaplan's method. We calculate the effective action for gauge fields to one loop, and find that it contains a longitudinal component even for anomaly-free cases. From the effective action we obtain gauge anomalies and Chern-Simons currents without ambiguity. We also show that the current corresponding to the fermion number has a nonzero divergence and it flows off the wall into the extra dimension. Similar results are obtained for a proposal by Shamir, who used a constant mass term with free boundaries instead of domain walls
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...
Meier-Gorlin syndrome Clinical genetics and genomics
S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia
Meier-Gorlin syndrome Clinical genetics and genomics
De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
Kaplan SpellRead. What Works Clearinghouse Intervention Report
What Works Clearinghouse, 2007
2007-01-01
"Kaplan SpellRead" (formerly known as "SpellRead Phonological Auditory Training"[R]) is a literacy program for struggling readers in grades 2 or above, including special education students, English language learners, and students more than two years below grade level in reading. "Kaplan SpellRead" integrates the…
Application of the standard lymphadenectomy in gastric adenocarcinoma
International Nuclear Information System (INIS)
Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro
2011-01-01
The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
Energy Technology Data Exchange (ETDEWEB)
Petit, O; Nilsson, H [Division of Fluid Mechanics, Chalmers University of Technology, Hoersalsvaegen 7A, SE-41296 Goeteborg (Sweden); Mulu, B; Cervantes, M, E-mail: olivierp@chalmers.s [Division of Fluid Mechanics, Luleaa University of Technology, SE-971 87 Luleaa (Sweden)
2010-08-15
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
Petit, O.; Mulu, B.; Nilsson, H.; Cervantes, M.
2010-08-01
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Älvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model
International Nuclear Information System (INIS)
Petit, O; Nilsson, H; Mulu, B; Cervantes, M
2010-01-01
The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.
Wan, Xiaomin; Peng, Liubao; Li, Yuanjian
2015-01-01
In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.
Rossman, Allan; Kaplan, Danny
2017-01-01
Danny Kaplan is DeWitt Wallace Professor of Mathematics and Computer Science at Macalester College. He received Macalester's Excellence in teaching Award in 2006 and the CAUSE/USCOTS Lifetime Achievement Award in 2017. This interview took place via email on March 4-June 17, 2017. Topics covered in the interview include: (1) the current state of…
Kaplan turbine tip vortex cavitation - analysis and prevention
Motycak, L.; Skotak, A.; Kupcik, R.
2012-11-01
The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
Directory of Open Access Journals (Sweden)
Ana – Maria Budai
2010-10-01
Full Text Available The paper present an analytical method that can be used to determianted fatigue life time duration in service for runner blade mechanism of Kaplan turbines. The study was made for lever button of runer blade mechanism using two analytical relation to calculate the maximum number of stress cycles whereupon the mechanism work without any damage. To estimate fatigue life time duration will be used a formula obtained from one of most comon cumulative damage methodology taking in consideration the real exploatation conditions of a specified Kapaln turbine.
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
International Nuclear Information System (INIS)
Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H
2012-01-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.
2012-11-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
Verification of Kaplan turbine cam curves realization accuracy at power plant
Directory of Open Access Journals (Sweden)
Džepčeski Dane
2016-01-01
Full Text Available Sustainability of approximately constant value of Kaplan turbine efficiency, for relatively large net head changes, is a result of turbine runner variable geometry. Dependence of runner blades position change on guide vane opening represents the turbine cam curve. The cam curve realization accuracy is of great importance for the efficient and proper exploitation of turbines and consequently complete units. Due to the reasons mentioned above, special attention has been given to the tests designed for cam curves verification. The goal of this paper is to provide the description of the methodology and the results of the tests performed in the process of Kaplan turbine cam curves verification.
DEFF Research Database (Denmark)
Wells, J Connor; Stukalin, Igor; Norton, Craig
2017-01-01
and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...
Influence of Working Environment on Fatigue Life Time Duration for Runner Blades of Kaplan Turbines
Directory of Open Access Journals (Sweden)
Ana-Maria Budai
2010-10-01
Full Text Available The paper present an analytical analyzes refer to influence of working environment on life time duration in service of runner blades of Kaplan turbines. The study are made using only analytical method, the entry dates being obtained from measurements made in situ for a Kaplan turbine. To calculate the maximum number of stress cycles whereupon the runner blades work without any damage it was used an analytical relation known in specialized literatures under the name of Morrow’s relation. To estimate fatigue life time duration will be used a formula obtained from one of most common cumulative damage methodology taking in consideration the real exploitation conditions of a specified Kaplan turbine.
Cardiovascular Risk Factors and 5-year Mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
Cardiovascular risk factors and 5-year mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
DEFF Research Database (Denmark)
Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...
Meier-Gorlin syndrome Clinical genetics and genomics
Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...
Kaplan turbine tip vortex cavitation – analysis and prevention
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Kupcik, R
2012-01-01
The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
Water hammer 2 phase analysis hydraulic system with a Kaplan turbine
Dudlik, A.; Koutnik, J.
2009-01-01
This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...
Computer Aided Design of Kaplan Turbine Piston with SolidWorks
Camelia Jianu
2010-01-01
The paper presents the steps for 3D computer aided design (CAD) of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
Trebše, Andrej J.
2004-01-01
The paper deals with efficiency measurement of Kaplan turbine with relative method (index test) and adjustment of operating of runner and guide vane governing system. At certain longer penstocks the looses in conduit at turbineload operation change the net head. On basis of model test on Kaplan turbine and relative turbine efficiency measurement on prototype the turbine governing system was optimized in accordance with comparative method. Prispevek obravnava meritev izkoristka kaplanove tu...
Directory of Open Access Journals (Sweden)
Min-jie Mao
2017-01-01
Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.
Censoring: a new approach for detection limits in total-reflection X-ray fluorescence
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.; Braziewicz, J.
2004-01-01
It is shown that the detection limits in the total-reflection X-ray fluorescence (TXRF), which restrict quantification of very low concentrations of trace elements in the samples, can be accounted for using the statistical concept of censoring. We demonstrate that the incomplete TXRF measurements containing the so-called 'nondetects', i.e. the non-measured concentrations falling below the detection limits and represented by the estimated detection limit values, can be viewed as the left random-censored data, which can be further analyzed using the Kaplan-Meier (KM) method correcting for nondetects. Within this approach, which uses the Kaplan-Meier product-limit estimator to obtain the cumulative distribution function corrected for the nondetects, the mean value and median of the detection limit censored concentrations can be estimated in a non-parametric way. The Monte Carlo simulations performed show that the Kaplan-Meier approach yields highly accurate estimates for the mean and median concentrations, being within a few percent with respect to the simulated, uncensored data. This means that the uncertainties of KM estimated mean value and median are limited in fact only by the number of studied samples and not by the applied correction procedure for nondetects itself. On the other hand, it is observed that, in case when the concentration of a given element is not measured in all the samples, simple approaches to estimate a mean concentration value from the data yield erroneous, systematically biased results. The discussed random-left censoring approach was applied to analyze the TXRF detection-limit-censored concentration measurements of trace elements in biomedical samples. We emphasize that the Kaplan-Meier approach allows one to estimate the mean concentrations being substantially below the mean level of detection limits. Consequently, this approach gives a new access to lower the effective detection limits for TXRF method, which is of prime interest for
International Nuclear Information System (INIS)
Bergant, A; Gregorc, B; Gale, J
2012-01-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatolicje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
Bergant, A.; Gregorc, B.; Gale, J.
2012-11-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatoličje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
Numerical investigation of hub clearance flow in a Kaplan turbine
Wu, H.; Feng, J. J.; Wu, G. K.; Luo, X. Q.
2012-11-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
Numerical investigation of hub clearance flow in a Kaplan turbine
International Nuclear Information System (INIS)
Wu, H; Feng, J J; Wu, G K; Luo, X Q
2012-01-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu
2015-01-01
Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...
DEFF Research Database (Denmark)
Mickley, H; Nielsen, J R; Berning, J
1995-01-01
infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
International Nuclear Information System (INIS)
Weili, L; Jinling, L; Xingqi, L; Yuan, L
2010-01-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Energy Technology Data Exchange (ETDEWEB)
Weili, L; Jinling, L; Xingqi, L; Yuan, L, E-mail: liaoweili2004@163.co [Institute of Water Resources and Hydro-Electric Engineering, Xi' an University of Technology No.5 South Jinhua Road, Xi' an, Shaanxi, 710048 (China)
2010-08-15
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Weili, L.; Jinling, L.; Xingqi, L.; Yuan, L.
2010-08-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
2017-08-01
28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival
2017-10-01
of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to
Computer Aided Design of Kaplan Turbine Piston with\tSolidWorks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy
International Nuclear Information System (INIS)
Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.
2000-01-01
Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de
Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat
2013-01-01
There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer
Competing approaches to analysis of failure times with competing risks.
Farley, T M; Ali, M M; Slaymaker, E
2001-12-15
For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.
Improved Governing of Kaplan Turbine Hydropower Plants Operating Island Grids
Gustafsson, Martin
2013-01-01
To reduce the consequences of a major fault in the electric power grid, functioning parts of the grid can be divided into smaller grid islands. The grid islands are operated isolated from the power network, which places new demands on a faster frequency regulation. This thesis investigates a Kaplan turbine hydropower plant operating an island grid. The Kaplan turbine has two control signals, the wicket gate and the turbine blade positions, controlling the mechanical power. The inputs are comb...
Kaplan og Norton bør læses af hele ledelsen
DEFF Research Database (Denmark)
Bukh, Per Nikolaj
2009-01-01
Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april......Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april...
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
International Nuclear Information System (INIS)
Javadi, Ardalan; Nilsson, Håkan
2014-01-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m 3 /s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
Javadi, Ardalan; Nilsson, Håkan
2014-03-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m3/s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation.
Kaplan-Narayanan-Neuberger lattice fermions pass a perturbative test
International Nuclear Information System (INIS)
Aoki, S.; Levien, R.B.
1995-01-01
We test perturbatively a recent scheme for implementing chiral fermions on the lattice, proposed by Kaplan and modified by Narayanan and Neuberger, using as our testing ground the chiral Schwinger model. The scheme is found to reproduce the desired form of the effective action, whose real part is gauge invariant and whose imaginary part gives the correct anomaly in the continuum limit, once technical problems relating to the necesary infinite extent of the extra dimension are properly addressed. The indications from this study are that the Kaplan-Narayanan-Neuberger scheme has a good chance at being a correct lattice regularization of chiral gauge theories
Comparison of Results according to the treatment Method in Maxillary Sinus Carcinoma
Energy Technology Data Exchange (ETDEWEB)
Chung, Woong Ki; Jo, Jae Sik; Ahn, Sung Ja; Nam, Taek Keun; Nah, Byung Sik [Chonnam National University College of Medicine, Kwangju (Korea, Republic of); Park, Seung Jin [Gyeongsang National Univ., Jinju (Korea, Republic of)
1995-03-15
Purpose : A retrospective analysis was performed to investigate the proper management of maxillary sinus carcinoma. Materials and Methods : Authors analysed 33 patients of squamous cell carcinoma of maxillary sinus treated at Chonnam University Hospital from January 1986 to December 1992. There were 24 men and 9 women with median age of 55 years. According to AJCC TNM system of 1988, a patient of T2, 10 patients of T3 and 22 patients of T4 were available, respectively. Cervical lymph node metastases was observed in 5 patients(N1;4/33, N2b;1/33). Patients were classified as 3 groups according to management method. The first group, named as 'FAR' (16 patients), was consisted of preoperative intra-arterial chemotherapy with 5-fluorouracil(5-FU;mean of total dosage;3078mg) through the superficial temporal artery with concurrent radiation(mean dose delivered;3433cGy, daily 180-200cGy) and vitamin A(50,000 IU daily), and followed by total maxillectomy and postoperative radiation therapy(mean dose;2351cGy). The second group, named as 'SR'(7 patients), was consisted of total maxillectomy followed by postoperative radiation therapy(mean dose 5920 cGy). Her third group, named as 'R'(6 patients), was treated with radiation alone(mean dose;7164cGy). Kaplan-Meier product limit method was used for survival analysis and Mantel-Cox test was performed for significance of survival difference between two groups. Results : Local recurrence free survival rate in the end of 2 year was 100%, 5-% and 0% in FAR, SR and R group, respectively. Disease free survival rate in 2 years was 88.9%, 40% and 50% in Far, SR and R group, respectively. There were statistically significant difference between FAR and SR or FAR and R group in their local recurrence free, disease free and overall survival rates. But difference of each survival rate between SR and R group was not significant. Conclusion : In this study FAR group revealed better results that SR or R group. In the
Comparison of Results according to the treatment Method in Maxillary Sinus Carcinoma
International Nuclear Information System (INIS)
Chung, Woong Ki; Jo, Jae Sik; Ahn, Sung Ja; Nam, Taek Keun; Nah, Byung Sik; Park, Seung Jin
1995-01-01
Purpose : A retrospective analysis was performed to investigate the proper management of maxillary sinus carcinoma. Materials and Methods : Authors analysed 33 patients of squamous cell carcinoma of maxillary sinus treated at Chonnam University Hospital from January 1986 to December 1992. There were 24 men and 9 women with median age of 55 years. According to AJCC TNM system of 1988, a patient of T2, 10 patients of T3 and 22 patients of T4 were available, respectively. Cervical lymph node metastases was observed in 5 patients(N1;4/33, N2b;1/33). Patients were classified as 3 groups according to management method. The first group, named as 'FAR' (16 patients), was consisted of preoperative intra-arterial chemotherapy with 5-fluorouracil(5-FU;mean of total dosage;3078mg) through the superficial temporal artery with concurrent radiation(mean dose delivered;3433cGy, daily 180-200cGy) and vitamin A(50,000 IU daily), and followed by total maxillectomy and postoperative radiation therapy(mean dose;2351cGy). The second group, named as 'SR'(7 patients), was consisted of total maxillectomy followed by postoperative radiation therapy(mean dose 5920 cGy). Her third group, named as 'R'(6 patients), was treated with radiation alone(mean dose;7164cGy). Kaplan-Meier product limit method was used for survival analysis and Mantel-Cox test was performed for significance of survival difference between two groups. Results : Local recurrence free survival rate in the end of 2 year was 100%, 5-% and 0% in FAR, SR and R group, respectively. Disease free survival rate in 2 years was 88.9%, 40% and 50% in Far, SR and R group, respectively. There were statistically significant difference between FAR and SR or FAR and R group in their local recurrence free, disease free and overall survival rates. But difference of each survival rate between SR and R group was not significant. Conclusion : In this study FAR group revealed better results that SR or R group. In the future prospective randomized
Case Report: Meier-Gorlin syndrome: Report of an additional patient ...
African Journals Online (AJOL)
We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.
Improvements of a Kaplan type small turbine: Forbedre og vidreutvikle en Kaplan småturbin
Fjærvold, Lars
2012-01-01
The goal with this master thesis was to establish Hill diagrams and improve a Kaplan turbine intended for use in Afghanistan. The turbine efficiency has been tested in setting 1 and 2. Turbine efficiency in setting 3 and 4 could not be tested because the runner blades interfere with the housing making it impossible to rotate the turbine. The efficiency was tested with an effective pressure head ranging from 2 to 8 meters. Best efficiency point was not reached because of limitations in the te...
Post, Wendy; Moser, Marvin; Kaplan, Norman
2005-10-01
Following a hypertension symposium in Baltimore, MD, on June 1, 2005, Dr. Wendy Post from the Johns Hopkins University School of Medicine, Baltimore, MD, had the opportunity to interview two of the outstanding hypertension experts in the United States on several controversial issues in hypertension management. Dr. Norman Kaplan is Clinical Professor of Medicine at the Southwestern Health Science Center in Dallas, TX, and Dr. Marvin Moser is Clinical Professor of Medicine at the Yale University School of Medicine, New Haven, CT. Both have been leaders in the field of hypertension treatment and education for more than 40 years. Dr. Kaplan's book Clinical Hypertension has been a standard textbook since 1973 and is now in its ninth edition. Dr. Marvin Moser was the Senior Medical Consultant to the National High Blood Pressure Education Program from 1974 to 2002 and was Chairman of the first Joint National Committee on Detection, Evaluation, and Treatment of High Blood Pressure and a member of the six subsequent committees. His book Clinical Management of Hypertension is in its seventh edition. Drs. Moser and Kaplan were corecipients of the 2004 International Society of Hypertension Award for Outstanding Contributions to Hypertension Treatment and Education and have lectured extensively throughout the United States and overseas.
Comparative Study of Barotrauma Risk during Fish Passage through Kaplan Turbines
Energy Technology Data Exchange (ETDEWEB)
Richmond, Marshall C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Romero-Gomez, Pedro [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Serkowski, John A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Rakowski, Cynthia L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Graf, Michael J. [Voith Hydro, York, PA (United States)
2015-10-01
Rapid pressure changes in hydroelectric turbine flows can cause barotrauma that can be hazardous to the passage of fish, in particular migratory juvenile salmonids. Although numerous laboratory tests have evaluated the effect of rapid decompression in fish species of relevance, numerical modeling studies offer the advantage of predicting, for new turbine designs, the potential risks of mortality and injury from rapid pressure change during turbine passage. However, rapid pressure change is only one of several hydraulic risks encountered by fish during turbine passage in addition to blade strike, shear, and turbulence. To better understand the role of rapid pressure changes, the present work focuses on the application of a computational fluid dynamics based method for evaluating the risk of pressure-related mortality to fish passing through an early 1960s era original hydroelectric Kaplan turbine at Wanapum Dam (Columbia River, Washington), and a modern advanced Kaplan turbine installed in 2005. The results show that the modeling approach acceptably reproduced the nadir pressure distributions compared to field data previously collected at the site using an autonomous sensor. Our findings show that the new advanced-design unit performs better, in terms of reduced barotrauma risk to fish from exposure to low pressures, than the original turbine unit. The outcomes allow for comparative analyses of turbine designs and operations prior to installation, an advantage that can potentially be integrated in the process of designing new turbine units to achieve superior environmental performance. Overall, the results show that modern turbine designs can achieve the multiple objectives of increasing power generation, lowering cavitation potential, and reducing barotrauma risks to passing fish.
Vos, Janet R; Hsu, Li; Brohet, Richard M; Mourits, Marian J E; de Vries, Jakob; Malone, Kathleen E; Oosterwijk, Jan C; de Bock, Geertruida H
2015-08-10
Recommendations for treating patients who carry a BRCA1/2 gene are mainly based on cumulative lifetime risks (CLTRs) of breast cancer determined from retrospective cohorts. These risks vary widely (27% to 88%), and it is important to understand why. We analyzed the effects of methods of risk estimation and bias correction and of population factors on CLTRs in this retrospective clinical cohort of BRCA1/2 carriers. The following methods to estimate the breast cancer risk of BRCA1/2 carriers were identified from the literature: Kaplan-Meier, frailty, and modified segregation analyses with bias correction consisting of including or excluding index patients combined with including or excluding first-degree relatives (FDRs) or different conditional likelihoods. These were applied to clinical data of BRCA1/2 families derived from our family cancer clinic for whom a simulation was also performed to evaluate the methods. CLTRs and 95% CIs were estimated and compared with the reference CLTRs. CLTRs ranged from 35% to 83% for BRCA1 and 41% to 86% for BRCA2 carriers at age 70 years width of 95% CIs: 10% to 35% and 13% to 46%, respectively). Relative bias varied from -38% to +16%. Bias correction with inclusion of index patients and untested FDRs gave the smallest bias: +2% (SD, 2%) in BRCA1 and +0.9% (SD, 3.6%) in BRCA2. Much of the variation in breast cancer CLTRs in retrospective clinical BRCA1/2 cohorts is due to the bias-correction method, whereas a smaller part is due to population differences. Kaplan-Meier analyses with bias correction that includes index patients and a proportion of untested FDRs provide suitable CLTRs for carriers counseled in the clinic. © 2015 by American Society of Clinical Oncology.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-09-17
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.
Modelling the survivorship of Nigeria children in their first 10 years of ...
African Journals Online (AJOL)
Fagbamigbe
Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...
Tinkle, Christopher L; Fernandez-Pineda, Israel; Sykes, April; Lu, Zhaohua; Hua, Chia-Ho; Neel, Michael D; Bahrami, Armita; Shulkin, Barry L; Kaste, Sue C; Pappo, Alberto; Spunt, Sheri L; Krasin, Matthew J
2017-11-15
Indications for and delivery of adjuvant therapies for pediatric nonrhabdomyosarcoma soft tissue sarcoma (NRSTS) have been derived largely from adult studies; therefore, significant concern remains regarding radiation exposure to normal tissue. The authors report long-term treatment outcomes and toxicities for pediatric and young adult patients with high-grade NRSTS who were treated on a prospective trial using limited-margin radiotherapy. Sixty-two patients (ages 3-22 years) with predominantly high-grade NRSTS requiring radiation were treated on a phase 2 institutional study of conformal external-beam radiotherapy and/or brachytherapy using a 1.5-cm to 2-cm anatomically constrained margin. The estimated cumulative incidence of local failure, Gray's method estimated cumulative incidence of local failure, Kaplan-Meier method estimated survival, competing-risk regression model determined predictors of disease outcome, and toxicity was reported according to CTCAE v2.0. At a median follow-up of 5.1 years (range, 0.2-10.9 years), 9 patients had experienced local failure. The 5-year overall cumulative incidence of local failure was 14.8% (95% confidence interval [CI], 7.2%-25%), and all but 1 local failure occurred outside the highest-dose irradiation volume. The 5-year Kaplan-Meier estimates for event-free and overall survival were 49.3% (95% CI, 36.3%-61.1%) and 67.9% (95% CI, 54.2%-78.3%), respectively. Multivariable analysis indicated that younger age was the only independent predictor of local recurrence (P = .004). The 5-year cumulative incidence of grade 3 or 4 late toxicity was 15% (95% CI, 7.2%-25.3%). The delivery of limited-margin radiotherapy using conformal external-beam radiotherapy or brachytherapy provides a high rate of local tumor control without an increase in marginal failures and with acceptable treatment-related morbidity. Cancer 2017;123:4419-29. © 2017 American Cancer Society. © 2017 American Cancer Society.
Panasiti, V; Curzio, M; Roberti, V; Lieto, P; Devirgiliis, V; Gobbi, S; Naspi, A; Coppola, R; Lopez, T; di Meo, N; Gatti, A; Trevisan, G; Londei, P; Calvieri, S
2013-01-01
The last melanoma staging system of the 2009 American Joint Committee on Cancer takes into account, for stage IV disease, the serum levels of lactate dehydrogenase (LDH) and the site of distant metastases. Our aim was to compare the significance of metastatic volume, as evaluated at the time of stage IV melanoma diagnosis, with other clinical predictors of prognosis. We conducted a retrospective multicentric study. To establish which variables were statistically correlated both with death and survival time, contingency tables were evaluated. The overall survival curves were compared using the Kaplan-Meier method. Metastatic volume and number of affected organs were statistically related to death. In detail, patients with a metastatic volume >15 cm(3) had a worse prognosis than those with a volume lower than this value (survival probability at 60 months: 6.8 vs. 40.9%, respectively). The Kaplan-Meier method confirmed that survival time was significantly related to the site(s) of metastases, to elevated LDH serum levels and to melanoma stage according to the latest system. Our results suggest that metastatic volume may be considered as a useful prognostic factor for survival among melanoma patients.
Prita Meier, Swahili Port Cities: The Architecture of Elsewhere
Longair, Sarah
2018-01-01
Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...
Kaplan kõneles Iraagis rahust / Raivo Nikiforov ; interv. Eda Post
Nikiforov, Raivo
2005-01-01
Tapa väljaõppekeskuse kaplan leitnant Raivo Nikiforov käis Bagdadis Eesti rahuvalvajatele jõulujumalateenistust pidamas ning eestlaste elu jälgimas. Iraagi missioonist, rahuvalvajate elamistingimustest
Survival analysis II: Cox regression
Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.
2011-01-01
In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the
STAT3 inhibitor enhances chemotherapy drug efficacy by ...
African Journals Online (AJOL)
Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.
The influence of obesity on response to tumour necrosis factor-α inhibitors in psoriatic arthritis
DEFF Research Database (Denmark)
Højgaard, Pil; Glintborg, Bente; Kristensen, Lars Erik
2016-01-01
OBJECTIVES: To investigate the impact of obesity on response to the first TNF-α inhibitor (TNFI) treatment course in patients with PsA followed in routine care. METHODS: We performed an observational cohort study based on the Danish and Icelandic biologics registries. Kaplan-Meier plots, Cox and ...
Geeslin, Andrew G; Chahla, Jorge; Moatshe, Gilbert; Muckenhirn, Kyle J; Kruckeberg, Bradley M; Brady, Alex W; Coggins, Ashley; Dornan, Grant J; Getgood, Alan M; Godin, Jonathan A; LaPrade, Robert F
2018-05-01
when compared with ALL sectioning. On simulated pivot-shift testing, ALL sectioning led to significantly increased internal rotation and anterior translation at 15° and 30°; sectioning of the Kaplan fibers led to significantly increased tibial internal rotation at 15° and 30° and anterior translation at 15°. No significant difference was found when anterior tibial translation was compared between the ACL/ALL- and ACL/Kaplan fiber-deficient states on simulated pivot-shift testing or isolated anterior tibial load. The ALL and Kaplan fibers restrain internal rotation in the ACL-deficient knee. Sectioning the Kaplan fibers led to greater tibial internal rotation at higher flexion angles (60°-90°) as compared with ALL sectioning. Additionally, the ALL and Kaplan fibers contribute to restraint of the pivot shift and anterior tibial translation in the ACL-deficient knee. This study reports that the ALL and distal iliotibial band Kaplan fibers restrain anterior tibial translation, internal rotation, and pivot shift in the ACL-deficient knee. Furthermore, sectioning the Kaplan fibers led to significantly greater tibial internal rotation when compared with ALL sectioning at high flexion angles. These results demonstrate increased rotational knee laxity with combined ACL and anterolateral extra-articular knee injuries and may allow surgeons to optimize the care of patients with this injury pattern.
Barnes, Leslie Fink; Lombardi, Joseph; Gardner, Thomas R; Strauch, Robert J; Rosenwasser, Melvin P
2018-01-01
The aim of this study was to compare the complete visible surface area of the radial head, neck, and coronoid in the Kaplan and Kocher approaches to the lateral elbow. The hypothesis was that the Kaplan approach would afford greater visibility due to the differential anatomy of the intermuscular planes. Ten cadavers were dissected with the Kaplan and Kocher approaches, and the visible surface area was measured in situ using a 3-dimensional digitizer. Six measurements were taken for each approach by 2 surgeons, and the mean of these measurements were analyzed. The mean surface area visible with the lateral collateral ligament (LCL) preserved in the Kaplan approach was 616.6 mm 2 in comparison with the surface area of 136.2 mm 2 visible in the Kocher approach when the LCL was preserved. Using a 2-way analysis of variance, the difference between these 2 approaches was statistically significant. When the LCL complex was incised in the Kocher approach, the average visible surface area of the Kocher approach was 456.1 mm 2 and was statistically less than the Kaplan approach. The average surface area of the coronoid visible using a proximally extended Kaplan approach was 197.8 mm 2 . The Kaplan approach affords significantly greater visible surface area of the proximal radius than the Kocher approach.
Air injection test on a Kaplan turbine: prototype - model comparison
Angulo, M.; Rivetti, A.; Díaz, L.; Liscia, S.
2016-11-01
Air injection is a very well-known resource to reduce pressure pulsation magnitude in turbines, especially on Francis type. In the case of large Kaplan designs, even when not so usual, it could be a solution to mitigate vibrations arising when tip vortex cavitation phenomenon becomes erosive and induces structural vibrations. In order to study this alternative, aeration tests were performed on a Kaplan turbine at model and prototype scales. The research was focused on efficiency of different air flow rates injected in reducing vibrations, especially at the draft tube and the discharge ring and also in the efficiency drop magnitude. It was found that results on both scales presents the same trend in particular for vibration levels at the discharge ring. The efficiency drop was overestimated on model tests while on prototype were less than 0.2 % for all power output. On prototype, air has a beneficial effect in reducing pressure fluctuations up to 0.2 ‰ of air flow rate. On model high speed image computing helped to quantify the volume of tip vortex cavitation that is strongly correlated with the vibration level. The hydrophone measurements did not capture the cavitation intensity when air is injected, however on prototype, it was detected by a sonometer installed at the draft tube access gallery.
Ackerman, Ari
2008-01-01
This article will examine educational ideals by exploring the relation between the individual, the collective, and humanity in Kaplan's Jewish and educational philosophy. Generally the goals of individualism, nationalism, and universalism are seen as mutually exclusive. By contrast, Kaplan argues for the symbiotic relationship between…
Survival of Root-filled Teeth in the Swedish Adult Population
DEFF Research Database (Denmark)
Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik
2016-01-01
INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...
Deciphering the Adaptive Immune Response to Ovarian Cancer
2013-10-01
positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By Kaplan –Meier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, Kaplan –Meier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor
DEFF Research Database (Denmark)
Heeran, Mel C; Rask, Lene; Høgdall, Claus K
2015-01-01
of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...
De 'wraak van de geografie' volgens Robert D. Kaplan
Mamadouh, V.
2013-01-01
De Amerikaanse publicist Robert D. Kaplan heeft een nieuwe bestseller, De wraak van de geografie, waarin hij het belang van geografie voor de internationale politiek uit de doeken doet. Zijn roep om meer aandacht voor geografie is echter erg eenzijdig en een miskenning van alles waar ons vak voor
International Nuclear Information System (INIS)
Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.
2008-01-01
Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be
Directory of Open Access Journals (Sweden)
Dong-dong Cheng
2015-07-01
Full Text Available Background/Aims: This aim of the present study was to identify specific markers determining the recurrence of the giant cell tumor of bone (GCTB. Methods: This study involved the clinicopathological analysis of 80 cases. All of the clinical features, pathological fracture, Campanacci grade, histological features and surgical methods were reviewed. Immunohistochemistry was used to detect the expression of Ki-67, CD147, mutant p53 and p63 in GCTB. Comparisons between different groups were performed using the Chi-square test. The risk factors affecting recurrence were analyzed using a binary logistic model. Kaplan-Meier analysis was employed for the survival analysis between the groups. Cell proliferation assays, migration and invasion assays were used to detect the function of CD147 on GCTB in vitro. Results: The univariate analysis showed that Ki-67 and CD147 expression, pathological fracture, Campanacci grade and surgical method were associated with recurrence. The multivariate analysis revealed that CD147 expression, Campanacci grade and surgical method were the factors affecting GCTB recurrence. In addition, the Kaplan-Meier analysis revealed that these factors affected tumor-free survival time. In vitro study revealed that the CD147 knockdown by small interfering RNA (siRNA technique dramatically reduced the proliferation, migration and invasion of GCTB. Conclusion: Our results suggest that CD147 may serve as an adequate marker for GCTB recurrence. Campanacci grade is a risk factor for GCTB recurrence, which is also affected by the surgical method used.
First line chemotherapy plus trastuzumab in metastatic breast cancer ...
African Journals Online (AJOL)
First line chemotherapy plus trastuzumab in metastatic breast cancer HER2 positive - Observational institutional study. ... The progression free survival was estimated by the Kaplan-Meier method, from the date of first cycle to the date of progression or at the last consultation, and the median was 12.8 months. Trastuzumab ...
DEFF Research Database (Denmark)
Kirk, O; Mocroft, A; Pradier, C
2001-01-01
-up within the EuroSIDA study. METHODS: Changes in plasma viral load (pVL) and CD4 cell count from baseline were compared between treatment groups. Time to new AIDS-defining events and death were compared in Kaplan--Meier models, and Cox models were established to further assess differences in clinical...
Satisfactory Results of the Exeter Revision Femoral Stem Used for Primary Total Hip Arthroplasty.
Desy, Nicholas M; Johnson, Joshua D; Sierra, Rafael J
2017-02-01
The Exeter cemented femoral stem has demonstrated excellent clinical and radiographic outcomes as well as long-term survivorship free from aseptic loosening. A shorter revision stem (125 mm) with a 44 offset became available for the purpose of cement-in-cement revision situations. In certain cases, this shorter revision stem may be used for various primary total hip arthroplasties (THAs) where the standard length stem would require distally reaming the femoral canal. We sought to report on the early to midterm results of this specific stem when used for primary THA regarding (1) clinical and radiographic outcomes, (2) complications, and (3) survivorship. Twenty-nine patients (33 hips) underwent a hybrid THA using the smaller revision Exeter cemented femoral stem. Twenty-five patients (28 hips) had at least 2 years of follow-up and were assessed for clinical and radiographic outcomes. All 33 hips were included in the analysis of complications and survivorship. The Kaplan-Meier survivorship was performed using revision for all causes and for aseptic loosening as the end points. The average clinical follow-up was 4 years (range, 2-7). Harris Hip Scores improved from a mean preoperative value of 56 (range, 23-96) to 90 (range, 51-100) at the latest follow-up. All patients demonstrated superior cement mantles with no signs of loosening. One patient suffered a B2 periprosthetic fracture and 1 patient experienced 2 episodes of instability. The 5-year Kaplan-Meier survivorship was 96.7% for all causes of revision and was 100% using aseptic loosening as the end point. The shorter Exeter revision cemented femoral stem has favorable early to midterm clinical and radiographic outcomes when used for primary THA with a low complication rate and is a viable option in patients with narrow femoral canals where uncemented stem fixation is not desired. Copyright © 2016 Elsevier Inc. All rights reserved.
Zhou, Huaqiang; Zhang, Yuanzhe; Song, Yiyan; Tan, Wulin; Qiu, Zeting; Li, Si; Chen, Qinchang; Gao, Shaowei
2017-09-01
Marital status's prognostic impact on pancreatic neuroendocrine tumors (PNET) has not been rigorously studied. We aimed to explore the relationship between marital status and outcomes of PNET. We retrospectively investigated 2060 PNET cases between 2004 and 2010 from Surveillance, Epidemiology, and End Results (SEER) database. Variables were compared by Chi 2 test, t-test as appropriate. Kaplan-Meier methods and COX proportional hazard models were used to ascertain independent prognostic factors. Married patients had better 5-year overall survival (OS) (53.37% vs. 42.27%, Pvs. 59.82%, P=0.001) comparing with unmarried patients. Multivariate analysis revealed marital status is an independent prognostic factor, with married patients showing better OS (HR=0.74; 95% CI: 0.65-0.84; Punmarried patients may be associated with a delayed diagnosis with advanced tumor stage, psychosocial and socioeconomic factors. Further studies are needed. Copyright © 2017. Published by Elsevier Masson SAS.
Numerical investigation of tip clearance cavitation in Kaplan runners
Nikiforova, K.; Semenov, G.; Kuznetsov, I.; Spiridonov, E.
2016-11-01
There is a gap between the Kaplan runner blade and the shroud that makes for a special kind of cavitation: cavitation in the tip leakage flow. Two types of cavitation caused by the presence of clearance gap are known: tip vortex cavitation that appears at the core of the rolled up vortex on the blade suction side and tip clearance cavitation that appears precisely in the gap between the blade tip edge and the shroud. In the context of this work numerical investigation of the model Kaplan runner has been performed taking into account variable tip clearance for several cavitation regimes. The focus is put on investigation of structure and origination of mechanism of cavitation in the tip leakage flow. Calculations have been performed with the help of 3-D unsteady numerical model for two-phase medium. Modeling of turbulent flow in this work has been carried out using full equations of Navier-Stokes averaged by Reynolds with correction for streamline curvature and system rotation. For description of this medium (liquid-vapor) simplification of Euler approach is used; it is based on the model of interpenetrating continuums, within the bounds of this two- phase medium considered as a quasi-homogeneous mixture with the common velocity field and continuous distribution of density for both phases. As a result, engineering techniques for calculation of cavitation conditioned by existence of tip clearance in model turbine runner have been developed. The detailed visualization of the flow was carried out and vortex structure on the suction side of the blade was reproduced. The range of frequency with maximum value of pulsation was assigned and maximum energy frequency was defined; it is based on spectral analysis of the obtained data. Comparison between numerical computation results and experimental data has been also performed. The location of cavitation zone has a good agreement with experiment for all analyzed regimes.
Censoring approach to the detection limits in X-ray fluorescence analysis
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.
2004-01-01
We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples
Directory of Open Access Journals (Sweden)
Zoltan-Iosif Korka
2016-10-01
Full Text Available CFD (Computational Fluid Dynamic is today a standard procedure for analyzing and simulating the flow through several hydraulic machines. In this process, the fluid flow domain is divided into small volumes where the governing equations are converted into algebraic ones, which are numerically solved. Computational results strongly depend on the applied mathematical model and on the numerical methods used for converting the governing equations into the algebraic ones. The goal of the paper is to evaluate, by numerical simulation, the hydraulic loads (forces and torques on the runner blades of an existent Kaplan turbine and to compare them with the experimental results obtained from model test.
Is there racial/ethnic variance in cervical cancer- specific survival of ...
African Journals Online (AJOL)
incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...
DEFF Research Database (Denmark)
Badawy, Mona; Fenstad, Anne M.; Bartz-Johannessen, Christoffer A.
2017-01-01
Background: High procedure volume and dedication to unicompartmental knee arthroplasty (UKA) has been suggested to improve revision rates. This study aimed to quantify the annual hospital volume effect on revision risk in Oxfordu? nicompartmental knee arthroplasty in the Nordic countries. Methods......). The outcome was revision risk after 2 and 10 years calculated using Kaplan Meier method. Multivariate Cox regression analysis was used to assess the Hazard Ratio (HR) of any revision due to specific reasons with 95% confidence intervals (CI). Results: The implant survival was 80% at 10 years in the volume...
de Wit, R.; van den Berg, H.; Burghouts, J.; Nortier, J.; Slee, P.; Rodenburg, C.; Keizer, J.; Fonteyn, M.; Verweij, J.; Wils, J.
1998-01-01
We have reported previously that the anti-emetic efficacy of single agent 5HT3 antagonists is not maintained when analysed with the measurement of cumulative probabilities. Presently, the most effective anti-emetic regimen is a combination of a 5HT3 antagonist plus dexamethasone. We, therefore, assessed the sustainment of efficacy of such a combination in 125 patients, scheduled to receive cisplatin > or = 70 mg m(-2) either alone or in combination with other cytotoxic drugs. Anti-emetic therapy was initiated with 10 mg of dexamethasone and 3 mg of granisetron intravenously, before cisplatin. On days 1-6, patients received 8 mg of dexamethasone and 1 mg of granisetron twice daily by oral administration. Protection was assessed during all cycles and calculated based on cumulative probability analyses using the method of Kaplan-Meier and a model for transitional probabilities. Irrespective of the type of analysis used, the anti-emetic efficacy of granisetron/dexamethasone decreased over cycles. The initial complete acute emesis protection rate of 66% decreased to 30% according to the method of Kaplan-Meier and to 39% using the model for transitional probabilities. For delayed emesis, the initial complete protection rate of 52% decreased to 21% (Kaplan-Meier) and to 43% (transitional probabilities). In addition, we observed that protection failure in the delayed emesis period adversely influenced the acute emesis protection in the next cycle. We conclude that the anti-emetic efficacy of a 5HT3 antagonist plus dexamethasone is not maintained over multiple cycles of highly emetogenic chemotherapy, and that the acute emesis protection is adversely influenced by protection failure in the delayed emesis phase. PMID:9652766
[Application of Competing Risks Model in Predicting Smoking Relapse Following Ischemic Stroke].
Hou, Li-Sha; Li, Ji-Jie; Du, Xu-Dong; Yan, Pei-Jing; Zhu, Cai-Rong
2017-07-01
To determine factors associated with smoking relapse in men who survived from their first stroke. Data were collected through face to face interviews with stroke patients in the hospital, and then repeated every three months via telephone over the period from 2010 to 2014. Kaplan-Meier method and competing risk model were adopted to estimate and predict smoking relapse rates. The Kaplan-Meier method estimated a higher relapse rate than the competing risk model. The four-year relapse rate was 43.1% after adjustment of competing risk. Exposure to environmental tobacco smoking outside of home and workplace (such as bars and restaurants) ( P =0.01), single ( P <0.01), and prior history of smoking at least 20 cigarettes per day ( P =0.02) were significant predictors of smoking relapse. When competing risks exist, competing risks model should be used in data analyses. Smoking interventions should give priorities to those without a spouse and those with a heavy smoking history. Smoking ban in public settings can reduce smoking relapse in stroke patients.
Bowden, T J; Bricknell, I R; Preziosi, B M
2018-01-01
Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.
Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies
International Nuclear Information System (INIS)
Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.
2007-01-01
Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients
Directory of Open Access Journals (Sweden)
Yibeltal Assefa
Full Text Available INTRODUCTION: Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. METHODS: Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. RESULTS: We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. CONCLUSION: The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Computer Aided Design of the Link-Fork Head-Piston Assembly of the Kaplan Turbine with Solidworks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of the link-fork head-piston assembly of the Kaplan turbine made in SolidWorks.The present paper is a tutorial for a Kaplan turbine assembly 3D geometry, which is dedicated to the Assembly design and Drawing Geometry and Drawing Annotation.
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...
Energy Technology Data Exchange (ETDEWEB)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J. [Ludwig-Maximilians-Universitaet Muenchen (Germany). Inst. fuer Klinische Radiologie; Hautmann, H.; Huber, R.M. [Klinikum Innenstadt der Ludwig-Maximilians-Universitaet Muenchen (Germany). Abteilung Pulmonologie, Medizinische Klinik
2002-08-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [German] Ziel: Erfassung des therapeutischen Potenzials der Stentbehandlung bei tracheobronchialen Stenosen, in-vivo Vergleich verschiedener Stenttypen und Erarbeitung von geeigneten Kriterien zur Stentwahl. Material und Methodik: Prospektive Fallanalyse. Zwischen 1993 und 1999 wurden insgesamt 53 Stents in das Tracheobronichalsystem von 39 konsekutiven Patienten implantiert. Jeder einzelne Stent (26 Streckerstents, 18 Wallstents, 6 Nitinolstents, ein Dumonstent
Can a polynomial interpolation improve on the Kaplan-Yorke dimension?
International Nuclear Information System (INIS)
Richter, Hendrik
2008-01-01
The Kaplan-Yorke dimension can be derived using a linear interpolation between an h-dimensional Lyapunov exponent λ (h) >0 and an h+1-dimensional Lyapunov exponent λ (h+1) <0. In this Letter, we use a polynomial interpolation to obtain generalized Lyapunov dimensions and study the relationships among them for higher-dimensional systems
Adding gauge fields to Kaplan's fermions
International Nuclear Information System (INIS)
Blum, T.; Kaerkkaeinen, L.
1994-01-01
We experiment with adding dynamical gauge field to Kaplan (defect) fermions. In the case of U(1) gauge theory we use an inhomogeneous Higgs mechanism to restrict the 3d gauge dynamics to a planar 2d defect. In our simulations the 3d theory produce the correct 2d gauge dynamics. We measure fermion propagators with dynamical gauge fields. They posses the correct chiral structure. The fermions at the boundary of the support of the gauge field (waveguide) are non-chiral, and have a mass two times heavier than the chiral modes. Moreover, these modes cannot be excited by a source at the defect; implying that they are dynamically decoupled. We have also checked that the anomaly relation is fullfilled for the case of a smooth external gauge field. (orig.)
International Nuclear Information System (INIS)
Badwe, R.A.
1999-01-01
The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model
de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.
2012-01-01
MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex
de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.
2012-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This
XRF and XANES Data for Kaplan U Paper
The dataset contains two XRF images of iron and uranium distribution on plant roots and a database of XANES data used to produce XANES spectra figure for Figure 7 in the published paper.This dataset is associated with the following publication:Kaplan, D., R. Kukkadapu, J. Seaman, B. Arey, A. Dohnalkova, S. Buettner, D. Li, T. Varga, K. Scheckel, and P. Jaffe. Iron Mineralogy and Uranium-Binding Environment in the Rhizosphere of a Wetland Soil. D. Barcelo SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 569: 53-64, (2016).
International Nuclear Information System (INIS)
Tai, Bee-Choo; Grundy, Richard G.; Machin, David
2010-01-01
Purpose: In trials designed to delay or avoid irradiation among children with malignant brain tumor, although irradiation after disease progression is an important event, patients who have disease progression may decline radiotherapy (RT), or those without disease progression may opt for elective RT. To accurately describe the cumulative need for RT in such instances, it is crucial to account for these distinct events and to evaluate how each contributes to the delay or advancement of irradiation via a competing risks analysis. Methods and Materials: We describe the summary of competing events in such trials using competing risks methods based on cumulative incidence functions and Gray's test. The results obtained are contrasted with standard survival methods based on Kaplan-Meier curves, cause-specific hazard functions and log-rank test. Results: The Kaplan-Meier method overestimates all event-specific rates. The cause-specific hazard analysis showed reduction in hazards for all events (A: RT after progression; B: no RT after progression; C: elective RT) among children with ependymoma. For event A, a higher cumulative incidence was reported for ependymoma. Although Gray's test failed to detect any difference (p = 0.331) between histologic subtypes, the log-rank test suggested marginal evidence (p = 0.057). Similarly, for event C, the log-rank test found stronger evidence of reduction in hazard among those with ependymoma (p = 0.005) as compared with Gray's test (p = 0.086). Conclusions: To evaluate treatment differences, failing to account for competing risks using appropriate methodology may lead to incorrect interpretations.
Prognostic role of syncytin expression in breast cancer
DEFF Research Database (Denmark)
Larsson, Lars-Inge; Holck, Susanne; Christensen, Ib Jarle
2007-01-01
Breast cancer cells were recently found to produce syncytin, an endogenous retroviral protein implicated in cell fusion, immune regulation, and nitric oxide synthase expression. To determine whether syncytin has a prognostic role in breast cancer, we investigated a series of 165 premenopausal lymph...... node-negative women for syncytin expression using an immunocytochemical scoring system. Results were analyzed with the Kaplan-Meier method and with the Cox proportional hazard model. Syncytin expression was observed in 38% of the patients, and the degree of syncytin expression constituted a positive...
Association of versican turnover with all-cause mortality in patients on haemodialysis
DEFF Research Database (Denmark)
Genovese, Federica; Karsdal, Morten A; Leeming, Diana J
2014-01-01
with cardiovascular diseases. The objective of the study was to investigate the association of versican turnover assessed in plasma with survival in haemodialysis patients. METHODS: A specific matrix metalloproteinase-generated neo-epitope fragment of versican (VCANM) was measured in plasma of 364 haemodialysis...... patients with a 5-years follow-up, using a robust competitive enzyme-linked immunosorbent assays. Association between VCANM plasma concentration and survival was assessed by Kaplan-Meier analysis and adjusted Cox model. RESULTS: Haemodialysis patients with plasma VCANM concentrations in the lowest quartile...
Fatigue Analysis of an Outer Bearing Bush of a Kaplan Turbine
Directory of Open Access Journals (Sweden)
Doina Frunzaverde
2011-01-01
Full Text Available The paper presents the fatigue analysis of an outer bearing bush of aKaplan turbine. This outer bush, together with an inner one, bear thepin lever - trunion - blade subassembly of the runner blade operatingmechanism. For modeling and simulation, SolidWorks software is used.
DEFF Research Database (Denmark)
Sidenius, N; Sier, C.F.M.; Ullum, H
2000-01-01
levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...
Cervical cancer: evaluation of our results
International Nuclear Information System (INIS)
De Cola, A.; Suárez, L.; Castillo, C.
2004-01-01
Introduction: Cervical cancer in women occupies 3rd place in incidence and 5th as a cause of cancer death in our country. The evolution is mainly determined by the stage, nodal status and histological type. The treatment of these tumors is surgical, radiant and / or systemic, depending on your choice mainly Stadium. Objective: To analyze the characteristics, evolution, treatment and survival of patients carriers of cervical cancer. Patients and Methods: The medical records were retrospectively analyzed for patients with cervical cancer treated at the Department of Oncology the Clinical Hospital in the period 1994-2004. Curves were constructed survival (sv) of total and free enfemedad sv sv by stage and after relapse by the method of Kaplan-Meier. Results: n = 75 patients, median age 45 years (24-90 years). Histological type: Epidermoid carcinomas 93% 5% 2% adenocarcinomas and adenosquamous. stadium (E) Initial: 31% IE, 38% EII, EIII 25%, 6% EIVA. Treatment was according to the stadium, considering that until 1999 was not standard concurrent chemoradiation. The median sv considering all stages was 124 months. The sv to 5 years for EI was 90% (median 188 sv months), for the ISI 65% (95 months) and the median sv CIRTs was 24 months. Followed for 13 months, 12 patients relapsed and the median after sv relapse was 8 months (95% CI 4-13 months) Conclusions: Although cervical cancer is a preventable disease, remains an important cause of morbidity and mortality. Our results are consistent with those reported in the literature, however far from the optimal, so it is necessary to continue clinical trials in this regard
Reverse hybrid total hip arthroplasty
DEFF Research Database (Denmark)
Wangen, Helge; Havelin, Leif I.; Fenstad, Anne M
2017-01-01
Background and purpose - The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA, have been sparsely described. The Nordic Arthroplasty....... Patients and methods - From the NARA, we extracted data on reverse hybrid THAs from January 1, 2000 until December 31, 2013. 38,415 such hips were studied and compared with cemented THAs. The Kaplan-Meier method and Cox regression analyses were used to estimate the prosthesis survival and the relative risk...
Epilepsy in Rett syndrome--lessons from the Rett networked database
DEFF Research Database (Denmark)
Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori
2015-01-01
collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...
International Nuclear Information System (INIS)
Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.
2016-01-01
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Energy Technology Data Exchange (ETDEWEB)
Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)
2016-07-15
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Runaway transient simulation of a model Kaplan turbine
Energy Technology Data Exchange (ETDEWEB)
Liu, S; Liu, D; Wu, Y [State Key Laboratory of Hydroscience and Engineering, Department of Thermal Eng., Tsinghua University, Beijing, 100084 (China); Zhou, D [Water Conservancy and Hydropower Eng., Hohai University, Nanjing. 210098 (China); Nishi, M, E-mail: liushuhong@tsinghua.edu.c [Kyushu Inst. Tech. Senior Academy, Kitakyushu, 804-8550 (Japan)
2010-08-15
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-{epsilon} turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Runaway transient simulation of a model Kaplan turbine
Liu, S.; Zhou, D.; Liu, D.; Wu, Y.; Nishi, M.
2010-08-01
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-epsilon turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Runaway transient simulation of a model Kaplan turbine
International Nuclear Information System (INIS)
Liu, S; Liu, D; Wu, Y; Zhou, D; Nishi, M
2010-01-01
The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-ε turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.
