KMWin – A Convenient Tool for Graphical Presentation of Results from Kaplan-Meier Survival Time Analysis

Science.gov (United States)

Gross, Arnd; Ziepert, Marita; Scholz, Markus

2012-01-01

Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912

MNS16A minisatellite genotypes in relation to risk of glioma and meningioma and to glioblastoma outcome

DEFF Research Database (Denmark)

Andersson, U.; Osterman, P.; Sjostrom, S.

2009-01-01

was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...

Permutational distribution of the log-rank statistic under random censorship with applications to carcinogenicity assays.

Science.gov (United States)

Heimann, G; Neuhaus, G

1998-03-01

In the random censorship model, the log-rank test is often used for comparing a control group with different dose groups. If the number of tumors is small, so-called exact methods are often applied for computing critical values from a permutational distribution. Two of these exact methods are discussed and shown to be incorrect. The correct permutational distribution is derived and studied with respect to its behavior under unequal censoring in the light of recent results proving that the permutational version and the unconditional version of the log-rank test are asymptotically equivalent even under unequal censoring. The log-rank test is studied by simulations of a realistic scenario from a bioassay with small numbers of tumors.

LogDet Rank Minimization with Application to Subspace Clustering

Directory of Open Access Journals (Sweden)

Zhao Kang

2015-01-01

Full Text Available Low-rank matrix is desired in many machine learning and computer vision problems. Most of the recent studies use the nuclear norm as a convex surrogate of the rank operator. However, all singular values are simply added together by the nuclear norm, and thus the rank may not be well approximated in practical problems. In this paper, we propose using a log-determinant (LogDet function as a smooth and closer, though nonconvex, approximation to rank for obtaining a low-rank representation in subspace clustering. Augmented Lagrange multipliers strategy is applied to iteratively optimize the LogDet-based nonconvex objective function on potentially large-scale data. By making use of the angular information of principal directions of the resultant low-rank representation, an affinity graph matrix is constructed for spectral clustering. Experimental results on motion segmentation and face clustering data demonstrate that the proposed method often outperforms state-of-the-art subspace clustering algorithms.

Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves.

Science.gov (United States)

Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J

2012-02-01

The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

On the Importance of Accounting for Competing Risks in Pediatric Cancer Trials Designed to Delay or Avoid Radiotherapy: I. Basic Concepts and First Analyses

International Nuclear Information System (INIS)

Tai, Bee-Choo; Grundy, Richard G.; Machin, David

2010-01-01

Purpose: In trials designed to delay or avoid irradiation among children with malignant brain tumor, although irradiation after disease progression is an important event, patients who have disease progression may decline radiotherapy (RT), or those without disease progression may opt for elective RT. To accurately describe the cumulative need for RT in such instances, it is crucial to account for these distinct events and to evaluate how each contributes to the delay or advancement of irradiation via a competing risks analysis. Methods and Materials: We describe the summary of competing events in such trials using competing risks methods based on cumulative incidence functions and Gray's test. The results obtained are contrasted with standard survival methods based on Kaplan-Meier curves, cause-specific hazard functions and log-rank test. Results: The Kaplan-Meier method overestimates all event-specific rates. The cause-specific hazard analysis showed reduction in hazards for all events (A: RT after progression; B: no RT after progression; C: elective RT) among children with ependymoma. For event A, a higher cumulative incidence was reported for ependymoma. Although Gray's test failed to detect any difference (p = 0.331) between histologic subtypes, the log-rank test suggested marginal evidence (p = 0.057). Similarly, for event C, the log-rank test found stronger evidence of reduction in hazard among those with ependymoma (p = 0.005) as compared with Gray's test (p = 0.086). Conclusions: To evaluate treatment differences, failing to account for competing risks using appropriate methodology may lead to incorrect interpretations.

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

DEFF Research Database (Denmark)

Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

2008-01-01

-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

DEFF Research Database (Denmark)

Kyndi, M.; Sorensen, F.B.; Alsner, J.

2008-01-01

-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves

Directory of Open Access Journals (Sweden)

Guyot Patricia

2012-02-01

Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2

DEFF Research Database (Denmark)

Sarkisian, Laura; Saaby, L.; Poulsen, T. S.

2015-01-01

-year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...

Perioperative Blood Transfusion as a Significant Predictor of Biochemical Recurrence and Survival after Radical Prostatectomy in Patients with Prostate Cancer.

Directory of Open Access Journals (Sweden)

Jung Kwon Kim

Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.

Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy

International Nuclear Information System (INIS)

Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.

2000-01-01

Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de

The 434(G>C) polymorphism in the eosinophil cationic protein gene and its association with tissue eosinophilia in oral squamous cell carcinomas

DEFF Research Database (Denmark)

Pereira, Michele C; Oliveira, Denise T; Olivieri, Eloísa H R

2010-01-01

OBJECTIVE: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G>C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic...... of ECP-gene polymorphism 434(G>C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test...

Volume-Based F-18 FDG PET/CT Imaging Markers Provide Supplemental Prognostic Information to Histologic Grading in Patients With High-Grade Bone or Soft Tissue Sarcoma

DEFF Research Database (Denmark)

Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid

2015-01-01

analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...

Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer

DEFF Research Database (Denmark)

Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim

2017-01-01

OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...

Increased 30-day mortality in patients with diabetes undergoing surgery for colorectal cancer

DEFF Research Database (Denmark)

Fransgaard, T; Thygesen, L C; Gögenur, I

2016-01-01

with the use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The 30-day mortality was examined by the Kaplan-Meier method with the log-rank test and the Cox regression model used to test statistical significance. RESULTS: The study included 29 353 patients, of whom...... 3250 had preexisting diabetes. The 30-day mortality was significantly increased in patients with CRC and preexisting diabetes (adjusted hazard ratio 1.17, 95% CI 1.01-1.35, P = 0.03). The type of antidiabetic medication used was not associated with 30-day mortality. CONCLUSION: Preexisting diabetes...

Compliance with Supportive Periodontal Treatment in Patients with Dental Implants.

Science.gov (United States)

Hu, Kai-Fang; Lin, Ying-Chu; Ho, Kun-Yen; Chou, Yu-Hsiang

The need for dental implants is increasing, and supportive periodontal treatment can achieve long-term success and prevent peri-implantitis. Contributing factors to noncompliance with long-term scheduled supportive periodontal treatment remain unclear. To investigate whether demographic and clinical characteristics are associated with noncompliance, the authors analyzed data for patients who had received dental implants. The authors recruited patients participating in a supportive periodontal treatment program after receiving permanent prostheses on implants placed from 2005 to 2013. Demographic data and dental treatment histories were collected. Compliance was defined as a record of participation in a standard supportive periodontal treatment program for at least 1 year. The chi-square test, log-rank test, Kaplan-Meier survival curve, and Cox proportional hazards model were used for statistical analysis. The study included 120 patients (259 implants, 60% compliance). The two groups (compliant and noncompliant) differed significantly in frequency distributions for sex (P = .0017), educational level (P = .0325), and histories of substance use (P = .0016), periodontitis (P = .0005), and root planing or flap surgery (P = .0002). The Kaplan-Meier survival curves and log-rank test showed that increases in cumulative continuation rates were significantly associated with male sex (P = .0025); body mass index ≥ 24 kg/m² (P = .0093); and a history of periodontitis (P implant placement, root planing or flap surgery was the crucial factor in determining compliance with supportive periodontal treatment. However, well-designed large-scale studies with a larger sample size are needed to confirm the findings of this study.

The 5-year incidence of bleb-related infection and its risk factors after filtering surgeries with adjunctive mitomycin C: collaborative bleb-related infection incidence and treatment study 2.

Science.gov (United States)

Yamamoto, Tetsuya; Sawada, Akira; Mayama, Chihiro; Araie, Makoto; Ohkubo, Shinji; Sugiyama, Kazuhisa; Kuwayama, Yasuaki

2014-05-01

To report the 5-year incidence of bleb-related infection after mitomycin C-augmented glaucoma filtering surgery and to investigate the risk factors for infections. Prospective, observational cohort study. A total of 1098 eyes of 1098 glaucoma patients who had undergone mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation performed at 34 clinical centers. Patients were followed up at 6-month intervals for 5 years, with special attention given to bleb-related infections. The follow-up data were analyzed via Kaplan-Meier survival analysis and the Cox proportional hazards model. Incidence of bleb-related infection over 5 years and risk factors for infections. Of the 1098 eyes, a bleb-related infection developed in 21 eyes. Kaplan-Meier survival analysis revealed that the incidence of bleb-related infection was 2.2±0.5% (cumulative incidence ± standard error) at the 5-year follow-up for all cases, whereas it was 7.9±3.1% and 1.7±0.4% for cases with and without a history of bleb leakage, respectively (P = 0.000, log-rank test). When only eyes with a well-functioning bleb were counted, it was 3.9±1.0%. No differences were found between the trabeculectomy cases and the combined surgery cases (P = 0.398, log-rank test) or between cases with a fornix-based flap and those with a limbal-based flap (P = 0.651, log-rank test). The Cox model revealed that a history of bleb leakage and younger age were risk factors for infections. The 5-year cumulative incidence of bleb-related infection was 2.2±0.5% in eyes treated with mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation in our prospective, multicenter study. Bleb leakage and younger age were the main risk factors for infections. Copyright © 2014 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Growth pattern of colorectal liver metastasis as a marker of recurrence risk

DEFF Research Database (Denmark)

Eefsen, R L; Vermeulen, P B; Christensen, I J

2015-01-01

from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...

High frequency of tumor cells with nuclear Egr-1 protein expression in human bladder cancer is associated with disease progression

DEFF Research Database (Denmark)

Egerod, Frederikke N S Lihme; Bartels, Annette; Fristrup, Niels

2009-01-01

bladder cancer. RESULTS: The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling...... than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling...

Aplicación y técnicas del análisis de supervivencia en las investigaciones clínicas Application and techniques of survival analysis in clinical research

Directory of Open Access Journals (Sweden)

Anissa Gramatges Ortiz

2002-08-01

Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated

Maternal smoking during pregnancy and the risk of pediatric cardiovascular diseases of the offspring: A population-based cohort study with up to 18-years of follow up.

Science.gov (United States)

Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal

2018-06-01

Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.

Kaplan-Narayanan-Neuberger lattice fermions pass a perturbative test

International Nuclear Information System (INIS)

Aoki, S.; Levien, R.B.

1995-01-01

We test perturbatively a recent scheme for implementing chiral fermions on the lattice, proposed by Kaplan and modified by Narayanan and Neuberger, using as our testing ground the chiral Schwinger model. The scheme is found to reproduce the desired form of the effective action, whose real part is gauge invariant and whose imaginary part gives the correct anomaly in the continuum limit, once technical problems relating to the necesary infinite extent of the extra dimension are properly addressed. The indications from this study are that the Kaplan-Narayanan-Neuberger scheme has a good chance at being a correct lattice regularization of chiral gauge theories

Prognostic value of alcohol dehydrogenase mRNA expression in gastric cancer.

Science.gov (United States)

Guo, Erna; Wei, Haotang; Liao, Xiwen; Xu, Yang; Li, Shu; Zeng, Xiaoyun

2018-04-01

Previous studies have reported that alcohol dehydrogenase (ADH) isoenzymes possess diagnostic value in gastric cancer (GC). However, the prognostic value of ADH isoenzymes in GC remains unclear. The aim of the present study was to identify the prognostic value of ADH genes in patients with GC. The prognostic value of ADH genes was investigated in patients with GC using the Kaplan-Meier plotter tool. Kaplan-Meier plots were used to assess the difference between groups of patients with GC with different prognoses. Hazard ratios (HR) and 95% confidence intervals (CI) were used to assess the relative risk of GC survival. Overall, 593 patients with GC and 7 ADH genes were included in the survival analysis. High expression of ADH 1A (class 1), α polypeptide ( ADH1A; log-rank P=0.043; HR=0.79; 95% CI: 0.64-0.99), ADH 1B (class 1), β polypeptide ( ADH1B ; log-rank P=1.9×10 -05 ; HR=0.65; 95% CI: 0.53-0.79) and ADH 5 (class III), χ polypeptide ( ADH5 ; log-rank P=0.0011; HR=0.73; 95% CI: 0.6-0.88) resulted in a significantly decreased risk of mortality in all patients with GC compared with patients with low expression of those genes. Furthermore, protective effects may additionally be observed in patients with intestinal-type GC with high expression of ADH1B (log-rank P=0.031; HR=0.64; 95% CI: 0.43-0.96) and patients with diffuse-type GC with high expression of ADH1A (log-rank P=0.014; HR=0.51; 95% CI: 0.3-0.88), ADH1B (log-rank P=0.04; HR=0.53; 95% CI: 0.29-0.98), ADH 4 (class II), π polypeptide (log-rank P=0.033; HR=0.58; 95% CI: 0.35-0.96) and ADH 6 (class V) (log-rank P=0.037; HR=0.59; 95% CI: 0.35-0.97) resulting in a significantly decreased risk of mortality compared with patients with low expression of those genes. In contrast, patients with diffuse-type GC with high expression of ADH5 (log-rank P=0.044; HR=1.66; 95% CI: 1.01-2.74) were significantly correlated with a poor prognosis. The results of the present study suggest that ADH1A and ADH1B may be potential

Prospective Randomized Trial Comparing Efficacy of Topical Loteprednol Etabonate 0.5% Versus Cyclosporine-A 0.05% for Treatment of Dry Eye Syndrome Following Hematopoietic Stem Cell Transplantation.

Science.gov (United States)

Boynton, Grace E; Raoof, Duna; Niziol, Leslie M; Hussain, Munira; Mian, Shahzad I

2015-07-01

To evaluate the safety and efficacy of topical loteprednol etabonate (LE) 0.5% compared with cyclosporine A (CsA) 0.05% for the prophylaxis and treatment of dry eye syndrome (DES) after hematopoietic stem cell transplantation (HSCT). Seventy-five patients were randomized to LE (n = 76 eyes of 38 patients) or CsA (n = 74 eyes of 37 patients) pre-HSCT. Lissamine green and fluorescein staining, tear break-up time, tear osmolarity (Osm), Schirmer score (Sch), intraocular pressure, visual acuity, and Ocular Surface Disease Index were assessed pre-HSCT, 3, 6, 9, and 12 months post-HSCT. There were no differences in DES incidence (P = 0.22; log-rank test) or progression (P = 0.41; log-rank test) between the 2 treatment arms during the course of the study. Among eyes with no DES at enrollment, the Kaplan-Meier analysis yielded a 90% rate of DES development in cyclosporine-treated eyes and a 79% rate of DES development in LE-treated eyes by 12 months post-HSCT. The Kaplan-Meier analysis of eyes with DES at enrollment demonstrated a 38% rate of disease progression among cyclosporine-treated eyes and a 26% rate of disease progression among loteprednol-treated eyes by 12 months. No patient in either group had an elevation of 10 mm Hg or greater from baseline at any study visit, and no patients had their treatment discontinued for elevation in intraocular pressure. Pre-HSCT initiation of LE 0.5% appears to be safe and may be as effective as CsA 0.5% for the treatment and prophylaxis of DES following HSCT.

Exercise Capacity and the Obesity Paradox in Heart Failure: The FIT (Henry Ford Exercise Testing) Project.

Science.gov (United States)

McAuley, Paul A; Keteyian, Steven J; Brawner, Clinton A; Dardari, Zeina A; Al Rifai, Mahmoud; Ehrman, Jonathan K; Al-Mallah, Mouaz H; Whelton, Seamus P; Blaha, Michael J

2018-05-03

To assess the influence of exercise capacity and body mass index (BMI) on 10-year mortality in patients with heart failure (HF) and to synthesize these results with those of previous studies. This large biracial sample included 774 men and women (mean age, 60±13 years; 372 [48%] black) with a baseline diagnosis of HF from the Henry Ford Exercise Testing (FIT) Project. All patients completed a symptom-limited maximal treadmill stress test from January 1, 1991, through May 31, 2009. Patients were grouped by World Health Organization BMI categories for Kaplan-Meier survival analyses and stratified by exercise capacity (<4 and ≥4 metabolic equivalents [METs] of task). Associations of BMI and exercise capacity with all-cause mortality were assessed using multivariable-adjusted Cox proportional hazards models. During a mean follow-up of 10.1±4.6 years, 380 patients (49%) died. Kaplan-Meier survival plots revealed a significant positive association between BMI category and survival for exercise capacity less than 4 METs (log-rank, P=.05), but not greater than or equal to 4 METs (P=.76). In the multivariable-adjusted models, exercise capacity (per 1 MET) was inversely associated, but BMI was not associated, with all-cause mortality (hazard ratio, 0.89; 95% CI, 0.85-0.94; P<.001 and hazard ratio, 0.99; 95% CI, 0.97-1.01; P=.16, respectively). Maximal exercise capacity modified the relationship between BMI and long-term survival in patients with HF, upholding the presence of an exercise capacity-obesity paradox dichotomy as observed over the short-term in previous studies. Copyright © 2018 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

Parental consanguineous marriages and clinical response to chemotherapy in locally advanced breast cancer patients.

Science.gov (United States)

Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam

2011-03-28

The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

Science.gov (United States)

2014-03-01

8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

The effect of quitting smoking on the risk of unfavorable events after surgical treatment of oral potentially malignant lesions

DEFF Research Database (Denmark)

Vladimirov, B S; Schiødt, Morten

2009-01-01

smokers at the time of diagnosis and were treated surgically. Patients were advised to quit smoking at each visit. The change of smoking habits and occurrence of unfavorable events were noted during follow-up. Descriptive statistics, Fischer's exact test, Kaplan-Meier curves with log-rank test, and Cox......The aim of this study was to examine if cessation of smoking after surgical excision of oral potentially malignant lesions in smokers reduced the risk of recurrences, development of new lesions or malignancies. 51 patients with oral leukoplakia or erythroplakia were included. They were daily...... proportional hazards model were used for analysis. 16 patients (31%) quit smoking during the observation period. Only one quitter (6%) developed recurrence compared with 11 continuing smokers (33%) (p

Primary mediastinal large B-cell lymphoma: Clinical features, prognostic factors and survival with RCHOP in Arab patients in the PET scan era.

Science.gov (United States)

Al Shemmari, Salem; Sankaranarayanan, Sreedharan P; Krishnan, Yamini

2014-07-01

PMBCL is a distinct type of nonhodgkins lymphoma with specific clinicopathological features. To clarify clinical features, treatment alternatives and outcomes, we evaluated 28 Arab patients treated with chemotherapy or radiotherapy between 2006 and 2011. PMBCL lymphoma patients identified according to WHO classification and treated at KCCC between 2006 and 2011 were included in this study. Demographic and clinical data are presented as means or medians. Overall survival was estimated using the Kaplan-Meier method. Survival rates were compared using the log-rank test. A P lymphoma entity seen in the young with good survival. The role of PET scan for response evaluation and the type of consolidation therapy needs to be further clarified.

Lenalidomide-induced myelosuppression is associated with renal dysfunction: adverse events evaluation of treatment-naïve patients undergoing front-line lenalidomide and dexamethasone therapy.

Science.gov (United States)

Niesvizky, Ruben; Naib, Tara; Christos, Paul J; Jayabalan, David; Furst, Jessica R; Jalbrzikowski, Jessica; Zafar, Faiza; Mark, Tomer; Lent, Richard; Pearse, Roger N; Ely, Scott; Leonard, John P; Mazumdar, Madhu; Chen-Kiang, Selina; Coleman, Morton

2007-09-01

Data on 72 patients receiving lenalidomide/dexamethasone for multiple myeloma (MM) was used to determine the factors that are associated with lenalidomide-induced myelosuppression. Eight of 14 patients with grade > or =3 myelosuppression had baseline creatinine clearance (CrCl) < or =0.67 ml/s. Kaplan-Meier analysis by log-rank test demonstrated a significant association (P < 0.0001) between renal insufficiency and time to myelosuppression (hazard ratio = 8.4; 95% confidence interval 2.9-24.7, P = 0.0001). Therefore, CrCl is inversely associated with significant myelosuppression. Caution should be exercised when lenalidomide therapy is commenced and CrCl should be incorporated as a determinant of the initial dosing of lenalidomide in MM patients.

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b and c

International Nuclear Information System (INIS)

Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.

2008-01-01

Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be

Simple prognostic model for patients with advanced cancer based on performance status.

Science.gov (United States)

Jang, Raymond W; Caraiscos, Valerie B; Swami, Nadia; Banerjee, Subrata; Mak, Ernie; Kaya, Ebru; Rodin, Gary; Bryson, John; Ridley, Julia Z; Le, Lisa W; Zimmermann, Camilla

2014-09-01

Providing survival estimates is important for decision making in oncology care. The purpose of this study was to provide survival estimates for outpatients with advanced cancer, using the Eastern Cooperative Oncology Group (ECOG), Palliative Performance Scale (PPS), and Karnofsky Performance Status (KPS) scales, and to compare their ability to predict survival. ECOG, PPS, and KPS were completed by physicians for each new patient attending the Princess Margaret Cancer Centre outpatient Oncology Palliative Care Clinic (OPCC) from April 2007 to February 2010. Survival analysis was performed using the Kaplan-Meier method. The log-rank test for trend was employed to test for differences in survival curves for each level of performance status (PS), and the concordance index (C-statistic) was used to test the predictive discriminatory ability of each PS measure. Measures were completed for 1,655 patients. PS delineated survival well for all three scales according to the log-rank test for trend (P statistic was similar for all three scales and ranged from 0.63 to 0.64. We present a simple tool that uses PS alone to prognosticate in advanced cancer, and has similar discriminatory ability to more complex models. Copyright © 2014 by American Society of Clinical Oncology.

Perioperative and mid-term oncologic outcomes of robotic assisted radical cystectomy with totally intracorporeal neobladder: Results of a propensity score matched comparison with open cohort from a single-centre series.

Science.gov (United States)

Simone, Giuseppe; Tuderti, Gabriele; Misuraca, Leonardo; Anceschi, Umberto; Ferriero, Mariaconsiglia; Minisola, Francesco; Guaglianone, Salvatore; Gallucci, Michele

2018-04-17

In this study, we compared perioperative and oncologic outcomes of patients treated with either open or robot-assisted radical cystectomy and intracorporeal neobladder at a tertiary care center. The institutional prospective bladder cancer database was queried for "cystectomy with curative intent" and "neobladder". All patients underwent robot-assisted radical cystectomy and intracorporeal neobladder or open radical cystectomy and orthotopic neobladder for high-grade non-muscle invasive bladder cancer or muscle invasive bladder cancer with a follow-up length ≥2 years were included. A 1:1 propensity score matching analysis was used. Kaplan-Meier method was performed to compare oncologic outcomes of selected cohorts. Survival rates were computed at 1,2,3 and 4 years after surgery and the log rank test was applied to assess statistical significance between the matched groups. Overall, 363 patients (299 open and 64 robotic) were included. Open radical cystectomy patients were more frequently male (p = 0.08), with higher pT stages (p = 0.003), lower incidence of urothelial histologies (p = 0.05) and lesser adoption of neoadjuvant chemotherapy (open radical cystectomy cases (all p ≥ 0.22). Open cohort showed a higher rate of perioperative overall complications (91.3% vs 42.2%, p 0.001). At Kaplan-Meier analysis robotic and open cohorts displayed comparable disease-free survival (log-rank p = 0.746), cancer-specific survival (p = 0.753) and overall-survival rates (p = 0.909). Robot-assisted radical cystectomy and intracorporeal neobladder provides comparable oncologic outcomes of open radical cystectomy and orthotopic neobladder at intermediate term survival analysis. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

Prior history of non-melanoma skin cancer is associated with increased mortality in patients with chronic lymphocytic leukemia

Science.gov (United States)

Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola

2009-01-01

We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092

Predictors of survival in surgically treated patients of spinal metastasis

Directory of Open Access Journals (Sweden)

Pravin Padalkar

2011-01-01

Full Text Available Background: The spinal metastasis occurs in up to 40% of cancer patient. We compared the Tokuhashi and Tomita scoring systems, two commonly used scoring systems for prognosis in spinal metastases. We also assessed the different variables separately with respect to their value in predicting postsurgical life expectancy. Finally, we suggest criteria for selecting patients for surgery based on the postoperative survival pattern. Materials and Methods: We retrospectively analyzed 102 patients who had been operated for metastatic disease of the spine. Predictive scoring was done according to the scoring systems proposed by Tokuhashi and Tomita. Overall survival was assessed using Kaplan-Meier survival analysis. Using the log rank test and Cox regression model we assessed the value of the individual components of each scoring system for predicting survival in these patients. Result: The factors that were most significantly associated with survival were the general condition score (Karnofsky Performance Scale (P=.000, log rank test, metastasis to internal organs (P=.0002 log rank test, and number of extraspinal bone metastases (P=.0058. Type of primary tumor was not found to be significantly associated with survival according to the revised Tokuhashi scoring system (P=.9131, log rank test. Stepwise logistic regression revealed that the Tomita score correlated more closely with survival than the Tokuhashi score. Conclusion: The patient′s performance status, extent of visceral metastasis, and extent of bone metastases are significant predictors of survival in patients with metastatic disease. Both revised Tokuhashi and Tomita scores were significantly correlated with survival. A revised Tokuhashi score of 7 or more and a Tomita score of 6 or less indicated >50% chance of surviving 6 months postoperatively. We recommend that the Tomita score be used for prognostication in patients who are contemplating surgery, as it is simpler to score and has a higher

Relationship between LAPTM4B Gene Polymorphism and Prognosis of Patients following Tumor Resection for Colorectal and Esophageal Cancers

Science.gov (United States)

Xing, Xiaofang; Du, Hong; Zhou, Chunlian; Zhang, Qingyun; Hao, Chunyi; Wen, Xianzi; Ji, Jiafu

2016-01-01

Background Lysosome-associated transmembrane-4 beta (LAPTM4B) is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients. Method Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort), 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher’s exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model. Results LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts). LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045). Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS) in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively), but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively). Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR) = 0.432; 95% confidence interval (CI) = 0.243–0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638–1.804 and 0.998, HR = 1.000, 95% CI = 0.663–1.530, respectively). Conclusion These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might

Relationship between LAPTM4B Gene Polymorphism and Prognosis of Patients following Tumor Resection for Colorectal and Esophageal Cancers.

Directory of Open Access Journals (Sweden)

Xiaojing Cheng

Full Text Available Lysosome-associated transmembrane-4 beta (LAPTM4B is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients.Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort, 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher's exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model.LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts. LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045. Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively, but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively. Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR = 0.432; 95% confidence interval (CI = 0.243-0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638-1.804 and 0.998, HR = 1.000, 95% CI = 0.663-1.530, respectively.These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might be a useful prognostic indicator for

Efficacy of qualitative response assessment interpretation criteria at 18F-FDG PET-CT for predicting outcome in locally advanced cervical carcinoma treated with chemoradiotherapy

International Nuclear Information System (INIS)

Scarsbrook, Andrew; Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag; Swift, Sarah; Cooper, Rachel

2017-01-01

To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced

Efficacy of qualitative response assessment interpretation criteria at 18F-FDG PET-CT for predicting outcome in locally advanced cervical carcinoma treated with chemoradiotherapy

Energy Technology Data Exchange (ETDEWEB)

Scarsbrook, Andrew [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); University of Leeds, Leeds Institute of Cancer and Pathology, Leeds (United Kingdom); Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); Swift, Sarah [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Cooper, Rachel [Leeds Teaching Hospitals NHS Trust, Department of Clinical Oncology, Leeds (United Kingdom)

2017-04-15

To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced

Determining factors behind the PageRank log-log plot

NARCIS (Netherlands)

Volkovich, Y.; Litvak, Nelli; Donato, D.

We study the relation between PageRank and other parameters of information networks such as in-degree, out-degree, and the fraction of dangling nodes. We model this relation through a stochastic equation inspired by the original definition of PageRank. Further, we use the theory of regular variation

Prognostic value of MLH1 promoter methylation in male patients with esophageal squamous cell carcinoma.

Science.gov (United States)

Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei

2017-04-01

The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.

Treatment of malignant biliary occlusion by means of transhepatic percutaneous biliary drainage with insertion of metal stents - results of an 8-year follow-up and analysis of the prognostic parameters; Behandlung der malignen Gallenwegsstenose mittels perkutaner transhepatischer Metallendoprothesenimplantation: 8 Jahres-Ergebnisse und Analyse prognostischer Faktoren

Energy Technology Data Exchange (ETDEWEB)

Alfke, H.; Alfke, B.; Froelich, J.J.; Klose, K.J.; Wagner, H.J. [Klinik fuer Strahlendiagnostik Philipps Univ. Marburg (Germany)

2003-08-01

Purpose: To analyze outcome and predictive factors for patient survival and patency rates of unresectable malignant biliary obstruction treated with percutaneous transhepatic insertion of metal stents. Materials and Methods: This is a retroselective analysis of 130 patients treated in one interventional radiological center with data collected from patient records and by telephone interviews. The procedure-related data had been prospectively documented in a computer data base. The Kaplan-Meier analysis was performed for univariate and multivariate comparison of survival and patency rates with the log-rank test used for different tumor types. Predictive factors for survival and 30-day mortality were analyzed by a stepwise logistic regression. Results: Underlying causes of malignant biliary obstructions were cholangiocarcinoma in 50, pancreatic carcinoma in 29, liver metastases in 27, gallbladder carcinoma in 20, and other tumors in 4 patients. The technical success rate was 99%, the complication rate 27% and the 30-day mortality 11%. Primary patency rates (406 days with a median of 207 days) did not differ significantly for different tumor types. The survival rates were significantly (p = 0.03 by log-rank test) better for patients with cholangiocarcinoma than for patients with pancreatic carcinoma and liver metastases. Multiple regression analysis revealed no predictive factor for patient survival and 30-day mortality. Conclusion: Percutaneous transhepatic insertion of metal biliary endoprostheses offers a good initial and long-term relief of jaundice caused by malignant biliary obstruction. Although survival rates for patients with cholangiocarcinoma are better than for other causes of malignant biliary obstruction, a clear predictive factor is lacking for patients undergoing palliative biliary stent insertion. (orig.) [German] Ziel: Ergebnisse der perkutanen transhepatischen Metallendoprothesenimplantation bei malignen Gallenwegsverschluessen zu evaluieren und

Prognostic relevance of cytochrome C oxidase in primary glioblastoma multiforme.

Directory of Open Access Journals (Sweden)

Corinne E Griguer

Full Text Available Patients with primary glioblastoma multiforme (GBM have one of the lowest overall survival rates among cancer patients, and reliable biomarkers are necessary to predict patient outcome. Cytochrome c oxidase (CcO promotes the switch from glycolytic to OXPHOS metabolism, and increased CcO activity in tumors has been associated with tumor progression after chemotherapy failure. Thus, we investigated the relationship between tumor CcO activity and the survival of patients diagnosed with primary GBM. A total of 84 patients with grade IV glioma were evaluated in this retrospective cohort study. Cumulative survival was calculated by the Kaplan-Meier method and analyzed by the log-rank test, and univariate and multivariate analyses were performed with the Cox regression model. Mitochondrial CcO activity was determined by spectrophotometrically measuring the oxidation of cytochrome c. High CcO activity was detected in a subset of glioma tumors (∼30%, and was an independent prognostic factor for shorter progression-free survival and overall survival [P = 0.0087 by the log-rank test, hazard ratio = 3.57 for progression-free survival; P<0.001 by the log-rank test, hazard ratio = 10.75 for overall survival]. The median survival time for patients with low tumor CcO activity was 14.3 months, compared with 6.3 months for patients with high tumor CcO activity. High CcO activity occurs in a significant subset of high-grade glioma patients and is an independent predictor of poor outcome. Thus, CcO activity may serve as a useful molecular marker for the categorization and targeted therapy of GBMs.

Air injection test on a Kaplan turbine: prototype - model comparison

Science.gov (United States)

Angulo, M.; Rivetti, A.; Díaz, L.; Liscia, S.

2016-11-01

Air injection is a very well-known resource to reduce pressure pulsation magnitude in turbines, especially on Francis type. In the case of large Kaplan designs, even when not so usual, it could be a solution to mitigate vibrations arising when tip vortex cavitation phenomenon becomes erosive and induces structural vibrations. In order to study this alternative, aeration tests were performed on a Kaplan turbine at model and prototype scales. The research was focused on efficiency of different air flow rates injected in reducing vibrations, especially at the draft tube and the discharge ring and also in the efficiency drop magnitude. It was found that results on both scales presents the same trend in particular for vibration levels at the discharge ring. The efficiency drop was overestimated on model tests while on prototype were less than 0.2 % for all power output. On prototype, air has a beneficial effect in reducing pressure fluctuations up to 0.2 ‰ of air flow rate. On model high speed image computing helped to quantify the volume of tip vortex cavitation that is strongly correlated with the vibration level. The hydrophone measurements did not capture the cavitation intensity when air is injected, however on prototype, it was detected by a sonometer installed at the draft tube access gallery.

In silico sampling reveals the effect of clustering and shows that the log-normal rank abundance curve is an artefact

NARCIS (Netherlands)

Neuteboom, J.H.; Struik, P.C.

2005-01-01

The impact of clustering on rank abundance, species-individual (S-N)and species-area curves was investigated using a computer programme for in silico sampling. In a rank abundance curve the abundances of species are plotted on log-scale against species sequence. In an S-N curve the number of species

A Matched Case-Control Study on Open and Endovascular Treatment of Popliteal Artery Aneurysms.

Science.gov (United States)

Dorigo, W; Fargion, A; Masciello, F; Piffaretti, G; Pratesi, G; Giacomelli, E; Pratesi, C

2018-01-01

To compare early and late results of open and endovascular management of popliteal artery aneurysm in a retrospective single-center matched case-control study Methods: From 1981 to 2015, 309 consecutive interventions for popliteal artery aneurysm were performed in our institution, in 59 cases with endovascular repair and in 250 cases with open repair. Endovascular repair was preferred in older asymptomatic patients, while open repair was offered more frequently to patients with a thrombosed popliteal artery aneurysm and a poor run-off status. A one-to-one coarsened exact matching on the basis of the baseline demographic, clinical, and anatomical covariates significantly different between the two treatment options was performed and two equivalent groups of 56 endovascular repairs and open repairs were generated. The two groups were compared in terms of perioperative results with χ 2 test and of follow-up outcomes with the Kaplan-Meier curves and log-rank test. There were no differences between the two groups in terms of perioperative outcomes. Median duration of follow-up was 38 months. Five-year survival rates were 94% in endovascular repair group and 89.5% in open repair group (p = 0.4, log-rank 0.6). Primary patency rates at 1, 3, and 5 years were 81%, 78%, and 72% in endovascular repair group and 82.5%, 80%, and 64% in open repair group (p = 0.8, log-rank 0.01). Freedom from reintervention at 5 years was 65.5% in endovascular repair group and 76% in open repair group (p = 0.2, log-rank 1.2). Secondary patency at 1, 3, and 5 years was 94%, 86%, and 74% in endovascular repair group, and 94%, 89%, and 71% in open repair group, respectively (p = 0.9, log-rank 0.01). The rates of limb preservation at 5 years were 94% in endovascular repair group and 86.4% in open repair group (p = 0.3, log-rank 0.8). Open repair and endovascular repair of popliteal artery aneurysms provided in this retrospective single-center experience similar perioperative and follow-up results in

Incidence and Outcome of BRCA Mutations in Unselected Patients with Triple Receptor-Negative Breast Cancer.

LENUS (Irish Health Repository)

Gonzalez-Angulo, Ana M

2011-03-01

To investigate the incidence of germline and somatic BRCA1\\/2 mutations in unselected patients with triple-negative breast cancer (TNBC) and determine the prognostic significance of carrying a mutation. Methods: DNA was obtained from 77 TNBC and normal tissues. BRCA1\\/2 exons\\/flanking regions were sequenced from tumor and patients classified as mutant or wild type (WT). Sequencing was repeated from normal tissue to identify germline and somatic mutations. Patient characteristics were compared with chi-square. Survival was estimated by Kaplan-Meier method and compared with log-rank. Cox proportional hazards models were fit to determine the independent association of mutation status with outcome.

Long-Term Safety of In Utero Exposure to Anti-TNFα Drugs for the Treatment of Inflammatory Bowel Disease

DEFF Research Database (Denmark)

Chaparro, M; Verreth, A; Lobaton, T

2018-01-01

OBJECTIVES: The long-term safety of exposure to anti-tumor necrosis factor (anti-TNFα) drugs during pregnancy has received little attention. We aimed to compare the relative risk of severe infections in children of mothers with inflammatory bowel disease (IBD) who were exposed to anti-TNFα drugs...... in utero with that of children who were not exposed to the drugs. METHODS: Retrospective multicenter cohort study. Exposed cohort: children from mothers with IBD receiving anti-TNFα medication (with or without thiopurines) at any time during pregnancy or during the 3 months before conception. Non......-exposed cohort: children from mothers with IBD not treated with anti-TNFα agents or thiopurines at any time during pregnancy or the 3 months before conception. The cumulative incidence of severe infections after birth was estimated using Kaplan-Meier curves, which were compared using the log-rank test. Cox...

Survival pathological prognosis factors in breast cancer

International Nuclear Information System (INIS)

Gonzalez-Longoria Boada, Lourdes B.

2012-01-01

A descriptive and longitudinal study of 273 women with breast cancer belonging to Granma province was carried out from 2003 to 2004, in order to analyze the survival of this female population, reason why the method of Kaplan Meier was used for the calculation of the mentioned variable and the Log Rank test was used for the comparison of curves. Patients with higher survival at 5 years were those who had tumors of 2 cm or less (87.5%), histological grade I (90.3%), nuclear grade I (88.3%), as well as the absence of vascular, lymphatic or lymph node invasion (with 80.6; 74.9 and 6.1% respectively). Also, tumor size, histological and nuclear grade, nodal status, as well as lymphatic and vascular invasion constituted prognosis factors, which favored the individualization of therapeutic behaviors

Removal of Endobronchial Malignant Mass by Cryotherapy Improved Performance Status to Receive Chemotherapy

Science.gov (United States)

Hsieh, Meng-Heng; Wang, Tsai-Yu; Yu, Chih-Teng; Chou, Chun-Liang; Lin, Shu-Min; Kuo, Chih-Hsi; Chung, Fu-Tsai

2014-01-01

Although malignant endobronchial mass (MEM) has poor prognosis, cryotherapy is reportedly a palliative treatment. Clinical data on postcryotherapy MEM patients in a university-affiliated hospital between 2007 and 2011 were evaluated. Survival curve with or without postcryotherapy chemotherapy and performance status (PS) improvement of these subjects were analyzed using the Kaplan-Meier method. There were 59 patients (42 males), with median age of 64 years (range, 51–76, and median performance status of 2 (interquartile range [IQR], 2-3). Postcryotherapy complications included minor bleeding (n = 12) and need for multiple procedures (n = 10), while outcomes were relief of symptoms (n = 51), improved PS (n = 45), and ability to receive chemotherapy (n = 40). The survival of patients with chemotherapy postcryotherapy was longer than that of patients without such chemotherapy (median, 534 versus 106 days; log-rank test, P = 0.007; hazard ratio, 0.25; 95% confidence interval, 0.10–0.69). The survival of patients with PS improvement postcryotherapy was longer than that of patients without PS improvement (median, 406 versus 106 days; log-rank test, P = 0.02; hazard ratio, 0.28; 95% confidence interval, 0.10–0.81). Cryotherapy is a feasible treatment for MEM. With better PS after cryotherapy, further chemotherapy becomes possible for patients to improve survival when MEM caused dyspnea and poor PS. PMID:25383370

ABCA Transporter Gene Expression and Poor Outcome in Epithelial Ovarian Cancer

DEFF Research Database (Denmark)

Hedditch, Ellen L; Gao, Bo; Russell, Amanda J

2014-01-01

-wide association study. Impact of short interfering RNA-mediated gene suppression was determined by colony forming and migration assays. Association with survival was assessed with Kaplan-Meier analysis and log-rank tests. All statistical tests were two-sided. RESULTS: Associations with outcome were observed...... with ABC transporters of the "A" subfamily, but not with multidrug transporters. High-level expression of ABCA1, ABCA6, ABCA8, and ABCA9 in primary tumors was statistically significantly associated with reduced survival in serous ovarian cancer patients. Low levels of ABCA5 and the C-allele of rs536009...... ABCA1, ABCA5 and ABCA9 gene expression = 33.2 months, 95% CI = 26.4 to 40.1; vs 55.3 months in the group with favorable ABCA gene expression, 95% CI = 49.8 to 60.8; P = .001), independently of tumor stage or surgical debulking status. Suppression of cholesterol transporter ABCA1 inhibited ovarian...

Characteristics and outcomes of patients with Ewing sarcoma over 40 years of age at diagnosis.

Science.gov (United States)

Karski, Erin E; Matthay, Katherine K; Neuhaus, John M; Goldsby, Robert E; Dubois, Steven G

2013-02-01

The peak incidence of Ewing sarcoma (EWS) is in adolescence, with little known about patients who are ≥40 years at diagnosis. We describe the clinical characteristics and survival of this rare group. This retrospective cohort study utilized the Surveillance Epidemiology and End Results database. 2780 patients were identified; including 383 patients diagnosed ≥40 years. Patient characteristics between age groups were compared using chi-squared tests. Survival from diagnosis to death was estimated via Kaplan-Meier methods, compared with log-rank tests, and modeled using multivariable Cox methods. A competing risks analysis was performed to evaluate death due to cancer. Patients ≥40 years of age were more likely to have extra-skeletal tumors (66.1% vs. 31.7%; p extra-skeletal tumors, metastatic disease, and axial primary tumors suggesting a difference in tumor biology. Independent of differences in these characteristics, older patients also have a lower survival rate. Copyright © 2012 Elsevier Ltd. All rights reserved.

Changes in acute response to radiation after implementation of new national guidelines for head and neck cancer

DEFF Research Database (Denmark)

Hansen, C. R.; Bertelsen, Anders; Zukauskaite, R.

2015-01-01

of volume of CTV1 for most institutions which previously used different margins. Change in CTV1 volume definition could influence the risk and time evolution of adverse effects e.g. mucositis. This study investigates change in acute response during RT in a centre where GTV to CTV1 margin was increased from......Purpose/Objective: New national guidelines (GL) for radiotherapy (RT) of head and neck cancer (HNC) were implemented at the beginning of 2013. One purpose of the new GL was to nationally standardise the expansion from GTV to high risk CTV (CTV1). This standardisation has resulted in change...... endpoints were dichotomized, grade 0- 1 vs 2+ or 0-2 vs 3+. Potential change in actuarial cumulative incidence (One minus the Kaplan Meier estimator) of mucositis was tested using the log-rank test. To stratify for the potential effect between non-accelerated (5 fx/w) and accelerated (6/10 fx/w) treatments...

Comparison of colorectal and gastric cancer: Survival and prognostic factors

International Nuclear Information System (INIS)

Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R

2009-01-01

Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)

Factors affecting commencement and cessation of smoking behaviour in Malaysian adults

Directory of Open Access Journals (Sweden)

Ghani Wan

2012-03-01

Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.

Abnormal sleep duration associated with hastened depressive recurrence in bipolar disorder.