Vogl, Vanessa; Hiller, Karl-Anton; Buchalla, Wolfgang; Federlin, Marianne; Schmalz, Gottfried
2016-12-01
A new universal adhesive with corresponding luting composite was recently marketed which can be used both, in a self-etch or in an etch-and-rinse mode. In this study, the clinical performance of partial ceramic crowns (PCCs) inserted with this adhesive and the corresponding luting material used in a self-etch or selective etch approach was compared with a self-adhesive universal luting material. Three PCCs were placed in a split-mouth design in 50 patients. Two PCCs were luted with a combination of a universal adhesive/resin cement (Scotchbond Universal/RelyX Ultimate, 3M ESPE) with (SB+E)/without (SB-E) selective enamel etching. Another PCC was luted with a self-adhesive resin cement (RelyX Unicem 2, 3M ESPE). Forty-eight patients were evaluated clinically according to FDI criteria at baseline and 6, 12 and 18 months. For statistical analyses, the chi-square test (α = 0.05) and Kaplan-Meier analysis were applied. Clinically, no statistically significant differences between groups were detected over time. Within groups, clinically significant increase for criterion "marginal staining" was detected for SB-E over 18 months. Kaplan-Meier analysis revealed significantly higher retention rates for SB+E (97.8 %) and SB-E (95.6 %) in comparison to RXU2 (75.6 %). The 18-month clinical performance of a new universal adhesive/composite combination showed no differences with respect to bonding strategy and may be recommended for luting PCCs. Longer-term evaluation is needed to confirm superiority of SB+E over SB-E. At 18 months, the new multi-mode adhesive, Scotchbond Universal, showed clinically reliable results when used for luting PCCs.
DEFF Research Database (Denmark)
Lange, Jeppe; Troelsen, Anders; Solgaard, Søren
2018-01-01
was re-revision performed due to infection and was evaluated by competing risk analysis, with death and aseptic revision as competing events. All-cause mortality was evaluated by Kaplan-Meier survival analysis. Oxford Hip Score (OHS) was used as disease-specific patient-reported outcome measure. RESULTS......BACKGROUND: Cementless 1-stage revision in chronic periprosthetic hip joint infections is limited evaluated. The purpose of this study was to evaluate a specific treatment protocol in this patient group. METHODS: The study was performed as a multicenter, proof-of-concept, observational study...
DEFF Research Database (Denmark)
Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul
2016-01-01
OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...
Clinical Features in a Danish Population-Based Cohort of Probable Multiple System Atrophy Patients
DEFF Research Database (Denmark)
Starhof, Charlotte; Korbo, Lise; Lassen, Christina Funch
2016-01-01
Background: Multiple system atrophy (MSA) is a rare, sporadic and progressive neurodegenerative disorder. We aimed to describe the clinical features of Danish probable MSA patients, evaluate their initial response to dopaminergic therapy and examine mortality. Methods: From the Danish National...... the criteria for probable MSA. We recorded clinical features, examined differences by MSA subtype and used Kaplan-Meier survival analysis to examine mortality. Results: The mean age at onset of patients with probable MSA was 60.2 years (range 36-75 years) and mean time to wheelchair dependency was 4.7 years...
International Nuclear Information System (INIS)
Zhu Yueqi; Li Minghua; Fang Chun; Wang Wu; Zhang Peilei; Cheng Yingsheng; Tan Huaqiao; Wang Jianbo
2010-01-01
Objective: Complicated aneurysms located in the cisternal segment of the internal carotid artery(ICA-CSA) present unique therapeutic difficulties. This study is to discuss the feasibility of the Willis stent-graft in treating complicated ICA-CSA by comparing its effect with that of coiling therapy. Methods: Willis covered stents were employed in 19 complicated ICA-CSAs (group A), while coils were used in 17 complicated ICA-CSAs (group B). Follow-up angiography was performed to investigate aneurysm recurrence, endoleak and parent artery (PA) stenosis. Kaplan-Meier curves were constructed to compare the recurrence-free and PA stenosis-free rate in both groups. Results: Total exclusion was immediately achieved in 13 ICA-CSAs and minor endoleaks presented in 5 cases in group A. Total or near-total occlusion was achieved in 7 ICA-CSAs, subtotal occlusion in 8 and partial occlusion in 2 cases in group B after coiling. Acute thrombosis occurred in 1 patient in either group and re-hemorrhage happened in 1 patient after coiling. Follow-up angiography in group A revealed that 16 ICA-CSAs were completely isolated, with two parent arteries showing mild in-stent stenosis. Eighteen months after the procedure, Kaplan-Meier analysis showed that the recurrence-free rate was 93.3% and 50%, while the stenosis-free rate of parent artery was 87.5% and 100% in group A and in Group B, respectively. In group A and group Bthe clinical neurological symptoms were fully recovered in 9 and 9, obviously improved in 3 and 5, unchanged in 2 and 2, and aggravated in one and 0 patients, respectively. Conclusion: The implantation of Willis stent-graft is a feasible endovascular therapy for complicated ICA-CSAs. When the parent artery is very tortuous or when the risk that a main collateral branch may be wrongly covered and occluded is present, the implantation of Willis covered stent can not be taken as the treatment of first choice. (authors)
Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents
International Nuclear Information System (INIS)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J.; Hautmann, H.; Huber, R.M.
2002-01-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [de
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
International Nuclear Information System (INIS)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho
2010-01-01
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
Energy Technology Data Exchange (ETDEWEB)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)
2010-08-15
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.
Directory of Open Access Journals (Sweden)
Hee Jin Lee
Full Text Available Several methods are used to assess the pathologic response of breast cancer after neoadjuvant chemotherapy (NAC to predict clinical outcome. However, the clinical utility of these systems for each molecular subtype of breast cancer is unclear. Therefore, we applied six pathologic response assessment systems to specific subtypes of breast cancer and compared the results.Five hundred and eighty eight breast cancer patients treated with anthracycline with/without taxane-based NAC were retrospectively analyzed, and the ypTNM stage, residual cancer burden (RCB, residual disease in breast and nodes (RDBN, tumor response ratio, Sataloff's classification, and Miller-Payne grading system were evaluated. The results obtained for each assessment system were analyzed in terms of patient survival.In triple-negative tumors, all systems were significantly associated with disease-free survival and Kaplan-Meier survival curves for disease-free survival were clearly separated by all assessment methods. For HR+/HER2- tumors, systems assessing the residual tumor (ypTNM stage, RCB, and RDBN had prognostic significance. However, for HER2+ tumors, the association between patient survival and the pathologic response assessment results varied according to the system used, and none resulted in distinct Kaplan-Meier curves.Most of the currently available pathologic assessment systems used after anthracycline with/without taxane-based NAC effectively classified triple-negative breast cancers into groups showing different prognoses. The pathologic assessment systems evaluating residual tumors only also had prognostic significance in HR+/HER2- tumors. However, new assessment methods are required to effectively evaluate the pathologic response of HR+/HER2+ and HR-/HER2+ tumors to anthracycline with/without taxane-based NAC.
A cyclostationary multi-domain analysis of fluid instability in Kaplan turbines
Pennacchi, P.; Borghesani, P.; Chatterton, S.
2015-08-01
Hydraulic instabilities represent a critical problem for Francis and Kaplan turbines, reducing their useful life due to increase of fatigue on the components and cavitation phenomena. Whereas an exhaustive list of publications on computational fluid-dynamic models of hydraulic instability is available, the possibility of applying diagnostic techniques based on vibration measurements has not been investigated sufficiently, also because the appropriate sensors seldom equip hydro turbine units. The aim of this study is to fill this knowledge gap and to exploit fully, for this purpose, the potentiality of combining cyclostationary analysis tools, able to describe complex dynamics such as those of fluid-structure interactions, with order tracking procedures, allowing domain transformations and consequently the separation of synchronous and non-synchronous components. This paper will focus on experimental data obtained on a full-scale Kaplan turbine unit, operating in a real power plant, tackling the issues of adapting such diagnostic tools for the analysis of hydraulic instabilities and proposing techniques and methodologies for a highly automated condition monitoring system.
DEFF Research Database (Denmark)
Ewertz, M.; Kempel, M.M.; During, M.
2008-01-01
patients in Denmark. PATIENTS AND METHODS: To evaluate the results of this treatment, we performed a nationwide population-based follow-up study of patients aged less than 75 years treated in Denmark from 1989 to 1998 based on the database of Danish Breast Cancer Cooperative Group. RESULTS: At 15 years...... of follow-up, the Kaplan-Meier estimate of overall survival was 69% among 3 758 patients who received the recommended treatment. Within the first 10 years of follow-up, the cumulative incidences of loco-regional recurrences, distant metastases or other malignant disease, or death as a first event were 9...
Large mass limit of the continuum theories in Kaplan's formulation
International Nuclear Information System (INIS)
Kawano, T.; Kikukawa, Y.
1994-01-01
Being inspired by Kaplan's proposal for simulating chiral fermions on a lattice, we examine the continuum analogue of his domain-wall construction for two-dimensional chiral Schwinger models. Adopting a slightly unusual dimensional regularization, we explicitly evaluate the one-loop effective action in the limit that the domain-wall mass goes to infinity. For anomaly-free cases, the effective action turns out to be gauge invariant in the two-dimensional sense
Application of Enlisted Force Retention Levels and Career Field Stability
2017-03-23
APPLICATION OF ENLISTED FORCE RETENTION LEVELS AND CAREER FIELD STABILITY THESIS Presented to the Faculty Department of Operational Sciences ...Fulfillment of the Requirements for the Degree of Master of Science in Operations Research Jamie T. Zimmermann, MS, BS Captain, USAF March 2017...Appendix B. The function proc lifetest is a nonparametric estimate of the survivor function using either the Kaplan-Meier method or the actuarial
Metastatic nasopharyngeal carcinoma: clinical study and therapeutic results of 95 cases
International Nuclear Information System (INIS)
Khanfir, A.; Frikha, M.; Ghorbel, A.; Drira, M.M.; Karray, H.; Daoud, J.
2006-01-01
Purpose. -- The objective of this retrospective study was to discuss the epidemio-clinical criteria and the therapeutic results of metastatic nasopharyngeal carcinoma. Patients and methods. - The current study concerned 95 patients with histologically proven nasopharyngeal carcinoma who were metastatic at diagnosis or who had developed late metastasis. We reviewed the epidemio-clinical records of all the patients. Patients were treated with chemotherapy (BEC regimen: bleomycin, epirubicin and cisplatin or PBF regimen: bleomycin, 5-fluorouracil and cisplatin) and radiotherapy of pauci metastatic localizations (single or double) or bone metastasis with high risk of compression or fracture ±associated with locoregional radiotherapy for patients who were metastatic at diagnosis. Response was assessed according to the WHO criteria. Overall survival was calculated according to the Kaplan-Meier method. A long-term disease-free survival was defined from 36 months. Results. - There were 34 patients who were metastatic at diagnosis and 61 patients who had developed late metastasis. The mean age was 41.5 years (sex-ratio: 3.1). Bone metastases were the most frequent (83%). Objective and complete response rates were respectively 75% and 70%, and 32% and 16% for BEC and PBF regimens. Twenty-five patients received radiotherapy for pauci metastatic localizations, among whom 19 patients who were metastatic at diagnosis received locoregional irradiation. The overall survival probability was of 15% for three years. Eleven patients were long survivors (extremes: 36 and 134 months). Conclusion. - Therapeutic results were comparable to those reported in other series using platin combination chemotherapy. Radiotherapy of metastasis yielded to long-term survival. (authors)
Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease
Directory of Open Access Journals (Sweden)
Rabah M. Shawky
2014-10-01
Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.
Energy Technology Data Exchange (ETDEWEB)
Drygas, A.; Bauer, K. [E.ON Wasserkraft GmbH, Landshut (Germany)
2008-07-01
In spite of aiming at minimum maintenance costs, runners of Kaplan turbines need to be kept in good repair. Besides preserving their main function as an energy converter, ecological reasons have to be considered as well. The latter aspect accounts for fully functional, safe seals of the pivot-mounted Kaplan runner blades. Advanced wear of the sealing surfaces may require mechanical processing, which formerly called for a costly dismantling of the runner. A newly developed and patented processing device now allows for machining the worn out sealing surfaces without dismantling the runner, thus reducing costs considerably. The device was first successfully applied to a Kaplan turbine runner with a diameter of 5.35 m. The device, so far designed for grinding, will be enhanced for lathing, in order to obtain a process even more efficient when combining lathing and grinding. (orig.)
Simone, Giuseppe; Tuderti, Gabriele; Misuraca, Leonardo; Anceschi, Umberto; Ferriero, Mariaconsiglia; Minisola, Francesco; Guaglianone, Salvatore; Gallucci, Michele
2018-04-17
In this study, we compared perioperative and oncologic outcomes of patients treated with either open or robot-assisted radical cystectomy and intracorporeal neobladder at a tertiary care center. The institutional prospective bladder cancer database was queried for "cystectomy with curative intent" and "neobladder". All patients underwent robot-assisted radical cystectomy and intracorporeal neobladder or open radical cystectomy and orthotopic neobladder for high-grade non-muscle invasive bladder cancer or muscle invasive bladder cancer with a follow-up length ≥2 years were included. A 1:1 propensity score matching analysis was used. Kaplan-Meier method was performed to compare oncologic outcomes of selected cohorts. Survival rates were computed at 1,2,3 and 4 years after surgery and the log rank test was applied to assess statistical significance between the matched groups. Overall, 363 patients (299 open and 64 robotic) were included. Open radical cystectomy patients were more frequently male (p = 0.08), with higher pT stages (p = 0.003), lower incidence of urothelial histologies (p = 0.05) and lesser adoption of neoadjuvant chemotherapy (open radical cystectomy cases (all p ≥ 0.22). Open cohort showed a higher rate of perioperative overall complications (91.3% vs 42.2%, p 0.001). At Kaplan-Meier analysis robotic and open cohorts displayed comparable disease-free survival (log-rank p = 0.746), cancer-specific survival (p = 0.753) and overall-survival rates (p = 0.909). Robot-assisted radical cystectomy and intracorporeal neobladder provides comparable oncologic outcomes of open radical cystectomy and orthotopic neobladder at intermediate term survival analysis. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.
Rivetti, A.; Angulo, M.; Lucino, C.; Hene, M.; Capezio, O.; Liscia, S.
2016-11-01
Blade tip cavitation is a well-known phenomenon that affects the performance of large-diameter Kaplan turbines and induces structural vibration. Injection of pressurized air has been found to yield promising results in reducing those damaging effects. In this work, the results of an experimental test of air injection on a 9.5-m-diameter Kaplan turbine are reported. Experiments were performed for several load conditions and for two different net heads. Accelerations, pressure pulsation and noise emission were monitored for every tested condition. Results show that, at the expense of a maximum efficiency drop of 0.2%, air injection induces a decrease on the level of vibration from 57% up to 84%, depending on the load condition. Such decrease is seen to be proportional to the air flow rate, in the range from 0.06 to 0.8‰ (respect to the discharge at the best efficiency point).
Results of revision anterior shoulder stabilization surgery in adolescent athletes.
Blackman, Andrew J; Krych, Aaron J; Kuzma, Scott A; Chow, Roxanne M; Camp, Christopher; Dahm, Diane L
2014-11-01
The purpose of this study was to determine failure rates, functional outcomes, and risk factors for failure after revision anterior shoulder stabilization surgery in high-risk adolescent athletes. Adolescent athletes who underwent primary anterior shoulder stabilization were reviewed. Patients undergoing subsequent revision stabilization surgery were identified and analyzed. Failure rates after revision surgery were assessed by Kaplan-Meier analysis. Failure was defined as recurrent instability requiring reoperation. Functional outcomes included the Marx activity score; American Shoulder and Elbow Surgeons score; and University of California, Los Angeles score. The characteristics of patients who required reoperation for recurrent instability after revision surgery were compared with those of patients who required only a single revision to identify potential risk factors for failure. Of 90 patients who underwent primary anterior stabilization surgery, 15 (17%) had failure and underwent revision surgery (mean age, 16.6 years; age range, 14 to 18 years). The mean follow-up period was 5.5 years (range, 2 to 12 years). Of the 15 revision patients, 5 (33%) had recurrent dislocations and required repeat revision stabilization surgery at a mean of 50 months (range, 22 to 102 months) after initial revision. No risk factors for failure were identified. The Kaplan-Meier reoperation-free estimates were 86% (95% confidence interval, 67% to 100%) at 24 months and 78% (95% confidence interval, 56% to 100%) at 48 months after revision surgery. The mean final Marx activity score was 14.8 (range, 5 to 20); American Shoulder and Elbow Surgeons score, 82.1 (range, 33 to 100); and University of California, Los Angeles score, 30.8 (range, 16 to 35). At 5.5 years' follow-up, adolescent athletes had a high failure rate of revision stabilization surgery and modest functional outcomes. We were unable to convincingly identify specific risk factors for failure of revision surgery. Level IV
Measuring survival time: a probability-based approach useful in healthcare decision-making.
2011-01-01
In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.
Directory of Open Access Journals (Sweden)
Muge Akmansu
2010-12-01
Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.
Treatments Results and Prognostic Factors in Locally Advanced Hypopharyngeal Cancer
International Nuclear Information System (INIS)
Yoon, Mee-Sun; Chung, Woong-Ki; Ahn, Sung-Ja; Nam, Taek-Keun; Song, Ju-Young; Nah, Byung-Sik; Lim, Sang Cheol; Lee, Joon Kyoo
2007-01-01
The purpose of this study is to present the treatment results and to identify possible prognostic indicators in patients with locally advanced hypopharyngeal carcinoma. Materials and Methods: Between October 1985 to December 2000, 90 patients who had locally advanced stage IV hypopharyngeal carcinoma were studied retrospectively. Twelve patients were treated with radiotherapy alone, 65 patients were treated with a combination of chemotherapy and radiotherapy, and 13 patients were treated with surgery and postoperative radiotherapy with or without neoadjuvant chemotherapy. Total radiation dose ranged from 59.0 to 88.2 Gy (median 70 Gy) for radiotherapy alone. Most patients had ciplatin and 5-fluorouracil, and others had cisplatin and peplomycin or vincristin. Median follow-up period was 15 months. Kaplan-Meier method was used for survival rate and Cox proportional hazard model for multivariate analysis of prognostic factors. Results: Overall 3- and 5-year survival rates were 27% and 17%, respectively. The 2-year locoregional control rates were 33% for radiotherapy alone, 32% for combined chemotherapy and radiotherapy, and 81% for combined surgery and radiotherapy (p=0.006). The prognostic factors affecting overall survival were T stage, concurrent chemo radiation and treatment response. Overall 3- and 5-year laryngeal preservation rates in combined chemotherapy and radiotherapy were 26% and 22%, respectively. Of these, the 5-year laryngeal preservation rates were 52% for concurrent chemo radiation group (n=11), and 16% for neoadjuvant chemotherapy and radiotherapy (n=54, p=0.012). Conclusion: Surgery and postoperative radiotherapy showed better results than radiotherapy alone or with chemotherapy. Radiotherapy combined with concurrent chemotherapy is an effective modality to achieve organ preservation in locally advanced hypopharyngeal cancer. Further prospective randomized studies will be required
Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng
2017-05-23
BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.
Directory of Open Access Journals (Sweden)
Køber Lars
2010-01-01
Full Text Available Abstract Background The optimal duration of clopidogrel treatment after percutaneous coronary intervention (PCI is unclear. We studied the risk of death or recurrent myocardial infarction (MI in relation to 6- and 12-months clopidogrel treatment among MI patients treated with PCI. Methods Using nationwide registers of hospitalizations and drug dispensing from pharmacies we identified 11 680 patients admitted with MI, treated with PCI and clopidogrel. Clopidogrel treatment was categorized in a 6-months and a 12-months regimen. Rates of death, recurrent MI or a combination of both were analyzed by the Kaplan Meier method and Cox proportional hazards models. Bleedings were compared between treatment regimens. Results The Kaplan Meier analysis indicated no benefit of the 12-months regimen compared with the 6-months in all endpoints. The Cox proportional hazards analysis confirmed these findings with hazard ratios for the 12-months regimen (the 6-months regimen used as reference for the composite endpoint of 1.01 (confidence intervals 0.81-1.26 and 1.24 (confidence intervals 0.95-1.62 for Day 0-179 and Day 180-540 after discharge. Bleedings occurred in 3.5% and 4.1% of the patients in the 6-months and 12-months regimen (p = 0.06. Conclusions We found comparable rates of death and recurrent MI in patients treated with 6- and 12-months' clopidogrel. The potential benefit of prolonged clopidogrel treatment in a real-life setting remains uncertain.
TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier
Tursk, Eda
2004-01-01
Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan
Cheung, Li C; Pan, Qing; Hyun, Noorie; Schiffman, Mark; Fetterman, Barbara; Castle, Philip E; Lorey, Thomas; Katki, Hormuzd A
2017-09-30
For cost-effectiveness and efficiency, many large-scale general-purpose cohort studies are being assembled within large health-care providers who use electronic health records. Two key features of such data are that incident disease is interval-censored between irregular visits and there can be pre-existing (prevalent) disease. Because prevalent disease is not always immediately diagnosed, some disease diagnosed at later visits are actually undiagnosed prevalent disease. We consider prevalent disease as a point mass at time zero for clinical applications where there is no interest in time of prevalent disease onset. We demonstrate that the naive Kaplan-Meier cumulative risk estimator underestimates risks at early time points and overestimates later risks. We propose a general family of mixture models for undiagnosed prevalent disease and interval-censored incident disease that we call prevalence-incidence models. Parameters for parametric prevalence-incidence models, such as the logistic regression and Weibull survival (logistic-Weibull) model, are estimated by direct likelihood maximization or by EM algorithm. Non-parametric methods are proposed to calculate cumulative risks for cases without covariates. We compare naive Kaplan-Meier, logistic-Weibull, and non-parametric estimates of cumulative risk in the cervical cancer screening program at Kaiser Permanente Northern California. Kaplan-Meier provided poor estimates while the logistic-Weibull model was a close fit to the non-parametric. Our findings support our use of logistic-Weibull models to develop the risk estimates that underlie current US risk-based cervical cancer screening guidelines. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Renal replacement therapy for autosomal dominant polycystic kidney disease (ADPKD) in Europe
DEFF Research Database (Denmark)
Spithoven, Edwin M; Kramer, Anneke; Meijer, Esther
2014-01-01
on RRT prevalence and survival on RRT in 12 European countries with 208 million inhabitants. We studied four 5-year periods (1991-2010). Survival analysis was performed by the Kaplan-Meier method and by Cox proportional hazards regression. RESULTS: From the first to the last study period, the prevalence...... for non-ADPKD subjects. Improved survival was noted for all RRT modalities: haemodialysis [adjusted hazard ratio for mortality during the last versus first time period 0.75 (95% confidence interval 0.61-0.91), peritoneal dialysis 0.55 (0.38-0.80) and transplantation 0.52 (0.32-0.74)]. Cardiovascular...
Epidemiology of Massive Transfusion
DEFF Research Database (Denmark)
Halmin, Märit; Chiesa, Flaminia; Vasan, Senthil K
2016-01-01
in Sweden from 1987 and in Denmark from 1996. A total of 92,057 patients were included. Patients were followed until the end of 2012. MEASUREMENTS AND MAIN RESULTS: Descriptive statistics were used to characterize the patients and indications. Post transfusion mortality was expressed as crude 30-day...... mortality and as long-term mortality using the Kaplan-Meier method and using standardized mortality ratios. The incidence of massive transfusion was higher in Denmark (4.5 per 10,000) than in Sweden (2.5 per 10,000). The most common indication for massive transfusion was major surgery (61.2%) followed...
DEFF Research Database (Denmark)
Schneider, Uffe; Nielsen, Rikke; Pedersen, Court
2007-01-01
. METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...
Increased 30-day mortality in patients with diabetes undergoing surgery for colorectal cancer
DEFF Research Database (Denmark)
Fransgaard, T; Thygesen, L C; Gögenur, I
2016-01-01
with the use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The 30-day mortality was examined by the Kaplan-Meier method with the log-rank test and the Cox regression model used to test statistical significance. RESULTS: The study included 29 353 patients, of whom...... 3250 had preexisting diabetes. The 30-day mortality was significantly increased in patients with CRC and preexisting diabetes (adjusted hazard ratio 1.17, 95% CI 1.01-1.35, P = 0.03). The type of antidiabetic medication used was not associated with 30-day mortality. CONCLUSION: Preexisting diabetes...
Castro-Otero, C.
2017-04-01
Very often small turbine manufacturers are requested to produce sizeable turbines, too large in terms of physical dimensions, power or designing capacity. In these cases clever alternative solutions should be found to meet customers’ needs. For instance: in the old times twin runner Francis turbines were an option instead of one large machine, or if a too large Pelton turbine cannot be manufactured or designed, a good option is to install a medium size Francis and a small Pelton. Likewise, a similar approach needs to be taken should the manufacturer be asked for a too large Kaplan. Facing this situation a good option is to install three or more small Kaplan turbines. This particular case was studied in depth and after all the considerations had been made, the following question arouse: Is this a way out for the manufacturer or is it really the best option for the customer? The choice made as a way out for the manufacturer became the best option for the customer and a success for both parties. This paper aims to encourage developers and engineering firms to search for more options than the traditional one to find the best option in plant design.
Gustavsson, Mikael; Kreuger, Jenny; Bundschuh, Mirco; Backhaus, Thomas
2017-11-15
This paper presents the ecotoxicological assessment and environmental risk evaluation of complex pesticide mixtures occurring in freshwater ecosystems in southern Sweden. The evaluation is based on exposure data collected between 2002 and 2013 by the Swedish pesticide monitoring program and includes 1308 individual samples, detecting mixtures of up to 53 pesticides (modal=8). Pesticide mixture risks were evaluated using three different scenarios for non-detects (best-case, worst-case and using the Kaplan-Meier method). The risk of each scenario was analyzed using Swedish Water Quality Objectives (WQO) and trophic-level specific environmental thresholds. Using the Kaplan-Meier method the environmental risk of 73% of the samples exceeded acceptable levels, based on an assessment using Concentration-Addition and WQOs for the individual pesticides. Algae were the most sensitive organism group. However, analytical detection limits, especially for insecticides, were insufficient to analyze concentrations at or near their WQO's. Thus, the risk of the analyzed pesticide mixtures to crustaceans and fish is systematically underestimated. Treating non-detects as being present at their individual limit of detection increased the estimated risk by a factor 100 or more, compared to the best-case or the Kaplan-Meier scenario. Pesticide mixture risks are often driven by only 1-3 compounds. However, the risk-drivers (i.e., individual pesticides explaining the largest share of potential effects) differ substantially between sites and samples, and 83 of the 141 monitored pesticides need to be included in the assessment to account for 95% of the risk at all sites and years. Single-substance oriented risk mitigation measures that would ensure that each individual pesticide is present at a maximum of 95% of its individual WQO, would also reduce the mixture risk, but only from a median risk quotient of 2.1 to a median risk quotient of 1.8. Also, acceptable total risk levels would still
Directory of Open Access Journals (Sweden)
Anurag Polavarapu
2015-01-01
Full Text Available Objective. The main aim is to evaluate safety, efficacy, and clinical performance of the Indolimus (Sahajanand Medical Technologies Pvt. Ltd., Surat, India sirolimus-eluting stent in high-risk diabetic population with complex lesions. Methods. It was a multicentre, retrospective, non-randomized, single-arm study, which enrolled 372 diabetic patients treated with Indolimus. The primary endpoint of the study was major adverse cardiac events (MACE, which is a composite of cardiac death, target lesion revascularization (TLR, target vessel revascularization (TVR, myocardial infarction (MI, and stent thrombosis (ST. The clinical follow-ups were scheduled at 30 days, 6 months, and 9 months. Results. The mean age of the enrolled patients was 53.4 ± 10.2 years. A total of 437 lesions were intervened successfully with 483 stents (1.1 ± 0.3 per lesion. There were 256 (68.8% male patients. Hypertension and totally occluded lesions were found in 202 (54.3% and 45 (10.3% patients, respectively. The incidence of MACE at 30 days, 6 months and 9 months was 0 (0%, 6 (1.6%, and 8 (2.2%, respectively. The event-free survival at 9-month follow-up by Kaplan Meier method was found to be 97.8%. Conclusion. The use of biodegradable polymer coated sirolimus-eluting stent is associated with favorable outcomes. The results demonstrated in our study depict its safety and efficacy in diabetic population.
An electronic health record-enabled obesity database
Directory of Open Access Journals (Sweden)
Wood G
2012-05-01
Full Text Available Abstract Background The effectiveness of weight loss therapies is commonly measured using body mass index and other obesity-related variables. Although these data are often stored in electronic health records (EHRs and potentially very accessible, few studies on obesity and weight loss have used data derived from EHRs. We developed processes for obtaining data from the EHR in order to construct a database on patients undergoing Roux-en-Y gastric bypass (RYGB surgery. Methods Clinical data obtained as part of standard of care in a bariatric surgery program at an integrated health delivery system were extracted from the EHR and deposited into a data warehouse. Data files were extracted, cleaned, and stored in research datasets. To illustrate the utility of the data, Kaplan-Meier analysis was used to estimate length of post-operative follow-up. Results Demographic, laboratory, medication, co-morbidity, and survey data were obtained from 2028 patients who had undergone RYGB at the same institution since 2004. Pre-and post-operative diagnostic and prescribing information were available on all patients, while survey laboratory data were available on a majority of patients. The number of patients with post-operative laboratory test results varied by test. Based on Kaplan-Meier estimates, over 74% of patients had post-operative weight data available at 4 years. Conclusion A variety of EHR-derived data related to obesity can be efficiently obtained and used to study important outcomes following RYGB.
Survival of Patients With Cervical Cancer in Rural India
Vinoda Thulaseedharan, Jissa; Malila, Nea; Swaminathan, Rajaraman; Esmy Pulikottil, Okuru; Hakama, Matti; Muwonge, Richard; Sankaranarayanan, Rengaswamy
2015-01-01
Background: Patients’ survival after diagnosis of cervical cancer is indirectly influenced by socio-economic factors. We evaluated this survival and its socio-economic determinants in a rural population in south India. Methods: We assessed 165 women diagnosed with cervical cancer from the routine care control arm of a randomized screening trial conducted in rural south India. Kaplan-Meier curves were plotted to illustrate the observed survival of cancer patients. The effect of socio-econom...
Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus
2013-01-01
BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...
Abraham, Anasooya; Habermann, Elizabeth B; Rothenberger, David A; Kwaan, Mary; Weinberg, Armin D; Parsons, Helen M; Gupta, Pankaj; Al-Refaie, Waddah B
2013-01-15
Randomized trials demonstrating the benefits of chemotherapy in patients with American Joint Committee on Cancer stage III colon cancer underrepresent persons aged ≥ 75 years. The generalizability of these studies to a growing elderly population remains unknown. Using the California Cancer Registry for 1994 through 2008, the authors conducted a population-based study of postcolectomy patients aged 50 years to 94 years with stage III (N1M0) colon adenocarcinoma. A 2-sided chi-square test and Cochran-Armitage test for trend were used to compare patient and tumor characteristics associated with receipt of chemotherapy across age groups. Multivariate regression was used to assess the association between older age and receipt of chemotherapy. Kaplan-Meier methods and Cox proportional hazards modeling were used to evaluate the association between chemotherapy and mortality, with propensity score adjustment. Approximately 44% (12,382 patients) of the study cohort was aged ≥ 75 years. Persons aged ≥ 75 years were found to be less likely to have received adjuvant chemotherapy than those aged colon cancer in the elderly. Copyright © 2012 American Cancer Society.
International Nuclear Information System (INIS)
Lubienski, A.; Bitsch, R.G.; Grenacher, L.; Kauffmann, G.W.; Schemmer, P.; Duex, M.
2004-01-01
Purpose: A retrospective analysis of long-term efficacy of combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) and TACE monotherapy was conducted in patients with large, non-resectable hepatocellular carcinoma (HCC). Methods and Materials: Fifty patients with large, unresectable HCC lesions underwent selective TACE. Liver cirrhosis was present in 42 patients, due to alcohol abuse (n = 22) and viral infection (n = 17). In three patients, the underlying cause for liver cirrhosis remained unclear. Child A cirrhosis was found in 22 and Child B cirrhosis in 20 patients. Repeated and combined TACE and PEI were performed in 22 patients and repeated TACE monotherapy was performed in 28 patients. Survival and complication rates were determined and compared. Results: The 6-, 12-, 24- and 36-month survival rates were 61%, 21%, 4%, and 4% for TACE monotherapy and 77%, 55%, 39% and 22% for combined TACE and PEI (Kaplan-Meier method). The kind of treatment significantly affected the survival rate (p=0.002 log-rank test). Severe side effects were present in two patients of the monotherapy group and in three patients of the combination therapy group. (orig.)
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
International Nuclear Information System (INIS)
Rivetti, A; Lucino, C; Liscia, S; Muguerza, D; Avellan, F
2012-01-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
Rivetti, A.; Lucino1, C.; Liscia, S.; Muguerza, D.; Avellan, F.
2012-11-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
Nested Cohort - R software package
NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.
DEFF Research Database (Denmark)
Agerbo, Esben
2007-01-01
longitudinal data on income, labor market affiliation, educational attainment, and marital and cohabitational status (96,369 patients, 256,619 admissions, and 2727 suicides). MAIN OUTCOME MEASURES: Suicide risks after hospital discharge were depicted using Kaplan-Meier product-limit methods. Hazard ratios (HRs...... is generally associated with low income, unemployment, educational underachievement, and singleness, but this study suggests that the opposite is true among psychiatric patients. However, loss of income, labor market status, and marriage increase the suicide risk....
Schein, Jeffrey; Caplan, Eric
2014-01-01
The thoughts of Mordecai Kaplan and Michael Rosenak present surprising commonalities as well as illuminating differences. Similarities include the perception that Judaism and Jewish education are in crisis, the belief that Jewish peoplehood must include commitment to meaningful content, the need for teachers to teach from a position of…
International Nuclear Information System (INIS)
Hanks, Gerald E.; Hanlon, Alexandra L. M.S.; Schultheiss, Timothy E.; Pinover, Wayne H.; Movsas, Benjamin; Epstein, Barry E.; Hunt, Margie
1998-01-01
Purpose: To report the 5-year outcomes of dose escalation with 3D conformal treatment (3DCRT) of prostate cancer. Methods and Materials: Two hundred thirty-two consecutive patients were treated with 3DCRT alone between 6/89 and 10/92 with ICRU reporting point dose that increased from 63 to 79 Gy. The median follow-up was 60 months, and any patient free of clinical or biochemical evidence of disease was termed bNED. Biochemical failure was defined as prostate-specific antigen (PSA) rising on two consecutive recordings and exceeding 1.5 ng/ml. Morbidity was reported by the Radiation Therapy Oncology Group (RTOG) scale, the Late Effects Normal Tissue (LENT) scale, and a Fox Chase modification of the latter (FC-LENT). All patients were treated with a four-field technique with a 1 cm clinical target volume (CTV) to planning target volume (PTV) margin to the prostate or prostate boost; the CTV and gross tumor volume (GTV) were the same. Actuarial rates of outcome were calculated by Kaplan-Meier and cumulative incidence methods and compared using the log rank and Gray's test statistic, respectively. Cox regression models were used to establish prognostic factors predictive of the various measures of outcome. Five-year Kaplan-Meier bNED rates were utilized by dose group to estimate logit response models for bNED and late morbidity. Results: PSA 10 ng/ml based on 5-year bNED results. No dose response was observed for patients with pretreatment PSA 10 ng/ml strongly suggests that clinical trials employing radiation should investigate the use of 3DCRT and prostate doses of 76-80 Gy
ORIGINAL ARTICLES Antiretroviral treatment for children
African Journals Online (AJOL)
Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.
Prosthetic above-knee femoropopliteal bypass grafting: five-year results of a randomized trial.
Green, R M; Abbott, W M; Matsumoto, T; Wheeler, J R; Miller, N; Veith, F J; Money, S; Garrett, H E
2000-03-01
This trial was designed to identify factors affecting patency rates of primary prosthetic above-knee femoropopliteal bypass grafts at 5 years. A multi-institutional, prospective trial randomized 240 patients to compare patency rates of Gore-tex and Hemashield above-knee femoropopliteal bypass grafts at 5 years. Univariate comparisons of patency between levels of each prognostic variable were made with the Kaplan-Meier method. Variables that had a univariate P value less than.25 or those known to be important were submitted to a Cox regression analysis. The patient survival rate at 5 years was 59.4%. There were no differences in primary or secondary patency rates at 5 years between the two graft materials (primary, 45% vs 43% and secondary, 68% vs 68%). The risk for graft occlusion was significantly increased for patients younger than 65 years (2.1; P =.001) and for grafts with a diameter less than 7 mm (1.65; P =.0219). Variables with no apparent independent effect on patency rates were smoking status, runoff, diabetes mellitus, sex, presenting symptoms, and postoperative treatment with aspirin or Coumadin. Noninvasive test results were not predictive of subsequent graft function. Although the type of prosthetic used for above-knee femoropopliteal bypass grafts does not affect 5-year patency rates, age and graft size do influence results. These factors should be considered before a prosthetic bypass grafting procedure. Furthermore, these data should serve as a contemporary standard, with which evolving and conventional procedures can be compared.
International Nuclear Information System (INIS)
Hawighorst, H.; Knopp, M.V.; Schoenberg, S.O.; Essig, M.; Kaick, G. van; Schaeffer, U.; Knapstein, P.G.; Weikel, W.
1998-01-01
Purpose: Purpose of this study is to compare functional MRI parameters with histomorphological markers of tumor microvessel density (MVD) and permeability (vascular endothelial growth factor) and to determine the ultimate value of both approaches by correlation with disease outcome in patients with primary cancer of the uterine cervix. Method: Pharmacokinetic parameters were calculated from contrast-enhanced dynamic MR imaging series in 37 patients with biopsy-proven primary cervical cancer. On the operative whole mount specimens, histomorphological markers of tumor angiogenesis (MVD, VEGF) were compared with the MRI-derived parameters. For MRI and histomorphological data, Kaplan-Meier survival curves were calculated and compared using logrank statistics. Results: Significant (p [de
Simpson's atherectomy in peripheral arteries
International Nuclear Information System (INIS)
Kueffer, G.; Spengel, F.A.; Hansen, R.; Pfluger, T.; Nathrath, W.; Muenchen Univ.; Muenchen Univ.
1990-01-01
Over a seventeen-month period, a percutaneous transluminal removal of stenosing plaque material from leg and pelvic arteries was performed successfully and without complication in 43 patients. A complete atherectomy in the femoropopliteal vessels succeeded in 99% of cases. In the pelvic region, the primary results were much lower (58%). After six months, the angiographically checked restenosis rate was 17% for femoropopliteal vessels and 11% for iliac arteries, and the corresponding Kaplan-Meier cumulative patency rates were 73.8 and 78.7% respectively. Simpson's atherectomy is the only method of its kind that is therapeutically effective and diagnostically significant, since the removed plaque can be used for further tests. (orig.) [de
Energy Technology Data Exchange (ETDEWEB)
Bouchbika, Z.; Benchakroun, N.; Sellai, N.; Jouhadi, H.; Tawfiq, N.; Sahraoui, S.; Benider, A. [Service radiotherapie-oncologie, CHU Ibn-Rochd, Casablanca (Morocco)
2011-10-15
The authors report the assessment of the local control, global survival and survival without recurrence, and also late complications, based on retrospective study over 8 years of 169 cases Hodgkin lymphoma in patients older than 18 (average age of 34) and who had been submitted to radiotherapy. Survival has been computed according to the Kaplan-Meier method. The authors notice that the recurrence rate is slightly higher than in the literature. During the considered period, radiotherapy was two-dimensional with higher doses than those corresponding to current standards. The improvement of radiotherapy techniques and the decrease of doses within the standards should improve the therapeutic results. Short communication
Directory of Open Access Journals (Sweden)
Ebrahim Shah
2010-11-01
Full Text Available Abstract Background Prevalence of cardiovascular disease (CVD in women shows regional variations not explained by common risk factors. Analysis of CVD incidence will provide insight into whether there is further divergence between regions with increasing age. Methods Seven-year follow-up data on 2685 women aged 59-80 (mean 69 at baseline from 23 towns in the UK were available from the British Women's Heart and Health Study. Time to fatal or non-fatal CVD was analyzed using Cox regression with adjustment for risk factors, using multiple imputation for missing values. Results Compared to South England, CVD incidence is similar in North England (HR 1.05 (95% CI 0.84, 1.31 and Scotland (0.93 (0.68, 1.27, but lower in Midlands/Wales (0.85 (0.64, 1.12. Event severity influenced regional variation, with South England showing lower fatal incident CVD than other regions, but higher non-fatal incident CVD. Kaplan-Meier plots suggested that regional divergence in CVD occurred before baseline (before mean baseline age of 69. Conclusions In women, regional differences in CVD early in adult life do not further diverge in later life. This may be due to regional differences in early detection, survivorship of women entering the study, or event severity. Targeting health care resources for CVD by geographic variation may not be appropriate for older age-groups.
Vachin, F; Hans, S; Atlan, D; Brasnu, D; Menard, M; Laccourreye, O
2004-06-01
To evaluate the long-term results of exclusive chemotherapy for T1-T3N0M0 glottic squamous cell carcinoma complete clinical responders after induction chemotherapy. Between 1985 and 2000, 69 patients with glottic squamous cell carcinoma complete clinical responders after induction chemotherapy were managed with exclusive chemotherapy at our department. Chemotherapy associated platinum and fluorouracil. This retrospective analysis evaluated actuarial survival, treatment morbidity, oncologic events and laryngeal preservation. Various independent factors were tested for potential correlation with survival and local recurrence. The 5-year Kaplan-Meier actuarial survival, local control, lymph node control estimate were 83,6%, 64,8%, 98,6% respectively. Chemotherapy never resulted in death. The 10-year actuarial metachronous second primary tumors estimate was 32%. The overall laryngeal preservation rate was 98,6%. Altogether our data and the review of the literature suggest that in patients achieving a complete clinical response after and induction based chemotherapy regimen, the completion of an exclusive chemotherapy regimen appears to be a valid alternative to the conventional use of radiotherapy or chemo-radiation protocols.
International Nuclear Information System (INIS)
Bhat, Rajesh; McBride, Kieran; Chakraverty, Sam; Vikram, Raghunandan; Severn, Alison
2007-01-01
Aim. To evaluate the technical success and patency rates following primary cutting balloon angioplasty for venous stenoses in native dialysis fistulas. Methods. Forty-one patients (26 men, 15 women; age range 26-82 years, average age 59 years) underwent 50 (repeat procedures in 9 patients) primary cutting balloon (PCB) angioplasty procedures in three institutions by three primary operators. The indication was primary stenosis in 21 patients, recurrent lesions in 15, and immature fistulas in 5. A PCB was used alone in 17 cases, but was followed by a larger standard balloon in 33 cases. Follow-up included ultrasound, flow analysis and urea reduction ratio, and ranged from 2 to 30 months (mean 14 months). Results. The technical success rate was 98%. All procedures were relatively painless. Two PCBs burst and 4 leaked, but without causing any morbidity. Nineteen fistulas were still working at last follow-up. Primary patency rates at 6, 12, and 24 months using Kaplan-Meier analysis were 88%, 73%, and 34%, respectively, and the primary assisted patencies were 90%, 75%, and 50%, respectively. Conclusion. PCB angioplasty has high technical success and low complication rates. The long-term patency rates are favorable for PCB angioplasty and compare favorably with other series
High Rab27A expression indicates favorable prognosis in CRC.
Shi, Chuanbing; Yang, Xiaojun; Ni, Yijiang; Hou, Ning; Xu, Li; Zhan, Feng; Zhu, Huijun; Xiong, Lin; Chen, Pingsheng
2015-06-13
Rab27A is a peculiar member in Rab family and has been suggested to play essential roles in the development of human cancers. However, the association between Rab27A expression and clinicopathological characteristics of colorectal cancer (CRC) has not been elucidated yet. One-step quantitative real-time polymerase chain reaction (qPCR) test with 18 fresh-frozen CRC samples and immunohistochemistry (IHC) analysis in 112 CRC cases were executed to evaluate the relationship between Rab27A expression and the clinicopathological features of CRC. Cox regression and Kaplan-Meier survival analyses were performed to identify the prognostic factors for 112 CRC patients. The results specified that the expression levels of Rab27A mRNA and protein were significantly higher in CRC tissues than that in matched non-cancerous tissues, in both qPCR test (p = 0.029) and IHC analysis (p = 0.020). The IHC data indicated that the Rab27A protein expression in CRC was statistically correlated with lymph node metastasis (p = 0.022) and TNM stage (p = 0.026). Cox multi-factor analysis and Kaplan-Meier method suggested Rab27A protein expression (p = 0.012) and tumor differentiation (p = 0.004) were significantly associated with the overall survival of CRC patients. The data indicated the differentiate expression of Rab27A in CRC tissues and matched non-cancerous tissues. Rab27A may be used as a valuable prognostic biomarker for CRC patients.
Phosphorus-32 therapy for cystic craniopharyngiomas
International Nuclear Information System (INIS)
Barriger, Robert Bryan; Chang, Andrew; Lo, Simon S.; Timmerman, Robert D.; DesRosiers, Colleen; Boaz, Joel C.; Fakiris, Achilles J.
2011-01-01
Background and purpose: To examine control rates for predominantly cystic craniopharyngiomas treated with intracavitary phosphorus-32 (P-32). Material and methods: 22 patients with predominantly cystic craniopharyngiomas were treated at Indiana University between October 1997 and December 2006. Nineteen patients with follow-up of at least 6 months were evaluated. The median patient age was 11 years, median cyst volume was 9 ml, a median dose of 300 Gy was prescribed to the cyst wall, and median follow-up was 62 months. Results: Overall cyst control rate after the initial P-32 treatment was 67%. Complete tumor control after P-32 was 42%. Kaplan-Meier 1-, 3-, and 5-year initial freedom-from-progression rates were 68%, 49%, and 31%, respectively. Following salvage therapy, the Kaplan-Meier 1-, 3-, and 5-year ultimate freedom-from-progression rates were 95%, 95%, and 86%, respectively. All patients were alive at the last follow-up. Visual function was stable or improved in 81% when compared prior to P-32 therapy. Pituitary function remained stable in 74% of patients following P-32 therapy. Conclusions: Intracystic P-32 can be an effective and tolerable treatment for controlling cystic components of craniopharyngiomas as a primary treatment or after prior therapies, but frequently allows for progression of solid tumor components. Disease progression in the form of solid tumor progression, re-accumulation of cystic fluid, or development of new cysts may require further radiotherapy or surgical intervention for optimal long-term disease control.
Factors affecting commencement and cessation of smoking behaviour in Malaysian adults
Directory of Open Access Journals (Sweden)
Ghani Wan
2012-03-01
Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.
International Nuclear Information System (INIS)
Scorticati, Carlos; Aguilar, Jorge A.; Gonzalez Granda, Pablo; Mendez, Fernando; Montiel, Raul; Rege, Eduardo; Alvarez, Patricio; Lopez, Miguel A.; Rizzi, Alfredo; Mazza, Osvaldo
2009-01-01
Introduction and Objectives: To analyze the results of the treatment in patients with cancer of prostate of high risk. Material and Method: Retrospective and observational analysis of 130 patients operated by CAP of high risk (criteria of D'Amico) average 41,48 months, divided in form nonrandomized in three groups 1: radical prostatectomy, 2: neoadjuvant hormonoterapy (BAC) + PR, 3: BAC + PR + x-ray (RT). Statistical analysis: multivaried, test of curved Chi2 and p statistical and of Kaplan Meier. Results: Biochemical relapse 68 patients (52.3%), average 23,37 months. Without differences according to therapeutic modality (p: 0.043). In the multivaried analysis of the 3 factors of presurgical, single risk we found a statistically significant relation in the coexistence of the 3 factors with the presence of positive margin in the PR piece. (p: 0,002). The analysis to make or not, neoadjuvant BAC without significant difference (p: 0,403) evaluating in such the rate of M+, actuarial global survival according to curves of Kaplan Meier to 5 and 10 years (P: 0,5257) and survival 5 actuarial specific cancer to and 10a (P: 0,2165). Conclusions: Without significant differences in: RB, clinical progression, pathological relapse, global and specific survival, rate of positive surgical margins. The 3 criteria of D'Amico were predictive of positive surgical margins and RB, the patients with RB in group 2 presented/displayed greater risk of clinical progression, the PR demonstrated a global survival and specify actuarial to 10 years greater to 50%, considering it therapeutic an option been worth. (authors) [es
Molecular genetics analysis of hereditary breast and ovarian cancer patients in India
Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan
2009-01-01
Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...
Syncytin immunoreactivity in colorectal cancer
DEFF Research Database (Denmark)
Larsen, Julie Mou; Christensen, Ib Jarle; Nielsen, Hans Jørgen
2009-01-01
monoclonal syncytin antibody we have assessed syncytin expression in a retrospective series of 140 colorectal cancer patients. Variable degrees of syncytin expression were detected in both colonic and rectal tumors and the prognostic impact of such expression was analysed with the Kaplan-Meier method...... and the Cox proportional hazard model. Interestingly, increased syncytin expression was associated with decreased overall survival in rectal but not in colonic cancer patients. Thus, the prognostic impact of syncytin expression appears to vary with the tumor type....
International Nuclear Information System (INIS)
Miclosina, C O; Balint, D I; Campian, C V; Frunzaverde, D; Ion, I
2012-01-01
This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from 'Eftimie Murgu' University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.
Miclosina, C. O.; Balint, D. I.; Campian, C. V.; Frunzaverde, D.; Ion, I.
2012-11-01
This paper deals with the optimization of the axial hydraulic turbines of Kaplan type. The optimization of the runner blade is presented systematically from two points of view: hydrodynamic and constructive. Combining these aspects in order to gain a safer operation when unsteady effects occur in the runner of the turbine is attempted. The design and optimization of the runner blade is performed with QTurbo3D software developed at the Center for Research in Hydraulics, Automation and Thermal Processes (CCHAPT) from "Eftimie Murgu" University of Resita, Romania. QTurbo3D software offers possibilities to design the meridian channel of hydraulic turbines design the blades and optimize the runner blade. 3D modeling and motion analysis of the runner blade operating mechanism are accomplished using SolidWorks software. The purpose of motion study is to obtain forces, torques or stresses in the runner blade operating mechanism, necessary to estimate its lifetime. This paper clearly states the importance of combining the hydrodynamics with the structural design in the optimization procedure of the runner of hydraulic turbines.
DEFF Research Database (Denmark)
Lindebjerg, J; Spindler, Karen-Lise Garm; Ploen, J
2009-01-01
to the tumour regression grade system and lymph node status in the surgical specimen was assessed. The prognostic value of clinico-pathological parameters was analysed using univariate analysis and Kaplan-Meier methods for comparison of groups. RESULTS: All patients responded to treatment and 47% had a major......OBJECTIVE: The purpose of the present study was to investigate the impact of tumour regression and the post-treatment lymph node status on the prognosis of rectal cancer treated by preoperative neoadjuvant chemoradiotherapy. METHOD: One hundred and thirty-five patients with locally advanced T3.......01). CONCLUSION: The combined assessment of lymph-node status and tumour response has strong prognostic value in locally advanced rectal cancer patient treated with preoperative long-course chemoradiation....
DEFF Research Database (Denmark)
Haaverstad, Rune; Vitale, Nicola; Karevold, Asbjørn
2006-01-01
OBJECTIVE: The aim of this report is the prospective, multicentre evaluation of clinical results and haemodynamic performance of the Medtronic Advantage aortic valve prosthesis. METHODS: From April 2001 to June 2003, 166 patients (male:female 125:41; mean (SD) age 61.8 (11.8) years) received...... an aortic advantage valve prosthesis. Complete cumulative follow-up was 242.7 patient-years (maximum 3.2; mean 1.6 years). Postoperatively, patients underwent early (within 30 days) and 1 year transthoracic echocardiography. RESULTS: 30 day mortality was 2.4% (n = 4). Kaplan-Meier estimates of freedom from...... echocardiography. CONCLUSIONS: Haemodynamic performance and early clinical results of Medtronic advantage in the aortic position were satisfactory and comparable with those of other bileaflet valves in current clinical use....
Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2
DEFF Research Database (Denmark)
Sarkisian, Laura; Saaby, L.; Poulsen, T. S.
2015-01-01
-year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...
High serum uric acid concentration predicts poor survival in patients with breast cancer.
Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min
2017-10-01
Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Evaluation of anterior chest wall implanted port: technical aspects, results, and complications
International Nuclear Information System (INIS)
Jeon, Young Hwan; Oh, Joo Hyeong; Yoon, Yup; Kim, Si Young
2000-01-01
To evaluate the technical aspects, results and complications of patients with implanted anterior chest wall port. Between April 1997 and June 1999, a total of 63 implanted ports were placed at the anterior chest wall of 63 consecutive patients by interventional radiologists. The indications were chemotherapy in 61 patients and total parenteral nutrition in two. The peripheral portion of the subclavian vein was punctured under fluoroscopic guidance via ipsilateral peripheral vein during venography. A central venous catheter was placed in the superior vena cava, and using the subcutaneous tunneling method, a connected infusion port was implanted at the anterior chest wall. Results and complications were reviewed, and by means of Kaplan-Meier survival analysis, the expected patency of the port was determined. The technical success rate for implanted port at the anterior chest wall was 100% (63/63 patients). In two patients, hematoma and oozing were treated by compression. The duration of port implantation ranged from 12 to 855 (mean, 187) days, and the port patency rate was 305.7±47.6 days. In seven patients (completed chemotherapy (n=3D3), central venous thrombosis (n=3D3) catheter-related infection (n=3D1)), the port was removed. Catheter obstruction occurred in two patients, and in one, the use of urokinase led to successful recanalization. Sixteen patients died of an underlying malignancy, but no catheter-related death was noted. Implantation of an anterior chest wall port is a safe and useful procedure, with long patency, for patients requiring chemotherapy and long-term venous access. (author)
Evaluation of anterior chest wall implanted port: technical aspects, results, and complications
Energy Technology Data Exchange (ETDEWEB)
Jeon, Young Hwan; Oh, Joo Hyeong; Yoon, Yup; Kim, Si Young [Kyung Hee University Hospital, Seoul (Korea, Republic of)
2000-07-01
To evaluate the technical aspects, results and complications of patients with implanted anterior chest wall port. Between April 1997 and June 1999, a total of 63 implanted ports were placed at the anterior chest wall of 63 consecutive patients by interventional radiologists. The indications were chemotherapy in 61 patients and total parenteral nutrition in two. The peripheral portion of the subclavian vein was punctured under fluoroscopic guidance via ipsilateral peripheral vein during venography. A central venous catheter was placed in the superior vena cava, and using the subcutaneous tunneling method, a connected infusion port was implanted at the anterior chest wall. Results and complications were reviewed, and by means of Kaplan-Meier survival analysis, the expected patency of the port was determined. The technical success rate for implanted port at the anterior chest wall was 100% (63/63 patients). In two patients, hematoma and oozing were treated by compression. The duration of port implantation ranged from 12 to 855 (mean, 187) days, and the port patency rate was 305.7{+-}47.6 days. In seven patients (completed chemotherapy (n=3D3), central venous thrombosis (n=3D3) catheter-related infection (n=3D1)), the port was removed. Catheter obstruction occurred in two patients, and in one, the use of urokinase led to successful recanalization. Sixteen patients died of an underlying malignancy, but no catheter-related death was noted. Implantation of an anterior chest wall port is a safe and useful procedure, with long patency, for patients requiring chemotherapy and long-term venous access. (author)
Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study
DEFF Research Database (Denmark)
Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars
2015-01-01
patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...
New methods for estimating follow-up rates in cohort studies
Directory of Open Access Journals (Sweden)
Xiaonan Xue
2017-12-01
Full Text Available Abstract Background The follow-up rate, a standard index of the completeness of follow-up, is important for assessing the validity of a cohort study. A common method for estimating the follow-up rate, the “Percentage Method”, defined as the fraction of all enrollees who developed the event of interest or had complete follow-up, can severely underestimate the degree of follow-up. Alternatively, the median follow-up time does not indicate the completeness of follow-up, and the reverse Kaplan-Meier based method and Clark’s Completeness Index (CCI also have limitations. Methods We propose a new definition for the follow-up rate, the Person-Time Follow-up Rate (PTFR, which is the observed person-time divided by total person-time assuming no dropouts. The PTFR cannot be calculated directly since the event times for dropouts are not observed. Therefore, two estimation methods are proposed: a formal person-time method (FPT in which the expected total follow-up time is calculated using the event rate estimated from the observed data, and a simplified person-time method (SPT that avoids estimation of the event rate by assigning full follow-up time to all events. Simulations were conducted to measure the accuracy of each method, and each method was applied to a prostate cancer recurrence study dataset. Results Simulation results showed that the FPT has the highest accuracy overall. In most situations, the computationally simpler SPT and CCI methods are only slightly biased. When applied to a retrospective cohort study of cancer recurrence, the FPT, CCI and SPT showed substantially greater 5-year follow-up than the Percentage Method (92%, 92% and 93% vs 68%. Conclusions The Person-time methods correct a systematic error in the standard Percentage Method for calculating follow-up rates. The easy to use SPT and CCI methods can be used in tandem to obtain an accurate and tight interval for PTFR. However, the FPT is recommended when event rates and
Directory of Open Access Journals (Sweden)
Marisa Aparecida Amaro Malvestio
2008-08-01
Full Text Available OBJETIVO: Analisar as variáveis clínicas e pré-hospitalares associadas à sobrevivência de vítimas de acidente de trânsito. MÉTODOS: Estudo realizado no município de São Paulo, SP, de 1999 a 2003. Foram analisados dados de 175 pacientes, entre 12 e 65 anos, vitimados por acidente de trânsito. A Análise de Sobrevivência de Kaplan-Meier foi utilizada na abordagem dos resultados na cena do acidente com as vítimas de escore OBJETIVO: Analizar las variables clínicas y pre hospitalarias asociadas a la sobrevida de víctimas de accidentes del tránsito. MÉTODOS: Estudio realizado en el municipio de São Paulo (Sudeste de Brasil, de 1999 a 2003. Fueron analizados datos de 175 pacientes, entre 12 y 65 años, victimas de accidentes de tránsito. El análisis de Sobrevida de Kaplan-Meier fue utilizado en el abordaje de los resultados en la escena del accidente con las víctimas de score OBJECTIVE: To assess clinical and prehospital variables associated with survival of motor vehicle crash victims. METHODS: Study carried out in the city of São Paulo (Southeastern Brazil, from 1999 to 2003. Data from 175 patients, who were aged between 12 and 65 years and had been motor vehicle crash victims, were analyzed. Kaplan-Meier Survival Analysis was used to approach the results at the accident scene with victims scoring <11, according to the Revised Trauma Score. Variables analyzed were: sex, age, injury mechanisms, basic and advanced support procedures, Revised Trauma Score parameters and fluctuations, time elapsed in the prehospital phase and trauma severity according to the Injury Severity Score and Maximum Abbreviated Injury Scale. RESULTS: Analysis revealed that victims who were less likely to survive during the hospitalization period showed serious lesions in the abdomen, thorax, or lower limbs, with negative fluctuation of respiratory frequency and Revised Trauma Score in the prehospital phase. In addition, they needed specialized
Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam
2011-03-28
The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Zheng Xiaokang; Ma Jun; Chen Longhua; Xia Yunfei; Shi Yusheng
2005-01-01
Purpose: To assess the dosimetric and clinical results of three-dimensional conformal radiotherapy (3D CRT) for locally recurrent nasopharyngeal carcinoma (NPC). Methods: A total of 86 patients with locally recurrent NPC were retreated with 3D CRT. The median prescribed dose was 68 Gy with 2 Gy per fractionation. Dosimetric quality was evaluated with dose distribution in planning target volume (PTV) and specified organs at risk (OAR), dose conformity index (CI) and dose homogeneity index (HI). The actuarial rate of local failure-free (LFF), overall survival (OS) and major late toxicities (MLT) were estimated with Kaplan-Meier method. Multivariate analysis for prognosis was performed using the Cox regression proportional hazards model. Results: The mean dose to PTV averaged 66.8 Gy, and the dose to specified OAR was acceptable. The average value of CI and HI was 0.59 and 9.1%. The 5-year actuarial rate of LFF and OS was 71 and 40%, respectively. The 5-year actuarial incidence of MLT≥Grade 3 and ≥Grade 4 were 100 and 49%, respectively. The major prognostic factors were T stage and the size of gross tumor volume (GTV). Advanced T stage and large GTV volume were associated with poor LFF and OS and high risk of MLT. Conclusion: The dosimetric quality of 3D CRT for locally recurrent NPC is generally excellent. A relatively high local control was achieved with this technique. However, the incidence of late toxicities were not found to decrease as originally expected. Early diagnosis of the recurrence and reasonable definition of the target volume are crucial to achieve a better outcome
International Nuclear Information System (INIS)
Korab-Chrzanowska, E.; Bartoszewska, J.; Kwiatkowski, S.
2005-01-01
To analyse the treatment results achieved in children treated for brain stem tumours at one institution between the years 1990 and 2004. Material. 20 patients (10 girls, 10 boys) aged 2.8-15.6 years were treated for brain stem tumors at the University Children's Hospital of Cracow (UCHC) in the years 1990-2004. The tumour type was defined basing on imaging studies (CT, MRI), and, in the case of 7 patients, additionally basing on histopathological results. In the collected material the predominant tumor type was benign glioma, detected in 17 patients. Malignant gliomas were diagnosed in 3 children. 7 children were treated by radiotherapy only. Surgical procedures and adjuvant radiotherapy were employed in 3 patients. 6 children underwent radiotherapy and chemotherapy. Combined surgical treatment followed by radiotherapy and chemotherapy was employed in 4 patients. Of the 20 patients 6 have died (30%). The surviving group (70%) includes 1 patient with tumor progression (5%), 5 - with stable tumors (25%), and 8 (40%) - with tumor regression. The probability of three-year overall survival for the entire group as calculated by the Kaplan-Meier method was 70% while the probability of three-year progression-free survival was 65%. Conclusions. Diffuse brain stem tumors, mostly those involving the pons, and malignant gliomas have poor prognosis. In the presented material we achieved the best treatment results in patients with exophytic or focal tumors, treated surgically with adjuvant therapy. (author)
International Nuclear Information System (INIS)
Craighead, Peter S.; Smulian, Hubert G.; Groot, Henk J. de; Toit, Pierre F.M. du
1997-01-01
Purpose: To compare patient demographics, treatment resources, practice patterns, and outcome results for squamous cell carcinoma of the uterine cervix (SCC) between the 1978 and 1983 Patterns of Care studies (PCS) in the United States of America (USA) and a nonacademic center within a developing country. Methods and Materials: Patient details (race, age, stage, and number per year), treatment used, and treatment outcome were retrieved from the charts of the 1160 cases registered at this center with SCC of the cervix between 1976 and 1985. Demographic variables and Kaplan-Meier survival estimates were calculated and compared with results from published PCS reviews. Results: There is a significant difference in the racial group presentation of cervix cancer at this center compared with the PCS reviews (p < 0.005), and median ages are significantly lower at this center (t = p < 0.001). The proportion of patients with Stage III or more was significantly higher at this center than the PCS centers (24 vs. 47%, p < 0.001). There were also vast differences in facility resources. Fewer cases at this center underwent intracavitary insertions than at PCS centers. Mean Point A doses were significantly reduced for this center compared with the PCS reviews. Kaplan-Meier estimates were similar for Stage I and II in PCS centers and this center, but were inferior for this center in Stage III patients (p < 0.05 for OS and p < 0.01 for LC). Late morbidity rates were similar for both PCS centers and this center. Conclusion: PCS recommendations may be applicable to nonacademic centers within developing countries, if the latter use staging techniques that are consistent with the PCS staging guidelines
Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.
Pion, J; Lenoir, M; Vandorpe, B; Segers, V
2015-11-01
This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.
DEFF Research Database (Denmark)
Schnack, Tine H; Sørensen, Rie D; Nedergaard, Lotte
2014-01-01
OBJECTIVES: Invasive serous adenocarcinomas may present as primary ovarian (POC), primary fallopian tube (PFC) or primary peritoneal (PPC) carcinomas. Whether they are variants of the same malignancy or develop through different pathways is debated. METHODS: Population-based prospectively collected...... data on POC (n=1443), PPC (n=268) and PFC (n=171) cases was obtained from the Danish Gynecological Cancer Database (2005-2013). Chi-square, Fisher's or Wilcoxon-Mann-Whitney test, multivariate logistic regression, Kaplan-Meier and multivariate Cox-regression were used as appropriate. Statistical tests...
Directory of Open Access Journals (Sweden)
Michelle Eisenhardt
2013-10-01
Full Text Available Backgound and Objectives: Colorectal cancer (CRC has high incidence, is often treatable and curable if diagnosed early. This study aimed to identify the epidemiological characteristic and assess overall survival in patients with CRC treated at a center specializing in oncology. Methods: Medical records of 127 patients with CRC were retrospectively evaluated. Clinical and epidemiological characteristics, in addition to treatment protocols and adverse reactions presented by patients were reviewed. The association of significance was assessed by chi-square and Fisher exact tests. The survival analyses were performed using the Kaplan-Meier method. The confidence interval was of 95% (p
Numerical Investigation of the Flow Structure in a Kaplan Draft Tube at Part Load
Maddahian, R.; Cervantes, M. J.; Sotoudeh, N.
2016-11-01
This research presents numerical simulation of the unsteady flow field inside the draft tube of a Kaplan turbine at part load condition. Due to curvature of streamlines, the ordinary two-equations turbulence models fail to predict the flow features. Therefore, a modification of the Shear Stress Transport (SST-SAS) model is utilized to approximate the turbulent stresses. A guide vane, complete runner and draft tube are considered to insure the real boundary conditions at the draft tube inlet. The outlet boundary is assumed to discharge into the atmosphere. The obtained pressure fluctuations inside the draft tube are in good agreement with available experimental data. In order to further investigate the RVR formation and its movement, the λ2 criterion, relating the position of the vortex core and strength to the second largest Eigen value of the velocity gradient tensor, is employed. The method used for vortex identification shows the flow structure and vortex motion inside the draft tube accurately.
Blade profile optimization of kaplan turbine using cfd analysis
International Nuclear Information System (INIS)
Janjua, A.B.; Khalil, M.S.
2013-01-01
Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof-river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional) CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models. (author)
Blade Profile Optimization of Kaplan Turbine Using CFD Analysis
Directory of Open Access Journals (Sweden)
Aijaz Bashir Janjua
2013-10-01
Full Text Available Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models.
International Nuclear Information System (INIS)
Prada, Pedro J.; Anchuelo, Javier; Blanco, Ana Garcia; Paya, Gema; Cardenal, Juan; Acuña, Enrique; Ferri, Maria; Vazquez, Andres; Pacheco, Maite; Sanchez, Jesica
2016-01-01
Objectives: We analyzed the long-term oncologic outcome for patients with prostate cancer and transurethral resection who were treated using low-dose-rate (LDR) prostate brachytherapy. Methods and Materials: From January 2001 to December 2005, 57 consecutive patients were treated with clinically localized prostate cancer. No patients received external beam radiation. All of them underwent LDR prostate brachytherapy. Biochemical failure was defined according to the 'Phoenix consensus'. Patients were stratified as low and intermediate risk based on The Memorial Sloan Kettering group definition. Results: The median follow-up time for these 57 patients was 104 months. The overall survival according to Kaplan-Meier estimates was 88% (±6%) at 5 years and 77% (±6%) at 12 years. The 5 and 10 years for failure in tumour-free survival (TFS) was 96% and respectively (±2%), whereas for biochemical control was 94% and respectively (±3%) at 5 and 10 years, 98% (±1%) of patients being free of local recurrence. A patient reported incontinence after treatment (1.7%). The chronic genitourinary complains grade I were 7% and grade II, 10%. At six months 94% of patients reported no change in bowel function. Conclusions: The excellent long-term results and low morbidity presented, as well as the many advantages of prostate brachytherapy over other treatments, demonstrates that brachytherapy is an effective treatment for patients with transurethral resection and clinical organ-confined prostate cancer. (author)
Energy Technology Data Exchange (ETDEWEB)
Prada, Pedro J.; Anchuelo, Javier; Blanco, Ana Garcia; Paya, Gema; Cardenal, Juan; Acuña, Enrique; Ferri, Maria [Department of Radiation Oncology, Hospital Universitario Marqués de Valdecilla, Santander, Cantabria (Spain); Vazquez, Andres; Pacheco, Maite; Sanchez, Jesica [Department of Radiation Physics, Hospital Universitario Marqués de Valdecilla, Santander, Cantabria (Spain)
2016-01-15
Objectives: We analyzed the long-term oncologic outcome for patients with prostate cancer and transurethral resection who were treated using low-dose-rate (LDR) prostate brachytherapy. Methods and Materials: From January 2001 to December 2005, 57 consecutive patients were treated with clinically localized prostate cancer. No patients received external beam radiation. All of them underwent LDR prostate brachytherapy. Biochemical failure was defined according to the 'Phoenix consensus'. Patients were stratified as low and intermediate risk based on The Memorial Sloan Kettering group definition. Results: The median follow-up time for these 57 patients was 104 months. The overall survival according to Kaplan-Meier estimates was 88% (±6%) at 5 years and 77% (±6%) at 12 years. The 5 and 10 years for failure in tumour-free survival (TFS) was 96% and respectively (±2%), whereas for biochemical control was 94% and respectively (±3%) at 5 and 10 years, 98% (±1%) of patients being free of local recurrence. A patient reported incontinence after treatment (1.7%). The chronic genitourinary complains grade I were 7% and grade II, 10%. At six months 94% of patients reported no change in bowel function. Conclusions: The excellent long-term results and low morbidity presented, as well as the many advantages of prostate brachytherapy over other treatments, demonstrates that brachytherapy is an effective treatment for patients with transurethral resection and clinical organ-confined prostate cancer. (author)
Comparison of colorectal and gastric cancer: Survival and prognostic factors
International Nuclear Information System (INIS)
Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R
2009-01-01
Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)
The clinical results of stereotactic irradiation for stage IA non-small-cell lung cancer
International Nuclear Information System (INIS)
Matsuura, Kanji; Kodama, Hisayuki; Murakami, Yuji; Kenjo, Masahiro; Kaneyasu, Yuko; Wadasaki, Koichi; Ito, Katsuhide; Kimura, Tomoki; Akagi, Yukio
2006-01-01
Discussed are the results in the title in authors' hospital. Subjects are 15 patients with the stage IA non-small cell lung cancer (10 males and 5 females; median age, 77 y; 11 cases of adenocarcinoma and 4 of squamous cell carcinoma), whose progress could be followed for 6 months or longer after the stereotactic irradiation during the period of July 1999 to 2006. The 8-9-gated irradiation therapy on the primary cancer alone was conducted with Varian Clinac 2300 (6MV-Xray) with the 3D planning equipment of PHILIPS Pinnacle. For some patients, the spirometer was used to monitor the voluntary breath-hold and body was fixed by vacuum fixer. Doses were 56 (4 Gy x 14) Gy in 3 cases, 60 (7.5 Gy x 8) Gy in 2, 50 (10 Gy x 5) Gy in 1 and 48 (12 Gy x 4) Gy in 9. Kaplan-Meier method was used for calculating the local control and survival rates. The former was 93% and the latter, 86% (1 year), 78% (2 y) and 39% (3 y). Three-year survival rate was 100% in 5 cases without other cancer and 18% in 10 with the cancers. Recurrence was seen in 3 cases and remote metastases, 7. Pneumonitis less than Grade 2 was in 11 cases. The stereotactic irradiation was thus found safe and effective in the stage IA non-small cell lung cancer. (T.I.)
Survival Analysis of Patients with End Stage Renal Disease
Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.
2015-06-01
This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.
PAM50 breast cancer intrinsic subtypes and effect of gemcitabine in advanced breast cancer patients
DEFF Research Database (Denmark)
Jørgensen, Charlotte Levin Tykjær; Nielsen, Torsten O; Bjerre, Karsten D
2014-01-01
BACKGROUND: In vitro studies suggest basal breast cancers are more sensitive to gemcitabine relative to other intrinsic subtypes. The main objective of this study was to use specimens from a randomized clinical trial to evaluate whether the basal-like subtype identifies patients with advanced...... breast cancer who benefit from gemcitabine plus docetaxel (GD) compared to single agent docetaxel (D). MATERIAL AND METHODS: From patients randomly assigned to GD or D, RNA was isolated from archival formalin-fixed, paraffin-embedded primary breast tumor tissue and used for PAM50 intrinsic subtyping...... chemotherapy were analyzed by the Kaplan-Meier method, and Cox proportional hazards regression models. Data analysis was performed independently by the Danish Breast Cancer Cooperative Group (DBCG) statistical core and all statistical tests were two-sided. RESULTS: RNA from 270 patients was evaluable; 84...
Patients undergoing radical prostatectomy have a better survival than the background population
DEFF Research Database (Denmark)
Andreas Røder, Martin; Brasso, Klaus; Drimer Berg, Kasper
2013-01-01
underwent radical prostatectomy. Patients were followed prospectively per protocol. No patients were lost to follow-up. Overall and cause-specific survival were described using Kaplan-Meier plots. Standardized relative survival and mortality ratio were calculated based on expected survival in the age......INTRODUCTION: The objective of this study was to investigate standardised relative survival and mortality ratio for patients undergoing radical prostatectomy for localized prostate cancer at our institution. MATERIAL AND METHODS: Between 1995 and 2010, a total of 1,350 consecutive patients......-matched Danish population using the methods and macros described by Dickmann. The country-specific population mortality rates used for calculation of the expected survival were based on data from The Human Mortality Database. RESULTS: The median follow-up was 3.4 years (range: 0-14.3 years). A total of 59 (4...
International Nuclear Information System (INIS)
Liu Dezhong; Li Huai; Zeng Huiying; Yang Ling
2001-01-01
Objective: To evaluate the efficacy of intra-hepatic arterial infusion chemotherapy for patients with liver metastasis from breast cancer. Methods: 1993-1998 years, Thirty four patients with liver metastasis from breast cancer had received epi-adriamycin, cisplatin, mitomycin and 5-fluorouracil by intrahepatic arterial infusion chemotherapy. Twelve patients had received embolization. Results: Six patients (17.65%) had a complete response, 12 patients (35.29%) had a partial response. The overall response rate was 52.94%. Cumulative survival rates at 1, 2, 3 and 4 years were 56.90%, 25.00%, 5.00% and 5.00% respectively (Kaplan-Meier method). The median overall survival time was 11.5 months. Conclusion: Intra-hepatic arterial infusion chemotherapy is safe and effective for liver metastasis from breast cancer and should be the first choice of treatment for these patients
Physical activity increases survival after heart valve surgery
DEFF Research Database (Denmark)
Lund, K.; Sibilitz, Kirstine Lærum; Kikkenborg Berg, Selina
2016-01-01
physical activity levels 6-12 months after heart valve surgery and (1) survival, (2) hospital readmission 18-24 months after surgery and (3) participation in exercise-based cardiac rehabilitation. METHODS: Prospective cohort study with registry data from The CopenHeart survey, The Danish National Patient......OBJECTIVES: Increased physical activity predicts survival and reduces risk of readmission in patients with coronary heart disease. However, few data show how physical activity is associated with survival and readmission after heart valve surgery. Objective were to assess the association between...... Register and The Danish Civil Registration System of 742 eligible patients. Physical activity was quantified with the International Physical Activity Questionnaire and analysed using Kaplan-Meier analysis and Cox regression and logistic regression methods. RESULTS: Patients with a moderate to high physical...
Miners’ return to work following injuries in coal mines
Directory of Open Access Journals (Sweden)
Ashis Bhattacherjee
2016-12-01
Full Text Available Background: The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW following a miner’s injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person’s social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners’ injuries. Material and Methods: A study was conducted for 109 injured workers from an underground coal mine in the years 2000–2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. Results: According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners’ return to work included presence of disease, job satisfaction and injury type. Conclusions: The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6:729–742
Proton Beam Radiotherapy for Uveal Melanomas at Nice Teaching Hospital: 16 Years' Experience
International Nuclear Information System (INIS)
Caujolle, Jean-Pierre; Mammar, Hamid; Chamorey, Emmanuel Phar; Pinon, Fabien; Herault, Joel; Gastaud, Pierre
2010-01-01
Purpose: To present the results of uveal melanomas treated at Nice Teaching Hospital. Methods and Materials: This retrospective study included 886 consecutive patients referred to our clinic for the treatment of uveal melanomas by proton beam radiotherapy from June 1991 to December 2007. Survival rates were determined by using Kaplan-Meier estimates, and prognostic factors were evaluated using the log-rank test or Cox model. Results: The number (percent total) of subjects staged according to the TNM classification system (6th edition) of malignant tumors included 39 stage T1 (4.4%), 420 stage T2 (47.40%), 409 stage T3 (46.16%), and 18 stage T4 (2.03%) patients. The median follow-up was 63.7 months. The Kaplan-Meier overall survival rate at 5 years according to the sixth edition TNM classification was 92% for T1, 89% for T2, 67% for T3, and 62% for T4; and at 10 years, 86% for T1, 78% for T2, 43% for T3, and 41% for T4. Five factors were found to be associated with an increased death rate: advanced age, tumor thickness, largest tumor basal diameter, tumor volume, and tumor volume-to-eyeball volume ratio. The metastasis-free survival rates were 88.3 % at 5 years and 76.4 % at 10 years. The local control rates were 93.9% at 5 years and 92.1% at 10 years. The ocular conservation rates were 91.1% at 5 years and 87.3% at 10 years. Conclusions: We report the results of a large series of patients treated for uveal melanomas with a very long follow-up. Despite the large tumor volume treated, our results were similar to previously published findings relating to proton beam therapy.
Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing
2017-04-01
Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.
International Nuclear Information System (INIS)
Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li
2011-01-01
Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)
Choi, Ji Young; Kim, Miso; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Heo, Dae Seog; Jo, Seong Jin
2018-04-05
Despite the successful use of tyrosine kinase inhibitors (TKIs) in cancer patients, their effect on herpes zoster development has not been studied. The aim of this study was to evaluate and compare the effects of epidermal growth factor receptor (EGFR) TKI and cytotoxic chemotherapy on the risk of herpes zoster development in non-small cell lung cancer (NSCLC) patients. We conducted a medical review of all eligible NSCLC patients in Seoul National University hospital between 2002 and 2015. We classified patients based on whether they previously underwent EGFR TKI therapy into either the TKI group or the cytotoxic group. We compared the incidence rates of herpes zoster during TKI therapy and cytotoxic chemotherapy. Additionally, the longitudinal risk of herpes zoster from TKIs was analyzed using the incidence rate ratio (IRR) of the TKI group to the cytotoxic group and the log-rank test of the Kaplan-Meier method. Of the 2,981 NSCLC patients, 54 patients (1.54%) developed herpes zoster. In the TKI group (2,002 patients), the IRR of herpes zoster during TKI therapy compared to that during cytotoxic chemotherapy was 1.05 (95% confidence interval [CI], 0.53 to 2.09). The IRR of the TKI group compared to the cytotoxic group was 1.33 (95% CI, 0.64 to 2.76). The Kaplan-Meier cumulative risk of both groups was not significantly different. Our results show that the incidence rate of herpes zoster in the TKI group was not statistically different from the incidence in the cytotoxic group during and after chemotherapy in NSCLC patients.
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper
1999-01-01
for folate biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP. METHODS: We studied bronchoalveolar samples collected in 1989-99 from a prospective cohort of HIV-1-infected patients who had PCP. In 144...... patients with 152 episodes of PCP, we analysed portions of DHPS using PCR and direct sequencing. The relation between survival, P. carinii DHPS mutations, and other predictors of treatment failure was assessed by Kaplan-Meier and multivariate Cox regression analysis. FINDINGS: P. carinii DHPS mutations...
DEFF Research Database (Denmark)
Pereira, Michele C; Oliveira, Denise T; Olivieri, Eloísa H R
2010-01-01
OBJECTIVE: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G>C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic...... of ECP-gene polymorphism 434(G>C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test...
Reexamining trends in premarital sex in the United States
Lawrence L. Wu; Steven Martin; Paula England
2018-01-01
Background: In a heavily cited paper, Finer (2007) asserted that by age 30, 82Š of US women born 1939-1948 engaged in premarital sex, increasing to 94Š for those born 1969-1978. Using the same data, our age 30 estimates are 55Š and 87Š for women born 1939-1948 and 1969-1978. Our analyses thus document strikingly different levels and trends. Methods: We replicate Finer's single-decrement Kaplan-Meier estimates of premarital sex using Cycles 3-6 of the National Survey of Family Growth, the s...
Directory of Open Access Journals (Sweden)
Giuseppe Bonaccorso
2014-06-01
Full Text Available Il contributo proposto ha l’obiettivo di analizzare alcuni significativi brani del tessuto urbano della periferia est di Roma, adottando metodi interpretativi legati alla storia, alla società, alla programmazione urbanistica e alla costruzione. Gli aspetti salienti del quadrante orientale della periferia romana verranno così delineati partendo “dal di dentro”, sottolineandone i percorsi, gli spazi e i nuclei compositivi che sono all’origine della struttura e della forma stessa dei quartieri disposti a cavallo del Grande Raccordo Anulare. In questo ambito, si pone l’attenzione su alcuni episodi chiave che vedono protagoniste le nuove chiese che riescono a creare una centralità all’interno dei quartieri periferici sostituendo le biblioteche, le piazze e i centri commerciali. Analizzando da vicino questi esempi, si scopre come di recente sono state realizzate chiese firmate da architetti di fama internazionale proprio allo scopo di rafforzare, o meglio di costruire, un fattore identitario per ciascun quartiere ubicato nel settore orientale della città. Partendo quindi dal generale si arriva a indagare una chiesa e un quartiere che possono essere considerati un modello da seguire per tutta la periferia a ridosso del GRA: la chiesa giubilare di Dio Padre Misericordioso progettata da Richard Meier nel quartiere di Tor Tre Teste. La sequenzialità degli eventi che hanno contraddistinto il concorso per la progettazione della chiesa, la scelta della proposta di Richard Meier, la complessità del cantiere, l’analisi tecnica, stilistica e simbolica della realizzazione finale sono quindi analizzate nell’ambito del rapporto con il quartiere e del tentativo di realizzare (attraverso di essa un centro di attrazione per tutta la periferia. The article analyses some significant parts of the urban tissue at the eastern periphery of Rome, using the interpretative methods inherent to history, society, urban programming and construction
Canlorbe, Geoffroy; Bendifallah, Sofiane; Raimond, Emilie; Graesslin, Olivier; Hudry, Delphine; Coutant, Charles; Touboul, Cyril; Bleu, Géraldine; Collinet, Pierre; Darai, Emile; Ballester, Marcos
2015-08-01
Studies focusing on the impact of obesity on survival in endometrial cancer (EC) have reported controversial results and few data exist on the impact of obesity on recurrence rate and recurrence-free survival (RFS). The aim of this study was to assess the impact of obesity on surgical staging and RFS in EC according to the European Society of Medical Oncology (ESMO) risk groups. Data of 729 women with EC who received primary surgical treatment between January 2000 and December 2012 were abstracted from a multicenter database. RFS distributions according to body mass index (BMI) in each ESMO risk group were estimated using the Kaplan-Meier method. Survival was evaluated using the log-rank test, and the Cox proportional hazards model was used to determine influence of multiple variables. Distribution of the 729 women with EC according to BMI was BMI women with a BMI ≥ 35 (72 %) than for those with a BMI obese women in the low-/intermediate-risk groups, but a BMI ≥ 35 was independently correlated to a poorer RFS (hazard ratio 12.5; 95 % confidence interval 3.1-51.3) for women in the high-risk group. Severe obesity negatively impacts RFS in women with high-risk EC, underlining the importance of complete surgical staging and adapted adjuvant therapies in this subgroup of women.
Age at sexual initiation and factors associated with it among youths ...
African Journals Online (AJOL)
Bernt Lindtjorn
Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.
Miller, Benjamin J; Gao, Yubo; Duchman, Kyle R
2017-09-01
There is continuing debate regarding the ideal modality for local control of the primary tumor for patients with Ewing's sarcoma. The primary aim of this study is to investigate the impact of the method of local control on overall survival in patients with Ewing's sarcoma. The National Cancer Data Base was used to identify patients Ewing's sarcoma of bone. A Kaplan-Meier survival analysis was performed at 2, 5, and 10 years. Factors with a level of significance of P 8 cm, and male sex while controlling for tumor site. Surgery alone was consistently the method of local control that resulted in the highest overall survival. Surgery alone resulted in the best overall survival for patients with Ewing's sarcoma of bone. The results of this investigation provide support to the approach of surgical resection with negative margins when possible. © 2017 Wiley Periodicals, Inc.
Community Music during the New Deal: The Contributions of Willem Van de Wall and Max Kaplan
Krikun, Andrew
2010-01-01
Willem Van de Wall (1887-1953) and Max Kaplan (1911-98) built careers spanning music performance, music education, adult education, sociology, social work, music therapy and community music. Willem Van de Wall was a seminal influence on the development of the fields of music therapy and adult education--researching the role of music in…
Directory of Open Access Journals (Sweden)
Biji M Sankaran
2015-01-01
Full Text Available Aim: To report the prevalence and outcomes of pressure ulcers (PU seen in a cohort of cancer patients requiring home-based palliative care. Materials and Methods: All patients referred for home care were eligible for this prospective observational study, provided they were living within a distance of 35 km from the institute and gave informed consent. During each visit, caregivers were trained and educated for providing nursing care for the patient. Dressing material for PU care was provided to all patients free of cost and care methods were demonstrated. Factors influencing the occurrence and healing of PUs were analyzed using logistic regression. Duration for healing of PU was calculated using the Kaplan Meier method. P < 0.05 are taken as significant. Results: Twenty-one of 108 (19.4% enrolled patients had PU at the start of homecare services. None of the patients developed new PU during the course of home care. Complete healing of PU was seen in 9 (42.9% patients. The median duration for healing of PU was found to be 56 days. Median expenditure incurred in patients with PU was Rs. 2323.40 with a median daily expenditure of Rs. 77.56. Conclusions: The present model of homecare service delivery was found to be effective in the prevention and management of PUs. The high prevalence of PU in this cohort indicates a need for greater awareness for this complication. Clinical Trial Registry Number: CTRI/2014/03/004477
Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment
2010-08-01
overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10
Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage
Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung
2014-01-01
In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...
International Nuclear Information System (INIS)
Pieters, Bradley R.; Geijsen, Elisabeth D.; Koedooder, Kees; Blank, Leo E.C.M.; Rezaie, Elisa; Grient, Johan N.B. van der; Reijke, Theo M. de; Koning, Caro C.E.
2011-01-01
Purpose: To evaluate treatment outcome of pulsed dose-rate brachytherapy (PDR) combined with external-beam radiotherapy (EBRT) for the treatment of prostate cancer. Methods and Materials: Between 2002 and 2007, 106 patients were treated by EBRT combined with PDR and followed prospectively. Two, 38, and 66 patients were classified as low-, intermediate-, and high-risk disease respectively according to the National Comprehensive Cancer Network criteria. EBRT dose was 46 Gy in 2.0-Gy fractions. PDR dose was increased stepwise from 24.96 to 28.80 Gy. Biochemical disease free survival and overall survival were determined by the Kaplan-Meier method. Cumulative incidence of late gastrointestinal (GI) and genitourinary (GU) toxicity were scored, according to the Common Terminology Criteria for Adverse Events. Results: The 3- and 5-year biochemical nonevidence of disease (bNED) were 92.8% (95% confidence interval [CI], 87.1-98.5) and 89.5% (95% CI, 85.2-93.8), respectively. Overall survival at 3 and 5 years was 99% (95% CI, 96-100) and 96% (95% CI, 90-100), respectively. The 3- and 5-year Grade 2 GI toxicity was 5.3% (95% CI, 0-10.6) and 12.0% (95% CI, 1.4-22.6), respectively. No Grade 3 or higher GI toxicity was observed. The 3- and 5-year Grade 2 or higher GU toxicity was 18.7% (95% CI, 10.3-27.1) and 26.9% (95% CI, 15.1-38.7), respectively. Conclusion: Results on tumor control and late toxicity of EBRT combined with PDR are good and comparable to results obtained with EBRT combined with high-dose-rate brachytherapy for the treatment of prostate cancer.
An improved method for calculation of interface pressure force in PLIC-VOF methods
International Nuclear Information System (INIS)
Sefollahi, M.; Shirani, E.
2004-08-01
Conventional methods for the modeling of surface tension force in Piecewise Linear Interface Calculation-Volume of Fluid (PLIC-VOF) methods, such as Continuum Surface Force (CSF), Continuum Surface Stress (CSS) and also Meier's method, convert the surface tension force into a body force. Not only do they include the force in the interfacial cells but also in the neighboring cells. Thus they produce spurious currents. Also the pressure jump, due to the surface tension, is not calculated accurately in these methods. In this paper a more accurate method for the application of interface force in the computational modeling of free surfaces and interfaces which use PLIC-VOF methods is developed. This method is based on the evaluation of the surface tension force only in the interfacial cells and not the neighboring cells. Also the normal and the interface surface area needed for the calculation of the surface tension force is calculated more accurately. The present method is applied to a two-dimensional motionless drop of liquid and a bubble of gas as well as a non-circular two-dimensional drop, which oscillates due to the surface tension force, in an initially stagnant fluid with no gravity force. The results are compared with the results of the cases when CSF, CSS and Meier's methods are used. It is shown that the present method calculates pressure jump at the interface more accurately and produces less spurious currents comparing to CSS an CSF models. (author)
Energy Technology Data Exchange (ETDEWEB)
Lubienski, A.; Bitsch, R.G.; Grenacher, L.; Kauffmann, G.W. [Radiologische Universitaetsklinik Heidelberg, Abt. Radiodiagnostik, Heidelberg (Germany); Schemmer, P. [Chirurgische Universitaetsklinik Heidelberg (Germany); Duex, M. [Radiologisches Zentralinstitut Krankenhaus Nordwest Frankfurt (Germany)
2004-12-01
Purpose: A retrospective analysis of long-term efficacy of combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) and TACE monotherapy was conducted in patients with large, non-resectable hepatocellular carcinoma (HCC). Methods and Materials: Fifty patients with large, unresectable HCC lesions underwent selective TACE. Liver cirrhosis was present in 42 patients, due to alcohol abuse (n = 22) and viral infection (n = 17). In three patients, the underlying cause for liver cirrhosis remained unclear. Child A cirrhosis was found in 22 and Child B cirrhosis in 20 patients. Repeated and combined TACE and PEI were performed in 22 patients and repeated TACE monotherapy was performed in 28 patients. Survival and complication rates were determined and compared. Results: The 6-, 12-, 24- and 36-month survival rates were 61%, 21%, 4%, and 4% for TACE monotherapy and 77%, 55%, 39% and 22% for combined TACE and PEI (Kaplan-Meier method). The kind of treatment significantly affected the survival rate (p=0.002 log-rank test). Severe side effects were present in two patients of the monotherapy group and in three patients of the combination therapy group. (orig.)
Directory of Open Access Journals (Sweden)
Abhishek A Solanki
Full Text Available PURPOSE: Radiation therapy (RT is commonly used as definitive treatment for early-stage nodular lymphocyte-predominant Hodgkin's lymphoma (NLPHL. We evaluated the cause-specific survival (CSS, overall survival (OS, and second malignancy (SM rates in patients with early-stage NLPHL treated with RT. METHODS AND MATERIALS: Patients with stage I-II NLPHL between 1988 and 2009 who underwent RT were selected from the Surveillance, Epidemiology and End Results database. Univariate analysis (UVA for CSS and Os was performed using the Kaplan-Meier method and included age, gender, involved site, year of diagnosis, presence of B-symptoms, and extranodal involvement (ENI. Multivariable analysis (MVA was performed using Cox Proportional Hazards modeling and included the above clinical variables. SM were classified as RT-related or non-RT-related. Freedom from SM and freedom from RT-related SM were determined using the Kaplan-Meier method. RESULTS: The study cohort included 469 patients. Median age was 37 years. The most common involved sites were the head and neck (36%, axilla/arm (26%, and multiple lymph node regions (18%. Sixty-eight percent had stage I disease, 70% were male, 4% had ENI, and 7% had B-symptoms. Median follow-up was 6 years. Ten-year CSS and Os were 98% and 88%, respectively. On UVA, none of the covariates was associated with CSS. Increasing age (p<0.01 and female gender (p<0.01 were associated with worse Os. On MVA, older age (p<0.01, female gender (p=0.04, multiple regions of involvement (p=0.03, stage I disease (p=0.02, and presence of B-symptoms (p=0.02 were associated with worse Os. Ten-year freedom from SM and freedom from RT-related SM were 89% and 99%, respectively. CONCLUSIONS: This is the largest series to evaluate the outcomes of stage I-II NLPHL patients treated with RT and found that this patient population has an excellent long-term prognosis and a low rate of RT-related second malignancies.
Graft survival rate of renal transplantation during a period of 10 years in Iran
Directory of Open Access Journals (Sweden)
Fatemeh Shahbazi
2015-01-01
Full Text Available Background: Kidney transplantation is a preferred treatment for many patients with end-stage renal disease (ESRD and is far more profitable than hemodialysis. Analyzing renal transplantation data can help to evaluate the effectiveness of transplantation interventions. The aim of this study was to determine the organ survival rate after kidney transplantation during a period of 10 years (March 2001-March 2011 among transplanted patients in Arak, Markazi Province, Iran. Materials and Methods: In this historical cohort study, all recipients of kidney transplantation from Arak, Markazi Province, Iran who had medical records in Valiasr Hospital and "charity for kidney patients" of Arak, Markazi Province, Iran during a period of 10 years from March 2001 to March 2011 were included. Data collected by using checklists were completed from patients′ hospital records. Kaplan-Meier method was used to determine the graft cumulative survival rate, log-rank test to compare survival curves in subgroups, and Cox regression model to define the hazard ratio and for ruling out the intervening factors. Statistical analysis was conducted by Statistical Package for the Social Sciences (SPSS 20 and Stata 11. Results: Mean duration of follow-up was 55.43 ± 42.02 months. By using the Kaplan-Meier method, the cumulative probability of graft survival at 1, 3, 5, 7, and 10 years was 99.1, 97.7, 94.3, 85.7, and 62.1%, respectively. The number of dialysis by controlling the effect of other variables had a significant association with the risk of graft failure [hazard ratios and 95% confidence interval (CI: 1.47 (1.02-2.13]. Conclusion: This study showed that the graft survival rate was satisfactory in this community and was similar to the results of single-center studies in the world. Dialysis time after transplantation was a significant predictor of survival in the recipients of kidney transplantation that should be considered.
International Nuclear Information System (INIS)
Hong, Hyun Pyo; Oh, Joo Hyeong; Yoon, Yub; Lee, Tae Won; Ihm, Chun Gyoo
2001-01-01
To evaluate the technical aspects, results and complications of the percutaneous radiologic placement of peritoneal dialysis catheters. Between December 1999 and April 2001, 26 peritoneal dialysis catheters were placed percutaneously in 26 consecutive patients by interventional radiologists. The patient group consisted of 16 men and ten women with a mean age of 55 (range, 30-77) years. The results and complications arising were reviewed, and the expected patency of the catheters was determined by means of Kaplan-Meier survival analysis. The technical success rate for catheter placement was 100% (26/26 patients). Severe local bleeding occurred in one patient due to by inferior epigastric artery puncture, and was treated by compression and electronic cautery. The duration of catheter implantation ranged from 1 to 510 days and the patency rate was 416±45 days. Catheter malfunction occurred in four patients. In two, this was restored by manipulation in the intervention room, and in one, through the use of urokinase. In three patients, peritonitis occurred. Catheters were removed from four patients due to malfunction (n=2), peritonitis (n=1), and death (n=1). Percutaneous radiologic placement of a peritoneal dialysis catheter is a relatively simple procedure that reduces the complication rate and improves catheter patency
Energy Technology Data Exchange (ETDEWEB)
Hong, Hyun Pyo; Oh, Joo Hyeong; Yoon, Yub; Lee, Tae Won; Ihm, Chun Gyoo [Kyunghee University Hospital, seoul (Korea, Republic of)
2001-01-01
To evaluate the technical aspects, results and complications of the percutaneous radiologic placement of peritoneal dialysis catheters. Between December 1999 and April 2001, 26 peritoneal dialysis catheters were placed percutaneously in 26 consecutive patients by interventional radiologists. The patient group consisted of 16 men and ten women with a mean age of 55 (range, 30-77) years. The results and complications arising were reviewed, and the expected patency of the catheters was determined by means of Kaplan-Meier survival analysis. The technical success rate for catheter placement was 100% (26/26 patients). Severe local bleeding occurred in one patient due to by inferior epigastric artery puncture, and was treated by compression and electronic cautery. The duration of catheter implantation ranged from 1 to 510 days and the patency rate was 416{+-}45 days. Catheter malfunction occurred in four patients. In two, this was restored by manipulation in the intervention room, and in one, through the use of urokinase. In three patients, peritonitis occurred. Catheters were removed from four patients due to malfunction (n=2), peritonitis (n=1), and death (n=1). Percutaneous radiologic placement of a peritoneal dialysis catheter is a relatively simple procedure that reduces the complication rate and improves catheter patency.
ASURV: Astronomical SURVival Statistics
Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.
2014-06-01
ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.
Influence of antiviral therapy on survival of patients with hepatitis B ...
African Journals Online (AJOL)
The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...
International Nuclear Information System (INIS)
Lencioni, R.; Pinto, F.; Armillotta, N.; Bassi, A.M.; Moretti, M.; Di Giulio, M.; Marchi, S.; Uliana, M.; Della Capanna, S.; Lencioni, M.; Bartolozzi, C.
1997-01-01
The objective of our work was to evaluate the long-term results of percutaneous ethanol injection (PEI) for the treatment of hepatocellular carcinoma (HCC) in patients with liver cirrhosis. A total of 184 cirrhotic patients with HCC underwent PEI as the only anticancer treatment over an 8-year period. Patients were followed after therapy by means of clinical examinations, laboratory tests, and US and CT studies performed at regular time intervals. Survival rates were determined according to the Kaplan-Meier method. The overall survival was 67% at 3 years, 41% at 5 years, and 19% at 7 years. The 3-, 5-, and 7-year survival rates of patients with single HCC≤3 cm (78, 54, and 28%, respectively) were significantly higher (p<0.01) than those of patients with single HCC of 3.1-5 cm (61, 32, and 16, respectively) or multiple HCCs (51, 21, and 0%, respectively). Survival of Child-Pugh A patients (79% at 3 years, 53% at 5 years, and 32% at 7 years) was significantly longer (p<0.01) than that of Child-Pugh B patients (50% at 3 years, 28% at 5 years, and 8% at 7 years). A selected group of 70 patients with Child-Pugh A cirrhosis and single HCC≤3 cm had a 7-year survival of 42%. Long-term survival of cirrhotic patients with HCC treated with PEI is comparable to that reported in published series of matched patients submitted to surgical resection. (orig.)
International Nuclear Information System (INIS)
Baumann, Brian C.; He, Jiwei; Hwang, Wei-Ting; Tucker, Kai N.; Bekelman, Justin E.; Herr, Harry W.; Lerner, Seth P.; Guzzo, Thomas J.; Malkowicz, S. Bruce; Christodouleas, John P.
2016-01-01
Purpose: To inform prospective trials of adjuvant radiation therapy (adj-RT) for bladder cancer after radical cystectomy, a locoregional failure (LF) risk stratification was proposed. This stratification was developed and validated using surgical databases that may not reflect the outcomes expected in prospective trials. Our purpose was to assess sources of bias that may affect the stratification model's validity or alter the LF risk estimates for each subgroup: time bias due to evolving surgical techniques; trial accrual bias due to inclusion of patients who would be ineligible for adj-RT trials because of early disease progression, death, or loss to follow-up shortly after cystectomy; bias due to different statistical methods to estimate LF; and subgrouping bias due to different definitions of the LF subgroups. Methods and Materials: The LF risk stratification was developed using a single-institution cohort (n=442, 1990-2008) and the multi-institutional SWOG 8710 cohort (n=264, 1987-1998) treated with radical cystectomy with or without chemotherapy. We evaluated the sensitivity of the stratification to sources of bias using Fine-Gray regression and Kaplan-Meier analyses. Results: Year of radical cystectomy was not associated with LF risk on univariate or multivariate analysis after controlling for risk group. By use of more stringent inclusion criteria, 26 SWOG patients (10%) and 60 patients from the single-institution cohort (14%) were excluded. Analysis of the remaining patients confirmed 3 subgroups with significantly different LF risks with 3-year rates of 7%, 17%, and 36%, respectively (P<.01), nearly identical to the rates without correcting for trial accrual bias. Kaplan-Meier techniques estimated higher subgroup LF rates than competing risk analysis. The subgroup definitions used in the NRG-GU001 adj-RT trial were validated. Conclusions: These sources of bias did not invalidate the LF risk stratification or substantially change the model's LF estimates.
Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.
Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak
Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.
LENUS (Irish Health Repository)
Gonzalez-Angulo, Ana M
2011-03-01
To investigate the incidence of germline and somatic BRCA1\\/2 mutations in unselected patients with triple-negative breast cancer (TNBC) and determine the prognostic significance of carrying a mutation. Methods: DNA was obtained from 77 TNBC and normal tissues. BRCA1\\/2 exons\\/flanking regions were sequenced from tumor and patients classified as mutant or wild type (WT). Sequencing was repeated from normal tissue to identify germline and somatic mutations. Patient characteristics were compared with chi-square. Survival was estimated by Kaplan-Meier method and compared with log-rank. Cox proportional hazards models were fit to determine the independent association of mutation status with outcome.
DEFF Research Database (Denmark)
Schnack, Tine H; Høgdall, Estrid; Thomsen, Lotte Nedergaard
2017-01-01
OBJECTIVES: Women with endometriosis carry an increased risk for ovarian clear cell adenocarcinomas (CCCs). Clear cell adenocarcinoma may develop from endometriosis lesions. Few studies have compared clinical and prognostic factors and overall survival in patients diagnosed as having CCC according...... to endometriosis status. METHODS: Population-based prospectively collected data on CCC with coexisting pelvic (including ovarian; n = 80) and ovarian (n = 46) endometriosis or without endometriosis (n = 95) were obtained through the Danish Gynecological Cancer Database. χ Test, independent-samples t test, logistic...... regression, Kaplan-Meier test, and Cox regression were used. Statistical tests were 2 sided. P values less than 0.05 were considered statistically significant. RESULTS: Patients with CCC and pelvic or ovarian endometriosis were significantly younger than CCC patients without endometriosis, and a higher...