Science.gov (United States)

Gershon, Anda; Do, Dennis; Satyanarayana, Satyanand; Shah, Saloni; Yuen, Laura D; Hooshmand, Farnaz; Miller, Shefali; Wang, Po W; Ketter, Terence A

2017-08-15

Abnormal sleep duration (ASD, disorder (BD), and often persists beyond acute mood episodes. Few longitudinal studies have examined the ASD's impact upon BD illness course. The current study examined the longitudinal impact of ASD upon bipolar depressive recurrence/recovery. Outpatients referred to the Stanford BD Clinic during 2000-2011 were assessed with the Systematic Treatment Enhancement Program for BD (STEP-BD) Affective Disorders Evaluation at baseline, and with the Clinical Monitoring Form at monthly follow-ups for up to two years of naturalistic treatment. Prevalence and clinical correlates of ASD in 93 recovered (euthymic ≥8 weeks) and 153 depressed BD patients were assessed. Kaplan-Meier analyses (Log-Rank tests) assessed relationships between baseline ASD and longitudinal depressive severity, with Cox Proportional Hazard analyses assessing potential mediators. ASD was only half as common among recovered versus depressed BD outpatients, but was significantly associated with hastened depressive recurrence (Log-Rank p=0.007), mediated by lifetime anxiety disorder and attenuated by lifetime history of psychosis, and had only a non-significant tendency towards association with delayed depressive recovery (Log-Rank p=0.07). In both recovered and depressed BD outpatients, baseline ASD did not have significant association with any baseline BD illness characteristic. Self-reported sleep duration. Limited generalizability beyond our predominately white, female, educated, insured American BD specialty clinic sample. Baseline ASD among recovered BD patients may be a risk marker for hastened depressive recurrence, suggesting it could be an important therapeutic target between mood episodes. Copyright © 2017 Elsevier B.V. All rights reserved.

PTFE grafts versus tunneled cuffed catheters for hemodialysis: which is the second choice when arteriovenous fistula is not feasible?

Science.gov (United States)

Donati, Gabriele; Cianciolo, Giuseppe; Mauro, Raffaella; Rucci, Paola; Scrivo, Anna; Marchetti, Antonio; Giampalma, Emanuela; Golfieri, Rita; Panicali, Laura; Iorio, Mario; Stella, Andrea; La Manna, Gaetano; Stefoni, Sergio

2015-02-01

Vascular access-related complications are still one of the leading causes of morbidity in hemodialysis patients. The aim of this study was to compare polytetrafluoroethylene (PTFE) grafts versus tunneled cuffed permanent catheters (TCCs) in terms of vascular access and patients' survival. An observational study was carried out with a 2-year follow-up. Eighty-seven chronic hemodialysis patients were enrolled: 31 with a PTFE graft as vascular access for hemodialysis versus 56 with a TCC. Patients' mean age was 63.8 ± 14.6 (grafts) versus 73.5 ± 11.3 years (TCCs), P = 0.001. Significantly more patients with TCC had atrial fibrillation than patients with grafts (30.3% versus 6.5%, P = 0.01). In an unadjusted Kaplan-Meier analysis, median TCC survival at 24 months was 5.4 months longer than that of PTFE grafts but not significantly (log-rank test = 1.3, P = ns). In a Cox regression analysis adjusted for age, gender, number of previous vascular accesses, diabetes, atrial fibrillation, smoking, and any complication, this lack of significant difference in survival of the vascular access between TCC and PTFE groups was confirmed and diabetes proved to be an independent risk factor for the survival of both vascular accesses considered (P = 0.02). In an unadjusted Kaplan-Meier analysis, a higher mortality was found in the TCC group than in the PTFE group at 24 months (log-rank test = 10.07, P PTFE grafts. When an arteriovenous fistula (AVF) is not possible, PTFE grafts can be considered the vascular access of second choice, whereas TCCs can be used when an AVF or PTFE graft are not feasible or as a bridge to AVF or PTFE graft creation. Copyright © 2014 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Factors Predictive of Symptomatic Radiation Injury After Linear Accelerator-Based Stereotactic Radiosurgery for Intracerebral Arteriovenous Malformations

Energy Technology Data Exchange (ETDEWEB)

Herbert, Christopher, E-mail: cherbert@bccancer.bc.ca [Department of Radiation Oncology, British Columbia Cancer Agency, Vancouver, BC (Canada); Moiseenko, Vitali [Department of Medical Physics, British Columbia Cancer Agency, Vancouver, BC (Canada); McKenzie, Michael [Department of Radiation Oncology, British Columbia Cancer Agency, Vancouver, BC (Canada); Redekop, Gary [Division of Neurosurgery, Vancouver General Hospital, University of British Columbia, Vancouver, BC (Canada); Hsu, Fred [Department of Radiation Oncology, British Columbia Cancer Agency, Abbotsford, BC (Canada); Gete, Ermias; Gill, Brad; Lee, Richard; Luchka, Kurt [Department of Medical Physics, British Columbia Cancer Agency, Vancouver, BC (Canada); Haw, Charles [Division of Neurosurgery, Vancouver General Hospital, University of British Columbia, Vancouver, BC (Canada); Lee, Andrew [Department of Neurosurgery, Royal Columbian Hospital, New Westminster, BC (Canada); Toyota, Brian [Division of Neurosurgery, Vancouver General Hospital, University of British Columbia, Vancouver, BC (Canada); Martin, Montgomery [Department of Medical Imaging, British Columbia Cancer Agency, Vancouver, BC (Canada)

2012-07-01

Purpose: To investigate predictive factors in the development of symptomatic radiation injury after treatment with linear accelerator-based stereotactic radiosurgery for intracerebral arteriovenous malformations and relate the findings to the conclusions drawn by Quantitative Analysis of Normal Tissue Effects in the Clinic (QUANTEC). Methods and Materials: Archived plans for 73 patients who were treated at the British Columbia Cancer Agency were studied. Actuarial estimates of freedom from radiation injury were calculated using the Kaplan-Meier method. Univariate and multivariate Cox proportional hazards models were used for analysis of incidence of radiation injury. Log-rank test was used to search for dosimetric parameters associated with freedom from radiation injury. Results: Symptomatic radiation injury was exhibited by 14 of 73 patients (19.2%). Actuarial rate of symptomatic radiation injury was 23.0% at 4 years. Most patients (78.5%) had mild to moderate deficits according to Common Terminology Criteria for Adverse Events, version 4.0. On univariate analysis, lesion volume and diameter, dose to isocenter, and a V{sub x} for doses {>=}8 Gy showed statistical significance. Only lesion diameter showed statistical significance (p < 0.05) in a multivariate model. According to the log-rank test, AVM volumes >5 cm{sup 3} and diameters >30 mm were significantly associated with the risk of radiation injury (p < 0.01). The V{sub 12} also showed strong association with the incidence of radiation injury. Actuarial incidence of radiation injury was 16.8% if V{sub 12} was <28 cm{sup 3} and 53.2% if >28 cm{sup 3} (log-rank test, p = 0.001). Conclusions: This study confirms that the risk of developing symptomatic radiation injury after radiosurgery is related to lesion diameter and volume and irradiated volume. Results suggest a higher tolerance than proposed by QUANTEC. The widely differing findings reported in the literature, however, raise considerable uncertainties.

P wave dispersion and maximum P wave duration are independently associated with rapid renal function decline.

Science.gov (United States)

Su, Ho-Ming; Tsai, Wei-Chung; Lin, Tsung-Hsien; Hsu, Po-Chao; Lee, Wen-Hsien; Lin, Ming-Yen; Chen, Szu-Chia; Lee, Chee-Siong; Voon, Wen-Chol; Lai, Wen-Ter; Sheu, Sheng-Hsiung

2012-01-01

The P wave parameters measured by 12-lead electrocardiogram (ECG) are commonly used as noninvasive tools to assess for left atrial enlargement. There are limited studies to evaluate whether P wave parameters are independently associated with decline in renal function. Accordingly, the aim of this study is to assess whether P wave parameters are independently associated with progression to renal end point of ≥25% decline in estimated glomerular filtration rate (eGFR). This longitudinal study included 166 patients. The renal end point was defined as ≥25% decline in eGFR. We measured two ECG P wave parameters corrected by heart rate, i.e. corrected P wave dispersion (PWdisperC) and corrected P wave maximum duration (PWdurMaxC). Heart function and structure were measured from echocardiography. Clinical data, P wave parameters, and echocardiographic measurements were compared and analyzed. Forty-three patients (25.9%) reached renal end point. Kaplan-Meier curves for renal end point-free survival showed PWdisperC > median (63.0 ms) (log-rank P = 0.004) and PWdurMaxC > median (117.9 ms) (log-rank Pfunction decline.

Association between poor clinical prognosis and sleep duration among breast cancer patients

Directory of Open Access Journals (Sweden)

Thalyta Cristina Mansano-Schlosser

Full Text Available ABSTRACT Objective: to investigate the association between clinical progression and the quality and duration of sleep in women with breast cancer. Method: longitudinal study, with 114 participants, conducted in a hospital in Brazil. The instruments used were: questionnaire for sociodemographic and clinical characterization, Pittsburgh Sleep Quality Index; Beck Depression Inventory and Herth Hope Scale. Data were analyzed through descriptive statistics and survival analyses (outcome: poor clinical progression, using the Kaplan-Meier curve, Log-rank test and Cox proportional model. Results: a higher probability of poor clinical progression was verified in women with sleep durations of less than six hours or nine hours and over (p=.0173. Conclusion: the results suggest the importance of further studies that seek to verify whether the quantitative management of sleep disorders would have an impact on the progression of breast cancer. Women should be encouraged to report sleep problems to nurses.

Co-integration Rank Testing under Conditional Heteroskedasticity

DEFF Research Database (Denmark)

Cavaliere, Guiseppe; Rahbæk, Anders; Taylor, A.M. Robert

null distributions of the rank statistics coincide with those derived by previous authors who assume either i.i.d. or (strict and covariance) stationary martingale difference innovations. We then propose wild bootstrap implementations of the co-integrating rank tests and demonstrate that the associated...... bootstrap rank statistics replicate the first-order asymptotic null distributions of the rank statistics. We show the same is also true of the corresponding rank tests based on the i.i.d. bootstrap of Swensen (2006). The wild bootstrap, however, has the important property that, unlike the i.i.d. bootstrap......, it preserves in the re-sampled data the pattern of heteroskedasticity present in the original shocks. Consistent with this, numerical evidence sug- gests that, relative to tests based on the asymptotic critical values or the i.i.d. bootstrap, the wild bootstrap rank tests perform very well in small samples un...

Environmental influences on antibody-enhanced dengue disease outcomes.

Science.gov (United States)

Diniz, Daniel Guerreiro; Fôro, César Augusto Raiol; Turiel, Maíra C Pereira; Sosthenes, Marcia C K; Demachki, Sâmia; Gomes, Giovanni Freitas; Rego, Carla M Damasceno; Magalhães, Marina Cutrim; Pinho, Brunno Gomes; Ramos, Juliana Pastana; Casseb, Samir M Moraes; Brito, Maysa de Vasconcelos; da Silva, Eliana Vieira Pinto; Nunes, Marcio Roberto Teixeira; Diniz, José Antonio Picanço; Cunningham, Colm; Perry, Victor Hugh; Vasconcelos, Pedro F Costa; Diniz, Cristovam W Picanço

2012-12-01

Because an enriched environment (EE) enhances T-cell activity and T-lymphocytes contribute to immunopathogenesis during heterologous dengue virus (DENV) infections, we hypothesised that an EE increases dengue severity. To compare single serotype (SS) and antibody-enhanced disease (AED) infections regimens, serial intraperitoneal were performed with DENV3 (genotype III) infected brain homogenate or anti-DENV2 hyperimmune serum followed 24 h later by DENV3 (genotype III) infected brain homogenate. Compared AED for which significant differences were detected between the EE and impoverished environmental (IE) groups (Kaplan-Meyer log-rank test, p = 0.0025), no significant differences were detected between the SS experimental groups (Kaplan-Meyer log-rank test, p = 0.089). Survival curves from EE and IE animals infected with the AED regimen were extended after corticoid injection and this effect was greater in the EE than in the IE group (Kaplan-Meyer log-rank test, p = 0.0162). Under the AED regimen the EE group showed more intense clinical signs than the IE group. Dyspnoea, tremor, hunched posture, ruffled fur, immobility, pre-terminal paralysis, shock and death were associated with dominant T-lymphocytic hyperplasia and presence of viral antigens in the liver and lungs. We propose that the increased expansion of these memory T-cells and serotype cross-reactive antibodies facilitates the infection of these cells by DENV and that these events correlate with disease severity in an EE.

Association between poor clinical prognosis and sleep duration among breast cancer patients.

Science.gov (United States)

Mansano-Schlosser, Thalyta Cristina; Ceolim, Maria Filomena

2017-06-05

to investigate the association between clinical progression and the quality and duration of sleep in women with breast cancer. longitudinal study, with 114 participants, conducted in a hospital in Brazil. The instruments used were: questionnaire for sociodemographic and clinical characterization, Pittsburgh Sleep Quality Index; Beck Depression Inventory and Herth Hope Scale. Data were analyzed through descriptive statistics and survival analyses (outcome: poor clinical progression), using the Kaplan-Meier curve, Log-rank test and Cox proportional model. a higher probability of poor clinical progression was verified in women with sleep durations of less than six hours or nine hours and over (p=.0173). the results suggest the importance of further studies that seek to verify whether the quantitative management of sleep disorders would have an impact on the progression of breast cancer. Women should be encouraged to report sleep problems to nurses. mensurar a associação entre evolução clínica e qualidade e duração do sono em mulheres com câncer de mama. estudo longitudinal, com 114 participantes, realizado em um hospital do Brasil. Os instrumentos utilizados foram: questionário para caracterização sociodemográfica e clínica, Índice de Qualidade do Sono de Pittsburgh; Inventário de Depressão de Beck e Escala de Esperança de Herth. Os dados foram analisados via análises descritivas e de sobrevivência (resultado: evolução clínica desfavorável), utilizando-se a curva de Kaplan-Meier, o teste log-rank e o modelo proporcional de Cox. verificou-se maior probabilidade de evolução clínica desfavorável em mulheres com duração de sono inferior a seis ou mais de nove horas (p = 0,0173). os resultados sugerem a importância de mais estudos que buscam verificar se a gestão quantitativa dos distúrbios do sono teria um impacto sobre a evolução do câncer de mama. As mulheres devem ser encorajadas a relatar isso espontaneamente aos enfermeiros. medir

Assessment by survival analysis of the radioprotective properties of propolis and its polyphenolic compounds

International Nuclear Information System (INIS)

Orsolic, N.; Benkovic, V.; Horvat-Knezevic, A.; Basic, I.; Kopjar, N.; Kosalec, I.; Bakmaz, M.; Mihaljevic, Z.; Bendelja, K.

2007-01-01

The radioprotective effects of propolis and polyphenolic compounds from propolis on the radiation-induced mortality of mice exposed to 9 Gy of γ-irradiation were studied. Intraperitoneal (i.p.) treatment of mice at doses of 100 mgkg -1 body weight of propolis (water or ethanolic extract; water-soluble derivative of propolis (WSDP) or ethanolic extract of propolis (EEP)) or its polyphenolic compounds (quercetin, naringin caffeic acid, chrysin) consecutively for 3 d before irradiation, delayed the onset of mortality and reduced the symptoms of radiation sickness. All test compounds provided protection against hematopoietic death (death within 30 d after irradiation). The greatest protection was achieved with quercetin; the number of survivors at the termination of the experiment was 63%. According to statistical analyses by the Kaplan-Meier method and the log-rank test, a significant difference between test components and control was found (p<0.001). Treatment with test components after lethal irradiation was ineffective. These results suggest that propolis and its polyphenolic compounds given to mice before irradiation protect mice from the lethal effects of whole-body irradiation. (author)

Targeted intraoperative radiotherapy tumour bed boost during breast-conserving surgery after neoadjuvant chemotherapy

Energy Technology Data Exchange (ETDEWEB)

Kolberg, Hans-Christian; Akpolat-Basci, Leyla; Stephanou, Miltiades [Marienhospital Bottrop gGmbH, Department of Gynecology and Obstetrics, Bottrop (Germany); Loevey, Gyoergy [BORAD, Bottrop (Germany); Fasching, Peter A. [University of Erlangen, Erlangen (Germany); Untch, Michael [Helios Klinikum Berlin-Buch, Berlin (Germany); Liedtke, Cornelia [University Hospital Schleswig-Holstein/Campus Luebeck, Luebeck (Germany); Bulsara, Max [University of Notre Dame, Fremantle (Australia); University College, London (United Kingdom); Vaidya, Jayant S. [University College, London (United Kingdom)

2017-01-15

The use of targeted intraoperative radiotherapy (TARGIT-IORT) as a tumour bed boost during breast-conserving surgery (BCS) for breast cancer has been reported since 1998. We present its use in patients undergoing breast conservation following neoadjuvant therapy (NACT). In this retrospective study involving 116 patients after NACT we compared outcomes of 61 patients who received a tumour bed boost with IORT during lumpectomy versus 55 patients treated in the previous 13 months with external (EBRT) boost. All patients received whole breast radiotherapy. Local recurrence-free survival (LRFS), disease-free survival (DFS), distant disease-free survival (DDFS), breast cancer mortality (BCM), non-breast cancer mortality (NBCM) and overall mortality (OS) were compared. Median follow up was 49 months. The differences in LRFS, DFS and BCM were not statistically significant. The 5-year Kaplan-Meier estimate of OS was significantly better by 15% with IORT: IORT 2 events (96.7%, 95%CI 87.5-99.2), EBRT 9 events (81.7%, 95%CI 67.6-90.1), hazard ratio (HR) 0.19 (0.04-0.87), log rank p = 0.016, mainly due to a reduction of 10.1% in NBCM: IORT 100%, EBRT 89.9% (77.3-95.7), HR (not calculable), log rank p = 0.015. The DDFS was as follows: IORT 3 events (95.1%, 85.5-98.4), EBRT 12 events (69.0%, 49.1-82.4), HR 0.23 (0.06-0.80), log rank p = 0.012. IORT during lumpectomy after neoadjuvant chemotherapy as a tumour bed boost appears to give results that are not worse than external beam radiotherapy boost. These data give further support to the inclusion of such patients in the TARGIT-B (boost) randomised trial that is testing whether IORT boost is superior to EBRT boost. (orig.) [German] Die intraoperative Radiotherapie (TARGIT-IORT) als vorgezogener Boost im Rahmen der brusterhaltenden Therapie (BET) ist seit 1998 Gegenstand der wissenschaftlichen Diskussion. Wir praesentieren Daten zum Einsatz der IORT bei der BET nach neoadjuvanter Therapie (NACT). In diese retrospektive Analyse

Preoperative serum lipid profile and outcome in nonmetastatic colorectal cancer

Directory of Open Access Journals (Sweden)

Ting-Ting Hong

2016-12-01

Full Text Available Objective: A large portion of non-metastatic colorectal cancers (non-mCRCs recur after curative surgery. In addition to the traditional tumor-related factors, host-related factors are also required to accurately predict prognosis. A few studies have shown an association between the serum lipid profile and the survival and treatment response of patients with colorectal cancer. Methods: We retrospectively evaluated the prognostic significance of the preoperative serum lipid profile [total cholesterol (TC, triglyceride (TG, low-density lipoprotein cholesterol (LDL-C, and high-density lipoprotein cholesterol (HDL-C] in patients with non-mCRC treated with curative surgery. The Spearman rank correlation test was used to analyze associations between lipid levels and categorical variables. Lipid levels were modeled as four equal-sized quartiles based on the distribution among the whole cohort. Kaplan-Meier curves were used to estimate survival probabilities, and the log-rank test was used to detect differences between them. Multivariate fractional polynomial (MFP analysis was used to model any non-linear effects and avoid categorization. To evaluate the added prognostic value of lipids, the predictive power of two models (with and without lipids as covariates was compared by using Harrell's C-statistic and the Akaike information criterion (AIC. Results: A total of 266 patients with non-mCRC were enrolled in the present study. Spearman rank correlation test showed that TG levels inversely correlated with N stage (r = −0.20, P = 0.00 and Tumor-Node-Metastasis (TNM stage (r = −0.19, P = 0.00. HDL-C levels positively correlated with perineural invasion (PNI (r = 0.15, P = 0.02, and LDL-C levels inversely correlated with lymphovascular invasion (LVI (r = −0.12, P = 0.04. None of the four lipids predicted overall survival (OS in univariate or multivariate analyses adjusted for age, gender, T stage, N stage, TNM stage

Rank-based Tests of the Cointegrating Rank in Semiparametric Error Correction Models

NARCIS (Netherlands)

Hallin, M.; van den Akker, R.; Werker, B.J.M.

2012-01-01

Abstract: This paper introduces rank-based tests for the cointegrating rank in an Error Correction Model with i.i.d. elliptical innovations. The tests are asymptotically distribution-free, and their validity does not depend on the actual distribution of the innovations. This result holds despite the

Applying Kaplan-Meier to Item Response Data

Science.gov (United States)

McNeish, Daniel

2018-01-01

Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…

MAINTAINANCE OF KAPLAN TURBINE TO ENHANCE THE EFFICIENCY

OpenAIRE

Mr. Shakti Prasanna Khadanga*; Nitish Kumar; Milind Kumar Singh; L. Raj Kumar

2016-01-01

Hydro power plant is the source of renewable energy which leads to reduction in burning of fossil fuels. So the environment is no longer polluted. This project depicts how sediment erosion occurs in Kaplan turbine and the various components of Kaplan turbine where actually erosion takes place. It reduces efficiency [7] and life of hydro power turbine but also causes problems in operations and maintenance. We conducted some necessary test on Kaplan turbine in fluid power laboratory. We are d...

Does underwater flash photography affect the behaviour, movement and site persistence of seahorses?

Science.gov (United States)

Harasti, D; Gladstone, W

2013-11-01

The effect of flash photography on seahorse species has never been tested. An experiment was established to test the effect of flash photography and the handling of Hippocampus whitei, a medium-sized seahorse species endemic to Australia, on their behavioural responses, movements and site persistence. A total of 24 H. whitei were utilized in the experiment with eight in each of the three treatments (flash photography, handling and control). The effect of underwater flash photography on H. whitei movements was not significant; however, the effect of handling H. whitei to take a photograph had a significant effect on their short-term behavioural responses to the photographer. Kaplan-Meier log-rank test revealed that there was no significant difference in site persistence of H. whitei from each of the three treatments and that flash photography had no long-term effects on their site persistence. It is concluded that the use of flash photography by divers is a safe and viable technique with H. whitei, particularly if photographs can be used for individual identification purposes. © 2013 The Fisheries Society of the British Isles.

The efficacy of postoperative radiotherapy in localized primary soft tissue sarcoma treated with conservative surgery

International Nuclear Information System (INIS)

Zhao, Ru-Ping; Yu, Xiao-Li; Zhang, Zhen; Jia, Li-Juan; Feng, Yan; Yang, Zhao-Zhi; Chen, Xing-Xing; Wang, Jian; Ma, Sheng-Lin; Guo, Xiao-Mao

2016-01-01

To evaluate the efficacy of postoperative radiotherapy (RT) on local failure-free survival (LFFS), distant metastasis-free survival (DMFS) and overall survival (OS) in patients with localized primary soft tissue sarcoma (STS) and to identify prognostic factors. Between January 2000 and July 2010, 220 consecutive patients with localized primary STS, who received conservative surgery with or without postoperative RT, were enrolled in the study. Survival curves were constructed by the Kaplan-Meier method and log-rank test was used to assess statistical significance. Multivariate analysis was applied to identify the prognostic factors. After a median follow-up of 68 months (range, 5–127 months), the 5-year LFFS, DMFS and OS were 70.0, 78.2 and 71.2 %, respectively. Tumor size, histological subtypes, margin status and postoperative RT were independent predictors for OS. Postoperative RT was associated with a significant reduced local recurrence risk versus surgery alone (hazard ratio [HR] = 0.408, 95 % confidence interval [CI] 0.235–0.707, P = 0.001), with 5-year LFFS of 81.1 and 63.6 %, respectively (log-rank, P = 0.004). The log-rank test showed that postoperative RT had a tendency of improving OS compared with surgery alone, with 5-year OS of 74.8 and 65.0 %, respectively (P = 0.089). Multivariate analysis demonstrated that postoperative RT significantly reduced mortality rate compared with surgery alone (HR = 0.512, 95 % CI 0.296–0.886, p = 0.017), especially in patients with liposarcoma (p = 0.034). Postoperative radiotherapy reduce both local recurrence and STS mortality in patients with localized primary STS. The efficacy of RT on survival warrants further prospective study. The online version of this article (doi:10.1186/s13014-016-0605-y) contains supplementary material, which is available to authorized users

Comparison of Parkinson risk in Ashkenazi Jewish Gaucher patients and GBA heterozygotes

Science.gov (United States)

Alcalay, Roy N.; Dinur, Tama; Quinn, Timothy; Sakanaka, Karina; Levy, Oren; Waters, Cheryl; Fahn, Stanley; Dorovski, Tsvyatko; Chung, Wendy K; Pauciulo, Michael; Nichols, William; Rana, Huma Q.; Balwani, Manisha; Bier, Louise; Elstein, Deborah; Zimran, Ari

2014-01-01

Importance Information on age-specific risk for Parkinson disease (PD) in Gaucher disease (GD) patients and glucocerebrosidase (GBA) heterozygotes is important for understanding the pathophysiology of the genetic association and for counseling these populations. Objective To estimate the age-specific risk of PD in Ashkenazi Jewish (AJ) patients with Type-1 GD and in GBA heterozygotes. Setting Two tertiary Gaucher centers and a Parkinson’s tertiary center. Participants GD patients at Shaare Zedek, Jerusalem, Israel (n=332) and Mount Sinai School of Medicine, NY (n=95), and GBA non-carrier non-PD spouse controls at Columbia University, NY (n=77). All were AJ and most GD patients (98.1%) carried at least one N370S mutation. Main outcome measure Main outcome measure was a diagnosis of PD. Diagnosis was established in GD patients on examination. We used a validated family history interview that identifies PD with a sensitivity of 95.5% and specificity of 96.2% to identify PD in family members. Kaplan-Meier survival curves were used to estimate age-specific PD risk among GD patients (n=427), among their parents, who are obligate GBA mutation carriers (heterozygotes, n=694) and among non-carriers (parents of non-PD non-GD controls, n=154). The age-specific risk was compared among groups using the log-rank test. Results Among those who developed PD, patients with GD had a younger age-at-onset than GBA heterozygotes (54.2, versus 65.2, p=0.003). Estimated age-specific risk for PD at ages 60 and 80 was 4.7% and 9.1% among GD patients, 1.5% and 7.7% among heterozygotes, and 0.7% and 2.1% among non-carriers. PD risk was higher in GD patients than non-carriers (p=0.008, log-rank test) and in heterozygotes than non-carriers (p=0.026, log-rank test) but did not reach significance between GD patients and GBA heterozygotes (p=0.074, log-rank test). Conclusion GD patients and GBA heterozygotes have an increased age-specific risk for PD compared to controls, with a similar

Permanent pacemaker implantation in octogenarians with unexplained syncope and positive electrophysiologic testing.

Science.gov (United States)

Giannopoulos, Georgios; Kossyvakis, Charalampos; Panagopoulou, Vasiliki; Tsiachris, Dimitrios; Doudoumis, Konstantinos; Mavri, Maria; Vrachatis, Dimitrios; Letsas, Konstantinos; Efremidis, Michael; Katsivas, Apostolos; Lekakis, John; Deftereos, Spyridon

2017-05-01

Syncope is a common problem in the elderly, and a permanent pacemaker is a therapeutic option when a bradycardic etiology is revealed. However, the benefit of pacing when no association of symptoms to bradycardia has been shown is not clear, especially in the elderly. The aim of this study was to evaluate the effect of pacing on syncope-free mortality in patients aged 80 years or older with unexplained syncope and "positive" invasive electrophysiologic testing (EPT). This was an observational study. A positive EPT for the purposes of this study was defined by at least 1 of the following: a corrected sinus node recovery time of >525 ms, a basic HV interval of >55 ms, detection of infra-Hisian block, or appearance of second-degree atrioventricular block on atrial decremental pacing at a paced cycle length of >400 ms. Among the 2435 screened patients, 228 eligible patients were identified, 145 of whom were implanted with a pacemaker. Kaplan-Meier analysis determined that time to event (syncope or death) was 50.1 months (95% confidence interval 45.4-54.8 months) with a pacemaker vs 37.8 months (95% confidence interval 31.3-44.4 months) without a pacemaker (log-rank test, P = .001). The 4-year time-dependent estimate of the rate of syncope was 12% vs 44% (P pacemaker implantation was independently associated with longer syncope-free survival. Significant differences were also shown in the individual components of the primary outcome measure (syncope and death from any cause). Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Conservative neck dissection in oral cancer patients: A 5 years retrospective study

Directory of Open Access Journals (Sweden)

Wan Mahadzir Wan Mustafa

2016-06-01

Full Text Available The impact of ablative oral cancer surgery was studied, with reference to recurrence and nodal metastasis,  survival probability and prognostic indicators and to determine if ethnicity influences the survival of patients. Patients who underwent major ablative surgery of the head and neck region with neck dissection were identified and assessed. Those with stage I-IV oral and oropharyngeal malignancies necessitating resection with or without radiotherapy from 2004 to 2009 were included in this study. All individuals had a pre-operative assessment and post operative assessment. Survival distributions were analyzed using Kaplan-Meier curves. Eighty seven patients (males: 38%; females: 62% were included in this study, with an age range of 21-85 years. Some 78% underwent neck dissections while 63% had surgery and radiotherapy. Nodal and primary site recurrence was 5.7% and 20.5%. The median survival time was 57 months. One year Overall Survival (OS rate was 72.7% and three year overall survival rate 61.5%. The log-rank test showed a significant difference of survival between Malay and Chinese patients (Bonferroni correction p=0.033. Recurrence-Free Survival (RFS analysis revealed that 25% of the patients have reached the event of recurrence at 46 months. The three year survival rate was 76.1%. In the RFS analysis, the log-rank test showed a significant difference in the event of recurrence and nodal metastasis (p<0.001. Conservative neck effectively controls neck metastases. Ethnicity influence  survival.

Clinical Efficiency of Two Sequences of Orthodontic Wires to Correct Crowding of the Lower Anterior Teeth

Directory of Open Access Journals (Sweden)

Cláudia Maria de Castro Serafim

2015-01-01

Full Text Available This study compared time to correction of mandibular anterior crowding using two arch wire sequences, one with conventional nickel-titanium (NiTi arch wires and the other with conventional and NiTi heat-activated arch wires. Twenty-two boys and girls (mean age: 16.68 ± 2.66 with moderate crowding (3–6 mm were assigned randomly to one of two groups and followed up for five months (six assessments when arch wires were changed. Time to crowding correction was analyzed statistically using the Kaplan-Meier method. Data were collected during the five-month follow-up, and time to correction was compared between groups using the log rank test. At the end of follow-up, mandibular crowding was corrected in 100% of the cases in the group treated with the sequence that included NiTi heat-activated arch wires, whereas about 30% of those treated with NiTi arch wires were not completely corrected. There was a significant difference in time to complete treatment between groups (log rank = 5.996; p<0.05. In the group treated with the sequence that included heat-activated wires, alignment and leveling of mandibular anterior teeth were completed earlier than in the group treated only with conventional NiTi arch wires. Clinical trial registration is found at RBR-7g5zng.

A genetic polymorphism in TOX3 is associated with survival of gastric cancer in a Chinese population.

Directory of Open Access Journals (Sweden)

Xiaojing Zhang

Full Text Available PURPOSE: Recently, genetic polymorphism (rs3803662C>T in TOX3 was reported to induce the risk of breast cancer. In this study, we hypothesized that rs3803662 could influence gastric cancer survival outcomes. METHODS: With multiplex SNaPshot method, we genotyped TOX3 rs3803662 in 880 gastric patients with surgical resection. The association between genotype and survival outcomes was performed by the Kaplan-Meier method, Cox regression analysis models and the log-rank test. RESULTS: There was no association in the analyses of rs3803662 and survival of gastric cancer. However, the stratified analysis by histology showed that rs3803662 CT/TT genotype was associated with a significantly better survival for diffuse-type gastric cancer (log-rank p = 0.030, hazard ratio [HR]  = 0.67, 95% confidence interval [CI]  = 0.46-0.96, than the CC genotype. In addition, this favorable effect was especially obvious among gastric cancer patients with tumor size >5 cm, T3 and T4 depth of invasion, lymph node metastasis, no drinking, no distant metastasis, no chemotherapy and gastric cardia cancer. CONCLUSIONS: TOX3 rs3803662 might play an important role in the prognostic outcome and treatment of gastric cancer, especially perhaps further help in explaining the reduced risk of death associated with diffuse-type gastric cancer.

Cointegration rank testing under conditional heteroskedasticity

DEFF Research Database (Denmark)

Cavaliere, Giuseppe; Rahbek, Anders Christian; Taylor, Robert M.

2010-01-01

We analyze the properties of the conventional Gaussian-based cointegrating rank tests of Johansen (1996, Likelihood-Based Inference in Cointegrated Vector Autoregressive Models) in the case where the vector of series under test is driven by globally stationary, conditionally heteroskedastic......, relative to tests based on the asymptotic critical values or the i.i.d. bootstrap, the wild bootstrap rank tests perform very well in small samples under a variety of conditionally heteroskedastic innovation processes. An empirical application to the term structure of interest rates is given....

Risk of invasive breast cancer and ductal carcinoma in situ in women with atypical papillary lesions of the breast.

Science.gov (United States)

Cuneo, Kyle C; Dash, Rajesh C; Wilke, Lee G; Horton, Janet K; Koontz, Bridget F

2012-09-01

Benign papillary lesions of the breast include papilloma and papillomatosis. A retrospective analysis of patients with a papillary breast lesion diagnosed between October 1992 and December 2009 was performed. Patients were excluded if they had a previous or concurrent diagnosis of invasive or in situ cancer or less than 6 months of follow-up. The Kaplan-Meier method was used to determine the risk of developing subsequent malignancy. The log rank test was used to compare groups of patients. Median follow-up for the 167 patients included in the study was 4.6 years. Fifty-one patients had a papillary lesion with atypia and 116 patients had a papillary lesion without atypia. Patients with a papillary lesion with atypia were more likely to develop invasive or in situ breast cancer with a 5 year risk of 13.0% versus 4.6% in patients with no atypia (p = 0.03). © 2012 Wiley Periodicals, Inc.

Time trends in recurrence of juvenile nasopharyngeal angiofibroma: Experience of the past 4 decades.

Science.gov (United States)

Mishra, Anupam; Mishra, Subhash Chandra

2016-01-01

An analysis of time distribution of juvenile nasopharyngeal angiofibroma (JNA) from the last 4 decades is presented. Sixty recurrences were analyzed as per actuarial survival. SPSS software was used to generate Kaplan-Meier (KM) curves and time distributions were compared by Log-rank, Breslow and Tarone-Ware test. The overall recurrence rate was 17.59%. Majority underwent open transpalatal approach(es) without embolization. The probability of detecting a recurrence was 95% in first 24months and comparison of KM curves of 4 different time periods was not significant. This is the first and largest series to address the time-distribution. The required follow up period is 2years. Our recurrence is just half of the largest series (reported so far) suggesting the superiority of transpalatal techniques. The similarity of curves suggests less likelihood for recent technical advances to influence the recurrence that as per our hypothesis is more likely to reflect tumor biology per se. Copyright © 2016 Elsevier Inc. All rights reserved.

The Role of Pretreatment FDG-PET in Nasopharyngeal Carcinoma Treated With Intensity-Modulated Radiotherapy

International Nuclear Information System (INIS)

Liu, Wen-Shan; Wu, Ming-Fang; Tseng, Hsien-Chun; Liu, Jung-Tung; Weng, Jui-Hung; Li, Yueh-Chun; Lee, Jong-Kang

2012-01-01

Purpose: Pretreatment with 2- [ 18 F] fluorodeoxyglucose positron emission tomography ( 18 F-FDG-PET) was evaluated as a predictor of local failure-free survival (LFFS), disease-free survival (DFS), and overall survival (OS) in patients with nonkeratinizing nasopharyngeal carcinoma (NPC) treated with intensity-modulated radiation therapy (IMRT) alone or concurrently with chemotherapy (CCRT). Patients and Methods: Seventy-five M0 NPC patients who received FDG-PET before treatment were analyzed. The primary tumor FDG uptake was measured as the maximum standardized uptake value (SUVmax). The LFFS, DFS, and OS were calculated by the Kaplan-Meier method, and the differences were evaluated on log-rank test. The prognostic significance was assessed by univariate and multivariate analyses. Results: Eighteen patients received IMRT alone and 57 received CCRT. The mean SUVmax was significantly higher in 12 patients with locoregional or distant failure than in those without failure (p 18 F-FDG uptake (SUVmax >5) indicates poor outcome in patients with NPC.

Establishment of a 12-gene expression signature to predict colon cancer prognosis

Directory of Open Access Journals (Sweden)

Dalong Sun

2018-06-01

Full Text Available A robust and accurate gene expression signature is essential to assist oncologists to determine which subset of patients at similar Tumor-Lymph Node-Metastasis (TNM stage has high recurrence risk and could benefit from adjuvant therapies. Here we applied a two-step supervised machine-learning method and established a 12-gene expression signature to precisely predict colon adenocarcinoma (COAD prognosis by using COAD RNA-seq transcriptome data from The Cancer Genome Atlas (TCGA. The predictive performance of the 12-gene signature was validated with two independent gene expression microarray datasets: GSE39582 includes 566 COAD cases for the development of six molecular subtypes with distinct clinical, molecular and survival characteristics; GSE17538 is a dataset containing 232 colon cancer patients for the generation of a metastasis gene expression profile to predict recurrence and death in COAD patients. The signature could effectively separate the poor prognosis patients from good prognosis group (disease specific survival (DSS: Kaplan Meier (KM Log Rank p = 0.0034; overall survival (OS: KM Log Rank p = 0.0336 in GSE17538. For patients with proficient mismatch repair system (pMMR in GSE39582, the signature could also effectively distinguish high risk group from low risk group (OS: KM Log Rank p = 0.005; Relapse free survival (RFS: KM Log Rank p = 0.022. Interestingly, advanced stage patients were significantly enriched in high 12-gene score group (Fisher’s exact test p = 0.0003. After stage stratification, the signature could still distinguish poor prognosis patients in GSE17538 from good prognosis within stage II (Log Rank p = 0.01 and stage II & III (Log Rank p = 0.017 in the outcome of DFS. Within stage III or II/III pMMR patients treated with Adjuvant Chemotherapies (ACT and patients with higher 12-gene score showed poorer prognosis (III, OS: KM Log Rank p = 0.046; III & II, OS: KM Log Rank p = 0.041. Among stage II/III pMMR patients

Left ventricular dyssynchrony assessed by gated SPECT phase analysis is an independent predictor of death in patients with advanced coronary artery disease and reduced left ventricular function not undergoing cardiac resynchronization therapy

Energy Technology Data Exchange (ETDEWEB)

Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)

2012-10-15

Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)

The Risk of Herpes Zoster in Patients with Non-small Cell Lung Cancer according to Chemotherapy Regimens: Tyrosine Kinase Inhibitors versus Cytotoxic Chemotherapy.

Science.gov (United States)

Choi, Ji Young; Kim, Miso; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Heo, Dae Seog; Jo, Seong Jin

2018-04-05

Despite the successful use of tyrosine kinase inhibitors (TKIs) in cancer patients, their effect on herpes zoster development has not been studied. The aim of this study was to evaluate and compare the effects of epidermal growth factor receptor (EGFR) TKI and cytotoxic chemotherapy on the risk of herpes zoster development in non-small cell lung cancer (NSCLC) patients. We conducted a medical review of all eligible NSCLC patients in Seoul National University hospital between 2002 and 2015. We classified patients based on whether they previously underwent EGFR TKI therapy into either the TKI group or the cytotoxic group. We compared the incidence rates of herpes zoster during TKI therapy and cytotoxic chemotherapy. Additionally, the longitudinal risk of herpes zoster from TKIs was analyzed using the incidence rate ratio (IRR) of the TKI group to the cytotoxic group and the log-rank test of the Kaplan-Meier method. Of the 2,981 NSCLC patients, 54 patients (1.54%) developed herpes zoster. In the TKI group (2,002 patients), the IRR of herpes zoster during TKI therapy compared to that during cytotoxic chemotherapy was 1.05 (95% confidence interval [CI], 0.53 to 2.09). The IRR of the TKI group compared to the cytotoxic group was 1.33 (95% CI, 0.64 to 2.76). The Kaplan-Meier cumulative risk of both groups was not significantly different. Our results show that the incidence rate of herpes zoster in the TKI group was not statistically different from the incidence in the cytotoxic group during and after chemotherapy in NSCLC patients.

Log-concave Probability Distributions: Theory and Statistical Testing

DEFF Research Database (Denmark)

An, Mark Yuing

1996-01-01

This paper studies the broad class of log-concave probability distributions that arise in economics of uncertainty and information. For univariate, continuous, and log-concave random variables we prove useful properties without imposing the differentiability of density functions. Discrete...... and multivariate distributions are also discussed. We propose simple non-parametric testing procedures for log-concavity. The test statistics are constructed to test one of the two implicati ons of log-concavity: increasing hazard rates and new-is-better-than-used (NBU) property. The test for increasing hazard...... rates are based on normalized spacing of the sample order statistics. The tests for NBU property fall into the category of Hoeffding's U-statistics...

Meier-Gorlin syndrome

NARCIS (Netherlands)

Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.

2015-01-01

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

Concurrent chemoradiation for vaginal cancer.

Directory of Open Access Journals (Sweden)

David T Miyamoto

Full Text Available BACKGROUND: It is not known whether the addition of chemotherapy to radiation therapy improves outcomes in primary vaginal cancer. Here, we review clinical outcomes in patients with primary vaginal cancer treated with radiation therapy (RT or concurrent chemoradiation therapy (CRT. METHODS: Seventy-one patients with primary vaginal cancer treated with definitive RT with or without concurrent chemotherapy at a single institution were identified and their records reviewed. A total of 51 patients were treated with RT alone; 20 patients were treated with CRT. Recurrences were analyzed. Overall survival (OS and disease-free survival (DFS rates were estimated using the Kaplan-Meier method. Cox regression analysis was performed. RESULTS: The median age at diagnosis was 61 years (range, 18-92 years and the median follow-up time among survivors was 3.0 years. Kaplan-Meier estimates for OS and DFS differed significantly between the RT and CRT groups (3-yr OS = 56% vs. 79%, log-rank p = 0.037; 3-yr DFS = 43% vs. 73%, log-rank p = 0.011. Twenty-three patients (45% in the RT group had a relapse at any site compared to 3 (15% in the CRT group (p = 0.027. With regard to the sites of first relapse, 10 patients (14% had local only, 4 (6% had local and regional, 9 (13% had regional only, 1 (1% had regional and distant, and 2 (3% had distant only relapse. On univariate analysis, the use of concurrent chemotherapy, FIGO stage, tumor size, and date of diagnosis were significant predictors of DFS. On multivariate analysis, the use of concurrent chemotherapy remained a significant predictor of DFS (hazard ratio 0.31 (95% CI, 0.10-0.97; p = 0.04. CONCLUSIONS: Vaginal cancer results in poor outcomes. Adequate radiation dose is essential to ensure curative management. Concurrent chemotherapy should be considered for vaginal cancer patients.

Association of oestrogen receptor beta 2 (ERβ2/ERβcx) with outcome of adjuvant endocrine treatment for primary breast cancer – a retrospective study

International Nuclear Information System (INIS)

Vinayagam, Raman; Sibson, D Ross; Holcombe, Christopher; Aachi, Vijay; Davies, Michael PA

2007-01-01

Oestrogen receptor beta (ERβ) modulates ERα activity; wild type ERβ (ERβ1) and its splice variants may therefore impact on hormone responsiveness of breast cancer. ERβ2/ERβcx acts as a dominant negative inhibitor of ERα and expression of ERβ2 mRNA has been proposed as a candidate marker for outcome in primary breast cancer following adjuvant endocrine therapy. We therefore now assess ERβ2 protein by immunostaining and mRNA by quantitative RT-PCR in relation to treatment outcome. ERβ2-specific immunostaining was quantified in 141 primary breast cancer cases receiving adjuvant endocrine therapy, but no neoadjuvant therapy or adjuvant chemotherapy. The expression of mRNA for ERβ2/ERβcx was measured in 100 cases by quantitative RT-PCR. Statistical analysis of breast cancer relapse and breast cancer survival was performed using Kaplan Meier log-rank tests and Cox's univariate and multivariate survival analysis. High ERβ2 immunostaining (Allred score >5) and high ERβ2 mRNA levels were independently associated with significantly better outcome across the whole cohort, including both ERα positive and negative cases (Log-Rank P < 0.05). However, only ERβ2 mRNA levels were significantly associated with better outcome in the ERα + subgroup (Log-Rank P = 0.01) and this was independent of grade, size, nodal status and progesterone receptor status (Cox hazard ratio 0.31 P = 0.02 for relapse; 0.17 P = 0.01 for survival). High ERβ2 mRNA was also associated with better outcome in node negative cases (Log Rank P < 0.001). ERβ2 protein levels were greater in ERα positive cases (T-test P = 0.00001), possibly explaining the association with better outcome. Levels of ERβ2 protein did not correlate ERβ2 mRNA levels, but 34% of cases had both high mRNA and protein and had a significantly better outcome (Log-Rank relapse P < 0.005). High ERβ2 protein levels were associated with ERα expression. Although most cases with high ERβ2 mRNA had strong ERβ2

Variations in Duchenne muscular dystrophy course in a multi-ethnic UK population: potential influence of socio-economic factors.

Science.gov (United States)

Hufton, Margaret; Roper, Helen

2017-08-01

To explore variation in clinical course and steroid treatment in Duchenne muscular dystrophy (DMD) by ethnic origin and socio-economic status. In this longitudinal cohort study, clinical outcome was defined as age at loss of ambulation (LOA). Ages are presented as months for accurate calculation. Steroid use was reviewed against national guidelines. Kaplan-Meier survival analysis was used to determine probabilities over time of LOA. Log-rank test was used to evaluate comparisons between ethnic and socio-economic groups. From 2005 to 2014, 71 children were newly diagnosed with DMD. Complete data were available on 69, including 33 of white British heritage and 23 of South Asian heritage. Mean age at diagnosis (without known family history) was 45.7 months; white British ethnicity 42.1 months (range 14-86mo), South Asian ethnicity 50.2 months (range 5-98mo). Twenty-four males lost ambulation. Those of South Asian heritage lost ambulation earlier (mean LOA 105.8mo [8y 10mo]) than those of white British heritage (mean LOA 117.8mo [9y 10mo]): log-rank test score 0.012 (p<0.05). Those most deprived did worse: mean age at LOA 130.0 months (10y 10mo) for the top 20 per cent and 102.5 months (8y 6mo) in the lower 20 per cent: log-rank test score 0.035 (p<0.05). The most socially deprived were diagnosed earlier and started steroids earlier. Of those of South Asian heritage, 18 per cent declined steroids, compared with 9 per cent of white British heritage. Also, 44 per cent of those of South Asian heritage stopped steroids compared with 17 per cent of those of white British heritage. Patients from South Asian and deprived backgrounds had earlier LOA. Genetic disease modifiers are likely to be implicated, but social and cultural factors influence access to treatment. © 2017 Mac Keith Press.

Heart transplant outcomes in recipients of Centers for Disease Control (CDC) high risk donors.

Science.gov (United States)

Tsiouris, Athanasios; Wilson, Lynn; Sekar, Rajesh B; Mangi, Abeel A; Yun, James J

2016-12-01

A lack of donor hearts remains a major limitation of heart transplantation. Hearts from Centers for Disease Control (CDC) high-risk donors can be utilized with specific recipient consent. However, outcomes of heart transplantation with CDC high-risk donors are not well known. We sought to define outcomes, including posttransplant hepatitis and human immunodeficiency virus (HIV) status, in recipients of CDC high-risk donor hearts at our institution. All heart transplant recipients from August 2010 to December 2014 (n = 74) were reviewed. Comparison of 1) CDC high-risk donor (HRD) versus 2) standard-risk donor (SRD) groups were performed using chi-squared tests for nominal data and Wilcoxon two-sample tests for continuous variables. Survival was estimated with Kaplan-Meier curves. Of 74 heart transplant recipients reviewed, 66 (89%) received a SRD heart and eight (11%) received a CDC HRD heart. We found no significant differences in recipient age, sex, waiting list 1A status, pretransplant left ventricular assist device (LVAD) support, cytomegalovirus (CMV) status, and graft ischemia times (p = NS) between the HRD and SRD groups. All of the eight HRD were seronegative at the time of transplant. Postoperatively, there was no significant difference in rejection rates at six and 12 months posttransplant. Importantly, no HRD recipients acquired hepatitis or HIV. Survival in HRD versus SRD recipients was not significantly different by Kaplan-Meier analysis (log rank p = 0.644) at five years posttransplant. Heart transplants that were seronegative at the time of transplant had similar posttransplant graft function, rejection rates, and five-year posttransplant survival versus recipients of SRD hearts. At our institution, no cases of hepatitis or HIV occurred in HRD recipients in early follow-up. © 2016 Wiley Periodicals, Inc.

Short-term outcomes after incontinent conduit for gynecologic cancer: comparison of ileal, sigmoid, and transverse colon.

Science.gov (United States)

Tabbaa, Zaid M; Janco, Jo Marie T; Mariani, Andrea; Dowdy, Sean C; McGree, Michaela E; Weaver, Amy L; Cliby, William A

2014-06-01

The aim of this study is to estimate the overall rates of significant incontinent conduit-related complications and compare rates between conduit types. This was a retrospective review of 166 patients who underwent incontinent urinary diversion from April 1993 through April 2013. Patients were categorized by conduit type-ileal, sigmoid colon, and transverse colon. Significant conduit-related complications were assessed at 30 and 90days after surgery. Significant conduit-related complication was defined as any of the following: ureteral stricture, conduit leak, conduit obstruction, conduit ischemia, ureteral anastomotic leak, stent obstruction requiring intervention via interventional radiology procedure or reoperation, and renal failure. A total of 166 patients underwent formation of an incontinent urinary conduit, most commonly during exenteration for gynecologic malignancy. There were 129 ileal, 11 transverse colon, and 26 sigmoid conduits. The overall significant conduit-related complication rate within 30days was 15.1%. Complication rates for ileal, transverse and sigmoid conduits were 14.7%, 0%, and 23.1%, respectively (Fisher's exact test, p=0.24). By 90days, the Kaplan-Meier estimated rates of significant complications were 21.8% overall, and 22.3%, 0%, and 28.9%, respectively, by conduit type (log-rank test, p=0.19). The most common significant conduit-related complications were conduit or ureteral anastomotic leaks and conduit obstructions. By 1 and 2years following surgery, the Kaplan-Meier estimated overall rate of significant conduit-related complication increased to 26.5% and 30.1%, respectively. Our study suggests that there are multiple appropriate tissue sites for use in incontinent conduit formation, and surgical approach should be individualized. Most significant conduit-related complications occur within 90days after surgery. Copyright © 2014 Elsevier Inc. All rights reserved.

Conservative management or gamma knife radiosurgery for vestibular schwannoma: tumor growth, symptoms, and quality of life.

Science.gov (United States)

Breivik, Cathrine Nansdal; Nilsen, Roy Miodini; Myrseth, Erling; Pedersen, Paal Henning; Varughese, Jobin K; Chaudhry, Aqeel Asghar; Lund-Johansen, Morten

2013-07-01

There are few reports about the course of vestibular schwannoma (VS) patients following gamma knife radiosurgery (GKRS) compared with the course following conservative management (CM). In this study, we present prospectively collected data of 237 patients with unilateral VS extending outside the internal acoustic canal who received either GKRS (113) or CM (124). The aim was to measure the effect of GKRS compared with the natural course on tumor growth rate and hearing loss. Secondary end points were postinclusion additional treatment, quality of life (QoL), and symptom development. The patients underwent magnetic resonance imaging scans, clinical examination, and QoL assessment by SF-36 questionnaire. Statistics were performed by using Spearman correlation coefficient, Kaplan-Meier plot, Poisson regression model, mixed linear regression models, and mixed logistic regression models. Mean follow-up time was 55.0 months (26.1 standard deviation, range 10-132). Thirteen patients were lost to follow-up. Serviceable hearing was lost in 54 of 71 (76%) (CM) and 34 of 53 (64%) (GKRS) patients during the study period (not significant, log-rank test). There was a significant reduction in tumor volume over time in the GKRS group. The need for treatment following initial GKRS or CM differed at highly significant levels (log-rank test, P < .001). Symptom and QoL development did not differ significantly between the groups. In VS patients, GKRS reduces the tumor growth rate and thereby the incidence rate of new treatment about tenfold. Hearing is lost at similar rates in both groups. Symptoms and QoL seem not to be significantly affected by GKRS.

Analysis of the Kaplan turbine draft tube effect

International Nuclear Information System (INIS)

Motycak, L; Skotak, A; Obrovsky, J

2010-01-01

The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

Analysis of the Kaplan turbine draft tube effect

Energy Technology Data Exchange (ETDEWEB)

Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)

2010-08-15

The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

Analysis of the Kaplan turbine draft tube effect

Science.gov (United States)

Motycak, L.; Skotak, A.; Obrovsky, J.

2010-08-01

The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

Rank Dynamics

Science.gov (United States)

Gershenson, Carlos

Studies of rank distributions have been popular for decades, especially since the work of Zipf. For example, if we rank words of a given language by use frequency (most used word in English is 'the', rank 1; second most common word is 'of', rank 2), the distribution can be approximated roughly with a power law. The same applies for cities (most populated city in a country ranks first), earthquakes, metabolism, the Internet, and dozens of other phenomena. We recently proposed ``rank diversity'' to measure how ranks change in time, using the Google Books Ngram dataset. Studying six languages between 1800 and 2009, we found that the rank diversity curves of languages are universal, adjusted with a sigmoid on log-normal scale. We are studying several other datasets (sports, economies, social systems, urban systems, earthquakes, artificial life). Rank diversity seems to be universal, independently of the shape of the rank distribution. I will present our work in progress towards a general description of the features of rank change in time, along with simple models which reproduce it

Multiple factor analysis of metachronous upper urinary tract transitional cell carcinoma after radical cystectomy

Directory of Open Access Journals (Sweden)

P. Wang

2007-07-01

Full Text Available Transitional cell carcinoma (TCC of the urothelium is often multifocal and subsequent tumors may occur anywhere in the urinary tract after the treatment of a primary carcinoma. Patients initially presenting a bladder cancer are at significant risk of developing metachronous tumors in the upper urinary tract (UUT. We evaluated the prognostic factors of primary invasive bladder cancer that may predict a metachronous UUT TCC after radical cystectomy. The records of 476 patients who underwent radical cystectomy for primary invasive bladder TCC from 1989 to 2001 were reviewed retrospectively. The prognostic factors of UUT TCC were determined by multivariate analysis using the COX proportional hazards regression model. Kaplan-Meier analysis was also used to assess the variable incidence of UUT TCC according to different risk factors. Twenty-two patients (4.6%. developed metachronous UUT TCC. Multiplicity, prostatic urethral involvement by the bladder cancer and the associated carcinoma in situ (CIS were significant and independent factors affecting the occurrence of metachronous UUT TCC (P = 0.0425, 0.0082, and 0.0006, respectively. These results were supported, to some extent, by analysis of the UUT TCC disease-free rate by the Kaplan-Meier method, whereby patients with prostatic urethral involvement or with associated CIS demonstrated a significantly lower metachronous UUT TCC disease-free rate than patients without prostatic urethral involvement or without associated CIS (log-rank test, P = 0.0116 and 0.0075, respectively. Multiple tumors, prostatic urethral involvement and associated CIS were risk factors for metachronous UUT TCC, a conclusion that may be useful for designing follow-up strategies for primary invasive bladder cancer after radical cystectomy.

Longterm Hydroxychloroquine Therapy and Low-dose Aspirin May Have an Additive Effectiveness in the Primary Prevention of Cardiovascular Events in Patients with Systemic Lupus Erythematosus.

Science.gov (United States)

Fasano, Serena; Pierro, Luciana; Pantano, Ilenia; Iudici, Michele; Valentini, Gabriele

2017-07-01

Systemic lupus erythematosus (SLE) is associated with an increased risk of cardiovascular disease (CVD). Thromboprophylaxis with low-dose aspirin (ASA) and hydroxychloroquine (HCQ) seems promising in SLE. We investigated the effects of HCQ cumulative dosages (c-HCQ) and the possible synergistic efficacy of ASA and HCQ in preventing a first CV event (CVE) in patients with SLE. Patients consecutively admitted to our center who, at admission, satisfied the 1997 American College of Rheumatology and/or 2012 Systemic Lupus Collaborating Clinics classification criteria for SLE, and had not experienced any CVE, were enrolled. The occurrence of a thrombotic event, use of ASA, and c-HCQ were recorded. Kaplan-Meier analysis was performed to determine the c-HCQ associated with a lower incidence of CVE. Cox regression analysis served to identify factors associated with a first CVE. For the study, 189 patients with SLE were enrolled and monitored for 13 years (median). Ten CVE occurred during followup. At Kaplan-Meier analysis, the CVE-free rate was higher in ASA-treated patients administered a c-HCQ > 600 g (standard HCQ dose for at least 5 yrs) than in patients receiving ASA alone, or with a c-HCQ dose < 600 g (log-rank test chi-square = 4.01, p = 0.04). Multivariate analysis showed that antimalarials plus ASA protected against thrombosis (HR 0.041 and HR 0.047, respectively), while antiphospholipid antibodies (HR 17.965) and hypertension (HR 18.054) increased the risk of a first CVE. Our results suggest that prolonged use of HCQ plus ASA is thromboprotective in SLE and provides additional evidence for its continued use in patients with SLE.

Dose escalation with 3D conformal treatment: five year outcomes, treatment optimization, and future directions

International Nuclear Information System (INIS)

Hanks, Gerald E.; Hanlon, Alexandra L. M.S.; Schultheiss, Timothy E.; Pinover, Wayne H.; Movsas, Benjamin; Epstein, Barry E.; Hunt, Margie

1998-01-01

Purpose: To report the 5-year outcomes of dose escalation with 3D conformal treatment (3DCRT) of prostate cancer. Methods and Materials: Two hundred thirty-two consecutive patients were treated with 3DCRT alone between 6/89 and 10/92 with ICRU reporting point dose that increased from 63 to 79 Gy. The median follow-up was 60 months, and any patient free of clinical or biochemical evidence of disease was termed bNED. Biochemical failure was defined as prostate-specific antigen (PSA) rising on two consecutive recordings and exceeding 1.5 ng/ml. Morbidity was reported by the Radiation Therapy Oncology Group (RTOG) scale, the Late Effects Normal Tissue (LENT) scale, and a Fox Chase modification of the latter (FC-LENT). All patients were treated with a four-field technique with a 1 cm clinical target volume (CTV) to planning target volume (PTV) margin to the prostate or prostate boost; the CTV and gross tumor volume (GTV) were the same. Actuarial rates of outcome were calculated by Kaplan-Meier and cumulative incidence methods and compared using the log rank and Gray's test statistic, respectively. Cox regression models were used to establish prognostic factors predictive of the various measures of outcome. Five-year Kaplan-Meier bNED rates were utilized by dose group to estimate logit response models for bNED and late morbidity. Results: PSA 10 ng/ml based on 5-year bNED results. No dose response was observed for patients with pretreatment PSA 10 ng/ml strongly suggests that clinical trials employing radiation should investigate the use of 3DCRT and prostate doses of 76-80 Gy

Endolymphatic sac surgery versus tenotomy of the stapedius and tensor tympani muscles in the management of patients with unilateral definite Meniere's disease.

Science.gov (United States)

Albu, Silviu; Babighian, Gregorio; Amadori, Maurizio; Trabalzini, Franco

2015-12-01

This study aims to compare the outcomes of patients with Meniere's disease submitted to either endolymphatic mastoid shunt (ES) or tenotomy of the stapedius and tensor tympani muscles (TSTM). This is a retrospective chart review of patients treated with ES or TSTM between 2000 and 2010 and followed up for at least 12 months. The main outcomes were represented by: (1) vertigo class, hearing stage and functional level according to the American Academy of Otolaryngology-Head and Neck Surgery criteria; (2) adjustment of dizziness handicap inventory (DHI) and (3) complete and substantial vertigo control using the Kaplan-Meier survival method. Sixty-three patients met the inclusion criteria: 34 underwent ES and 29 TSTM. The baseline demographic characteristics, the hearing stage, the functional level, the DHI and hearing levels were not different between the two groups. No significant difference in vertigo class was demonstrated: 66 % of TSTM patients attained class A compared to 44 % in the ES group (p = 0.14). Kaplan-Meier survival curves specific to class A showed significant differences, favoring TSTM (log-rank test, p = 0.022). TSTM patients demonstrated significantly improved functional level (p = 0.0004) and improved DHI scores (p = 0.001). Eight ES patients (25 %) demanded a second surgical attempt compared to none in the TSTM. Aural fullness was significantly improved in TSTM group (p = 0.01), while the difference in tinnitus improvement was non-significant. Hearing preservation was significantly better in TSTM group (p = 0.001). TSTM is a safe surgical procedure, with significant vertigo control rates, and important hearing preservation rates. More patients and longer follow-up are needed to support our preliminary findings.

Adjuvant Ab Interno Tumor Treatment After Proton Beam Irradiation.

Science.gov (United States)

Seibel, Ira; Riechardt, Aline I; Heufelder, Jens; Cordini, Dino; Joussen, Antonia M

2017-06-01

This study was performed to show long-term outcomes concerning globe preservation in uveal melanoma patients after proton beam therapy with the main focus on outcomes according to different adjuvant ab interno surgical procedures. Retrospective cohort study. All patients treated with primary proton beam therapy for choroidal or ciliary body melanoma between June 1998 and June 2015 were included. A total of 2499 patients underwent primary proton beam therapy, with local tumor control and globe preservation rates of 95.9% and 94.8% after 5 years, respectively. A total of 110 (4.4%) patients required secondary enucleation. Unresponsive neovascular glaucoma was the leading cause of secondary enucleation in 78 of the 2499 patients (3.1%). The 5-year enucleation-free survival rate was 94.8% in the endoresection group, 94.3% in the endodrainage group, and 93.5% in the comparator group. The log-rank test showed P = .014 (comparator group vs endoresection group) and P = .06 (comparator group vs endodrainage-vitrectomy group). Patients treated with endoresection or endodrainage-vitrectomy developed less radiation retinopathy (30.5% and 37.4% after 5 years, P = .001 and P = .048 [Kaplan-Meier], respectively) and less neovascular glaucoma (11.6% and 21.3% after 5 years, P = .001 and P = .01 [Kaplan-Meier], respectively) compared with the comparator group (52.3% radiation retinopathy and 57.8% neovascular glaucoma after 5 years). This study suggests that in larger tumors the enucleation and neovascular glaucoma rates might be reduced by adjuvant surgical procedures. Although endoresection is the most promising adjuvant treatment option, the endodrainage-vitrectomy is recommended in patients who are ineligible for endoresection. Copyright © 2017 Elsevier Inc. All rights reserved.

Adjuvant Medications That Improve Survival after Locoregional Therapy.

Science.gov (United States)

Boas, F Edward; Ziv, Etay; Yarmohammadi, Hooman; Brown, Karen T; Erinjeri, Joseph P; Sofocleous, Constantinos T; Harding, James J; Solomon, Stephen B

2017-07-01

To determine if outpatient medications taken at the time of liver tumor embolization or ablation affect survival. A retrospective review was done of 2,032 liver tumor embolization, radioembolization, and ablation procedures performed in 1,092 patients from June 2009 to April 2016. Pathology, hepatocellular carcinoma (HCC) stage (American Joint Committee on Cancer), neuroendocrine tumor (NET) grade, initial locoregional therapy, overall survival after initial locoregional therapy, Child-Pugh score, Eastern Cooperative Oncology Group performance status, Charlson Comorbidity Index, and outpatient medications taken at the time of locoregional therapy were analyzed for each patient. Kaplan-Meier survival curves were calculated for patients taking 29 medications or medication classes (including prescription and nonprescription medications) for reasons unrelated to their primary cancer diagnosis. Kaplan-Meier curves were compared using the log-rank test. For patients with HCC initially treated with embolization (n = 304 patients), the following medications were associated with improved survival when taken at the time of embolization: beta-blockers (P = .0007), aspirin (P = .0008) and other nonsteroidal antiinflammatory drugs (P = .009), proton pump inhibitors (P = .004), and antivirals for hepatitis B or C (P = .01). For colorectal liver metastases initially treated with ablation (n = 172 patients), beta-blockers were associated with improved survival when taken at the time of ablation (P = .02). Aspirin and beta-blockers are associated with significantly improved survival when taken at the time of embolization for HCC. Aspirin was not associated with survival differences after locoregional therapy for NET or colorectal liver metastases, suggesting an HCC-specific effect. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

Generalized Reduced Rank Tests using the Singular Value Decomposition

NARCIS (Netherlands)

F.R. Kleibergen (Frank); R. Paap (Richard)

2003-01-01

textabstractWe propose a novel statistic to test the rank of a matrix. The rank statistic overcomes deficiencies of existing rank statistics, like: necessity of a Kronecker covariance matrix for the canonical correlation rank statistic of Anderson (1951), sensitivity to the ordering of the variables

Improvements of a Kaplan type small turbine: Forbedre og vidreutvikle en Kaplan småturbin

OpenAIRE

Fjærvold, Lars

2012-01-01

The goal with this master thesis was to establish Hill diagrams and improve a Kaplan turbine intended for use in Afghanistan. The turbine efficiency has been tested in setting 1 and 2. Turbine efficiency in setting 3 and 4 could not be tested because the runner blades interfere with the housing making it impossible to rotate the turbine. The efficiency was tested with an effective pressure head ranging from 2 to 8 meters. Best efficiency point was not reached because of limitations in the te...

Treatment Outcomes for T4 Oropharyngeal Squamous Cell Carcinoma.

Science.gov (United States)

Zenga, Joseph; Wilson, Michael; Adkins, Douglas R; Gay, Hiram A; Haughey, Bruce H; Kallogjeri, Dorina; Michel, Loren S; Paniello, Randal C; Rich, Jason T; Thorstad, Wade L; Nussenbaum, Brian

2015-12-01

Little is known about treatment outcomes for T4 oropharyngeal squamous cell carcinoma (OPSCC), particularly in the era of human papillomavirus (HPV)-related disease. To evaluate oncologic outcomes for T4 OPSCC treated with primary surgical and nonsurgical therapies. Retrospective cohort study of 131 patients from a single academic hospital, who were treated for T4a or T4b OPSCC (with any N stage and without distant metastatic disease at presentation) between 1998 and 2012 and had a minimum 2-year follow-up (the median follow-up time was 34.6 months). This study was conducted between January 1, 1998, and November 1, 2012. Sixty-nine patients underwent nonsurgical therapy, 47 (68%) of whom had p16-positive tumors. Nonsurgical treatment paradigms included induction chemotherapy followed by chemoradiotherapy (n = 36 [54%]), concurrent chemoradiotherapy (n = 29 [43%]), and induction chemotherapy followed by radiation therapy alone (n = 2 [3%]). Sixty-two patients underwent surgical treatment, 50 (81%) of whom had p16-positive tumors. Fifty-seven surgical patients (92%) received adjuvant therapy. Overall survival (OS) was the primary outcome measure. Secondary outcome measures included disease-specific survival (DSS), disease-free survival (DFS), 2-year gastrostomy and tracheostomy tube rates, and major complication rates. Significant baseline differences between the surgical vs nonsurgical groups included age (mean 59.8 vs 55.4 years [P = .005]), sex (male, 95% vs 84% [P = .04]), body mass index (<18.5 [calculated as weight in kilograms divided by height in meters squared], 3% vs 16% [P = .02]), and smoking history of 10 or more pack-years (48% vs 77% [P = .003]). For p16-positive patients, Kaplan-Meier estimates of OS, DSS, and DFS were significantly higher for surgically treated patients than for the nonsurgical group (χ(2)(1) = 7.335 for log-rank P = .007, χ(2)(1) = 8.607 for log-rank P = .003, and χ(2)(1) = 7.763 for log-rank P = .005, respectively

Age at sexual initiation and factors associated with it among youths ...

African Journals Online (AJOL)

Bernt Lindtjorn

Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.

Adiabatic quantum algorithm for search engine ranking.

Science.gov (United States)

Garnerone, Silvano; Zanardi, Paolo; Lidar, Daniel A

2012-06-08

We propose an adiabatic quantum algorithm for generating a quantum pure state encoding of the PageRank vector, the most widely used tool in ranking the relative importance of internet pages. We present extensive numerical simulations which provide evidence that this algorithm can prepare the quantum PageRank state in a time which, on average, scales polylogarithmically in the number of web pages. We argue that the main topological feature of the underlying web graph allowing for such a scaling is the out-degree distribution. The top-ranked log(n) entries of the quantum PageRank state can then be estimated with a polynomial quantum speed-up. Moreover, the quantum PageRank state can be used in "q-sampling" protocols for testing properties of distributions, which require exponentially fewer measurements than all classical schemes designed for the same task. This can be used to decide whether to run a classical update of the PageRank.

Generalized reduced rank tests using the singular value decomposition

NARCIS (Netherlands)

Kleibergen, F.R.; Paap, R.

2002-01-01

We propose a novel statistic to test the rank of a matrix. The rank statistic overcomes deficiencies of existing rank statistics, like: necessity of a Kronecker covariance matrix for the canonical correlation rank statistic of Anderson (1951), sensitivity to the ordering of the variables for the LDU

Measuring the success of combined intravesical dimethyl sulfoxide and triamcinolone for treatment of bladder pain syndrome/interstitial cystitis.

Science.gov (United States)

Gafni-Kane, Adam; Botros, Sylvia M; Du, Hongyan; Sand, Robert I; Sand, Peter K

2013-02-01

The purpose of this study was to investigate change in bladder capacity as a measure of response to combined intravesical dimethyl sulfoxide (DMSO) and triamcinolone instillations for the treatment of newly diagnosed bladder pain syndrome/interstitial cystitis (BPS/IC). 141 newly diagnosed women were identified retrospectively. 79 were treated with weekly DMSO/triamcinolone instillations. Change in bladder capacity with bladder retrofill, daytime urinary frequency, nocturia episodes per night, and Likert scale symptom scores were reviewed. Wilcoxon signed-rank tests, Wilcoxon rank-sum tests, Spearman's rank correlations, COX regression analysis, and a Kaplan-Meier survival curve were performed. Significant changes (median (25(th)-percentile to 75(th)-percentile) were noted for bladder capacity (75 mL (25 to 130 mL), p measure of response to intravesical DMSO/triamcinolone for newly diagnosed BPS/IC. Clinical outcomes do not differ based upon presence of DO.

Therapeutic Inhibition of Pro-Inflammatory Signaling and Toxicity to Staphylococcal Enterotoxin B by a Synthetic Dimeric BB-Loop Mimetic of MyD88

Science.gov (United States)

2012-07-27

56 stock solution and 75 ml of the 16 dilution buffer was mixed with 25 ml of the supernatant, incubated for 30 min at 65 oC to inactivate endogenous ...shock by staphylococcal pyrogenic exotoxin type C. Infect Immun 36: 123–128. Meier survival analysis and log-rank tests were performed to compare

Research on Test-bench for Sonic Logging Tool

Directory of Open Access Journals (Sweden)

Xianping Liu

2016-01-01

Full Text Available In this paper, the test-bench for sonic logging tool is proposed and designed to realize automatic calibration and testing of the sonic logging tool. The test-bench System consists of Host Computer, Embedded Controlling Board, and functional boards. The Host Computer serves as the Human Machine Interface (HMI and processes uploaded data. The software running on Host Computer is designed on VC++, which is developed based on multithreading, Dynamic Linkable Library (DLL and Multiple Document Interface (MDI techniques. The Embedded Controlling Board uses ARM7 as the microcontroller and communicates with Host Computer via Ethernet. The Embedded Controlling Board software is realized based on embedded uclinux operating system with a layered architecture. The functional boards are designed based on Field Programmable Gate Array (FPGA and provide test interfaces for the logging tool. The functional board software is divided into independent sub-modules that can repeatedly be used by various functional boards and then integrated those sub-modules in the top layer. With the layered architecture and modularized design, the software system is highly reliable and extensible. With the help of designed system, a test has been conducted quickly and successfully on the electronic receiving cabin of the sonic logging tool. It demonstrated that the system could greatly improve the production efficiency of the sonic logging tool.

Asympotic efficiency of signed - rank symmetry tests under skew alternatives.

OpenAIRE

Alessandra Durio; Yakov Nikitin

2002-01-01

The efficiency of some known tests for symmetry such as the sign test, the Wilcoxon signed-rank test or more general linear signed rank tests was studied mainly under the classical alternatives of location. However it is interesting to compare the efficiencies of these tests under asymmetric alternatives like the so-called skew alternative proposed in Azzalini (1985). We find and compare local Bahadur efficiencies of linear signed-rank statistics for skew alternatives and discuss also the con...

A Rank Test on Equality of Population Medians

OpenAIRE

Pooi Ah Hin

2012-01-01

The Kruskal-Wallis test is a non-parametric test for the equality of K population medians. The test statistic involved is a measure of the overall closeness of the K average ranks in the individual samples to the average rank in the combined sample. The resulting acceptance region of the test however may not be the smallest region with the required acceptance probability under the null hypothesis. Presently an alternative acceptance region is constructed such that it has the smallest size, ap...

Patient factors associated with lung transplant referral and waitlist for patients with cystic fibrosis and pulmonary fibrosis.

Science.gov (United States)

Liu, Yuan; Vela, Monica; Rudakevych, Tanya; Wigfield, Christopher; Garrity, Edward; Saunders, Milda R

2017-03-01

Since 2005, the Lung Allocation Score (LAS) has prioritized patient benefit and post-transplant survival, reducing waitlist to transplant time to fibrosis (CF) and pulmonary fibrosis (PF). We analyzed the times from transplant eligibility to referral, work-up and waitlisting using Kaplan-Meier curves and log-rank tests. Overall, the referral rate for transplant-eligible patients was 64%. Of those referred, approximately 36% reach the lung transplant waitlist. Referred CF patients were significantly more likely to reach the transplant waitlist than PF patients (CF 60% vs PF 22%, p < 0.05). In addition, CF patients had a shorter wait from transplant eligibility to waitlist than PF patients (329 vs 2,369 days, respectively [25th percentile], p < 0.05). Patients with PF and CF both faced delays from eligibility to referral and waitlist. Quality improvement efforts are needed to better identify and refer appropriate patients for lung transplant evaluation. Targeted interventions may facilitate more efficient evaluation completion and waitlist appearance. Copyright © 2017 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

Readiness for change and short-term outcomes of female adolescents in residential treatment for anorexia nervosa.

Science.gov (United States)

McHugh, Matthew D

2007-11-01

To determine if readiness for change (RFC) at admission predicted length of stay (LOS) and short-term outcomes among female adolescents in residential treatment for anorexia nervosa (AN). Using a prospective cohort design to collect data from participants (N = 65) at admission and discharge, Kaplan-Meier survival analysis and Cox regression tested whether RFC on admission predicted time in LOS to a favorable short-term outcome--a composite endpoint based on minimum criteria for weight gain, drive for thinness, depression, anxiety, and health-related quality of life (HRQOL). Participants with low RFC had a mean survival time to a favorable short-term outcome of 59.4 days compared to 34.1 days for those with high RFC (log rank = 8.44, df = 1, p = .003). The probability of a favorable short-term outcome was 5.30 times greater for participants with high RFC. Readiness for change is a useful predictor of a favorable short-term outcome and should be considered in the assessment profile of patients with AN. (c) 2007 by Wiley Periodicals, Inc.

CXCR4 expression varies significantly among different subtypes of glioblastoma multiforme (GBM) and its low expression or hypermethylation might predict favorable overall survival.

Science.gov (United States)

Ma, Xinlong; Shang, Feng; Zhu, Weidong; Lin, Qingtang

2017-09-01

CXCR4 is an oncogene in glioblastoma multiforme (GBM) but the mechanism of its dysregulation and its prognostic value in GBM have not been fully understood. Bioinformatic analysis was performed by using R2 and the UCSC Xena browser based on data from GSE16011 in GEO datasets and in GBM cohort in TCGA database (TCGA-GBM). Kaplan Meier curves of overall survival (OS) were generated to assess the association between CXCR4 expression/methylation and OS in patients with GBM. GBM patients with high CXCR4 expression had significantly worse 5 and 10 yrs OS (p GBM subtypes, there was an inverse relationship between overall DNA methylation and CXCR4 expression. CXCR4 expression was significantly lower in CpG island methylation phenotype (CIMP) group than in non CIMP group. Log rank test results showed that patients with high CXCR4 methylation (first tertile) had significantly better 5 yrs OS (p = 0.038). CXCR4 expression is regulated by DNA methylation in GBM and its low expression or hypermethylation might indicate favorable OS in GBM patients.

Prognostic Factors of Uterine Serous Carcinoma-A Multicenter Study.

Science.gov (United States)

Zhong, Xiaozhu; Wang, Jianliu; Kaku, Tengen; Wang, Zhiqi; Li, Xiaoping; Wei, Lihui

2018-04-04

The prognostic factors of uterine serous carcinoma (USC) vary among studies, and there is no report of Chinese USC patients. The aim of this study was to investigate the clinicopathological characteristics and prognostic factors in Chinese patients with USC. Patients with USC from 13 authoritative university hospitals in China and treated between 2004 and 2014 were retrospectively reviewed. Three-year disease-free survival rate (DFSR), cumulative recurrence, and cumulative mortality were estimated by Kaplan-Meier analyses and log-rank tests. Multivariate Cox regression analysis was used to model the association of potential prognostic factors with clinical outcomes. Data of a total of 241 patients were reviewed. The median follow-up was 26 months (range, 1-128 months). Median age was 60 years (range, 39-84 years), and 58.0% had stages I-II disease. The 3-year DFSR and cumulative recurrence were 46.8% and 27.7%. Advanced stage (III and IV) (P = 0.004), myometrial invasion (P = 0.001), adnexal involvement (P USC. Prospective studies are needed to confirm these results.

Four decades of the kidney transplantation program at the Institute Nacional de Ciencias Médicas y Nutrición Salvador Zubirán in Mexico City.

Science.gov (United States)

Morales-Buenrostro, Luis E; Marino-Vázquez, Lluvia A; Alberú, Josefina

2009-01-01

This is a retrospective study that includes four decades of kidney transplant program at our Institute, with a total of 923 kidney transplants in 872 recipients. In this report, the effect of variables in recipient, donor, and transplant on long-term graft survival was analyzed using the Kaplan Meier method with log-rank test for survival comparisons. Global graft survival at our center-analyzed by censoring for death-with-functioning-graft-for 1, 5 and 10 years was 93%, 83% and 74%, respectively, with median survival of 24.5 years. When analyzed for all-cause graft loss, 1, 5 and 10 year survival was 90%, 76% and 61%, with 12.8-year median survival. Variables associated with lower graft survival censored for death-with-functioning-graft were transplantation in an earlier decade, less histocompatibility, younger kidney transplant recipients, no induction therapy, and double drug initial immunosuppression. After Cox's regression multivariate analysis, the risk factors that remained associated with worse survival were younger recipient, earlier transplant decade, and deceased donor.

KRAS polymorphisms are associated with survival of CRC in Chinese population.

Science.gov (United States)

Dai, Qiong; Wei, Hui Lian; Huang, Juan; Zhou, Tie Jun; Chai, Li; Yang, Zhi-Hui

2016-04-01

rs12245, rs12587, rs9266, rs1137282, rs61764370, and rs712 of KRAS oncogene are characterized in the 3'UTR. The study highlights the important role of these polymorphisms playing in the susceptibility, oxaliplatin-based chemotherapy sensitivity, progression, and prognosis of CRC. Improved multiplex ligation detection reaction (iMLDR) technique is used for genotyping. An unconditional logistic regression model was used to estimate the association of certain polymorphism and CRC risk. The Kaplan-Meier method, log-rank test, and Cox regression model were used to evaluate the effects of polymorphisms on survival analysis. Results demonstrated that TT genotype and T allele of rs712 were associated with the increased risk of CRC; the patients with GG genotype and G allele of rs61764370 had a shorter survival and a higher risk of relapse or metastasis of CRC. Our studies supported the conclusions that rs61764370 and rs712 polymorphisms of the KRAS are functional and it may play an important role in the development of CRC and oxaliplatin-based chemotherapy efficiency and prognosis of CRC.

Thymidine phosphorylase and hypoxia-inducible factor 1-α expression in clinical stage II/III rectal cancer: association with response to neoadjuvant chemoradiation therapy and prognosis.

Science.gov (United States)

Lin, Shuhan; Lai, Hao; Qin, Yuzhou; Chen, Jiansi; Lin, Yuan

2015-01-01

The aim of this study was to determine whether pretreatment status of thymidine phosphorylase (TP), and hypoxia-inducible factor alpha (HIF-1α) could predict pathologic response to neoadjuvant chemoradiation therapy with oxaliplatin and capecitabine (XELOXART) and outcomes for clinical stage II/III rectal cancer patients. A total of 180 patients diagnosed with clinical stage II/III rectal cancer received XELOXART. The status of TP, and HIF-1α were determined in pretreatment biopsies by immunohistochemistry (IHC). Tumor response was assessed in resected regimens using the tumor regression grade system and TNM staging system. 5-year disease free survival (DFS) and 5-year overall survival (OS) were evaluated with the Kaplan-Meier method and were compared by the log-rank test. Over expression of TP and low expression of HIF-1α were associated with pathologic response to XELOXART and better outcomes (DFS and OS) in clinical stage II/III rectal cancer patients (P rectal cancer received XELOXART. Additional well-designed, large sample, multicenter, prospective studies are needed to confirm the result of this study.

Clinical performance of ART restorations in primary teeth: a survival analysis.

Science.gov (United States)

Faccin, Elise Sasso; Ferreira, Simone Helena; Kramer, Paulo Floriani; Ardenghi, Thiago Machado; Feldens, Carlos Alberto

2009-01-01

To assess the survival of Atraumatic Restorative Treatment (ART) restorations in primary teeth performed in a dental clinical setting. One hundred and five single-surface ART restorations placed in 56 preschool children (mean age 31 months) were included. Final-year dental students performed the restorations using standard ART procedures with hand instruments. A resin-modified glass ionomer cement (Vitremer 3M/ESPE) was used as a restorative material. Performances of the restorations were assessed directly by the ART evaluation criteria. Follow-up period ranged from 6 to 48 months. Survival estimates for restoration longevity were evaluated using the Kaplan-Meier method. Log-rank test (P ART restorations were 89%, 85% and 72% in 6 to 11, 12 to 24 and 25 to 48 months of evaluation respectively. Differences in success rates among demographic and clinical characteristics were not statistically significant. High survivals rates of the ART restorations found in this study seem to indicate the reliability of this approach as an appropriate treatment option for primary teeth in a clinical setting.

Prognostic nutritional index is associated with survival after total gastrectomy for patients with gastric cancer.

Science.gov (United States)

Ishizuka, Mitsuru; Oyama, Yusuke; Abe, Akihito; Tago, Kazuma; Tanaka, Genki; Kubota, Keiichi

2014-08-01

To investigate the influence of clinical characteristics including nutritional markers on postoperative survival in patients undergoing total gastrectomy (TG) for gastric cancer (GC). One hundred fifty-four patients were enrolled. Uni- and multivariate analyses using the Cox proportional hazard model were performed to explore the most valuable clinical characteristic that was associated with postoperative survival. Multivariate analysis using twelve clinical characteristics selected from univariate analyses revealed that age (≤ 72/>72), carcinoembryonic antigen (≤ 20/>20) (ng/ml), white blood cell count (≤ 9.5/>9.5) (× 10(3)/mm(3)), prognostic nutritional index (PNI) (≤ 45/>45) and lymph node metastasis (negative/positive) were associated with postoperative survival. Kaplan-Meier analysis and log-rank test showed that patients with higher PNI (>45) had a higher postoperative survival rate than those with lower PNI (≤ 45) (p<0.001). PNI is associated with postoperative survival of patients undergoing TG for GC and is able to divide such patients into two independent groups before surgery. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Atrophic gastritis and enlarged gastric folds diagnosed by double-contrast upper gastrointestinal barium X-ray radiography are useful to predict future gastric cancer development based on the 3-year prospective observation.

Science.gov (United States)

Yamamichi, Nobutake; Hirano, Chigaya; Ichinose, Masao; Takahashi, Yu; Minatsuki, Chihiro; Matsuda, Rie; Nakayama, Chiemi; Shimamoto, Takeshi; Kodashima, Shinya; Ono, Satoshi; Tsuji, Yosuke; Niimi, Keiko; Sakaguchi, Yoshiki; Kataoka, Yosuke; Saito, Itaru; Asada-Hirayama, Itsuko; Takeuchi, Chihiro; Yakabi, Seiichi; Kaikimoto, Hikaru; Matsumoto, Yuta; Yamaguchi, Daisuke; Kageyama-Yahara, Natsuko; Fujishiro, Mitsuhiro; Wada, Ryoichi; Mitsushima, Toru; Koike, Kazuhiko

2016-07-01

Double-contrast upper gastrointestinal barium X-ray radiography (UGI-XR) is the standard gastric cancer screening method in Japan. Atrophic gastritis and enlarged gastric folds are considered the two major features of Helicobacter pylori-induced chronic gastritis, but the clinical meaning of evaluating them by UGI-XR has not been elucidated. We analyzed healthy UGI-XR examinees without a history of gastrectomy, previous Helicobacter pylori eradication and usage of gastric acid suppressants. Of the 6433 subjects, 1936 (30.1 %) had atrophic gastritis and 1253 (19.5 %) had enlarged gastric folds. During the 3-year prospective observational follow-up, gastric cancer developed in seven subjects, six of whom (85.7 %) had atrophic gastritis with H. pylori infection and five of whom (71.4 %) had enlarged gastric folds with H. pylori infection. The Kaplan-Meier method with log-rank testing revealed that both UGI-XR-based atrophic gastritis (p = 0.0011) and enlarged gastric folds (p = 0.0003) are significant predictors for future gastric cancer incidence.

Prognostic value of N-terminal prohormone brain natriuretic peptide for in-hospital and long-term outcomes in patients with infective endocarditis.

Science.gov (United States)

Wei, Xue-Biao; Liu, Yuan-Hui; He, Peng-Cheng; Yu, Dan-Qing; Zhou, Ying-Ling; Tan, Ning; Chen, Ji-Yan

2017-05-01

Background Limited research studies with a large sample size were performed to evaluate the prognostic value of N-terminal pro-B-type natriuretic peptide (NT-proBNP) for in-hospital or long-term poor outcomes in patients with infective endocarditis. Methods A total of 703 patients with infective endocarditis were enrolled and divided into four groups according to admission NT-pro-BNP (pg/mL) quartiles: Q1 (3522). Multivariate regression was used to determine independent risk of NT-proBNP for in-hospital and one-year death. Results In-hospital death occurred in 9.0% of patients. The in-hospital mortality was increased from the lowest to the highest NT-proBNP quartiles (1.1%, 3.4%, 9.1% and 22.3%, P  2260 pg/mL had 76.2% sensitivity and 69.1% specificity for predicting in-hospital death. Kaplan-Meier analysis showed that patients with NT-proBNP > 2260 pg/ml had a worse prognosis than those without (log-rank test 18.84, P endocarditis.

Meier-Gorlin syndrome

OpenAIRE

de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

2015-01-01

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...