Axial U(1) current in Grabowska and Kaplan's formulation
Hamada, Yu; Kawai, Hikaru
2017-06-01
Recently, Grabowska and Kaplan [Phys. Rev. Lett. 116, 211602 (2016); Phys. Rev. D 94, 114504 (2016)] suggested a nonperturbative formulation of a chiral gauge theory, which consists of the conventional domain-wall fermion and a gauge field that evolves by gradient flow from one domain wall to the other. We introduce two sets of domain-wall fermions belonging to complex conjugate representations so that the effective theory is a 4D vector-like gauge theory. Then, as a natural definition of the axial-vector current, we consider a current that generates simultaneous phase transformations for the massless modes in 4 dimensions. However, this current is exactly conserved and does not reproduce the correct anomaly. In order to investigate this point precisely, we consider the mechanism of the conservation. We find that this current includes not only the axial current on the domain wall but also a contribution from the bulk, which is nonlocal in the sense of 4D fields. Therefore, the local current is obtained by subtracting the bulk contribution from it.
Coupled skinny baker's maps and the Kaplan-Yorke conjecture
Gröger, Maik; Hunt, Brian R.
2013-09-01
The Kaplan-Yorke conjecture states that for ‘typical’ dynamical systems with a physical measure, the information dimension and the Lyapunov dimension coincide. We explore this conjecture in a neighborhood of a system for which the two dimensions do not coincide because the system consists of two uncoupled subsystems. We are interested in whether coupling ‘typically’ restores the equality of the dimensions. The particular subsystems we consider are skinny baker's maps, and we consider uni-directional coupling. For coupling in one of the possible directions, we prove that the dimensions coincide for a prevalent set of coupling functions, but for coupling in the other direction we show that the dimensions remain unequal for all coupling functions. We conjecture that the dimensions prevalently coincide for bi-directional coupling. On the other hand, we conjecture that the phenomenon we observe for a particular class of systems with uni-directional coupling, where the information and Lyapunov dimensions differ robustly, occurs more generally for many classes of uni-directionally coupled systems (also called skew-product systems) in higher dimensions.
Latzman, Robert D.; Markon, Kristian E.
2010-01-01
There has been an increased interest in the structure of and relations among executive functions.The present study examined the factor structure as well as age-related factorial invariance of the Delis-Kaplan Executive Function System (D-KEFS), a widely used inventory aimed at assessing executive functions. Analyses were first conducted using data…
DEFF Research Database (Denmark)
Andersson, U.; Osterman, P.; Sjostrom, S.
2009-01-01
was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...
Birth interval and its predictors among married women in Dabat ...
African Journals Online (AJOL)
2008-12-30
Birth intervals (time between two successive live births) if short are associated with diverse complications. We assessed birth interval and its predictors among 613 married women who gave birth from January 1 to December 30, 2008. Data were collected in April 2012. Life table and Kaplan-Meier curve were used to ...
Jacobs, Benjamin M.
2009-01-01
This historical study focuses on how John Dewey's theory of education as socialization and Mordecai Kaplan's theory of Judaism as a civilization together served as an ideological base and pedagogical framework for the creation of "progressive," "reconstructed" American Jewish school programs in the early 20th century…
Examining the Latent Structure of the Delis-Kaplan Executive Function System.
Karr, Justin E; Hofer, Scott M; Iverson, Grant L; Garcia-Barrera, Mauricio A
2018-05-04
The current study aimed to determine whether the Delis-Kaplan Executive Function System (D-KEFS) taps into three executive function factors (inhibition, shifting, fluency) and to assess the relationship between these factors and tests of executive-related constructs less often measured in latent variable research: reasoning, abstraction, and problem solving. Participants included 425 adults from the D-KEFS standardization sample (20-49 years old; 50.1% female; 70.1% White). Eight alternative measurement models were compared based on model fit, with test scores assigned a priori to three factors: inhibition (Color-Word Interference, Tower), shifting (Trail Making, Sorting, Design Fluency), and fluency (Verbal/Design Fluency). The Twenty Questions, Word Context, and Proverb Tests were predicted in separate structural models. The three-factor model fit the data well (CFI = 0.938; RMSEA = 0.047), although a two-factor model, with shifting and fluency merged, fit similarly well (CFI = 0.929; RMSEA = 0.048). A bifactor model fit best (CFI = 0.977; RMSEA = 0.032) and explained the most variance in shifting indicators, but rarely converged among 5,000 bootstrapped samples. When the three first-order factors simultaneously predicted the criterion variables, only shifting was uniquely predictive (p measuring executive-related constructs and provide a framework through which clinicians can interpret D-KEFS results.
Combination therapy with hormonal, radiation and chemotherapy for stage C prostate cancer
International Nuclear Information System (INIS)
Iwasawa, Toshihisa; Matsumoto, Hidetsugu
1996-01-01
To improve the effectiveness of treatment for patients with stage C prostate cancer, therapy in combination with hormonal, radiation and chemotherapy was given for the initial period, and there after, hormonal therapy was continuously administered to 18 patients with chemotherapy and three patients without it. At the Social Health Insurance Medical Center, between May 1988 and August 1991, 21 patients were diagnosed to have stage C histologically confirmed adenocarcinoma of the prostate. The average age of the patients was 69.0 years. The tumor was well, moderate and poorly differentiated in 5, 6 and 10 patients, respectively. As hormonal therapy, orchiectomy was performed on 19 of the 21 patients. Furthermore, 11 patients were administered estramustine phosphate, 9 chlormadinone acetate, and one diethylstilbesterol diphosphate. As, radiation therapy, all patients were treated with AP-PA parallel opposing technique to small pelvis with a 12 cm x 12 cm treatment field (44-45 Gy) combined with conformation radiotherapy to prostate (20-26 Gy). Chemotherapy was performed using either one or a combination of the following; cis-diamminedichloroplatinum, adriamycin, cyclophosphamide, 5-fluorouracil, methotrexate and etoposide. The observation period was 54.5 months on the average. Recurrence was observed in 3 patients, for all of which the sites were at bone. The 5-year non-recurrence rate was 90.4% by Kaplan-Meier's method. There were 4 deaths, three were due to prostate cancer and one to gastric cancer. The 5-year cumulative survival rate by Kaplan-Meier's method was 90.5%. In conclusion, this treatment was effective for stage C cases of prostate cancer. (author)
Age at hysterectomy as a predictor for subsequent pelvic organ prolapse repair
DEFF Research Database (Denmark)
Lykke, Rune; Blaakær, Jan; Ottesen, Bent
2016-01-01
from 1977 to 2009 from the Danish National Patient Registry. The cohort consisted of 154,882 hysterectomized women, who were followed up for up to 32 years. Survival analysis for each age group at hysterectomy was performed using Kaplan-Meier product limit methods. RESULTS: For all hysterectomized......INTRODUCTION AND HYPOTHESIS: The aim of this study was to investigate the association between patient age at the time of hysterectomy and subsequent pelvic organ prolapse (POP) surgery. METHODS: We gathered data on all benign hysterectomies and POP surgeries performed in Denmark on Danish women...... women, we found that low age at hysterectomy yielded a lower risk of subsequent POP surgery than did hysterectomy at an older age. This difference diminished after stratification by indication; all non-POP hysterectomies had a low cumulative incidence at 8-11 % at the end of the follow-up period...
DEFF Research Database (Denmark)
Bonde, Lisbeth; Sorensen, Rikke; Fosbøl, Emil Loldrup
2010-01-01
with patients not treated with clopidogrel. Similarly, 2 groups without HF were identified. Risks of all-cause death were obtained by the Kaplan-Meier method and Cox regression analyses. RESULTS: We identified 56,944 patients with first-time AMI. In the matched cohort with HF (n = 5,050) and a mean follow......OBJECTIVES: We studied the association of clopidogrel with mortality in acute myocardial infarction (AMI) patients with heart failure (HF) not receiving percutaneous coronary intervention (PCI). BACKGROUND: Use of clopidogrel after AMI is low in patients with HF, despite the fact that clopidogrel...... is associated with absolute mortality reduction in AMI patients. METHODS: All patients hospitalized with first-time AMI (2000 through 2005) and not undergoing PCI within 30 days from discharge were identified in national registers. Patients with HF treated with clopidogrel were matched by propensity score...
LINEAR REGRESSION MODEL ESTİMATİON FOR RIGHT CENSORED DATA
Directory of Open Access Journals (Sweden)
Ersin Yılmaz
2016-05-01
Full Text Available In this study, firstly we will define a right censored data. If we say shortly right-censored data is censoring values that above the exact line. This may be related with scaling device. And then we will use response variable acquainted from right-censored explanatory variables. Then the linear regression model will be estimated. For censored data’s existence, Kaplan-Meier weights will be used for the estimation of the model. With the weights regression model will be consistent and unbiased with that. And also there is a method for the censored data that is a semi parametric regression and this method also give useful results for censored data too. This study also might be useful for the health studies because of the censored data used in medical issues generally.
DEFF Research Database (Denmark)
Rasmussen, Maria; Sunde, Lone; Andersen, René F
2017-01-01
AIM: This study estimated the urinary tract infection (UTI) risk in a nationwide cohort of infants prenatally diagnosed with parenchymal kidney anomalies compared with a comparison cohort. METHODS: A Danish population-based nationwide cohort of foetuses diagnosed with parenchymal kidney anomalies...... between 2007 and 2012 had previously been identified. These were compared with foetuses without kidney anomalies who were prenatally scanned the same year. Live born infants were followed from birth until the diagnosis of UTI, emigration, death or two years of age. Cumulative incidences of UTIs were...... computed. Mortality was estimated using the Kaplan-Meier method. RESULTS: We identified 412 foetuses with parenchymal kidney anomalies out of 362 069 who underwent ultrasound scans and 277 were born alive. The overall risk of a UTI before the age of two years was 19%, and it was 14% among infants without...
Assefa, Yibeltal; Worku, Alemayehu; Wouters, Edwin; Koole, Olivier; Haile Mariam, Damen; Van Damme, Wim
2012-01-01
Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.
Role of IKK-alpha in the EGFR Signaling Regulation
2014-09-01
expression. (E) Kaplan -Meier overall survival curves of IKKin breast cancer patient data set. 16 Reference 1. Lo, H. W., Xia, W., Wei, Y...150- 100- 50- 150- 100- Twist1 AKT1-p AKT-T C 250- 150- 100- N-cad P1 P2 P3 TGFβ - - - + + - + + - - + - - + + + - - + - - + + + 50- Vimentin 150- 100
Exclusive breastfeeding duration and determinants among Brazilian children under two years of age
Directory of Open Access Journals (Sweden)
Sarah Warkentin
2013-06-01
Full Text Available OBJECTIVE: The present study described the duration and identified the determinants of exclusive breastfeeding. METHODS: The study used data from the Pesquisa Nacional de Demografia e Saúde da Criança e da Mulher 2006 (National Demographic and Health Survey on Women and Children 2006. Data were collected using questionnaires administered by trained professionals and refer to a subsample of 1,704 children aged less than 24 months. The estimated durations of exclusive breastfeeding are presented according to socioeconomic, demographic and epidemiological variables. Kaplan Meier estimator curves were used to produce valid estimates of breastfeeding duration and the Cox's proportional hazards model was fitted to identify risks. RESULTS: The median estimated duration of exclusive breastfeeding was 60 days. The final Cox model consisted of mother's age <20 years (hazard ratio=1.53, 95% confidence interval=1.11-1.48, use of pacifier (hazard ratio=1.53, 95% confidence interval=1.37-1.71, not residing in the country's southeast region (hazard ratio=1.22, 95% confidence interval=1.07-1.40 and socioeconomic status (hazard ratio=1.28, 95% confidence interval=1.06-1.55. CONCLUSION: The Kaplan Meier estimator corrected the underestimated duration of breastfeeding in the country when calculated by the current status methodology. Despite the national efforts done in the last decades to promote breastfeeding, the results indicate that the duration of exclusive breastfeeding is still half of that recommended for this dietary practice to promote health. Ways to revert this situation would be ongoing educational activities involving the educational and health systems, associated with advertising campaigns on television and radio mainly targeting young mothers with low education level and low income, identified as those at high risk of weaning their children early.
Energy Technology Data Exchange (ETDEWEB)
Barney, Brandon M., E-mail: barney.brandon@mayo.edu [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Petersen, Ivy A. [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Dowdy, Sean C.; Bakkum-Gamez, Jamie N. [Division of Gynecologic Surgery, Mayo Clinic, Rochester, Minnesota (United States); Haddock, Michael G. [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States)
2012-05-01
Purpose: To report our institutional experience with intraoperative radiotherapy (IORT) as a component of treatment for women with locally advanced or recurrent uterine sarcoma. Methods and Materials: From 1990 to 2010, 16 women with primary (n = 3) or locoregionally recurrent (n = 13) uterine sarcoma received IORT as a component of combined modality treatment. Tumor histology studies found leiomyosarcoma (n = 9), endometrial stromal sarcoma (n = 4), and carcinosarcoma (n = 3). Surgery consisted of gross total resection in 2 patients, subtotal resection in 6 patients, and resection with close surgical margins in 8 patients. The median IORT dose was 12.5 Gy (range, 10-20 Gy). All patients received perioperative external beam radiotherapy (EBRT; median dose, 50.4 Gy; range, 20-62.5 Gy), and 6 patients also received perioperative systemic therapy. Results: Seven of the 16 patients are alive at a median follow-up of 44 months (range, 11-203 months). The 3-year Kaplan-Meier estimate of local relapse (within the EBRT field) was 7%, and central control (within the IORT field) was 100%. No local failures occurred in any of the 6 patients who underwent subtotal resection. The 3-year freedom from distant relapse was 48%, with failures occurring most frequently in the lungs or mediastinum. Median survival was 18 months, and 3-year Kaplan-Meier estimates of cause-specific and overall survival were 58% and 53%, respectively. Three patients (19%) experienced late Grade 3 toxicity. Conclusions: A combined modality approach with perioperative EBRT, surgery, and IORT for locally advanced or recurrent uterine sarcoma resulted in excellent local disease control with acceptable toxicity, even in patients with positive resection margins. With this approach, some patients were able to experience long-term freedom from recurrence.
International Nuclear Information System (INIS)
Barney, Brandon M.; Petersen, Ivy A.; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.
2012-01-01
Purpose: To report our institutional experience with intraoperative radiotherapy (IORT) as a component of treatment for women with locally advanced or recurrent uterine sarcoma. Methods and Materials: From 1990 to 2010, 16 women with primary (n = 3) or locoregionally recurrent (n = 13) uterine sarcoma received IORT as a component of combined modality treatment. Tumor histology studies found leiomyosarcoma (n = 9), endometrial stromal sarcoma (n = 4), and carcinosarcoma (n = 3). Surgery consisted of gross total resection in 2 patients, subtotal resection in 6 patients, and resection with close surgical margins in 8 patients. The median IORT dose was 12.5 Gy (range, 10–20 Gy). All patients received perioperative external beam radiotherapy (EBRT; median dose, 50.4 Gy; range, 20–62.5 Gy), and 6 patients also received perioperative systemic therapy. Results: Seven of the 16 patients are alive at a median follow-up of 44 months (range, 11–203 months). The 3-year Kaplan-Meier estimate of local relapse (within the EBRT field) was 7%, and central control (within the IORT field) was 100%. No local failures occurred in any of the 6 patients who underwent subtotal resection. The 3-year freedom from distant relapse was 48%, with failures occurring most frequently in the lungs or mediastinum. Median survival was 18 months, and 3-year Kaplan-Meier estimates of cause-specific and overall survival were 58% and 53%, respectively. Three patients (19%) experienced late Grade 3 toxicity. Conclusions: A combined modality approach with perioperative EBRT, surgery, and IORT for locally advanced or recurrent uterine sarcoma resulted in excellent local disease control with acceptable toxicity, even in patients with positive resection margins. With this approach, some patients were able to experience long-term freedom from recurrence.
Directory of Open Access Journals (Sweden)
Wan-Chen Yu
Full Text Available We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan.This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI, geriatric syndromes, activities of daily living (ADL using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE. Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk.Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years. Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038 or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002 after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition.Physical disability
Yu, Wan-Chen; Chou, Ming-Yueh; Peng, Li-Ning; Lin, Yu-Te; Liang, Chih-Kuang; Chen, Liang-Kung
2017-01-01
We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan. This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI), geriatric syndromes, activities of daily living (ADL) using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE). Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk. Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years). Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038) or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002) after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition. Physical disability is a major
Estimating a population cumulative incidence under calendar time trends
DEFF Research Database (Denmark)
Hansen, Stefan N; Overgaard, Morten; Andersen, Per K
2017-01-01
BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date....... It is common practice to apply the Kaplan-Meier or Aalen-Johansen estimator to the total sample and report either the estimated cumulative incidence curve or just a single point on the curve as a description of the disease risk. METHODS: We argue that, whenever the disease or disorder of interest is influenced...
Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis
DEFF Research Database (Denmark)
Egeberg, Alexander; Skov, Lone; Zachariae, Claus
2018-01-01
It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....
Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal
2018-06-01
Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
P. Wang
2007-07-01
Full Text Available Transitional cell carcinoma (TCC of the urothelium is often multifocal and subsequent tumors may occur anywhere in the urinary tract after the treatment of a primary carcinoma. Patients initially presenting a bladder cancer are at significant risk of developing metachronous tumors in the upper urinary tract (UUT. We evaluated the prognostic factors of primary invasive bladder cancer that may predict a metachronous UUT TCC after radical cystectomy. The records of 476 patients who underwent radical cystectomy for primary invasive bladder TCC from 1989 to 2001 were reviewed retrospectively. The prognostic factors of UUT TCC were determined by multivariate analysis using the COX proportional hazards regression model. Kaplan-Meier analysis was also used to assess the variable incidence of UUT TCC according to different risk factors. Twenty-two patients (4.6%. developed metachronous UUT TCC. Multiplicity, prostatic urethral involvement by the bladder cancer and the associated carcinoma in situ (CIS were significant and independent factors affecting the occurrence of metachronous UUT TCC (P = 0.0425, 0.0082, and 0.0006, respectively. These results were supported, to some extent, by analysis of the UUT TCC disease-free rate by the Kaplan-Meier method, whereby patients with prostatic urethral involvement or with associated CIS demonstrated a significantly lower metachronous UUT TCC disease-free rate than patients without prostatic urethral involvement or without associated CIS (log-rank test, P = 0.0116 and 0.0075, respectively. Multiple tumors, prostatic urethral involvement and associated CIS were risk factors for metachronous UUT TCC, a conclusion that may be useful for designing follow-up strategies for primary invasive bladder cancer after radical cystectomy.
International Nuclear Information System (INIS)
Barney, Brandon M.; Petersen, Ivy A.; Mariani, Andrea; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.
2013-01-01
Objectives: The optimal adjuvant therapy for International Federation of Gynecology and Obstetrics (FIGO) stage I papillary serous (UPSC) or clear cell (CC) endometrial cancer is unknown. We report on the largest single-institution experience using adjuvant high-dose-rate vaginal brachytherapy (VBT) for surgically staged women with FIGO stage I UPSC or CC endometrial cancer. Methods and Materials: From 1998-2011, 103 women with FIGO 2009 stage I UPSC (n=74), CC (n=21), or mixed UPSC/CC (n=8) endometrial cancer underwent total abdominal hysterectomy with bilateral salpingo-oophorectomy followed by adjuvant high-dose-rate VBT. Nearly all patients (n=98, 95%) also underwent extended lymph node dissection of pelvic and paraortic lymph nodes. All VBT was performed with a vaginal cylinder, treating to a dose of 2100 cGy in 3 fractions. Thirty-five patients (34%) also received adjuvant chemotherapy. Results: At a median follow-up time of 36 months (range, 1-146 months), 2 patients had experienced vaginal recurrence, and the 5-year Kaplan Meier estimate of vaginal recurrence was 3%. The rates of isolated pelvic recurrence, locoregional recurrence (vaginal + pelvic), and extrapelvic recurrence (including intraabdominal) were similarly low, with 5-year Kaplan-Meier estimates of 4%, 7%, and 10%, respectively. The estimated 5-year overall survival was 84%. On univariate analysis, delivery of chemotherapy did not affect recurrence or survival. Conclusions: VBT is effective at preventing vaginal relapse in women with surgical stage I UPSC or CC endometrial cancer. In this cohort of patients who underwent comprehensive surgical staging, the risk of isolated pelvic or extrapelvic relapse was low, implying that more extensive adjuvant radiation therapy is likely unnecessary.
Directory of Open Access Journals (Sweden)
Yuh-Fang Chen
Full Text Available PURPOSE: To study the association between retinitis pigmentosa (RP and the progression of diabetic retinopathy (DR. METHODS: Using the Longitudinal Health Insurance Database 2000 of Taiwan, we identified individuals with an initial diagnosis for RP during the period of 1997-2008. A non-RP comparison group, 10-fold frequency matched by sex, age, index year and the year of diabetes diagnosed, were randomly selected from the same database. The occurrence of DR was observed for all subjects until the end of 2009. The Kaplan-Meier curves were used to illustrate the cumulative probability of developing DR for the RP group and comparison groups. The hazard ratio (HR of DR for the RP group relative to the comparison group was estimated using Cox proportional hazards model after adjusting for potential confounders. RESULTS: The Kaplan-Meier curves were not statistically significant different between the RP group and the comparison group. However, the RP group had a higher cumulative probability of developing DR during the first six to seven years. The cumulative probability kept increasing and became higher in the comparison group but remained unchanged in the RP group. The HR for the RP patients comparing with the comparison group was 0.96 (95% confidence interval (CI = 0.43-2.14. Stratified by severity, RP was associated with a non-statistically significant reduced risk of proliferative DR (PDR (HR = 0.70, 95% CI = 0.16-3.14. The HR for non-proliferative DR (NPDR was 1.08 (95% CI = 0.40-2.86. CONCLUSION: In this study, RP was not statistically significant associated with the incidence of DR.
Malone, Shawn; Perry, Gad; Segal, Roanne; Dahrouge, Simone; Crook, Juanita
2005-09-01
To assess the feasibility and tolerability of intermittent androgen suppression therapy (IAS) in prostate cancer. Patients with recurrent or metastic prostate cancer received cyclical periods of treatment with leuprolide acetate and nilutamide for 8 months, and rest periods. Cycles were repeated at progression until the treatment failed to achieve normal prostate-specific antigen (PSA) levels. Patients were followed with PSA level, testosterone level, haemoglobin level, weight and bone mineral density evaluations. The median time to treatment failure, recovery from anaemia, or normalization of testosterone level was estimated by the Kaplan-Meier method. In all, 95 patients received 245 cycles; the median duration of rest periods was 8 months and median time to treatment failure 47 months. Testosterone recovery during rest periods was documented in 117 (61%) of cycles. Anaemia was mild and reported in 33%, 44% and 67% of cycles 1, 2 and 3, respectively. Sexual function recovered during the rest periods in 47% of cycles. There was no significant overall change in body mass index at the end of the treatment period. Osteoporosis was documented in at least one site evaluated in 41 patients (37%). IAS has the potential to reduce side-effects, including recovery of haemoglobin level, return of sexual function and absence of weight gain at the end of the study period.
Concurrent chemoradiation for vaginal cancer.
Directory of Open Access Journals (Sweden)
David T Miyamoto
Full Text Available BACKGROUND: It is not known whether the addition of chemotherapy to radiation therapy improves outcomes in primary vaginal cancer. Here, we review clinical outcomes in patients with primary vaginal cancer treated with radiation therapy (RT or concurrent chemoradiation therapy (CRT. METHODS: Seventy-one patients with primary vaginal cancer treated with definitive RT with or without concurrent chemotherapy at a single institution were identified and their records reviewed. A total of 51 patients were treated with RT alone; 20 patients were treated with CRT. Recurrences were analyzed. Overall survival (OS and disease-free survival (DFS rates were estimated using the Kaplan-Meier method. Cox regression analysis was performed. RESULTS: The median age at diagnosis was 61 years (range, 18-92 years and the median follow-up time among survivors was 3.0 years. Kaplan-Meier estimates for OS and DFS differed significantly between the RT and CRT groups (3-yr OS = 56% vs. 79%, log-rank p = 0.037; 3-yr DFS = 43% vs. 73%, log-rank p = 0.011. Twenty-three patients (45% in the RT group had a relapse at any site compared to 3 (15% in the CRT group (p = 0.027. With regard to the sites of first relapse, 10 patients (14% had local only, 4 (6% had local and regional, 9 (13% had regional only, 1 (1% had regional and distant, and 2 (3% had distant only relapse. On univariate analysis, the use of concurrent chemotherapy, FIGO stage, tumor size, and date of diagnosis were significant predictors of DFS. On multivariate analysis, the use of concurrent chemotherapy remained a significant predictor of DFS (hazard ratio 0.31 (95% CI, 0.10-0.97; p = 0.04. CONCLUSIONS: Vaginal cancer results in poor outcomes. Adequate radiation dose is essential to ensure curative management. Concurrent chemotherapy should be considered for vaginal cancer patients.
International Nuclear Information System (INIS)
Garsa, Adam A.; Badiyan, Shahed N.; DeWees, Todd; Simpson, Joseph R.; Huang, Jiayi; Drzymala, Robert E.; Barani, Igor J.; Dowling, Joshua L.; Rich, Keith M.; Chicoine, Michael R.; Kim, Albert H.; Leuthardt, Eric C.; Robinson, Clifford G.
2014-01-01
Purpose: To evaluate local control rates and predictors of individual tumor local control for brain metastases from non-small cell lung cancer (NSCLC) treated with stereotactic radiosurgery (SRS). Methods and Materials: Between June 1998 and May 2011, 401 brain metastases in 228 patients were treated with Gamma Knife single-fraction SRS. Local failure was defined as an increase in lesion size after SRS. Local control was estimated using the Kaplan-Meier method. The Cox proportional hazards model was used for univariate and multivariate analysis. Receiver operating characteristic analysis was used to identify an optimal cutpoint for conformality index relative to local control. A P value <.05 was considered statistically significant. Results: Median age was 60 years (range, 27-84 years). There were 66 cerebellar metastases (16%) and 335 supratentorial metastases (84%). The median prescription dose was 20 Gy (range, 14-24 Gy). Median overall survival from time of SRS was 12.1 months. The estimated local control at 12 months was 74%. On multivariate analysis, cerebellar location (hazard ratio [HR] 1.94, P=.009), larger tumor volume (HR 1.09, P<.001), and lower conformality (HR 0.700, P=.044) were significant independent predictors of local failure. Conformality index cutpoints of 1.4-1.9 were predictive of local control, whereas a cutpoint of 1.75 was the most predictive (P=.001). The adjusted Kaplan-Meier 1-year local control for conformality index ≥1.75 was 84% versus 69% for conformality index <1.75, controlling for tumor volume and location. The 1-year adjusted local control for cerebellar lesions was 60%, compared with 77% for supratentorial lesions, controlling for tumor volume and conformality index. Conclusions: Cerebellar tumor location, lower conformality index, and larger tumor volume were significant independent predictors of local failure after SRS for brain metastases from NSCLC. These results warrant further investigation in a prospective
International Nuclear Information System (INIS)
Trovo, Marco; Minatel, Emilio; Durofil, Elena; Polesel, Jerry; Avanzo, Michele; Baresic, Tania; Bearz, Alessandra; Del Conte, Alessandro; Franchin, Giovanni; Gobitti, Carlo; Rumeileh, Imad Abu; Trovo, Mauro G.
2014-01-01
Purpose: To retrospectively assess toxicity and outcome of re-irradiation with stereotactic body radiation therapy (SBRT) in patients with recurrent or persistent non-small cell lung cancer (NSCLC), who were previously treated with radical radiation therapy (50-60 Gy). The secondary endpoint was to investigate whether there are dosimetric parameter predictors of severe radiation toxicity. Methods and Materials: The analysis was conducted in 17 patients with “in-field” recurrent/persistent centrally located NSCLC, who underwent re-irradiation with SBRT. SBRT consisted of 30 Gy in 5 to 6 fractions; these prescriptions would be equivalent for the tumor to 37.5 to 40 Gy, bringing the total 2-Gy-per-fraction cumulative dose to 87 to 100 Gy, considering the primary radiation therapy treatment. Actuarial analyses and survival were calculated by the Kaplan-Meier method, and P values were estimated by the log-rank test, starting from the date of completion of SBRT. Dosimetric parameters from the subgroups with and without grade ≥3 pulmonary toxicity were compared using a 2-tailed Student t test. Results: The median follow-up was 18 months (range, 4-57 months). Only 2 patients had local failure, corresponding to a local control rate of 86% at 1 year. The Kaplan-Meier estimates of overall survival (OS) rates at 1 and 2 years were 59% and 29%, respectively; the median OS was 19 months. Four patients (23%) experienced grade 3 radiation pneumonitis, and 1 patient developed fatal pneumonitis. One patient died of fatal hemoptysis 2 months after the completion of SBRT. Unexpectedly, heart maximum dose, D5 (minimum dose to at least 5% of the heart volume), and D10 were correlated with risk of radiation pneumonitis (P<.05). Conclusions: Re-irradiation with SBRT for recurrent/persistent centrally located NSCLC achieves excellent results in terms of local control. However, the high rate of severe toxicity reported in our study is of concern
Energy Technology Data Exchange (ETDEWEB)
Trovo, Marco, E-mail: marcotrovo33@hotmail.com [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Minatel, Emilio; Durofil, Elena [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Polesel, Jerry [Department of Epidemiology and Biostatistics, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Avanzo, Michele [Department of Medical Physics, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Baresic, Tania [Department of Nuclear Medicine, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Bearz, Alessandra [Department of Medical Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Del Conte, Alessandro [Department of Medical Oncology, Pordenone General Hospital, Aviano, Pordenone (Italy); Franchin, Giovanni; Gobitti, Carlo; Rumeileh, Imad Abu; Trovo, Mauro G. [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy)
2014-04-01
Purpose: To retrospectively assess toxicity and outcome of re-irradiation with stereotactic body radiation therapy (SBRT) in patients with recurrent or persistent non-small cell lung cancer (NSCLC), who were previously treated with radical radiation therapy (50-60 Gy). The secondary endpoint was to investigate whether there are dosimetric parameter predictors of severe radiation toxicity. Methods and Materials: The analysis was conducted in 17 patients with “in-field” recurrent/persistent centrally located NSCLC, who underwent re-irradiation with SBRT. SBRT consisted of 30 Gy in 5 to 6 fractions; these prescriptions would be equivalent for the tumor to 37.5 to 40 Gy, bringing the total 2-Gy-per-fraction cumulative dose to 87 to 100 Gy, considering the primary radiation therapy treatment. Actuarial analyses and survival were calculated by the Kaplan-Meier method, and P values were estimated by the log-rank test, starting from the date of completion of SBRT. Dosimetric parameters from the subgroups with and without grade ≥3 pulmonary toxicity were compared using a 2-tailed Student t test. Results: The median follow-up was 18 months (range, 4-57 months). Only 2 patients had local failure, corresponding to a local control rate of 86% at 1 year. The Kaplan-Meier estimates of overall survival (OS) rates at 1 and 2 years were 59% and 29%, respectively; the median OS was 19 months. Four patients (23%) experienced grade 3 radiation pneumonitis, and 1 patient developed fatal pneumonitis. One patient died of fatal hemoptysis 2 months after the completion of SBRT. Unexpectedly, heart maximum dose, D5 (minimum dose to at least 5% of the heart volume), and D10 were correlated with risk of radiation pneumonitis (P<.05). Conclusions: Re-irradiation with SBRT for recurrent/persistent centrally located NSCLC achieves excellent results in terms of local control. However, the high rate of severe toxicity reported in our study is of concern.
Energy Technology Data Exchange (ETDEWEB)
Winkler, C.; Dornfeld, S.; Friedrich, S.; Baumann, M. [Technische Univ. Dresden (Germany). Klinik und Poliklinik fuerStrahlentherapie und Radioonkologie; Schwarz, R. [Universitaetskrankenhaus Hamburg-Eppendorf (Germany). Abt. fuer Strahlentherapie
1998-12-01
Aim: Retrospective assessment of the efficacy of radiatiotherapy for meningeomas with high risk for local recurrence. Patients and methods: Records of 67 patients with meningeomas treated from 1974 to 1995 at 2 centres were analyzed. Follow-up time ranged from 0.8 to 213 months (median: 61 months). Radiation therapy was given either after local failure or after biopsy or subtotal resection. The ratio between malignant (n=20) and benign (n=47) meningenoma was 1:2.4. Median age of the patients was 55 years (7 to 77 years). Radiation treatment was given at 1.5 to 2 Gy per fraction to 36 to 79.5 Gy. Survival rates were calculated by the Kaplan-Meier method. Statistical comparisons were performed with the log-rank test and the Cox proportional hazards model. The Bonferroni method was used to correct for multiple comparisons. Results: Five- and 10-year disease-free survival rates were 82%{+-}5% (standard error) and 70%{+-}9%. Local control rates at 5 and 10 years were 78%{+-}5% and 68%{+-}9%. In uni- and multivariate analysis histology, sex, total dose and center showed no significant influence on the results. Patients age was significant for local control (univariate p=0.02; multivariate p=0.03) and disease-free survival (univariate/multivariate p=0.04). The postoperative tumor burden had a significant influence of disease-free survival (multivariate P=0.04). After Bonferroni correction no significant influenc e was observed. We did not observe late side effects, especially brain necrosis. Conclusions: Despite of the negative selection of our patients we observed high survival- and local control rates after radiation therapy. This underscores the role of radiation therapy in the treatment of meningeomas with high risk of local failure. (orig.) [Deutsch] Hintergrund: Retrospektive Auswertung der Behandlungsergebnisse der Bestrahlung von Meningeomen mit hohem Rezidivrisiko. Patienten und Methode: Im Zeitraum zwischen 1974 und 1995 wurden an zwei Zentren insgesamt 67
Ti, Lianping; Richardson, Lindsey; DeBeck, Kora; Nguyen, Paul; Montaner, Julio; Wood, Evan; Kerr, Thomas
2014-08-01
Despite the growing prevalence of illicit stimulant drug use internationally, and the widespread involvement of people who inject drugs (IDU) within street-based drug markets, little is known about the impact of different types of street-based income generation activities on the cessation of stimulant use among IDU. Data were derived from an open prospective cohort of IDU in Vancouver, Canada. We used Kaplan-Meier methods and Cox proportional hazards regression to examine the effect of different types of street-based income generation activities (e.g., sex work, drug dealing, and scavenging) on time to cessation of stimulant use. Between December, 2005 and November, 2012, 887 IDU who use stimulant drugs (cocaine, crack cocaine, or crystal methamphetamine) were prospectively followed-up for a median duration of 47 months. In Kaplan-Meier analyses, compared to those who did not engage in street-based income generation activities, participants who reported sex work, drug dealing, scavenging, or more than one of these activities were significantly less likely to report stimulant drug use cessation (all pstreet-based income generation activity remained significantly associated with a slower time to stimulant drug cessation (all p<0.005). Our findings highlight the urgent need for strategies to address stimulant dependence, including novel pharmacotherapies. Also important, structural interventions, such as low-threshold employment opportunities, availability of supportive housing, legal reforms regarding drug use, and evidence-based approaches that reduce harm among IDU are urgently required. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Development of low head Kaplan turbine for power station rehabilitation project
Lim, S. M.; Ohtake, N.; Kurosawa, S.; Suzuki, T.; Yamasaki, T.; Nishi, H.
2012-11-01
This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.
Development of low head Kaplan turbine for power station rehabilitation project
International Nuclear Information System (INIS)
Lim, S M; Ohtake, N; Kurosawa, S; Suzuki, T; Yamasaki, T; Nishi, H
2012-01-01
This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.
Survival analysis in hematologic malignancies: recommendations for clinicians
Delgado, Julio; Pereira, Arturo; Villamor, Neus; López-Guillermo, Armando; Rozman, Ciril
2014-01-01
The widespread availability of statistical packages has undoubtedly helped hematologists worldwide in the analysis of their data, but has also led to the inappropriate use of statistical methods. In this article, we review some basic concepts of survival analysis and also make recommendations about how and when to perform each particular test using SPSS, Stata and R. In particular, we describe a simple way of defining cut-off points for continuous variables and the appropriate and inappropriate uses of the Kaplan-Meier method and Cox proportional hazard regression models. We also provide practical advice on how to check the proportional hazards assumption and briefly review the role of relative survival and multiple imputation. PMID:25176982
Energy Technology Data Exchange (ETDEWEB)
Young, M; Craft, D [Massachusetts General Hospital and Harvard Medical School, Boston, MA (United States)
2016-06-15
Purpose: To develop an efficient, pathway-based classification system using network biology statistics to assist in patient-specific response predictions to radiation and drug therapies across multiple cancer types. Methods: We developed PICS (Pathway Informed Classification System), a novel two-step cancer classification algorithm. In PICS, a matrix m of mRNA expression values for a patient cohort is collapsed into a matrix p of biological pathways. The entries of p, which we term pathway scores, are obtained from either principal component analysis (PCA), normal tissue centroid (NTC), or gene expression deviation (GED). The pathway score matrix is clustered using both k-means and hierarchical clustering, and a clustering is judged by how well it groups patients into distinct survival classes. The most effective pathway scoring/clustering combination, per clustering p-value, thus generates various ‘signatures’ for conventional and functional cancer classification. Results: PICS successfully regularized large dimension gene data, separated normal and cancerous tissues, and clustered a large patient cohort spanning six cancer types. Furthermore, PICS clustered patient cohorts into distinct, statistically-significant survival groups. For a suboptimally-debulked ovarian cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00127) showed significant improvement over that of a prior gene expression-classified study (p = .0179). For a pancreatic cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00141) showed significant improvement over that of a prior gene expression-classified study (p = .04). Pathway-based classification confirmed biomarkers for the pyrimidine, WNT-signaling, glycerophosphoglycerol, beta-alanine, and panthothenic acid pathways for ovarian cancer. Despite its robust nature, PICS requires significantly less run time than current pathway scoring methods. Conclusion: This work validates the PICS method to improve
ALLOGENEIC STEM CELL TRANSPLANTATION FOR ADULT PATIENTS WITH ACUTE LEUKEMIA – 14 YEARS EXPERIENCE
Directory of Open Access Journals (Sweden)
Jože Pretnar
2004-12-01
Full Text Available Background. This study was designed to evaluate the impact of various prognostic factors on long-term survival and event free survival after allogeneic hematopoietic stem cell transplantation for patients with acute leukemia.Methods and patients. Between years 1989 and 2002 44 patients with acute leukemia (30 with AML and 14 with ALL were transplanted. Survival curves using the Kaplan-Meier method were calculated for patients transplanted with two different sources of stem cells – bone marrow and peripheral blood and separately for patients with female donor.Results. Estimated 10 years survival for AML is 43% and 64% for ALL patients which is not statistically different. There are no significant differences in outcome regarding source of stem cells and in donors’ gender.Conclusions. To conclude, our results show that neither source of stem cells nor donor’s gender has impact on the long-term survival after hematopoietic stem cell transplantation. As published previously patients transplanted beyond the first remission have significantly worse outcome.
[Survival rate of IPS-Empress 2 all-ceramic crowns and bridges: three year's results].
Zimmer, Doris; Gerds, Thomas; Strub, Jörg R
2004-01-01
The objective of this prospective clinical study was to calculate the survival rate of IPS-Empress2 crowns and fixed partial dentures (FPD) over a three-year period. In 43 patients 27 IPS-Empress2 crowns and 31 fixed partial dentures were adhesively luted. Crowns were placed on premolars and molars and FPDs were inserted in the anterior and premolar area. Abutments were prepared with a circular 1.2 mm wide shoulder. The clinical follow-up examination took place after 6, 12, 24, 36 and 48 months. After a mean of 38 months, the survival rate (Kaplan-Meier) of all-ceramic crowns was 100% and of the three unit FDP 72.4%. There were a total of six complete failures which occurred only with the three-unit IPS-Empress2 FPDs. Three FPDs exhibited fractures of the framework for which the manufacturer's instructions of connector-dimension was not satisfied, and one FPD exhibited an irreparable incomplete veneer fracture. Further two FPDs showed biological failures. The accuracy of fit and esthetics were clinically satisfactory. The three-year results showed the IPS-Empress2-ceramic as an adequate all-ceramic material for single crowns. The use for FPD needs further critical consideration.
DEFF Research Database (Denmark)
Møller, Henrik; Coupland, Victoria H; Tataru, Daniela
2018-01-01
INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... diagnosis. RESULTS: Survival improved over the period studied. The use of active treatment varied between geographical areas, with inter-quintile ranges of 9%-17% for surgical resection, 4%-13% for radical radiotherapy, and 22%-35% for chemotherapy. At 2 years, there were 188 potentially avoidable deaths...
A nationwide study of serous “borderline” ovarian tumors in Denmark 1978–2002
DEFF Research Database (Denmark)
Hannibal, Charlotte Gerd; Vang, Russell; Junge, Jette
2014-01-01
OBJECTIVE: To describe the study population and estimate overall survival of women with a serous "borderline" ovarian tumor (SBT) in Denmark over 25 years relative to the general population. METHODS: The Danish Pathology Data Bank and the Danish Cancer Registry were used to identify 1487 women...... as noninvasive or invasive. Medical records were collected from hospital departments and reviewed. Data were analyzed using Kaplan-Meier and relative survival was estimated with follow-up through September 2, 2013. RESULTS: A cohort of 1042 women with a confirmed SBT diagnosis was identified. Women with stage I...... had an overall survival similar to the overall survival expected from the general population (p=0.3), whereas women with advanced stage disease had a poorer one (pwomen with noninvasive (pwomen with advanced stage...
Radical prostatectomy in clinically localized high-risk prostate cancer
DEFF Research Database (Denmark)
Røder, Martin Andreas; Berg, Kasper Drimer; Christensen, Ib Jarle
2013-01-01
) is regarded as primary therapy by others. This study examined the outcome for high-risk localized PCa patients treated with RP. Material and methods. Of 1300 patients who underwent RP, 231 were identified as high-risk. Patients were followed for biochemical recurrence (BCR) (defined as prostate-specific......Abstract Objective. The optimal therapeutic strategy for high-risk localized prostate cancer (PCa) is controversial. Supported by randomized trials, the combination of external beam radiation therapy (EBRT) and endocrine therapy (ET) is advocated by many, while radical prostatectomy (RP...... antigen ≥ 0.2 ng/ml), metastatic disease and survival. Excluding node-positive patients, none of the patients received adjuvant therapy before BCR was confirmed. Univariate and multivariate analysis was performed with Kaplan-Meier and Cox proportional hazard models. Results. Median follow-up was 4.4 years...
Directory of Open Access Journals (Sweden)
Estela Azeka
2009-02-01
Full Text Available OBJECTIVE: The aim of this study was to report a single center experience of organ and tissue transplantation INTRODUCTION: This is the first report of organ and tissue transplantation at the Hospital das Clínicas of the University of Sao Paulo Medical School. METHODS: We collected data from each type of organ transplantation from 2002 to 2007. The data collected were patient characteristics and actuarial survival Kaplan-Meier curves at 30 days, one year, and five years RESULTS: There were a total of 3,321 transplants at our institution and the 5-year survival curve ranged from 53% to 88%. CONCLUSION: This report shows that solid organ and tissue transplants are feasible within the institution and allow us to expect that the quality of transplantation will improve in the future.
DEFF Research Database (Denmark)
Loeve, Martine; Hop, Wim C. J.; de Bruijne, Marleen
2012-01-01
Rationale: Up to a third of cystic fibrosis (CF) patients awaiting lung transplantation (LTX) die while waiting. Inclusion of computed tomography (CT) scores may improve survival prediction models such as the lung allocation score (LAS). Objectives: This study investigated the association between...... CT and survival in CF patients screened for LTX. Methods: Clinical data and chest CTs of 411 CF patients screened for LTX between 1990 and 2005 were collected from 17 centers. CTs were scored with the Severe Advanced Lung Disease (SALD) 4-category scoring system, including the components "infection....../inflammation" (INF), air trapping/hypoperfusion (AT), normal/hyperperfusion (NOR) and bulla/cysts (BUL). The volume of each component was computed using semi-automated software. Survival analysis included Kaplan-Meier curves, and Cox-regression models. Measurements and main results: 366 (186 males) out of 411...
International Nuclear Information System (INIS)
Goebel, U.; Calaminus, G.; Haasenritter, N.
1988-01-01
Pineal tumours are increasingly identified histologically since the introduction of the surgical microscope and microsurgical techniques. A major biological characteristic of germ-cell tumours is the fact that they produce tumour markers. Meaningful therapy planning is determined by the biological behaviour of the individual tumour entity which is strongly influenced by its intracranial localization. Important risk factors need to be identified and weighted according to previous treatment in order to arrive at an adequate therapy with improved curative prospects. Three risk areas can be defined for tumour extension. Therapy planning is also determined by the metastatic spread behaviour of germ-cell tumours. Within the two therapy studies for nontesticular germ-cell tumours MAKEI 83 and 86, a total of 180 germ-cell tumours, 24 of which were localized intercranially, were reported from 46 different clinics. All patients have a survival probability according to Kaplan and Meier of 67 ± 10% at an observation duration of 48 months. (orig./MG) [de
Energy Technology Data Exchange (ETDEWEB)
Vaidya, Jayant S., E-mail: jayant.vaidya@ucl.ac.uk [Research Department of Surgery, Division of Surgery and Interventional Science, University College London, London (United Kingdom); Baum, Michael [Research Department of Surgery, Division of Surgery and Interventional Science, University College London, London (United Kingdom); Tobias, Jeffrey S. [Department of Radiation Oncology, University College London Hospitals, London (United Kingdom); Wenz, Frederik [Radiation Oncology and Gynaecology, University Medical Centre of Mannheim (Germany); Massarut, Samuele [Surgery and Radiation Oncology, Centro di Riferimento Oncologico (CRO), Aviano (Italy); Keshtgar, Mohammed [Research Department of Surgery, Division of Surgery and Interventional Science, University College London, London (United Kingdom); Hilaris, Basil [Radiation Oncology, Our Lady of Mercy, New York Medical College, New York (United States); Saunders, Christobel [Institute of Health and Rehabilitation Research, University of Notre Dame, Fremantle, Western Australia (Australia); Williams, Norman R.; Brew-Graves, Chris [Research Department of Surgery, Division of Surgery and Interventional Science, University College London, London (United Kingdom); Corica, Tammy [Institute of Health and Rehabilitation Research, University of Notre Dame, Fremantle, Western Australia (Australia); Roncadin, Mario [Surgery and Radiation Oncology, Centro di Riferimento Oncologico (CRO), Aviano (Italy); Kraus-Tiefenbacher, Uta; Suetterlin, Marc [Radiation Oncology and Gynaecology, University Medical Centre of Mannheim (Germany); Bulsara, Max [Institute of Health and Rehabilitation Research, University of Notre Dame, Fremantle, Western Australia (Australia); Joseph, David [Radiation Oncology, Sir Charles Gairdner Hospital and School of Surgery, University of Western Australia, Perth (Australia)
2011-11-15
Purpose: We have previously shown that delivering targeted radiotherapy to the tumour bed intraoperatively is feasible and desirable. In this study, we report on the feasibility, safety, and long-term efficacy of TARGeted Intraoperative radioTherapy (Targit), using the Intrabeam system. Methods and Materials: A total of 300 cancers in 299 unselected patients underwent breast-conserving surgery and Targit as a boost to the tumor bed. After lumpectomy, a single dose of 20 Gy was delivered intraoperatively. Postoperative external beam whole-breast radiotherapy excluded the usual boost. We also performed a novel individualized case control (ICC) analysis that computed the expected recurrences for the cohort by estimating the risk of recurrence for each patient using their characteristics and follow-up period. Results: The treatment was well tolerated. The median follow up was 60.5 months (range, 10-122 months). Eight patients have had ipsilateral recurrence: 5-year Kaplan Meier estimate for ipsilateral recurrence is 1.73% (SE 0.77), which compares well with that seen in the boosted patients in the European Organization for Research and Treatment of Cancer study (4.3%) and the UK STAndardisation of breast RadioTherapy study (2.8%). In a novel ICC analysis of 242 of the patients, we estimated that there should be 11.4 recurrences; in this group, only 6 recurrences were observed. Conclusions: Lumpectomy and Targit boost combined with external beam radiotherapy results in a low local recurrence rate in a standard risk patient population. Accurate localization and the immediacy of the treatment that has a favorable effect on tumour microenvironment may contribute to this effect. These long-term data establish the long-term safety and efficacy of the Targit technique and generate the hypothesis that Targit boost might be superior to an external beam boost in its efficacy and justifies a randomized trial.
Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto
2017-06-01
Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.
Ten years summary: FDG-PET on irradiated brain tumour
International Nuclear Information System (INIS)
Wang Shuxia; Boethius, J.
2004-01-01
Purpose: To retrospectively evaluate FDG-PET in differentiation of post-radiotherapy status: recurrence, radiation necrosis, malignant regression of low grade primary brain tumour, and to evaluate PET in terms of survival prediction. Material and methods: 117 irradiated patients (156 PET) were consecutively included. PET results were judged by a set of rigid follow-up standards. Brain metastases from lung carcinoma were further studied. Survival time was analysed with Kaplan-Meier method. Results: There were 61 true-positive, 2 false-positive, 15 false-negative, 51 true-negative PET; leaving 5 positive and 22 negative PET results indeterminate. PET positive predictive value was 96% in all and 100% in brain metastasis from lung carcinoma. PET negative predictive value was 55.6% among surgically selected cases. Survival time was significantly longer in patient's with negative PET, both brain metastasis and primary brain tumour. Conclusions: FDG-PET was a good method to pick up tumour recurrence from radiation necrosis, especially metastasis from lung carcinoma. FDG uptake could be used as a non-invasive parameter to predict patient's prognosis. (authors)
International Nuclear Information System (INIS)
Gu Wendong; Ji Qinghai; Lu Xueguan; Feng Yan
2003-01-01
Objective: To analyze the results of neck dissection in patients who failed in cervical lymph nodes after radiotherapy for nasopharyngeal carcinoma. Methods: Eighty-three patients who received neck dissection due to lymph node persistence or recurrence after definitive radiotherapy were analyzed retrospectively according to the following relevant factors: age, sex, the interval between completion of radiotherapy and surgery, rN stage, postoperative radiotherapy given or not, the adjacent tissues involved or not and the number of positive nodes. Kaplan-Meier method, Log-rank method and Cox method were used in the statistical analysis. Results: The 1-, 3- and 5-year overall survival rates were 80.7%, 47.1% and 34.9%. The interval between completion of radiotherapy and surgery, postoperative radiotherapy given or not, the adjacent tissues involved or not were significantly prognostic factors in statistic analysis. Conclusions: Neck dissection can be applied in the management of cervical lymph node failure in nasopharyngeal carcinoma after radiotherapy. Postoperative radiotherapy should be considered in patients with capsular invasion and/or adjacent tissue involvement
Energy Technology Data Exchange (ETDEWEB)
Soares, Celia Regina; Miziara Filho, Miguel Abrao; Fogaroli, Ricardo Cesar; Baraldi, Helena Espindola; Pellizzon, Antonio Cassio Assis; Pelosi, Edilson Lopes [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil). Servico de Radioterapia], e-mail: celiarsoares@terra.com.br; Fristachi, Carlos Elias [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil). Servico de Onco-Ginecologia e Mastologia; Paes, Roberto Pinto [Instituto do Cancer Dr. Arnaldo Vieira de Carvalho (ICAVC), Sao Paulo, SP (Brazil)
2008-12-15
Objective: to assess the treatment of breast cancer T2 ({<=} 4 cm) and T3 through neoadjuvant chemotherapy, quadrantectomy and high dose rate brachytherapy as a boost, complementary radiotherapy and adjuvant chemotherapy, considering local control and overall survival. Material and method: this clinical prospective descriptive study was based on the evaluation of 88 patients ranging from 30 to 70 years old, with infiltrating ductal carcinoma, clinical stage IIb and IIIa, responsive to the neoadjuvant chemotherapy, treated from June/1995 to December/2006. Median follow-up was 58 months. Using clinical methods the tumor was evaluated before and after three or four cycles of chemotherapy based on anthracyclines. Overall survival and local control were assessed according to Kaplan-Meier methodology. Results: Local control and overall survival in five years were 90% and 73.5%, respectively. Conclusion: local control and overall survival were comparable to other forms of treatment. (author)
Marquardt, Pascal; Strub, Jörg Rudolf
2006-04-01
The aim of this prospective clinical study was to evaluate the survival rates of IPS Empress 2 (Ivoclar Vivadent) all-ceramic crowns and fixed partial dentures (FPDs) after an observation period of up to 5 years. Forty-three patients (19 women and 24 men) were included in this study. The patients were treated with a total of 58 adhesive bonded IPS Empress 2 restorations. A total of 27 single crowns were placed on molars and premolars, and 31 three-unit FPDs were placed in the anterior and premolar regions. Clinical follow-up examinations took place at 6, 12, 24, 36, 48, and 60 months after insertion. Statistical analysis of the data was calculated using the Kaplan-Meier method. Results of the 50-month analysis (interquartile range, 33 to 61 months) showed that the survival rate was 100% for crowns and 70% for FPDs. Six failures that occurred exclusively in the three-unit FPDs were observed. Framework fractures were recorded in three FPD units where the connector dimensions did not meet the manufacturer specifications. Only one FPD exhibited an irreparable partial veneer fracture, and 2 FPDs showed evidence of biologic failures. The accuracy of fit and esthetic parameters were clinically satisfactory for crowns and FPDs. The results of this 5-year clinical evaluation suggest that IPS Empress 2 ceramic is an appropriate material for the fabrication of single crowns. Because of the reduced survival rates, strict conditions should be considered before the use of IPS Empress 2 material for the fabrication of three-unit FPDs.