Additional androgen deprivation makes the difference. Biochemical recurrence-free survival in prostate cancer patients after HDR brachytherapy and external beam radiotherapy

International Nuclear Information System (INIS)

Schiffmann, Jonas; Tennstedt, Pierre; Beyer, Burkhard; Boehm, Katharina; Tilki, Derya; Salomon, Georg; Graefen, Markus; Lesmana, Hans; Platz, Volker; Petersen, Cordula; Kruell, Andreas; Schwarz, Rudolf

2015-01-01

The role of additional androgen deprivation therapy (ADT) in prostate cancer (PCa) patients treated with combined HDR brachytherapy (HDR-BT) and external beam radiotherapy (EBRT) is still unknown. Consecutive PCa patients classified as D'Amico intermediate and high-risk who underwent HDR-BT and EBRT treatment ± ADT at our institution between January 1999 and February 2009 were assessed. Multivariable Cox regression models predicting biochemical recurrence (BCR) were performed. BCR-free survival was assessed with Kaplan-Meier analyses. Overall, 392 patients were assessable. Of these, 221 (56.4 %) underwent trimodality (HDR-BT and EBRT and ADT) and 171 (43.6 %) bimodality (HDR-BT and EBRT) treatment. Additional ADT administration reduced the risk of BCR (HR: 0.4, 95 % CI: 0.3-0.7, p < 0.001). D'Amico high-risk patients had superior BCR-free survival when additional ADT was administered (log-rank p < 0.001). No significant difference for BCR-free survival was recorded when additional ADT was administered to D'Amico intermediate-risk patients (log-rank p = 0.2). Additional ADT administration improves biochemical control in D'Amico high-risk patients when HDR-BT and EBRT are combined. Physicians should consider the oncological benefit of ADT administration for these patients during the decision-making process. (orig.) [de

Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

Directory of Open Access Journals (Sweden)

Jie Zhao

2015-01-01

Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.

Adaptive linear rank tests for eQTL studies.

Science.gov (United States)

Szymczak, Silke; Scheinhardt, Markus O; Zeller, Tanja; Wild, Philipp S; Blankenberg, Stefan; Ziegler, Andreas

2013-02-10

Expression quantitative trait loci (eQTL) studies are performed to identify single-nucleotide polymorphisms that modify average expression values of genes, proteins, or metabolites, depending on the genotype. As expression values are often not normally distributed, statistical methods for eQTL studies should be valid and powerful in these situations. Adaptive tests are promising alternatives to standard approaches, such as the analysis of variance or the Kruskal-Wallis test. In a two-stage procedure, skewness and tail length of the distributions are estimated and used to select one of several linear rank tests. In this study, we compare two adaptive tests that were proposed in the literature using extensive Monte Carlo simulations of a wide range of different symmetric and skewed distributions. We derive a new adaptive test that combines the advantages of both literature-based approaches. The new test does not require the user to specify a distribution. It is slightly less powerful than the locally most powerful rank test for the correct distribution and at least as powerful as the maximin efficiency robust rank test. We illustrate the application of all tests using two examples from different eQTL studies. Copyright © 2012 John Wiley & Sons, Ltd.

Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.

Science.gov (United States)

Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J

2014-03-01

Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.

Large cell lymphoma in children and adolescents of the Instituto Nacional de Cancerologia E.S.E. (Bogota, Colombia): 1980-2001

International Nuclear Information System (INIS)

De los Reyes I; Martinez, T; Vizcaino M; Moreno C

2005-01-01

Objective: to characterize and establish the survival of pediatric patients with lymphoma treated at the National Cancer Institute of Colombia, the period 1980-2001. Methods: clinical records of nineteen patients were reviewed, diagnosis was confirmed by morphology, and immune-phenotype was established with CD20, CD30, CD43, CD45RB, CD45RO, CD68, CD3, ALK, tdt and S-100 antibodies. Associations were established by using Fisher's exact test, Kaplan-Meier's method for survival, and the log rank test to compare survival trends. Results: ten patients were girls; the age median was eleven years, with a range between three and sixteen years. Seven cases presented lymphoma at the neck, which was the most frequent localization, nine patients were at stage l; the most frequent immune-phenotype was that of T cells, with eleven cases. Thirteen patients presented complete remission. After two years, event-free survival was 47.3%, disease-free survival was 99.8%, and global survival 68%. After five years, event-free survival was 28,8%. Conclusion: a bigger number of patients must be studied in order to establish more precise estimations concerning clinical features and survival

Secreted protein acidic and rich in cysteine (SPARC is associated with nasopharyngeal carcinoma metastasis and poor prognosis

Directory of Open Access Journals (Sweden)

Wang Hai-Yun

2012-02-01

Full Text Available Abstract Background The aim of the present study was to analyse the expression of Secreted protein acidic and rich in cysteine (SPARC in nasopharyngeal carcinoma (NPC specimens, and to evaluate its correlation with clinicopathologic features, including survival of patients with NPC Methods NPC tissue microarrays (TMAs were constructed from Sun Yat-sen University Cancer Center (SYSUCC, another three centers on mainland China, Singapore and Hong Kong. Using quantitative RT-PCR and Western-blotting techniques, we detected mRNA and protein expression of SPARC in NPC cell lines and immortalized nasopharyngeal epithelial cells (NPECs induced by Bmi-1 (NPEC2 Bmi-1. The difference of SPARC expression in the cell lines was tested using a t-test method. The relationship between the SPARC expression and clinicopathological data was assessed by chi-square. Survival analysis was estimated using the Kaplan-Meier approach with log-rank test. Univariate and multivariate analyses of clinical variables were performed using Cox proportional hazards regression models. Results The expression levels of SPARC mRNA and protein were markedly higher in NPC cell lines than in NPEC2 Bmi-1. Especially, the expression levels of SPARC mRNA and protein were much lower in the 6-10B than in the 5-8 F (P = 0.002, P = 0.001. SPARC immunostaining revealed cytoplasmic localization in NPC cells and no staining in the stroma and epithelium. In addition, high level of SPARC positively correlated with the status of distant metastasis (P = 0.001 and WHO histological classification (P = 0.023. NPC patients with high SPARC expression also had a significantly poorer prognosis than patients with low SPARC expression (log-rank test, P P P Conclusions SPARC expression is common in NPC patients. Our data shows that elevated SPARC expression is a potential unfavorable prognostic factor for patients with NPC.

Identification of significant features by the Global Mean Rank test.

Science.gov (United States)

Klammer, Martin; Dybowski, J Nikolaj; Hoffmann, Daniel; Schaab, Christoph

2014-01-01

With the introduction of omics-technologies such as transcriptomics and proteomics, numerous methods for the reliable identification of significantly regulated features (genes, proteins, etc.) have been developed. Experimental practice requires these tests to successfully deal with conditions such as small numbers of replicates, missing values, non-normally distributed expression levels, and non-identical distributions of features. With the MeanRank test we aimed at developing a test that performs robustly under these conditions, while favorably scaling with the number of replicates. The test proposed here is a global one-sample location test, which is based on the mean ranks across replicates, and internally estimates and controls the false discovery rate. Furthermore, missing data is accounted for without the need of imputation. In extensive simulations comparing MeanRank to other frequently used methods, we found that it performs well with small and large numbers of replicates, feature dependent variance between replicates, and variable regulation across features on simulation data and a recent two-color microarray spike-in dataset. The tests were then used to identify significant changes in the phosphoproteomes of cancer cells induced by the kinase inhibitors erlotinib and 3-MB-PP1 in two independently published mass spectrometry-based studies. MeanRank outperformed the other global rank-based methods applied in this study. Compared to the popular Significance Analysis of Microarrays and Linear Models for Microarray methods, MeanRank performed similar or better. Furthermore, MeanRank exhibits more consistent behavior regarding the degree of regulation and is robust against the choice of preprocessing methods. MeanRank does not require any imputation of missing values, is easy to understand, and yields results that are easy to interpret. The software implementing the algorithm is freely available for academic and commercial use.

S-shaped versus conventional straight skin incision: Impact on primary functional maturation, stenosis and thrombosis of autogenous radiocephalic arteriovenous fistula: Impact of incision on maturation, stenosis & failure of RCAVF. Study design: Prospective observational comparative.

Science.gov (United States)

Kordzadeh, Ali; Panayiotopolous, Yiannis

2017-10-01

The objective of this study is to test the null hypothesis that an S-shaped surgical incision versus conventional (straight) skin incision in the creation of autogenous radiocephalic arteriovenous fistulas (RCAVFs) have no impact on the primary end-point of primary functional maturation and secondary end points of stenosis and thrombosis. A prospective observational comparative consecutive study with intention-to-treat on individuals undergoing only radiocephalic arteriovenous fistula (RCAVFs) over a period of 12 months was conducted. Variables on patient's demographics, comorbidities, anesthesia type, mean arterial blood pressure, thrill, laterality, cephalic vein and radial artery diameter were collated. The test of probability was assessed through Chi-Square, Kaplan-Meier survival estimator and Log-Rank analysis. Total of n = 83 individuals with median age of 67 years (IQR, 20-89) and male predominance 83% during this period were subjected to RCAVF formation. Total of n = 45 patients in straight skin incision were compared to n = 38 individuals in S-shaped group. Despite equal prevalence of demographics, comorbidities, anesthesia type, mean arterial blood pressure (MAP), thrill, laterality, cephalic vein and radial artery diameter ( p  > 0.05) higher incidence of juxta-anastomotic stenosis was noted in the straight skin incision group ( p  = 0.029) in comparative and survival analysis (Log-Rank, p  = 0.036). The maturation of the entire cohort was 69% (S-shaped 76% vs. straight group 62%) (p > 0.05). The outcome of this study demonstrates that S-shaped surgical skin incision is associated with a lower incidence of stenosis in comparison to straight incision type in RCAVF formation.

Are comorbid anxiety disorders a risk factor for suicide attempts in patients with mood disorders? A two-year prospective study.

Science.gov (United States)

Abreu, L N; Oquendo, M A; Galfavy, H; Burke, A; Grunebaum, M F; Sher, L; Sullivan, G M; Sublette, M E; Mann, J; Lafer, B

2018-01-01

Comorbid anxiety disorders have been considered a risk factor for suicidal behavior in patients with mood disorders, although results are controversial. The aim of this two-year prospective study was to determine if lifetime and current comorbid anxiety disorders at baseline were risk factors for suicide attempts during the two-year follow-up. We evaluated 667 patients with mood disorders (504 with major depression and 167 with bipolar disorder) divided in two groups: those with lifetime comorbid anxiety disorders (n=229) and those without (n=438). Assessments were performed at baseline and at 3, 12, and 24 months. Kaplan-Meier survival analysis and log-rank test were used to evaluate the relationship between anxiety disorders and suicide attempts. Cox proportional hazard regression was performed to investigate clinical and demographic variables that were associated with suicide attempts during follow-up. Of the initial sample of 667 patients, 480 had all three follow-up interviews. During the follow-up, 63 patients (13.1%) attempted suicide at least once. There was no significant difference in survival curves for patients with and without comorbid anxiety disorders (log-rank test=0.269; P=0.604). Female gender (HR=3.66, P=0.001), previous suicide attempts (HR=3.27, P=0.001) and higher scores in the Buss-Durkee Hostility Inventory (HR=1.05, P≤0.001) were associated with future suicide attempts. Our results suggest that comorbid anxiety disorders were not risk factors for suicide attempts. Further studies were needed to determine the role of anxiety disorders as risk factors for suicide attempts. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Frailty Index Developed From a Cancer-Specific Geriatric Assessment and the Association With Mortality Among Older Adults With Cancer.

Science.gov (United States)

Guerard, Emily J; Deal, Allison M; Chang, YunKyung; Williams, Grant R; Nyrop, Kirsten A; Pergolotti, Mackenzi; Muss, Hyman B; Sanoff, Hanna K; Lund, Jennifer L

2017-07-01

Background: An objective measure is needed to identify frail older adults with cancer who are at increased risk for poor health outcomes. The primary objective of this study was to develop a frailty index from a cancer-specific geriatric assessment (GA) and evaluate its ability to predict all-cause mortality among older adults with cancer. Patients and Methods: Using a unique and novel data set that brings together GA data with cancer-specific and long-term mortality data, we developed the Carolina Frailty Index (CFI) from a cancer-specific GA based on the principles of deficit accumulation. CFI scores (range, 0-1) were categorized as robust (0-0.2), pre-frail (0.2-0.35), and frail (>0.35). The primary outcome for evaluating predictive validity was all-cause mortality. The Kaplan-Meier method and log-rank tests were used to compare survival between frailty groups, and Cox proportional hazards regression models were used to evaluate associations. Results: In our sample of 546 older adults with cancer, the median age was 72 years, 72% were women, 85% were white, and 47% had a breast cancer diagnosis. Overall, 58% of patients were robust, 24% were pre-frail, and 18% were frail. The estimated 5-year survival rate was 72% in robust patients, 58% in pre-frail patients, and 34% in frail patients (log-rank test, P older adults with cancer, a finding that was independent of age, sex, cancer type and stage, and number of medical comorbidities. The CFI has the potential to become a tool that oncologists can use to objectively identify frailty in older adults with cancer. Copyright © 2017 by the National Comprehensive Cancer Network.

Predictors for adverse outcome after iliac angioplasty and stenting for limb-threatening ischemia.

Science.gov (United States)

Timaran, Carlos H; Stevens, Scott L; Freeman, Michael B; Goldman, Mitchell H

2002-09-01

The role of iliac artery angioplasty and stenting (IAS) for the treatment of limb-threatening ischemia is not defined. IAS has been used primarily for patients with disabling claudication. Because poorer results have been shown in patients with critical ischemia after iliac artery angioplasty, the purpose of this study was to estimate the influence of risk factors on the outcome of iliac angioplasty and stent placement in patients with limb-threatening ischemia. During a 5-year period (from 1996 to 2001), 85 iliac angioplasty and stent placement procedures (107 stents) were performed in 31 women and 43 men with limb-threatening ischemia. Patients with claudication were specifically excluded. The criteria prepared by the Ad Hoc Committee on Reporting Standards (Society for Vascular Surgery/International Society for Cardiovascular Surgery) were followed to define the variables. The TransAtlantic InterSociety Consensus classification was used to characterize the type of iliac lesions. Both univariate (Kaplan-Meier [KM]) and multivariate analyses (Cox proportional hazards model) were used to determine the association between variables, cumulative patency, limb salvage, and survival. Indications for iliac angioplasty with stenting were ischemic rest pain (56%) and tissue loss (44%). Primary stenting was performed in 36 patients (42%). Stents were placed selectively after iliac angioplasty mainly for residual stenosis or pressure gradient (43%). Overall, primary stent patency rate was 90% at 1 year, 74% at 3 years, and 69% at 5 years. Primary stent patency rate was significantly reduced in women compared with men (KM, log-rank test, P 1.6 mg/dL; KM, log-rank test, P IAS. Limb salvage, as shown in this study, is not affected by previous iliac stent failure.

Predictive Factors for Visual Field Conversion: Comparison of Scanning Laser Polarimetry and Optical Coherence Tomography.

Science.gov (United States)

Diekmann, Theresa; Schrems-Hoesl, Laura M; Mardin, Christian Y; Laemmer, Robert; Horn, Folkert K; Kruse, Friedrich E; Schrems, Wolfgang A

2018-02-01

The purpose of this study was to compare the ability of scanning laser polarimetry (SLP) and spectral-domain optical coherence tomography (SD-OCT) to predict future visual field conversion of subjects with ocular hypertension and early glaucoma. All patients were recruited from the Erlangen glaucoma registry and examined using standard automated perimetry, 24-hour intraocular pressure profile, and optic disc photography. Peripapillary retinal nerve fiber layer thickness (RNFL) measurements were obtained by SLP (GDx-VCC) and SD-OCT (Spectralis OCT). Positive and negative predictive values (PPV, NPV) were calculated for morphologic parameters of SLP and SD-OCT. Kaplan-Meier survival curves were plotted and log-rank tests were performed to compare the survival distributions. Contingency tables and Venn-diagrams were calculated to compare the predictive ability. The study included 207 patients-75 with ocular hypertension, 85 with early glaucoma, and 47 controls. Median follow-up was 4.5 years. A total of 29 patients (14.0%) developed visual field conversion during follow-up. SLP temporal-inferior RNFL [0.667; 95% confidence interval (CI), 0.281-0.935] and SD-OCT temporal-inferior RNFL (0.571; 95% CI, 0.317-0.802) achieved the highest PPV; nerve fiber indicator (0.923; 95% CI, 0.876-0.957) and SD-OCT mean (0.898; 95% CI, 0.847-0.937) achieved the highest NPV of all investigated parameters. The Kaplan-Meier curves confirmed significantly higher survival for subjects within normal limits of measurements of both devices (P<0.001). Venn diagrams tested with McNemar test statistics showed no significant difference for PPV (P=0.219) or NPV (P=0.678). Both GDx-VCC and SD-OCT demonstrate comparable results in predicting future visual field conversion if taking typical scans for GDx-VCC. In addition, the likelihood ratios suggest that GDx-VCC's nerve fiber indicator<30 may be the most useful parameter to confirm future nonconversion. (http://www.ClinicalTrials.gov number, NTC

Eigentumors for prediction of treatment failure in patients with early-stage breast cancer using dynamic contrast-enhanced MRI: a feasibility study

Science.gov (United States)

Chan, H. M.; van der Velden, B. H. M.; E Loo, C.; Gilhuijs, K. G. A.

2017-08-01

We present a radiomics model to discriminate between patients at low risk and those at high risk of treatment failure at long-term follow-up based on eigentumors: principal components computed from volumes encompassing tumors in washin and washout images of pre-treatment dynamic contrast-enhanced (DCE-) MR images. Eigentumors were computed from the images of 563 patients from the MARGINS study. Subsequently, a least absolute shrinkage selection operator (LASSO) selected candidates from the components that contained 90% of the variance of the data. The model for prediction of survival after treatment (median follow-up time 86 months) was based on logistic regression. Receiver operating characteristic (ROC) analysis was applied and area-under-the-curve (AUC) values were computed as measures of training and cross-validated performances. The discriminating potential of the model was confirmed using Kaplan-Meier survival curves and log-rank tests. From the 322 principal components that explained 90% of the variance of the data, the LASSO selected 28 components. The ROC curves of the model yielded AUC values of 0.88, 0.77 and 0.73, for the training, leave-one-out cross-validated and bootstrapped performances, respectively. The bootstrapped Kaplan-Meier survival curves confirmed significant separation for all tumors (P  <  0.0001). Survival analysis on immunohistochemical subgroups shows significant separation for the estrogen-receptor subtype tumors (P  <  0.0001) and the triple-negative subtype tumors (P  =  0.0039), but not for tumors of the HER2 subtype (P  =  0.41). The results of this retrospective study show the potential of early-stage pre-treatment eigentumors for use in prediction of treatment failure of breast cancer.

Prevalence and mortality of cancer among HIV-infected inpatients in Beijing, China.

Science.gov (United States)

Yang, Jun; Su, Shu; Zhao, Hongxin; Wang, Dennis; Wang, Jiali; Zhang, Fujie; Zhao, Yan

2016-02-16

Cancer is responsible for elevated HIV-related morbidity and mortality. Research on HIV-infected patients with concurrent cancer is rare in China. The purpose of our study was to investigate the prevalence and risk factors associated with cancer among HIV-infected inpatients in Beijing, and to investigate the mortality and risk factors among HIV-infected inpatients with cancer. Hospital records from a total of 1946 HIV-infected patients were collected from the Beijing Ditan Hospital. The data, from 2008 to 2013, were collected retrospectively. The cancer diagnoses included AIDS-defining cancers (ADC) and non-AIDS defining cancers (NADC). Logistic regression was used to identify risk factors predicting the concurrence of cancer with HIV. Mortality was examined using Kaplan-Meier estimates and Cox proportional hazards models. 7.7 % (149 cases) of all HIV-infected inpatients had concurrent cancer at their first hospital admission; of those, 33.6 % (50 cases) had ADCs, and 66.4 % (99 cases) had NADCs. The most prevalent NADCs were Hodgkin's lymphoma, gastrointestinal cancer, liver cancer, and lung cancer. Patients who did not accept antiretroviral therapy (ART) were more likely to suffer from cancer [AOR = 2.07 (1.42-3.01), p = 0.001]. Kaplan-Meier curves indicated that the survival probability of HIV-positive cancer patients was significantly lower than that of HIV-positive cancer-free patients (log-rank test, p cancer, the mortality was also higher among those who did not receive ART [AHR = 2.19 (1.84-2.61), p cancer concurrence among hospitalized HIV-infected patients was 7.7 %. Concurrent cancer also increased mortality among HIV-infected patients. ART was protective against concurrent cancer as well as mortality among HIV-infected cancer patients. These results highlight the importance of promoting cancer screening and early ART initiation among HIV-infected patients.

Proton Beam Radiotherapy for Uveal Melanomas at Nice Teaching Hospital: 16 Years' Experience

International Nuclear Information System (INIS)

Caujolle, Jean-Pierre; Mammar, Hamid; Chamorey, Emmanuel Phar; Pinon, Fabien; Herault, Joel; Gastaud, Pierre

2010-01-01

Purpose: To present the results of uveal melanomas treated at Nice Teaching Hospital. Methods and Materials: This retrospective study included 886 consecutive patients referred to our clinic for the treatment of uveal melanomas by proton beam radiotherapy from June 1991 to December 2007. Survival rates were determined by using Kaplan-Meier estimates, and prognostic factors were evaluated using the log-rank test or Cox model. Results: The number (percent total) of subjects staged according to the TNM classification system (6th edition) of malignant tumors included 39 stage T1 (4.4%), 420 stage T2 (47.40%), 409 stage T3 (46.16%), and 18 stage T4 (2.03%) patients. The median follow-up was 63.7 months. The Kaplan-Meier overall survival rate at 5 years according to the sixth edition TNM classification was 92% for T1, 89% for T2, 67% for T3, and 62% for T4; and at 10 years, 86% for T1, 78% for T2, 43% for T3, and 41% for T4. Five factors were found to be associated with an increased death rate: advanced age, tumor thickness, largest tumor basal diameter, tumor volume, and tumor volume-to-eyeball volume ratio. The metastasis-free survival rates were 88.3 % at 5 years and 76.4 % at 10 years. The local control rates were 93.9% at 5 years and 92.1% at 10 years. The ocular conservation rates were 91.1% at 5 years and 87.3% at 10 years. Conclusions: We report the results of a large series of patients treated for uveal melanomas with a very long follow-up. Despite the large tumor volume treated, our results were similar to previously published findings relating to proton beam therapy.

Red cell distribution width and its association with mortality in neonatal sepsis.

Science.gov (United States)

Martin, Snehal L; Desai, Saumil; Nanavati, Ruchi; Colah, Roshan B; Ghosh, Kanjaksha; Mukherjee, Malay B

2018-01-08

Neonatal sepsis is a major cause of mortality in the developing countries. However, with current severity scores and laboratory parameters, predicting outcomes of neonatal sepsis is a serious challenge. Red cell distribution width (RDW) is a readily available pragmatic means to predict outcomes of various comorbidities in adults and children, without causing any additional blood loss. However, its utility in neonates remains unexplored. Hence, the objective of the present study was to evaluate the association of RDW with neonatal sepsis and its role as a predictive marker for mortality. This Prospective observational study was carried out in a Level IIIB NICU for a period of 3 years. It involved comparison of RDW values of septic neonates with those of controls (matched for gestational age and birth weight) with an equal allocation ratio. A total of 251 septic neonates along with 251 controls >28 weeks of gestational age were enrolled. The RDW was derived from complete blood count done within first 6 hours of life. After arranging the RDW (median; interquartile range (IQR)), the values were categorized as those above the 50th percentile i.e. ≥20% and those below the 50th percentile i.e. rates of the above two groups were assessed using the Kaplan-Meier curve and the log rank test. RDW levels were significantly higher among the neonatal sepsis cases (19.90%) as compared to the controls (18.90%) with a p value of < .001. RDW was significantly higher amongst the nonsurvivors than survivors (p < .003). Kaplan-Meier curve showed that septic neonates having RDW values ≥20% had significantly increased mortality (p < .02) with a hazard ratio of 0.5. High RDW is associated with neonatal sepsis and is an independent outcome predictor for mortality associated with neonatal sepsis.

Additional androgen deprivation makes the difference. Biochemical recurrence-free survival in prostate cancer patients after HDR brachytherapy and external beam radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Schiffmann, Jonas; Tennstedt, Pierre; Beyer, Burkhard; Boehm, Katharina; Tilki, Derya; Salomon, Georg; Graefen, Markus [University Medical Center Hamburg-Eppendorf, Martini-Clinic Prostate Cancer Center, Hamburg (Germany); Lesmana, Hans; Platz, Volker; Petersen, Cordula; Kruell, Andreas; Schwarz, Rudolf [University Medical Center Hamburg-Eppendorf, Department of Radiation oncology, Hamburg (Germany)

2015-04-01

The role of additional androgen deprivation therapy (ADT) in prostate cancer (PCa) patients treated with combined HDR brachytherapy (HDR-BT) and external beam radiotherapy (EBRT) is still unknown. Consecutive PCa patients classified as D'Amico intermediate and high-risk who underwent HDR-BT and EBRT treatment ± ADT at our institution between January 1999 and February 2009 were assessed. Multivariable Cox regression models predicting biochemical recurrence (BCR) were performed. BCR-free survival was assessed with Kaplan-Meier analyses. Overall, 392 patients were assessable. Of these, 221 (56.4 %) underwent trimodality (HDR-BT and EBRT and ADT) and 171 (43.6 %) bimodality (HDR-BT and EBRT) treatment. Additional ADT administration reduced the risk of BCR (HR: 0.4, 95 % CI: 0.3-0.7, p < 0.001). D'Amico high-risk patients had superior BCR-free survival when additional ADT was administered (log-rank p < 0.001). No significant difference for BCR-free survival was recorded when additional ADT was administered to D'Amico intermediate-risk patients (log-rank p = 0.2). Additional ADT administration improves biochemical control in D'Amico high-risk patients when HDR-BT and EBRT are combined. Physicians should consider the oncological benefit of ADT administration for these patients during the decision-making process. (orig.) [German] Der Nutzen einer zusaetzlichen Hormonentzugstherapie (ADT, ''androgen deprivation therapy'') fuer Patienten mit Prostatakarzinom (PCa), welche mit einer Kombination aus HDR-Brachytherapie (HDR-BT) und perkutaner Bestrahlung (EBRT) behandelt werden, ist weiterhin ungeklaert. Fuer diese Studie wurden konsekutive, nach der D'Amico-Risikoklassifizierung in ''intermediate'' und ''high-risk'' eingeteilte Patienten ausgewaehlt, die zwischen Januar 1999 und Februar 2009 in unserem Institut eine kombinierte Therapie aus HDR-BT, EBRT ± ADT erhalten haben. Eine

Effectiveness of brachytherapy in treating carcinoma of the vulva

International Nuclear Information System (INIS)

Pohar, Surjeet; Hoffstetter, Sylvette; Peiffert, Didier; Luporsi, Elisabeth; Pernot, Monique

1995-01-01

Purpose: Radical radiotherapeutic management of vulvar cancer often incorporates brachytherapy as a portion of the treatment regimen. However, few studies using this modality alone to manage vulvar cancer have been published. Methods and Materials: Thirty four patients were treated with iridium-192 ( 192 Ir) brachytherapy for vulvar cancer between 1975 and 1993 at Centre Alexis Vautrin. Twenty-one patients were treated at first presentation when surgery was contraindicated or declined. Of these patients, 12 had International Federation of Gynecology and Obstetrics Classification Stage III or IV disease, 8 were Stage II, 1 was Stage I, and 1 was Stage 0. Thirteen patients were treated for recurrent disease. Paris system rules for implantation and dose prescription were followed. The median reference dose was 60 Gy (range 53 to 88 Gy). At the time of analysis, 10 of 34 patients were alive. Median follow-up in these 10 patients was 31 months (range: 21 months to 107 months). Fourteen of the 24 deaths were from causes other than vulvar cancer. Results: Kaplan-Meier actuarial 5-year local control was 47% (95% confidence interval (CI) = 23 to 73%) and 5-year actuarial loco-regional control was 45% (95% CI = 21 to 70%). Kaplan-Meier actuarial 5-year disease-specific survival was 56% (95% CI = 33 to 76%) and actuarial 5-year survival was 29% (95% CI = 15 to 49%). Median time to death was 14 months. Subset analysis revealed a higher actuarial 5-year local control in patients treated at first presentation than those treated for recurrence (80 vs. 19%, log rank, p = 0.04). Similarly, actuarial 5-year loco-regional control was higher in patients treated at first presentation (80 vs. 16%, log rank, p 0.01). The two groups did not differ significantly in disease-specific or overall survival. The actuarial 5-year disease specific survival of 56% is somewhat less than the expected 5-year disease-specific survival after surgery in a group having a similar proportion of early stage

Application of the BAR score as a predictor of short- and long-term survival in liver transplantation patients.

Science.gov (United States)

de Campos Junior, Ivan Dias; Stucchi, Raquel Silveira Bello; Udo, Elisabete Yoko; Boin, Ilka de Fátima Santana Ferreira

2015-01-01

The balance of risk (BAR) is a prediction system after liver transplantation. To assess the BAR system, a retrospective observational study was performed in 402 patients who had transplant surgery between 1997 and 2012. The BAR score was computed for each patient. Receiver operating characteristic curve analysis with the Hosmer-Lemeshow test was used to calculate sensitivity, specificity, and model calibration. The cutoff value with the best Youden index was selected. Statistical analysis employed the Kaplan-Meier method (log-rank test) for survival, the Mann-Whitney test for group comparison, and multiple logistic regression analysis. 3-month survival was 46% for BAR ≥ 11 and 77% for BAR BAR ≥ 11 and 69% for BAR BAR ≥ 11 [odds ratio (OR) 3.08; 95% confidence interval (CI) 1.75-5.42; p = 0.001] and intrasurgical use of packed red blood cells (RBC) above 6 units (OR 4.49; 95% CI 2.73-7.39; p = 0.001). For survival BAR ≥ 11 (OR 2.94; 95% CI 1.67-5.16; p = 0.001) and RBC >6 units (OR 2.99; 95% CI 1.92-4.64; p = 0.001). Our study contributes to the incorporation of the BAR system into Brazilian transplantation centers.

Pendidikan Kesehatan Reproduksi Formal dan Hubungan Seksual Pranikah Remaja Indonesia

Directory of Open Access Journals (Sweden)

Anggriyani Wahyu Pinandari

2015-08-01

by sexual and reproductive revolution. Potential problems in this era are the increase of premarital sexual behavior, unwanted pregnancy, sexual transmitted infection and drug abuse. This study aimed to examine the influence of formal reproductive health education to delay premarital sexual intercourse among Indonesian teenagers and young adults. Cross sectional study analyzed as retrospective cohort used data of Indonesian Teenage Reproductive Health Survey in 2012 (10,980 men and 8,902 women. Effects of formal reproductive health education to delay sexual intercourse behavior was analyzed using kaplan meier curve, log-rank test, and chi square test, meanwhile multivariat analysis used logistic regression. All tests used confidence interval 95% and p value = 0.05. Results of survival analysis of abstinence committing sexual intercourse showed that teenagers who didn’t receive or only receive one of reproductive health education materials had bigger hazard ratio (respectively 1.55 (CI=1.32 – 1.82; 0.99 (CI=0.86 – 1.15 and 2.26 (CI=1.43 – 3.56. Receiving complete information gave longer abstinence time. Drug abuse, smoking, alcohol, men, aged between 20 – 24 years old and poor were more likely to commit premarital sexual intercourse. Receipt of reproductive health information at formal education level may delay the occurrence of premarital sexual intercourse.

CASAS: Cancer Survival Analysis Suite, a web based application.

Science.gov (United States)

Rupji, Manali; Zhang, Xinyan; Kowalski, Jeanne

2017-01-01

We present CASAS, a shiny R based tool for interactive survival analysis and visualization of results. The tool provides a web-based one stop shop to perform the following types of survival analysis:  quantile, landmark and competing risks, in addition to standard survival analysis.  The interface makes it easy to perform such survival analyses and obtain results using the interactive Kaplan-Meier and cumulative incidence plots.  Univariate analysis can be performed on one or several user specified variable(s) simultaneously, the results of which are displayed in a single table that includes log rank p-values and hazard ratios along with their significance. For several quantile survival analyses from multiple cancer types, a single summary grid is constructed. The CASAS package has been implemented in R and is available via http://shinygispa.winship.emory.edu/CASAS/. The developmental repository is available at https://github.com/manalirupji/CASAS/.

Comparing survival curves using rank tests

NARCIS (Netherlands)

Albers, Willem/Wim

1990-01-01

Survival times of patients can be compared using rank tests in various experimental setups, including the two-sample case and the case of paired data. Attention is focussed on two frequently occurring complications in medical applications: censoring and tail alternatives. A review is given of the

Rankings of International Achievement Test Performance and Economic Strength: Correlation or Conjecture?

Directory of Open Access Journals (Sweden)

CHRISTOPHER H. TIENKEN

2008-04-01

Full Text Available Examining a popular political notion, this article presents results from a series of Spearman Rho calculations conducted to investigate relationships between countries’ rankings on international tests of mathematics and science and future economic competitiveness as measured by the 2006 World Economic Forum’s Growth Competitiveness Index (GCI. The study investigated the existence of relationships between international test rankings from three different time periods during the last 50 years of U.S. education policy development (i.e., 1957–1982, 1983–2000, and 2001–2006 and 2006 GCI ranks. It extends previous research on the topic by investigating how GCI rankings in the top 50 percent and bottom 50 percent relate to rankings on international tests for the countries that participated in each test. The study found that the relationship between ranks on international tests of mathematics and science and future economic strength is stronger among nations with lower-performing economies. Nations with strong economies, such as the United States, demonstrate a weaker, nonsignificant relationship.

Robust Intratumor Partitioning to Identify High-Risk Subregions in Lung Cancer: A Pilot Study

International Nuclear Information System (INIS)

Wu, Jia; Gensheimer, Michael F.; Dong, Xinzhe; Rubin, Daniel L.; Napel, Sandy; Diehn, Maximilian; Loo, Billy W.; Li, Ruijiang

2016-01-01

Purpose: To develop an intratumor partitioning framework for identifying high-risk subregions from "1"8F-fluorodeoxyglucose positron emission tomography (FDG-PET) and computed tomography (CT) imaging and to test whether tumor burden associated with the high-risk subregions is prognostic of outcomes in lung cancer. Methods and Materials: In this institutional review board–approved retrospective study, we analyzed the pretreatment FDG-PET and CT scans of 44 lung cancer patients treated with radiation therapy. A novel, intratumor partitioning method was developed, based on a 2-stage clustering process: first at the patient level, each tumor was over-segmented into many superpixels by k-means clustering of integrated PET and CT images; next, tumor subregions were identified by merging previously defined superpixels via population-level hierarchical clustering. The volume associated with each of the subregions was evaluated using Kaplan-Meier analysis regarding its prognostic capability in predicting overall survival (OS) and out-of-field progression (OFP). Results: Three spatially distinct subregions were identified within each tumor that were highly robust to uncertainty in PET/CT co-registration. Among these, the volume of the most metabolically active and metabolically heterogeneous solid component of the tumor was predictive of OS and OFP on the entire cohort, with a concordance index or CI of 0.66-0.67. When restricting the analysis to patients with stage III disease (n=32), the same subregion achieved an even higher CI of 0.75 (hazard ratio 3.93, log-rank P=.002) for predicting OS, and a CI of 0.76 (hazard ratio 4.84, log-rank P=.002) for predicting OFP. In comparison, conventional imaging markers, including tumor volume, maximum standardized uptake value, and metabolic tumor volume using threshold of 50% standardized uptake value maximum, were not predictive of OS or OFP, with CI mostly below 0.60 (log-rank P>.05). Conclusion: We propose a robust intratumor

Robust Intratumor Partitioning to Identify High-Risk Subregions in Lung Cancer: A Pilot Study

Energy Technology Data Exchange (ETDEWEB)

Wu, Jia; Gensheimer, Michael F.; Dong, Xinzhe [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Rubin, Daniel L. [Department of Radiology, Stanford University School of Medicine, Stanford, California (United States); Department of Medicine (Biomedical Informatics Research), Stanford University School of Medicine, Stanford, California (United States); Napel, Sandy [Department of Radiology, Stanford University School of Medicine, Stanford, California (United States); Diehn, Maximilian [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Stanford Cancer Institute, Stanford University School of Medicine, Stanford, California (United States); Institute for Stem Cell Biology and Regenerative Medicine, Stanford University School of Medicine, Stanford, California (United States); Loo, Billy W. [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Stanford Cancer Institute, Stanford University School of Medicine, Stanford, California (United States); Li, Ruijiang, E-mail: rli2@stanford.edu [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Stanford Cancer Institute, Stanford University School of Medicine, Stanford, California (United States)

2016-08-01

Purpose: To develop an intratumor partitioning framework for identifying high-risk subregions from {sup 18}F-fluorodeoxyglucose positron emission tomography (FDG-PET) and computed tomography (CT) imaging and to test whether tumor burden associated with the high-risk subregions is prognostic of outcomes in lung cancer. Methods and Materials: In this institutional review board–approved retrospective study, we analyzed the pretreatment FDG-PET and CT scans of 44 lung cancer patients treated with radiation therapy. A novel, intratumor partitioning method was developed, based on a 2-stage clustering process: first at the patient level, each tumor was over-segmented into many superpixels by k-means clustering of integrated PET and CT images; next, tumor subregions were identified by merging previously defined superpixels via population-level hierarchical clustering. The volume associated with each of the subregions was evaluated using Kaplan-Meier analysis regarding its prognostic capability in predicting overall survival (OS) and out-of-field progression (OFP). Results: Three spatially distinct subregions were identified within each tumor that were highly robust to uncertainty in PET/CT co-registration. Among these, the volume of the most metabolically active and metabolically heterogeneous solid component of the tumor was predictive of OS and OFP on the entire cohort, with a concordance index or CI of 0.66-0.67. When restricting the analysis to patients with stage III disease (n=32), the same subregion achieved an even higher CI of 0.75 (hazard ratio 3.93, log-rank P=.002) for predicting OS, and a CI of 0.76 (hazard ratio 4.84, log-rank P=.002) for predicting OFP. In comparison, conventional imaging markers, including tumor volume, maximum standardized uptake value, and metabolic tumor volume using threshold of 50% standardized uptake value maximum, were not predictive of OS or OFP, with CI mostly below 0.60 (log-rank P>.05). Conclusion: We propose a robust

The prognostic value of metabolic tumor volume in FDG PET/CT evaluation of post-operative survival in patients with esophageal squamous cell cancer

International Nuclear Information System (INIS)

Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li

2011-01-01

Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)

Stereotactic Body Radiation Therapy for Re-irradiation of Persistent or Recurrent Non-Small Cell Lung Cancer

International Nuclear Information System (INIS)

Trovo, Marco; Minatel, Emilio; Durofil, Elena; Polesel, Jerry; Avanzo, Michele; Baresic, Tania; Bearz, Alessandra; Del Conte, Alessandro; Franchin, Giovanni; Gobitti, Carlo; Rumeileh, Imad Abu; Trovo, Mauro G.

2014-01-01

Purpose: To retrospectively assess toxicity and outcome of re-irradiation with stereotactic body radiation therapy (SBRT) in patients with recurrent or persistent non-small cell lung cancer (NSCLC), who were previously treated with radical radiation therapy (50-60 Gy). The secondary endpoint was to investigate whether there are dosimetric parameter predictors of severe radiation toxicity. Methods and Materials: The analysis was conducted in 17 patients with “in-field” recurrent/persistent centrally located NSCLC, who underwent re-irradiation with SBRT. SBRT consisted of 30 Gy in 5 to 6 fractions; these prescriptions would be equivalent for the tumor to 37.5 to 40 Gy, bringing the total 2-Gy-per-fraction cumulative dose to 87 to 100 Gy, considering the primary radiation therapy treatment. Actuarial analyses and survival were calculated by the Kaplan-Meier method, and P values were estimated by the log-rank test, starting from the date of completion of SBRT. Dosimetric parameters from the subgroups with and without grade ≥3 pulmonary toxicity were compared using a 2-tailed Student t test. Results: The median follow-up was 18 months (range, 4-57 months). Only 2 patients had local failure, corresponding to a local control rate of 86% at 1 year. The Kaplan-Meier estimates of overall survival (OS) rates at 1 and 2 years were 59% and 29%, respectively; the median OS was 19 months. Four patients (23%) experienced grade 3 radiation pneumonitis, and 1 patient developed fatal pneumonitis. One patient died of fatal hemoptysis 2 months after the completion of SBRT. Unexpectedly, heart maximum dose, D5 (minimum dose to at least 5% of the heart volume), and D10 were correlated with risk of radiation pneumonitis (P<.05). Conclusions: Re-irradiation with SBRT for recurrent/persistent centrally located NSCLC achieves excellent results in terms of local control. However, the high rate of severe toxicity reported in our study is of concern

Stereotactic Body Radiation Therapy for Re-irradiation of Persistent or Recurrent Non-Small Cell Lung Cancer

Energy Technology Data Exchange (ETDEWEB)

Trovo, Marco, E-mail: marcotrovo33@hotmail.com [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Minatel, Emilio; Durofil, Elena [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Polesel, Jerry [Department of Epidemiology and Biostatistics, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Avanzo, Michele [Department of Medical Physics, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Baresic, Tania [Department of Nuclear Medicine, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Bearz, Alessandra [Department of Medical Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Del Conte, Alessandro [Department of Medical Oncology, Pordenone General Hospital, Aviano, Pordenone (Italy); Franchin, Giovanni; Gobitti, Carlo; Rumeileh, Imad Abu; Trovo, Mauro G. [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy)

2014-04-01

Purpose: To retrospectively assess toxicity and outcome of re-irradiation with stereotactic body radiation therapy (SBRT) in patients with recurrent or persistent non-small cell lung cancer (NSCLC), who were previously treated with radical radiation therapy (50-60 Gy). The secondary endpoint was to investigate whether there are dosimetric parameter predictors of severe radiation toxicity. Methods and Materials: The analysis was conducted in 17 patients with “in-field” recurrent/persistent centrally located NSCLC, who underwent re-irradiation with SBRT. SBRT consisted of 30 Gy in 5 to 6 fractions; these prescriptions would be equivalent for the tumor to 37.5 to 40 Gy, bringing the total 2-Gy-per-fraction cumulative dose to 87 to 100 Gy, considering the primary radiation therapy treatment. Actuarial analyses and survival were calculated by the Kaplan-Meier method, and P values were estimated by the log-rank test, starting from the date of completion of SBRT. Dosimetric parameters from the subgroups with and without grade ≥3 pulmonary toxicity were compared using a 2-tailed Student t test. Results: The median follow-up was 18 months (range, 4-57 months). Only 2 patients had local failure, corresponding to a local control rate of 86% at 1 year. The Kaplan-Meier estimates of overall survival (OS) rates at 1 and 2 years were 59% and 29%, respectively; the median OS was 19 months. Four patients (23%) experienced grade 3 radiation pneumonitis, and 1 patient developed fatal pneumonitis. One patient died of fatal hemoptysis 2 months after the completion of SBRT. Unexpectedly, heart maximum dose, D5 (minimum dose to at least 5% of the heart volume), and D10 were correlated with risk of radiation pneumonitis (P<.05). Conclusions: Re-irradiation with SBRT for recurrent/persistent centrally located NSCLC achieves excellent results in terms of local control. However, the high rate of severe toxicity reported in our study is of concern.

Infrainguinal arterial reconstructions in patients with aortoiliac occlusive disease: the influence of iliac stenting.

Science.gov (United States)

Timaran, C H; Stevens, S L; Freeman, M B; Goldman, M H

2001-12-01

Iliac artery angioplasty (IAA) is an effective adjunct when combined with infrainguinal arterial reconstructions (IARs) in appropriate patients with multilevel occlusive disease. However, the effect of iliac artery stenting (IAS) on the outcome of patients undergoing distal bypass procedures is not defined. The purpose of this study was to estimate the influence of previous IAS for iliac occlusive disease on the outcome of IARs, compared with those after IAA alone or aortofemoral bypass grafting procedures (AFBs). During a 5-year period (1995-2000), 105 patients with previous intervention for iliac occlusive disease underwent 120 IARs. The criteria prepared by the Ad Hoc Committee on Reporting Standards (Society for Vascular Surgery/International Society for Cardiovascular Surgery) were followed to define the variables. The TransAtlantic Inter-Society Consensus classification was used to characterize the type of iliac lesions. Univariate (Kaplan-Meier) and multivariate analyses (Cox proportional hazards model) were used to determine the association between preoperative variables and cumulative primary patency. Forty-five IARs were performed in patients with an earlier IAS repair, 33 in patients with an earlier IAA repair, and 42 in patients with an earlier AFB repair. There were not significant differences between patients in the IAS and IAA groups, except for a more frequent use of polytetrafluoroethylene grafts for IARs in the IAS group (40% vs 15%; chi(2) test, P = .03). The 5-year primary patency rate for IARs was 68% in the IAS group, 46% in the IAA group, and 61% in the AFB group. Univariate analyses revealed that primary patency rates for IARs in patients with previous IAS were significantly higher than those in the IAA group (Kaplan-Meier, log-rank test, P = .02). Previous IAA repair was associated with a two-fold increased risk of IAR graft failure (relative risk, 2.2; 95% CI, 1.1-4.8; P = .04). IARs in patients with previous IAS have significantly

Association between circulating fibroblast growth factor 21 and mortality in end-stage renal disease.

Directory of Open Access Journals (Sweden)

Marina Kohara

Full Text Available Fibroblast growth factor 21 (FGF21 is an endocrine factor that regulates glucose and lipid metabolism. Circulating FGF21 predicts cardiovascular events and mortality in type 2 diabetes mellitus, including early-stage chronic kidney disease, but its impact on clinical outcomes in end-stage renal disease (ESRD patients remains unclear. This study enrolled 90 ESRD patients receiving chronic hemodialysis who were categorized into low- and high-FGF21 groups by the median value. We investigated the association between circulating FGF21 levels and the cardiovascular event and mortality during a median follow-up period of 64 months. A Kaplan-Meier analysis showed that the mortality rate was significantly higher in the high-FGF21 group than in the low-FGF21 group (28.3% vs. 9.1%, log-rank, P = 0.034, while the rate of cardiovascular events did not significantly differ between the two groups (30.4% vs. 22.7%, log-rank, P = 0.312. In multivariable Cox models adjusted a high FGF21 level was an independent predictor of all-cause mortality (hazard ratio: 3.98; 95% confidence interval: 1.39-14.27, P = 0.009. Higher circulating FGF21 levels were associated with a high mortality rate, but not cardiovascular events in patient with ESRD, suggesting that circulating FGF21 levels serve as a predictive marker for mortality in these subjects.

Association between circulating fibroblast growth factor 21 and mortality in end-stage renal disease.

Science.gov (United States)

Kohara, Marina; Masuda, Takahiro; Shiizaki, Kazuhiro; Akimoto, Tetsu; Watanabe, Yuko; Honma, Sumiko; Sekiguchi, Chuji; Miyazawa, Yasuharu; Kusano, Eiji; Kanda, Yoshinobu; Asano, Yasushi; Kuro-O, Makoto; Nagata, Daisuke

2017-01-01

Fibroblast growth factor 21 (FGF21) is an endocrine factor that regulates glucose and lipid metabolism. Circulating FGF21 predicts cardiovascular events and mortality in type 2 diabetes mellitus, including early-stage chronic kidney disease, but its impact on clinical outcomes in end-stage renal disease (ESRD) patients remains unclear. This study enrolled 90 ESRD patients receiving chronic hemodialysis who were categorized into low- and high-FGF21 groups by the median value. We investigated the association between circulating FGF21 levels and the cardiovascular event and mortality during a median follow-up period of 64 months. A Kaplan-Meier analysis showed that the mortality rate was significantly higher in the high-FGF21 group than in the low-FGF21 group (28.3% vs. 9.1%, log-rank, P = 0.034), while the rate of cardiovascular events did not significantly differ between the two groups (30.4% vs. 22.7%, log-rank, P = 0.312). In multivariable Cox models adjusted a high FGF21 level was an independent predictor of all-cause mortality (hazard ratio: 3.98; 95% confidence interval: 1.39-14.27, P = 0.009). Higher circulating FGF21 levels were associated with a high mortality rate, but not cardiovascular events in patient with ESRD, suggesting that circulating FGF21 levels serve as a predictive marker for mortality in these subjects.

Classification of rank 2 cluster varieties

DEFF Research Database (Denmark)

Mandel, Travis

We classify rank 2 cluster varieties (those whose corresponding skew-form has rank 2) according to the deformation type of a generic fiber U of their X-spaces, as defined by Fock and Goncharov. Our approach is based on the work of Gross, Hacking, and Keel for cluster varieties and log Calabi...

Verification of Kaplan turbine cam curves realization accuracy at power plant

Directory of Open Access Journals (Sweden)

Džepčeski Dane

2016-01-01

Full Text Available Sustainability of approximately constant value of Kaplan turbine efficiency, for relatively large net head changes, is a result of turbine runner variable geometry. Dependence of runner blades position change on guide vane opening represents the turbine cam curve. The cam curve realization accuracy is of great importance for the efficient and proper exploitation of turbines and consequently complete units. Due to the reasons mentioned above, special attention has been given to the tests designed for cam curves verification. The goal of this paper is to provide the description of the methodology and the results of the tests performed in the process of Kaplan turbine cam curves verification.

Genetics Home Reference: Meier-Gorlin syndrome

Science.gov (United States)

... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...

Metabolic Characteristics and Risks Associated with Stone Recurrence in Korean Young Adult Stone Patients.

Science.gov (United States)

Kang, Ho Won; Seo, Sung Pil; Kim, Won Tae; Kim, Yong-June; Yun, Seok-Joong; Kim, Wun-Jae; Lee, Sang-Cheol

2017-08-01

The aim of this study was to assess the metabolic characteristics and risks of stone recurrence in young adult stone patients in Korea. The medical records of 1532 patients presenting with renal or ureteric stones at our stone clinic between 1994 and 2015 were retrospectively reviewed. Patients were grouped according to age (young adult, 18-29 years; intermediate onset, 30-59 years; old age, ≥60 years) at first presentation, and measurements of clinicometabolic characteristics and risks of stone recurrence were compared. Overall, excretion of urinary stone-forming substances was highest in the intermediate onset group, followed by the young adult and old age groups. Importantly, excretion of urinary citrate was lowest in the young adult group. Kaplan-Meier analyses identified a significant difference between the three age groups in terms of stone recurrence (log rank test, p adult stone patients. Younger age (18-29 years) at first stone presentation was a significant risk factor for stone recurrence, and urinary citrate excretion was an independent risk factor affecting recurrence in this group. Metabolic evaluation and potassium citrate therapy should be considered for young adult stone patients to prevent recurrence.

Sleep disorders and an increased risk of Parkinson's disease in individuals with non-apnea sleep disorders: a population-based cohort study.

Science.gov (United States)

Hsiao, Yi-Han; Chen, Yung-Tai; Tseng, Ching-Ming; Wu, Li-An; Perng, Diahn-Warng; Chen, Yuh-Min; Chen, Tzeng-Ji; Chang, Shi-Chuan; Chou, Kun-Ta

2017-10-01

Sleep disorders are common non-motor symptoms in patients with Parkinson's disease. Our study aims to explore the relationship between non-apnea sleep disorders and future Parkinson's disease. This is a cohort study using a nationwide database. The participants were recruited from the Taiwan National Health Insurance Research Database between 2000 and 2003. A total of 91 273 adult patients who had non-apnea sleep disorders without pre-existing Parkinson's disease were enrolled. An age-, gender-, income-, urbanization- and Charlson comorbidity index score-matched control cohort consisting of 91 273 participants was selected for comparison. The two cohorts were followed for the occurrence of Parkinson's disease, death or until the end of 2010, whichever came first. The Kaplan-Meier analyses revealed patients with non-apnea sleep disorders tended to develop Parkinson's disease (log-rank test, P sleep disorders was an independent risk factor for the development of Parkinson's disease [crude hazard ratio: 1.63, 95% confidence interval (CI): 1.54-1.73, P sleep disorders, especially chronic insomnia, are associated with a higher risk for future Parkinson's disease. © 2017 European Sleep Research Society.

Atrial Fibrillation and Coronary Artery Disease as Risk Factors of Retinal Artery Occlusion: A Nationwide Population-Based Study

Directory of Open Access Journals (Sweden)

Ju-Chuan Yen

2015-01-01

Full Text Available We use Taiwanese national health insurance research database (NHIRD to investigate whether thrombolism (carotid artery disease (CAD as a surrogate or embolism (atrial fibrillation (AF as a surrogate plays roles in later retinal artery occlusion (RAO development and examine their relative weights. The relative risks of RAO between AF and CAD patients and controls were compared by estimating the crude hazard ratio with logistic regression. Kaplan-Meier analysis was used to calculate the cumulative incidence rates of developing RAO, and a log-rank test was used to analyze the differences between the survival curves. Separate Cox proportional hazard regressions were done to compute the RAO-free rate after adjusting for possible confounding factors such as age and sex. The crude hazard ratios were 7.98 for the AF group and 5.27 for the CAD group, and the adjusted hazard ratios were 8.32 and 5.34 for the AF and CAD groups, respectively. The observation time with RAO-free was shorter for AF compared with CAD group (1490 versus 1819 days. AF and CAD were both risk factors for RAO with different hazard ratios. To tackle both AF and CAD is crucial for curbing RAO.

Efficacy of icotinib versus traditional chemotherapy as first-line treatment for preventing brain metastasis from advanced lung adenocarcinoma in patients with epidermal growth factor receptor-sensitive mutation.

Science.gov (United States)

Zhao, Xiao; Zhu, Guangqin; Chen, Huoming; Yang, Ping; Li, Fang; Du, Nan

2016-01-01

This study aimed to investigate the potential use of icotinib as first-line treatment to prevent brain metastasis from advanced lung adenocarcinoma. This investigation was designed as a retrospective nonrandomized controlled study. Enrolled patients received either icotinib or traditional chemotherapy as their first-line treatment. The therapeutic efficacy was compared among patients with advanced. (stages IIIB and IV) lung adenocarcinoma with epidermal growth factor receptor (EGFR)-sensitive mutation. The primary endpoint was the cumulative incidence of brain metastasis, whereas, the secondary endpoint was overall survival(OS). Death without brain metastasis was considered a competitive risk to calculate the cumulative risk of brain metastasis. Survival analysis was conducted using the Kaplan-Meier method and statistical significance was determined using the log-rank test. The present study included 396 patients with 131 in the icotinib group and 265 in the chemotherapy group. Among those with EGFR-sensitive mutation, the cumulative risk of brain metastasis was lower in the icotinib group than in the chemotherapy group. However, no significant difference in OS was observed between the two groups. Icotinib can effectively reduce the incidence of brain metastasis and therefore improve prognosis in advanced lung adenocarcinoma patients with EGFR.sensitive mutation.

The effect of semirigid dressings on below-knee amputations.

Science.gov (United States)

MacLean, N; Fick, G H

1994-07-01

The effect of using semirigid dressings (SRDs) on the residual limb of individuals who have had below-knee amputations as a consequence of peripheral vascular disease was investigated, with the primary question being: Does the time to readiness for prosthetic fitting for patients treated with the SRDs differ from that of patients treated with soft dressings? Forty patients entered the study and were alternately assigned to one of two groups. Nineteen patients were assigned to the SRD group, and 21 patients were assigned to the soft dressing group. The time from surgery to readiness for prosthetic fitting was recorded for each patient. Kaplan-Meier survival curves were generated for each group, and the results were analyzed with the log-rank test. There was a difference between the two curves, and an examination of the curves suggests that the expected time to readiness for prosthetic fitting for patients treated with the SRDs would be less than half that of patients treated with soft dressings. The results suggest that a patient may be ready for prosthetic fitting sooner if treated with SRDs instead of soft dressings.

The value of molecular expression of KIT and KIT ligand analysed using real-time polymerase chain reaction and immunohistochemistry as a prognostic indicator for canine cutaneous mast cell tumours.

Science.gov (United States)

Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M

2015-03-01

This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.

Long-term results of interventional treatment of large unresectable hepatocellular carcinoma (HCC): significant survival benefit from combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) compared to TACE monotherapy

International Nuclear Information System (INIS)

Lubienski, A.; Bitsch, R.G.; Grenacher, L.; Kauffmann, G.W.; Schemmer, P.; Duex, M.

2004-01-01

Purpose: A retrospective analysis of long-term efficacy of combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) and TACE monotherapy was conducted in patients with large, non-resectable hepatocellular carcinoma (HCC). Methods and Materials: Fifty patients with large, unresectable HCC lesions underwent selective TACE. Liver cirrhosis was present in 42 patients, due to alcohol abuse (n = 22) and viral infection (n = 17). In three patients, the underlying cause for liver cirrhosis remained unclear. Child A cirrhosis was found in 22 and Child B cirrhosis in 20 patients. Repeated and combined TACE and PEI were performed in 22 patients and repeated TACE monotherapy was performed in 28 patients. Survival and complication rates were determined and compared. Results: The 6-, 12-, 24- and 36-month survival rates were 61%, 21%, 4%, and 4% for TACE monotherapy and 77%, 55%, 39% and 22% for combined TACE and PEI (Kaplan-Meier method). The kind of treatment significantly affected the survival rate (p=0.002 log-rank test). Severe side effects were present in two patients of the monotherapy group and in three patients of the combination therapy group. (orig.)

TOKYO criteria 2014 for transpapillary biliary stenting.

Science.gov (United States)

Isayama, Hiroyuki; Hamada, Tsuyoshi; Yasuda, Ichiro; Itoi, Takao; Ryozawa, Shomei; Nakai, Yousuke; Kogure, Hirofumi; Koike, Kazuhiko

2015-01-01

It is difficult to carry out meta-analyses or to compare the results of different studies of biliary stents because there is no uniform evaluation method. Therefore, a standardized reporting system is required. We propose a new standardized system for reporting on biliary stents, the 'TOKYO criteria 2014', based on a consensus among Japanese pancreatobiliary endoscopists. Instead of stent occlusion, we use recurrent biliary obstruction, which includes occlusion and migration. The time to recurrent biliary obstruction was estimated using Kaplan-Meier analysis with the log-rank test. We can evaluate both plastic and self-expandable metallic stents (uncovered and covered). We also propose specification of the cause of recurrent biliary obstruction, identification of complications other than recurrent biliary obstruction, indication of severity, measures of technical and clinical success, and a standard for clinical care. Most importantly, the TOKYO criteria 2014 allow comparison of biliary stent quality across studies. Because blocked stents can be drained not only using transpapillary techniques but also by an endoscopic ultrasonography-guided transmural procedure, we should devise an evaluation method that includes transmural stenting in the near future. © 2014 The Authors. Digestive Endoscopy © 2014 Japan Gastroenterological Endoscopy Society.

Improving standard of care through introduction of laparoscopy for the surgical management of gynecological malignancies.

Science.gov (United States)

Bogani, Giorgio; Cromi, Antonella; Serati, Maurizio; Di Naro, Edoardo; Casarin, Jvan; Pinelli, Ciro; Candeloro, Ilario; Sturla, Davide; Ghezzi, Fabio

2015-05-01

This study aimed to evaluate the impact on perioperative and medium-term oncologic outcomes of the implementation of laparoscopy into a preexisting oncologic setting. Data from consecutive 736 patients undergoing surgery for apparent early stage gynecological malignancies (endometrial, cervical, and adnexal cancers) between 2000 and 2011 were reviewed. Complications were graded per the Accordion classification. Survival outcomes within the first 5 years were analyzed using Kaplan-Meier method. Overall, 493 (67%), 162 (22%), and 81 (11%) had surgery for apparent early stage endometrial, cervical, and adnexal cancer. We assisted at an increase of the number of patients undergoing surgery via laparoscopy through the years (from 10% in the years 2000-2003 to 82% in years 2008-2011; P 0.05). The introduction of laparoscopy did not adversely affect medium-term (within 5 years) survival outcomes of patients undergoing surgery for apparent early stage cancers of the endometrium, uterine cervix, and adnexa (P > 0.05 log-rank test). The introduction of laparoscopy into a preexisting oncologic service allows an improvement of standard of care due to a gain in perioperative results, without detriments of medium-term oncologic outcomes.

Long-term results of interventional treatment of large unresectable hepatocellular carcinoma (HCC): significant survival benefit from combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) compared to TACE monotherapy; Langzeitergebnisse der interventionellen Therapie von grossen, inoperablen hepatozellulaeren Karzinomen (HCC): signifikanter Ueberlebensvorteil von transarterieller Chemoembolisation (TACE) und perkutaner Ethanolinjektion (PEI) gegenueber der TACE-Monotherapie

Energy Technology Data Exchange (ETDEWEB)

Lubienski, A.; Bitsch, R.G.; Grenacher, L.; Kauffmann, G.W. [Radiologische Universitaetsklinik Heidelberg, Abt. Radiodiagnostik, Heidelberg (Germany); Schemmer, P. [Chirurgische Universitaetsklinik Heidelberg (Germany); Duex, M. [Radiologisches Zentralinstitut Krankenhaus Nordwest Frankfurt (Germany)

2004-12-01

Purpose: A retrospective analysis of long-term efficacy of combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) and TACE monotherapy was conducted in patients with large, non-resectable hepatocellular carcinoma (HCC). Methods and Materials: Fifty patients with large, unresectable HCC lesions underwent selective TACE. Liver cirrhosis was present in 42 patients, due to alcohol abuse (n = 22) and viral infection (n = 17). In three patients, the underlying cause for liver cirrhosis remained unclear. Child A cirrhosis was found in 22 and Child B cirrhosis in 20 patients. Repeated and combined TACE and PEI were performed in 22 patients and repeated TACE monotherapy was performed in 28 patients. Survival and complication rates were determined and compared. Results: The 6-, 12-, 24- and 36-month survival rates were 61%, 21%, 4%, and 4% for TACE monotherapy and 77%, 55%, 39% and 22% for combined TACE and PEI (Kaplan-Meier method). The kind of treatment significantly affected the survival rate (p=0.002 log-rank test). Severe side effects were present in two patients of the monotherapy group and in three patients of the combination therapy group. (orig.)

Merkel cell carcinoma of the head and neck: poorer prognosis than non-head and neck sites.

Science.gov (United States)

Morand, G B; Madana, J; Da Silva, S D; Hier, M P; Mlynarek, A M; Black, M J

2016-04-01

Merkel cell carcinoma is a rare, aggressive neurocutaneous malignancy. This study investigated whether patients with Merkel cell carcinoma in the head and neck had poorer outcomes than patients with Merkel cell carcinoma located elsewhere. A retrospective study was performed of patients with Merkel cell carcinoma treated at the Jewish General Hospital in Montréal, Canada, from 1993 to 2013. Associations between clinicopathological characteristics and disease-free and disease-specific survival rates were examined according to the Kaplan-Meier method. Twenty-seven patients were identified. Although basic clinicopathological characteristics and treatments were similar between head and neck and non-head and neck Merkel cell carcinoma groups, disease-free and disease-specific survival rates were significantly lower in the head and neck Merkel cell carcinoma group (log-rank test; p = 0.043 and p = 0.001, respectively). Mortality was mainly due to distant metastasis. Patients with head and neck Merkel cell carcinoma had poorer survival rates than patients with non-head and neck Merkel cell carcinoma in our study. The tendency to obtain close margins, a less predictable metastatic pattern, and/or intrinsic tumour factors related to the head and neck may explain this discrepancy.

Relationship between mono-hydroxy-carbazepine serum concentrations and adverse effects in patients on oxcarbazepine monotherapy.

Science.gov (United States)

Sattler, Annika; Schaefer, Marion; May, Theodor W

2015-09-01

To evaluate the relationship between serum concentrations of mono-hydroxy-carbazepine (MHD), the main metabolite of oxcarbazepine (OXC), and the occurrence of adverse effects (AE) in a large group of patients on OXC monotherapy. An antiepileptic drug (AED) therapeutic drug monitoring (TDM) database was analyzed especially with regard to OXC dosage, MHD serum concentration, and the occurrence of AE. In total, 893 blood samples of 442 patients were included in this retrospective study. The statistical evaluation was performed by means of Kaplan-Meier estimates, log-rank tests and generalized estimating equations (GEE). At least one AE was reported in 78 (17.6%) of the 442 patients. At MHD serum concentrations of 30.0 μg/ml and 43.7 μg/ml and OXC dosages of 33.1 mg/kg and 62.3 mg/kg, 25% and 75% of patients, respectively, experienced at least one AE. Log-rank tests indicated that younger patients (<18 years) may be able to tolerate higher MHD serum levels (p = 0.006) and higher OXC dosages per body weight (p < 0.001) compared to adult patients (≥ 18 years). Furthermore, AEs occurred at higher body-weight adjusted OXC dosages of extended release formulations compared to immediate-release formulations (p = 0.010), whereas MHD serum levels at which AEs occurred did not differ significantly between formulations (p = 0.125). Multivariate GEE confirmed the results. The occurrence of AEs is significantly (and non-linearly) dependent on MHD serum level, whereas the dependence of OXC dosage is less distinctive. But, tolerability of OXC seems to depend on age of the patients as well as on pharmaceutical formulation of OXC. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

Two types of lacunar infarcts: further arguments from a study on prognosis.

Science.gov (United States)

de Jong, G; Kessels, F; Lodder, J

2002-08-01

Earlier, we found that lacunar stroke patients with > or =1 asymptomatic lacunar infarcts on CT had leukoaraiosis and hypertension significantly more often than patients without such lesions, and we hypothesized that 2 types of small-vessel disease could be distinguished during life: arteriolosclerosis and microatheromatosis, respectively. Differences in prognosis might sustain this hypothesis of 2 lacunar stroke entities. Therefore, we performed a follow-up in 333 patients with first lacunar stroke, distinguishing those with > or =1 asymptomatic lacunar lesions (LACI+) from those without such lesions (LACI-). Cross-sectional follow-up was performed after 785+/-479 days (mean+/-SD) in 104 LACI+ patients and 865+/-545 days in 229 LACI- patients. Mortality at the end of follow-up was 33% in LACI+ and 21% in LACI- patients [odds ratio (OR), 1.74; 95% confidence interval (CI), 1.01 to 3.01]. Stroke recurrence rate was 21% in LACI+ and 11% in LACI- (OR, 2.09; 95% CI, 1.08 to 4.06). Forty percent of LACI+ and 26% of LACI- patients had unfavorable outcome at the end of follow-up (OR, 1.95; 95% CI, 1.17 to 3.26). Kaplan-Meier curves showed less favorable survival in LACI+ (log-rank test, P=0.0218) and survival free of stroke (log-rank test, P=0.0121) than in LACI-. When we restricted the analysis to patients with both silent lesions and leukoaraiosis (n=63) compared with those without (n=196), differences were even more pronounced. Prognosis for mortality, recurrent stroke, and overall functional outcome in lacunar stroke patients with > or =1 silent lacunar lesions is more unfavorable than in patients without such lesions. These findings sustain the idea of 2 lacunar stroke entities.

Quality of Life after Post-Prostatectomy Intensity Modulated Radiation Therapy: Pelvic Nodal Irradiation Is Not Associated with Worse Bladder, Bowel, or Sexual Outcomes.

Directory of Open Access Journals (Sweden)

James M Melotek

Full Text Available Limited data exist regarding toxicity and quality of life (QOL after post-prostatectomy intensity modulated radiation therapy (IMRT and whether pelvic nodal RT influences these outcomes.118 men were treated with curative-intent RT after radical prostatectomy. 69 men (58% received pelvic nodal RT. QOL data and physician-assigned toxicity were prospectively collected. Changes in QOL from baseline were assessed with Wilcoxon signed-rank tests and risk factors associated with each domain were identified with generalized estimating equation (GEE models. Late freedom from (FF toxicity was estimated by the Kaplan-Meier method and comparisons were tested using the log-rank test.Urinary irritation/obstruction, bowel, and sexual domain scores declined at 2 months (all P ≤ 0.01 but were no different than baseline at subsequent visits through 4 years of follow-up. At 4 years, FF grade 2+ GI toxicity was 90% and FF grade 2+ GU toxicity was 89%. On GEE analysis, pelvic nodal RT was associated with decreased bowel function (P = 0.09 and sexual function (P = 0.01. On multivariate analysis, however, there was no significant association with either decreased bowel (P = 0.31 or sexual (P = 0.84 function. There was also no association with either FF grade 2+ GI toxicity (P = 0.24 or grade 2+ GU toxicity (P = 0.51.Receipt of pelvic nodal RT was not associated with inferior QOL or toxicity compared to prostate bed alone RT. For the entire cohort, RT was associated with only temporary declines in patient-reported urinary, bowel, or sexual QOL.

Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

Directory of Open Access Journals (Sweden)

Soumittra Nagasamy

2009-08-01

Full Text Available Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differences were tested using the Log-rank test. Results Fifteen (16% pathogenic mutations (12 in BRCA1 and 3 in BRCA2, of which six were novel BRCA1 mutations were identified. None of the cases showed CHEK2*1100delC mutation. Many reported polymorphisms in the exonic and intronic regions of BRCA1 and BRCA2 were also seen. The mutation status and the polymorphisms were analyzed for association with the clinico-pathological features like age, stage, grade, histology, disease status, survival (overall and disease free and with prognostic molecular markers (ER, PR, c-erbB2 and p53. Conclusion The stage of the disease at diagnosis was the only statistically significant (p

The Poor Survival among Pulmonary Tuberculosis Patients in Chiapas, Mexico: The Case of Los Altos Region

Science.gov (United States)

Nájera-Ortiz, J. C.; Sánchez-Pérez, H. J.; Ochoa-Díaz-López, H.; Leal-Fernández, G.; Navarro-Giné, A.

2012-01-01

Objective. To analyse survival in patients with pulmonary tuberculosis (PTB) and factors associated with such survival. Design. Study of a cohort of patients aged over 14 years diagnosed with PTB from January 1, 1998 to July 31, 2005. During 2004–2006 a home visit was made to each patient and, during 2008-2009, they were visited again. During these visits a follow-up interview was administered; when the patient had died, a verbal autopsy was conducted with family members. Statistical analysis consisted of survival tests, Kaplan-Meier log-rank test and Cox regression. Results. Of 305 studied patients, 68 had died due to PTB by the time of the first evaluation, 237 were followed-up for a second evaluation, and 10 of them had died of PTB. According to the Cox regression, age (over 45 years) and treatment duration (under six months) were associated with a poorer survival. When treatment duration was excluded, the association between poorer survival with age persisted, whereas with having been treated via DOTS strategy, was barely significant. Conclusions. In the studied area it is necessary that patients receive a complete treatment scheme, and to give priority to patients aged over 45 years. PMID:22701170

Median Survival Time of Endometrial Cancer Patients with Lymphovascular Invasion at the Hospital Universiti Sains Malaysia.

Science.gov (United States)

Asyikeen, Wan Adnan Wan Nor; Siti-Azrin, Ab Hamid; Jalil, Nur Asyilla Che; Zin, Anani Aila Mat; Othman, Nor Hayati

2016-11-01

Endometrial cancer is the most common gynaecologic malignancy among females worldwide. The purpose of this study was to determine the median survival time of endometrial cancer patients at the Hospital Universiti Sains Malaysia (USM). A list of 121 endometrial cancer cases registered at Hospital USM between 2000 until 2011 was retrospectively reviewed. The survival time of the endometrial cancer patients was estimated by Kaplan-Meier survival analysis. Log-rank tests were performed to compare the survival of the patients based on socio-demographics and clinical presentation. Only 108 patients, 87.0%, were included who were of Malay ethnicity. Previous history included menopause in 67.6% of patients and diabetes mellitus in 39.8% of patients; additionally, 63.4% of patients were nulliparous. Tumour staging was as follows: 24.5% stage I, 10.8% stage II, 26.5% stage III and 38.2% stage IV. The overall median survival time of the endometrial cancer patients was 70.20 months (95% confidence interval (CI): 51.79, 88.61). The significant factors were age, the presence of lymphovascular invasion and treatment received. The overall survival of endometrial cancer was low. A prospective study needs to be carried out to discover more effective and accurate tests for the early detection of endometrial cancer.

The Poor Survival among Pulmonary Tuberculosis Patients in Chiapas, Mexico: The Case of Los Altos Region

Directory of Open Access Journals (Sweden)

J. C. Nájera-Ortiz

2012-01-01

Full Text Available Objective. To analyse survival in patients with pulmonary tuberculosis (PTB and factors associated with such survival. Design. Study of a cohort of patients aged over 14 years diagnosed with PTB from January 1, 1998 to July 31, 2005. During 2004–2006 a home visit was made to each patient and, during 2008-2009, they were visited again. During these visits a follow-up interview was administered; when the patient had died, a verbal autopsy was conducted with family members. Statistical analysis consisted of survival tests, Kaplan-Meier log-rank test and Cox regression. Results. Of 305 studied patients, 68 had died due to PTB by the time of the first evaluation, 237 were followed-up for a second evaluation, and 10 of them had died of PTB. According to the Cox regression, age (over 45 years and treatment duration (under six months were associated with a poorer survival. When treatment duration was excluded, the association between poorer survival with age persisted, whereas with having been treated via DOTS strategy, was barely significant. Conclusions. In the studied area it is necessary that patients receive a complete treatment scheme, and to give priority to patients aged over 45 years.

RELATIONSHIP BETWEEN THE PROANGIOGENIC ROLE OF EG-VEGF, CLINICOPATHOLOGICAL CHARACTERISTICS AND SURVIVAL IN TUMORAL OVARY.

Science.gov (United States)

Lozneanu, Ludmila; Avădănei, Roxana; Cîmpean, Anca Maria; Giuşcă, Simona Eliza; Amălinei, Cornelia; Căruntu, Irina-Draga

2015-01-01

To prove the presence of EG-VEGF in tumor ovary and to analyze its involvement in the ovarian carcinogenesis, as promoter of angiogenesis, in relationship with the clinicopathological prognostic factors and survival. The study group comprises tumor tissue specimens from 50 cases of surgically treated ovarian cancer that were immunohistochemically investigated. A scoring system based on the percentage of positive cells and the intensity of staining was applied for the semiquantitative assessment of EG-VEGF, as negative or positive. Statistics involved χ2 test, and Kaplan-Meier and log-rank test. EG-VEGF was positive in 35 cases (70%) and negative in 15 cases (30%). Our data confirmed the predominance of EG-VEGF positivity in the serous subiype as compared to endometrioid and clear cell subtypes, and its absence in mucinous subtype. Moreover, we demonstrated that EG-VEGF is overexpressed mainly in high-grade ovarian carcinomas (type II) than in low-grade ones. Significant differences were registered between the EG-VEGF positive or negative expression and tumor stage and histological subtypes, respectively. Survival analysis showed no differences in patient's survival and EG-VEGF positive and negative cases. The analysis of EG-VEGF expression in ovarian tumors points out the relationship between the enhanced potential for tumor angiogenesis and the tumor aggressivity.

TENSOR DECOMPOSITIONS AND SPARSE LOG-LINEAR MODELS

Science.gov (United States)

Johndrow, James E.; Bhattacharya, Anirban; Dunson, David B.

2017-01-01

Contingency table analysis routinely relies on log-linear models, with latent structure analysis providing a common alternative. Latent structure models lead to a reduced rank tensor factorization of the probability mass function for multivariate categorical data, while log-linear models achieve dimensionality reduction through sparsity. Little is known about the relationship between these notions of dimensionality reduction in the two paradigms. We derive several results relating the support of a log-linear model to nonnegative ranks of the associated probability tensor. Motivated by these findings, we propose a new collapsed Tucker class of tensor decompositions, which bridge existing PARAFAC and Tucker decompositions, providing a more flexible framework for parsimoniously characterizing multivariate categorical data. Taking a Bayesian approach to inference, we illustrate empirical advantages of the new decompositions. PMID:29332971

Time of default in tuberculosis patients on directly observed treatment.

Science.gov (United States)

Pardeshi, Geeta S

2010-09-01

Default remains an important challenge for the Revised National Tuberculosis Control Programme, which has achieved improved cure rates. This study describes the pattern of time of default in patients on DOTS. Tuberculosis Unit in District Tuberculosis Centre, Yavatmal, India; Retrospective cohort study. This analysis was done among the cohort of patients of registered at the Tuberculosis Unit during the year 2004. The time of default was assessed from the tuberculosis register. The sputum smear conversion and treatment outcome were also assessed. Kaplan-Meier plots and log rank tests. Overall, the default rate amongst the 716 patients registered at the Tuberculosis Unit was 10.33%. There was a significant difference in the default rate over time between the three DOTS categories (log rank statistic= 15.49, P=0.0004). Amongst the 331 smear-positive patients, the cumulative default rates at the end of intensive phase were 4% and 16%; while by end of treatment period, the default rates were 6% and 31% in category I and category II, respectively. A majority of the smear-positive patients in category II belonged to the group 'treatment after default' (56/95), and 30% of them defaulted during re-treatment. The sputum smear conversion rate at the end of intensive phase was 84%. Amongst 36 patients without smear conversion at the end of intensive phase, 55% had treatment failure. Patients defaulting in intensive phase of treatment and without smear conversion at the end of intensive phase should be retrieved on a priority basis. Default constitutes not only a major reason for patients needing re-treatment but also a risk for repeated default.

The Role of Adjuvant Radiation in Uterine Sarcomas

International Nuclear Information System (INIS)

Sampath, Sagus; Schultheiss, Timothy E.; Ryu, Janice K.; Wong, Jeffrey Y.C.

2010-01-01

Purpose: To determine clinical and pathological factors significant for overall survival (OS) and local-regional failure-free survival (LRFFS) in uterine sarcoma as they relate to adjuvant radiotherapy (AR). Methods and Materials: A retrospective analysis of 3,650 patients with uterine sarcoma was conducted using the National Oncology Database, a proprietary database of aggregated tumor registries owned by Impac Medical Systems (Sunnyvale, CA). Adjuvant radiotherapy was defined as postoperative external beam radiation to the pelvis, with or without brachytherapy. Prognostic factors were identified by multivariate analysis (MVA) using the Cox proportional hazards model. The Kaplan-Meier method was used to estimate survival, with significant differences (p < 0.05) determined using the log-rank test. Results: The median follow-up time was 59 months, with a 5-year OS of 37%. Significant prognostic factors for OS were stage, race/ethnicity, grade, age, histology, lymph node status, and surgical treatment (p < 0.01 for all factors). Use of AR was not predictive for OS. For nonmetastatic cancer patients receiving definitive surgery (n = 2,206), the 5-year LRFFS was 87%. In this group, stage, grade, histology, and AR were prognostic for LRFFS (p < 0.05), with AR associated with improved outcome compared with surgery alone (hazard ratio = 0.4, p < 0.001). Patients with carcinosarcoma, endometrial stromal sarcoma, leiomyosarcoma, poorly differentiated tumors, and negative lymph nodes had reduced local-regional failure (LRF) with AR (log-rank, p < 0.05 for all). Conclusion: In the largest retrospective analysis of uterine sarcoma published thus far, AR conferred a 53% reduction in the risk of LRF at 5 years. Use of AR may have broader indications than what are currently accepted in clinical practice.

Comparison of DNA aneuploidy, chromosome 1 abnormalities, MYCN amplification and CD44 expression as prognostic factors in neuroblastoma.

Science.gov (United States)

Christiansen, H; Sahin, K; Berthold, F; Hero, B; Terpe, H J; Lampert, F

1995-01-01

A comparison of the prognostic impact of five molecular variables in a large series was made, including tests of their nonrandom association and multivariate analysis. Molecular data were available for 377 patients and MYCN amplification, cytogenetic chromosome 1p deletion, loss of chromosome 1p heterozygosity, DNA ploidy and CD44 expression were investigated. Their interdependence and influence on event-free survival was tested uni- and multivariately using Pearson's chi 2-test, Kaplan-Meier estimates, log rank tests and the Cox's regression model. MYCN amplification was present in 18% (58/322) of cases and predicted poorer prognosis in localised (P < 0.001), metastatic (P = 0.002) and even 4S (P = 0.040) disease. CD44 expression was found in 86% (127/148) of cases, and was a marker for favourable outcome in patients with neuroblastoma stages 1-3 (P = 0.003) and 4 (P = 0.017). Chromosome 1p deletion was cytogenetically detected in 51% (28/55), and indicated reduced event-free survival in localised neuroblastoma (P = 0.020). DNA ploidy and loss of heterozygosity on chromosome 1p were of less prognostic value. Most factors of prognostic significance were associated with each other. By multivariate analysis, MYCN was selected as the only relevant factor. Risk estimation of high discriminating power is, therefore, possible for patients with localised and metastatic neuroblastoma using stage and MYCN.

Association between tobacco smoking and response to tumour necrosis factor α inhibitor treatment in psoriatic arthritis

DEFF Research Database (Denmark)

Højgaard, Pil; Glintborg, Bente; Hetland, Merete Lund

2015-01-01

study based on the Danish nationwide DANBIO registry. Kaplan-Meier plots, logistic and Cox regression analyses by smoking status (current/previous/never smoker) were calculated for treatment adherence, ACR20/50/70-responses and EULAR-good-response. Additional stratified analyses were performed according...... to gender and TNFi-subtype (adalimumab/etanercept/infliximab). RESULTS: Among 1388 PsA patients included in the study, 1148 (83%) had known smoking status (33% current, 41% never and 26% previous smokers). Median follow-up time was 1.22 years (IQR 0.44-2.96). At baseline, current smokers had lower Body Mass...... Assessment Questionnaire (HAQ) score (1.1 (0.7 to 1.5)/1.0 (0.5 to 1.5)) than never smokers (all psmokers had shorter treatment adherence than never smokers (1.56 years (0.97 to 2.15)/2.43 years (1.88 to 2.97), (median (95% CI)), log rank p=0.02) and poorer 6 months' EULAR-good-response rates...

TMACS test procedure TP005: Sensor configuration, logging, and data conversion. Revision 4

International Nuclear Information System (INIS)

Washburn, S.J.

1994-01-01

The TMACS Software Project Test Procedures translate the project's acceptance criteria into test steps. Software releases are certified when the affected Test Procedures are successfully performed and the customers authorize installation of these changes. This Test Procedure addresses the sensor configuration, conversion and logging requirements of the TMACS. The features to be tested are as follows: sensor configuration data; conversion of continuous sensor data to engineering units; conversion of digital data to discrete states; discrete sensor data logging; and continuous sensor data logging

Time to Wound Healing and Major Adverse Limb Events in Patients with Critical Limb Ischemia Treated with Endovascular Revascularization.

Science.gov (United States)

Reed, Grant W; Salehi, Negar; Giglou, Pejman R; Kafa, Rami; Malik, Umair; Maier, Michael; Shishehbor, Mehdi H

2016-10-01

There are few studies that quantify the impact of time to wound healing on outcomes after endovascular revascularization of critical limb ischemia (CLI). In this retrospective study, 179 patients with CLI and tissue loss were assessed for adverse events after endovascular therapy. Associations between time to wound healing and outcomes were determined via Cox proportional hazards analysis. The long-term probability of events was assessed with Kaplan-Meier analysis. The primary end point was major adverse limb events (MALE-major amputation, surgical endarterectomy, or bypass). Secondary end points were major amputation, need for repeat endovascular therapy, and mortality. After multivariable adjustment for time-dependent wound healing, age, renal function, diabetes, and Rutherford class, independent predictors of MALE included the presence of an unhealed wound (hazard ratio [HR], 5.2; 95% confidence interval (CI), 2.3-11.8; P wounds compared with healed wounds (log-rank P wounds healed within 4 months had a lower probability of MALE than patients who did not heal by 4 months (log-rank, P = 0.04). Unhealed wounds were also independently associated with major amputation (HR, 9.0; 95% CI, 2.6-31.1; P = 0.0004), and patients whose wounds healed by 3 months had less major amputation (log-rank, P = 0.04). Unhealed wounds were independently associated with increased risk of mortality (HR, 42.7; 95% CI, 5.7-319.0; P = 0.002) but not repeat revascularization. Unhealed wounds are an independent risk factor for MALE, major amputation, and mortality after endovascular treatment of CLI. Wound healing within 3 months is associated with less risk of major amputation, and within 4 months less risk of MALE. A focus should be on achieving wound healing as fast as possible in this population. Copyright © 2016 Elsevier Inc. All rights reserved.

Comparison of long-term results between laparoscopy-assisted gastrectomy and open gastrectomy with D2 lymph node dissection for advanced gastric cancer.

Science.gov (United States)

Hamabe, Atsushi; Omori, Takeshi; Tanaka, Koji; Nishida, Toshirou

2012-06-01

Laparoscopy-assisted gastrectomy (LAG) has been established as a low-invasive surgery for early gastric cancer. However, it remains unknown whether it is applicable also for advanced gastric cancer, mainly because the long-term results of LAG with D2 lymph node dissection for advanced gastric cancer have not been well validated compared with open gastrectomy (OG). A retrospective cohort study was performed to compare LAG and OG with D2 lymph node dissection. For this study, 167 patients (66 LAG and 101 OG patients) who underwent gastrectomy with D2 lymph node dissection for advanced gastric cancer were reviewed. Recurrence-free survival and overall survival time were estimated using Kaplan-Meier curves. Stratified log-rank statistical evaluation was used to compare the difference between the LAG and OG groups stratified by histologic type, pathologic T status, N status, and postoperative adjuvant chemotherapy. The adjusted Cox proportional hazards regression models were used to calculate the hazard ratios (HRs) of LAG. The 5-year recurrence-free survival rate was 89.6% in the LAG group and 75.8% in the OG group (nonsignificant difference; stratified log-rank statistic, 3.11; P = 0.0777). The adjusted HR of recurrence for LAG compared with OG was 0.389 [95% confidence interval (CI) 0.131-1.151]. The 5-year overall survival rate was 94.4% in the LAG group and 78.5% in the OG group (nonsignificant difference; stratified log-rank statistic, 0.4817; P = 0.4877). The adjusted HR of death for LAG compared with OG was 0.633 (95% CI 0.172-2.325). The findings show that LAG with D2 lymph node dissection is acceptable in terms of long-term results for advanced gastric cancer cases and may be applicable for advanced gastric cancer treatment.

Effect of PR interval prolongation on long-term outcomes in patients with left bundle branch block vs non-left bundle branch block morphologies undergoing cardiac resynchronization therapy.

Science.gov (United States)

Rickard, John; Karim, Mohammad; Baranowski, Bryan; Cantillon, Daniel; Spragg, David; Tang, W H Wilson; Niebauer, Mark; Grimm, Richard; Trulock, Kevin; Wilkoff, Bruce; Varma, Niraj

2017-10-01

Although the influence of QRS duration (QRSd) and/or bundle branch block morphology on outcomes of cardiac resynchronization therapy (CRT) have been well studied, the effect of PR interval remains uncertain. The purpose of this study was to evaluate the impact of PR prolongation (PRp) before CRT on long-term outcomes, specifically taking into account bundle branch block morphology and QRSd. We extracted clinical data on consecutive patients undergoing CRT. Multivariate models were constructed to analyze the effect of PRp (≥200 ms) on the combined endpoint of death, heart transplant, or left ventricular assist device. Kaplan-Meier curves were constructed stratifying patients based on bundle branch block and QRSd (dichotomized by 150 ms). Of the 472 patients who met inclusion criteria, 197 (41.7%) had PR interval ≥200 ms. During follow-up (mean 5.1 ± 2.6 years) there were 214 endpoints, of which 109 (23.1%) occurred in patients with PRp. In multivariate analysis, PRp was independently associated with worsened outcomes (hazard ratio 1.34, 95% confidence interval 1.01-1.77, P = .04). When stratified by bundle branch block morphology, PRp was significantly associated with worsened outcomes (log-rank P <.001) in patients with LBBB but not in those with non-LBBB (log-rank P = .55). Among patients with LBBB, stratified by QRSd, patients without PRp had improved outcomes compared to those with PRp independent of QRSd (log-rank P <.001). PRp is an independent predictor of impaired long-term outcome after CRT among patients with LBBB but not in non-LBBB patients. Notably, among LBBB patients, PRp is a more important predictor than QRSd in assessing long-term outcomes. Copyright © 2017. Published by Elsevier Inc.