DEFF Research Database (Denmark)
Charlot, Mette; Grove, Erik; Hansen, Peter Riis
2011-01-01
: All aspirin treated patients surviving 30 days after a first myocardial infarction from 1997 to 2006, with follow-up for one year. Patients treated with clopidogrel were excluded. MAIN OUTCOME MEASURES: The risk of the combined end point of cardiovascular death, myocardial infarction, or stroke...... associated with use of proton pump inhibitors was analysed using Kaplan-Meier analysis, Cox proportional hazard models, and propensity score matched Cox proportional hazard models. Results 3366 of 19 925 (16.9%) aspirin treated patients experienced recurrent myocardial infarction, stroke, or cardiovascular...
DEFF Research Database (Denmark)
Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid
2015-01-01
analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...
Directory of Open Access Journals (Sweden)
Anissa Gramatges Ortiz
2002-08-01
Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated
Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner
International Nuclear Information System (INIS)
Amiri, K; Cervantes, M J; Mulu, B; Raisee, M
2014-01-01
Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR
Load variation effects on the pressure fluctuations exerted on a Kaplan turbine runner
Amiri, K.; Mulu, B.; Raisee, M.; Cervantes, M. J.
2014-03-01
Introduction of intermittent electricity production systems like wind power and solar systems to electricity market together with the consumption-based electricity production resulted in numerous start/stops, load variations and off-design operation of water turbines. The hydropower systems suffer from the varying loads exerted on the stationary and rotating parts of the turbines during load variations which they are not designed for. On the other hand, investigations on part load operation of single regulated turbines, i.e., Francis and propeller, proved the formation of rotating vortex rope (RVR) in the draft tube. The RVR induces oscillating flow both in plunging and rotating modes which results in oscillating force with two different frequencies on the runner blades, bearings and other rotating parts of the turbine. The purpose of this study is to investigate the effect of transient operations on the pressure fluctuations on the runner and mechanism of the RVR formation/mitigation. Draft tube and runner blades of the Porjus U9 model, a Kaplan turbine, were equipped with pressure sensors. The model was run in off-cam mode during different load variation conditions to check the runner performance under unsteady condition. The results showed that the transients between the best efficiency point and the high load happens in a smooth way while transitions to/from the part load, where rotating vortex rope (RVR) forms in the draft tube induces high level of fluctuations with two frequencies on the runner; plunging and rotating mode of the RVR.
International Nuclear Information System (INIS)
Kawamura, Toshiki; Ishiguchi, Tsuneo; Shibamoto, Yuta
2006-01-01
We analyzed the therapeutic results and prognostic factors of 46 primary central nervous system lymphoma (PCNSL) patients who were treated at twelve institutions in the Tokai district of Japan between 1995 and 1999. We compared the results with those of a Japanese nationwide survey performed in the past. We sent each institution a questionnaire about the state of patients' disease, pathological type, method and doses of radiotherapy, regimen and intensity of chemotherapy, and patients' prognoses. The range of patients' ages was 33 to 93 years (median, 61 years). Thirty-one were men and 15 were women. The most prevalent histology was diffuse large B cell type (33 patients). We used the Kaplan-Meier method to calculate the survival rate and Cox's proportional hazards model to analyze the prognostic factors. The five-year cumulative survival rate was 25%, and the median survival time was 22.7 months. The five-year disease-free survival rate was 23%. In monovariate analysis, patients who were both younger than 60 years old and had a World Health Organization (WHO) performance status (PS) score equal to or less than 2 showed a better survival rate. Furthermore, the patients receiving systemic chemotherapy showed a significantly better local control rate. In addition, patients who received systemic chemotherapy achieved a higher complete remission rate than those not receiving it. However, no factors that significantly influenced survival rate were identified in multivariate analysis. We demonstrated that the therapeutic outcome of PCNSL patients has recently improved. In particular, patients with good PS showed better local control than those with poor PS. However, we could not identify any significant prognostic factors in PCNSL patients. (author)
Magnitude of bacteraemia predicts one-year mortality
DEFF Research Database (Denmark)
Gradel, Kim Oren; Schønheyder, Henrik Carl; Søgaard, Mette
Objectives: All hospitals in our region use the BacT/Alert® blood culture (BC) system with a 3-bottle BC set for adults. We hypothesized that the magnitude of bacteremia (i.e., number of positive bottles in the initial BC set) predicted one-year mortality. Methods In a population-based study we...... with a BC index of 1 (i.e., one positive bottle) were chosen as the reference group. We computed Kaplan-Meier curves and performed Cox regression analyses to estimate mortality rate ratios (MRRs) with 95 % confidence intervals [CIs] 30 and 365 days after the initial BC sampling date, first in crude analyses...... mortality....
Markov chains and semi-Markov models in time-to-event analysis.
Abner, Erin L; Charnigo, Richard J; Kryscio, Richard J
2013-10-25
A variety of statistical methods are available to investigators for analysis of time-to-event data, often referred to as survival analysis. Kaplan-Meier estimation and Cox proportional hazards regression are commonly employed tools but are not appropriate for all studies, particularly in the presence of competing risks and when multiple or recurrent outcomes are of interest. Markov chain models can accommodate censored data, competing risks (informative censoring), multiple outcomes, recurrent outcomes, frailty, and non-constant survival probabilities. Markov chain models, though often overlooked by investigators in time-to-event analysis, have long been used in clinical studies and have widespread application in other fields.
Mwango, Albert; Stringer, Jeffrey; Ledergerber, Bruno; Mulenga, Lloyd; Bucher, Heiner C.; Westfall, Andrew O.; Calmy, Alexandra; Boulle, Andrew; Chintu, Namwinga; Egger, Matthias; Chi, Benjamin H.
2011-01-01
Background Loss to follow-up (LTFU) is common in antiretroviral therapy (ART) programmes. Mortality is a competing risk (CR) for LTFU; however, it is often overlooked in cohort analyses. We examined how the CR of death affected LTFU estimates in Zambia and Switzerland. Methods and Findings HIV-infected patients aged ≥18 years who started ART 2004–2008 in observational cohorts in Zambia and Switzerland were included. We compared standard Kaplan-Meier curves with CR cumulative incidence. We calculated hazard ratios for LTFU across CD4 cell count strata using cause-specific Cox models, or Fine and Gray subdistribution models, adjusting for age, gender, body mass index and clinical stage. 89,339 patients from Zambia and 1,860 patients from Switzerland were included. 12,237 patients (13.7%) in Zambia and 129 patients (6.9%) in Switzerland were LTFU and 8,498 (9.5%) and 29 patients (1.6%), respectively, died. In Zambia, the probability of LTFU was overestimated in Kaplan-Meier curves: estimates at 3.5 years were 29.3% for patients starting ART with CD4 cells Switzerland since only few patients died. The results from Cox and Fine and Gray models were similar: in Zambia the risk of loss to follow-up and death increased with decreasing CD4 counts at the start of ART, whereas in Switzerland there was a trend in the opposite direction, with patients with higher CD4 cell counts more likely to be lost to follow-up. Conclusions In ART programmes in low-income settings the competing risk of death can substantially bias standard analyses of LTFU. The CD4 cell count and other prognostic factors may be differentially associated with LTFU in low-income and high-income settings. PMID:22205933
SAMSN1 is highly expressed and associated with a poor survival in glioblastoma multiforme.
Directory of Open Access Journals (Sweden)
Yong Yan
Full Text Available OBJECTIVES: To study the expression pattern and prognostic significance of SAMSN1 in glioma. METHODS: Affymetrix and Arrystar gene microarray data in the setting of glioma was analyzed to preliminarily study the expression pattern of SAMSN1 in glioma tissues, and Hieratical clustering of gene microarray data was performed to filter out genes that have prognostic value in malignant glioma. Survival analysis by Kaplan-Meier estimates stratified by SAMSN1 expression was then made based on the data of more than 500 GBM cases provided by The Cancer Genome Atlas (TCGA project. At last, we detected the expression of SAMSN1 in large numbers of glioma and normal brain tissue samples using Tissue Microarray (TMA. Survival analysis by Kaplan-Meier estimates in each grade of glioma was stratified by SAMSN1 expression. Multivariate survival analysis was made by Cox proportional hazards regression models in corresponding groups of glioma. RESULTS: With the expression data of SAMSN1 and 68 other genes, high-grade glioma could be classified into two groups with clearly different prognoses. Gene and large sample tissue microarrays showed high expression of SAMSN1 in glioma particularly in GBM. Survival analysis based on the TCGA GBM data matrix and TMA multi-grade glioma dataset found that SAMSN1 expression was closely related to the prognosis of GBM, either PFS or OS (P<0.05. Multivariate survival analysis with Cox proportional hazards regression models confirmed that high expression of SAMSN1 was a strong risk factor for PFS and OS of GBM patients. CONCLUSION: SAMSN1 is over-expressed in glioma as compared with that found in normal brains, especially in GBM. High expression of SAMSN1 is a significant risk factor for the progression free and overall survival of GBM.
Intraoperative Radiation Therapy for Locally Advanced and Recurrent Soft-Tissue Sarcomas in Adults
International Nuclear Information System (INIS)
Tran, Phuoc T.; Hara, Wendy; Su Zheng; Lin, H. Jill; Bendapudi, Pavan K.; Norton, Jeffrey; Teng, Nelson; King, Christopher R.; Kapp, Daniel S.
2008-01-01
Purpose: To analyze the outcomes of and identify prognostic factors for patients treated with surgery and intraoperative radiotherapy (IORT) for locally advanced and recurrent soft-tissue sarcoma in adults from a single institution. Methods and Materials: We retrospectively reviewed 50 consecutive patients treated with IORT to 62 sites of disease. Primary sites included retroperitoneum-pelvis (78%), extremity (8%), and other (14%). Seventy percent of patients had recurrent disease failing prior surgery (70%) and/or radiation (32%). Mean disease-free interval (DFI) before IORT was 1.9 years (range, 2 weeks-5.4 years). The IORT was delivered with orthovoltage X-rays using individually sized beveled cone applicators. Clinical characteristics were as follows: mean tumor size, 10 cm (range, 1-25 cm); high-grade histologic subtype (72%); and mean dose, 1,159 cGy (range, 600-1,600 cGy). Postoperative radiation or chemotherapy was administered to 37% of IORT Sites and 32% of patients, respectively. Outcomes measured were infield control (IFC), locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Mean and median follow-up of alive patients were 59 and 35 months, respectively. Results: Kaplan-Meier 5-year IFC, LRC, DMFS, and DSS probabilities for the entire group were 55%, 26%, 51%, and 25%, respectively. Prognostic factors found to be significant (p < 0.05) on multivariate analysis were prior DFI and tumor size for LRC, extremity location and leiomyosarcoma histologic subtype for DMFS, and prior DFI for DSS. Our cohort had five Grade 3/4 complications associated with treatment or a 5-year Kaplan-Meier Grade 3/4 complication-free survival rate of 85%. Conclusions: IORT after tumor reductive surgery is well tolerated and seems to confer IFC in carefully selected patients
Han, Tianci; Shu, Tianci; Dong, Siyuan; Li, Peiwen; Li, Weinan; Liu, Dali; Qi, Ruiqun; Zhang, Shuguang; Zhang, Lin
2017-05-01
Decreased expression of human chemokine-like factor-like MARVEL transmembrane domain-containing 3 (CMTM3) has been identified in a number of human tumors and tumor cell lines, including gastric and testicular cancer, and PC3, CAL27 and Tca-83 cell lines. However, the association between CMTM3 expression and the clinicopathological features and prognosis of esophageal squamous cell carcinoma (ESCC) patients remains unclear. The aim of the present study was to investigate the correlation between CMTM3 expression and clinicopathological parameters and prognosis in ESCC. CMTM3 mRNA and protein expression was analyzed in ESCC and paired non-tumor tissues by quantitative real-time polymerase chain reaction, western blotting and immunohistochemical analysis. The Kaplan-Meier method was used to plot survival curves and the Cox proportional hazards regression model was also used for univariate and multivariate survival analysis. The results revealed that CMTM3 mRNA and protein expression levels were lower in 82.5% (30/40) and 75% (30/40) of ESCC tissues, respectively, when compared with matched non-tumor tissues. Statistical analysis demonstrated that CMTM3 expression was significantly correlated with lymph node metastasis (P=0.002) and clinical stage (P<0.001) in ESCC tissues. Furthermore, the survival time of ESCC patients exhibiting low CMTM3 expression was significantly shorter than that of ESCC patients exhibiting high CMTM3 expression (P=0.01). In addition, Kaplan-Meier survival analysis revealed that the overall survival time of patients exhibiting low CMTM3 expression was significantly decreased compared with patients exhibiting high CMTM3 expression (P=0.010). Cox multivariate analysis indicated that CMTM3 protein expression was an independent prognostic predictor for ESCC after resection. This study indicated that CMTM3 expression is significantly decreased in ESCC tissues and CMTM3 protein expression in resected tumors may present an effective prognostic
Directory of Open Access Journals (Sweden)
Vogt A
2011-11-01
Full Text Available Alexander Vogt1, Anke Schoelmerich1, Franziska Pollner1, Manuela Schlitt1, Uwe Raaz1, Lars Maegdefessel2, Iris Reindl1, Michael Buerke1, Karl Werdan1, Axel Schlitt11Department of Medicine III, Martin Luther-University, Halle, Germany; 2Division of Cardiovascular Medicine, Stanford University School of Medicine, Stanford, CA, USAPurpose: The aim of this study was to determine the long-term safety of drug-eluting stent (DES versus bare metal stent (BMS implantation in a “real-world” setting.Patients and methods: A total of 1809 patients who were treated with implantation of either BMS or DES were assessed. Kaplan-Meier and multivariate Cox regression analyses concerning primary endpoint of cardiac mortality were performed.Results: A total of 609 patients received DES. Mean age was 66.2 ± 11.3 years, 69.4% were male, and 1517 (83.8% were treated for acute coronary syndrome (unstable angina 510 [28.2%], non-ST-elevation myocardial infarction [NSTEMI] 506 [28.0%], and ST-elevation myocardial infarction [STEMI] 501 [27.7%]. Mean follow-up was 34 ± 15 months. During follow-up, 268 patients died of cardiac causes (DES 42 [7.3%]; BMS 226 [19.6%]; P < 0.001. Univariate Kaplan-Meier analysis showed an advantage of DES over BMS concerning the primary endpoint (P < 0.001. When adjusting for classic risk factors and additional factors that affect the progression of coronary heart disease (CHD, DES was not found to be superior to BMS (hazard ratio 0.996, 95% confidence interval 0.455–2.182, P = 0.993. Severely impaired renal function was an independent predictor for cardiac mortality after stent implantation.Conclusion: Treatment with DES is safe in the long term, also in patients presenting with STEMI. However, in multivariate analyses it is not superior to BMS treatment.Keywords: coronary stent, outcome, renal insufficiency, myocardial infarction, STEMI
Energy Technology Data Exchange (ETDEWEB)
Lo, Andrea C., E-mail: andrealo@gmail.com [Department of Radiation Oncology, British Columbia Cancer Agency Vancouver Centre, Vancouver, British Columbia (Canada); Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); Howard, A. Fuchsia [School of Population and Public Health, University of British Columbia, Vancouver, British Columbia (Canada); Nichol, Alan; Sidhu, Keerat; Abdulsatar, Farah [Department of Radiation Oncology, British Columbia Cancer Agency Vancouver Centre, Vancouver, British Columbia (Canada); Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada); Hasan, Haroon [Department of Radiation Oncology, British Columbia Cancer Agency Vancouver Centre, Vancouver, British Columbia (Canada); Goddard, Karen [Department of Radiation Oncology, British Columbia Cancer Agency Vancouver Centre, Vancouver, British Columbia (Canada); Department of Surgery, University of British Columbia, Vancouver, British Columbia (Canada)
2014-04-01
Purpose: We report long-term outcomes and complications of craniopharyngioma patients referred to our institution. Methods and Materials: Between 1971 and 2010, 123 consecutive patients received primary treatment for craniopharyngioma in British Columbia and were referred to our institution. The median age was 30 years (range, 2-80 years). Thirty-nine percent of patients were treated primarily with subtotal resection (STR) and radiation therapy (RT), 28% with STR alone, 15% with gross total resection, 11% with cyst drainage (CD) alone, 5% with CD+RT, and 2% with RT alone. Eight percent of patients received intracystic bleomycin (ICB) therapy. Results: Median follow-up was 8.9 years, and study endpoints were reported at 10 years. Ten-year Kaplan-Meier progression-free survival (PFS) was 46%. Patients treated with STR+RT or CD+RT had the highest PFS (82% and 83%, respectively). There were no significant differences between PFS after adjuvant versus salvage RT (84% vs 74%, respectively; P=.6). Disease-specific survival (DSS) was 88%, and overall survival (OS) was 80%. Primary treatment modality did not affect DSS or OS, while older age was a negative prognostic factor for OS but not DSS. Kaplan-Meier rates for visual deterioration, anterior pituitary hormone deficiency, diabetes insipidus, seizure disorder, and cerebrovascular events (CVE) due to treatment, not tumor progression, were 27%, 76%, 45%, 16%, and 11%, respectively. The CVE rate was 29% in patients who received ICB compared to 10% in those who did not (P=.07). Conclusions: We report favorable PFS in patients with craniopharyngioma, especially in those who received RT after surgery. DSS and OS rates were excellent regardless of primary treatment modality. We observed a high incidence of hypopituitarism, visual deterioration, and seizure disorder. Eleven percent of patients experienced CVEs after treatment. There was a suggestion of increased CVE risk in patients treated with ICB.
Long-term results after primary infrapopliteal angioplasty for limb ischemia
International Nuclear Information System (INIS)
Alfke, H.; Marburg Univ.; Vannucchi, A.; Froelich, J.J.; Klinikum Bad Hersfeld; El-Sheik, M.; Wagner, H.J.; Vivantes-Klinikum im Friedrichshain
2007-01-01
Purpose: To evaluate the technical success rate, procedure-related complications, and clinical long-term results for patients who underwent infrapopliteal angioplasty. Materials and Methods: We retrospectively evaluated all patients who underwent infrapopliteal angioplasty to treat critical chronic limb ischemia or severe claudication from 1/1997 to 12/1999. We excluded patients with acute (< 2 weeks) limb ischemia. Procedure-related data were prospectively documented in a database and analyzed with a focus on the technical success rate and procedure-related complications. In addition all clinical documents were analyzed, and a follow-up examination was performed or telephone interviews were conducted with patients, relatives and referring doctors for follow-up. The primary end points were the limb salvage rate and patient survival rate. The secondary end points included the complication rate, technical success rate, and walking distance. Results: 112 patients with a mean age of 72 years (41 women, 71 men) underwent crural angioplasty on 121 limbs. Four patients suffered from severe claudication (Rutherford category 3) and all others had critical chronic limb ischemia (category 4 to 6). The complication rate was 2.7 %. The technical success rate was 92 %. The ankle brachial index increased from 0.59 to 0.88. The mean walking distance increased significantly from 52 ± 66 to 284 ± 346 meters at the time of follow-up. The limb salvage rate was 83.6 % after one year and 81.1 % after three years. The mean survival rate according to Kaplan-Meier was 79.4 %, 69.2 %, and 54.2 % at 1, 2, and 3 years, respectively. Patients with at least one patent run-off vessel after angioplasty had a significantly better limb salvage rate. Diabetes was not a risk factor for limb salvage. Conclusion: Infrapopliteal angioplasty shows a high technical success rate with an acceptable complication rate. The clinical long-term success seems favorable if a least one open run-off vessel was
Direct visual internal urethrotomy: Is it a durable treatment option?
Pal, Dilip Kumar; Kumar, Sanjay; Ghosh, Bastab
2017-01-01
To evaluate the long-term success rate of direct vision internal urethrotomy as a treatment for anterior urethral strictures. We retrospectively analyzed the results for patients who underwent internal urethrotomy from January 2009 to January 2014 for anterior urethral strictures. Patients were followed till January 2016. Patients with complicated urethral strictures with a history of previous urethroplasty, hypospadias repair, or previous radiation were excluded from the study, as anticipated low success rate of direct visual internal urethrotomy (DVIU) in these patients. The Kaplan-Meier method was used to analyze stricture-free probability after the first, second, and third urethrotomy. A total of 186 patients were included in this study. Stricture-free rates after first, second, and third urethrotomy were 29.66%, 22.64%, and 13.33%, respectively. Although DVIU may be a management option for anterior urethral stricture disease, it seems that long-term results are disappointing.
Association between poor clinical prognosis and sleep duration among breast cancer patients
Directory of Open Access Journals (Sweden)
Thalyta Cristina Mansano-Schlosser
Full Text Available ABSTRACT Objective: to investigate the association between clinical progression and the quality and duration of sleep in women with breast cancer. Method: longitudinal study, with 114 participants, conducted in a hospital in Brazil. The instruments used were: questionnaire for sociodemographic and clinical characterization, Pittsburgh Sleep Quality Index; Beck Depression Inventory and Herth Hope Scale. Data were analyzed through descriptive statistics and survival analyses (outcome: poor clinical progression, using the Kaplan-Meier curve, Log-rank test and Cox proportional model. Results: a higher probability of poor clinical progression was verified in women with sleep durations of less than six hours or nine hours and over (p=.0173. Conclusion: the results suggest the importance of further studies that seek to verify whether the quantitative management of sleep disorders would have an impact on the progression of breast cancer. Women should be encouraged to report sleep problems to nurses.
International Nuclear Information System (INIS)
Riemann, B.; Kraemer, J.A.; Schober, O.; Schmid, K.W.; Dralle, H.; Dietlein, M.; Schicha, H.; Sauerland, C.; Frankewitsch, T.
2010-01-01
The Multicentre Study Differentiated Thyroid Cancer (MSDS) collective represents a well defined group of patients with locally aggressive thyroid carcinomas (pT4; AJCC/UICC 1997). The aim of the present study was to compare the survival of patients with minimum and extensive extrathyroidal growth according to the new AJCC/UICC TNM staging system 2009. Patients, methods: The follow-up data of 347 patients were analysed. Patients were reclassified according to the current AJCC/UICC 2009 classification. The event-free and overall survival was evaluated using Kaplan-Meier analysis. In addition, postoperative complications and status of disease were documented. Results: 327 patients were assigned to stage pT3 and 20 patients to stage pT4a, respectively. Median follow-up was 6.1 years (range 0.04-9.8 years). 92.5% of patients reached complete remission. There were 7.8% recurrences in the thyroid bed, in locoregional lymph nodes and/or in distant sites. The overall survival was >98% both in pT3 and pT4a patients (p = n. s.). In contrast, the event-free survival was significantly less favourable in pT4a patients (p < 0.001). Using multivariate analysis the following parameters were significant predictors of event-free survival: histological tumour type, degree of extrathyroidal extension and nodal metastasis (p < 0.05). Conclusions: The MSDS patients with locally aggressive differentiated thyroid cancer showed an excellent overall survival during a median follow-up of 6.1 years. According to the current AJCC/UICC 2009 classification, pT3 patients with minimal extrathyroidal extension revealed a significantly better event-free survival than pT4a patients with extensive extrathyroidal growth. (orig.)
International Nuclear Information System (INIS)
Xue Bo; Zhang Peilei; Wang Jue; Li Minghua; Zhao Jungong; Zhu Yueqi; Tan Huaqiao; Wang Jianbo
2011-01-01
Objective: To evaluate batroxobin in preventing vascular restenosis in diabetic patients after infrapopliteal arterial angioplasty through comparing the clinical results of the combination use of batroxobin and aspirin with that of simple use of aspirin. Methods: After a successful angioplasty, fifty-two diabetic patients with symptomatic infrapopliteal obstructions were randomly divided into the study group (n=26) and the control group (n=26). Patients in both groups received 100 aspirin everyday, but the patients in study group additionally received 5 IU batroxobin intravenous drip every day for six times. At the end of the follow-up period lasting for 12 months, magnetic resonance angiography (MRA) or Doppler ultrasonic angiography was performed to check the vessels to see if there was any restenosis or reocclusion. The relief degree of clinical symptoms were observed, and both preoperative and postoperative ankle-brachial index (ABI) were regularly determined and compared. Kaplan-Meier curves were constructed to evaluate restenosis/reocclusion-free rate, limb salvage rate and amputation-free rate. Results: During the follow-up period the occurrence of restenosis/reocclusion in study group and control group was 22.0% and 34.5% respectively (P=0.0307). Statistically significant difference in ABI existed between two groups both after the procedure (P<0.05) and at 12 months after the treatment (P=0.0094). Clinical improvement and tissue healing in study group and control group were observed in 23 and 19 patients respectively (P=0.0544). Twelve months after angioplasty, Kaplan-Meier analysis showed that the restenosis/reocclusion-free rate, the limb salvage rate and the amputation-free rate for study group were 74.0%, 96.2% and 84.6% respectively, while they was 54.8%, 92.3% and 84.6% respectively for control group. Conclusion: The results of this study indicate that the use of the clinical therapeutic efficacy and markedly relieve the symptoms, although this
Directory of Open Access Journals (Sweden)
Strazzullo Viviana
2006-12-01
Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader
Directory of Open Access Journals (Sweden)
Vasile Cojocaru
2011-09-01
Full Text Available In order to increase the lifetime of runner blades of Kaplan turbines damaged by cavitation erosion, an anticavitation lip is attached to the periphery of the runner blades on the suction side. The anticavitation lip overtakes the cavitation pitting which appears between the runner blades and the runner chamber. A blade with the original anticavitation lip was modeled using CAE. The numerical simulations showed the tip vortex position and the source of the cavitation erosion. Using these data, a modified profile of the anticavitation lip was designed.
Prognostic impact of tumor MET expression among patients with stage IV gastric cancer
DEFF Research Database (Denmark)
Erichsen, Rune; Kelsh, Michael A; Oliner, Kelly S
2016-01-01
PURPOSE: We aimed to investigate the prevalence and prognostic impact of tumor mesenchymal epithelial transition factor (MET) expression in stage IV gastric cancers in a real-world clinical setting because existing evidence is sparse. METHODS: The study included archived cancer specimens from 103...... stage IV gastric cancer patients (2003-2010). We analyzed MET-protein expression by immunohistochemistry (MET-positive if ≥25% of tumor cells showed MET expression). We calculated overall survival using the Kaplan-Meier method and hazard ratios comparing mortality among MET-positive and MET.......6 months), corresponding to an adjusted hazard ratio of 2.2 (95% confidence interval, 1.3-3.7). CONCLUSIONS: Tumor MET expression is prevalent and has substantial prognostic impact in stage IV gastric cancer patients....
MEKK1 is a Novel Regulator of the Dmp1-Arf-p53 Pathway and Prognostic Indicator in Breast Cancer
2012-12-01
hDMP1, INK4a/ARF, p53 or Hdm2 amplification. Kaplan -Meier analyses have been conducted to study the impact for the impact of loss or gain of each locus on...Palma P, Pellegrini S, Fina P et al. Mdm2 gene alterations and mdm2 protein expression in breast carcinomas. J Pathol 1995; 175: 31–38. 21 Turbin DA
Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón
2016-01-01
The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Masaaki, E-mail: BCD06275@nifty.com [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan); Department of Neurosurgery, Tokyo Women' s Medical University Medical Center E, Tokyo (Japan); Kawabe, Takuya [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan); Department of Neurosurgery, Kyoto Prefectural University of Medicine Graduate School of Medical Sciences, Kyoto (Japan); Higuchi, Yoshinori [Department of Neurosurgery, Chiba University Graduate School of Medicine, Chiba (Japan); Sato, Yasunori [Clinical Research Center, Chiba University Graduate School of Medicine, Chiba (Japan); Barfod, Bierta E. [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan); Kasuya, Hidetoshi [Department of Neurosurgery, Tokyo Women' s Medical University Medical Center E, Tokyo (Japan); Urakawa, Yoichi [Katsuta Hospital Mito GammaHouse, Hitachi-naka (Japan)
2012-12-01
Purpose: We tested the validity of 3 recently proposed prognostic indexes for breast cancer patients with brain metastases (METs) treated radiosurgically. The 3 indexes are Diagnosis-Specific Graded Prognostic Assessment (DS-GPA), New Breast Cancer (NBC)-Recursive Partitioning Analysis (RPA), and our index, sub-classification of RPA class II patients into 3 sub-classes (RPA class II-a, II-b and II-c) based on Karnofsky performance status, tumor number, original tumor status, and non-brain METs. Methods and Materials: This was an institutional review board-approved, retrospective cohort study using our database of 269 consecutive female breast cancer patients (mean age, 55 years; range, 26-86 years) who underwent Gamma Knife radiosurgery (GKRS) alone, without whole-brain radiation therapy, for brain METs during the 15-year period between 1996 and 2011. The Kaplan-Meier method was used to estimate the absolute risk of each event. Results: Kaplan-Meier plots of our patient series showed statistically significant survival differences among patients stratified into 3, 4, or 5 groups based on the 3 systems (P<.001). However, the mean survival time (MST) differences between some pairs of groups failed to reach statistical significance with all 3 systems. Thus, we attempted to regrade our 269 breast cancer patients into 3 groups by modifying our aforementioned index along with the original RPA class I and III, (ie, RPA I+II-a, II-b, and II-c+III). There were statistically significant MST differences among these 3 groups without overlap of 95% confidence intervals (CIs) between any 2 pairs of groups: 18.4 (95% CI = 14.0-29.5) months in I+II-a, 9.2 in II-b (95% CI = 6.8-12.9, P<.001 vs I+II-a) and 5.0 in II-c+III (95% CI = 4.2-6.8, P<.001 vs II-b). Conclusions: As none of the new grading systems, DS-GPS, BC-RPA and our system, was applicable to our set of radiosurgically treated patients for comparing survivals after GKRS, we slightly modified our system for breast cancer
Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford
2015-01-01
Purpose The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients and Methods Patients with metastatic human epidermal growth factor receptor 2–positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m2 once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. Results From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Conclusion Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. PMID:25547504
Colorectal cancers detected through screening are associated with lower stages and improved survival
DEFF Research Database (Denmark)
Lindebjerg, Jan; Osler, Merete; Bisgaard, Claus Hedebo
2014-01-01
in the feasibility study cohort were reviewed with respect to the effect of screening participation on stages and survival. MATERIAL AND METHODS: All cases of CRC in a feasibility study cohort diagnosed from the beginning of the study until two years after the study ended were identified. Differences...... in the distribution of colon cancer stages and rectal cancer groups between the various screening categories were analysed through χ(2)-tests. Survival analysis with respect to screening groups was done by Kaplan-Meier and Cox-Mantel hazard ratios, and survival was corrected for lead time. RESULTS: Colon cancers...... detected through screening were diagnosed at significantly lower stages than among screening non-responders. There were relatively fewer locally advanced rectal cancers among patients diagnosed through positive FOBT than among non-responders. Survival among screening cancer patients was superior...
Whole abdominal irradiation in ovarian carcinoma
International Nuclear Information System (INIS)
Romestaing, P.; Gallo, C.; Gerard, J.F.; Ardiet, J.M.; Carrie, C.
1989-01-01
The prognosis of ovarian cancers, which are frequently diagnosed at a late stage, can probably be improved by whole abdominal radiotherapy. 45 patients in Lyon and 8 patients in Montelimar (7 stage I or C, 10 stage II and 36 stage III) were treated by whole abdominal radiotherapy, generally after 6 courses of chemotherapy (46 cases). The overall 5-year survival of this group of patients was 48% (Kaplan-Meier method). When the patients treated by complete resection at 1st look surgery (19 cases) are compared with those in whom 1st look surgery was incomplete (34 cases), the actuarial survival was 83% versus 27%. This study demonstrates that whole abdominal radiotherapy is feasible without any serious long-term complications after two operations and 6 courses of chemotherapy. These encouraging results need to be confirmed by randomized prospective studies [fr
Mortality and secular trend in the incidence of bipolar disorder
DEFF Research Database (Denmark)
Medici, Clara Reece; Videbech, Poul; Gustafsson, Lea Nørgreen
2015-01-01
BACKGROUND: The world-wide interest in bipolar disorder is illustrated by an exponential increase in publications on the disorder registered in Pubmed since 1990. This inspired an investigation of the epidemiology of bipolar disorder. METHODS: This was a register-based cohort study. All first......-ever diagnoses of bipolar disorder (International Classification of Diseases-10: F31) were identified in the nationwide Danish Psychiatric Central Research Register between 1995 and 2012. Causes of death were obtained from The Danish Register of Causes of Death. Age- and gender standardized incidence rates......, standardized mortality ratio (SMR) and Kaplan-Meier survival estimates were calculated. RESULTS: We identified 15,334 incident cases of bipolar disorder. The incidence rate increased from 18.5/100,000 person-years (PY) in 1995 to 28.4/100,000 PY in 2012. The mean age at time of diagnosis decreased...
DEFF Research Database (Denmark)
Wilke, Thomas; Mueller, Sabrina; Groth, Antje
2015-01-01
BACKGROUND: The aim of this study was to analyse which factors predict the real-world macro-/microvascular event, hospitalisation and death risk in patients with type 2 diabetes mellitus. Furthermore, we aimed to investigate whether there exists both an under- and over-treatment risk...... of these patients. METHODS: We used a German claims/clinical data set covering the years 2010-12. Diabetes-related events were defined as (1) macro-, (2) microvascular events leading to inpatient hospitalisation, (3) other hospitalisations with type 2 diabetes mellitus as main diagnosis, (4) all-cause death and (5......) a composite outcome including all event categories 1-4. Factors associated with event risk were analysed by a Kaplan-Meier curve analysis and by multivariable Cox regression models. RESULTS: 229,042 patients with type 2 diabetes mellitus (mean age 70.2 years; mean CCI 6.03) were included. Among factors...
Subintimal angioplasty in femoropopliteal region-Mid-term results
International Nuclear Information System (INIS)
Koecher, Martin; Cerna, Marie; Utikal, Petr; Kozak, Jiri; Sisola, Ivan; Thomas, Rohit P.; Bachleda, Petr; Drac, Petr; Sekanina, Zdenek; Langova, Katerina
2010-01-01
Purpose: Subintimal angioplasty is becoming more frequently used treatment option for patients with long arterial occlusions or diffuse atherosclerotic changes as an alternative to surgical treatment in claudicants especially in patients with critical limb ischemia. The aim of our article is to retrospectively assess mid-term outcomes of subintimal angioplasty of chronic arterial occlusions in femoropopliteal region followed clinically and by Doppler ultrasonography. Materials and methods: From May 2002 to December 2007, 133 femoropopliteal artery occlusions in 123 patients were indicated for subintimal recanalisation. The indications for treatment were intermittent claudications in 84 patients (63.15%) and critical limb ischemia in 49 patients (36.85%). The median length of lesions was 11.4 cm, range 2-30 cm. Except doppler ultrasonographic examination done 24 h after the procedure and clinical examination before discharge, both clinical and ultrasonographic examinations were performed 6 and 12 months after the procedure and yearly thereafter. Statistical analysis of our cohort was performed by Kaplan-Meier analysis, log-rank test and Cox regression. Results: Technical success was achieved in 86.46%. Primary patency rate was 83.1% (SE: 3.9%), 67.5% (SE: 5%), 58% (SE: 5.9%) a 48.4% (SE: 7.1%) at 6, 12, 24 and 36 months respectively. No statistically significant difference of primary patency was found between the group of claudicants and the group of patient with critical limb ischemia. Statistically significant prediction factors for primary patency were only the quality of the run off and the length of the occlusion. Limb salvage rate in our group of patients with critical limb ischemia was 80.8% at 12 months. Conclusion: Subintimal recanalisation is a simple and safe procedure for treatment of chronic peripheral arterial occlusions with high primary technical success rate, acceptable primary patency rate, low percentage of complications and mortality is as low as
Predicting long-term graft survival in adult kidney transplant recipients
Directory of Open Access Journals (Sweden)
Brett W Pinsky
2012-01-01
Full Text Available The ability to accurately predict a population′s long-term survival has important implications for quantifying the benefits of transplantation. To identify a model that can accurately predict a kidney transplant population′s long-term graft survival, we retrospectively studied the United Network of Organ Sharing data from 13,111 kidney-only transplants completed in 1988- 1989. Nineteen-year death-censored graft survival (DCGS projections were calculated and com-pared with the population′s actual graft survival. The projection curves were created using a two-part estimation model that (1 fits a Kaplan-Meier survival curve immediately after transplant (Part A and (2 uses truncated observational data to model a survival function for long-term projection (Part B. Projection curves were examined using varying amounts of time to fit both parts of the model. The accuracy of the projection curve was determined by examining whether predicted sur-vival fell within the 95% confidence interval for the 19-year Kaplan-Meier survival, and the sample size needed to detect the difference in projected versus observed survival in a clinical trial. The 19-year DCGS was 40.7% (39.8-41.6%. Excellent predictability (41.3% can be achieved when Part A is fit for three years and Part B is projected using two additional years of data. Using less than five total years of data tended to overestimate the population′s long-term survival, accurate prediction of long-term DCGS is possible, but requires attention to the quantity data used in the projection method.
Extraneural metastases of medulloblastoma: desmoplastic variants may have prolonged survival.
Young, Robert J; Khakoo, Yasmin; Yhu, Stephen; Wolden, Suzanne; De Braganca, Kevin C; Gilheeney, Stephen W; Dunkel, Ira J
2015-04-01
Extraneural metastases from CNS medulloblastoma are rare and poorly described. The purpose of this study is to describe the clinical and radiological characteristics of a large single institution series of patients with medulloblastoma who developed extraneural metastases. We retrospectively reviewed a departmental database over a 20 year period for all patients with medulloblastoma who developed extraneural metastases. Chart and imaging reviews were performed, and overall survival (OS) estimated by the Kaplan-Meier method. We found 14 patients with medulloblastoma and extraneural metastases. The median age at initial diagnosis was 16.3 years (range, 3.2-44.2), and the most common subtype was desmoplastic (n = 6, 42.9%). After initial gross total resection, most patients received radiation therapy alone (n = 10, 71.4%). Metastases to bone were most common (n = 11, 78.6%) followed by metastases to bone marrow (n = 6, 42.9%), usually to the spine. The median time from initial diagnosis to first extraneural metastasis was 1.5 years (range, 0.2-17.4), and the median OS from extraneural metastasis to death was 3.3 years (range, 0-18). The Kaplan-Meier estimate of 5 year OS from extraneural metastasis diagnosis was 40.0% (95% CI, 20.2-79.2). Extraneural metastases from medulloblastoma may rarely develop after initial diagnosis to involve bone and bone marrow. We found that desmoplastic variant extraneural tumors had longer survival than nondesmoplastic variants, suggesting that histopathological and more recent molecular subtyping have important roles in determining the prognosis of medulloblastoma patients. © 2014 Wiley Periodicals, Inc.
Resultado do tratamento cirúrgico das neoplasias do seio piriforme
Directory of Open Access Journals (Sweden)
Costa Claudiney C.
2003-01-01
Full Text Available Os tumores da laringe e hipofaringe apresentam alta incidência no Brasil, sendo o sexto sítio mais comum entre os tumores malignos no sexo masculino. O diagnóstico inicial geralmente é realizado com lesões em estadio clínicos avançados diminuindo o sucesso do tratamento instituído. OBJETIVOS: Avaliar a evolução de 60 pacientes com carcinoma epidermóide de seio piriforme, considerando tratamento instituído, complicações e sobrevida estimada em 5 anos. FORMA DE ESTUDO: Estudo retrospectivo. MÉTODO: Os testes estatístico utilizados foram o método de Kaplan-Meier e o teste exato de Fisher. RESULTADOS: Dos 60 pacientes, 43 foram submetidos a tratamento cirúrgico seguido de radioterapia. Atualmente 27,9% estão vivos sem doença, 11,6% vivos com doença, 9,4% mortos sem doença, 34,8% mortos com doença e perda de seguimento de 16,3%. A complicação pós-operatória mais freqüente foi a fístula cutânea. A recidiva local ocorreu em 5 pacientes, regional em 6, loco-regional em 3 e metástase à distância em 6. Não houve correlação entre margem cirúrgica comprometida e sobrevida em 20 pacientes com recidiva tumoral (Teste de Fisher. Aplicando a curva de sobrevida atuarial pelo método Kaplan-Meier, obtivemos média de sobrevida em 5 anos de 23,2 meses. CONCLUSÃO: A principal complicação pós-operatória foi a fístula cutânea, sendo tratada clinicamente. A margem cirúrgica comprometida não alterou o prognóstico, apesar de ser sempre um dos princípios da cirurgia oncológica. A principal falha no tratamento foi a recidiva locorregional. A curva de sobrevida atuarial (Kaplan-Meier em cinco anos apresentou média de 23,2 meses.
Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine
Schmidt, H.; Kirschner, O.; Riedelbauch, S.; Necker, J.; Kopf, E.; Rieg, M.; Arantes, G.; Wessiak, M.; Mayrhuber, J.
2014-03-01
Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation.
Influence of the vibro-acoustic sensor position on cavitation detection in a Kaplan turbine
International Nuclear Information System (INIS)
Schmidt, H; Kirschner, O; Riedelbauch, S; Necker, J; Kopf, E; Rieg, M; Arantes, G; Wessiak, M; Mayrhuber, J
2014-01-01
Hydraulic turbines can be operated close to the limits of the operating range to meet the demand of the grid. When operated close to the limits, the risk increases that cavitation phenomena may occur at the runner and / or at the guide vanes of the turbine. Cavitation in a hydraulic turbine can cause material erosion on the runner and other turbine parts and reduce the durability of the machine leading to required outage time and related repair costs. Therefore it is important to get reliable information about the appearance of cavitation during prototype operation. In this experimental investigation the high frequency acoustic emissions and vibrations were measured at 20 operating points with different cavitation behaviour at different positions in a large prototype Kaplan turbine. The main goal was a comparison of the measured signals at different sensor positions to identify the sensitivity of the location for cavitation detection. The measured signals were analysed statistically and specific values were derived. Based on the measured signals, it is possible to confirm the cavitation limit of the examined turbine. The result of the investigation shows that the position of the sensors has a significant influence on the detection of cavitation
Item response theory analyses of the Delis-Kaplan Executive Function System card sorting subtest.
Spencer, Mercedes; Cho, Sun-Joo; Cutting, Laurie E
2018-02-02
In the current study, we examined the dimensionality of the 16-item Card Sorting subtest of the Delis-Kaplan Executive Functioning System assessment in a sample of 264 native English-speaking children between the ages of 9 and 15 years. We also tested for measurement invariance for these items across age and gender groups using item response theory (IRT). Results of the exploratory factor analysis indicated that a two-factor model that distinguished between verbal and perceptual items provided the best fit to the data. Although the items demonstrated measurement invariance across age groups, measurement invariance was violated for gender groups, with two items demonstrating differential item functioning for males and females. Multigroup analysis using all 16 items indicated that the items were more effective for individuals whose IRT scale scores were relatively high. A single-group explanatory IRT model using 14 non-differential item functioning items showed that for perceptual ability, females scored higher than males and that scores increased with age for both males and females; for verbal ability, the observed increase in scores across age differed for males and females. The implications of these findings are discussed.
Characteristics and outcomes of patients with Ewing sarcoma over 40 years of age at diagnosis.
Karski, Erin E; Matthay, Katherine K; Neuhaus, John M; Goldsby, Robert E; Dubois, Steven G
2013-02-01
The peak incidence of Ewing sarcoma (EWS) is in adolescence, with little known about patients who are ≥40 years at diagnosis. We describe the clinical characteristics and survival of this rare group. This retrospective cohort study utilized the Surveillance Epidemiology and End Results database. 2780 patients were identified; including 383 patients diagnosed ≥40 years. Patient characteristics between age groups were compared using chi-squared tests. Survival from diagnosis to death was estimated via Kaplan-Meier methods, compared with log-rank tests, and modeled using multivariable Cox methods. A competing risks analysis was performed to evaluate death due to cancer. Patients ≥40 years of age were more likely to have extra-skeletal tumors (66.1% vs. 31.7%; p extra-skeletal tumors, metastatic disease, and axial primary tumors suggesting a difference in tumor biology. Independent of differences in these characteristics, older patients also have a lower survival rate. Copyright © 2012 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Liu, Wen-Shan; Wu, Ming-Fang; Tseng, Hsien-Chun; Liu, Jung-Tung; Weng, Jui-Hung; Li, Yueh-Chun; Lee, Jong-Kang
2012-01-01
Purpose: Pretreatment with 2- [ 18 F] fluorodeoxyglucose positron emission tomography ( 18 F-FDG-PET) was evaluated as a predictor of local failure-free survival (LFFS), disease-free survival (DFS), and overall survival (OS) in patients with nonkeratinizing nasopharyngeal carcinoma (NPC) treated with intensity-modulated radiation therapy (IMRT) alone or concurrently with chemotherapy (CCRT). Patients and Methods: Seventy-five M0 NPC patients who received FDG-PET before treatment were analyzed. The primary tumor FDG uptake was measured as the maximum standardized uptake value (SUVmax). The LFFS, DFS, and OS were calculated by the Kaplan-Meier method, and the differences were evaluated on log-rank test. The prognostic significance was assessed by univariate and multivariate analyses. Results: Eighteen patients received IMRT alone and 57 received CCRT. The mean SUVmax was significantly higher in 12 patients with locoregional or distant failure than in those without failure (p 18 F-FDG uptake (SUVmax >5) indicates poor outcome in patients with NPC.
Wang, Xiangyang; Cao, Weilan; Zheng, Chenguo; Hu, Wanle; Liu, Changbao
2018-06-01
Marital status has been validated as an independent prognostic factor for survival in several cancer types, but is controversial in rectal cancer (RC). The objective of this study was to investigate the impact of marital status on the survival outcomes of patients with RC. We extracted data of 27,498 eligible patients diagnosed with RC between 2004 and 2009 from the Surveillance, Epidemiology and End Results (SEER) database. Patients were categorized into married, never married, divorced/separated and widowed groups.We used Chi-square tests to compare characteristics of patients with different marital status.Rectal cancer specific survival was compared using the Kaplan-Meier method,and multivariate Cox regression analyses was used to analyze the survival outcome risk factors in different marital status. The widowed group had the highest percentage of elderly patients and women,higher proportion of adenocarcinomas, and more stage I/II in tumor stage (P married group (76.7% VS 85.4%). Compared with the married patients, the never married (HR 1.40), widowed (HR 1.61,) and divorced/separated patients (HR 1.16) had an increased overall 5-year mortality. A further analysis showed that widowed patients had an increased overall 5-year cause-specific survival(CSS) compared with married patients at stage I(HR 1.92),stage II (HR 1.65),stage III (HR 1.73),and stage IV (HR 1.38). Our study showed marriage was associated with better outcomes of RC patients, but unmarried RC patients, especially widowed patients,are at greater risk of cancer specific mortality. Copyright © 2018 Elsevier Ltd. All rights reserved.
Clinical results of Intracoronary Brachytherapy (ICBT) for multiple in-stent restenosis
International Nuclear Information System (INIS)
Stadler, P.; Schaefer, C.; Chaber, S.; Putnik, K.; Treutwein, M.; Koelbl, O.; Muders, F.