MultiModality Surgical and Hyperbaric Management of Mandibular Osteoradionecrosis

International Nuclear Information System (INIS)

Freiberger, John J.; Yoo, David S.; Lisle Dear, Guy de; McGraw, Thomas A.; Blakey, George H.; Padilla Burgos, Rebecca; Kraft, Kevin; Nelson, John W.; Moon, Richard E.; Piantadosi, Claude A.

2009-01-01

Purpose: To elucidate long-term outcomes in 65 consecutive patients meeting a uniform definition of mandibular osteoradionecrosis (ORN) treated with multimodality therapy including hyperbaric oxygen (HBO). Methods and Materials: Pretreatment, post-treatment and long-term follow-up of mandibular lesions with exposed bone were ranked by a systematic review of medical records and patient telephone calls. The ranking system was based on lesion diameter and number plus disease progression. Changes from pretreatment to post-treatment and follow-up were analyzed by Wilcoxon signed-rank tests. Improved wound survival, measured by time to relapse, defined as any less favorable rank after HBO treatment, was assessed by Kaplan-Meier analysis. Results: In all, 57 cases (88%) resolved or improved by lesion grade or progression and evolution criteria after HBO (p < 0.001). Four patients healed before surgery after HBO alone. Of 57 patients who experienced improvement, 41 had failed previous nonmultimodality therapy for 3 months and 26 for 6 months or more. A total of 43 patients were eligible for time-to-relapse survival analysis. Healing or improvement lasted a mean duration of 86.1 months (95% confidence interval [95% CI], 64.0-108.2) in nonsmokers (n = 20) vs. 15.8 months (95% CI, 8.4-23.2) in smokers (n = 14) versus 24.2 months (95% CI, 15.2-33.2) in patients with recurrent cancer (n = 9) (p = 0.002 by the log-rank method). Conclusions: Multimodality therapy using HBO is effective for ORN when less intensive therapies have failed. Although the healing rate in similarly affected patients not treated with HBO is unknown, the improvements seen with peri-operative HBO were durable provided that the patients remained cancer free and abstained from smoking.

Low-cost glass ionomer cement as ART sealant in permanent molars: a randomized clinical trial

Directory of Open Access Journals (Sweden)

Daniela HESSE

2015-01-01

Full Text Available Clinical trials are normally performed with well-known brands of glass ionomer cement (GIC, but the cost of these materials is high for public healthcare in less-affluent communities. Given the need to research cheaper materials, it seems pertinent to investigate the retention rate of a low-cost GIC applied as atraumatic restorative treatment (ART sealants in two centers in Brazil. Four hundred and thirty-seven 6-to-8-year-old schoolchildren were selected in two cities in Brazil. The children were randomly divided into two groups, according to the tested GIC applied in the first permanent molars. The retention rate was evaluated after 3, 6 and 12 months. Kaplan-Meier survival analysis and the log-rank test were performed. The variables were tested for association with sealant longevity, using logistic regression analyses (α = 5%. The retention rate of sealants after 12 months was 19.1%. The high-cost GIC brand presented a 2-fold-more-likely-to-survive rate than the low-cost brand (p < 0.001. Significant difference was also found between the cities where the treatments were performed, in that Barueri presented a higher sealant survival rate than Recife (p < 0.001. The retention rate of a low-cost GIC sealant brand was markedly lower than that of a well-known GIC sealant brand.

Psychotherapy use in bipolar disorder: Association with functioning and illness severity.

Science.gov (United States)

Sylvia, Louisa G; Thase, Michael E; Reilly-Harrington, Noreen A; Salcedo, Stephanie; Brody, Benjamin; Kinrys, Gustavo; Kemp, David; Shelton, Richard C; McElroy, Susan L; Kocsis, James H; Bobo, William V; Kamali, Masoud; McInnis, Melvin; Friedman, Edward; Tohen, Mauricio; Bowden, Charles L; Ketter, Terence A; Singh, Vivek; Calabrese, Joseph; Nierenberg, Andrew A; Rabideau, Dustin J; Elson, Constance M; Deckersbach, Thilo

2015-05-01

This study examines characteristics of individuals with bipolar disorder who sought psychotherapy versus those who did not. Bipolar CHOICE was an 11-site comparative effectiveness study of lithium versus quetiapine in symptomatic outpatients (N = 482) with bipolar disorder. At baseline, participants' psychotherapy use within the past 3 months, mood, functioning, and overall health were assessed. Logistic regressions were used to test whether psychotherapy users and non-users differed on various demographic and clinical variables at baseline. Mixed-effects regression was used to determine whether psychotherapy groups differed on response to treatment over the 6-month study. Kaplan-Meier plots and log-rank tests were employed to test whether there were any differences in time to recovery (CGI-BP ≤ 2 for at least 8 weeks) between the groups. Thirty one percent of participants reported using psychotherapy services. Psychotherapy users reported greater medication side effect burden than non-users and were more likely to have moderate to high suicide risk and at least one anxiety disorder. Participants not utilizing medications or psychotherapy had greater mania symptom severity, were younger, and less educated than medication only users. Medication only users were more likely to be married than the other participants. These data suggest that a minority of individuals with bipolar disorder attend psychotherapy services, and those that do have greater illness burden. © The Royal Australian and New Zealand College of Psychiatrists 2015.

Development of a new biofidelity ranking system for anthropomorphic test devices.

Science.gov (United States)

Rhule, Heather H; Maltese, Matthew R; Donnelly, Bruce R; Eppinger, Rolf H; Brunner, Jill K; Bolte, John H

2002-11-01

A new biofidelity assessment system is being developed and applied to three side impact dummies: the WorldSID-alpha, the ES-2 and the SID-HIII. This system quantifies (1) the ability of a dummy to load a vehicle as a cadaver does, "External Biofidelity," and (2) the ability of a dummy to replicate those cadaver responses that best predict injury potential, "Internal Biofidelity." The ranking system uses cadaver and dummy responses from head drop tests, thorax and shoulder pendulum tests, and whole body sled tests. Each test condition is assigned a weight factor based on the number of human subjects tested to form the biomechanical response corridor and how well the biofidelity tests represent FMVSS 214, side NCAP (SNCAP) and FMVSS 201 Pole crash environments. For each response requirement, the cumulative variance of the dummy response relative to the mean cadaver response (DCV) and the cumulative variance of the mean cadaver response relative to the mean plus one standard deviation (CCV) are calculated. The ratio of DCV/CCV expresses how well the dummy response duplicates the mean cadaver response: a smaller ratio indicating better biofidelity. For each test condition, the square root is taken of each Response Comparison Value (DCV/CCV), and then these values are averaged and multiplied by the appropriate Test Condition Weight. The weighted and averaged comparison values are then summed and divided by the sum of the Test Condition Weights to obtain a rank for each body region. Each dummy obtains an overall rank for External Biofidelity and an overall rank for Internal Biofidelity comprised of an average of the ranks from each body region. Of the three dummies studied, the selected comparison test data indicate that the WorldSID-alpha prototype dummy demonstrated the best overall External Biofidelity although improvement is needed in all of the dummies to better replicate human kinematics. All three dummies estimate potential injury assessment with similar levels of

Cross-system log file analysis for hypothesis testing

NARCIS (Netherlands)

Glahn, Christian

2008-01-01

Glahn, C. (2008). Cross-system log file analysis for hypothesis testing. Presented at Empowering Learners for Lifelong Competence Development: pedagogical, organisational and technological issues. 4th TENCompetence Open Workshop. April, 10, 2008, Madrid, Spain.

Análisis de supervivencia en presencia de riesgos competitivos: estimadores de la probabilidad de suceso Survival analysis with competing risks: estimating failure probability

Directory of Open Access Journals (Sweden)

Javier Llorca

2004-10-01

Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

Effect of epidermal growth factor receptor gene polymorphisms on prognosis in glioma patients

Science.gov (United States)

Li, Jingjie; Yan, Mengdan; Xie, Zhilan; Zhu, Yuanyuan; Chen, Chao; Jin, Tianbo

2016-01-01

Previous studies suggested that single nucleotide polymorphisms (SNPs) in epidermal growth factor receptor (EGFR) are associated with risk of glioma. However, the associations between these SNPs and glioma patient prognosis have not yet been fully investigated. Therefore, the present study was aimed to evaluate the effects of EGFR polymorphisms on the glioma patient prognosis. We retrospectively evaluated 269 glioma patients and investigated associations between EGFR SNPs and patient prognosis using Cox proportional hazard models and Kaplan-Meier curves. Univariate analysis revealed that age, gross-total resection and chemotherapy were associated with the prognosis of glioma patients (p < 0.05). In addition, four EGFR SNPs (rs11506105, rs3752651, rs1468727 and rs845552) correlated with overall survival (OS) (Log-rank p = 0.011, 0.020, 0.008, and 0.009, respectively) and progression-free survival PFS (Log-rank p = 0.026, 0.024, 0.019 and 0.009, respectively). Multivariate analysis indicated that the rs11506105 G/G genotype, the rs3752651 and rs1468727 C/C genotype and the rs845552 A/A genotype correlated inversely with OS and PFS. In addition, OS among patients with the rs730437 C/C genotype (p = 0.030) was significantly lower OS than among patients with A/A genotype. These data suggest that five EGFR SNPs (rs11506105, rs3752651, rs1468727, rs845552 and rs730437) correlated with glioma patient prognosis, and should be furthered validated in studies of ethnically diverse patients. PMID:27437777

Kaplan turbine tip vortex cavitation - analysis and prevention

Science.gov (United States)

Motycak, L.; Skotak, A.; Kupcik, R.

2012-11-01

The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

[Survival analysis with competing risks: estimating failure probability].

Science.gov (United States)

Llorca, Javier; Delgado-Rodríguez, Miguel

2004-01-01

To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

Graft survival rate of renal transplantation during a period of 10 years in Iran

Directory of Open Access Journals (Sweden)

Fatemeh Shahbazi

2015-01-01

Full Text Available Background: Kidney transplantation is a preferred treatment for many patients with end-stage renal disease (ESRD and is far more profitable than hemodialysis. Analyzing renal transplantation data can help to evaluate the effectiveness of transplantation interventions. The aim of this study was to determine the organ survival rate after kidney transplantation during a period of 10 years (March 2001-March 2011 among transplanted patients in Arak, Markazi Province, Iran. Materials and Methods: In this historical cohort study, all recipients of kidney transplantation from Arak, Markazi Province, Iran who had medical records in Valiasr Hospital and "charity for kidney patients" of Arak, Markazi Province, Iran during a period of 10 years from March 2001 to March 2011 were included. Data collected by using checklists were completed from patients′ hospital records. Kaplan-Meier method was used to determine the graft cumulative survival rate, log-rank test to compare survival curves in subgroups, and Cox regression model to define the hazard ratio and for ruling out the intervening factors. Statistical analysis was conducted by Statistical Package for the Social Sciences (SPSS 20 and Stata 11. Results: Mean duration of follow-up was 55.43 ± 42.02 months. By using the Kaplan-Meier method, the cumulative probability of graft survival at 1, 3, 5, 7, and 10 years was 99.1, 97.7, 94.3, 85.7, and 62.1%, respectively. The number of dialysis by controlling the effect of other variables had a significant association with the risk of graft failure [hazard ratios and 95% confidence interval (CI: 1.47 (1.02-2.13]. Conclusion: This study showed that the graft survival rate was satisfactory in this community and was similar to the results of single-center studies in the world. Dialysis time after transplantation was a significant predictor of survival in the recipients of kidney transplantation that should be considered.

Synergistic effects of cognitive impairment on physical disability in all-cause mortality among men aged 80 years and over: Results from longitudinal older veterans study.

Directory of Open Access Journals (Sweden)

Wan-Chen Yu

Full Text Available We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan.This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI, geriatric syndromes, activities of daily living (ADL using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE. Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk.Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years. Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038 or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002 after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition.Physical disability

Synergistic effects of cognitive impairment on physical disability in all-cause mortality among men aged 80 years and over: Results from longitudinal older veterans study.

Science.gov (United States)

Yu, Wan-Chen; Chou, Ming-Yueh; Peng, Li-Ning; Lin, Yu-Te; Liang, Chih-Kuang; Chen, Liang-Kung

2017-01-01

We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan. This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI), geriatric syndromes, activities of daily living (ADL) using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE). Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk. Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years). Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038) or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002) after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition. Physical disability is a major

Stereotactic radiosurgery improves the survival in patients with solitary brain metastasis: a reasonable alternative to surgery

International Nuclear Information System (INIS)

Kwan, H. Cho; Hall, Walter A.; Lee, Andrew K.; Gerbi, Bruce J.; Higgins, Patrick D.; Nussbaum, Eric S.; Chung, K.K. Lee; Bohen, Marva; Clark, H. Brent

1996-01-01

Purpose: To evaluate the efficacy of stereotactic radiosurgery (SRS) in patients with solitary brain metastasis from extracranial primary cancer and to compare the outcome with that of external whole brain irradiation with or without surgical resection. Materials and Methods: Between September 1970 and November, 1995, 231 patients with solitary brain metastasis were treated at the Department of Radiation Oncology, University of Minnesota Hospital. One hundred twenty six patients (56%) were treated with external whole brain irradiation (WBI) only (Group 1), seventy three (32%) underwent surgical resection prior to WBI (Group 2) and thirty two (14%) underwent stereotactic radiosurgery (SRS) with WBI (Group 3). Lung (38%) was the most common site of primary cancer, followed by breast (15%), unknown primary (12%), gastro-intestinal tract (10%), skin (malignant melanoma: 9%), kidney (renal cell carcinoma: 8%) and others (9%). The median dose to the whole brain was 3750 cGy in 15 fractions (ranges from 2000 cGy to 5000 cGy). The median radiosurgical dose of 17.5 Gy (range, 12-40 Gy) was delivered to the 40%-90% isodose line encompassing the target. Eighteen patients were treated with SRS for recurrent or persistent disease following WBI and 14 patients received SRS as a boost in conjunction with WBI. Actuarial survival was calculated from the date of treatment according to the Kaplan-Meier method and statistical significance was assessed with the log-rank test. Results: The actuarial median survivals were 3.8 months for Group 1 (ranges from 1 to 84 months), 10.5 months for Group 2 (ranges from 1 to 125 months) and 9.8 months for Group 3 (ranges from 1 to 36 months). The survivals at one and two years were 19% and 6% for Group 1, 47% and 19% for Group 2, and 44% and 21% for Group 3, respectively. The survival advantage of Groups 2 or 3 over Group 1 was statistically significant (p < 0.0001 by log-rank test). There was no survival advantage of surgery (Group 2) over SRS

Meier-Gorlin syndrome Clinical genetics and genomics

NARCIS (Netherlands)

S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)

2015-01-01

textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia

Meier-Gorlin syndrome Clinical genetics and genomics

NARCIS (Netherlands)

De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf

2015-01-01

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

Clinical Study of Acute Vasoreactivity Testing in Patients with Chronic Thromboembolic Pulmonary Hypertension

Institute of Scientific and Technical Information of China (English)

Qi-Xia Xu; Yuan-Hua Yang; Jie Geng; Zhen-Guo Zhai; Juan-Ni Gong; Ji-Feng Li; Xiao Tang

2017-01-01

Background:The clinical significance of acute vasoreactivity testing (AVT) in patients with chronic thromboembolic pulmonary hypertension (CTEPH) remains unclear.We analyzed changes in hemodynamics and oxygenation dynamics indices after AVT in patients with CTEPH using patients with pulmonary arterial hypertension (PAH) as controls.Methods:We analyzed retrospectively the results of AVT in 80 patients with PAH and 175 patients with CTEPH registered in the research database ofBeijing Chao-Yang Hospital between October 2005 and August 2014.Demographic variables,cardiopulmonary indicators,and laboratory findings were compared in these two subgroups.A long-term follow-up was conducted in patients with CTEPH.Between-group comparisons were performed using the independent-sample t-test or the rank sum test,within-group comparisons were conducted using the paired t-test or the Wilcoxon signed-rank test,and count data were analyzed using the Chi-squared test.Survival was estimated using the Kaplan-Meier method and log-rank test.Results:The rates of positive response to AVT were similar in the CTEPH (25/175,14.3％) and PAH (9/80,11.3％) groups (P ＞ 0.05).Factors significantly associated a positive response to AVT in the CTEPH group were level of N-terminal pro-brain natriuretic peptide (≤1131.000 ng/L),mean pulmonary arterial pressure (mPAP,≤44.500 mmHg),pulmonary vascular resistance (PVR,≤846.500 dyn·s1·m-5),cardiac output (CO,≥3.475 L/min),and mixed venous oxygen partial pressure (PvO2,≥35.150 mmHg).Inhalation of iloprost resulted in similar changes in mean blood pressure,mPAP,PVR,systemic vascular resistance,CO,arterial oxygen saturation (SaO2),mixed venous oxygen saturation,partial pressure of oxygen in arterial blood (PaO2),PvO2,and intrapulmonary shunt (Qs/Qt) in the PAH and CTEPH groups (all P ＞ 0.05).The survival time in patients with CTEPH with a negative response to AVT was somewhat shorter than that in AVT-responders although the difference was

Kaplan SpellRead. What Works Clearinghouse Intervention Report

Science.gov (United States)

What Works Clearinghouse, 2007

2007-01-01

"Kaplan SpellRead" (formerly known as "SpellRead Phonological Auditory Training"[R]) is a literacy program for struggling readers in grades 2 or above, including special education students, English language learners, and students more than two years below grade level in reading. "Kaplan SpellRead" integrates the…

Prospective Randomized Trial of Prone Accelerated Intensity Modulated Breast Radiation Therapy With a Daily Versus Weekly Boost to the Tumor Bed

International Nuclear Information System (INIS)

Cooper, Benjamin T.; Formenti-Ujlaki, George F.; Li, Xiaochun; Shin, Samuel M.; Fenton-Kerimian, Maria; Guth, Amber; Roses, Daniel F.; Hitchen, Christine J.; Rosenstein, Barry S.; Dewyngaert, J. Keith; Goldberg, Judith D.; Formenti, Silvia C.

2016-01-01

Purpose: To report the results of a prospective randomized trial comparing a daily versus weekly boost to the tumor cavity during the course of accelerated radiation to the breast with patients in the prone position. Methods and Materials: From 2009 to 2012, 400 patients with stage 0 to II breast cancer who had undergone segmental mastectomy participated in an institutional review board–approved trial testing prone breast radiation therapy to 40.5 Gy in 15 fractions 5 d/wk to the whole breast, after randomization to a concomitant daily boost to the tumor bed of 0.5 Gy, or a weekly boost of 2 Gy, on Friday. The present noninferiority trial tested the primary hypothesis that a weekly boost produced no more acute toxicity than did a daily boost. The recurrence-free survival was estimated for both treatment arms using the Kaplan-Meier method; the relative risk of recurrence or death was estimated, and the 2 arms were compared using the log-rank test. Results: At a median follow-up period of 45 months, no deaths related to breast cancer had occurred. The weekly boost regimen produced no more grade ≥2 acute toxicity than did the daily boost regimen (8.1% vs 10.4%; noninferiority Z = −2.52; P=.006). No statistically significant difference was found in the cumulative incidence of long-term fibrosis or telangiectasia of grade ≥2 between the 2 arms (log-rank P=.923). Two local and two distant recurrences developed in the daily treatment arm and three local and one distant developed in the weekly arm. The 4-year recurrence-free survival rate was not different between the 2 treatment arms (98% for both arms). Conclusions: A tumor bed boost delivered either daily or weekly was tolerated similarly during accelerated prone breast radiation therapy, with excellent control of disease and comparable cosmetic results.

Prospective Randomized Trial of Prone Accelerated Intensity Modulated Breast Radiation Therapy With a Daily Versus Weekly Boost to the Tumor Bed

Energy Technology Data Exchange (ETDEWEB)

Cooper, Benjamin T.; Formenti-Ujlaki, George F. [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Li, Xiaochun [Division of Biostatistics, Departments of Population Health and Environmental Medicine, New York University School of Medicine, New York, New York (United States); Shin, Samuel M.; Fenton-Kerimian, Maria [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Guth, Amber; Roses, Daniel F. [Department of Surgery, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Hitchen, Christine J. [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Rosenstein, Barry S. [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Department of Radiation Oncology, Icahn School of Medicine at Mount Sinai, New York, New York (United States); Dewyngaert, J. Keith [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Goldberg, Judith D. [Division of Biostatistics, Departments of Population Health and Environmental Medicine, New York University School of Medicine, New York, New York (United States); Formenti, Silvia C., E-mail: formenti@med.cornell.edu [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States)

2016-06-01

Purpose: To report the results of a prospective randomized trial comparing a daily versus weekly boost to the tumor cavity during the course of accelerated radiation to the breast with patients in the prone position. Methods and Materials: From 2009 to 2012, 400 patients with stage 0 to II breast cancer who had undergone segmental mastectomy participated in an institutional review board–approved trial testing prone breast radiation therapy to 40.5 Gy in 15 fractions 5 d/wk to the whole breast, after randomization to a concomitant daily boost to the tumor bed of 0.5 Gy, or a weekly boost of 2 Gy, on Friday. The present noninferiority trial tested the primary hypothesis that a weekly boost produced no more acute toxicity than did a daily boost. The recurrence-free survival was estimated for both treatment arms using the Kaplan-Meier method; the relative risk of recurrence or death was estimated, and the 2 arms were compared using the log-rank test. Results: At a median follow-up period of 45 months, no deaths related to breast cancer had occurred. The weekly boost regimen produced no more grade ≥2 acute toxicity than did the daily boost regimen (8.1% vs 10.4%; noninferiority Z = −2.52; P=.006). No statistically significant difference was found in the cumulative incidence of long-term fibrosis or telangiectasia of grade ≥2 between the 2 arms (log-rank P=.923). Two local and two distant recurrences developed in the daily treatment arm and three local and one distant developed in the weekly arm. The 4-year recurrence-free survival rate was not different between the 2 treatment arms (98% for both arms). Conclusions: A tumor bed boost delivered either daily or weekly was tolerated similarly during accelerated prone breast radiation therapy, with excellent control of disease and comparable cosmetic results.

Optimization of Kaplan turbines. A contribution to economic efficiency; Optimierung von Kaplan-Turbinen. Ein Beitrag zur Betriebswirtschaftlichkeit

Energy Technology Data Exchange (ETDEWEB)

Sevcik, Petr

2009-07-01

The Kaplan turbine has the best theoretical efficiency chart in the total range of operation. In order to achieve these good properties, the turbine has to be adjusted optimally. In general, these settings are performed by the manufacturer of turbines during commissioning. In practice one often meets Kaplan turbines where the scenery does not correspond to the optimal control line. The author of the contribution under consideration reports on possible causes for these errors and also methods of how this scenery can be optimized cost-effectively and how to minimize power losses.

One year Survival Rate of Ketac Molar versus Vitro Molar for Occlusoproximal ART Restorations: a RCT

Directory of Open Access Journals (Sweden)

PACHECO Anna Luisa de Brito

2017-11-01

Full Text Available Abstract Good survival rates for single-surface Atraumatic Restorative Treatment (ART restorations have been reported, while multi-surface ART restorations have not shown similar results. The aim of this study was to evaluate the survival rate of occluso-proximal ART restorations using two different filling materials: Ketac Molar EasyMix (3M ESPE and Vitro Molar (DFL. A total of 117 primary molars with occluso-proximal caries lesions were selected in 4 to 8 years old children in Barueri city, Brazil. Only one tooth was selected per child. The subjetcs were randomly allocated in two groups according to the filling material. All treatments were performed following the ART premises and all restorations were evaluated after 2, 6 and 12 months. Restoration survival was evaluated using Kaplan-Meier survival analysis and Log-rank test, while Cox regression analysis was used for testing association with clinical factors (α = 5%. There was no difference in survival rate between the materials tested, (HR = 1.60, CI = 0.98–2.62, p = 0.058. The overall survival rate of restorations was 42.74% and the survival rate per group was Ketac Molar = 50,8% and Vitro Molar G2 = 34.5%. Cox regression test showed no association between the analyzed clinical variables and the success of the restorations. After 12 months evaluation, no difference in the survival rate of ART occluso-proximal restorations was found between tested materials.

On Locally Most Powerful Sequential Rank Tests

Czech Academy of Sciences Publication Activity Database

Kalina, Jan

2017-01-01

Roč. 36, č. 1 (2017), s. 111-125 ISSN 0747-4946 R&D Projects: GA ČR GA17-07384S Grant - others:Nadační fond na podporu vědy(CZ) Neuron Institutional support: RVO:67985807 Keywords : nonparametric test s * sequential ranks * stopping variable Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 0.339, year: 2016

Elevated Serum IL-17 Expression at Cessation Associated with Graves’ Disease Relapse

Directory of Open Access Journals (Sweden)

Jianhui Li

2018-01-01

Full Text Available Background. Antithyroid drug (ATD treatment occupies the cornerstone therapeutic modality of Graves’ disease (GD with a high relapse rate after discontinuation. This study aimed to assess potential risk factors for GD relapse especially serum interleukin-17 (IL-17 expression. Methods. Consecutive newly diagnosed GD patients who were scheduled to undergo ATD therapy from May 2011 to May 2014 were prospectively enrolled. Risk factors for GD relapse were analyzed by univariate and multivariate Cox proportional hazard analyses. The association between serum IL-17 expression at cessation and GD relapse was analyzed with relapse-free survival (RFS by the Kaplan–Meier survival analysis and log-rank test. Results. Of the 117 patients, 72 (61.5% maintained a remission for 12 months after ATD withdrawal and 45 (38.5% demonstrated GD relapse. The final multivariate Cox analysis indicated elevated IL-17 expression at cessation to be an independent risk factor for GD relapse within 12 months after ATD withdrawal (HR: 3.04, 95% CI: 1.14–7.67, p=0.021. Patients with higher expressions of IL-17 (≥median value at cessation demonstrated a significantly higher RFS than those with lower levels by the Kaplan–Meier analysis and log-rank test (p=0.028. Conclusions. This present study indicated elevated serum IL-17 expression at cessation to be a predictor for GD relapse within 12 months.

Association of single nucleotide polymorphisms in promoter of matrix metalloproteinase-2, 8 genes with bladder cancer risk in Northern India.

Science.gov (United States)

Srivastava, Priyanka; Kapoor, Rakesh; Mittal, Rama D

2013-02-01

Matrix metalloproteinases (MMPs) are expressed in melanocytes and their overexpression has been linked to tumor development, progression, and metastasis. At the genetic level, following functional promoter polymorphisms are known to modify the gene transcription: -1306 C > T, -735 C > T in MMP2, and 799 C > T in MMP8 gene. Hence we hypothesize that functional polymorphisms in the 2 MMP SNPs in promoter region may modulate the risk for bladder cancer (BC) progression in North Indian population. Genotyping for these polymorphisms were done in a group of 200 BC and 200 age matched, similar ethnicity unrelated healthy controls using PCR-based methods. Two-sided χ(2), Cox-regression was utilized to evaluate the associations between genotype and various clinical and epidemiologic factors. Multivariate analyses were conducted using logistic regression, adjusting for known BC confounders such as age and gender. Survival analysis was done using the Kaplan-Meier method and differences in survival were assessed using the log rank test. Individuals with MMP2 (-1306) TT genotype as well as T allele were at higher risk of BC (P, 0.042; OR, 2.85; P, 0.001; OR, 1.76). This effect was even more apparent in case of CT+TT (P T were associated with high risk of recurrence in BCG treated patients (HR, 4.32; P, 0.006 and HR, 2.06; P, 0.047) thus showing reduced recurrence free survival (CT+TT/CC = 34/45 months; log rank P, 0.039). Our data suggested that variant allele of MMP2 1306C > T was associated with high risk of tumor recurrence and reduced recurrence free survival in superficial BC patients. Copyright © 2013 Elsevier Inc. All rights reserved.

Uterine Carcinosarcoma Confined to the Pelvis: A Retrospective Review and Outcome Analysis

International Nuclear Information System (INIS)

Li, H.; TenNapel, M.J.; Bhatia, S.K.; Ahmed, A.; Lin, L.; Jacobson, G.

2014-01-01

Objective. We compared the treatments of uterine carcinosarcoma at our institution and evaluated their impact on survival. Methods. A retrospective analysis was performed on 60 eligible patients with carcinosarcoma limited to the pelvis. Subjects were divided into four categories: surgery, surgery plus chemotherapy, surgery plus radiation therapy, and a combination of surgery, chemotherapy, and RT. The most commonly used chemotherapy was cisplatin and/or carboplatin and taxol. Radiotherapy included external beam radiation therapy (EBRT) alone or with high dose rate (HDR) brachytherapy or HDR brachytherapy alone. Survival probability data were computed using the Kaplan-Meier method. The differences between groups were compared using the log-rank test. Results. The combination of surgery and radiation therapy with or without chemotherapy is seen to improve overall survival (OS) compared to surgery alone (Ρ =0.044 and Ρ =0.028 resp.). Brachytherapy involving three HDR vaginal cylinder fractions shows an equally effective reduction in local recurrence compared to EBRT. Conclusion. Our study of a relatively large number of carcinosarcoma patients suggests that adjuvant radiation therapy improves OS compared to surgery alone. Brachytherapy with 3 HDR vaginal cylinder fractions is preferred because of its time-saving, better tolerance, low toxicity and equivalent OS, and local control compared to EBRT.

[Survival rate for breast cancer in Rabat (Morocco) 2005-2008].

Science.gov (United States)

Mechita, Nada Bennani; Tazi, Mohammed Adnane; Er-Raki, Abdelouahed; Mrabet, Mustapha; Saadi, Asma; Benjaafar, Noureddine; Razine, Rachid

2016-01-01

Breast cancer is a public health problem in Morocco. This study aims to estimate the survival rate for patients with breast cancer living in Rabat. We conducted a prognostic study of female patients with breast cancer diagnosed during 2005-2008, living in Rabat and whose data were recorded in the Rabat Cancer Registry. The date of inclusion in this study corresponded with the date on which cancer was histologically confirmed. Survival rate was estimated using the Kaplan-Meier method and the comparison between the different classes of a variable was made using the log rank test. The study of factors associated with survival was performed using the Cox model. During the study period 628 cases of breast cancer were collected. Mortality rate was 19.9%. Overall 1-year survival rate was 97.1%, 89.2% at 3 years and 80.6% at 5 years. In multivariate analysis, breast cancer survival was statistically lower in patients over 70 years of age (p <0.001) with large tumor size (p < 0.001), advanced-stage adenopathies (p = 0.007), metastases (p < 0.001) and not using hormone therapy (p = 0.002). Large tumor size and metastases are poor prognostic factors in breast cancer, hence the need to strengthen screening programs.

Mortality in relation to the type of household among elderly people living in a community.

Science.gov (United States)

Nakanishi, N; Nakura, I; Nagano, K; Yoneda, H; Takatorige, T; Shinsho, F; Tatara, K

1998-03-01

The objective of this study was to determine whether there is an association of mortality with the type of household in elderly people. A cohort of 1,352 elderly people aged 65 years and over at baseline in October 1992 was followed for 42 months. Follow-up was completed for 1,266 (93.6%) (172 deceased and 1,094 alive). From the analysis using the Kaplan-Meier method and the log-rank test, male sex, older age group (75 years and over), no satisfaction with present dwelling, disability, no use of health checks, no practices of daily preventive health promotion, no participation in social activities, and no finding life worth living (no Ikigai) were univariately statistically significantly related to mortality. Furthermore, elderly people living with their spouse only or living alone had higher survival rates than those living with their spouse and children or living with their children, and the curves among the four subclasses of household were significantly different. From the Cox proportional hazards model, living with a spouse only remained as an independent predictor for survival, and living alone was not an increased risk factor for mortality, controlling for sex, age, housing conditions, disability, use of health management, and psychosocial conditions.

Evaluation of the prognostic value of Okuda, Cancer of the Liver Italian Program, and Japan Integrated Staging systems for hepatocellular carcinoma patients undergoing radiotherapy

International Nuclear Information System (INIS)

Seong, Jinsil; Shim, Su Jung; Lee, Ik Jae; Han, Kwang Hyub; Chon, Chae Yoon; Ahn, Sang Hoon

2007-01-01

Purpose: The purpose of this study was to compare the validity of staging systems, as well as to identify the staging system with the best prognostic value, in hepatocellular carcinoma (HCC) patients treated with radiotherapy. Methods and Materials: From 1992 to 2003, a total of 305 patients undergoing radiotherapy for HCC were evaluated retrospectively. All patients were classified before radiation therapy by the following systems: tumor-node-metastasis (TNM), Okuda, Cancer of the Liver Italian Program (CLIP), and Japan Integrated Staging (JIS) score. Cumulative survival rates were obtained using the Kaplan-Meier method, and were statistically compared using the log-rank test. Results: Median survival time was 11 months. The 1-, 2-, 3-, 4-, and 5-year survival rates were 45.1%, 24.5%, 14.7%, 10.3%, and 6.4%, respectively. Significant differences in survival were observed between all TNM stages, between CLIP scores 2, 3 and 5, 6, as well as between JIS scores 1, 2, and 2, 3. Conclusions: Among the systems studied, the TNM staging approach appeared to be the best predictor of prognosis. Staging systems that reflect liver disease status (Okuda stage, CLIP, and JIS score) showed limitations in stratifying patients undergoing radiotherapy into different prognostic groups

New-Onset Diabetes Mellitus in Liver Transplant Recipients With Hepatitis C: Analysis of the National Database.

Science.gov (United States)

Li, Z; Sun, F; Hu, Z; Xiang, J; Zhou, J; Yan, S; Wu, J; Zhou, L; Zheng, S

2016-01-01

New-onset diabetes mellitus (NODM) after liver transplantation (LT) occurs with increased frequency in recipients with hepatitis C virus (HCV). We compared the incidence and risk factors for NODM in HCV vs non-HCV recipients. Among 24,956 liver recipients, 18,741 without pretransplantation diabetes were identified. NODM-free survival was analyzed using Kaplan-Meier and log-rank tests, and risk factors for NODM were examined using multivariate Cox regression analysis. The overall incidence of NODM was 13.0% at 1 year after LT. At 1, 2, 3, and 5 years after LT, incidence of NODM in HCV recipients was 14.4%, 4.3%, 3.1%, and 3.5%, respectively, compared with 11.9%, 3.5%, 3.2%, and 6.4%, respectively, in non-HCV recipients. HCV recipients had a higher risk of NODM than non-HCV recipients (hazard ratio 1.17 [1.09-1.27], P diabetes mellitus. Risk factors in non-HCV recipients were male recipient, BMI, and recipients with nonalcoholic steatohepatitis diagnosis. HCV recipients have a higher incidence and more risk factors for NODM than non-HCV recipients. Early identification of modifiable risk factors will assist clinical interventions to prevent NODM complications after LT. Copyright © 2016 Elsevier Inc. All rights reserved.

Prognostic value of preoperative intratumoral FDG uptake heterogeneity in patients with epithelial ovarian cancer

Energy Technology Data Exchange (ETDEWEB)

Lee, Maria; Kim, Hee Seung; Chung, Hyun Hoon; Kim, Jae-Weon; Park, Noh-Hyun; Song, Yong Sang [Seoul National University College of Medicine, Department of Obstetrics and Gynecology, Cancer Research Institute, Seoul (Korea, Republic of); Lee, Hyunjong; Cheon, Gi Jeong [Seoul National University College of Medicine, Department of Nuclear Medicine, Cancer Research Institute, Seoul (Korea, Republic of)

2017-01-15

To investigate the prognostic value of intratumoral FDG uptake heterogeneity (IFH) derived from PET/CT in patients with epithelial ovarian cancer (EOC). We retrospectively reviewed patients with pathologically proven epithelial ovarian cancer who underwent preoperative {sup 18}F-FDG PET/CT scans. PET/CT parameters such as maximum and average standardized uptake values (SUV{sub max} and SUV{sub avg}), sum of all metabolic tumour volume (MTV), cumulative total lesion glycolysis (TLG) and IFH were assessed. Regression analyses were used to identify clinicopathological and imaging variables associated with disease-free survival (DFS). Clinicopathological data were reviewed for 61 eligible patients. The median duration of DFS was 13 months (range, 6-26 months), and 18 (29.5 %) patients experienced recurrence. High IFH values were associated with tumour recurrence (P = 0.005, hazard ratio 4.504, 95 % CI 1.572-12.902). The Kaplan-Meier survival graphs showed that DFS significantly differed in groups categorized based on IFH (P = 0.002, log-rank test). Moreover, there were significant differences in DFS (P = 0.009) and IFH (P = 0.040) between patients with and without recurrence. Preoperative IFH measured by {sup 18}F-FDG PET/CT was significantly associated with EOC recurrence. FDG-based heterogeneity could be a useful and potential predicator of EOC recurrence before treatment. (orig.)

Prognostic value of total lesion glycolysis on preoperative {sup 18}F-FDG PET/CT in patients with uterine carcinosarcoma

Energy Technology Data Exchange (ETDEWEB)

Lee, Jeong-Won [Sungkyunkwan University School of Medicine, Department of Obstetrics and Gynecology, Seoul (Korea, Republic of); Sungkyunkwan University School of Medicine, Samsung Advanced Institute for Health Sciences and Technology, Seoul (Korea, Republic of); Heo, Eun Jin [Sungkyunkwan University School of Medicine, Department of Obstetrics and Gynecology, Seoul (Korea, Republic of); Moon, Seung Hwan [Sungkyunkwan University School of Medicine, Department of Nuclear Medicine, Seoul (Korea, Republic of); Lee, Hyunjong; Cheon, Gi Jeong [Seoul National University College of Medicine, Department of Nuclear Medicine, Seoul (Korea, Republic of); Lee, Maria; Kim, Hee Seung; Chung, Hyun Hoon [Seoul National University College of Medicine, Department of Obstetrics and Gynecology, Cancer Research Institute, Seoul (Korea, Republic of)

2016-11-15

To investigate the relationship between functional tumour parameters measured during preoperative {sup 18}F-FDG PET/CT and clinical outcomes in patients with uterine carcinosarcoma. For patients with pathologically proven uterine carcinosarcoma, we determined the maximal and average standardized uptake values, cumulative total lesion glycolysis (TLG) and sum of all metabolic tumour volumes (MTVs). Their predictive value for recurrence and the effects of pretreatment functional tumour activity on patient survival were compared. Clinicopathological data from 28 eligible patients were reviewed. The median duration of progression-free survival was 18.6 months (range 6.1-84.5 months), and 10 (35.7 %) patients experienced recurrences. Univariate analyses showed significant associations between recurrence and tumour size, lymph node metastasis, high TLG and MTV values, and ovarian invasion. Multivariate analysis identified high TLG value as an independent risk factor for recurrence (p = 0.048, hazard ratio 115.261, 95 % confidence interval 1.041-12,765.483). Kaplan-Meier survival curves showed that progression-free survival significantly differed in groups categorized according to TLG (p = 0.007, log-rank test). Preoperative TLG measured with {sup 18}F-FDG PET/CT was statistically significantly associated with uterine carcinosarcoma recurrence. Metabolic parameters can provide useful quantitative criteria for disease prognostication in patients with uterine carcinosarcoma before treatment. (orig.)

Impact of posterior rhabdosphincter reconstruction during robot-assisted radical prostatectomy: retrospective analysis of time to continence.

Science.gov (United States)

Woo, Jason R; Shikanov, Sergey; Zorn, Kevin C; Shalhav, Arieh L; Zagaja, Gregory P

2009-12-01

Posterior rhabdosphincter (PR) reconstruction during robot-assisted radical prostatectomy (RARP) was introduced in an attempt to improve postoperative continence. In the present study, we evaluate time to achieve continence in patients who are undergoing RARP with and without PR reconstruction. A prospective RARP database was searched for most recent cases that were accomplished with PR reconstruction (group 1, n = 69) or with standard technique (group 2, n = 63). We performed the analysis applying two definitions of continence: 0 pads per day or 0-1 security pad per day. Patients were evaluated by telephone interview. Statistical analysis was carried out using the Kaplan-Meier method and log-rank test. With PR reconstruction, continence was improved when defined as 0-1 security pad per day (median time of 90 vs 150 days; P = 0.01). This difference did not achieve statistical significance when continence was defined as 0 pads per day (P = 0.12). A statistically significant improvement in continence rate and time to achieve continence is seen in patients who are undergoing PR reconstruction during RARP, with continence defined as 0-1 security/safety pad per day. A larger, prospective and randomized study is needed to better understand the impact of this technique on postoperative continence.

Efficacy of icotinib versus traditional chemotherapy as first-line treatment for preventing brain metastasis from advanced lung adenocarcinoma in patients with epidermal growth factor receptor-sensitive mutation

Directory of Open Access Journals (Sweden)

Xiao Zhao

2014-01-01

Full Text Available Objective: This study aimed to investigate the potential use of icotinib as first-line treatment to prevent brain metastasis from advanced lung adenocarcinoma. Patients and Methods: This investigation was designed as a retrospective nonrandomized controlled study. Enrolled patients received either icotinib or traditional chemotherapy as their first-line treatment. The therapeutic efficacy was compared among patients with advanced (stages IIIB and IV lung adenocarcinoma with epidermal growth factor receptor (EGFR-sensitive mutation. The primary endpoint was the cumulative incidence of brain metastasis, whereas the secondary endpoint was overall survival (OS. Death without brain metastasis was considered a competitive risk to calculate the cumulative risk of brain metastasis. Survival analysis was conducted using the Kaplan-Meier method and statistical significance were determined using the log-rank test. Results: The present study included 396 patients with 131 in the icotinib group and 265 in the chemotherapy group. Among those with EGFR-sensitive mutation, the cumulative risk of brain metastasis was lower in the icotinib group than in the chemotherapy group. However, no significant difference in OS was observed between the two groups. Conclusion: Icotinib can effectively reduce the incidence of brain metastasis and therefore improve prognosis in advanced lung adenocarcinoma patients with EGFR-sensitive mutation.

Comparison of minocycline and azithromycin for the treatment of mild scrub typhus in northern China.

Science.gov (United States)

Zhao, Minxing; Wang, Ting; Yuan, Xiaoyu; Du, Weiming; Lin, Miaoxin; Shen, Yanbo

2016-09-01

Scrub typhus, caused by Orientia tsutsugamushi, has recently emerged in northern China where the disease had not been known to exist. Although doxycycline and azithromycin are the recommended agents for the treatment of scrub typhus, clinical responses depend both on the susceptibilities of various O. tsutsugamushi strains and the severity of the disease. A retrospective analysis was conducted on patients diagnosed with mild scrub typhus from August 2013 to January 2016 in the Affiliated Hospital of Nantong University, northern China. A total of 40 patients who received minocycline treatment and 34 patients who received azithromycin treatment were included in the analysis. All patients except one defervesced within 120 h after initiating antimicrobial therapy. Kaplan-Meier curves in association with log-rank test showed that the median time to defervescence was significantly shorter for the minocycline-treated group than the azithromycin-treated group (P = 0.003). There were no serious adverse events during treatment. No relapse occurred in either group during the 1-month follow-up period. In conclusion, both minocycline and azithromycin are effective and safe for the treatment of mild scrub typhus, but minocycline is more active than azithromycin against O. tsutsugamushi infection acquired in northern China. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

Sequential Oxygenation Index and Organ Dysfunction Assessment within the First 3 Days of Mechanical Ventilation Predict the Outcome of Adult Patients with Severe Acute Respiratory Failure

Directory of Open Access Journals (Sweden)

Hsu-Ching Kao

2013-01-01

Full Text Available Objective. To determine early predictors of outcomes of adult patients with severe acute respiratory failure. Method. 100 consecutive adult patients with severe acute respiratory failure were evaluated in this retrospective study. Data including comorbidities, Sequential Organ Failure Assessment (SOFA score, Acute Physiological Assessment and Chronic Health Evaluation II (APACHE II score, PaO2, FiO2, PaO2/FiO2, PEEP, mean airway pressure (mPaw, and oxygenation index (OI on the 1st and the 3rd day of mechanical ventilation, and change in OI within 3 days were recorded. Primary outcome was hospital mortality; secondary outcome measure was ventilator weaning failure. Results. 38 out of 100 (38% patients died within the study period. 48 patients (48% failed to wean from ventilator. Multivariate analysis showed day 3 OI ( and SOFA ( score were independent predictors of hospital mortality. Preexisting cerebrovascular accident (CVA ( was the predictor of weaning failure. Results from Kaplan-Meier method demonstrated that higher day 3 OI was associated with shorter survival time (log-Rank test, . Conclusion. Early OI (within 3 days and SOFA score were predictors of mortality in severe acute respiratory failure. In the future, prospective studies measuring serial OIs in a larger scale of study cohort is required to further consolidate our findings.