2006-01-01
Background and purpose: treatment of in-stent restenosis (ISR) with percutaneous coronary intervention (PCI) alone is often followed by early re-restenosis. The present study focused on the effect of intracoronary brachytherapy (ICBT) on multiple in-stent restenosis (MISR) after repeated PCI. Patients and methods: 40 patients (27 male, 13 female, age: 66 ± 9 years) with MISR (two to six ISRs, median three ISRs) were retrospectively analyzed. All patients were treated by using the Novoste registered Beta-Cath trademark 3.5F System after PCI. The target vessel received 18.4-25.3 Gy of radiation at a depth of 2 mm from the center of the source. The restenosis-free survival and overall survival were calculated by Kaplan-Meier analysis (log-rank). The time interval between last PCI without ICBT and the consecutive recurrence was compared with the follow-up time after PCI with ICBT. Results: the 3-year overall survival rate after ICBT was 93%. The 0.5-, 1-, 2-, and 3-year ISR-free survival rates after PCI + ICBT were 81%, 72%, 52%, and 38%, respectively. After PCI alone, the 0.5-, 1-, and 2-year ISR-free survival rates were 30%, 13%, and 0%, respectively. This difference was highly significant (p < 0.0001). Patients with more than three ISRs before ICBT had a better outcome (3-year ISR-free survival: 80%) than patients with only two or three ISRs before ICBT (3-year ISR-free survival: 25%; p < 0.05). Conclusion: ICBT is highly effective and safe in patients with ISR. The results of this study are in accordance with the WRIST and BETA-WRIST data. After 6 months both studies revealed an ISR-free survival rate of 86% (WRIST) and 66% (BETA-WRIST), respectively. The ISR rates in the own control group (70%) were comparable to the placebo groups in WRIST (68%) and BETA-WRIST (72%). Interestingly, patients with more than three ISRs before ICBT had the lowest ISR rate after ICBT. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Gray, Phillip J. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Harvard Radiation Oncology Program, Boston, Massachusetts (United States); Lin, Chun Chieh; Jemal, Ahmedin [Surveillance and Health Services Research Program, American Cancer Society, Atlanta, Georgia (United States); Shipley, William U. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Fedewa, Stacey A. [Surveillance and Health Services Research Program, American Cancer Society, Atlanta, Georgia (United States); Kibel, Adam S. [Division of Urology, Brigham and Women' s Hospital/Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Rosenberg, Jonathan E. [Genitourinary Oncology Service, Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Kamat, Ashish M. [Division of Surgery, Department of Urology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Virgo, Katherine S. [Department of Health Policy and Management, Emory University, Atlanta, Georgia (United States); Blute, Michael L. [Department of Urology, Massachusetts General Hospital, Boston, Massachusetts (United States); Zietman, Anthony L. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Efstathiou, Jason A., E-mail: jefstathiou@partners.org [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)
2014-04-01
Purpose: To examine the accuracy of clinical staging and its effects on outcome in bladder cancer (BC) patients treated with radical cystectomy (RC), using a large national database. Methods and Materials: A total of 16,953 patients with BC without distant metastases treated with RC from 1998 to 2009 were analyzed. Factors associated with clinical–pathologic stage discrepancy were assessed by multivariate generalized estimating equation models. Survival analysis was conducted for patients treated between 1998 and 2004 (n=7270) using the Kaplan-Meier method and Cox proportional hazards models. Results: At RC 41.9% of patients were upstaged, whereas 5.9% were downstaged. Upstaging was more common in females, the elderly, and in patients who underwent a more extensive lymphadenectomy. Downstaging was less common in patients treated at community centers, in the elderly, and in Hispanics. Receipt of preoperative chemotherapy was highly associated with downstaging. Five-year overall survival rates for patients with clinical stages 0, I, II, III, and IV were 67.2%, 62.9%, 50.4%, 36.9%, and 27.2%, respectively, whereas those for the same pathologic stages were 70.8%, 75.8%, 63.7%, 41.5%, and 24.7%, respectively. On multivariate analysis, upstaging was associated with increased 5-year mortality (hazard ratio [HR] 1.80, P<.001), but downstaging was not associated with survival (HR 0.88, P=.160). In contrast, more extensive lymphadenectomy was associated with decreased 5-year mortality (HR 0.76 for ≥10 lymph nodes examined, P<.001), as was treatment at an National Cancer Institute–designated cancer center (HR 0.90, P=.042). Conclusions: Clinical–pathologic stage discrepancy in BC patients is remarkably common across the United States. These findings should be considered when selecting patients for preoperative or nonoperative management strategies and when comparing the outcomes of bladder sparing approaches to RC.
International Nuclear Information System (INIS)
Vujovic, Olga; Yu, Edward; Cherian, Anil; Dar, A. Rashid; Stitt, Larry; Perera, Francisco
2006-01-01
Purpose: This retrospective review was conducted to determine if delay in the start of radiotherapy after conservative breast surgery had any detrimental effect on local recurrence or disease-free survival in node-negative breast cancer patients. Methods and Materials: A total of 568 patients with T1 and T2, N0 breast cancer were treated with breast-conserving surgery and breast irradiation, without adjuvant systemic therapy, between January 1, 1985 and December 31, 1992 at the London Regional Cancer Centre. The time intervals from definitive breast surgery to breast irradiation used for analysis were 0 to 8 weeks (201 patients), greater than 8 to 12 weeks (235 patients), greater than 12 to 16 weeks (91 patients), and greater than 16 weeks (41 patients). Kaplan-Meier estimates of time to local-recurrence and disease-free survival rates were calculated. Results: Median follow-up was 11.2 years. Patients in all 4 time intervals were similar in terms of age and pathologic features. No statistically significant difference was seen between the 4 groups in local recurrence or disease-free survival with surgery radiotherapy interval (p = 0.521 and p = 0.222, respectively). The overall local-recurrence rate at 5 and 10 years was 4.6% and 11.3%, respectively. The overall disease-free survival at 5 and 10 years was 79.6% and 67.0%, respectively. Conclusion: This retrospective study suggests that delay in the start of breast irradiation of up to 16 weeks from definitive surgery does not increase the risk of recurrence in node-negative breast cancer patients. The certainty of these results is limited by the retrospective nature of this analysis
DEFF Research Database (Denmark)
Bellinazzi, Vera R; Cipolli, José A; Pimenta, Marcio V
2015-01-01
AD) greater than the median value presented the worst clinical outcome compared to those with isolated sFV less than the median value or sAD greater than the median value, suggesting an additive effect of these two variables. Further, Kaplan-Meier analysis demonstrated worse outcome for individuals with s...... intima-media thickness and clinically defined high cardiovascular risk did not. Furthermore, area under the receiver-operating characteristic curve for sFV/sAD was higher than that for Framingham risk score (0.77 versus 0.64; P = 0.045), whereas adding sFV/sAD to the Framingham risk factors resulted...
Effect of darapladib on major coronary events after an acute coronary syndrome
DEFF Research Database (Denmark)
O'Donoghue, Michelle L; Braunwald, Eugene; White, Harvey D
2014-01-01
]) at 868 sites in 36 countries. INTERVENTIONS: Patients were randomized to either once-daily darapladib (160 mg) or placebo on a background of guideline-recommended therapy. Patients were followed up for a median of 2.5 years between December 7, 2009, and December 6, 2013. MAIN OUTCOMES AND MEASURES......: The primary end point (major coronary events) was the composite of coronary heart disease (CHD) death, MI, or urgent coronary revascularization for myocardial ischemia. Kaplan-Meier event rates are reported at 3 years. RESULTS: During a median duration of 2.5 years, the primary end point occurred in 903...
DEFF Research Database (Denmark)
Egerod, Frederikke N S Lihme; Bartels, Annette; Fristrup, Niels
2009-01-01
bladder cancer. RESULTS: The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling...... than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling...
DEFF Research Database (Denmark)
Søgaard, Mette; Nørgaard, Mette; Sørensen, Henrik Toft
2009-01-01
for age, gender, coexisting chronic diseases, marital status, use of immunosuppressives, and calendar period. Further, we conducted analyses restricted to patients a discharge diagnose of infectious diseases (ICD-10 codes A00-B99). Results: In total, 1,665 (8.2%) patients had positive blood culture...... System. We computed Kaplan-Meier curves and product limit estimates for the main study variables. Next, time-dependent Cox regression analyses was used to compare the risk of death in patients with positive blood cultures and patients with negative cultures at days 0-7, 8-30, and 31-180, controlling...
Weiner, Lois; Kaplan, Andy
2014-01-01
In this commentary, Andy Kaplan discusses with Lois Weiner, Diane Ravitch's latest book "The Reign of Error," which combines scholarly argument and scrupulous research in defense of democratic education. Weiner notes, the book will prove an important resource in the ongoing struggle for the survival of public schooling. Weiner adds,…
Directory of Open Access Journals (Sweden)
A. D. Kaprin
2016-01-01
Full Text Available Widespread peritoneal carcinomatosis in gastric cancer, in fact, is the end-stage of the disease. The survival median of patients is no more than 3–6 months. Development of various methods of intraperitoneal chemotherapy can improve the prognosis of this category of patients.Objective. To evaluate the efficacy and safety of intraperitoneal aerosol chemotherapy under pressure (IACUP in patients with gastric cancer with peritoneal carcinomatosis.Materials and methods. The treatment Protocol consisted of a laparotomy or laparoscopy for the staging of the tumor process, 3–4 courses of systemic chemotherapy scheme XELOX followed by conducting at least 3 sessions of intraperitoneal aerosol chemotherapy under pressure (IACUP with an interval of 6 weeks on the background of chemotherapy. In the case of progression the patient was excluded from the study. Currently, the study included 27 patients with disseminated gastric cancer who underwent 46 procedures of IACUP. There were 8 men and 19 women. The average age of patients was 50.6 years.Results. In the framework of the safety assessment of IACUP there were 3 cases of adverse effects. Two patients (7,4% noted nausea for the first 2 days after running the session of IACUP. In one patient the iatrogenic perforation of the diaphragm during biopsy of the peritoneum with the development of carbonetworks occurred. The survival median was 11 months. One-year survival rate (by KaplanMeier was 50.7%. 14 patients are alive and continue to participate in the study during the first year of observation.Conclusion. Intraperitoneal aerosol chemotherapy under pressure (IACUP is a simple, minimally invasive and safe method for the palliative treatment of patients with disseminated carcinomatosis of gastric cancer. We developed the treatment Protocol that allows us to achieve one-year survival of more than half of patients.
Hyperfractionation in carcinoma of the cervix: tumor control and late bowel complications
International Nuclear Information System (INIS)
Viswanathan, Faith Rangad; Varghese, Cherian; Peedicayil, Abraham; Lakshmanan, Jeyaseelan; Narayan, Viswanathan Perungulam
1999-01-01
Purpose: Hyperfractionation has been advocated to improve local tumor control by increasing radiation dose without increasing late normal tissue complications. The aim of this study was to determine if hyperfractionation decreased late bowel complications. Methods and Materials: Thirty patients with Stage II and III cervical cancer were randomized to receive either hyperfractionation or conventional fractionation. Patients were followed for 5 years and monitored for tumor control, recurrence, and bowel complications. The relative risks of tumor control and bowel complications were computed at 1 year and 5 years of follow-up. Kaplan-Meier survival curves were plotted to determine probabilities of being tumor-free and bowel complication-free. Results: There were 15 patients in each group. At 1 year of follow-up, 2 patients in the hyperfractionation group (13%) and 7 patients in the conventional treatment group (45%) had tumor (relative risk [RR] 0.3; 95% confidence interval [CI] 0.1, 1.1; p = 0.054). Delayed bowel complications were seen in 8 patients in the hyperfractionation group and 1 patient in the conventional treatment group (RR 7.5; 95% CI 1.1, 52; p = 0.014). At 5 years, 2 patients in the hyperfractionation group and 8 patients in the conventional treatment group had tumor (RR 0.3; 95% CI 0.1, 1.1; p = 0.04). Delayed bowel complications (Grades 2 and 3) occurred in 9 women in the hyperfractionation group and 2 patients in the conventional group (RR 5.4; 95% CI 1.5, 19.5; p 0.0006). Kaplan-Meier analysis showed that the hyperfractionation group had significantly more bowel complications over the 5 years of follow-up (p 0.024). Conclusion: Hyperfractionation may result in better tumor control both at 1 year and at 5 years following treatment of cervical cancer. However, hyperfractionation could lead to increased late bowel complications and must be used judiciously in the treatment of cervical cancer
Role of IKK-alpha in EGFR Signaling Regulation
2013-09-01
heatmap. (B) Low expression of ΙΚΚα in TNBC cell lines. (C) Low expression of ΙΚΚα in TNBC cell lines. (D) Kaplan -Meier overall survival curves of...0.2 150- 100- 50- 150- 100- 0.5 50- 50- - - + + - + - + Vimentin E-cad N-cad 150- 100- 50- 150- 100- Twist1 AKT-p AKT-T C 250- 150- 100- N-cad P1 P2 P3
Al Shemmari, Salem; Sankaranarayanan, Sreedharan P; Krishnan, Yamini
2014-07-01
PMBCL is a distinct type of nonhodgkins lymphoma with specific clinicopathological features. To clarify clinical features, treatment alternatives and outcomes, we evaluated 28 Arab patients treated with chemotherapy or radiotherapy between 2006 and 2011. PMBCL lymphoma patients identified according to WHO classification and treated at KCCC between 2006 and 2011 were included in this study. Demographic and clinical data are presented as means or medians. Overall survival was estimated using the Kaplan-Meier method. Survival rates were compared using the log-rank test. A P lymphoma entity seen in the young with good survival. The role of PET scan for response evaluation and the type of consolidation therapy needs to be further clarified.
FDG-PET on Irradiated Brain Tumor: Ten Years' Summary
International Nuclear Information System (INIS)
Wang, S.X.; Boethius, J.; Ericson, K.
2006-01-01
Purpose: To evaluate FDG-PET in post-radiotherapy differentiation of tumor recurrence/malignant degeneration and radiation reaction, and to assess the role of PET in terms of survival. Material and Methods: 117 consecutive patients with a total of 156 FDG-PET examinations with positive but non-diagnostic MRI and/or CT were included. Final diagnosis was based on histopathology or correlated with radiologic and clinical follow-up. Brain metastases from lung carcinomas were further studied separately. Survival time was analysed using the Kaplan-Meier method. Results: There were 61 true-positive, 2 false-positive, 15 false-negative, and 51 true-negative PET examinations; 5 positive and 22 negative PET examinations were indeterminate. The positive predictive value of a PET examination was 96% in all and 100% in brain metastases from lung carcinoma. The negative predictive value based on the histopathologic results was 55.6%. Survival time was significantly longer in patients with negative PET. Conclusion: FDG-PET is a valuable tool in the detection of tumor recurrence, especially lung carcinoma metastasis. FDG uptake is a prognostic marker
Directory of Open Access Journals (Sweden)
A. V. Rusanov
2016-12-01
Full Text Available The results of numerical investigation of spatial flow of viscous incompressible fluid in flow part of Kaplan turbine PL20 Kremenchug HPP at optimum setting angle of runner blade φb = 15° and at maximum setting angle φb = 35° are shown. The flow simulation has been carried out on basis of numerical integration of the Reynolds equations with an additional term containing artificial compressibility. The differential two-parameter model of Menter (SST has been applied to take into account turbulent effects. Numerical integration of the equations is carried out using an implicit quasi-monotone Godunov type scheme of second - order accuracy in space and time. The calculations have been conducted with the help of the software system IPMFlow. The analysis of fluid flow in the flow part elements is shown and the values of hydraulic losses and local cavitation coefficient have been obtained. Comparison of calculated and experimental results has been carried out.
DEFF Research Database (Denmark)
Axén, Iben; Bodin, Lennart; Kongsted, Alice
2012-01-01
to recovery? This question was answered using survival analysis, illustrated in Kaplan-Meier curves, Proportional Hazard regression analyses and spline regression analyses. 4: How is the repeatedly measured data associated with baseline (predictor) variables? This question was answered using generalized...... involves some challenges. Vital issues to consider are the within-subject correlation, the between measurement occasion correlation and the presence of missing values. The overall aim of this commentary is to describe different methods of analyzing repeated data. It is meant to give an overview...... for the clinical researcher in order for complex outcome measures to be interpreted in a clinically meaningful way. METHODS: A model data set was formed using data from two clinical studies, where patients with low back pain were followed with weekly text messages for 18 weeks. Different research questions...
Sutton, Virginia Kay
This paper examines statistical issues associated with estimating paths of juvenile salmon through the intakes of Kaplan turbines. Passive sensors, hydrophones, detecting signals from ultrasonic transmitters implanted in individual fish released into the preturbine region were used to obtain the information to estimate fish paths through the intake. Aim and location of the sensors affects the spatial region in which the transmitters can be detected, and formulas relating this region to sensor aiming directions are derived. Cramer-Rao lower bounds for the variance of estimators of fish location are used to optimize placement of each sensor. Finally, a statistical methodology is developed for analyzing angular data collected from optimally placed sensors.
Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D
2011-12-01
To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.
[Expression and clinical significance of 5hmC in bladder urothelial carcinoma].
Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing
2016-02-01
To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.
Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola
2009-01-01
We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092
About the value of Ruthenium 106 brachytherapy in the treatment of uveal melanomas
International Nuclear Information System (INIS)
Langmann, G.; Mosboeck, G.; Stuecklschwaiger, G.; Muellner, K.; Lechner, H.; Faulborn, J.
2002-01-01
Background: to investigate the clinical course, sequelae and visual function of uveal melanomas treated with Ruthenium 106 brachytherapy. Patients and method: 47 patients who underwent Ruthenium 106 brachytherapy between 1985 and 2000 were evaluated using Kaplan Meier statistical method. Mean follow up interval was 22 month (range 8 - 152 months). Results: Local tumor control rate was 85 %, 5 years possibility to avoid enucleation was 75 %. The most important sequelae were radiation optic neuropathy (29 %), maculopathy (37 %) and radiation retinopathy (32 %). After terminating the study the 34 % of the patients achieved a visual acuity of 20/40 and more, another 34 % had a visual function of 20/200 and lower. Conclusion: Ruthenium 106 brachytherapy is our method of choice in small medium sized uveal melanomas and a maximum tumor prominence of 6 mm. Tumors have to be located in the midperiphery and outer periphery of the fundus including the ciliary body. In addition to the indications introduced by Lommatzsch we treated ciliary body melanomas with a tumor base more than 3 clock hours (by shifting the plaque) as an alternative therapy to enucleation. (author)
DEFF Research Database (Denmark)
Chesnaye, Nicholas C.; Van Stralen, Karlijn J.; Bonthuis, Marjolein
2017-01-01
from the ESPN/ERA-EDTA Registry. The effect of donor and recipient age combinations on 5-year graft-failure risk, stratified by donor source, was estimated using Kaplan-Meier survival curves and Cox regression, while adjusting for sex, primary renal diseases with a high risk of recurrence, pre......Background The impact of donor age in paediatric kidney transplantation is unclear. We therefore examined the association of donor-recipient age combinations with graft survival in children. Methods Data for 4686 first kidney transplantations performed in 13 countries in 1990-2013 were extracted......-emptive transplantation, year of transplantation and country. Results The risk of graft failure in older living donors (50-75 years old) was similar to that of younger living donors {adjusted hazard ratio [aHR] 0.74 [95% confidence interval (CI) 0.38-1.47]}. Deceased donor (DD) age was non-linearly associated with graft...
Enhanced Predictive Capability of a 1-Hour Oral Glucose Tolerance Test
DEFF Research Database (Denmark)
Pareek, Manan; Bhatt, Deepak L; Nielsen, Mette L
2018-01-01
OBJECTIVE: To examine whether the 1-h blood glucose measurement would be a more suitable screening tool for assessing the risk of diabetes and its complications than the 2-h measurement. RESEARCH DESIGN AND METHODS: We conducted a prospective population-based cohort study of 4,867 men, randomly...... selected from prespecified birth cohorts between 1921 and 1949, who underwent an oral glucose tolerance test with blood glucose measurements at 0, 1, and 2 h. Subjects were followed for up to 39 years, with registry-based recording of events. Discriminative abilities of elevated 1-h (≥8.6 mmol/L) versus 2......-h (≥7.8 mmol/L) glucose for predicting incident type 2 diabetes, vascular complications, and mortality were compared using Kaplan-Meier analysis, Cox proportional hazards regression, and net reclassification improvement. RESULTS: Median age was 48 years (interquartile range [IQR] 48-49). During...
The influence of unilateral oophorectomy on the age of menopause
DEFF Research Database (Denmark)
Rosendahl, M; Simonsen, M K; Kjer, J J
2017-01-01
OBJECTIVE: To determine the age of menopause after premenopausal unilateral oophorectomy (UO) and to establish whether UO at a young age leads to menopause at a younger age than if UO occurs at an older age. METHODS: A cohort of 28 731 women, of whom 17 781 (62%) were menopausal, was investigated....... Information on menopause was obtained from self-reported questionnaires. Surgical data were obtained from the National Patient Register to avoid recollection bias. Age of menopause after UO/not UO was determined using Kaplan-Meier curves. Cox regression was used to identify factors of importance for early...... menopause. RESULTS: UO was performed in 1148 women. Women with UO after the age of 45 years, premenopausal hysterectomy, bilateral oophorectomy and cancer were excluded, leaving 236 in the analysis. Menopause occurred 1.8 years earlier after UO compared to women with two intact ovaries (mean 49.5 vs. 51...
DEFF Research Database (Denmark)
Schrama, Johannes Cornelis; Fenstad, Anne M; Dale, Håvard
2015-01-01
Background and purpose-Medical treatment of rheumatoid arthritis (RA) has changed dramatically over the last 15 years, including immune modulation. We investigated the risk of revision for infection after primary total hip replacement (THR) in patients with rheumatoid arthritis over a 16-year...... period, and compared it with that in THR patients with osteoarthritis (OA).Patients and methods-We identified 13,384 THRs in RA patients and 377,287 THRs in OA patients from 1995 through 2010 in a dataset from the Nordic Arthroplasty Register Association (NARA). Kaplan-Meier survival curves......, with revision for infection as the endpoint, were constructed. Cox regression analyses were performed to calculate the relative risk (RR) of revision for infection adjusted for age, sex, fixation technique, and year of primary surgery.Results-RA patients had a 1.3 times (95% CI 1.0-1.6) higher risk of revision...
Long-term mortality in patients with atrial septal defect
DEFF Research Database (Denmark)
Nyboe, Camilla; Karunanithi, Zarmiga; Nielsen-Kudsk, Jens Erik
2018-01-01
Aims: In this nationwide cohort of atrial septal defect (ASD) patients, the largest to date, we report the longest follow-up time with and without closure in childhood and adulthood compared with a general population cohort. Methods and results: Using population-based registries, we included Danish...... individuals born before 1994 who received an ASD diagnosis between 1959 and 2013. All diagnoses were subsequently validated (n = 2277). Using the Kaplan-Meier estimates and Cox proportional hazards regression adjusted for sex, birth year, and a modified Charlson Comorbidity Index, we compared the mortality...... of ASD patients with that of a birth year and sex matched general population cohort. The median follow-up from ASD diagnosis was 18.1 years (range 1-53 years). Patients with ASD had a higher mortality [adjusted hazard ratio (HR): 1.7; 95% confidence interval (CI): 1.5-1.9] compared with the general...
DEFF Research Database (Denmark)
Astrup, Birgitte Schmidt; Lauritsen, Jens; Ravn, Pernille
, respectively. The median survival time for lacerations was 24 hours (n=19) seen with the naked eye, 40 hours seen with the colposcope (n=28) and 80 hours seen with toluidine blue dye (n=26). Several important pitfalls in the diagnosis of lesions using the three techniques were identified. We propose a model...... insight into the duration of lesions, frequency of lesions seen with different investigative techniques and to identify pitfalls in the diagnosis of lesions. Materials and Methods: 98 women were examined within 48 hours of consensual sexual intercourse using the naked eye, the colposcope and toluidine...... blue dye application. 50 of the women were re-examined after 3 or 4 days and again after 6 or 7 days, and Kaplan-Meier plots of the duration of lacerations were produced. Results: Lacerations were the most frequent lesion seen with all three techniques, seen in 31%, 41% and 49% of participants...
Analyzing survival curves at a fixed point in time for paired and clustered right-censored data
Su, Pei-Fang; Chi, Yunchan; Lee, Chun-Yi; Shyr, Yu; Liao, Yi-De
2018-01-01
In clinical trials, information about certain time points may be of interest in making decisions about treatment effectiveness. Rather than comparing entire survival curves, researchers can focus on the comparison at fixed time points that may have a clinical utility for patients. For two independent samples of right-censored data, Klein et al. (2007) compared survival probabilities at a fixed time point by studying a number of tests based on some transformations of the Kaplan-Meier estimators of the survival function. However, to compare the survival probabilities at a fixed time point for paired right-censored data or clustered right-censored data, their approach would need to be modified. In this paper, we extend the statistics to accommodate the possible within-paired correlation and within-clustered correlation, respectively. We use simulation studies to present comparative results. Finally, we illustrate the implementation of these methods using two real data sets. PMID:29456280
DEFF Research Database (Denmark)
Roed, Casper; Engsig, Frederik Neess; Omland, Lars Haukali
2012-01-01
OBJECTIVES: To determine the long-term mortality, the causes of death and the incidence of cancer in listeria meningitis patients. METHODS: Nationwide, population-based cohort study including all adult patients diagnosed with listeria meningitis from 1977 to 2006 and alive 1 year after diagnosis......, and an age-and gender-matched, population control cohort. Kaplan-Meier tables, Cox regression analysis and cumulative incidence function were used as outcome analyses. RESULTS: We identified 114 listeria meningitis patients and 1026 population controls. The adjusted mortality rate ratio (MRR) for listeria...... meningitis patients the first 5 years of follow-up was 2.35(95% confidence interval (CI) 1.60-3.45) thereafter the MRR was 0.93(95% CI: 0.56-1.55). Listeria meningitis patients had an increased risk of death due to cancer the first 5 years of follow-up, and in the same period patients above 50 years of age...
Shiozawa, Kazue; Watanabe, Manabu; Ikehara, Takashi; Kogame, Michio; Kikuchi, Yoshinori; Igarashi, Yoshinori; Sumino, Yasukiyo
2016-07-01
The present study aimed to determine the usefulness of contrast-enhanced ultrasonography (CEUS) with Sonazoid in evaluating the therapeutic response to sorafenib for hepatocellular carcinoma (HCC). In total, 26 patients with advanced HCC who received sorafenib and were followed up by CEUS were enrolled in the present study. CEUS was performed prior to and within 2-4 weeks of treatment, and the images of the target lesion in the post-vascular phase with a re-injection method were analyzed. The presence (+) or absence (-) of intratumoral necrosis and the intratumoral vascular architecture on micro-flow imaging (MFI) were compared prior to and subsequent to treatment. Target lesions that exhibited non-enhancement after re-injection were considered to indicate intratumoral necrosis. The intratumoral vascular architecture was classified into three groups, as follows: Vd, the intratumoral vessels visually narrowed or decreased; Vnc, the vessels remained unchanged; and Vi, the vessels were thickened or increased. Survival curves were estimated using the Kaplan-Meier method and compared using the log rank test between the intratumoral necrosis (+) and (-) groups, and among the Vd, Vnc and Vi groups. PVnc group and 5 patients in the Vi group. The MSTs in the Vd, Vnc and Vi groups were 15.6 months (95% CI, 5.0-23.3), 11.0 months (95% CI, 3.5-17.6) and 3.6 months (95% CI: 1.2-6.0), respectively. The P-value for the differences between the Vd and Vnc groups, Vd and Vi groups, and Vnc and Vi groups were 0.78, 0.016 and 0.047, respectively, which indicated that the survival time decreased significantly in the Vi group. Evaluation of intratumoral vascular architecture using MFI demonstrates promise for assessing the therapeutic response to sorafenib in patients with HCC.
Togashi, K; Koike, T; Emura, I; Usuda, H
2008-07-01
Non-invasive lung cancers showed a good prognosis after limited surgery. But it is still uncertain about invasive lung cancers. We investigated the indications for limited surgery for small lung cancer tumors measuring 1 cm or less in diameter on preoperative computed tomography (CT). This study retrospectively analyzed of 1,245 patients who underwent complete resection of lung cancer between 1989 and 2004 in our hospital. Sixty-two patients (5%) had tumors measuring 1 cm or less in diameter. The probability of survival was calculated using the Kaplan-Meier method. All diseases were detected by medical checkup, 52 % of the patients were not definitively diagnosed with lung cancer before surgery. Adenocarcinoma was histologically diagnosed in 49 patients (79%). Other histologic types included squamous cell carcinoma (8), large cell carcinoma (1), small cell carcinoma (1), carcinoid (2), and adenosquamous cell carcinoma (1). Fifty-seven patients (92%) showed pathologic stage IA. The other stages were IB (2), IIA (1), and IIIB (2). There were 14 bronchioloalveolar carcinomas (25% of IA diseases). The 5-year survival rates of IA patients were 90%. The 5-year survival rate of patients with tumors measuring 1cm or less diameter was 91% after lobectomy or pneumonectomy, and 90% after wedge resection or segmentectomy. There were 3 deaths from cancer recurrence, while there were no deaths in 14 patients with bronchioloalveolar carcinoma After limited surgery, non-invasive cancer showed good long-term results, while invasive cancer showed a recurrence rate of 2.3% to 79% even though the tumor measured 1 cm or less in diameter on preoperative CT.
Wang, Lu; Wang, Cong; Wang, Jiangfeng; Huang, Xiaochen; Cheng, Yufeng
2017-10-01
A novel systemic immune-inflammation index (SII) based on platelet (P), neutrophil (N), and lymphocyte (L) counts has been reported to be associated with clinical outcomes in several solid tumors. We aimed to investigate its prognostic value in esophageal squamous cell carcinoma (ESCC) and the potential relationship with quality of life (QOL). A total of 280 ESCC patients who underwent esophagectomy were enrolled. SII (SII = P × N/L) was calculated on the basis of data obtained within 1 week before surgery. An optimal cut-off value stratified patients into high (≥560) and low (<560) preoperative SII groups. The widely used EORTC QLQ-C30 and QLQ-OES18 were utilized to assess QOL at cancer diagnosis and 36 months after surgery. Generalized estimating equations (GEEs) were used to evaluate the association of SII with QOL. Kaplan-Meier method and Cox proportional regression were used to analyze the prognostic value of SII. Kaplan-Meier analyses revealed that higher SII correlated significantly with poorer overall survival (OS) (p < 0.001) and disease-free survival (DFS) (p < 0.001) in patients with ESCC. Multivariate analysis identified SII as an independent prognostic factor for OS (p < 0.001; HR 2.578; 95% CI 1.625-4.088) and DFS (p < 0.001; HR 2.699; 95% CI 1.726-4.223). In addition, patients with high SII exhibited notably deteriorating QOL (p < 0.05). The preoperative SII is a promising biomarker for predicting survival and QOL of patients with ESCC. It may help to identify the high-risk patients for treatment strategy decisions.
Rao, Zilong; Zheng, Huaguang; Wang, Fei; Wang, Anxin; Liu, Liping; Dong, Kehui; Zhao, Xingquan; Wang, Yilong; Cao, Yibin
2017-08-01
To evaluate the role of HTPR in predicting early recurrence of ischemic events in patients with minor ischemic stroke or high-risk TIA. From January 2014 to September 2014, a single center continuously enrolled patients with minor ischemic stroke or high-risk TIA and gave them antiplatelet therapy consisting of aspirin with clopidogrel. HTPR was assessed by TEG after 7 days of antiplatelet therapy and detected CYP2C19 genotype. The incidence of recurrent ischemic events was assessed 3 months after onset. The incidence of recurrent ischemic events was compared between the HTPR and NTPR groups with the Kaplan-Meier method, and multivariate Cox proportional hazards models were used to determine the risk factors associated with recurrent ischemic events. We enrolled 278 eligible patients with minor ischemic stroke or high-risk TIA. Through TEG testing, patients with HTPR were 22.7%, and carriers were not associated with HTPR to ADP by TEG-ADP(%) (p = 0.193). A total of 265 patients completed 3 months of follow-up, and Kaplan-Meier analysis showed that patients with HTPR had a higher percentage of recurrent ischemic events compared with patients with NTPR (p = 0.002). In multivariate Cox proportional hazards models, history of ischemic stroke or TIA (HR 4.45, 95% CI 1.77-11.16, p = 0.001) and HTPR (HR 3.34, 95% CI 1.41-7.91, p = 0.006) was independently associated with recurrent ischemic events. In patients with minor stroke or TIA, the prevalence of HTPR was 22.7%, and HTPR was independently associated with recurrent ischemic events.
Albu, Silviu; Babighian, Gregorio; Amadori, Maurizio; Trabalzini, Franco
2015-12-01
This study aims to compare the outcomes of patients with Meniere's disease submitted to either endolymphatic mastoid shunt (ES) or tenotomy of the stapedius and tensor tympani muscles (TSTM). This is a retrospective chart review of patients treated with ES or TSTM between 2000 and 2010 and followed up for at least 12 months. The main outcomes were represented by: (1) vertigo class, hearing stage and functional level according to the American Academy of Otolaryngology-Head and Neck Surgery criteria; (2) adjustment of dizziness handicap inventory (DHI) and (3) complete and substantial vertigo control using the Kaplan-Meier survival method. Sixty-three patients met the inclusion criteria: 34 underwent ES and 29 TSTM. The baseline demographic characteristics, the hearing stage, the functional level, the DHI and hearing levels were not different between the two groups. No significant difference in vertigo class was demonstrated: 66 % of TSTM patients attained class A compared to 44 % in the ES group (p = 0.14). Kaplan-Meier survival curves specific to class A showed significant differences, favoring TSTM (log-rank test, p = 0.022). TSTM patients demonstrated significantly improved functional level (p = 0.0004) and improved DHI scores (p = 0.001). Eight ES patients (25 %) demanded a second surgical attempt compared to none in the TSTM. Aural fullness was significantly improved in TSTM group (p = 0.01), while the difference in tinnitus improvement was non-significant. Hearing preservation was significantly better in TSTM group (p = 0.001). TSTM is a safe surgical procedure, with significant vertigo control rates, and important hearing preservation rates. More patients and longer follow-up are needed to support our preliminary findings.
International Nuclear Information System (INIS)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel; Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano; Mar Munoz Sanchez, Maria del; Alvarez Cabellos, Ruth; Espinosa Aunion, Ruth
2015-01-01
To explore the relationship between basal 18 F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent 18 F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with 18 F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel [University General Hospital, Nuclear Medicine Department, Ciudad Real (Spain); Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano [University of Castilla-La Mancha, Department of Mathematics, Ciudad Real (Spain); Mar Munoz Sanchez, Maria del [Virgen de la Luz Hospital, Oncology Department, Cuenca (Spain); Alvarez Cabellos, Ruth [Virgen de la Salud Hospital, Oncology Department, Toledo (Spain); Espinosa Aunion, Ruth [La Mancha Centro Hospital, Oncology Department, Ciudad Real (Spain)
2015-11-15
To explore the relationship between basal {sup 18}F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent {sup 18}F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with {sup 18}F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Boundary element method for internal axisymmetric flow
Directory of Open Access Journals (Sweden)
Gokhman Alexander
1999-01-01
Full Text Available We present an accurate fast method for the computation of potential internal axisymmetric flow based on the boundary element technique. We prove that the computed velocity field asymptotically satisfies reasonable boundary conditions at infinity for various types of inlet/exit. Computation of internal axisymmetric potential flow is an essential ingredient in the three-dimensional problem of computation of velocity fields in turbomachines. We include the results of a practical application of the method to the computation of flow in turbomachines of Kaplan and Francis types.
Seror, Olivier; N'Kontchou, Gisèle; Nault, Jean-Charles; Rabahi, Yacine; Nahon, Pierre; Ganne-Carrié, Nathalie; Grando, Véronique; Zentar, Nora; Beaugrand, Michel; Trinchet, Jean-Claude; Diallo, Abou; Sellier, Nicolas
2016-08-01
Purpose To assess the long-term outcome in 108 consecutive patients treated with no-touch multibipolar radiofrequency ablation (RFA) for hepatocellular carcinoma (HCC) that met the Milan criteria. Materials and Methods This retrospective study was approved by the ethical review board, and the need to obtain informed consent was waived. Between November 1, 2006, and December 31, 2011, 132 HCC tumors (diameter, 10-45 mm; 39 tumors ≥ 30 mm) in 108 consecutive patients (106 with cirrhosis) that met Milan criteria were treated with no-touch multibipolar RFA, which consisted of activating, in bipolar mode, three or four electrodes inserted just beyond the tumor margins. Follow-up was performed every 3 months for 2 years and every 6 months thereafter with computed tomographic or magnetic resonance imaging. Survival probabilities were computed by using the Kaplan-Meier method. Predictive factors of tumor progression and overall survival were assessed by using the Cox proportional hazard model. Results No technical failure occurred, and complete ablation was achieved for all the nodules. After a median of 40.5 months (range, 2-84 months) of follow-up, 3- and 5-year local and overall tumor progression-free survival were 96%, 94%, 52%, and 32%, respectively. Neither tumor diameter greater than 30 mm nor location abutting a large vessel were associated with local tumor progression. Tumor diameter greater than 30 mm was the only parameter predictive of overall tumor progression (P = .0036). Independent factors associated with shorter overall survival were Child-Pugh class B disease, age greater than 65 years, and platelet count of less than 150 g/L (P touch multibipolar RFA for HCC tumors that meet Milan criteria provides a high local tumor progression-free survival rate. An ongoing randomized trial might help to clarify the role of this new approach for the treatment of early HCC. (©) RSNA, 2016 Online supplemental material is available for this article. An earlier
Burrage, Lindsay C; Charng, Wu-Lin; Eldomery, Mohammad K; Willer, Jason R; Davis, Erica E; Lugtenberg, Dorien; Zhu, Wenmiao; Leduc, Magalie S; Akdemir, Zeynep C; Azamian, Mahshid; Zapata, Gladys; Hernandez, Patricia P; Schoots, Jeroen; de Munnik, Sonja A; Roepman, Ronald; Pearring, Jillian N; Jhangiani, Shalini; Katsanis, Nicholas; Vissers, Lisenka E L M; Brunner, Han G; Beaudet, Arthur L; Rosenfeld, Jill A; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Xia, Fan; Lalani, Seema R; Lupski, James R; Bongers, Ernie M H F; Yang, Yaping
2015-12-03
Meier-Gorlin syndrome (MGS) is a genetically heterogeneous primordial dwarfism syndrome known to be caused by biallelic loss-of-function mutations in one of five genes encoding pre-replication complex proteins: ORC1, ORC4, ORC6, CDT1, and CDC6. Mutations in these genes cause disruption of the origin of DNA replication initiation. To date, only an autosomal-recessive inheritance pattern has been described in individuals with this disorder, with a molecular etiology established in about three-fourths of cases. Here, we report three subjects with MGS and de novo heterozygous mutations in the 5' end of GMNN, encoding the DNA replication inhibitor geminin. We identified two truncating mutations in exon 2 (the 1(st) coding exon), c.16A>T (p.Lys6(∗)) and c.35_38delTCAA (p.Ile12Lysfs(∗)4), and one missense mutation, c.50A>G (p.Lys17Arg), affecting the second-to-last nucleotide of exon 2 and possibly RNA splicing. Geminin is present during the S, G2, and M phases of the cell cycle and is degraded during the metaphase-anaphase transition by the anaphase-promoting complex (APC), which recognizes the destruction box sequence near the 5' end of the geminin protein. All three GMNN mutations identified alter sites 5' to residue Met28 of the protein, which is located within the destruction box. We present data supporting a gain-of-function mechanism, in which the GMNN mutations result in proteins lacking the destruction box and hence increased protein stability and prolonged inhibition of replication leading to autosomal-dominant MGS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Wu, Chao; Chen, Ping; Qian, Jian-Jun; Jin, Sheng-Jie; Yao, Jie; Wang, Xiao-Dong; Bai, Dou-Sheng; Jiang, Guo-Qing
2016-11-29
Marital status has been reported as an independent prognostic factor for survival in various cancers, but it has been rarely studied in hepatocellular carcinoma (HCC) treated by surgical resection. We retrospectively investigated Surveillance, Epidemiology, and End Results (SEER) population-based data and identified 13,408 cases of HCC with surgical treatment between 1998 and 2013. The patients were categorized according to marital status, as "married," "never married," "widowed," or "divorced/separated." The 5-year HCC cause-specific survival (HCSS) data were obtained, and Kaplan-Meier methods and multivariate Cox regression models were used to ascertain whether marital status is also an independent prognostic factor for survival in HCC. Patients in the widowed group had the higher proportion of women, a greater proportion of older (>60 years) patients, more frequency in latest year of diagnosis (2008-2013), a greater number of tumors at TNM stage I/II, and more prevalence at localized SEER Stage, all of which were statistically significant within-group comparisons (P Married patients had better 5-year HCSS than did unmarried patients (46.7% vs 37.8%) (P < 0.001); conversely, widowed patients had lowest HCSS compared with all other patients, overall, at each SEER stage, and for different tumor sizes. Marital status is an important prognostic factor for survival in patients with HCC treated with surgical resection. Widowed patients have the highest risk of death compared with other groups.
Directory of Open Access Journals (Sweden)
L. L. Vysotskaya
2015-01-01
Full Text Available Aim: To assess long-term efficacy of firstand second-line tyrosine kinase inhibitors in non-selected patients with chronic myeloid leukemia in a real-life clinical setting.Materials and methods: The assessment is based on long-term results of a prospective single center comparative clinical trial that was based on non-selected groups of 116 patients with various stages of chronic myeloid leukemia being treated with a first generation tyrosine kinase inhibitor imatinib, and of 44 patients being treated with a second generation tyrosine kinase inhibitor nilotinib. We analyzed all-cause mortality, progression-free survival from April 2005 to April 2013, with a median of the follow-up of 128 months.Results: In 116 patients with chronic myeloid leukemia treated with imatinib, the Kaplan-Meier survival estimate was 120 months. In 44 patients at an early chronic phase, 5-year overall survival and progression-free survival was 93.2% and 8-year overall and progression-free survival was 79.5%. In 44 patients at a late chronic stage, 5-year overall and progression-free survival was 95.5%, 8-year overall and progression-free survival, 72.7%. In 28 patients at acceleration phase, 5-years overall survival was 78.6% and 8-year overall survival, 46%. Median of overall survival in patients treated with nilotinib was not reached. During 78.6 months of combination treatment with cytotoxic agents, tyrosine kinase inhibitors of the first (imatinib and second line (nilotinib, overall survival was 100%.Conclusion: In clinical practice, inclusion of patients with chronic myeloid leukemia and imatinib resistance (disease relapse or imatinib intolerance into the treatment program with frontline therapy with general cytotoxic agents and thereafter with firstand second-line tyrosine kinase inhibitors significantly improves overall survival.
Directory of Open Access Journals (Sweden)
Chao Hsing-Lung
2010-05-01
Full Text Available Abstract Background To analyze the rate of larynx preservation in patients of locally advanced hypopharyngeal cancer treated with intensity modulated radiotherapy (IMRT plus concurrent chemotherapy, and compare the results with patients treated with primary surgery. Methods Between January 2003 and November 2007, 14 patients were treated with primary surgery and 33 patients were treated with concurrent chemoradiotherapy (CCRT using IMRT technique. Survival rate, larynx preservation rate were calculated with the Kaplan-Meier method. Multivariate analysis was conducted for significant prognostic factors with Cox-regression method. Results The median follow-up was 19.4 months for all patients, and 25.8 months for those alive. The 5-year overall survival rate was 33% and 44% for primary surgery and definitive CCRT, respectively (p = 0.788. The 5-year functional larynx-preservation survival after IMRT was 40%. Acute toxicities were common, but usually tolerable. The rates of treatment-related mucositis (≥ grade 2 and pharyngitis (≥ grade 3 were higher in the CCRT group. For multivariate analysis, treatment response and cricoid cartilage invasion strongly correlated with survival. Conclusions IMRT plus concurrent chemotherapy may preserve the larynx without compromising survival. Further studies on new effective therapeutic agents are essential.
Directory of Open Access Journals (Sweden)
Cheng Tsui
2012-01-01
Full Text Available Abstract Background Increased health care costs have made it incumbent on health-care facilities and physicians to demonstrate both clinical and cost efficacy when recommending treatments. Though studies have examined the cost-effectiveness of adjuvant goserelin with radiotherapy for locally advanced prostate cancer, few have compared the cost-effectiveness of adjuvant goserelin to adjuvant chemotherapy alone in premenopausal breast cancer. Methods In this retrospective study at one hospital, the records of 152 patients with stage Ia to IIIa ER + breast cancer who received goserelin or chemotherapy were reviewed. Survival analysis was assessed by the Kaplan-Meier method. Patients were interviewed to evaluate their quality of life using the European Organization for Research and Treatment Quality of Life questionnaire (EORTC-QLQ-C30, version 4.0, and to obtain the utility value by the standard gamble (SG and visual scale (VS methods. Total medical cost was assessed from the (National Health Insurance NHI payer's perspective. Results Survival at 11 years was significantly better in the groserelin group (P Conclusions Goserelin therapy results in better survival and higher utility-weighted life-years, and is more cost-effective than TC or TEC chemotherapy.
Horikawa, Akira; Miyakoshi, Naohisa; Shimada, Yoichi; Kodama, Hiroyuki
2015-10-28
Excellent results have recently been reported for both total knee arthroplasty (TKA) and unicompartmental knee arthroplasty (UKA), but there have been few reports about which has a better long-term outcome. The preoperative and postoperative results of TKA and UKA for osteoarthritis of the knee were thus compared. The results of 48 patients who underwent TKA and 25 patients who underwent UKA were evaluated based on clinical scores and survivorship in the middle long-term period. Preoperative, latest postoperative, and changes in the femoro-tibial angle (FTA), range of motion (ROM), Japanese Orthopedic Association score (JOA score), and Japanese Knee Osteoarthritis Measure (JKOM) were compared. The patients' mean age was 73 years. The mean follow-up period was 9 years (TKA: mean, 10.5 years; range, 7-12 years; UKA: mean, 9 years; range, 6-11 years). Preoperative FTA and ROM were significantly higher in the UKA group than in the TKA group. Total changes in all scores were similar among the two groups, as were changes in scores for all JOA and JKOM domains. The cumulative revision rate was higher for UKA than for TKA (7 versus 4%). Kaplan-Meier survivorship at 10 years was 84% for UKA and 92% for TKA. This clinical study found no significant differences between TKA and UKA, except in long-term survivorship.
Sayers, Adrian; Crowther, Michael J; Judge, Andrew; Whitehouse, Michael R; Blom, Ashley W
2017-08-28
The use of benchmarks to assess the performance of implants such as those used in arthroplasty surgery is a widespread practice. It provides surgeons, patients and regulatory authorities with the reassurance that implants used are safe and effective. However, it is not currently clear how or how many implants should be statistically compared with a benchmark to assess whether or not that implant is superior, equivalent, non-inferior or inferior to the performance benchmark of interest.We aim to describe the methods and sample size required to conduct a one-sample non-inferiority study of a medical device for the purposes of benchmarking. Simulation study. Simulation study of a national register of medical devices. We simulated data, with and without a non-informative competing risk, to represent an arthroplasty population and describe three methods of analysis (z-test, 1-Kaplan-Meier and competing risks) commonly used in surgical research. We evaluate the performance of each method using power, bias, root-mean-square error, coverage and CI width. 1-Kaplan-Meier provides an unbiased estimate of implant net failure, which can be used to assess if a surgical device is non-inferior to an external benchmark. Small non-inferiority margins require significantly more individuals to be at risk compared with current benchmarking standards. A non-inferiority testing paradigm provides a useful framework for determining if an implant meets the required performance defined by an external benchmark. Current contemporary benchmarking standards have limited power to detect non-inferiority, and substantially larger samples sizes, in excess of 3200 procedures, are required to achieve a power greater than 60%. It is clear when benchmarking implant performance, net failure estimated using 1-KM is preferential to crude failure estimated by competing risk models. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No
Methodical Aspects of Applying Strategy Map in an Organization
Directory of Open Access Journals (Sweden)
Piotr Markiewicz
2013-06-01
Full Text Available One of important aspects of strategic management is the instrumental aspect included in a rich set of methods and techniques used at particular stages of strategic management process. The object of interest in this study is the development of views and the implementation of strategy as an element of strategic management and instruments in the form of methods and techniques. The commonly used method in strategy implementation and measuring progress is Balanced Scorecard (BSC. The method was created as a result of implementing the project “Measuring performance in the Organization of the future” of 1990, completed by a team under the supervision of David Norton (Kaplan, Norton 2002. The developed method was used first of all to evaluate performance by decomposition of a strategy into four perspectives and identification of measures of achievement. In the middle of 1990s the method was improved by enriching it, first of all, with a strategy map, in which the process of transition of intangible assets into tangible financial effects is reflected (Kaplan, Norton 2001. Strategy map enables illustration of cause and effect relationship between processes in all four perspectives and performance indicators at the level of organization. The purpose of the study being prepared is to present methodical conditions of using strategy maps in the strategy implementation process in organizations of different nature.
Iverson, Shawn M; Spierer, Oriel; Papachristou, George C; Feuer, William J; Shi, Wei; Greenfield, David S; O'Brien, Terrence P
2018-02-01
To compare corneal graft survival rates after penetrating keratoplasty (PK) and Descemet's stripping endothelial keratoplasty (DSEK) in patients with a glaucoma drainage device (GDD) or medically managed glaucoma. A retrospective chart review was conducted on consecutive patients who underwent primary PK or primary DSEK. Inclusion criteria consisted of eyes with a diagnosis of glaucoma prior to corneal transplantation and a minimum of 6 months of follow-up. Graft failure was defined as an edematous cornea with failure to maintain deturgescence lasting beyond a period of 1 month of intense steroid therapy or vascularization and scarring resulting in irreversible loss of central graft clarity. Corneal graft survival was calculated using Kaplan-Meier survival analysis. Patients were divided into four groups: GDD-PK, GDD-DSEK, medical-PK and medical-DSEK. Fifty-six eyes of 56 patients were identified as meeting inclusion criteria. Among eyes with a GDD, there was no difference in the proportion of failures between PK grafts (48%) and DSEK grafts (50%) (p = 0.90). Failure occurred earlier in DSEK recipients compared to PK recipients, 5.82 ± 6.77 months versus 14.40 ± 7.70 months, respectively (p = 0.04). A Kaplan-Meier analysis did not identify a difference between the four groups with respect to graft failure (p = 0.52). There is no significant difference in graft survival rates between medically and surgically treated glaucoma patients for either PK or DSEK grafts. In patients with GDD, graft failure occurs earlier in DSEK compared to PK.
Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali; Shariati, Mahsa
2016-03-01
Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results.
DEFF Research Database (Denmark)
Inzitari, Domenico; Pracucci, Giovanni; Poggesi, Anna
2009-01-01
cerebral infarcts and atrophy. MAIN OUTCOME MEASURE: Transition from no disability (defined as a score of 0 or 1 on the instrumental activities of daily living scale) to disability (score >/=2) or death over three year follow-up. Secondary outcomes were incident dementia and stroke. RESULTS: Over a mean...... follow-up period of 2.42 years (SD 0.97, median 2.94 years), information on the main outcome was available for 633 patients. The annual rate of transition or death was 10.5%, 15.1%, and 29.5%, respectively, for patients with mild, moderate, or severe age related changes in white matter (Kaplan-Meier log...
Oncologic results of laparoscopic liver resection for malignant liver tumors.
Akyuz, Muhammet; Yazici, Pinar; Yigitbas, Hakan; Dural, Cem; Okoh, Alexis; Aliyev, Shamil; Aucejo, Federico; Quintini, Cristiano; Fung, John; Berber, Eren
2016-02-01
There are scant data regarding oncologic outcomes of laparoscopic liver resection (LLR). The aim of this study is to analyze the oncologic outcomes of LLR for malignant liver tumors (MLT). This was a prospective IRB-approved study of 123 patients with MLT undergoing LLR. Kaplan-Meier disease-free (DFS) and overall survival (OS) was calculated. Tumor type was colorectal in 61%, hepatocellular cancer in 21%, neuroendocrine in 5% and others in 13%. Mean tumor size was 3.2 ± 1.9 cm and number of tumors 1.6 ± 1.2. A wedge resection or segmentectomy was performed in 63.4%, bisegmentectomy in 24.4%, and hemihepatectomy in 12.2%. Procedures were totally laparoscopic in 67% and hand-assisted in 33%. Operative time was 235.2 ± 94.3 min, and conversion rate 7.3%. An R0 resection was achieved in 90% of patients and 94% of tumors. Median hospital stay was 3 days. Morbidity was 22% and mortality 0.8%. For patients with colorectal liver metastasis, DFS and OS at 2 years was 47% and 88%, respectively. This study shows that LLR is a safe and efficacious treatment for selected patients with MLT. Complete resection and margin recurrence rate are comparable to open series in the literature. © 2015 Wiley Periodicals, Inc.
Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions
International Nuclear Information System (INIS)
Lakatos, K; Szamosi, Z; Bereczkei, S
2012-01-01
This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.
Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions
Lakatos, K.; Szamosi, Z.; Bereczkei, S.
2012-11-01
This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.
Análisis de la recurrencia de cáncer de lengua considerando la presencia de eventos competitivos.
Directory of Open Access Journals (Sweden)
Raúl Vicente Mantilla Quispe
2008-10-01
Full Text Available Objetivo: Estimar la probabilidad de recurrencia en pacientes con cáncer de lengua según la edad, el estado ganglionar patológico y el tipo de tratamiento de los pacientes considerando la muerte antes de la recurrencia como evento competitivo. Material y métodos: Serie de casos retrospectiva de 290 pacientes con cáncer de lengua, con tratamiento en el INEN, entre los años 1977 y 2000. Se excluyeron del estudio 29 pacientes tratados solo con radioterapia. De los 261 pacientes, 31 solo tuvieron tratamiento del tumor primario. Resultados: La recurrencia fue 36,8%, la recurrencia local fue la más frecuente. La incidencia acumulada de la recurrencia a los 5 años, con el método de Kaplan Meier, se estimó en 44,7%, y según el análisis de riesgos competitivos en 42,4%. En el análisis univariado considerando riesgos competitivos, las incidencias acumuladas fueron: 56,8 y 38,9% en pacientes menores o iguales que 45 y mayores que 45 años respectivamente (p = 0,1556, 29,4% y 50,5% en pacientes con ganglios patológicos negativos y positivos, respectivamente (p = 0,0002, y 37,5% en pacientes con cirugía, y 47,4% con radioterapia (p = 0,03. En el análisis multivariado, con regresión de riesgos competitivos, no se encontró diferencia entre los tipos de tratamiento sobre la recurrencia (RR = 1,146, p = 0,620. Conclusiones: La pequeña diferencia entre los resultados del método Kaplan Meier y el que toma en cuenta eventos competitivos se debe a la baja tasa del evento competitivo, más aún por que se trata de muerte no relacionada con la enfermedad. La tasa de recurrencia fue similar al reportado en la literatura. Sólo se encontró diferencia significativa en la tasa de recurrencia en el grupo con compromiso ganglionar positivo. Aunque la comparación con los métodos estándar, Kaplan Meier y Regresión de Cox, muestra resultados similares se deben tener en cuenta los eventos competitivos. (Rev Med Hered 2008;19: 145-151.
Setting the stage for medieval plague: Pre-black death trends in survival and mortality.
DeWitte, Sharon N
2015-11-01
The 14(th) -century Black Death was one of the most devastating epidemics in human history, killing tens of millions of people in a short period of time. It is not clear why mortality rates during the epidemic were so high. One possibility is that the affected human populations were particularly stressed in the 14(th) century, perhaps as a result of repeated famines in areas such as England. This project examines survival and mortality in two pre-Black Death time periods, 11-12(th) centuries vs 13(th) century CE, to determine if demographic conditions were deteriorating before the epidemic occurred. This study is done using a sample of individuals from several London cemeteries that have been dated, in whole or in part, either to the 11-12(th) centuries (n = 339) or 13(th) century (n = 258). Temporal trends in survivorship and mortality are assessed via Kaplan-Meier survival analysis and by modeling time period as a covariate affecting the Gompertz hazard of adult mortality. The age-at-death distributions from the two pre-Black Death time periods are significantly different, with fewer older adults in 13(th) century. The results of Kaplan-Meier survival analysis indicate reductions in survival before the Black Death, with significantly lower survival in the 13(th) century (Mantel Cox p < 0.001). Last, hazard analysis reveals increases in mortality rates before the Black Death. Together, these results suggest that health in general was declining in the 13(th) century, and this might have led to high mortality during the Black Death. This highlights the importance of considering human context to understand disease in past and living human populations. © 2015 Wiley Periodicals, Inc.
Prognostic value of body mass index before treatment for laryngeal squamous cell carcinoma
International Nuclear Information System (INIS)
Li, Zhao-Qu; Zou, Lan; Liu, Tian-Run; Yang, An-Kui
2015-01-01
Patients with head and neck cancer often suffer from malnutrition. This study aims to investigate the influence of body mass index (BMI) on the prognosis of laryngeal squamous cell carcinoma (LSCC). A total of 473 patients with LSCC initially treated at Sun Yat-sen University Cancer Center between January 2005 and July 2009 were retrospectively reviewed. Survival analysis was performed by the Kaplan-Meier method and Cox regression model. Low BMI before treatment was significantly associated with poor overall survival in patients with LSCC (P<0.001). BMI was an independent prognostic factor for patients with LSCC. Leanness before treatment was associated with poor prognosis in patients with LSCC. Good nutritional status is favorable to improve survival in patients with LSCC
Cholecystokinin in plasma predicts cardiovascular mortality in elderly females
DEFF Research Database (Denmark)
Gøtze, Jens P.; Rehfeld, Jens F; Alehagen, Urban
2016-01-01
BACKGROUND: Cholecystokinin (CCK) and gastrin are related gastrointestinal hormones with documented cardiovascular effects of exogenous administration. It is unknown whether measurement of endogenous CCK or gastrin in plasma contains information regarding cardiovascular mortality. METHODS......: Mortality risk was evaluated using Cox proportional hazard regression and Kaplan-Meier analyses. Elderly patients in a primary care setting with symptoms of cardiac disease, i.e. shortness of breath, peripheral edema, and/or fatigue, were evaluated (n=470). Primary care patients were followed for 13years...... information was obtained from 4th quartile gastrin concentrations on 5-year cardiovascular mortality risk. CONCLUSIONS: CCK in plasma is an independent marker of cardiovascular mortality in elderly female patients. The study thus introduces measurement of plasma CCK in gender-specific cardiovascular risk...
DEFF Research Database (Denmark)
Møller, Henrik; Coupland, Victoria H; Tataru, Daniela
2018-01-01
INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... to statistical adjustments for age, sex, socio-economic status, performance status and co-morbidity. CONCLUSION: The extent of use of different treatment modalities varies between geographical areas in England. These variations are not attributable to measurable patient and tumour characteristics, and more...
Fatigue, General Health, and Ischemic Heart Disease in Older Adults
DEFF Research Database (Denmark)
Ekmann, Anette; Petersen, Inge; Mänty, Minna Regina
2013-01-01
Backgrounds.Fatigue has been shown to predict ischemic heart disease (IHD) and mortality in nonsmoking middle-aged men free of cardiovascular disease. The aim of this study was to investigate the predictive value of fatigue for IHD and general health in nondisabled individuals free...... of cardiovascular disease and older than 70 years. METHODS: The study population was drawn from The Longitudinal Study of Aging Danish Twins. In total, 1,696 participants were followed up for 2-10 years by questionnaires and 10-16 years through registries. Kaplan Meier, Cox Proportional Hazard and logistic.......08-2.00) compared with participants without fatigue. CONCLUSION: We concluded that fatigue in nondisabled older adults free of cardiovascular disease is an early predictor for development of subsequent poor general health and IHD....
Smooth conditional distribution function and quantiles under random censorship.
Leconte, Eve; Poiraud-Casanova, Sandrine; Thomas-Agnan, Christine
2002-09-01
We consider a nonparametric random design regression model in which the response variable is possibly right censored. The aim of this paper is to estimate the conditional distribution function and the conditional alpha-quantile of the response variable. We restrict attention to the case where the response variable as well as the explanatory variable are unidimensional and continuous. We propose and discuss two classes of estimators which are smooth with respect to the response variable as well as to the covariate. Some simulations demonstrate that the new methods have better mean square error performances than the generalized Kaplan-Meier estimator introduced by Beran (1981) and considered in the literature by Dabrowska (1989, 1992) and Gonzalez-Manteiga and Cadarso-Suarez (1994).
International Nuclear Information System (INIS)
Wu, Jianing; Yan, Shaoze; Zuo, Ming J.
2016-01-01
Mechanism reliability is defined as the ability of a certain mechanism to maintain output accuracy under specified conditions. Mechanism reliability is generally assessed by the classical direct probability method (DPM) derived from the first order second moment (FOSM) method. The DPM relies strongly on the analytical form of the dynamic solution so it is not applicable to multi-body mechanisms that have only numerical solutions. In this paper, an indirect probability model (IPM) is proposed for mechanism reliability evaluation of multi-body mechanisms. IPM combines the dynamic equation, degradation function and Kaplan–Meier estimator to evaluate mechanism reliability comprehensively. Furthermore, to reduce the amount of computation in practical applications, the IPM is simplified into the indirect probability step model (IPSM). A case study of a crank–slider mechanism with clearance is investigated. Results show that relative errors between the theoretical and experimental results of mechanism reliability are less than 5%, demonstrating the effectiveness of the proposed method. - Highlights: • An indirect probability model (IPM) is proposed for mechanism reliability evaluation. • The dynamic equation, degradation function and Kaplan–Meier estimator are used. • Then the simplified form of indirect probability model is proposed. • The experimental results agree well with the predicted results.
Impact of Comorbidities on Tumor Necrosis Factor Inhibitor Therapy in Psoriatic Arthritis
DEFF Research Database (Denmark)
Ballegaard, Christine; Højgaard, Pil; Dreyer, Lene
2017-01-01
characteristics, disease activity and treatment response and persistence was obtained from the DANBIO registry. Information on comorbidities according to the Charlson Comorbidity Index (CCI) was obtained through linkage with the Danish National Patient Register. Kaplan-Meier plots and Cox proportional hazard...... compared with patients without comorbidities (hazard ratio 1.72, [1.26 to 2.37], p = 0.001). A smaller proportion of patients with a CCI score ≥ 2 achieved European League Against Rheumatism (EULAR) good response (p
Improve T Cell Therapy in Neuroblastoma
2015-09-01
bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and
Directory of Open Access Journals (Sweden)
Coco Claudio
2012-09-01
Full Text Available Abstract Background Expression levels of CD133, a cancer stem cell marker, and of the α-subunit of the dystroglycan (α-DG complex, have been previously reported to be altered in colorectal cancers. Methods Expression levels of CD133 and α-DG were assessed by immunohistochemistry in a series of colon cancers and their prognostic significance was evaluated. Results Scattered cells positive for CD133 were rarely detected at the bases of the crypts in normal colonic mucosa while in cancer cells the median percentage of positive cells was 5% (range 0–80. A significant correlation was observed with pT parameter and tumor stage but not with tumor grade and N status. Recurrence and death from disease were significantly more frequent in CD133-high expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor groups for both disease-free (p = 0.002 and overall (p = 0.008 survival. Expression of α-DG was reduced in a significant fraction of tumors but low α-DG staining did not correlate with any of the classical clinical-pathological parameters. Recurrence and death from the disease were significantly more frequent in α-DG-low expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor tumors for both disease-free (p = 0.02 and overall (p = 0.02 survival. Increased expression of CD133, but not loss of α-DG, confirmed to be an independent prognostic parameters at a multivariate analysis associated with an increased risk of recurrence (RR = 2.4; p = 0.002 and death (RR = 2.3; p = 0.003. Conclusions Loss of α-DG and increased CD133 expression are frequent events in human colon cancer and evaluation of CD133 expression could help to identify high-risk colon cancer patients.
International Nuclear Information System (INIS)
Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Fritz, P.
2000-01-01
Aim: To assess effect an toxicity of high-dose-rate afterloading (HDR) alone or in combination with external beam radiotherapy (EBRT) in centrally located tumors of the upper respiratory tract. Patients and Methods: From 1987 to 1996, 55 patients were treated. Twenty-one patients (group A1: 17 non-small-cell lung cancer [NSCLC], A2: 4 metastases from other malignancies) were treated using HDR alone due to a relapse after external beam irradiation. In 34 previously untreated and inoperable patients (group B1: 27 NSCLC, B2: 7 metastases from other malignancies) HDR was given as a boost after EBRT (30 to 60 Gy, median 50). HDR was carried out with a 192 Ir source (370 GBq). The brachytherapy dose (group A: 5 to 27 Gy, median 20; B: 10 to 20 Gy, median 15) was prescribed to 1 cm distance from the source axis. A distanciable applicator was used in 39/55 patients. Results: In group A1, a response rate (CR, PR) of 53% (group B1: 77%) was reached. The median survival (Kaplan-Meier) was 5 months in group A1 (B1: 20 months). The 1-, 3- and 5-year local progression free survival rates (Kaplan-Meier) were 66% (15%), 52% (0%), and 37% (0%) in group B1 (group A1). Prognostic favorable factors in group B1 were a tumor diameter 70. Grade-1 or 2 toxicity (RTOG/EORTC) occurred in 0% in group A and in 6% in group B. We observed no Grad-3 or 4 toxicity. Complications caused by persistent or progressive local disease occurred in 3 patients in goup A (fatal hemorrhage, tracheomediastinal fistula, hemoptysis) and in 2 patients in group B (fatal hemorrhage, hemoptysis). Conclusions: HDR brachytherapy is an effective treatment with moderate side effects. In combination with external beam irradiation long-term remissions can be reached in one third of the patients. (orig.) [de
Labhardt, Niklaus Daniel; Keiser, Olivia; Sello, Motlalepula; Lejone, Thabo Ishmael; Pfeiffer, Karolin; Davies, Mary-Ann; Egger, Matthias; Ehmer, Jochen; Wandeler, Gilles
2013-11-21
Lesotho was among the first countries to adopt decentralization of care from hospitals to nurse-led health centres (HCs) to scale up the provision of antiretroviral therapy (ART). We compared outcomes between patients who started ART at HCs and hospitals in two rural catchment areas in Lesotho. The two catchment areas comprise two hospitals and 12 HCs. Patients ≥16 years starting ART at a hospital or HC between 2008 and 2011 were included. Loss to follow-up (LTFU) was defined as not returning to the facility for ≥180 days after the last visit, no follow-up (no FUP) as not returning after starting ART, and retention in care as alive and on ART at the facility. The data were analysed using logistic regression, competing risk regression and Kaplan-Meier methods. Multivariable analyses were adjusted for sex, age, CD4 cell count, World Health Organization stage, catchment area and type of ART. All analyses were stratified by gender. Of 3747 patients, 2042 (54.5%) started ART at HCs. Both women and men at hospitals had more advanced clinical and immunological stages of disease than those at HCs. Over 5445 patient-years, 420 died and 475 were LTFU. Kaplan-Meier estimates for three-year retention were 68.7 and 69.7% at HCs and hospitals, respectively, among women (p=0.81) and 68.8% at HCs versus 54.7% at hospitals among men (phospitals among women (odds ratio (OR): 0.89, 95% confidence interval (CI): 0.73-1.09) and higher retention at HCs among men (OR: 1.53, 95% CI: 1.20-1.96). The latter result was mainly driven by a lower proportion of patients LTFU at HCs (OR: 0.68, 95% CI: 0.51-0.93). In rural Lesotho, overall retention in care did not differ significantly between nurse-led HCs and hospitals. However, men seemed to benefit most from starting ART at HCs, as they were more likely to remain in care in these facilities compared to hospitals.
The long-term outcomes of epilepsy surgery
Keller, Simon; Nicolson, Andrew; Biswas, Shubhabrata; Smith, David; Osman Farah, Jibril; Eldridge, Paul; Wieshmann, Udo
2018-01-01
Objective Despite modern anti-epileptic drug treatment, approximately 30% of epilepsies remain medically refractory and for these patients, epilepsy surgery may be a treatment option. There have been numerous studies demonstrating good outcome of epilepsy surgery in the short to median term however, there are a limited number of studies looking at the long-term outcomes. The aim of this study was to ascertain the long-term outcome of resective epilepsy surgery in a large neurosurgery hospital in the U.K. Methods This a retrospective analysis of prospectively collected data. We used the 2001 International League Against Epilepsy (ILAE) classification system to classify seizure freedom and Kaplan-Meier survival analysis to estimate the probability of seizure freedom. Results We included 284 patients who underwent epilepsy surgery (178 anterior temporal lobe resections, 37 selective amygdalohippocampectomies, 33 temporal lesionectomies, 36 extratemporal lesionectomies), and had a prospective median follow-up of 5 years (range 1–27). Kaplan-Meier estimates showed that 47% (95% CI 40–58) remained seizure free (apart from simple partial seizures) at 5 years and 38% (95% CI 31–45) at 10 years after surgery. 74% (95% CI 69–80) had a greater than 50% seizure reduction at 5 years and 70% (95% CI 64–77) at 10 years. Patients who had an amygdalohippocampectomy were more likely to have seizure recurrence than patients who had an anterior temporal lobe resection (p = 0.006) and temporal lesionectomy (p = 0.029). There was no significant difference between extra temporal and temporal lesionectomies. Hippocampal sclerosis was associated with a good outcome but declined in relative frequency over the years. Conclusion The vast majority of patients who were not seizure free experienced at least a substantial and long-lasting reduction in seizure frequency. A positive long-term outcome after epilepsy surgery is possible for many patients and especially those with
Energy Technology Data Exchange (ETDEWEB)
Alfke, H. [Klinikum Luedenscheid (Germany). Klinik fuer Diagnostische und Interventionelle Radiologie; Marburg Univ. (Germany). Klinik fuer Strahlendiagnostik; Vannucchi, A. [Marburg Univ. (Germany). Klinik fuer Strahlendiagnostik; Froelich, J.J. [Marburg Univ. (Germany). Klinik fuer Strahlendiagnostik; Klinikum Bad Hersfeld (Germany). Klinik fuer Radiologie und Nuklearmedizin; El-Sheik, M.; Wagner, H.J. [Marburg Univ. (Germany). Klinik fuer Strahlendiagnostik; Vivantes-Klinikum im Friedrichshain (Germany). Inst. fuer Radiologie und Interventionelle Therapie
2007-08-15
Purpose: To evaluate the technical success rate, procedure-related complications, and clinical long-term results for patients who underwent infrapopliteal angioplasty. Materials and Methods: We retrospectively evaluated all patients who underwent infrapopliteal angioplasty to treat critical chronic limb ischemia or severe claudication from 1/1997 to 12/1999. We excluded patients with acute (< 2 weeks) limb ischemia. Procedure-related data were prospectively documented in a database and analyzed with a focus on the technical success rate and procedure-related complications. In addition all clinical documents were analyzed, and a follow-up examination was performed or telephone interviews were conducted with patients, relatives and referring doctors for follow-up. The primary end points were the limb salvage rate and patient survival rate. The secondary end points included the complication rate, technical success rate, and walking distance. Results: 112 patients with a mean age of 72 years (41 women, 71 men) underwent crural angioplasty on 121 limbs. Four patients suffered from severe claudication (Rutherford category 3) and all others had critical chronic limb ischemia (category 4 to 6). The complication rate was 2.7 %. The technical success rate was 92 %. The ankle brachial index increased from 0.59 to 0.88. The mean walking distance increased significantly from 52 {+-} 66 to 284 {+-} 346 meters at the time of follow-up. The limb salvage rate was 83.6 % after one year and 81.1 % after three years. The mean survival rate according to Kaplan-Meier was 79.4 %, 69.2 %, and 54.2 % at 1, 2, and 3 years, respectively. Patients with at least one patent run-off vessel after angioplasty had a significantly better limb salvage rate. Diabetes was not a risk factor for limb salvage. Conclusion: Infrapopliteal angioplasty shows a high technical success rate with an acceptable complication rate. The clinical long-term success seems favorable if a least one open run-off vessel was
Onisko, Agnieszka; Druzdzel, Marek J; Austin, R Marshall
2016-01-01
Classical statistics is a well-established approach in the analysis of medical data. While the medical community seems to be familiar with the concept of a statistical analysis and its interpretation, the Bayesian approach, argued by many of its proponents to be superior to the classical frequentist approach, is still not well-recognized in the analysis of medical data. The goal of this study is to encourage data analysts to use the Bayesian approach, such as modeling with graphical probabilistic networks, as an insightful alternative to classical statistical analysis of medical data. This paper offers a comparison of two approaches to analysis of medical time series data: (1) classical statistical approach, such as the Kaplan-Meier estimator and the Cox proportional hazards regression model, and (2) dynamic Bayesian network modeling. Our comparison is based on time series cervical cancer screening data collected at Magee-Womens Hospital, University of Pittsburgh Medical Center over 10 years. The main outcomes of our comparison are cervical cancer risk assessments produced by the three approaches. However, our analysis discusses also several aspects of the comparison, such as modeling assumptions, model building, dealing with incomplete data, individualized risk assessment, results interpretation, and model validation. Our study shows that the Bayesian approach is (1) much more flexible in terms of modeling effort, and (2) it offers an individualized risk assessment, which is more cumbersome for classical statistical approaches.
International Nuclear Information System (INIS)
Rassart, E.; Paquette, Y.; Jolicoeur, P.
1988-01-01
The molecularly cloned infectious Kaplan radiation leukemia virus has previously been shown to be unable to replicate on mouse fibroblasts. To map the viral sequences responsible for this, we constructed chimeric viral DNA genomes in vitro with parental cloned infectious viral DNAs from the nonfibrotropic (F-) BL/VL3 V-13 radiation leukemia virus and the fibrotropic (F+) endogenous BALB/c or Moloney murine leukemia viruses (MuLV). Infectious chimeric MuLVs, recovered after transfection of Ti-6 lymphocytes with these recombinant DNAs, were tested for capacity to replicate on mouse fibroblasts in vitro. We found that chimeric MuLVs harboring the long terminal repeat (LTR) of a fibrotropic MuLV replicated well on mouse fibroblasts. Conversely, chimeric MuLVs harboring the LTR of a nonfibrotropic MuLV were restricted on mouse fibroblasts. These results indicate that the LTR of BL/VL3 radiation leukemia virus harbors the primary determinant responsible for its inability to replicate on mouse fibroblasts in vitro. Our results also show that the primary determinant allowing F+ MuLVs (endogenous BALB/c and Moloney MuLVs) to replicate on mouse fibroblasts in vitro resides within the LTR
Fractionated afterloading therapy in inoperable malignant tumours of the brain
International Nuclear Information System (INIS)
Sparenberg, A.
1987-01-01
With the advent of the method of afterloading the range of uses for fractionated interstitial brady-therapy could be broadened to include malignant cerebral tumours. The mean survival time of 33 female patients was calculated to be 8.3 months for the entire group and 11.3 months for cases not otherwise pretreated. Even though the age, tumour volume, target dose and Karnofsky index obviously tended to influence the survival time, such relationships could not be confirmed statistically. Using the method by Kaplan-Meier it was determined that 65% of the total study group were likely to survive beyond six months and 32% to survive for one year. A separate analysis of patients receiving no previous treatment showed these chances to be 75% and 44%, respectively. The advantages of this therapy are discussed on a comparative basis. (VHE) [de
International Nuclear Information System (INIS)
Hoppe, Bradford S.; Flampouri, Stella; Zaiden, Robert; Slayton, William; Sandler, Eric; Ozdemir, Savas; Dang, Nam H.; Lynch, James W.; Li, Zuofeng; Morris, Christopher G.; Mendenhall, Nancy P.
2014-01-01
Purpose: This study describes the early clinical outcomes of a prospective phase 2 study of consolidative involved-node proton therapy (INPT) as a component of combined-mode therapy in patients with stages I to III Hodgkin lymphoma (HL) with mediastinal involvement. Methods and Materials: Between September 2009 and June 2013, 15 patients with newly diagnosed HL received INPT after completing chemotherapy in an institutional review board-approved protocol comparing the dosimetric impact of PT with those of three-dimensional conformal radiation therapy (3DCRT) and intensity modulated RT. Based on 18 F-Fluorodeoxyglucose positron emission tomography/computed tomography ( 18 F-FDG PET/CT) response, 5 children received 15 to 25.5 cobalt Gy equivalent (CGE) of INPT after receiving 4 cycles of Adriamycin, Bleomycin, Vincristine, Etoposide, Prednisone, Cyclophosphamide or Vincristine, adriamycin, methotrexate, Prednisone chemotherapy, and 10 adults received 30.6 to 39.6 CGE of INPT after 3 to 6 cycles of Adriamycin, Bleomycine, Vinblastine, Dacarbazine. Patients were routinely evaluated for toxicity during and after treatment, using Common Terminology Criteria for Adverse Events, version 3.0, and for relapse by physical examination and routine imaging. Relapse-free survival (RFS) and event-free survival (EFS) rates were calculated using the Kaplan-Meier method from the time of diagnosis. Results: The median follow-up was 37 months (range, 26-55). Two events occurred during follow-up: 1 relapse (inside and outside the targeted field) and 1 transformation into a primary mediastinal large B cell lymphoma. The 3-year RFS rate was 93%, and the 3-year EFS rate was 87%. No acute or late grade 3 nonhematologic toxicities were observed. Conclusions: Although decades of follow-up will be needed to realize the likely benefit of PT in reducing the risk of radiation-induced late effects, PT following chemotherapy in patients with HL is well-tolerated, and disease outcomes were similar
Energy Technology Data Exchange (ETDEWEB)
Hoppe, Bradford S., E-mail: bhoppe@floridaproton.org [Radiation Oncology, University of Florida Proton Therapy Institute, Jacksonville, Florida (United States); Flampouri, Stella [Radiation Oncology, University of Florida Proton Therapy Institute, Jacksonville, Florida (United States); Zaiden, Robert [Department of Medicine, Division of Hematology and Oncology, University of Florida College of Medicine, Jacksonville, Florida (United States); Slayton, William [Department of Pediatrics, Division of Hematology and Oncology, University of Florida College of Medicine, Gainesville, Florida (United States); Sandler, Eric [Department of Pediatrics, Division of Hematology/Oncology Nemours Children' s Clinic, Jacksonville, Florida (United States); Ozdemir, Savas [Department of Radiology, Division of Functional and Molecular Imaging, University of Florida College of Medicine, Jacksonville, Florida (United States); Dang, Nam H.; Lynch, James W. [Department of Medicine, Division of Hematology and Oncology, University of Florida College of Medicine, Gainesville, Florida (United States); Li, Zuofeng; Morris, Christopher G.; Mendenhall, Nancy P. [Radiation Oncology, University of Florida Proton Therapy Institute, Jacksonville, Florida (United States)
2014-08-01
Purpose: This study describes the early clinical outcomes of a prospective phase 2 study of consolidative involved-node proton therapy (INPT) as a component of combined-mode therapy in patients with stages I to III Hodgkin lymphoma (HL) with mediastinal involvement. Methods and Materials: Between September 2009 and June 2013, 15 patients with newly diagnosed HL received INPT after completing chemotherapy in an institutional review board-approved protocol comparing the dosimetric impact of PT with those of three-dimensional conformal radiation therapy (3DCRT) and intensity modulated RT. Based on {sup 18}F-Fluorodeoxyglucose positron emission tomography/computed tomography ({sup 18}F-FDG PET/CT) response, 5 children received 15 to 25.5 cobalt Gy equivalent (CGE) of INPT after receiving 4 cycles of Adriamycin, Bleomycin, Vincristine, Etoposide, Prednisone, Cyclophosphamide or Vincristine, adriamycin, methotrexate, Prednisone chemotherapy, and 10 adults received 30.6 to 39.6 CGE of INPT after 3 to 6 cycles of Adriamycin, Bleomycine, Vinblastine, Dacarbazine. Patients were routinely evaluated for toxicity during and after treatment, using Common Terminology Criteria for Adverse Events, version 3.0, and for relapse by physical examination and routine imaging. Relapse-free survival (RFS) and event-free survival (EFS) rates were calculated using the Kaplan-Meier method from the time of diagnosis. Results: The median follow-up was 37 months (range, 26-55). Two events occurred during follow-up: 1 relapse (inside and outside the targeted field) and 1 transformation into a primary mediastinal large B cell lymphoma. The 3-year RFS rate was 93%, and the 3-year EFS rate was 87%. No acute or late grade 3 nonhematologic toxicities were observed. Conclusions: Although decades of follow-up will be needed to realize the likely benefit of PT in reducing the risk of radiation-induced late effects, PT following chemotherapy in patients with HL is well-tolerated, and disease outcomes
Energy Technology Data Exchange (ETDEWEB)
Kessler, P.; Bloch-Birkholz, A.; Neukam, F.W. [Erlangen-Nuernberg Univ., Erlangen (Germany). Klinik und Poliklinik fuer Mund-, Kiefer-, Gesichtschirurgie; Grabenbauer, G.; Sauer, R. [Erlangen-Nuernberg Univ., Erlangen (Germany). Klinik und Poliklinik fuer Strahlentherapie; Leher, A. [Erlangen-Nuernberg Univ., Erlangen (Germany). Inst. fuer Medizininformatik, Biometrie und Epidemiologie; Vairaktaris, E. [Univ. of Athens Medical School (Greece). Dept. of Maxillofacial Surgery
2007-04-15
Background and Purpose: In recent years, different concepts for the treatment of oral squamous cell carcinomas (OSCC) have been developed; these include preoperative simultaneous neoadjuvant radiochemotherapy and one-stage surgery with tumor ablation and reconstruction. When considering long-term survival, there is substantial evidence that multimodality treatment based on a neoadjuvant radiochemotherapy is superior to adjuvant therapy concepts based on a surgical approach with postoperative irradiation. The aim of this study was to discuss the 5-year survival rate in a neoadjuvant and an adjuvant combination treatment in patients with primary OSCC. Patients and Methods: This nonrandomized longitudinal study prospectively evaluates the long-term tumor-free survival in 128 patients with oral cancer. Two groups consisting of 74 neoadjuvantly and 54 primarily surgically treated patients were formed. 99 patients suffered from stage III and IV disease according to the UICC criteria. Long-term survival was estimated according to the Kaplan-Meier assumption. Results: The neoadjuvant treatment increases the prospect of a long-term tumor-free survival. According to Kaplan-Meier assumption the estimation for a 5-year tumor-free survival in OSCC in category T1 is 83.1% in neoadjuvant, and 70.1% in adjuvant treatment, in T2 79.6% and 57.7%, in T3 68.2% and 33.2%, in T4 51.4% and 30.5%, respectively. Significance (p < 0.05) could be proven for T1 (p = 0.002), T2 (p = 0.028), and T4 (p < 0.0001) tumors. The effectiveness of the preoperative radiochemotherapy was demonstrated in the pathohistological result of tumor-free resection specimens in 28 patients of the neoadjuvant treatment group (37.8%). On the other hand, four patients died during the preoperative combination therapy. 64.8% of the patients in the adjuvant and 71.6% in the neoadjuvant treatment group survived the observation period. Conclusion: Neoadjuvant therapy is highly effective and results in a better 5-year
Energy Technology Data Exchange (ETDEWEB)
Alfke, H.; Alfke, B.; Froelich, J.J.; Klose, K.J.; Wagner, H.J. [Klinik fuer Strahlendiagnostik Philipps Univ. Marburg (Germany)
2003-08-01
Purpose: To analyze outcome and predictive factors for patient survival and patency rates of unresectable malignant biliary obstruction treated with percutaneous transhepatic insertion of metal stents. Materials and Methods: This is a retroselective analysis of 130 patients treated in one interventional radiological center with data collected from patient records and by telephone interviews. The procedure-related data had been prospectively documented in a computer data base. The Kaplan-Meier analysis was performed for univariate and multivariate comparison of survival and patency rates with the log-rank test used for different tumor types. Predictive factors for survival and 30-day mortality were analyzed by a stepwise logistic regression. Results: Underlying causes of malignant biliary obstructions were cholangiocarcinoma in 50, pancreatic carcinoma in 29, liver metastases in 27, gallbladder carcinoma in 20, and other tumors in 4 patients. The technical success rate was 99%, the complication rate 27% and the 30-day mortality 11%. Primary patency rates (406 days with a median of 207 days) did not differ significantly for different tumor types. The survival rates were significantly (p = 0.03 by log-rank test) better for patients with cholangiocarcinoma than for patients with pancreatic carcinoma and liver metastases. Multiple regression analysis revealed no predictive factor for patient survival and 30-day mortality. Conclusion: Percutaneous transhepatic insertion of metal biliary endoprostheses offers a good initial and long-term relief of jaundice caused by malignant biliary obstruction. Although survival rates for patients with cholangiocarcinoma are better than for other causes of malignant biliary obstruction, a clear predictive factor is lacking for patients undergoing palliative biliary stent insertion. (orig.) [German] Ziel: Ergebnisse der perkutanen transhepatischen Metallendoprothesenimplantation bei malignen Gallenwegsverschluessen zu evaluieren und
Energy Technology Data Exchange (ETDEWEB)
Lin, Y.C.; Lee, J.C.; Huang, Y.S. [Dept. of Veterinary Medicine, National Chung-Hsing Univ., Taichung (Taiwan); Dept. of Nuclear Medicine (Taiwan); Tsai, S.C. [Show Chwan Memorial Hospital (Taiwan); Hung, G.U. [Changhua Christian Hospital, Changhua (Taiwan); Lin, W.Y. [Taichung Veterans General Hospital, Taichung (Taiwan)
2005-07-01
The aim of this study was to compare the therapeutic efficacies of direct intratumoural injection of {sup 188}Re microspheres (DIRM) and direct intratumoural injection of ethanol (DIE) in rabbits bearing liver tumours. Materials and methods: Fifteen rabbits bearing liver tumours were divided into three groups: group 1 received DIE, group 2 received DIRM, and group 3 (control) received saline. Tumour size was measured by liver sonography before injection, as well as 2, 4, 8, and 12 weeks after injection. Survival time was calculated from the day of treatment to three months after treatment by Kaplan-Meier survival analysis. Results: The mean survival time was 68{+-}9.8 days for the rabbits in the DIRM group, 55.8{+-}11.8 days for the DIE group, and 38.8{+-}6.2 days for the control group. Conclusion: The rabbits survived longer in the DIRM group than in the DIE group although there is no statistical significance. We believe the DIRM method has a good potential to be an alternative to DIE for the treatment of liver tumours. (orig.)
Directory of Open Access Journals (Sweden)
Shingo Hatakeyama
2012-01-01
Full Text Available The oral adsorbent AST-120 has the potential to delay dialysis initiation and improve survival of patients on dialysis. We evaluated the effect of AST-120 on dialysis initiation and its potential to improve survival in patients with chronic kidney disease. The present retrospective pair-matched study included 560 patients, grouped according to whether or not they received AST-120 before dialysis (AST-120 and non-AST-120 groups. The cumulative dialysis initiation free rate and survival rate were compared by the Kaplan-Meier method. Multivariate analysis was used to determine the impact of AST-120 on dialysis initiation. Our results showed significant differences in the 12- and 24-month dialysis initiation free rate (P<0.001, although no significant difference was observed in the survival rate between the two groups. In conclusion, AST-120 delays dialysis initiation in chronic kidney disease (CKD patients but has no effect on survival. AST-120 is an effective therapy for delaying the progression of CKD.
DEFF Research Database (Denmark)
Wild, J B; Stather, P W; Biancari, F
2013-01-01
of patients with screening detected sub aneurysmal aortic dilatation. DESIGN AND METHODS: Individual patient data was obtained from 8 screening programmes that had performed long term follow up of patients with sub aneurysmal aortic dilatation. Outcome measures recorded were the progression to true aneurysmal...... dilatation (aortic diameter 30 mm or greater), progression to size threshold for surgical intervention (55 mm) and aneurysm rupture. RESULTS: Aortic measurements for 1696 men and women (median age 66 years at initial scan) with sub-aneurysmal aortae were obtained, median period of follow up was 4.0 years...... (range 0.1-19.0 years). Following Kaplan Meier and life table analysis 67.7% of patients with 5 complete years of surveillance reached an aortic diameter of 30 mm or greater however 0.9% had an aortic diameter of 54 mm. A total of 26.2% of patients with 10 complete years of follow up had an AAA...
Survival of a cohort of women with cervical cancer diagnosed in a Brazilian cancer center
Directory of Open Access Journals (Sweden)
Claudio Calazan do Carmo
2011-08-01
Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (p<0.001. There was seen a dose-response relationship between mortality and clinical staging, ranging from 27.8 to 749.6 per 1,000 cases-year in women stage I and IV, respectively. CONCLUSIONS: The study showed that early detection through prevention programs is crucial to increase cervical cancer survival.
Oncologic safety of cervical nerve preservation in neck dissection for head and neck cancer.
Honda, Keigo; Asato, Ryo; Tsuji, Jun; Miyazaki, Masakazu; Kada, Shinpei; Tsujimura, Takashi; Kataoka, Michiko
2017-09-01
Although the functional merits of preserving cervical nerves in neck dissection for head and neck cancer have been reported, the oncologic safety has not yet been determined. Therefore, the purpose of this study was to evaluate the safety of cervical nerve preservation. A retrospective chart review was performed on patients with head and neck cancer who had been treated by neck dissection between 2009 and 2014 at Kyoto Medical Center. Management of cervical nerves and clinical results were analyzed. A total of 335 sides of neck dissection had been performed in 222 patients. Cervical nerves were preserved in 175 neck sides and resected in 160 sides. The 5-year overall survival (OS) rate calculated by the Kaplan-Meier method was 71%. The 5-year neck control rate was 95% in cervical nerve preserved sides and 89% in cervical nerve resected sides. Preserving cervical nerves in neck dissection is oncologically safe in selected cases. © 2017 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Legarth, Rebecca; Omland, Lars H; Dalton, Susanne O
2015-01-01
-infected individuals diagnosed (without intravenous drug abuse or hepatitis C infection) (n = 3205), and a background population cohort matched by age, gender, and country of birth (n = 22 435) were analyzed. Educational level (low or high) and cancer events were identified in Danish national registers. Cumulative...... incidences, incidence rate ratios (IRRs), and survival using Kaplan-Meier methods were estimated. RESULTS: Low educational level was associated with increased risk of cancer among HIV-infected individuals compared to population controls: all (adjusted-IRRs: 1.4 [95% confidence interval {CI}, 1.1-1.7] vs 1.......1 [95% CI, .9-1.2]), tobacco- and alcohol-related (2.1 [95% CI, 1.3-3.4] vs 1.3 [95% CI, 1.1-1.6]), and other (1.7 [95% CI, 1.1-2.8] vs 0.9 [95% CI, .7-1.0]). Educational level was not associated with infection-related or ill-defined cancers. One-year-survival was not associated with educational level...
Xing, Xiaofang; Du, Hong; Zhou, Chunlian; Zhang, Qingyun; Hao, Chunyi; Wen, Xianzi; Ji, Jiafu
2016-01-01
Background Lysosome-associated transmembrane-4 beta (LAPTM4B) is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients. Method Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort), 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher’s exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model. Results LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts). LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045). Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS) in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively), but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively). Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR) = 0.432; 95% confidence interval (CI) = 0.243–0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638–1.804 and 0.998, HR = 1.000, 95% CI = 0.663–1.530, respectively). Conclusion These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might
Salazar-Ospina, Andrea; Amariles, Pedro; Hincapié-García, Jaime A; González-Avendaño, Sebastián; Benjumea, Dora M; Faus, Maria José; Rodriguez, Luis F
2017-01-01
Bipolar I disorder (BD-I) is a chronic illness characterized by relapses alternating with periods of remission. Pharmacists can contribute to improved health outcomes in these patients through pharmaceutical care in association with a multidisciplinary health team; however, more evidence derived from randomized controlled trials (RCTs) is needed to demonstrate the effect of pharmaceutical care on patients with BD-I. To assess the effectiveness of a pharmaceutical intervention using the Dader Method on patients with BD-I, measured by the decrease in the number of hospitalizations, emergency service consultations, and unscheduled outpatient visits from baseline through 1 year of follow-up. This study is based on the EMDADER-TAB trial, which was an RCT designed to compare pharmaceutical care with the usual care given to outpatients with BD-I in a psychiatric clinic. The main outcome was the use of health care services, using Kaplan-Meier methods and Cox regression. The trial protocol was registered in ClinicalTrials.gov (Identifier NCT01750255). 92 patients were included in the EMDADER-TAB study: 43 pharmaceutical care patients (intervention group) and 49 usual care patients (control group). At baseline, no significant differences in demographic and clinical characteristics were found across the 2 groups. After 1 year of follow-up, the risk of hospitalizations and emergencies was higher for the control group than for the intervention group (HR = 9.03, P = 0.042; HR = 3.38, P = 0.034, respectively); however, the risk of unscheduled outpatient visits was higher for the intervention group (HR = 4.18, P = 0.028). There was no "placebo" treatment, and patients in the control group might have produced positive outcomes and reduced the magnitude of differences compared with the intervention group. Compared with usual care, pharmaceutical care significantly reduced hospitalizations and emergency service consultations by outpatients with BD-I. This study received funding from
Energy Technology Data Exchange (ETDEWEB)
Salavati, Ali [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); University of Minnesota, Department of Radiology, Minneapolis, MN (United States); Duan, Fenghai [Brown University School of Public Health, Department of Biostatistics and Center for Statistical Sciences, Providence, RI (United States); Snyder, Bradley S. [Brown University School of Public Health, Center for Statistical Sciences, Providence, RI (United States); Wei, Bo [Emory University, Department of Biostatistics, Rollins School of Public Health, Atlanta, GA (United States); Houshmand, Sina; Alavi, Abass [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Khiewvan, Benjapa [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Mahidol University, Division of Nuclear Medicine, Department of Radiology, Faculty of Medicine Siriraj Hospital, Bangkok (Thailand); Opanowski, Adam [ACR Center for Research and Innovation, American College of Radiology, Philadelphia, PA (United States); Simone, Charles B. [University of Maryland Medical Center, Department of Radiation Oncology, Baltimore, MD (United States); Siegel, Barry A. [Washington University School of Medicine, Mallinckrodt Institute of Radiology and the Alvin J. Siteman Cancer Center, St, Louis, MO (United States); Machtay, Mitchell [Case Western Reserve University and University Hospitals Case Medical Center, Department of Radiation Oncology, Cleveland, OH (United States)
2017-11-15
In recent years, multiple studies have demonstrated the value of volumetric FDG-PET/CT parameters as independent prognostic factors in patients with non-small cell lung cancer (NSCLC). We aimed to determine the optimal cut-off points of pretreatment volumetric FDG-PET/CT parameters in predicting overall survival (OS) in patients with locally advanced NSCLC and to recommend imaging biomarkers appropriate for routine clinical applications. Patients with inoperable stage IIB/III NSCLC enrolled in ACRIN 6668/RTOG 0235 were included. Pretreatment FDG-PET scans were quantified using semiautomatic adaptive contrast-oriented thresholding and local-background partial-volume-effect-correction algorithms. For each patient, the following indices were measured: metabolic tumor volume (MTV), total lesion glycolysis (TLG), SUVmax, SUVmean, partial-volume-corrected TLG (pvcTLG), and pvcSUVmean for the whole-body, primary tumor, and regional lymph nodes. The association between each index and patient outcome was assessed using Cox proportional hazards regression. Optimal cut-off points were estimated using recursive binary partitioning in a conditional inference framework and used in Kaplan-Meier curves with log-rank testing. The discriminatory ability of each index was examined using time-dependent receiver operating characteristic (ROC) curves and corresponding area under the curve (AUC(t)). The study included 196 patients. Pretreatment whole-body and primary tumor MTV, TLG, and pvcTLG were independently prognostic of OS. Optimal cut-off points were 175.0, 270.9, and 35.5 cm{sup 3} for whole-body TLG, pvcTLG, and MTV, and were 168.2, 239.8, and 17.4 cm{sup 3} for primary tumor TLG, pvcTLG, and MTV, respectively. In time-dependent ROC analysis, AUC(t) for MTV and TLG were uniformly higher than that of SUV measures over all time points. Primary tumor and whole-body parameters demonstrated similar patterns of separation for those patients above versus below the optimal cut
Trends in study design and the statistical methods employed in a leading general medicine journal.
Gosho, M; Sato, Y; Nagashima, K; Takahashi, S
2018-02-01
Study design and statistical methods have become core components of medical research, and the methodology has become more multifaceted and complicated over time. The study of the comprehensive details and current trends of study design and statistical methods is required to support the future implementation of well-planned clinical studies providing information about evidence-based medicine. Our purpose was to illustrate study design and statistical methods employed in recent medical literature. This was an extension study of Sato et al. (N Engl J Med 2017; 376: 1086-1087), which reviewed 238 articles published in 2015 in the New England Journal of Medicine (NEJM) and briefly summarized the statistical methods employed in NEJM. Using the same database, we performed a new investigation of the detailed trends in study design and individual statistical methods that were not reported in the Sato study. Due to the CONSORT statement, prespecification and justification of sample size are obligatory in planning intervention studies. Although standard survival methods (eg Kaplan-Meier estimator and Cox regression model) were most frequently applied, the Gray test and Fine-Gray proportional hazard model for considering competing risks were sometimes used for a more valid statistical inference. With respect to handling missing data, model-based methods, which are valid for missing-at-random data, were more frequently used than single imputation methods. These methods are not recommended as a primary analysis, but they have been applied in many clinical trials. Group sequential design with interim analyses was one of the standard designs, and novel design, such as adaptive dose selection and sample size re-estimation, was sometimes employed in NEJM. Model-based approaches for handling missing data should replace single imputation methods for primary analysis in the light of the information found in some publications. Use of adaptive design with interim analyses is increasing
Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei
2017-04-01
The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.
Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G
2006-10-01
Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.
Locke, S; Osborne, M; O'Rourke, P
2011-02-01
The objective of this paper is to measure the clinical course (months) in young athletes with persistent fatigue and to identify any covariates affecting the duration of recovery. This was a prospective longitudinal study of 68 athletes; 87% were elite (42 males, 26 females), aged 20.5±3.74 years (SD), who presented with the symptom of persistent fatigue. The collective duration to full clinical recovery was estimated using Kaplan-Meier product-limit curves, and covariates associated with prolonging recovery were identified from Cox proportional hazard models. The median recovery was 5 months (range 1-60 months). The range of presenting symptom duration was 0.5-36 months. The covariates identified were an increased duration of presenting symptoms [hazard ratio (HR), 1.06; 95% confidence interval (CI), 1.02-1.12; P=0.005] and the response of serum cortisol concentration to a standard exercise challenge (HR, 1.92; 95% CI, 1.09-3.38; P=0.03). Delay in recovery was not associated with categories of fatigue that included medical, training-related diagnoses, or other causes. In conclusion, the fatigued athlete represents a significant clinical problem with a median recovery of 5 months, whose collective clinical course to recovery can be estimated by Kaplan-Meier curves and appears to be a continuum. © 2009 John Wiley & Sons A/S.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
International Nuclear Information System (INIS)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao
2017-01-01
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
Stent placement with the monorail technique for treatment of mesenteric artery stenosis.
Schaefer, Philipp J; Schaefer, Fritz K W; Hinrichsen, Holger; Jahnke, Thomas; Charalambous, Nikolas; Heller, Martin; Mueller-Huelsbeck, Stefan
2006-04-01
To analyze the immediate and midterm success of stenting of mesenteric arteries by a monorail technique in patients with chronic mesenteric ischemia. In this prospective case series, 19 patients (11 male, 8 female; mean age, 62.9 +/- 10.4 y; range, 36-82 y) with 23 symptomatic stenoses of mesenteric arteries were treated with stent placement by a monorail technique in a radiologic intervention center over a period of 4.5 years. Clinical examinations and duplex sonography were used to evaluate the stents' patency and clinical success. Kaplan-Meier graphs were calculated to analyze the patency and freedom-from-symptom rate. Initial technical success rate was 22/23 (96%). Mean follow-up was 17 months (range, 1-58 mo). Primary patency and primary clinical success rates were 82% and 78%, respectively. According to Kaplan-Meier tables, the patency rates were 96%, 87%, 76%, and 61% at 0, 1, 15, and 24 months, respectively, and the freedom-from-symptom rates were 95%, 90%, 72%, and 54% at 0, 1, 24, and 30 months, respectively. No peri-interventional complications occurred. Two patients died of cardiac failure in the hospital within 30 days after intervention; deaths were not related to the intervention. Stent placement by a monorail technique in mesenteric arteries is an effective and safe treatment for symptomatic stenoses in patients with chronic mesenteric ischemia after a mean follow-up of 17 months.
Charoenrook, Victor; Michael, Ralph; de la Paz, Maria Fideliz; Temprano, José; Barraquer, Rafael I
2018-04-01
To compare the anatomical and the functional results between osteo-odonto-keratoprosthesis (OOKP) and keratoprosthesis using tibial bone autograft (Tibial bone KPro). We reviewed the charts of 258 patients; 145 had OOKP whereas 113 had Tibial bone KPro implanted. Functional success was defined as best corrected visual acuity ≥0.05 on decimal scale and anatomical success as retention of the keratoprosthesis lamina. Kaplan-Meier survival curves were calculated for anatomical and functional survival as well as to estimate the probability of post-op complications. The anatomical survival for both KPro groups was not significantly different and was estimated as 67% for OOKP and 54% for Tibial bone KPro at 10 years after surgery. There was also no difference found after subdividing for primary diagnosis groups such as chemical injury, thermal burn, trachoma and all autoimmune cases combined. Estimated functional survival at 10 years post-surgery was 49% for OOKP and 25% for Tibial bone KPro, which was significantly different. The probability of patients with Tibial bone KPro developing one or more post-operative complications at 10 years after surgery (65%) was significantly higher than those with OOKP (40%). Mucous membrane necrosis and retroprosthetic membrane formation were more common in Tibial bone KPro than OOKP. Both types of autologous biological KPro, OOKP and Tibial bone KPro, had statistically similar rate of keratoprosthesis extrusion. Although functional success rate was significantly higher in OOKP, it may have been influenced by a better visual potential in the patients in this group. Copyright © 2018 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Strnad, Vratislav; Lotter, Michael; Kreppner, Stephan; Fietkau, Rainer [University Hospital Erlangen, Dept. of Radiation Oncology, Erlangen (Germany)
2015-01-10
To assess the long-term results of protocol-based interstitial pulsed-dose-rate (PDR) brachytherapy as reirradiation combined with simultaneous chemotherapy and interstitial hyperthermia in selected patients with recurrent head and neck tumors. A total of 104 patients with biopsy-proven recurrent head and neck cancer were treated with interstitial PDR brachytherapy. Salvage surgery had also been undergone by 53/104 (51 %) patients (R1 or R2 resection in > 80 % of patients). Salvage brachytherapy alone was administered in 81 patients (78 %), with a median total dose of 56.7 Gy. Salvage brachytherapy in combination with external beam radiotherapy (EBRT) was performed in 23/104 patients (32 %), using a median total dose of D{sub REF} = 24 Gy. Simultaneously to PDR brachytherapy, concomitant chemotherapy was administered in 58/104 (55.8 %) patients. A single session of interstitial hyperthermia was also used to treat 33/104 (31.7 %) patients. The analysis was performed after a median follow-up of 60 months. Calculated according to Kaplan-Meier, local tumor control rates after 2, 5, and 10 years were 92.5, 82.4, and 58.9 %, respectively. Comparing results of salvage PDR brachytherapy with or without simultaneous chemotherapy, the 10-year local control rates were 76 vs. 39 % (p= 0014), respectively. No other patient- or treatment-related parameters had a significant influence on treatment results. Soft tissue necrosis or bone necrosis developed in 18/104 (17.3 %) and 11/104 (9.6 %) patients, respectively, but only 3 % of patients required surgical treatment. PDR interstitial brachytherapy with simultaneous chemotherapy is a very effective and, in experienced hands, also a safe treatment modality in selected patients with head and neck cancer in previously irradiated areas. (orig.) [German] Es erfolgte die Analyse der Langzeitergebnisse einer protokollbasierten interstitiellen Brachytherapie (Re-Bestrahlung) mit simultaner Chemotherapie und interstitieller Hyperthermie
Energy Technology Data Exchange (ETDEWEB)
Santarelli, M.; Raffetto, N.; Torcia, P.; Vitturini, A.; Tombolini, V.; Maurizi Enrici, R. [Istituto di radiologia Universita Roma ' ' La Sapienza' ' , Rome (Italy)
1999-11-01
Purpose: this study was undertaken to evaluate the efficacy of two regimens of chemoradiotherapy in the treatment of locally advanced head and neck cancer. Methods: from 1992 to 1997, 127 patients with locally advanced head and neck cancer (stage III-IV) were randomized. Sixty-six patients (group a), 42 male and 24 female, with a median age of 48 years (range 40-72) received during radiotherapy two courses (1.-6. week) of chemotherapy with carbo-platin (300 mg/m{sup 2} day 1) and etoposide (60 mg/m{sup 2} days 1 to 3). Sixty-one patients (group b), 40 male and 21 female, with a median age of 51 years (range 42-69) received two cycles of chemotherapy with 5 FU (750 mg/m{sup 2} days 1 to 5) and MIT C ( 10 mg/m{sup 2} day 1). The median dose of radiotherapy was 60 Gy (range 55-66 Gy) 180 cGy /d 5w. Results: the actuarial five-year survival rate(Kaplan-Meier) was 38 % for group a (CBDCA+etoposide+RT) and 25 % for group b (5FU+MIT C+RT). The difference was statistically significant (p = 0.036). Toxicity group a: mucositis G III in 41 patients and G IV in 16; dysphagia G III in 46 patients and IV in 5; leukopenia in 24 patients; 28 patients required nutritional therapy. Toxicity group b: mucositis G III in 38 patients and G IV in 17; dysphagia G III in 48 patients and G IV in 3; leukopenia in 23 patients; 25 patients needed nutritional therapy. Conclusions: the data of the actuarial survival five-year rate suggest that concomitant chemotherapy in group a (CBDCA+etoposide+RT) is better than the concomitant chemotherapy in group b (5FU+MIT C+RT). (author)
Energy Technology Data Exchange (ETDEWEB)
Turaka, Aruna [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Buyyounouski, Mark K., E-mail: mark.buyyounouski@fccc.edu [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Hanlon, Alexandra L. [School of Nursing, University of Pennsylvania, Philadelphia, PA (United States); Horwitz, Eric M. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Greenberg, Richard E. [Department of Surgery, Fox Chase Cancer Center, Philadelphia, PA (United States); Movsas, Benjamin [Department of Radiation Oncology, Henry Ford Hospital, Detroit, MI (United States)
2012-03-01
Purpose: To correlate tumor oxygenation status with long-term biochemical outcome after prostate brachytherapy. Methods and Materials: Custom-made Eppendorf PO{sub 2} microelectrodes were used to obtain PO{sub 2} measurements from the prostate (P), focused on positive biopsy locations, and normal muscle tissue (M), as a control. A total of 11,516 measurements were obtained in 57 men with localized prostate cancer immediately before prostate brachytherapy was given. The Eppendorf histograms provided the median PO{sub 2}, mean PO{sub 2}, and % <5 mm Hg or <10 mm Hg. Biochemical failure (BF) was defined using both the former American Society of Therapeutic Radiation Oncology (ASTRO) (three consecutive raises) and the current Phoenix (prostate-specific antigen nadir + 2 ng/mL) definitions. A Cox proportional hazards regression model evaluated the influence of hypoxia using the P/M mean PO{sub 2} ratio on BF. Results: With a median follow-up time of 8 years, 12 men had ASTRO BF and 8 had Phoenix BF. On multivariate analysis, P/M PO{sub 2} ratio <0.10 emerged as the only significant predictor of ASTRO BF (p = 0.043). Hormonal therapy (p = 0.015) and P/M PO{sub 2} ratio <0.10 (p = 0.046) emerged as the only independent predictors of the Phoenix BF. Kaplan-Meier freedom from BF for P/M ratio <0.10 vs. {>=}0.10 at 8 years for ASTRO BF was 46% vs. 78% (p = 0.03) and for the Phoenix BF was 66% vs. 83% (p = 0.02). Conclusions: Hypoxia in prostate cancer (low mean P/M PO{sub 2} ratio) significantly predicts for poor long-term biochemical outcome, suggesting that novel hypoxic strategies should be investigated.
International Nuclear Information System (INIS)
Crispo, Anna; Esposito, Emanuela; Amore, Alfonso; Di Bonito, Maurizio; Botti, Gerardo; Montella, Maurizio; Barba, Maddalena; D’Aiuto, Giuseppe; De Laurentiis, Michelino; Grimaldi, Maria; Rinaldo, Massimo; Caolo, Giuseppina; D’Aiuto, Massimiliano; Capasso, Immacolata
2013-01-01
Stage shift is widely considered a major determinant of the survival benefit conferred by breast cancer screening. However, factors and mechanisms underlying such a prognostic advantage need further clarification. We sought to compare the molecular characteristics of screen detected vs. symptomatic breast cancers and assess whether differences in tumour biology might translate into survival benefit. In a clinical series of 448 women with operable breast cancer, the Kaplan-Meier method and the log-rank test were used to estimate the likelihood of cancer recurrence and death. The Cox proportional hazard model was used for the multivariate analyses including mode of detection, age at diagnosis, tumour size, and lymph node status. These same models were applied to subgroups defined by molecular subtypes. Screen detected breast cancers tended to show more favourable clinicopathological features and survival outcomes compared to symptomatic cancers. The luminal A subtype was more common in women with mammography detected tumours than in symptomatic patients (68.5 vs. 59.0%, p=0.04). Data analysis across categories of molecular subtypes revealed significantly longer disease free and overall survival for screen detected cancers with a luminal A subtype only (p=0.01 and 0.02, respectively). For women with a luminal A subtype, the independent prognostic role of mode of detection on recurrence was confirmed in Cox proportional hazard models (p=0.03). An independent role of modality of detection on survival was also suggested (p=0.05). Molecular subtypes did not substantially explain the differences in survival outcomes between screened and symptomatic patients. However, our results suggest that molecular profiles might play a role in interpreting such differences at least partially. Further studies are warranted to reinterpret the efficacy of screening programmes in the light of tumour biology
International Nuclear Information System (INIS)
Santarelli, M.; Raffetto, N.; Torcia, P.; Vitturini, A.; Tombolini, V.; Maurizi Enrici, R.
1999-01-01
Purpose: this study was undertaken to evaluate the efficacy of two regimens of chemoradiotherapy in the treatment of locally advanced head and neck cancer. Methods: from 1992 to 1997, 127 patients with locally advanced head and neck cancer (stage III-IV) were randomized. Sixty-six patients (group a), 42 male and 24 female, with a median age of 48 years (range 40-72) received during radiotherapy two courses (1.-6. week) of chemotherapy with carbo-platin (300 mg/m 2 day 1) and etoposide (60 mg/m 2 days 1 to 3). Sixty-one patients (group b), 40 male and 21 female, with a median age of 51 years (range 42-69) received two cycles of chemotherapy with 5 FU (750 mg/m 2 days 1 to 5) and MIT C ( 10 mg/m 2 day 1). The median dose of radiotherapy was 60 Gy (range 55-66 Gy) 180 cGy /d 5w. Results: the actuarial five-year survival rate (Kaplan-Meier) was 38 % for group a (CBDCA+etoposide+RT) and 25 % for group b (5FU+MIT C+RT). The difference was statistically significant (p = 0.036). Toxicity group a: mucositis G III in 41 patients and G IV in 16; dysphagia G III in 46 patients and IV in 5; leukopenia in 24 patients; 28 patients required nutritional therapy. Toxicity group b: mucositis G III in 38 patients and G IV in 17; dysphagia G III in 48 patients and G IV in 3; leukopenia in 23 patients; 25 patients needed nutritional therapy. Conclusions: the data of the actuarial survival five-year rate suggest that concomitant chemotherapy in group a (CBDCA+etoposide+RT) is better than the concomitant chemotherapy in group b (5FU+MIT C+RT). (author)
Directory of Open Access Journals (Sweden)
Claudio Calazan do Carmo
2011-08-01
Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (pOBJETIVO: Evaluar la sobrevida global de mujeres con cáncer de cuello uterino e identificar factores pronósticos relacionados. MÉTODOS: Todos los 3.341 casos tratados en el Instituto Nacional de Cáncer, Rio de Janeiro, Sureste de Brasil, entre 1999 y 2004 fueron seleccionados y sus datos clínicos, anatomo-patológicos y de seguimiento fueron colectados. Se utilizaron la curva de Kaplan-meier y el modelo de Cox par evaluación de la sobrevida y para análisis logística múltiple, respectivamente. RESULTADOS: De los casos estudiados, 68,3% presentaban enfermedad localmente avanzada. La sobrevida en cinco años fue de 48%. Posterior al análisis múltiple, el estadio clínico al diagnóstico fue la única variable significativamente asociada con el pronóstico (pOBJETIVO: Avaliar a sobrevida global de mulheres com câncer de colo uterino e identificar fatores prognósticos relacionados. MÉTODOS: Todos os 3.341 casos tratados no Instituto Nacional de Câncer, Rio de Janeiro, RJ, entre 1999 e 2004 foram selecionados e seus dados clínicos, anatomo-patológicos e de seguimento foram coletados. Foram utilizados a curva de Kaplan-Meier e o modelo de Cox para avaliação da sobrevida e para análise logística m
Dave, Anushree
2017-12-01
This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.
Directory of Open Access Journals (Sweden)
Jung Kwon Kim
Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.
Chang, Wei-Chin; Lin, Chun-Shu; Yang, Cheng-Yu; Lin, Chih-Kung; Chen, Yuan-Wu
2018-04-01
Lymph node metastasis in oral squamous cell carcinoma (OSCC) is a poor prognostic factor. The histopathologic stage (e.g., pN) is used to evaluate the severity of lymph node metastasis; however, the current staging system insufficiently predicts survival and recurrence. We investigated clinical outcomes and lymph node density (LND) in betel nut-chewing individuals. We retrospectively analyzed 389 betel nut-exposed patients with primary OSCC who underwent surgical resection in 2002-2015. The prognostic significance of LND was evaluated by overall survival (OS) and disease-free survival (DFS) using the Kaplan-Meier method. Kaplan-Meier analyses showed that the 5-year OS and DFS rates in all patients were 60.9 and 48.9%, respectively. Multivariate analysis showed that variables independently prognostic for OS were aged population (hazard ratio [HR] = 1.6, 95% confidence interval [95% CI] = 1.1-2.5; P = .025), and cell differentiation classification (HR = 2.4, 95% CI = 1.4-4.2; P = .002). In pathologic N-positive patients, a receiver operating characteristic (ROC) curve for OS was used and indicated the best cutoff of 0.05, and the multivariate analysis showed that LND was an independent predictor of OS (HR = 2.2, 95% CI = 1.3-3.7; P = .004). Lymph node density, at a cutoff of 0.05, was an independent predictor of OS and DFS. OS and DFS underwent multiple analyses, and LND remained significant. The pathologic N stage had no influence in the OS analysis. LND is a more reliable predictor of survival in betel nut-chewing patients for further post operation adjuvant treatment, such as reoperation or adjuvant radiotherapy.
The results of palliative radiation therapy in patients with unresectable advanced pancreatic cancer
International Nuclear Information System (INIS)
Ryu, Mi Ryeong; Yoon, Sei Chul; Kim, Yeon Sil; Chung, Su Mi
2006-01-01
To evaluate the treatment results and prognostic factors of palliative radiation therapy in the patients with unresectable advanced pancreatic cancer. Thirty-seven evaluable patients with unresectable advanced pancreatic cancer who were treated by palliative radiation therapy for pain relief at the Department of Radiation Oncology, Kangnam St. Mary's hospital, the Catholic University of Korea between March 1984 and February 2005 were analysed retrospectively. There were 22 men and 15 women. Age at diagnosis ranged from 30 to 80 (median 57) years. Twelve patients (32.4%) had liver metastases and 22 patients (59.5%) had lymph node metastases. Radiation therapy was delivered to primary tumor and regional lymph nodes with 1 ∼ 2 cm margin, and total dose was 3,240 ∼ 5,580 cGy (median 5,040 cGy). Chemotherapy with radiotherapy was delivered in 30 patients (81%) with 5-FU alone (21 patients) or gemcitabine (9 patients). The follow-up period ranged from 1 to 44 months. Survival and prognostic factors were analysed using Kaplan-Meier method and log-rank test respectively. Overall mean and median survival were 11 and 8 months and 1-year survival rate was 20%. Among 33 patients who were amenable for response evaluation, 7 patients had good response and 22 patients had fail response with overall response rate of 87.9%. Mild to moderate toxicity were observed in 14 patients with nausea, vomiting, and indigestion, but severe toxicity requiring interruption of treatment were not observed. Chemotherapy didn't influence the survival and symptomatic palliation, but the group containing gemcitabine showed a tendency of longer survival (median 12 months) than 5-FU alone group (median 5.5 months) without statistical significance (ρ > 0.05). The significant prognostic factors were Karnofsky performance status and liver metastasis (ρ 0.05). Radiation therapy was effective for symptomatic palliation in the patients with unresectable advanced pancreatic cancer and would play an
A population-based study of survival and discharge status for survivors after head injury
DEFF Research Database (Denmark)
Engberg, Aase Worså; Teasdale, T W
2004-01-01
and cerebral lesion was described quantitatively through Kaplan-Meier survival distributions. Besides, patterns of severity, neurophysical and mental sequelae among survivors 5, 10 and 15 years post-injury were described. It was shown by examples how the study has been useful already for the planning......-Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score
Oligonodular hepatocellular carcinoma (HCC): MR-guided laser-induced thermotherapy (LITT)
International Nuclear Information System (INIS)
Eichler, K.; Mack, M.G.; Straub, R.; Engelmann, K.; Zangos, S.; Woitaschek, D.; Vogl, T.J.
2001-01-01
Purpose. To prospectively evaluate the therapeutic potential of MR-guided laser-induced thermotherapy (LITT) in patients with oligonodular hepatocellular carcinoma. Material and methods. 39 patients with 61 intrahepatic lesions were treated with LITT. The Nd:YAG laser fiber was introduced with a percutaneously positioned irrigated laser application system. Qualitative and quantitative MR parameters and clinical data were evaluated. Results. All patients tolerated the procedure well under local anesthesia. All observed complications were minor and no further treatment was necessary. Online MR thermometry allowed exact visualization. Lesions p to 2 cm in diameter could be efficiently treated with a single laser application, larger lesions were treated simultaneous multiapplication. In 97.5% we achieved a complete necrosis of the tumor and a 5 mm safety margin, resulting in a complete destruction of the tumor without local recurrences. Mean survival was 4.4 years (95% Cl: 3.6-5.2 years) after the time of diagnoses of the HCC (Kaplan-Meier-method). Conclusion. In intrahepatic oligonodular involvement of hepatocellular carcinoma LITT appears to be an effective therapeutic procedure with a high tumor contol rate and better survival data. (orig.) [de
Different duration of Colchicine for preventing recurrence of Gouty arthritis
Directory of Open Access Journals (Sweden)
H Karimzadeh
2006-05-01
Full Text Available Background: Gout is a Common recurrent clinical syndrome characterized by increased serum uric acid and recurrent attacks of acute arthritis. Colchicine is used for Prophylaxis against recurrence of arthritis, but the duration of its administration has mentioned variable. In this study, optimal duration of prophylactic colchicine for prevention of gouty arthritis was assessed. Methods : In a clinical trial 190 patients with gouty arthritis divided randomly to group 1,2and 3 and received colchicine for 3 to 6, 7 to 9 and 10 to 12 months then colchicine discontinued and the patients followed one year for recurrence of arthritis. Result assessed by survival analysis with Kaplan –Meier method. Results: The probability of recurrence of arthritis (in order of duration of colchicine prophylaxis was 54%, 27.5% and 23%, respectively. The difference between group one and others was statistically significant, but between group 2 and 3 was not statistically significant. Conclusion: The most suitable duration of colchicine prophylaxis that accompanied with lower recurrence rate was 7-9 months, which seems more cost -effective than 10-12 months regimen. Key words: Gout, Colchicine, Arthritis, Recurrence
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Energy Technology Data Exchange (ETDEWEB)
Ukonsaari; Jan
2012-08-15
This study concerns environmentally adapted Kaplan runners, which have no oil for lubricating the blade regulation mechanisms and bearings. The runners are water or air filled with self lubricated bearings. Recent design also includes regulation system pressure increase and servo motor placement below runner centre and environmentally adapted synthetic ester as hydraulic fluid. These together with power output increase and efficiency optimization are suspected sources of poor runner function. Of 37 runners 43 % have had some kind of problem and 30 % bearing or mechanism related ones. When the axial blade bearing problems are excluded the problems occurred at 16 %. Deeper look into the design of newer runners shows that only bronze based runner hubs is significantly more problem dense regarding regulation mechanisms (50 %). Hidden figures of increased runner regulation forces are suspected. All problems cannot be explained and the young machines limit the experiences. The working group's opinion and bring ups of historical and present examples during the work show evidence that the old oil filled runners function is far from perfect, nor the life length. The future is not with oil filled runner hubs. Main parts of the discovered problems have been solved and can be resolved by thorough design analysis. One future concern is what effects the recent design changes will cause due to increase demand for power output changes including the number of starts and stops. That is why the working group's recommendation is to put joint effort into material fatigue and in which a first step is to identify the real forces the runners are exposed to.
Energy Technology Data Exchange (ETDEWEB)
Berger, Adam C., E-mail: adam.berger@jefferson.edu [Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (United States); Winter, Kathryn [RTOG Statistical Center, Philadelphia, Pennsylvania (United States); Hoffman, John P. [Fox Chase Cancer Center, Philadelphia, Pennsylvania (United States); Regine, William F. [University of Maryland Medical Systems, Baltimore, Maryland (United States); Abrams, Ross A. [Rush University Medical Center, Chicago, Illinois (United States); Safran, Howard [Division of Hematology/Oncology, The Miriam Hospital, Providence, Rhode Island (United States); Freedman, Gary M. [Fox Chase Cancer Center, Philadelphia, Pennsylvania (United States); Benson, Alan B. [Northwestern Memorial Hospital, Chicago, Illinois (United States); MacDonald, John [St. Vincent' s Comprehensive Cancer Center, New York, New York (United States); Willett, Christopher G. [Duke University Medical Center, Durham, North Carolina (United States)
2012-11-01
Purpose: Radiation Therapy Oncology Group (RTOG) trial 9704 was the largest randomized trial to use adjuvant chemoradiation therapy for patients with pancreatic cancer. This report analyzes 5-year survival by serum level of tumor marker CA 19-9 of {<=}90 vs >90 U/mL and compares results to the those of the CONKO-001 trial. Methods and Materials: CA 19-9 expression was analyzed as a dichotomized variable ({<=}90 vs >90 U/mL). Cox proportional hazard models were used to identify the impact of the CA 19-9 value on overall survival (OS). Actuarial estimates of OS were calculated using the Kaplan-Meier method. Results: Both univariate (hazard ratio [HR] = 3.2; 95% confidence interval [CI], 2.3-4.3, P<.0001) and multivariate (HR = 3.1; 95% CI, 2.2-4.2, P<.0001) analyses demonstrated a statistically significant decrease in OS for CA 19-9 serum level of {>=}90 U/mL. For patients in the gemcitabine (Gem) treatment arm with CA 19-9 <90 U/mL, median survival was 21 months. For patients with CA 19-9 {>=}90 U/mL, this number dropped to 10 months. In patients with pancreatic head tumors in the Gem treatment arm with RT quality assurance per protocol and CA 19-9 of <90 U/mL, median survival and 5-year rate were 24 months and 34%. In comparison, the median survival and 5-year OS rate for patients in the Gem arm of the CONKO trial were 22 months and 21%. Conclusions: This analysis demonstrates that patients with postresection CA 19-9 values {>=}90 U/mL had a significantly worse survival. Patients with pancreatic head tumors treated with Gem with CA 19-9 serum level of <90 U/mL and per protocol RT had favorable survival compared to that seen in the CONKO trial. CA 19-9 is a stratification factor for the current RTOG adjuvant pancreas trial (0848).
Directory of Open Access Journals (Sweden)
Deyan Davidov
2014-12-01
Full Text Available Objective: The aim of this study was to evaluate elevated platelet count as a prognostic factor for survival in patients with advanced (stage IIIB/ IV non- small cell lung cancer (NSCLC receiving first- line chemotherapy. Methods: From 2005 to 2009 three hundreds forty seven consecutive patients with stage IIIB or IV NSCLC, treated in Department of Medical Oncology, UMHAT "Dr Georgi Stranski" entered the study. The therapeutic regimens included intravenous administration of platinum- based doublets. Survival analysis was evaluated by Kaplan- Meier test. The influence of pretreatment thrombocytosis as prognostic factor for survival was analyzed using multivariate stepwise Cox regression analyses. Results: Elevated platelet counts were found in 78 patients. The overall survival for patients without elevated platelet counts was 9,6 months versus 6,9 months for these with thrombocytosis. In multivariate analysis as independent poor prognostic factors were identified: stage, performance status and elevated platelet counts. Conclusions: These results indicated that platelet counts as well as some clinical pathologic characteristics could be useful prognostic factors in patients with unresectable NSCLC.
Directory of Open Access Journals (Sweden)
Deyan Davidov
2017-05-01
Full Text Available Objective: The aim of this study was to investigate the prognostic significance for survival of certain clinical and pathological factors in patients with advanced or metastatic colorectal carcinoma (CRC treated with first- line chemotherapy. Methods: From 2002 to 2011 seventy- four consecutive patients with advanced or metastatic CRC, treated in UMHAT- Dr. G. Stranski, Department of Medical Oncology entered the study. Some patient’s characteristics, hematological and pathological parameters, were evaluated for their role as predictors of overall survival. The therapeutic regimens included FOLFOX or FOlFIRI. Survival analysis was evaluated by Kaplan- Meier test. The influence of pretreatment characteristics as prognostic factor for survival was analyzed using multivariate stepwise Cox regression analyses. Results: In multivariate analysis a significant correlation was exhibited between survival, poor performance status and multiple sites of metastasis. Variables significantly associated with overall survival in univariate analysis were performance status>1, thrombocytosis, anemia and number of metastatic sites >1. Conclusion: These results indicated that poor performance status, anemia, thrombocytosis as well as multiple site of metastasis could be useful prognostic factors in patients with metastatic CRC.
Fasano, Serena; Pierro, Luciana; Pantano, Ilenia; Iudici, Michele; Valentini, Gabriele
2017-07-01
Systemic lupus erythematosus (SLE) is associated with an increased risk of cardiovascular disease (CVD). Thromboprophylaxis with low-dose aspirin (ASA) and hydroxychloroquine (HCQ) seems promising in SLE. We investigated the effects of HCQ cumulative dosages (c-HCQ) and the possible synergistic efficacy of ASA and HCQ in preventing a first CV event (CVE) in patients with SLE. Patients consecutively admitted to our center who, at admission, satisfied the 1997 American College of Rheumatology and/or 2012 Systemic Lupus Collaborating Clinics classification criteria for SLE, and had not experienced any CVE, were enrolled. The occurrence of a thrombotic event, use of ASA, and c-HCQ were recorded. Kaplan-Meier analysis was performed to determine the c-HCQ associated with a lower incidence of CVE. Cox regression analysis served to identify factors associated with a first CVE. For the study, 189 patients with SLE were enrolled and monitored for 13 years (median). Ten CVE occurred during followup. At Kaplan-Meier analysis, the CVE-free rate was higher in ASA-treated patients administered a c-HCQ > 600 g (standard HCQ dose for at least 5 yrs) than in patients receiving ASA alone, or with a c-HCQ dose < 600 g (log-rank test chi-square = 4.01, p = 0.04). Multivariate analysis showed that antimalarials plus ASA protected against thrombosis (HR 0.041 and HR 0.047, respectively), while antiphospholipid antibodies (HR 17.965) and hypertension (HR 18.054) increased the risk of a first CVE. Our results suggest that prolonged use of HCQ plus ASA is thromboprotective in SLE and provides additional evidence for its continued use in patients with SLE.
Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping
2017-10-01
Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.
Bentall operation in 375 patients: long-term results and predictors of death.
Varrica, Alessandro; Satriano, Angela; de Vincentiis, Carlo; Biondi, Andrea; Trimarchi, Santi; Ranucci, Marco; Menicanti, Lorenzo; Frigiola, Alessandro
2014-01-01
The Bentall operation is a 40-year-old standardized procedure for treating aortic valve diseases and aneurysms involving the aortic root. The study aim was to analyze the results and predictors of long-term outcome after the Bentall procedure for aortic root diseases. Between January 1990 and December 2007, a total of 375 patients (296 males, 79 females) underwent the Bentall operation at the authors' institution. Bicuspid aortic valve (BAV) was present in 91 patients, and Marfan syndrome in 13. Thirty-six patients were treated as emergencies, and 30 for acute dissection. A concomitant surgical procedure was performed in 78 patients. The operative procedure included both classic Bentall and button techniques. Follow up data were obtained from hospital and office records and from telephone contacts. Kaplan-Meier survival analysis and Cox regression analysis were performed to investigate the predictors of long-term outcome. The overall in-hospital mortality was 4.5%, and after elective operations was 2.3%. A 20-year long-term follow up included 32 late deaths, of which 14 were cardiac-related. Freedom from late all-cause mortality at 5, 10, and 15 years was 97.1%, 81.9%, and 53.9%, respectively. At univariate analysis, long-term mortality was associated with age, diabetes, BAV, NYHA class III/IV, emergency treatment, cardiopulmonary bypass time, and coronary artery bypass grafting. Independent predictors of long-term mortality were age (OR 1.16; CI: 1.08-1.23), emergency surgery (OR 28; CI: 4-192) and BAV (OR 3; CI: 1.3-6.9). The Bentall procedure is a safe and durable operation, with a very good early and long-term results and a low rate of reoperation. In the present series, age, BAV and emergency surgery were important independent predictors of mortality.
International Nuclear Information System (INIS)
Asher, Anthony L.; Burri, Stuart H.; Wiggins, Walter F.; Kelly, Renee P.; Boltes, Margaret O.; Mehrlich, Melissa; Norton, H. James; Fraser, Robert W.
2014-01-01
Purpose: Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Methods and Materials: Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Results: Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. Conclusions: NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong
Energy Technology Data Exchange (ETDEWEB)
Asher, Anthony L., E-mail: asher@cnsa.com [Department of Neurosurgery, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States); Carolina Neurosurgery and Spine Associates, Charlotte, North Carolina (United States); Burri, Stuart H. [Department of Radiation Oncology, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States); Wiggins, Walter F. [Wake Forest School of Medicine MD/PhD Program, Winston-Salem, North Carolina (United States); Kelly, Renee P. [Brain Tumor Fund for the Carolinas, Charlotte, North Carolina (United States); Boltes, Margaret O.; Mehrlich, Melissa [Carolina Neurosurgery and Spine Associates, Charlotte, North Carolina (United States); Norton, H. James [Department of Biostatistics, Carolinas Medical Center, Charlotte, North Carolina (United States); Fraser, Robert W. [Department of Radiation Oncology, Levine Cancer Institute and Carolinas Medical Center, Charlotte, North Carolina (United States)
2014-03-15
Purpose: Resected brain metastases (BM) require radiation therapy to reduce local recurrence. Whole brain radiation therapy (WBRT) reduces recurrence, but with potential toxicity. Postoperative stereotactic radiosurgery (SRS) is a strategy without prospective data and problematic target delineation. SRS delivered in the preoperative setting (neoadjuvant, or NaSRS) allows clear target definition and reduction of intraoperative dissemination of tumor cells. Methods and Materials: Our treatment of resectable BM with NaSRS was begun in 2005. Subsequently, a prospective trial of NaSRS was undertaken. A total of 47 consecutively treated patients (23 database and 24 prospective trial) with a total of 51 lesions were reviewed. No statistical difference was observed between the 2 cohorts, and they were combined for analysis. The median follow-up time was 12 months (range, 1-58 months), and the median age was 57. A median of 1 day elapsed between NaSRS and resection. The median diameter of lesions was 3.04 cm (range, 1.34-5.21 cm), and the median volume was 8.49 cc (range, 0.89-46.7 cc). A dose reduction strategy was used, with a median dose of 14 Gy (range, 11.6-18 Gy) prescribed to 80% isodose. Results: Kaplan-Meier overall survival was 77.8% and 60.0% at 6 and 12 months. Kaplan-Meier local control was 97.8%, 85.6%, and 71.8% at 6, 12, and 24 months, respectively. Five of 8 failures were proved pathologically without radiation necrosis. There were no perioperative adverse events. Ultimately, 14.8% of the patients were treated with WBRT. Local failure was more likely with lesions >10 cc (P=.01), >3.4 cm (P=.014), with a trend in surface lesions (P=.066) and eloquent areas (P=.052). Six of the 8 failures had an obvious dural attachment or proximity to draining veins. Conclusions: NaSRS can be performed safely and effectively with excellent results without documented radiation necrosis. Local control was excellent even in the setting of large (>3 cm) lesions. The strong
International Nuclear Information System (INIS)
Xu Ying; Zhu Yueqi; Zhao Jungong; Wang Jianbo; Tan Huaqiao; Cheng Yingsheng; Li Minghua; Wang Jue; Cheng Yongde
2011-01-01
Objective: To assess the feasibility and efficacy of subintimal angioplasty (SA) for the treatment of below-the-arterial occlusion in diabetic patients with chronic critical limb ischemia (CLI). Methods: SA was adopted for 57 diseased lower limbs in 37 diabetic patients with chronic CLI and occlusive disease of the dorsalis pedis artery (DPA) and/or planter artery (PA), who were not suitable candidates for intraluminal angioplasty or bypass surgery. Of the total 57 diseased lower limbs, tissue loss was seen in 31 (54.4%) and pain was reported in 51 (89.5%). SA was carried out to create continuous arterial flow to the foot for limb salvage. Both before and after the procedure the clinical symptoms, DPA or PA pulse volume scores and ankle-brachial indexes (ABI) were determined in all patients, the results were compared and statistically analysed. During the follow-up period, the healing of the wound, the salvage of the diseased limb and the re-stenosis occurrence of the target vessels were evaluated. Kaplan-Meier curves were constructed to evaluate limb salvage, survival rate and freedom from amputation. Results: A total of 66 below-the-ankle arterial lesions were detected in 57 affected limbs. Of the 66 lesions, SA was successfully performed in 55 (83.3%). Before SA the median pulse volume scores and ABIs were 0.33±0.54 and 0.31±0.19 respectively, which became 2.04±1.05 and 0.80±0.14 respectively after SA, the differences in both median pulse volume scores and ABI were statistically significant (P<0.01 for both). One patient (2.7%) died within 30 days after the procedure. Mild complications, such as bleeding, thrombosis or angiospasm etc. occurred in five patents (13.5%). Twelve months after SA. Kaplan-Meier analysis showed that the limb salvage rate was 94.6%, the freedom from amputation was 89.2% and the survival rate was 97.3%. Conclusion: SA of the dorsalis pedis artery and/or planter artery is an effective technique for lower limb salvage in diabetic
van den Reek, J M P A; Tummers, M; Zweegers, J; Seyger, M M B; van Lümig, P P M; Driessen, R J B; van de Kerkhof, P C M; Kievit, W; de Jong, E M G J
2015-03-01
Drug survival is an indicator for treatment success; insight in predictors associated with drug survival is important. To analyse the long-term drug survival for adalimumab in patients with psoriasis treated in daily practice and (II) to identify predictors of prolonged drug survival for adalimumab split for different reasons of discontinuation. Data were extracted from a prospective psoriasis cohort and analysed using Kaplan-Meier survival curves split for reasons of discontinuation. Baseline predictors associated with longer drug survival were identified using multivariate Cox-regression analysis. One hundred and sixteen patients were included with a total of 208 patient-years. Overall drug survival was 76% after 1 year and 52% after 4.5 years. In patients who stopped due to ineffectiveness, longer drug survival was associated with the absence of specific comorbidities (P = 0.03). In patients who stopped due to side-effects, longer drug survival was associated with male gender (P = 0.02). Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation. Strong, specific predictors can lead to patient-tailored treatment. © 2014 European Academy of Dermatology and Venereology.
DEFF Research Database (Denmark)
Kongsted, Per; Svane, Inge M; Lindberg, Henriette
2016-01-01
To compare treatment outcomes in patients with metastatic castration-resistant prostate cancer treated with cabazitaxel (CA) as second-line or third-line therapy in the everyday clinical setting. Charts from 94 patients treated with CA as second-line (n=28) or third-line therapy (n=66) were...... evaluated. Common Terminology Criteria for Adverse Events were used to register grade 3-4 nonhematological toxicity during treatment with CA. Baseline metastatic castration-resistant prostate cancer-related prognostic factors, duration of therapy, and maximum prostate-specific antigen (PSA) percentage...... change were registered during treatment with CA and previous/subsequent novel androgen receptor targeting therapies. Progression-free survival (PFS) and overall survival (OS) were calculated using the Kaplan-Meier method. A median of 6 versus 5 treatment cycles was administered in patients treated...
Measuring quality indicators in the operating room: cleaning and turnover time.
Jericó, Marli de Carvalho; Perroca, Márcia Galan; da Penha, Vivian Colombo
2011-01-01
This exploratory-descriptive study was carried out in the Surgical Center Unit of a university hospital aiming to measure time spent with concurrent cleaning performed by the cleaning service and turnover time and also investigated potential associations between cleaning time and the surgery's magnitude and specialty, period of the day and the room's size. The sample consisted of 101 surgeries, computing cleaning time and 60 surgeries, computing turnover time. The Kaplan-Meier method was used to analyze time and Pearson's correlation to study potential correlations. The time spent in concurrent cleaning was 7.1 minutes and turnover time was 35.6 minutes. No association between cleaning time and the other variables was found. These findings can support nurses in the efficient use of resources thereby speeding up the work process in the operating room.
DEFF Research Database (Denmark)
Tanadini-Lang, S; Rieber, J; Filippi, A R
2017-01-01
BACKGROUND: Radical local treatment of pulmonary metastases is practiced with increasing frequency due to acknowledgment and better understanding of oligo-metastatic disease. This study aimed to develop a nomogram predicting overall survival (OS) after stereotactic body radiotherapy (SBRT......) for pulmonary metastases. PATIENTS AND METHODS: A multi-institutional database of 670 patients treated with SBRT for pulmonary metastases was used as training cohort. Cox regression analysis with bidirectional variable elimination was performed to identify factors to be included into the nomogram model...... to predict 2-year OS. The calibration rate of the nomogram was assessed by plotting the actual Kaplan-Meier 2-year OS against the nomogram predicted survival. The nomogram was externally validated using two separate monocentric databases of 145 and 92 patients treated with SBRT for pulmonary metastases...
Expression and clinical significance of PIWIL2 in hilar cholangiocarcinoma tissues and cell lines.
Chen, Y J; Xiong, X F; Wen, S Q; Tian, L; Cheng, W L; Qi, Y Q
2015-06-26
The objective of this study was to explore the relationship between PIWI-like protein 2 (PIWIL2) and clinicopathological charac-teristics and prognosis after radical resection. To accomplish this, we analyzed PIWIL2 expression in hilar cholangiocarcinoma tissues and cell lines. PIWIL2 expression was detected by immunohistochemistry in 41 hilar cholangiocarcinoma samples and 10 control tissues. Western blotting and immunocytofluorescence were used to investigate PIWIL2 expression in the cholangiocarcinoma cell line QBC939 and the bile duct epithelial cell line HIBEpic. Univariate and multivariate surviv-al analyses were performed using the Kaplan-Meier method for hilar cholangiocarcinoma patients who underwent radical resection. PIWIL2 expression was significantly higher in the hilar cholangiocarcinoma tissues and QBC939 cells than in control tissues and HIBEpic cells, respectively (P hilar cholangiocarcinoma (P hilar cholangiocarcinoma.
DEFF Research Database (Denmark)
Freilich, Jonatan; Manouchehrinia, Ali; Trusheim, Mark
2017-01-01
Previous research characterizing factors influencing multiple sclerosis (MS) disease progression has typically been based on time to disease milestones (Kaplan-Meier, Cox hazard regression, etc.). A limitation of these methods is the handling of the often large groups of patients not reaching...... the milestone. To characterize clinical factors influencing MS disease progression as annual transitions from each Expanded Disability Status Scale (EDSS). The annual progression of 11,964 patients from the Swedish MS Registry was analysed with 10 multinomial logistic regressions, that is, one for transition...... from each full EDSS with explanatory variables age, sex, age at onset, time in current EDSS, highest prior EDSS, MS course and treatment. All factors (except sex) investigated had statistically significant impacts on transitions from at least one EDSS. However, significance and size of the effect...
Conditional survival of patients with diffuse large B-cell lymphoma
DEFF Research Database (Denmark)
Møller, Michael Boe; Pedersen, Niels Tinggaard; Christensen, Bjarne E
2006-01-01
BACKGROUND: Prognosis of lymphoma patients is usually estimated at the time of diagnosis and the estimates are guided by the International Prognostic Index (IPI). However, conditional survival estimates are more informative clinically, as they consider those patients only who have already survive...... survival probability provides more accurate prognostic information than the conventional survival rate estimated from the time of diagnosis.......BACKGROUND: Prognosis of lymphoma patients is usually estimated at the time of diagnosis and the estimates are guided by the International Prognostic Index (IPI). However, conditional survival estimates are more informative clinically, as they consider those patients only who have already survived...... a period of time after treatment. Conditional survival data have not been reported for lymphoma patients. METHODS: Conditional survival was estimated for 1209 patients with diffuse large B-cell lymphoma (DLBCL) from the population-based LYFO registry of the Danish Lymphoma Group. The Kaplan-Meier method...
Directory of Open Access Journals (Sweden)
Keroulay Estebanez Roque
2011-09-01
took place at a public and cardiologic hospital, located in the city of Rio de Janeiro. For the analysis of the survival, the method Kaplan-Meier was used. The probability of surviving free from an adverse event to drugs up to 30, 60 and 100 days was respectively of 96%, 93% and 73%. The adverse events to drugs represent marking conditions that describe the performance of the health services. The detection of adverse events in hospitals makes it possible to know the failures that occur in the medication system and also to implement strategies to reduce them.
Tremblay, Gabriel; Livings, Christopher; Crowe, Lydia; Kapetanakis, Venediktos; Briggs, Andrew
2016-01-01
Cost-effectiveness models for the treatment of long-term conditions often require information on survival beyond the period of available data. This paper aims to identify a robust and reliable method for the extrapolation of overall survival (OS) in patients with radioiodine-refractory differentiated thyroid cancer receiving lenvatinib or placebo. Data from 392 patients (lenvatinib: 261, placebo: 131) from the SELECT trial are used over a 34-month period of follow-up. A previously published criterion-based approach is employed to ascertain credible estimates of OS beyond the trial data. Parametric models with and without a treatment covariate and piecewise models are used to extrapolate OS, and a holistic approach, where a series of statistical and visual tests are considered collectively, is taken in determining the most appropriate extrapolation model. A piecewise model, in which the Kaplan-Meier survivor function is used over the trial period and an extrapolated tail is based on the Exponential distribution, is identified as the optimal model. In the absence of long-term survival estimates from clinical trials, survival estimates often need to be extrapolated from the available data. The use of a systematic method based on a priori determined selection criteria provides a transparent approach and reduces the risk of bias. The extrapolated OS estimates will be used to investigate the potential long-term benefits of lenvatinib in the treatment of radioiodine-refractory differentiated thyroid cancer patients and populate future cost-effectiveness analyses.
Directory of Open Access Journals (Sweden)
Regina Coeli Azeredo Cardoso
2013-09-01
Full Text Available OBJECTIVES: to evaluate infant mortality in very low birth weight newborns from a public hospital in Rio de Janeiro, Brazil (2002-2006. METHODS: a retrospective cohort study was performed using the probabilistic linkage method to identify infant mortality. Mortality proportions were calculated according to birth weight intervals and period of death. The Kaplan-Meier method was used to estimate overall cumulative survival probability. The association between maternal schooling and survival of very low birth weight infants was evaluated by means of Cox proportional hazard models adjusted for: prenatal care, birth weight, and gestational age. RESULTS: the study included 782 very low birth weight newborns. Of these, (28.6% died before one year of age. Neonatal mortality was 19.5%, and earlyneonatal mortality was 14.9%. Mortality was highest in the lowest weight group (71.6%. Newborns whose mothers had less than four years of schooling had 2.5 times higher risk of death than those whose mothers had eight years of schooling or more, even after adjusting for intermediate factors. CONCLUSIONS: the results showed higher mortality among very low birth weight infants. Low schooling was an independent predictor of infant death in this low-income population sample.
PROSPECT Eligibility and Clinical Outcomes: Results From the Pan-Canadian Rectal Cancer Consortium.
Bossé, Dominick; Mercer, Jamison; Raissouni, Soundouss; Dennis, Kristopher; Goodwin, Rachel; Jiang, Di; Powell, Erin; Kumar, Aalok; Lee-Ying, Richard; Price-Hiller, Julie; Heng, Daniel Y C; Tang, Patricia A; MacLean, Anthony; Cheung, Winson Y; Vickers, Michael M
2016-09-01
The PROSPECT trial (N1048) is evaluating the selective use of chemoradiation in patients with cT2N1 and cT3N0-1 rectal cancer undergoing sphincter-sparing low anterior resection. We evaluated outcomes of PROSPECT-eligible and -ineligible patients from a multi-institutional database. Data from patients with locally advanced rectal cancer who received chemoradiation and low anterior resection from 2005 to 2014 were retrospectively collected from 5 Canadian centers. Overall survival, disease-free survival (DFS), recurrence-free survival (RFS), and time to local recurrence (LR) were estimated using the Kaplan-Meier method, and a multivariate analysis was performed adjusting for prognostic factors. A total of 566 (37%) of 1531 patients met the PROSPECT eligibility criteria. Eligible patients were more likely to have better PS (P = .0003) and negative circumferential resection margin (P PROSPECT eligibility was associated with improved DFS (hazard ratio [HR], 0.75; 95% confidence interval [CI], 0.61-0.91), overall survival (HR, 0.73; 95% CI, 0.57-0.95), and RFS (HR, 0.68; 95% CI, 0.54-0.86) in univariate analyses. In multivariate analysis, only RFS remained significantly improved for PROSPECT-eligible patients (HR, 0.75; 95% CI, 0.57-1.00, P = .0499). The 3-year DFS and freedom from LR for PROSPECT-eligible patients were 79.1% and 97.4%, respectively, compared to 71.1% and 96.8% for PROSPECT-ineligible patients. Real-world data corroborate the eligibility criteria used in the PROSPECT study; the criteria identify a subgroup of patients in whom risk of recurrence is lower and in whom selective use of chemoradiation should be actively examined. Copyright © 2016 Elsevier Inc. All rights reserved.
Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming
2016-11-01
Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard-Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200-440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ˜ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.
Energy Technology Data Exchange (ETDEWEB)
Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming, E-mail: bmcheng@nsrrc.org.tw [National Synchrotron Radiation Research Center, No. 101, Hsin-Ann Road, Hsinchu Science Park, Hsinchu 30076, Taiwan (China)
2016-11-20
Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard–Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200–440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ∼ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.
International Nuclear Information System (INIS)
Lu, Hsiao-Chi; Lo, Jen-Iu; Peng, Yu-Chain; Chou, Sheng-Lung; Lin, Meng-Yeh; Cheng, Bing-Ming
2016-01-01
Irradiation of solid nitrogen at 4 K with far-ultraviolet light from a synchrotron caused excitation to the upper state of the Vegard–Kaplan (VK) system; the emission in that system was simultaneously recorded in wavelength region 200–440 nm. The lifetimes of emission lines for VK (0, 1) to (0, 12) transitions were measured in the range of 2.12 ∼ 2.65 s. The threshold wavelength to observe the VK emission was 175.0 ± 3.5 nm, corresponding to energy 7.08 ± 0.14 eV. This investigation of the generation of icy VK nitrogen enhances our understanding of its photochemistry in space.
Radial Artery as a Coronary Artery Bypass Conduit: 20-Year Results.
Gaudino, Mario; Tondi, Paolo; Benedetto, Umberto; Milazzo, Valentina; Flore, Roberto; Glieca, Franco; Ponziani, Francesca Romana; Luciani, Nicola; Girardi, Leonard N; Crea, Filippo; Massetti, Massimo
2016-08-09
There is a lack of evidence for the choice of the second conduit in coronary surgery. The radial artery (RA) is a possible option, but few data on very-long-term outcomes exist. This study describes 20-year results of RA grafts used for coronary artery bypass grafting and the effects of RA removal on forearm circulation. We report the results of the prospective 20-year follow-up of the first 100 consecutive patients who received the RA as a coronary bypass conduit at our institution. Follow-up was 100% complete. There were 64 deaths, 23 (35.9%) from cardiovascular causes. Kaplan-Meier 20-year survival was 31%. Of the 36 survivors, 33 (91.6%) underwent RA graft control at a mean of 19.0 ± 2.5 years after surgery. The RA was found to be patent in 24 cases (84.8% patency). In the overall population, probability of graft failure at 20 years was 19.0 ± 0.2% for the left internal thoracic artery (ITA), 25.0 ± 0.2% for the RA, and 55.0 ± 0.2% for the saphenous vein (p = 0.002 for RA vs. saphenous vein, 0.11 for RA vs. ITA, and p 90%, but not location of distal anastomosis, significantly influenced long-term RA graft patency. No patients reported hand or forearm symptoms. The ulnar artery diameter was increased in the operated arm (2.44 ± 0.43 mm vs. 2.01 ± 0.47 mm; p 90% stenosis. RA harvesting does not lead to hand or forearm symptoms, even at a very-long-term follow-up. Copyright © 2016 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Robab Hassanzadeh
2012-03-01
Full Text Available Objective: In this study continuation rate and reasons for discontinuation of Depot-medroxyprogestroneacetate (DMPAand Cyclofem have been compared.Materials and methods: A retrospective cohort study was conducted with 422 women (202 Cyclofemand220 DMPA userswho had started using the methods 12-24 months before the study in East Azerbaijanhealth houses. Data were collected by reviewing the records and interview with the clients and analysedusing Kaplan-Meier and Cox Regression.Results: The 3, 6, 9, 12 months continuation rate were 56%, 37%, 30%, 27% respectively for Cyclofemversus 75%, 59.5%, 48%, 42.5% for DMPA. Menstrual changes were reported significantly more by theDMPA users than the Cyclofem users (85% vs. 73%, P=0.008 as the main reason for thediscontinuation, the difference mainly reflected of amenorrhea (50% vs. 23%, P=0.003. None of DMPAusers and 11% of Cyclofem users claimed frequency of visits and lack of method supplies as their maindiscontinuation reason.Conclusion: Discontinuation rate was high for the both methods but it was higher for Cyclofem.Thecommon side effects mentioned as the main reasons for discontinuation of the both methods are nothealth threatening. Therefore, health care providers may help to improve their continuation rate byappropriate consultation.
Hosseinalipour, S. M.; Raja, A.; Hajikhani, S.
2012-06-01
A full three dimensional Navier - Stokes numerical simulation has been performed for performance analysis of a Kaplan turbine which is installed in one of the Irans south dams. No simplifications have been enforced in the simulation. The numerical results have been evaluated using some integral parameters such as the turbine efficiency via comparing the results with existing experimental data from the prototype Hill chart. In part of this study the numerical simulations were performed in order to calculate the prototype turbine efficiencies in some specific points which comes from the scaling up of the model efficiency that are available in the model experimental Hill chart. The results are very promising which shows the good ability of the numerical techniques for resolving the flow characteristics in these kind of complex geometries. A parametric study regarding the evaluation of turbine performance in three different runner angles of the prototype is also performed and the results are cited in this paper.
Kaden, Jürgen; May, Gottfried; Völp, Andreas; Wesslau, Claus
2009-01-01
In organ grafts donor-specific sensitization is initiated immediately after revascularization. Therefore, in 1990 we introduced the intra-operative single high-dose ATG-Fresenius (ATG-F) induction in addition to standard triple drug therapy (TDT) consisting of steroids, azathioprine and cyclosporin. A total of 778 first renal transplantations from deceased donors, performed between 1987 and 1998, were included in this evaluation. This retrospective analysis of clinic records and electronic databases presents data of all recipients of first kidney grafts who received two different ATG-F inductions (1(st) group: 9 mg/kg body weight as single high-dose intra-operatively, n=484; 2(nd) group: 3 mg/kg body weight on 7 or 8 consecutive days as multiple-dose starting also intra-operatively, n=78) and standard TDT alone (3(rd) group: TDT alone, n=216). The 10-year patient survival rates were 72.6+/-2.6% (TDT + ATG-F single high-dose), 79.5+/-5.1% (TDT + ATG-F multiple-dose) and 67.2+/-3.7%% (TDT alone; Kaplan-Meier estimates with standard errors; ATG-F vs TDT alone, p=0.001). The 10-year graft survival rates with censoring of patients that died with a functioning graft were 73.8+/-2.4%, 57.7+/-5.8% and 58.4+/-3.6% (Kaplan-Meier estimates with standard errors; 1(st) vs 2(nd )and 3(rd) group, respectively, p<0.001) and the 10-year graft survival rates with patient death counted as graft failure were 58.3+/-2.7%, 55.7+/-5.8% and 48.2+/-3.5% (Kaplan-Meier estimates with standard errors; ATG-F single high-dose vs TDT, p=0.023). In pre-sensitized recipients there were also significant differences in favour of ATG-F, more notably in the single high-dose ATG-F induction. A total of 69% of the patients in the two cohorts receiving ATG-F did not experience any transplant rejections compared to 56% in patients undergoing TDT alone (p=0.018). The incidence of infectious complications was comparable across all groups. According to evidence obtained from the routine documentation of 778
Mid-term effect of direct intrahepatic portosystemic shunt for the treatment of portal hypertension
International Nuclear Information System (INIS)
Luo Jianjun; Yan Zhiping; Wang Jianhua; Liu Qingxin; Qu Xudong
2009-01-01
Objective: To retrospectively analyze the mid-term clinical results of direct intrahepatic portosystemic shunt (DIPS) in treating patients with portal hypertension. Methods: DIPS were created in 23 patients with portal hypertension. Both preoperative and postoperative portal systemic pressure gradient (PPG), liver function and clinical symptoms were recorded and compared. Shunt patency was checked by color Doppler ultrasonography and the data were statistically analyzed by Kaplan-Meier method. Results DIPS creation was successfully accomplished in all 23 patients. No serious complications occurred after DIPS except for hemorrhagic ascites (n = 1) and mild hepatic encephalopathy (n = 3). Mean PPG significantly decreased from preoperative (32.6 ± 5.3) mmHg with a range of (23 - 43) mmHg to postoperative (10.1 ± 2.7) mmHg with a range of (5-14) mmHg (P < 0.001). After the procedure, the albumin level also markedly decreased while the bilirubin level distinctly increased. Obvious improvement of the clinical symptoms was observed. The cumulated primary patency rate of the shunt one and two years after treatment was 77.4% and 50.2% respectively. Conclusion: The mid-term clinical results indicate that DIPS is an effective and safe procedure for treating patients with portal hypertension. (authors)