The Impact of Anastomotic Angle for Re-Occlusion of Brachioaxillary Graft Arteriovenous Fistula after Percutaneous Thromboaspiration

Energy Technology Data Exchange (ETDEWEB)

Kim, Keon Young; Jin, Gong Yong; Hwang, Seung Bae; Choi, Eun Jung; Song, Ji Soo; Han, Young Min; Kwon, Keun Sang [Chonbuk National University Hospital and Medical School, Jeonju (Korea, Republic of)

2013-03-15

The purpose of this study is to evaluate the factors that affect graft patency in brachioaxillary graft arteriovenous fistula patients. A retrospective study was conducted on 33 patients (20 men, 13 women; mean age, 67.5 years; mean interval to first stenosis, 17 months), who had performed percutaneous angioplasty for first episode of stenosis after brachioaxillary graft surgery. We evaluated the relevant factors affecting the graft patency after first episode of stenosis, such as age, sex, underlying disease (hypertension, diabetes mellitus, hyperlipidemia, cardiovascular disease, cerebrovascular attack), anastomotic angle between graft and axillary vein, and anastomotic angle between the graft and brachial artery. Kaplan-Meier method and log rank test and receiver operating characteristics curve analysis were used in statistical analysis. Graft patency rates after 1 month, 6 months, and 12 months were 75.8%, 39.4%, and 9.1%. There was a correlation between graft-axillary vein anastomotic angle and patency rates (r = 0.372, p = 0.033); larger the venous anastomotic angle, the longer patency rate. However, it does not come up with significant results in patency rates on age, sex, underlying disease, and graft-brachial artery angle. In patients with brachioaxillary graft arteriovenous fistula, as venous anastomotic angle more obtuse, the graft patency may be longer.

Intermediate-term patency of upper arm arteriovenous fistulae for hemodialysis access in children.

Science.gov (United States)

Haricharan, Ramanath N; Aprahamian, Charles J; Morgan, Traci L; Harmon, Carroll M; Barnhart, Douglas C

2008-01-01

The goal of this study was to estimate the 2-year cumulative thrombosis-free survival of basilic vein transposition (BVT) and brachiocephalic fistulae in children. All children who underwent BVT or brachiocephalic fistula construction at a tertiary care children's hospital from June 2001 to July 2006 were reviewed. Kaplan-Meier analysis, log-rank test, and proportional hazards regression were done. Sixteen children (7 girls) with inadequate forearm veins underwent creation of 18 fistulae (12 BVT, 6 brachiocephalic). Median age was 14 (9-19) years. Mean (+/-SE) operative times for BVT and brachiocephalic fistulae were 3.4 (+/- 0.6) hours and 1.9 (+/-0.4) hours, respectively. The overall 2-year cumulative survival rate was 74% (BVT, 66%; brachiocephalic fistula, 83%). Four fistulae failed (1 brachiocephalic, 3 BVT) and 14 fistulae were censored (5, patent fistula; 4, renal transplantation; 2, unrelated death; 1, elective conversion to peritoneal dialysis; 1, surgical ligation of fistula; 1, lost to follow-up). Of 18 fistulae, 6 underwent additional interventions (4, percutaneous angioplasty; 2, surgical thrombectomy). There were no significant differences in survival times based on fistula type, prior transplant status, age, or operative time. Brachiocephalic and BVT fistulae create reliable hemodialysis access for children who have inadequate forearm veins to allow construction of more distal fistulae.

Radiochemotherapy in Anal Cancer: cCR, clinical outcomes and quality of life using two different treatment schedules.

Science.gov (United States)

Di Santo, Sara; Trignani, Marianna; Neri, Matteo; Milano, Angelo; Innocenti, Paolo; Taraborrelli, Maria; Augurio, Antonietta; Vinciguerra, Annamaria; Di Tommaso, Monica; Ursini, Lucia Anna; Di Pilla, Angelo; Di Nicola, Marta; Genovesi, Domenico

2015-01-01

Main endpoint was a response rate to therapy; secondary endpoints were disease-free survival, overall survival, acute and late toxicities, specially in terms of anorectal and urinary continence. Radiochemotherapy for anal cancer achieves a good clinical response, locoregional control, anal function preservation. However, oncologic outcomes can differ using radiotherapy plus fluorouracil and mytomicin vs. cisplatin and fluorouracil. Between 2000 and 2012, 27 anal cancer patients receiving radiotherapy combined with two different radiochemotherapy schedules, fluorouracil and mytomicin (group A) and cisplatin plus fluorouracil (group B). The Kaplan-Meier method was also used to estimate local control, overall survival and disease free survival. Statistical significance between curves was evaluated using the Log-rank test. Complete pathological response was found in 85.2% of patients, with higher rates of response in the group A (100% vs. 63.6%, p = 0.039). No significantly difference was found between the two groups for the other endpoints. Low rates of both acute and late toxicities were recorded. Radiotherapy plus fluorouracil and mytomicin provide a better complete pathological response than radiotherapy plus cisplatin and fluorouracil and a greater rate of anal sphincter function preservation. Globally, radiochemotherapy of the anal cancer provides excellent clinical outcomes with a good profile of acute and late toxicity, without difference between the two groups studied.

Early perfusion changes within 1 week of systemic treatment measured by dynamic contrast-enhanced MRI may predict survival in patients with advanced hepatocellular carcinoma

Energy Technology Data Exchange (ETDEWEB)

Chen, Bang-Bin; Yu, Chih-Wei; Liang, Po-Chin [National Taiwan University College of Medicine and Hospital, Department of Medical Imaging and Radiology, Taipei City (China); Hsu, Chao-Yu [National Taiwan University College of Medicine and Hospital, Department of Medical Imaging and Radiology, Taipei City (China); Taipei Hospital, Ministry of Health and Welfare, Department of Radiology, New Taipei City (China); Hsu, Chiun; Hsu, Chih-Hung; Cheng, Ann-Lii [National Taiwan University College of Medicine and Hospital, Department of Oncology, Taipei City (China); Shih, Tiffany Ting-Fang [National Taiwan University College of Medicine and Hospital, Department of Medical Imaging and Radiology, Taipei City (China); Taipei City Hospital, Department of Medical Imaging, Taipei City (China); National Taiwan University Hospital, Department of Medical Imaging, Taipei (China)

2017-07-15

To correlate early changes in the parameters of dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) within 1 week of systemic therapy with overall survival (OS) in patients with advanced hepatocellular carcinoma (HCC). Eighty-nine patients with advanced HCC underwent DCE-MRI before and within 1 week following systemic therapy. The relative changes of six DCE-MRI parameters (Peak, Slope, AUC, Ktrans, Kep and Ve) of the tumours were correlated with OS using the Kaplan-Meier model and the double-sided log-rank test. All patients died and the median survival was 174 days. Among the six DCE-MRI parameters, reductions in Peak, AUC, and Ktrans, were significantly correlated with one another. In addition, patients with a high Peak reduction following treatment had longer OS (P = 0.023) compared with those with a low Peak reduction. In multivariate analysis, a high Peak reduction was an independent favourable prognostic factor in all patients [hazard ratio (HR), 0.622; P = 0.038] after controlling for age, sex, treatment methods, tumour size and stage, and Eastern Cooperative Oncology Group performance status. Early perfusion changes within 1 week following systemic therapy measured by DCE-MRI may aid in the prediction of the clinical outcome in patients with advanced HCC. (orig.)

Impact of neoadjuvant chemotherapy on complications of minimally invasive radical cystectomy.

Science.gov (United States)

Lizée, D; Salas, R S; Barret, E; Galiano, M; Di Trapani, E; Montorsi, F; Cathelineau, X

2017-03-01

Neoadjuvant chemotherapy (NC) before minimally invasive radical cystectomy (MIRC) is considered a standard of care in muscle-invasive bladder cancer or recurrent high-risk non-muscle-invasive bladder cancer. To evaluate the impact of NC on morbidity and mortality after MIRC. We prospectively evaluated 135 patients who underwent MIRC (laparoscopic: n=100; robotic: n=35) between 2007 and 2013 with ≥90 days of follow-up (median age: 66 year). Complications were analyzed and graded according to the Clavien Dindo classification system. Logistic regression models were used to evaluate the impact of NC on postoperative complications. Kaplan-Meier methods with the log-rank test were used for cancer-specific survival probabilities and differences between the 2groups (MIRC with and without NC). Sixty-two of 135 patients received NC. A total of 118 patients (87.4%) developed 179 complications, chiefly infectious (48.0%) or gastrointestinal (21.2%), ≤90 days after surgery; 3 patients died bladder cancer who had NC versus no NC. We did not find any significant differences in terms of early or late complications, length of stay, or reintervention. The oncologic outcomes regarding NC were encouraging. Copyright © 2016. Publicado por Elsevier España, S.L.U.

Clinical characteristics associated with mortality of patients with anaerobic bacteremia.

Science.gov (United States)

Umemura, Takumi; Hamada, Yukihiro; Yamagishi, Yuka; Suematsu, Hiroyuki; Mikamo, Hiroshige

2016-06-01

The presence of anaerobes in the blood stream is known to be associated with a higher rate of mortality. However, few prognostic risk factor analyses examining whether a patient's background characteristics are associated with the prognosis have been reported. We performed a retrospective case-controlled study to assess the prognostic factors associated with death from anaerobic bacteremia. Seventy-four patients with anaerobic bacteremia were treated between January 2005 and December 2014 at Aichi Medical University Hospital. The clinical information included drug susceptibility was used for analysis of prognostic factors for 30-day mortality. Multivariate logistic analyses revealed an association between the 30-day mortality rate and malignancy (OR: 3.64, 95% CI: 1.08-12.31) and clindamycin resistance (OR: 7.93, 95% CI: 2.33-27.94). The result of Kaplan-Meier analysis of mortality showed that the 30-day survival rate was 83% in clindamycin susceptible and 38.1% in clindamycin resistant anaerobes causing bacteremia. The result of log-rank test also showed that susceptibility to clindamycin affected mortality (P anaerobic bacteremia with a higher risk of 30-day mortality. The results of this study are important for the early and appropriate management of patients with anaerobic bacteremia. Copyright © 2016 Elsevier Ltd. All rights reserved.

Clinical implication of elevated human cervical cancer oncogene-1 expression in esophageal squamous cell carcinoma.

Science.gov (United States)

Liu, Ying; Li, Ke; Ren, Zhonghai; Li, Shenglei; Zhang, Hongyan; Fan, Qingxia

2012-07-01

The human cervical cancer oncogene 1 (HCCR-1), a novel human oncoprotein, has been shown to be upregulated in various human tumors and plays a critical role in tumorigenesis and tumor progression. Here, the authors investigated HCCR-1 level in esophageal squamous cell carcinoma (ESCC) tissues and assessed the correlation between HCCR-1 level and prognosis of the patients with ESCC. HCCR-1 levels were investigated by immunohistochemistry, in situ hybridization, real-time quantitative RT-PCR and Western blotting methods; Kaplan-Meier curve was used to evaluate the prognostic value of HCCR-1 level in patients with ESCC using log-rank test. HCCR-1 displayed high levels in ESCC tissues compared to squamous dysplasia tissues and normal esophageal epithelial tissues. No significant correlation was observed between the levels of HCCR-1 mRNA and protein and gender and age (all p>0.05) but obviously related to histological grade, clinical stage, and lymph node metastasis (all p<0.001). Moreover, the survival rate of the patients with low HCCR-1 levels was higher than that of the patients with high HCCR-1 levels (both p<0.05). These data demonstrate that HCCR-1 may be used as a novel predictor for the prognosis of the patients with ESCC.

Increased Risk of Anxiety or Depression After Traumatic Spinal Cord Injury in Patients with Preexisting Hyperlipidemia: A Population-Based Study.

Science.gov (United States)

Lim, Sher-Wei; Eric Nyam, Tee-Tau; Ho, Chung-Han; Shiue, Yow-Ling; Wang, Jhi-Joung; Chio, Chung-Ching; Kuo, Jinn-Rung

2017-10-01

Anxiety or depression (AD) is a common complication after traumatic spinal cord injury (tSCI). This study sought to investigate the role of preexisting hyperlipidemia in new-onset AD after tSCI using a longitudinal population database. This retrospective cohort study used Longitudinal Health Insurance Database data from January 1997 to December 2011. The case and comparison groups were individuals who experienced tSCI and who did and did not have preexisting hyperlipidemia, respectively. Kaplan-Meier curves were plotted, and log-rank test was used to compare the differences between these 2 groups. A Cox regression model was used to estimate the relative risk of AD. A total of 26,892 adult patients were enrolled in this study. After 1:3 matching with age and gender, it showed 1) tSCI patients with preexisting hyperlipidemia have a 1.32-fold adjusted hazard ratio (HR) compared with those without hyperlipidemia (P 2; HR, 1.9; 95% CI 1.2-2.9), and those with a history of stroke (HR, 1.7; 95% CI 1.0-2.7). Preexisting hyperlipidemia is an independent predictor of new-onset AD in patients with tSCI, especially in those who are younger, male, have a higher CCI score, and have stroke. Copyright © 2017 Elsevier Inc. All rights reserved.

Infectious Complications of Radiologically Inserted Hickman Catheters in Patients with Hematologic Disorders

International Nuclear Information System (INIS)

Bakker, Jeannette; Overhagen, Hans van; Wielenga, Jenne; Marie, Siem de; Nouwen, Jan; Ridder, Marie A.J. de; Lameris, Johan S.

1998-01-01

Purpose: To assess the incidence of infections and its influence on the survival of radiologically inserted Hickman catheters (HCs) in patients with hematologic disorders and to determine factors associated with premature HC removal. Methods: Survival and complications of 175 HCs in 115 patients were studied retrospectively. To describe the data the Kaplan-Meier method and the log-rank test were used, using the date of HC removal due to HC-related infection as endpoint. A stratified Cox regression model was used to determine explanatory factors. Results: Seventy (40%) HCs were removed prematurely because of proven or probable HC-related infections. The incidence of infection leading to HC removal was 4.78 per 1000 catheter-days for proven HC infections. Univariate analysis revealed that acute myeloid leukemia, acute lymphocytic leukemia, or treatment for these diseases, gender, each subsequent catheter in the same patient and insertion site increased the risk of premature removal of the catheter due to infection. Conclusion: Infection is a major problem in patients with HCs. Unfortunately, the factors associated with increased infection rates that were found in this study cannot be influenced. Further studies are necessary to determine the role of environmental conditions in a radiology suite in relation to the risk of developing a catheter-related infection

Mortality predictors of HIV-infected patients on antiretroviral therapy in Debre Tabor General Hospital and Woreta Health Center, South Gondar Zone, Northwest Ethiopia

Directory of Open Access Journals (Sweden)

Mekonnen Assefa Ahunie

2017-02-01

Full Text Available Objective: To investigate the mortality predictors of HIV-infected individuals who were receiving antiretroviral treatment. Methods: Data were extracted from medical records of 698 antiretroviral therapy (ART users enrolled at Debre Tabor General Hospital and Woreta Health Center from January 2005 to June 2014 and sociodemographic, clinical and ART-related data were collected. Mortality was compared by using time-to-event Kaplan-Meier method and log rank test and Cox regression analysis were used to identify the predictors of mortality. Results: The overall mortality rate was 1.5 per 100 persons per year. Ambulatory and bedridden patients had four- and seven-fold higher risk of death [adjusted hazard ratio (HR = 4.2, 95% confidence interval (CI: 1.7–10.7 and adjusted HR = 6.5, 95% CI: 2.0–20.7, respectively] as compared to those patients who had worked functional status. Patients who had poor antiretroviral drug adherence had five times higher risk of death (adjusted HR = 5.1, 95% CI: 1.6–16.3 than patients who had good antiretroviral adherence. Conclusions: Mortality rate was highly observed in the early phase of antiretroviral treatment. Poor ART adherence, being ambulatory and bedridden functional status was independent predictors of mortality.

Effect of Kuanxiong Aerosol () on Patients with Angina Pectoris: A Non-inferiority Multi-center Randomized Controlled Trial.

Science.gov (United States)

Yang, Qiao-Ning; Bai, Rui-Na; Dong, Guo-Ju; Ge, Chang-Jiang; Zhou, Jing-Min; Huang, Li; He, Yan; Wang, Jun; Ren, Ai-Hua; Huang, Zhan-Quan; Zhu, Guang-Li; Lu, Shu; Xiong, Shang-Quan; Xian, Shao-Xiang; Zhu, Zhi-Jun; Shi, Da-Zhuo; Lu, Shu-Zheng; Li, Li-Zhi; Chen, Ke-Ji

2018-05-01

To evaluate the effect and safety of Kuanxiong Aerosol (, KA) on patients with angina pectoris. Block randomization was performed to randomly allocate 750 patients into KA (376 cases) and control groups (374 cases). During an angina attack, the KA group received 3 consecutive sublingual sprays of KA (0.6 mL per spray). The control group received 1 sublingual nitroglycerin tablet (NT, 0.5 mg/tablet). Log-rank tests and Kaplan-Meier estimations were used to estimate the angina remission rates at 6 time-points after treatment (1, 2, 3, 4, 5, and >5 min). Logistic regression analysis was performed to observe the factors inflfluencing the rate of effective angina remission, and the remission rates and incidences of adverse reactions were compared for different Canadian Cardiovascular Society (CCS) classes of angina. The 5-min remission rates in the KA and control groups were not signifificantly different (94.41% vs. 90.64%, P>0.05). The angina CCS class signifificantly inflfluenced the rate of remission (95% confidence interval = 0.483-0.740, P0.05), while they were signifificantly better for KA in the CCSI and II subgroups (Pangina. Furthermore, in CCSII and III patients, KA is superior to NT, with a lower incidence of adverse reactions. (Registration No. ChiCTRIPR-15007204).

Preoperative High-Dose Steroid Has Long-Term Beneficial Effects for Myasthenia Gravis

Directory of Open Access Journals (Sweden)

Syuichi Tetsuka

2013-01-01

Full Text Available Previous studies addressing preoperative steroid treatment have revealed that control of myasthenia gravis (MG with steroids prior to surgery appeared to stabilize postoperative status. The purpose of our study was to clarify the clinical benefits of the preoperative programmed high-dose steroid treatment on the long-term outcomes of MG patients. We retrospectively reviewed the records of 171 MG patients who were followed up after undergoing thymectomy in our hospital between 1988 and 2006. One hundred and thirteen patients in the programmed treatment group had received preoperative steroid treatment, while 58 patients received no steroid treatment during the preoperative period. Clinical remission, which was defined as the achievement of the modified pharmacologic remission (PR for at least 1 year, and clinical benefits were compared between the two groups. With regard to the remission after thymectomy, Kaplan-Meier life-table curves for patients in the preoperative steroid treatment group versus those for patients in the no steroid preoperative treatment group revealed a significantly higher probability of the PR in the preoperative steroid treatment group (log-rank test, P<0.01. This study might be the first, as per our knowledge, to indicate that preoperative programmed high-dose steroid treatment has long-term beneficial effects for MG patients.

Comparison of Long-Term Outcomes of Postmastectomy Radiotherapy between Breast Cancer Patients with and without Immediate Flap Reconstruction.

Directory of Open Access Journals (Sweden)

Hsin-Hua Lee

Full Text Available To compare the long-term clinical outcomes of postmastectomy radiotherapy (PMRT between breast cancer patients with and without immediate transverse rectus abdominis myocutaneous (TRAM flap reconstruction.The study included 492 patients with stage II or III breast cancer who underwent modified radical mastectomy (MRM and chemotherapy followed by PMRT between 1997 and 2011. Cox regression model and Kaplan-Meier curves were calculated, and the log-rank test was used to evaluate the differences between overall and disease-free survival rates in the 2 groups.Among 492 patients, 213 patients had immediate TRAM flap reconstruction. The mean follow-up was 7.2 years (range, 11-191 months. The 5-year and 10-year disease free survival rates were 81% and 76% for the TRAM flap group and 78% and 73% for the non-flap group. The 5-year and 10-year overall survival rates were 89% and 73% for the TRAM flap group and 83% and 74% for the non-flap group.There exists no statistically significant difference in the rates of local recurrence, distant metastasis, disease-free and overall survival when comparing immediate TRAM flap reconstruction with no reconstruction. Our results suggest that immediate TRAM flap reconstruction does not compromise long term clinical outcomes in breast cancer patients requiring PMRT.

[Clinical characteristics and prognosis of colon cancer patient with extremely elevated carcinoembryonic antigen level].

Science.gov (United States)

Chen, Pengju; Yao, Yunfeng; Zhang, Dakui; Gu, Jin

2015-10-01

To explore the clinicopathological characteristics and prognosis of colon cancer patients with extremely elevated serum carcinoembryonic antigen(CEA) level before operation(>50 μg/L). Clinicopathological and follow-up data of 1250 patients with colonic adenocarcinoma undergoing primary tumor resection between January 2001 and December 2011 were retrospectively analyzed. All the patients were divided into three groups according to the preoperative serum CEA levels as normal group (0-5 μg/L, 721 cases), elevated group(5-50 μg/L, 408 cases) and extremely elevated(>50 μg/L, 121 cases). Kaplan-Meier method was used to analyze the overall survival and disease-free survival. Log-rank test was used to compare the survival between groups. Cox regression was used to screen the independent prognostic factors of colon cancer. Compared with normal and elevated groups, patients with extremely elevated CEA had more advanced T,N,M stages (Pcolon cancer (all PColon cancer patients with extremely elevated preoperative CEA levels are associated with more unfavorable pathological factors, advanced TNM stage and more distant metastases (especially the liver metastases) during the follow-up. The elevated degree of preoperative CEA level is an independent poor prognostic factor of patients with colon cancer.

Robust Intratumor Partitioning to Identify High-Risk Subregions in Lung Cancer: A Pilot Study.

Science.gov (United States)

Wu, Jia; Gensheimer, Michael F; Dong, Xinzhe; Rubin, Daniel L; Napel, Sandy; Diehn, Maximilian; Loo, Billy W; Li, Ruijiang

2016-08-01

To develop an intratumor partitioning framework for identifying high-risk subregions from (18)F-fluorodeoxyglucose positron emission tomography (FDG-PET) and computed tomography (CT) imaging and to test whether tumor burden associated with the high-risk subregions is prognostic of outcomes in lung cancer. In this institutional review board-approved retrospective study, we analyzed the pretreatment FDG-PET and CT scans of 44 lung cancer patients treated with radiation therapy. A novel, intratumor partitioning method was developed, based on a 2-stage clustering process: first at the patient level, each tumor was over-segmented into many superpixels by k-means clustering of integrated PET and CT images; next, tumor subregions were identified by merging previously defined superpixels via population-level hierarchical clustering. The volume associated with each of the subregions was evaluated using Kaplan-Meier analysis regarding its prognostic capability in predicting overall survival (OS) and out-of-field progression (OFP). Three spatially distinct subregions were identified within each tumor that were highly robust to uncertainty in PET/CT co-registration. Among these, the volume of the most metabolically active and metabolically heterogeneous solid component of the tumor was predictive of OS and OFP on the entire cohort, with a concordance index or CI of 0.66-0.67. When restricting the analysis to patients with stage III disease (n=32), the same subregion achieved an even higher CI of 0.75 (hazard ratio 3.93, log-rank P=.002) for predicting OS, and a CI of 0.76 (hazard ratio 4.84, log-rank P=.002) for predicting OFP. In comparison, conventional imaging markers, including tumor volume, maximum standardized uptake value, and metabolic tumor volume using threshold of 50% standardized uptake value maximum, were not predictive of OS or OFP, with CI mostly below 0.60 (log-rank P>.05). We propose a robust intratumor partitioning method to identify clinically relevant, high

Combined detection of preoperative serum CEA, CA19-9 and CA242 improve prognostic prediction of surgically treated colorectal cancer patients.

Science.gov (United States)

Wang, Jingtao; Wang, Xiao; Yu, Fudong; Chen, Jian; Zhao, Senlin; Zhang, Dongyuan; Yu, Yang; Liu, Xisheng; Tang, Huamei; Peng, Zhihai

2015-01-01

We assessed the prognostic significance of preoperative serum carcinoembryonic antigen (CEA), carbohydrate antigen 19-9 (CA19-9) and carbohydrate antigen 242 (CA242) levels in surgically treated colorectal cancer patients. The relationship of preoperative serum CEA, CA19-9 and CA242 levels with disease characteristics was investigated in 310 patients. Correlation between tumor markers was investigated using Pearson correlation test. Univariate and multivariate survival analyses were used to study the relationship between preoperative tumor markers and prognosis [disease free survival (DFS) and overall survival (OS)]. Kaplan-Meier analysis with log rank test was used to assess the impact of tumor marker levels on survival. Positive rate of preoperative serum CEA, CA19-9 and CA242 were 54.84%, 47.42% and 37.10%, respectively. High preoperative CEA level was associated with tumor size (P = 0.038), T stage (P tumor AJCC stage (P = 0.023). Preoperative CA242 positively correlated with CEA (P markers was of independent prognostic value in CRC (HR = 2.532, 95% CI: 1.400-4.579, P = 0.002 for OS; and HR = 2.366, 95% CI: 1.334-4.196, P = 0.003 for DFS). Combined detection of preoperative serum CEA, CA19-9 and CA242 is of independent prognostic value for management of CRC patients treated surgically.

Development of a nomogram combining clinical staging with 18F-FDG PET/CT image features in non-small-cell lung cancer stage I-III

International Nuclear Information System (INIS)

Desseroit, Marie-Charlotte; Visvikis, Dimitris; Majdoub, Mohamed; Hatt, Mathieu; Tixier, Florent; Perdrisot, Remy; Cheze Le Rest, Catherine; Guillevin, Remy

2016-01-01

Our goal was to develop a nomogram by exploiting intratumour heterogeneity on CT and PET images from routine 18 F-FDG PET/CT acquisitions to identify patients with the poorest prognosis. This retrospective study included 116 patients with NSCLC stage I, II or III and with staging 18 F-FDG PET/CT imaging. Primary tumour volumes were delineated using the FLAB algorithm and 3D Slicer trademark on PET and CT images, respectively. PET and CT heterogeneities were quantified using texture analysis. The reproducibility of the CT features was assessed on a separate test-retest dataset. The stratification power of the PET/CT features was evaluated using the Kaplan-Meier method and the log-rank test. The best standard metric (functional volume) was combined with the least redundant and most prognostic PET/CT heterogeneity features to build the nomogram. PET entropy and CT zone percentage had the highest complementary values with clinical stage and functional volume. The nomogram improved stratification amongst patients with stage II and III disease, allowing identification of patients with the poorest prognosis (clinical stage III, large tumour volume, high PET heterogeneity and low CT heterogeneity). Intratumour heterogeneity quantified using textural features on both CT and PET images from routine staging 18 F-FDG PET/CT acquisitions can be used to create a nomogram with higher stratification power than staging alone. (orig.)

Clinical and Radiologic Outcomes of Submerged and Nonsubmerged Bone-Level Implants with Internal Hexagonal Connections in Immediate Implantation: A 5-Year Retrospective Study.

Science.gov (United States)

Wu, Shiyu; Wu, Xiayi; Shrestha, Rachana; Lin, Jinying; Feng, Zhicai; Liu, Yudong; Shi, Yunlin; Huang, Baoxin; Li, Zhipeng; Liu, Quan; Zhang, Xiaocong; Hu, Mingxuan; Chen, Zhuofan

2018-02-01

To evaluate the 5-year clinical and radiologic outcome of immediate implantation using submerged and nonsubmerged techniques with bone-level implants and internal hexagonal connections and the effects of potential influencing factors. A total of 114 bone-level implants (XiVE S plus) with internal hexagonal connections inserted into 72 patients were included. Patients were followed up for 5 years. A t-test was used to statistically evaluate the marginal bone loss between the submerged and nonsubmerged groups. The cumulative survival rate (CSR) was calculated according to the life table method and illustrated with Kaplan-Meier survival curves. Comparisons of the CSR between healing protocols, guided bone regeneration, implants with different sites, lengths, and diameters were performed using log-rank tests. The 5-year cumulative implant survival rates with submerged and nonsubmerged healing were 94% and 96%, respectively. No statistically significant differences in terms of marginal bone loss, healing protocol, application of guided bone regeneration, implant site, or length were observed. High CSRs and good marginal bone levels were achieved 5 years after immediate implantation of bone-level implants with internal hexagonal connections using both the submerged and nonsubmerged techniques. Factors such as implant length, site, and application of guided bone regeneration did not have an impact on the long-term success of the implants. © 2017 by the American College of Prosthodontists.

Perinatal stroke and the risk of developing childhood epilepsy

Science.gov (United States)

Golomb, Meredith R.; Garg, Bhuwan P.; Carvalho, Karen S.; Johnson, Cynthia S.; Williams, Linda S.

2008-01-01

Objectives To describe the prevalence of epilepsy after 6 months-of-age in children with perinatal stroke and examine whether perinatal data predict epilepsy onset and resolution. Study design A retrospective review of 64 children with perinatal stroke. In children with at least 6 months of follow-up data, Kaplan-Meier curves, univariate log-rank tests, and Cox proportional hazards models were used to examine predictors of time to development of seizures, and time to resolution of seizures in children with epilepsy. The association of risk factors with the presence of epilepsy at any time after 6 months-of-age was examined using Fisher’s exact test. Results Forty-one of the 61 children with at least 6 months of follow-up data (67%) had epilepsy between 6 months-of-age and last follow-up, but in 13 of 41 seizures eventually resolved and anticonvulsants were discontinued. Infarct on prenatal ultrasound (p=0.0065) and family history of epilepsy (p=0.0093) were significantly associated with time to development of seizures after 6 months-of-age in the univariate analysis. No assessed variables were associated with time to resolution of epilepsy or with the presence of epilepsy after 6 months-of-age. Conclusions Childhood epilepsy is frequent after perinatal stroke. Evidence of infarction on prenatal ultrasound and a family history of epilepsy predict earlier onset of active seizures. PMID:17889079

Impact of Socioeconomic Status and Ethnicity on Melanoma Presentation and Recurrence in Caucasian Patients.

Science.gov (United States)

Salvaggio, Christine; Han, Sung Won; Martires, Kathryn; Robinson, Eric; Madankumar, Reshmi; Gumaste, Priyanka; Polsky, David; Stein, Jennifer; Berman, Russell; Shapiro, Richard; Zhong, Judy; Osman, Iman

2016-01-01

The impact of ethnicity and the socioeconomic status (SES) among Caucasians is not well studied. Here, we examine the impact of income on melanoma presentation and prognosis within a Caucasian cohort, accounting for ethnicity, as some reports suggest increased melanoma incidence in Ashkenazi Jewish (AJ) BRCA mutation carriers. We studied prospectively enrolled primary melanoma patients at New York University. SES data were estimated using United States' Census Bureau data and patient zip codes. We evaluated associations between ethnicity, SES, and baseline characteristics using the χ² test and multivariate logistic regression. We compared survival distributions using Kaplan-Meier curves, log-rank tests, and Cox proportional hazard ratios. Of the 1,339 enrolled patients, AJ represented 32% (n = 423). Apart from AJ being older at presentation (p < 0.001), no significant differences were observed in baseline characteristics between ethnic groups. Patients with a median household income (MHI) lower than the median of the cohort were significantly more likely to present with advanced stages (p < 0.001) compared to patients with a higher MHI. Shorter overall (p = 0.016) and post-recurrence survival (p = 0.042) was also observed in patients from lower-income households. Data suggest that disparities in melanoma presentation in Caucasians stratify according to income independent of ethnic background. © 2016 S. Karger AG, Basel.

Prognostic factors in patients with malignant pleural effusion: Is it possible to predict mortality in patients with good performance status?

Science.gov (United States)

Abrao, Fernando Conrado; Peixoto, Renata D'Alpino; de Abreu, Igor Renato Louro Bruno; Janini, Maria Cláudia; Viana, Geisa Garcia; de Oliveira, Mariana Campello; Younes, Riad Naim

2016-04-01

The aim of this study was to identify predictors of mortality only in patients with malignant pleural effusion (MPE) showing good performance status which required pleural palliative procedures. All patients with MPE submitted to pleural palliative procedure were enrolled in a prospective study between 2013 and 2014. Patients with Eastern cooperative oncology group (ECOG) score zero, one, and two were considered with good performance status. The possible prognostic factors were tested for significance using the log-rank test (Kaplan-Meier method) and those with significance on univariate analysis were entered into a multivariable Cox model. A total of 64 patients were included in the analysis. Median follow-up time for surviving patients was 263 days. Median survival for the entire cohort was not reached yet. In the multivariate analysis, gastrointestinal primary site (P = 0.006), low albumin concentration in the pleural fluid (P = 0.017), and high serum NLR (P = 0.007) were associated with mortality. In our cohort of ECOG 0-2 patients with MPE submitted to pleural palliative procedures, gastrointestinal malignancy compared to other sites, low pleural fluid albumin and high NLR were significantly associated with mortality. The identification of these prognostic factors may assist the choice of the optimal palliative technique. J. Surg. Oncol. 2016;113:570-574. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

A new concept for stainless steels ranking upon the resistance to cavitation erosion

Science.gov (United States)

Bordeasu, I.; Popoviciu, M. O.; Salcianu, L. C.; Ghera, C.; Micu, L. M.; Badarau, R.; Iosif, A.; Pirvulescu, L. D.; Podoleanu, C. E.

2017-01-01

In present, the ranking of materials as their resistance to cavitation erosion is obtained by using laboratory tests finalized with the characteristic curves mean depth erosion against time MDE(t) and mean depth erosion rate against time MDER(t). In some previous papers, Bordeasu and co-workers give procedures to establish exponential equation representing the curves, with minimum scatter of the experimental obtained results. For a given material, both exponential equations MDE(t) and MDER(t) have the same values for the parameters of scale and for the shape one. For the ranking of materials is sometimes important to establish single figure. Till now in Timisoara Polytechnic University Cavitation Laboratory were used three such numbers: the stable value of the curve MDER(t), the resistance to cavitation erosion (Rcav ≡ 1/MDERstable) and the normalized cavitation resistance Rns which is the rate between vs = MDERstable for the analyzed material and vse= MDERse the mean depth erosion rate for the steel OH12NDL (Rns = vs/vse ). OH12NDL is a material used for manufacturing the blades of numerous Kaplan turbines in Romania for which both cavitation erosion laboratory tests and field measurements of cavitation erosions are available. In the present paper we recommend a new method for ranking the materials upon cavitation erosion resistance. This method uses the scale and shape parameters of the exponential equations which represents the characteristic cavitation erosion curves. Till now the method was applied only for stainless steels. The experimental results show that the scale parameter represents an excellent method for ranking the stainless steels. In the future this kind of ranking will be tested also for other materials especially for bronzes used for manufacturing ship propellers.

Reporting of loss to follow-up information in randomised controlled trials with time-to-event outcomes: a literature survey

Directory of Open Access Journals (Sweden)

Bender Ralf

2011-09-01

Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.

Anterolateral Knee Extra-articular Stabilizers: A Robotic Sectioning Study of the Anterolateral Ligament and Distal Iliotibial Band Kaplan Fibers.

Science.gov (United States)

Geeslin, Andrew G; Chahla, Jorge; Moatshe, Gilbert; Muckenhirn, Kyle J; Kruckeberg, Bradley M; Brady, Alex W; Coggins, Ashley; Dornan, Grant J; Getgood, Alan M; Godin, Jonathan A; LaPrade, Robert F

2018-05-01

The individual kinematic roles of the anterolateral ligament (ALL) and the distal iliotibial band Kaplan fibers in the setting of anterior cruciate ligament (ACL) deficiency require further clarification. This will improve understanding of their potential contribution to residual anterolateral rotational laxity after ACL reconstruction and may influence selection of an anterolateral extra-articular reconstruction technique, which is currently a matter of debate. Hypothesis/Purpose: To compare the role of the ALL and the Kaplan fibers in stabilizing the knee against tibial internal rotation, anterior tibial translation, and the pivot shift in ACL-deficient knees. We hypothesized that the Kaplan fibers would provide greater tibial internal rotation restraint than the ALL in ACL-deficient knees and that both structures would provide restraint against internal rotation during a simulated pivot-shift test. Controlled laboratory study. Ten paired fresh-frozen cadaveric knees (n = 20) were used to investigate the effect of sectioning the ALL and the Kaplan fibers in ACL-deficient knees with a 6 degrees of freedom robotic testing system. After ACL sectioning, sectioning was randomly performed for the ALL and the Kaplan fibers. An established robotic testing protocol was utilized to assess knee kinematics when the specimens were subjected to a 5-N·m internal rotation torque (0°-90° at 15° increments), a simulated pivot shift with 10-N·m valgus and 5-N·m internal rotation torque (15° and 30°), and an 88-N anterior tibial load (30° and 90°). Sectioning of the ACL led to significantly increased tibial internal rotation (from 0° to 90°) and anterior tibial translation (30° and 90°) as compared with the intact state. Significantly increased internal rotation occurred with further sectioning of the ALL (15°-90°) and Kaplan fibers (15°, 60°-90°). At higher flexion angles (60°-90°), sectioning the Kaplan fibers led to significantly greater internal rotation

On the rigidity of rank gradient in a group of intermediate growth

OpenAIRE

Grigorchuk, Rostislav; Kravchenko, Rostyslav

2018-01-01

We introduce and investigate the rigidity property of rank gradient in the case of the group $\\mathcal G$ of intermediate growth constructed by the first author. We show that $\\mathcal G$ is normally $(f,g)$-RG rigid where $f(n)=\\log(n)$ and $g(n) =\\log(\\log(n)).$

Cross-system log file analysis for hypothesis testing

NARCIS (Netherlands)

Glahn, Christian; Specht, Marcus; Schoonenboom, Judith; Sligte, Henk; Moghnieh, Ayman; Hernández-Leo, Davinia; Stefanov, Krassen; Lemmers, Ruud; Koper, Rob

2008-01-01

Glahn, C., Specht, M., Schoonenboom, J., Sligte, H., Moghnieh, A., Hernández-Leo, D. Stefanov, K., Lemmers, R., & Koper, R. (2008). Cross-system log file analysis for hypothesis testing. In H. Sligte & R. Koper (Eds.), Proceedings of the 4th TENCompetence Open Workshop. Empowering Learners for

Oxygen uptake efficiency slope and peak oxygen consumption predict prognosis in children with tetralogy of Fallot.

Science.gov (United States)

Tsai, Yun-Jeng; Li, Min-Hui; Tsai, Wan-Jung; Tuan, Sheng-Hui; Liao, Tin-Yun; Lin, Ko-Long

2016-07-01

Oxygen uptake efficiency slope (OUES) and peak oxygen consumption (VO2peak) are exercise parameters that can predict cardiac morbidity in patients with numerous heart diseases. But the predictive value in patients with tetralogy of Fallot is still undetermined, especially in children. We evaluated the prognostic value of OUES and VO2peak in children with total repair of tetralogy of Fallot. Retrospective cohort study. Forty tetralogy of Fallot patients younger than 12 years old were recruited. They underwent a cardiopulmonary exercise test during the follow-up period after total repair surgery. The results of the cardiopulmonary exercise test were used to predict the cardiac related hospitalization in the following two years after the test. OUES normalized by body surface area (OUES/BSA) and the percentage of predicted VO2peak appeared to be predictive for two-year cardiac related hospitalization. Receiver operating characteristic curve analysis demonstrated that the best threshold value for OUES/BSA was 1.029 (area under the curve = 0.70, p = 0.03), and for VO2peak was 74% of age prediction (area under the curve = 0.72, p = 0.02). The aforementioned findings were confirmed by Kaplan-Meier plots and log-rank test. OUES/BSA and VO2peak are useful predictors of cardiac-related hospitalization in children with total repair of tetralogy of Fallot. © The European Society of Cardiology 2015.

Systemic treatment with CAR-engineered T cells against PSCA delays subcutaneous tumor growth and prolongs survival of mice

International Nuclear Information System (INIS)

Hillerdal, Victoria; Ramachandran, Mohanraj; Leja, Justyna; Essand, Magnus

2014-01-01

Adoptive transfer of T cells genetically engineered with a chimeric antigen receptor (CAR) has successfully been used to treat both chronic and acute lymphocytic leukemia as well as other hematological cancers. Experimental therapy with CAR-engineered T cells has also shown promising results on solid tumors. The prostate stem cell antigen (PSCA) is a protein expressed on the surface of prostate epithelial cells as well as in primary and metastatic prostate cancer cells and therefore a promising target for immunotherapy of prostate cancer. We developed a third-generation CAR against PSCA including the CD28, OX-40 and CD3 ζ signaling domains. T cells were transduced with a lentivirus encoding the PSCA-CAR and evaluated for cytokine production (paired Student’s t-test), proliferation (paired Student’s t-test), CD107a expression (paired Student’s t-test) and target cell killing in vitro and tumor growth and survival in vivo (Log-rank test comparing Kaplan-Meier survival curves). PSCA-CAR T cells exhibit specific interferon (IFN)-γ and interleukin (IL)-2 secretion and specific proliferation in response to PSCA-expressing target cells. Furthermore, the PSCA-CAR-engineered T cells efficiently kill PSCA-expressing tumor cells in vitro and systemic treatment with PSCA-CAR-engineered T cells significantly delays subcutaneous tumor growth and prolongs survival of mice. Our data confirms that PSCA-CAR T cells may be developed for treatment of prostate cancer

18F-FDG PET diagnostic and prognostic patterns do not overlap in Alzheimer's disease (AD) patients at the mild cognitive impairment (MCI) stage

International Nuclear Information System (INIS)

Morbelli, Silvia; Bauckneht, Matteo; Buschiazzo, Ambra; Nieri, Alberto; Sambuceti, Gianmario; Pagani, Marco; De Carli, Fabrizio

2017-01-01

We aimed to identify the cortical regions where hypometabolism can predict the speed of conversion to dementia in mild cognitive impairment due to Alzheimer's disease (MCI-AD). We selected from the clinical database of our tertiary center memory clinic, eighty-two consecutive MCI-AD that underwent 18F-fluorodeoxyglucose (FDG) PET at baseline during the first diagnostic work-up and were followed up at least until their clinical conversion to AD dementia. The whole group of MCI-AD was compared in SPM8 with a group of age-matched healthy controls (CTR) to verify the presence of AD diagnostic-pattern; then the correlation between conversion time and brain metabolism was assessed to identify the prognostic-pattern. Significance threshold was set at p < 0.05 False-Discovery-Rate (FDR) corrected at peak and at cluster level. Each MCI-AD was then compared with CTR by means of a SPM single-subject analysis and grouped according to presence of AD diagnostic-pattern and prognostic-pattern. Kaplan-Meier-analysis was used to evaluate if diagnostic- and/or prognostic-patterns can predict speed of conversion to dementia. Diagnostic-pattern corresponded to typical posterior hypometabolism (BA 7, 18, 19, 30, 31 and 40) and did not correlate with time to conversion, which was instead correlated with metabolic levels in right middle and inferior temporal gyri as well as in the fusiform gyrus (prognostic-pattern, BA 20, 21 and 38). At Kaplan-Meier analysis, patients with hypometabolism in the prognostic pattern converted to AD-dementia significantly earlier than patients not showing significant hypometabolism in the right middle and inferior temporal cortex (9 versus 19 months; Log rank p < 0.02, Breslow test: p < 0.003, Tarone-Ware test: p < 0.007). The present findings support the role of FDG PET as a robust progression biomarker even in a naturalist population of MCI-AD. However, not the AD-typical diagnostic-pattern in posterior regions but the middle and inferior temporal

18F-FDG PET diagnostic and prognostic patterns do not overlap in Alzheimer's disease (AD) patients at the mild cognitive impairment (MCI) stage

Energy Technology Data Exchange (ETDEWEB)

Morbelli, Silvia; Bauckneht, Matteo; Buschiazzo, Ambra; Nieri, Alberto; Sambuceti, Gianmario [Genoa Univ. (Italy). Dept. of Health Sciences; IRCCS AOU San Martino-IST, Genoa (Italy). Nuclear Medicine Unit; Arnaldi, Dario; Picco, Agnese; Pardini, Matteo; Brugnolo, Andrea; Girtler, Nicola; Nobili, Flavio [Genoa Univ. (Italy). Clinical Neurology, Department of Neuroscience (DINOGMI); IRCCS AOU San Martino-IST, Genoa (Italy); Pagani, Marco [Institute of Cognitive Sciences and Technologies, Rome (Italy); Karolinska Hospital, Stockholm (Sweden). Department of Nuclear Medicine; Chincarini, Andrea [Istituto Nazionale di Fisica Nucleare, Genoa (Italy); De Carli, Fabrizio [National Research Council, Genoa (Italy). Institute of Bioimaging and Molecular Physiology

2017-11-15

We aimed to identify the cortical regions where hypometabolism can predict the speed of conversion to dementia in mild cognitive impairment due to Alzheimer's disease (MCI-AD). We selected from the clinical database of our tertiary center memory clinic, eighty-two consecutive MCI-AD that underwent 18F-fluorodeoxyglucose (FDG) PET at baseline during the first diagnostic work-up and were followed up at least until their clinical conversion to AD dementia. The whole group of MCI-AD was compared in SPM8 with a group of age-matched healthy controls (CTR) to verify the presence of AD diagnostic-pattern; then the correlation between conversion time and brain metabolism was assessed to identify the prognostic-pattern. Significance threshold was set at p < 0.05 False-Discovery-Rate (FDR) corrected at peak and at cluster level. Each MCI-AD was then compared with CTR by means of a SPM single-subject analysis and grouped according to presence of AD diagnostic-pattern and prognostic-pattern. Kaplan-Meier-analysis was used to evaluate if diagnostic- and/or prognostic-patterns can predict speed of conversion to dementia. Diagnostic-pattern corresponded to typical posterior hypometabolism (BA 7, 18, 19, 30, 31 and 40) and did not correlate with time to conversion, which was instead correlated with metabolic levels in right middle and inferior temporal gyri as well as in the fusiform gyrus (prognostic-pattern, BA 20, 21 and 38). At Kaplan-Meier analysis, patients with hypometabolism in the prognostic pattern converted to AD-dementia significantly earlier than patients not showing significant hypometabolism in the right middle and inferior temporal cortex (9 versus 19 months; Log rank p < 0.02, Breslow test: p < 0.003, Tarone-Ware test: p < 0.007). The present findings support the role of FDG PET as a robust progression biomarker even in a naturalist population of MCI-AD. However, not the AD-typical diagnostic-pattern in posterior regions but the middle and inferior temporal

Kaplan turbine tip vortex cavitation – analysis and prevention

International Nuclear Information System (INIS)

Motycak, L; Skotak, A; Kupcik, R

2012-01-01

The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

Prognostic significance of transient myocardial ischaemia after first acute myocardial infarction: five year follow up study

DEFF Research Database (Denmark)

Mickley, H; Nielsen, J R; Berning, J

1995-01-01

infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...

Interview with Danny Kaplan

Science.gov (United States)

Rossman, Allan; Kaplan, Danny

2017-01-01

Danny Kaplan is DeWitt Wallace Professor of Mathematics and Computer Science at Macalester College. He received Macalester's Excellence in teaching Award in 2006 and the CAUSE/USCOTS Lifetime Achievement Award in 2017. This interview took place via email on March 4-June 17, 2017. Topics covered in the interview include: (1) the current state of…

Generating pseudo test collections for learning to rank scientific articles

NARCIS (Netherlands)

Berendsen, R.; Tsagkias, M.; de Rijke, M.; Meij, E.

2012-01-01

Pseudo test collections are automatically generated to provide training material for learning to rank methods. We propose a method for generating pseudo test collections in the domain of digital libraries, where data is relatively sparse, but comes with rich annotations. Our intuition is that

A prospective observational study comparing a physiological scoring system with time-based discharge criteria in pediatric ambulatory surgical patients.

Science.gov (United States)

Armstrong, James; Forrest, Helen; Crawford, Mark W

2015-10-01

Discharge criteria based on physiological scoring systems can be used in the postanesthesia care unit (PACU) to fast-track patients after ambulatory surgery; however, studies comparing physiological scoring systems with traditional time-based discharge criteria are lacking. The purpose of this study was to compare PACU discharge readiness times using physiological vs time-based discharge criteria in pediatric ambulatory surgical patients. We recorded physiological observations from consecutive American Society of Anesthesiologists physical status I-III patients aged 1-18 yr who were admitted to the PACU after undergoing ambulatory surgery in a tertiary academic pediatric hospital. The physiological score was a combination of the Aldrete and Chung systems. Scores were recorded every 15 min starting upon arrival in the PACU. Patients were considered fit for discharge once they attained a score ≥12 (maximum score, 14), provided no score was zero, with the time to achieve a score ≥12 defining the criteria-based discharge (CBD) time. Patients were discharged from the PACU when both the CBD and the existing time-based discharge (TBD) criteria were met. The CBD and TBD data were compared using Kaplan-Meier and log-rank analysis. Observations from 506 children are presented. Median (interquartile range [IQR]) age was 5.5 [2.8-9.9] yr. Median [IQR] CBD and TBD PACU discharge readiness times were 30 [15-45] min and 60 [45-60] min, respectively. Analysis of Kaplan-Meier curves indicated a significant difference in discharge times using the different criteria (hazard ratio, 5.43; 95% confidence interval, 4.51 to 6.53; P < 0.001). All patients were discharged home without incident. This prospective study suggests that discharge decisions based on physiological criteria have the potential for significantly speeding the transit of children through the PACU, thereby enhancing PACU efficiency and resource utilization.

LogScope

Science.gov (United States)

Havelund, Klaus; Smith, Margaret H.; Barringer, Howard; Groce, Alex

2012-01-01

LogScope is a software package for analyzing log files. The intended use is for offline post-processing of such logs, after the execution of the system under test. LogScope can, however, in principle, also be used to monitor systems online during their execution. Logs are checked against requirements formulated as monitors expressed in a rule-based specification language. This language has similarities to a state machine language, but is more expressive, for example, in its handling of data parameters. The specification language is user friendly, simple, and yet expressive enough for many practical scenarios. The LogScope software was initially developed to specifically assist in testing JPL s Mars Science Laboratory (MSL) flight software, but it is very generic in nature and can be applied to any application that produces some form of logging information (which almost any software does).

On Locally Most Powerful Sequential Rank Tests

Czech Academy of Sciences Publication Activity Database

Kalina, Jan

2017-01-01

Roč. 36, č. 1 (2017), s. 111-125 ISSN 0747-4946 R&D Projects: GA ČR GA17-07384S Grant - others:Nadační fond na podporu vědy(CZ) Neuron Institutional support: RVO:67985556 Keywords : nonparametric test s * sequential ranks * stopping variable Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 0.339, year: 2016 http://library.utia.cas.cz/separaty/2017/SI/kalina-0474065.pdf

Hyper-local, directions-based ranking of places

DEFF Research Database (Denmark)

Venetis, Petros; Gonzalez, Hector; Jensen, Christian S.

2011-01-01

they are numerous and contain precise locations. Specifically, the paper proposes a framework that takes a user location and a collection of near-by places as arguments, producing a ranking of the places. The framework enables a range of aspects of directions queries to be exploited for the ranking of places......, including the frequency with which places have been referred to in directions queries. Next, the paper proposes an algorithm and accompanying data structures capable of ranking places in response to hyper-local web queries. Finally, an empirical study with very large directions query logs offers insight...... into the potential of directions queries for the ranking of places and suggests that the proposed algorithm is suitable for use in real web search engines....

Evaluation of Retention in Methadone Treatment in Patients Attending Baharan Hospital Clinic in Zahedan City

Directory of Open Access Journals (Sweden)

M.D. Mohebi

2015-04-01

Full Text Available Introduction & Objectives: Substance abuse and opioid dependency refers to hazardous use of psychoactive substance .Prevention and treatment of opiate dependence has not been success-ful. Most effective drug in agonist treatment of opiates is methadone maintenance therapy (MMT.But the lack of cooperation of addicts in methadone maintenance therapy has always been a big problem to continue. The purpose of this study is to investigate the retention in the MMT. Materials & Methods: This historical cohort study analyzed the medical records of patients of Baharan hospital in Zahedan. All 912 cases of methadone maintenance clinic of Baharan hos-pital in Zahedan 2011-2012 were studied and the data were analyzed using SPSS. Tables and indexes were analyzed by the Chi-square test and survival curves were plotted using Kaplan–Meier method and analyzed by Log-Rank test. Results: This study reviewed records from 912 patients with a mean age of 34.67% and stan-dard deviation of 10.88 and the range of 15-86 years. 735 were male and 177 ware female. 1-moth retention rate was 71%, 3 months was 59%, 6 months was 47%, 1 year was 30% and 2 years was 17%. Kaplan-Meier median survival time of 8 months was estimated by relation-ship. Doses higher than 60 mg/d of methadone was associated with increased survival on MMT. Conclusion: Age increase, increase of employment time, increasing of the duration of drug abuse, increasing the daily dose of methadone, oral substance abuse increased retention rate and heroin abuse and smoking were associated with decrease retention rate of methadone maintenance therapy. So, with an emphasis on each of these factors effective steps can be taken to improve the cooperation of patients in MMT. (Sci J Hamadan Univ Med Sci 2015; 22 (1:30-36

The surgical treatment of failure in cervical lymph nodes after radiotherapy for nasopharyngeal carcinoma: an analysis of 83 patients

International Nuclear Information System (INIS)

Gu Wendong; Ji Qinghai; Lu Xueguan; Feng Yan

2003-01-01

Objective: To analyze the results of neck dissection in patients who failed in cervical lymph nodes after radiotherapy for nasopharyngeal carcinoma. Methods: Eighty-three patients who received neck dissection due to lymph node persistence or recurrence after definitive radiotherapy were analyzed retrospectively according to the following relevant factors: age, sex, the interval between completion of radiotherapy and surgery, rN stage, postoperative radiotherapy given or not, the adjacent tissues involved or not and the number of positive nodes. Kaplan-Meier method, Log-rank method and Cox method were used in the statistical analysis. Results: The 1-, 3- and 5-year overall survival rates were 80.7%, 47.1% and 34.9%. The interval between completion of radiotherapy and surgery, postoperative radiotherapy given or not, the adjacent tissues involved or not were significantly prognostic factors in statistic analysis. Conclusions: Neck dissection can be applied in the management of cervical lymph node failure in nasopharyngeal carcinoma after radiotherapy. Postoperative radiotherapy should be considered in patients with capsular invasion and/or adjacent tissue involvement

Cytogenetic abnormalities and their prognostic significance in idiopathic myelofibrosis: a study of 106 cases.

Science.gov (United States)

Reilly, J T; Snowden, J A; Spearing, R L; Fitzgerald, P M; Jones, N; Watmore, A; Potter, A

1997-07-01

The prognostic significance of cytogenetic abnormalities was determined in 106 patients with well-characterized idiopathic myelofibrosis who were successfully karyotyped at diagnosis. 35% of the cases exhibited a clonal abnormality (37/106), whereas 65% (69/106) had a normal karyotype. Three characteristic defects, namely del(13q) (nine cases), del(20q) (eight cases) and partial trisomy 1q (seven cases), were present in 64.8% (24/37) of patients with clonal abnormalities. Kaplan-Meier plots and log rank analysis demonstrated an abnormal karyotype to be an adverse prognostic variable (P 10.3 x 10(9)/l; P=0.06) were also associated with a shorter survival. In contrast, sex, spleen and liver size, and percentage blast cells were not found to be significant. Multivariate analysis, using Cox's regression, revealed karyotype, haemoglobin concentration, platelet and leucocyte counts to retain their unfavourable prognostic significance. A simple and useful schema for predicting survival in idiopathic myelofibrosis has been produced by combining age, haemoglobin concentration and karyotype with median survival times varying from 180 months (good-risk group) to 16 months (poor-risk group).

Over-expression of Eph and ephrin genes in advanced ovarian cancer: ephrin gene expression correlates with shortened survival

Directory of Open Access Journals (Sweden)

Lincoln Douglas

2006-06-01

Full Text Available Abstract Background Increased expression of Eph receptor tyrosine kinases and their ephrin ligands has been implicated in tumor progression in a number of malignancies. This report describes aberrant expression of these genes in ovarian cancer, the commonest cause of death amongst gynaecological malignancies. Methods Eph and ephrin expression was determined using quantitative real time RT-PCR. Correlation of gene expression was measured using Spearman's rho statistic. Survival was analysed using log-rank analysis and (was visualised by Kaplan-Meier survival curves. Results Greater than 10 fold over-expression of EphA1 and a more modest over-expression of EphA2 were observed in partially overlapping subsets of tumors. Over-expression of EphA1 strongly correlated (r = 0.801; p Conclusion These data imply that increased levels of ephrins A1 and A5 in the presence of high expression of Ephs A1 and A2 lead to a more aggressive tumor phenotype. The known functions of Eph/ephrin signalling in cell de-adhesion and movement may explain the observed correlation of ephrin expression with poor prognosis.

Access, Rank, and Select in Grammar-compressed Strings

DEFF Research Database (Denmark)

Belazzougui, Djamal; Cording, Patrick Hagge; Puglisi, Simon J.

2015-01-01

Given a string S of length N on a fixed alphabet of σ symbols, a grammar compressor produces a context-free grammar G of size n that generates S and only S. In this paper we describe data structures to support the following operations on a grammar-compressed string: access(S,i,j) (return substring...... consecutive symbols from S. Alternatively, we can achieve \\O(logτN+m/logσN) query time using \\O(nτlogτ(N/n)logN) bits of space, matching a lower bound stated by Verbin and Yu for strings where N is polynomially related to n when τ = log ε N. For rank and select we describe data structures of size \\O...

Test Scores, Class Rank and College Performance: Lessons for Broadening Access and Promoting Success.

Science.gov (United States)

Niu, Sunny X; Tienda, Marta

2012-04-01

Using administrative data for five Texas universities that differ in selectivity, this study evaluates the relative influence of two key indicators for college success-high school class rank and standardized tests. Empirical results show that class rank is the superior predictor of college performance and that test score advantages do not insulate lower ranked students from academic underperformance. Using the UT-Austin campus as a test case, we conduct a simulation to evaluate the consequences of capping students admitted automatically using both achievement metrics. We find that using class rank to cap the number of students eligible for automatic admission would have roughly uniform impacts across high schools, but imposing a minimum test score threshold on all students would have highly unequal consequences by greatly reduce the admission eligibility of the highest performing students who attend poor high schools while not jeopardizing admissibility of students who attend affluent high schools. We discuss the implications of the Texas admissions experiment for higher education in Europe.

Fatores prognósticos no carcinoma espinocelular de cavidade oral Prognostic factors in squamous cell carcinoma of the oral cavity

Directory of Open Access Journals (Sweden)

José Raphael de Moura Campos Montoro

2008-12-01

Full Text Available Devido à incerteza da evolução do câncer oral é que os pesquisadores procuram fatores que possam influenciar no prognóstico. OBJETIVO: Avaliar em pacientes com carcinoma espinocelular de cavidade oral variáveis que possam influenciar no tempo de sobrevida. MATERIAIS E MÉTODOS: Analisados dados de 45 pacientes no período de Janeiro de 2001 a Janeiro de 2006. As curvas de sobrevida foram estimadas pelo método de Kaplan-Meier e para compará-las os testes de log-rank e o modelo de regressão de Cox. Desenho do Estudo: Análise retrospectiva. RESULTADOS: A sobrevida global foi de 39% em 5 anos. Apenas as variáveis, metástase cervical (p=0,017, radioterapia pós-operatória (p=0,056 e margens comprometidas (p=0,004 tiveram significância estatística. A sobrevida foi menor em pacientes: com metástase cervical; com margens comprometidas e os submetidos à radioterapia pós-operatória, ou seja, nos tumores mais agressivos. Após ajustamento, a radioterapia não mostrou significância estatística. Provavelmente a sobrevida de 39% seja pelo elevado número de pacientes com metástase (52,2% e pelo fato da amostra ser basicamente de cânceres de língua e assoalho (82%, os de controle mais difícil. CONCLUSÃO: A metástase cervical e o comprometimento das margens cirúrgicas são os fatores prognósticos no carcinoma de cavidade oral que influenciaram na sobrevida.Researchers have been looking for factors that can influence the prognosis of oral cancer, because its outcome is highly uncertain. AIM: To evaluate variables that can impact the survival rate of patients with squamous-cell carcinoma of the oral cavity. MATERIAL AND METHODS: Data analysis of 45 patients from January, 2001 to January, 2006. Survival rate curves have been estimated using the Kaplan-Meier method and they have been compared through the log-rank test and the Cox regression standard. Study design: Retrospective analysis. RESULTS: Total five-year survival rate was of 39

Temozolomide during radiotherapy of glioblastoma multiforme. Daily administration improves survival

Energy Technology Data Exchange (ETDEWEB)

Nachbichler, Silke Birgit; Schupp, Gabi; Ballhausen, Hendrik; Niyazi, Maximilian; Belka, Claus [LMU Munich, Department of Radiation Oncology, Munich (Germany)

2017-11-15

Temozolomide-(TMZ)-based chemoradiotherapy defines the current gold standard for the treatment of newly diagnosed glioblastoma. Data regarding the influence of TMZ dose density during chemoradiotherapy are currently not available. We retrospectively compared outcomes in patients receiving no TMZ, TMZ during radiotherapy on radiotherapy days only, and TMZ constantly 7 days a week. From 2002-2012, a total of 432 patients with newly diagnosed glioblastoma received radiotherapy in our department: 118 patients had radiotherapy alone, 210 had chemoradiotherapy with TMZ (75 mg/m{sup 2}) daily (7/7), and 104 with TMZ only on radiotherapy days (5/7). Radiotherapy was applied to a total dose of 60 Gy. Median survival after radiotherapy alone was 9.1 months, compared to 12.6 months with 5/7-TMZ and to 15.7 months with 7/7-TMZ. The 1-year survival rates were 33, 52, and 64%, respectively. Kaplan-Meier analysis showed a significant improvement of TMZ-7/7 vs. 5/7 (p = 0.01 by the log-rank test), while 5/7-TMZ was still superior to no TMZ at all (p = 0.02). Multivariate Cox regression showed a significant influence of TMZ regimen (p = 0.009) on hazard rate (+58% between groups) even in the presence of confounding factors age, sex, resection status, and radiotherapy dose concept. Our results confirm the findings of the EORTC/NCIC trial. It seems that also a reduced TMZ scheme can at first prolong the survival of glioblastoma patients, but not as much as the daily administration. (orig.) [German] Eine Temozolomid-(TMZ-)basierte Radiochemotherapie ist der gegenwaertige Goldstandard in der Behandlung von neu diagnostizierten Glioblastomen. Daten bezueglich des Einflusses der TMZ-Dosisdichte waehrend der Radiochemotherapie sind derzeit nicht vorhanden. Wir haben retrospektiv die Ergebnisse von Patienten verglichen, die entweder kein TMZ, TMZ zur Strahlentherapie nur an Bestrahlungstagen oder TMZ konstant 7 Tage/Woche erhalten hatten. Von 2002-2012 bekamen insgesamt 432 Patienten mit

Small cell lung cancer with and without superior vena cava syndrome: a multivariate analysis of prognostic factors in 408 cases

International Nuclear Information System (INIS)

Wuerschmidt, Florian; Buenemann, Henry; Heilmann, Hans-Peter

1995-01-01

Purpose: Patients with small cell lung cancer (SCLC) and superior vena cava syndrome (SVCS) are widely believed to have a grave prognosis. The purpose of this study was to determine the prognosis of patients with SCLC and SVCS as compared to SCLC without SVCS. Methods and Materials: A retrospective analysis of 408 cases of SCLC ± SVCS was performed. Three-hundred and sixty showed no clinical signs of SVCS and 43 (11%) had SVCS; in 5 patients no adequate information was available about clinical signs of SVCS. All patients were classified as limited disease cases. About 98% received chemotherapy usually as the first treatment followed by radiotherapy. A median total dose of 46 Gy (range 30 to 70 Gy) was given at 2.0 Gy per fraction five times weekly. A prophylactic cranial irradiation was applied if a complete remission was achieved after chemotherapy or after 30 Gy of irradiation. Kaplan-Meier survival curves are shown and comparisons were made by the log-rank and the Gehan/Wilcoxon test. To adjust for prognostic factors, a proportional hazards analysis was done. Results: Patients without SVCS had 5-year survival rates (± SE) and a median survival time (MST; 95% confidence intervals) of 11% ± 2% and 13.7 months (12.7-14.5) in UICC Stage I to III; in Stage III the figures were 9% ± 2% and 12.6 months (11.2-13.7). In comparison, SCLC with SVCS had 5-year survival rates of 15% ± 7% and MST of 16.1 months (13.8-20.5). The difference was significant in univariate analysis (Stage III disease: p 0.008 by the log-rank test). In a multivariate analysis of all patients, Stage (Stage I + II > III; p = 0.0003), SVCS (yes > no; p = 0.005), and Karnofsky performance status (≤ 70 < 80-100%; p = 0.008) were of significant importance. Conclusions: SVCS is a favorable prognostic sign in SCLC. The treatment should be curatively intended

Technique-associated outcomes in horses following large colon resection.

Science.gov (United States)

Pezzanite, Lynn M; Hackett, Eileen S

2017-11-01

To compare survival and complications in horses undergoing large colon resection with either sutured end-to-end or stapled functional end-to-end anastomoses. Retrospective cohort study. Twenty-six client-owned horses with gastrointestinal disease. Retrospective data were retrieved from the medical records of 26 horses undergoing colectomy, including 14 horses with sutured end-to-end and 12 horses with stapled functional end-to-end anastomoses, between 2003 and 2016. Records were evaluated for signalment, medical and surgical treatments, and survival to hospital discharge. Long-term follow-up was obtained through owner contact. Continuous variables were compared with Mann-Whitney tests. Fisher's exact testing was used to compare survival to hospital discharge. Survival time was compared by constructing Kaplan-Meier survival curves and performing log-rank curve comparison testing. Mean age of horses undergoing colectomy was 13 years. Reason for colectomy was prophylaxis (12) or salvage (14). Mean surgical time was 169 minutes. Mean hospitalization time was 9 days, which did not differ with anastomosis type (P = .62). Nine of 12 horses undergoing stapled functional end-to-end anastomosis and 12 of 14 horses undergoing sutured end-to-end anastomosis survived to hospital discharge (P = .63). Survival time did not differ with anastomosis technique (P = .35). Short- and long-term survival outcomes are not different between sutured end-to-end or stapled functional end-to-end anastomoses in horses undergoing colectomy. © 2017 The American College of Veterinary Surgeons.

Feasibility and safety of extended adjuvant temozolomide beyond six cycles for patients with glioblastoma.

Science.gov (United States)

Hsieh, S Yp; Chan, D Tm; Kam, M Km; Loong, H Hf; Tsang, W K; Poon, D Mc; Ng, S Cp; Poon, W S

2017-12-01

Temozolomide is the first chemotherapeutic agent proven effective for patients with newly diagnosed glioblastoma. The drug is well tolerated for its low toxicity. The current standard practice is concomitant chemoradiotherapy for 6 weeks followed by 6 cycles of adjuvant temozolomide. Some Caucasian studies have suggested that patients might benefit from extended adjuvant cycles of temozolomide (>6 cycles) to lengthen both progression-free survival and overall survival. In the present study, we compared differences in survival and toxicity profile between patients who received conventional 6-cycle temozolomide and those who received more than 6 cycles of temozolomide. Patients with newly diagnosed glioblastoma without progressive disease and completed concomitant chemoradiotherapy during a 4-year period were studied. Progression-free survival was compared using Kaplan-Meier survival curves. t Test, U test, and correlation were chosen accordingly to examine the impact of age, extent of resection, MGMT promoter methylation status and adjuvant cycles on progression-free survival. For factors with a P value of cycles of temozolomide (n=7) and 43.4 months for those who received more than 6 cycles (n=7) [P=0.007, log-rank test]. Two patients in the former group and one in the latter group encountered grade 1 toxicity and recovered following dose adjustment. Cycles of adjuvant temozolomide were correlated with progression-free survival (P=0.016, hazard ratio=0.68). Extended cycles of temozolomide are safe and feasible for Chinese patients with disease responsive to temozolomide.

Irritancy ranking of anionic detergents using one-time occlusive, repeated occlusive and repeated open tests

NARCIS (Netherlands)

Tupker, RA; Bunte, EE; Fidler, [No Value; Wiechers, JW; Coenraads, PJ

Discrepancies between the one-time patch test and the wash test regarding the ranking of irritancy of detergents have been found in the literature. The aim of the present study was to investigate the concordance of irritancy rank order of 4 anionic detergents tested by 3 different exposure methods,

Pearson's chi-square test and rank correlation inferences for clustered data.

Science.gov (United States)

Shih, Joanna H; Fay, Michael P

2017-09-01

Pearson's chi-square test has been widely used in testing for association between two categorical responses. Spearman rank correlation and Kendall's tau are often used for measuring and testing association between two continuous or ordered categorical responses. However, the established statistical properties of these tests are only valid when each pair of responses are independent, where each sampling unit has only one pair of responses. When each sampling unit consists of a cluster of paired responses, the assumption of independent pairs is violated. In this article, we apply the within-cluster resampling technique to U-statistics to form new tests and rank-based correlation estimators for possibly tied clustered data. We develop large sample properties of the new proposed tests and estimators and evaluate their performance by simulations. The proposed methods are applied to a data set collected from a PET/CT imaging study for illustration. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Competency-based residency training and the web log: modeling practice-based learning and enhancing medical knowledge

Directory of Open Access Journals (Sweden)

Matthew F. Hollon

2015-12-01

Full Text Available Background: By using web-based tools in medical education, there are opportunities to innovatively teach important principles from the general competencies of graduate medical education. Objectives: Postulating that faculty transparency in learning from uncertainties in clinical work could help residents to incorporate the principles of practice-based learning and improvement (PBLI in their professional development, faculty in this community-based residency program modeled the steps of PBLI on a weekly basis through the use of a web log. Method: The program confidentially surveyed residents before and after this project about actions consistent with PBLI and knowledge acquired through reading the web log. Results: The frequency that residents encountered clinical situations where they felt uncertain declined over the course of the 24 weeks of the project from a mean frequency of uncertainty of 36% to 28% (Wilcoxon signed rank test, p=0.008; however, the frequency with which residents sought answers when faced with uncertainty did not change (Wilcoxon signed rank test, p=0.39, remaining high at approximately 80%. Residents answered a mean of 52% of knowledge questions correct when tested prior to faculty posts to the blog, rising to a mean of 65% of questions correct when tested at the end of the project (paired t-test, p=0.001. Conclusions: Faculty role modeling of PBLI behaviors and posting clinical questions and answers to a web log led to modest improvements in medical knowledge but did not alter behavior that was already taking place frequently among residents.

Ambulation and survival following surgery in elderly patients with metastatic epidural spinal cord compression.

Science.gov (United States)

Itshayek, Eyal; Candanedo, Carlos; Fraifeld, Shifra; Hasharoni, Amir; Kaplan, Leon; Schroeder, Josh E; Cohen, José E

2017-12-28

Metastatic epidural spinal cord compression (MESCC) is a disabling consequence of disease progression. Surgery can restore/preserve physical function, improving access to treatments that increase duration of survival; however, advanced patient age may deter oncologists and surgeons from considering surgical management. Evaluate the duration of ambulation and survival in elderly patients following surgical decompression of MESCC. Retrospective file review of a prospective database, under IRB waiver of informed consent, of consecutive patients treated in an academic tertiary care medical center from 8/2008-3/2015. Patients ≥65 years presenting neurological and/or radiological signs of cord compression due to metastatic disease, who underwent surgical decompression. Duration of ambulation and survival. Patients underwent urgent multidisciplinary evaluation and surgery. Ambulation and survival were compared with age, pre- and postoperative neurological (American Spinal Injury Association [ASIA] Impairment Scale [AIS]) and performance status (Karnofsky Performance Status [KPS], and Tokuhashi Score using Kruskal-Wallis and Wilcoxon signed-rank tests, Pearson correlation coefficient, Cox regression model, log rank analysis, and Kaplan Meir analysis. 40 patients were included (21 male, 54%; mean age 74 years, range 65-87). Surgery was performed a mean 3.8 days after onset of motor symptoms. Mean duration of ambulation and survival were 474 (range 0-1662) and 525 days (range 11-1662), respectively; 53% of patients (21/40) survived and 43% (17/40) retained ambulation for ≥1 year. There was no significant relationship between survival and ambulation for patients aged 65-69, 70-79, or 80-89, although Kaplan Meier analysis suggested stratification. There was a significant relationship between duration of ambulation and pre- and postoperative AIS (p=0.0342, p=0.0358, respectively) and postoperative KPS (p=0.0221). Tokuhashi score was not significantly related to duration of

Another Argument in Favour of Wilcoxon's Signed Rank Test

OpenAIRE

Rosenblatt, Jonathan; Benjamini, Yoav

2013-01-01

The Wilcoxon Signed Rank test is typically called upon when testing whether a symmetric distribution has a specified centre and the Gaussianity is in question. As with all insurance policies it comes with a cost, even if small, in terms of power versus a t-test, when the distribution is indeed Gaussian. In this note we further show that even when the distribution tested is Gaussian there need not be power loss at all, if the alternative is of a mixture type rather than a shift. The signed ran...

Evaluation of Hydraulic Loads on the Runner Blades of a Kaplan Turbine using CFD Simulation and Model Test

Directory of Open Access Journals (Sweden)

Zoltan-Iosif Korka

2016-10-01

Full Text Available CFD (Computational Fluid Dynamic is today a standard procedure for analyzing and simulating the flow through several hydraulic machines. In this process, the fluid flow domain is divided into small volumes where the governing equations are converted into algebraic ones, which are numerically solved. Computational results strongly depend on the applied mathematical model and on the numerical methods used for converting the governing equations into the algebraic ones. The goal of the paper is to evaluate, by numerical simulation, the hydraulic loads (forces and torques on the runner blades of an existent Kaplan turbine and to compare them with the experimental results obtained from model test.

La chiesa di Richard Meier a Tor Tre Teste e il suo contributo al consolidamento identitario dei nuovi quartieri romani oltre il GRA / The church designed by Richard Meier in Tor Tre Teste and the identity consolidation in the new roman neighbourhoods beyond the Great Circular Road

Directory of Open Access Journals (Sweden)

Giuseppe Bonaccorso

2014-06-01

Full Text Available Il contributo proposto ha l’obiettivo di analizzare alcuni significativi brani del tessuto urbano della periferia est di Roma, adottando metodi interpretativi legati alla storia, alla società, alla programmazione urbanistica e alla costruzione. Gli aspetti salienti del quadrante orientale della periferia romana verranno così delineati partendo “dal di dentro”, sottolineandone i percorsi, gli spazi e i nuclei compositivi che sono all’origine della struttura e della forma stessa dei quartieri disposti a cavallo del Grande Raccordo Anulare. In questo ambito, si pone l’attenzione su alcuni episodi chiave che vedono protagoniste le nuove chiese che riescono a creare una centralità all’interno dei quartieri periferici sostituendo le biblioteche, le piazze e i centri commerciali.  Analizzando da vicino questi esempi, si scopre come di recente sono state realizzate chiese firmate da architetti di fama internazionale proprio allo scopo di rafforzare, o meglio di costruire, un fattore identitario per ciascun quartiere ubicato nel settore orientale della città. Partendo quindi dal generale si arriva a indagare una chiesa e un quartiere che possono essere considerati un modello da seguire per tutta la periferia a ridosso del GRA: la chiesa giubilare di Dio Padre Misericordioso progettata da Richard Meier nel quartiere di Tor Tre Teste. La sequenzialità degli eventi che hanno contraddistinto il concorso per la progettazione della chiesa, la scelta della proposta di Richard Meier, la complessità del cantiere, l’analisi tecnica, stilistica e simbolica della realizzazione finale sono quindi analizzate nell’ambito del rapporto con il quartiere e del tentativo di realizzare (attraverso di essa un centro di attrazione per tutta la periferia.   The article analyses some significant parts of the urban tissue at the eastern periphery of Rome, using the interpretative methods inherent to history, society, urban programming and construction

Challenges in risk estimation using routinely collected clinical data: The example of estimating cervical cancer risks from electronic health-records.

Science.gov (United States)

Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A

2018-06-01

Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Polymorphous low-grade adenocarcinoma: A Danish national study

DEFF Research Database (Denmark)

Elhakim, Mohammad Talal; Breinholt, Helle; Godballe, Christian

2016-01-01

. Histological slides were reviewed and data concerning demographics, tumour site, clinical stage, treatment profiles and follow-up were retrieved. Survival estimates and prognostic factors were evaluated by comparing Kaplan–Meier plots using the Mantel–Haenszel log-rank test. Results Of the 73 patients, 47 (64......%) were female. Median age was 58 years. The most common location was the palate (73%). Median latency was five months. Recurrence was seen in 13% of patients. Overall survival (OS), disease-specific survival (DSS) and recurrence-free survival (RFS) rates after 10 years were 73%, 99% and 83%, respectively...

Meier-Gorlin syndrome Clinical genetics and genomics

OpenAIRE

Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie

2015-01-01

textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...

Fatores de risco de recidiva de lesões intra-epiteliais cervicais após conização por cirurgia de alta freqüência em mulheres portadoras e não portadoras do vírus da imunodeficiência humana Risk factors for cervical intraepithelial lesions after loop electrosurgical excision procedure in HIV-infected and non-infected women

Directory of Open Access Journals (Sweden)

Maria Inês de Miranda Lima

2006-09-01

Full Text Available OBJETIVOS: avaliar os fatores de risco associados à recidiva das lesões intra-epiteliais, após conização do colo com cirurgia de alta freqüência. MÉTODOS: estudo caso-controle aninhado em coorte de 201 pacientes que se submeteram à conização com cirurgia de alta freqüência por apresentarem lesão intra-epitelial cervical, acompanhadas, em média, por dois anos. Participaram 94 portadoras do HIV e 107 não-portadoras do vírus. A conização cervical foi realizada por cirurgia de alta freqüência e a peça cirúrgica encaminhada para exame histopatológico, que avaliou o grau da lesão, as margens e a ocupação glandular. Após a cirurgia, as pacientes foram examinadas a cada seis meses com citologia oncótica e colposcopia. Foram consideradas recidivas as lesões que, após a cirurgia, foram confirmadas novamente por biópsia. Neste estudo, foram considerados casos as pacientes com recidiva e controles as sem recidiva. As comparações entre os grupos foram realizadas pelo teste do chi2 e a análise multivariada pela regressão logística. Para a análise de sobrevida foi utilizado o método de Kaplan-Meier (teste log-rank. RESULTADOS: houve recidiva das lesões em 40 pacientes. As variáveis que inicialmente apresentaram significância estatística foram: número de parceiros, soropositividade, margens do cone e envolvimento glandular, como indicadores do risco para recidiva. A ocorrência simultânea de ocupação glandular e margens comprometidas apresentou as recidivas mais freqüentes. Após análise pela regressão logística, permaneceram significativamente associados à recorrência das lesões: ocupação glandular (OR=9,1; IC a 95%:13,0-27,5; presença do HIV (OR=4,6; IC a 95%:1,1-6,3; margens comprometidas (OR-2,6; IC a 95%:1,9-11,2. CONCLUSÕES: os fatores de risco associados à recidiva das lesões intra-epiteliais cervicais foram: soropositividade, ocupação glandular e margens comprometidas.PURPOSE: to evaluate

Testing compression strength of wood logs by drilling resistance

Science.gov (United States)

Kalny, Gerda; Rados, Kristijan; Rauch, Hans Peter

2017-04-01

Soil bioengineering is a construction technique using biological components for hydraulic and civil engineering solutions, based on the application of living plants and other auxiliary materials including among others log wood. Considering the reliability of the construction it is important to know about the durability and the degradation process of the wooden logs to estimate and retain the integral performance of a soil bioengineering system. An important performance indicator is the compression strength, but this parameter is not easy to examine by non-destructive methods. The Rinntech Resistograph is an instrument to measure the drilling resistance by a 3 mm wide needle in a wooden log. It is a quasi-non-destructive method as the remaining hole has no weakening effects to the wood. This is an easy procedure but result in values, hard to interpret. To assign drilling resistance values to specific compression strengths, wooden specimens were tested in an experiment and analysed with the Resistograph. Afterwards compression tests were done at the same specimens. This should allow an easier interpretation of drilling resistance curves in future. For detailed analyses specimens were investigated by means of branch inclusions, cracks and distances between annual rings. Wood specimens are tested perpendicular to the grain. First results show a correlation between drilling resistance and compression strength by using the mean drilling resistance, average width of the annual rings and the mean range of the minima and maxima values as factors for the drilling resistance. The extended limit of proportionality, the offset yield strength and the maximum strength were taken as parameters for compression strength. Further investigations at a second point in time strengthen these results.

A Comparative Study of Survival Rate in High Grade Glioma Tumors Being Treated by Radiotherapy Alone Versus Chemoradiation With Nitrosourea.

Science.gov (United States)

Houshyari, Mohammad; Hajalikhani, Farzaneh; Rakhsha, Afshin; Hajian, Parastoo

2015-03-25

In adults, malignant glioma (high-grade glioma) is one of the most common brain tumors. In spite of different types of treatment, the outcome is still not likely to be favorable. The aim of this study was to determine the difference between survival rate in adult patients with high grade glioma treated by radiotherapy only and those treated by a combination of radiotherapy and nitrosurea-based chemotherapy. This study was conducted using the records of 48 patients with grade 3 or 4 of glial brain tumor referred to the radiation-oncology ward of Shohada-e-Tajrish Hospital in Tehran, Iran from 2005 to 2012. The patients had undergone radiotherapy alone or adjuvant chemoradiation with nitrosourea. The median survival of patients after receiving the different types of treatment were evaluated using the Kaplan-Meier method and the log -rank exam. Data were analyzed using univariate analysis for median survival regarding to the patients' age, gender, extent of surgery, Karnofsky performance status (KPS) with the Kaplan-Meier method, and the log-rank exam. We used the Cox-model for multivariate analysis. Records of 48 patients were studied (34 men and 14 women). The mean survival were 18 months for men and 15.2 months for women (P=0.05). Around 58% (28 patients) were more than 50 years old, and 42% (20 patients) were less than 50, and mean survival for the two age groups were 13 and 20 months, respectively (P<0.001). Then, the patients were divided into three groups according to the extent of surgery, i.e., excisional biopsy (11 patients), stereotactic biopsy (22 patients), and resection (15 patients), and the mean survival for the three groups were 14.7, 17.3, and 18.8 months, respectively. There was no significant statistical difference for mean survival between the three groups (P=0.23). The KPS was greater than 70% in 23 patients and less than 70% in 21 patients, and the mean survival for the former and latter groups were 17.6 and 16 months, respectively (P=0

Numerical simulation of turbulence flow in a Kaplan turbine -Evaluation on turbine performance prediction accuracy-

International Nuclear Information System (INIS)

Ko, P; Kurosawa, S

2014-01-01

The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine

Numerical simulation of turbulence flow in a Kaplan turbine -Evaluation on turbine performance prediction accuracy-

Science.gov (United States)

Ko, P.; Kurosawa, S.

2014-03-01

The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine.

Bias and precision of methods for estimating the difference in restricted mean survival time from an individual patient data meta-analysis

Directory of Open Access Journals (Sweden)

Béranger Lueza

2016-03-01

Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect

Improved analysis of bacterial CGH data beyond the log-ratio paradigm

Directory of Open Access Journals (Sweden)

Aakra Ågot

2009-03-01

Full Text Available Abstract Background Existing methods for analyzing bacterial CGH data from two-color arrays are based on log-ratios only, a paradigm inherited from expression studies. We propose an alternative approach, where microarray signals are used in a different way and sequence identity is predicted using a supervised learning approach. Results A data set containing 32 hybridizations of sequenced versus sequenced genomes have been used to test and compare methods. A ROC-analysis has been performed to illustrate the ability to rank probes with respect to Present/Absent calls. Classification into Present and Absent is compared with that of a gaussian mixture model. Conclusion The results indicate our proposed method is an improvement of existing methods with respect to ranking and classification of probes, especially for multi-genome arrays.

Well-logging method using well-logging tools run through a drill stem test string for determining in-situ change in formation water saturation values

International Nuclear Information System (INIS)

Fertl, W.H.

1975-01-01

A logging tool (pulsed neutron or neutron-gamma ray) whose response indicates formation water saturation value, is run through an opening extending through a portion of a drill stem test string. A sample portion of the formation fluid in the zone of interest is removed and another logging run is made. The differences between the plots of the two logging runs indicate the formation potential productivity in the zone of interest

High mortality risk among individuals assumed to be TB-negative can be predicted using a simple test

DEFF Research Database (Denmark)

Rabna, Paulo; Andersen, Andreas; Wejse, Christian

2009-01-01

1007 aTBneg individuals who were enrolled from 2004 to 2006; 4983 age-matched controls were followed for comparison. Plasma suPAR levels were measured using the suPARnostic ELISA. Survival was analysed using Cox regression, ROC curves and Kaplan-Meier analysis. RESULTS: After 3 months of follow......-up, mortality was 21 per 100 person-year-observation (PYO) among aTBneg individuals and three per 100 PYO among the control population [mortality rate ratio (MRR) = 6.92 (95% CI 4.48-10.7)]. SuPAR values ranged between 0.9 and 45 ng/ml in aTBneg individuals. A log-linear relationship was found between su......PAR levels linear range, a 1 ng/ml increase was associated with a 46% increase in the mortality rate: MRR = 1.46 (95% CI 1.34-1.59). The area under the ROC curves was 0.88 for HIV-positive individuals and 0.79 for HIV-negative individuals. CONCLUSIONS: Our study showed...

Water hammer 2 phase analysis hydraulic system with a Kaplan turbine

OpenAIRE

Dudlik, A.; Koutnik, J.

2009-01-01

This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...

Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

Science.gov (United States)

Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan

2009-01-01

Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differences were tested using the Log-rank test. Results Fifteen (16%) pathogenic mutations (12 in BRCA1 and 3 in BRCA2), of which six were novel BRCA1 mutations were identified. None of the cases showed CHEK2*1100delC mutation. Many reported polymorphisms in the exonic and intronic regions of BRCA1 and BRCA2 were also seen. The mutation status and the polymorphisms were analyzed for association with the clinico-pathological features like age, stage, grade, histology, disease status, survival (overall and disease free) and with prognostic molecular markers (ER, PR, c-erbB2 and p53). Conclusion The stage of the disease at diagnosis was the only statistically significant (p < 0.0035) prognostic parameter. The mutation frequency and the polymorphisms were similar to reports on other ethnic populations. The lack of association between the clinico-pathological variables, mutation status and the disease status is likely to be due to the small numbers. PMID:19656415

Impact of UCSF criteria according to pre- and post-OLT tumor features: analysis of 479 patients listed for HCC with a short waiting time.

Science.gov (United States)

Decaens, Thomas; Roudot-Thoraval, Françoise; Hadni-Bresson, Solange; Meyer, Carole; Gugenheim, Jean; Durand, Francois; Bernard, Pierre-Henri; Boillot, Olivier; Sulpice, Laurent; Calmus, Yvon; Hardwigsen, Jean; Ducerf, Christian; Pageaux, Georges-Philippe; Dharancy, Sebastien; Chazouilleres, Olivier; Cherqui, Daniel; Duvoux, Christophe

2006-12-01

Orthotopic liver transplantation (OLT) indication for hepatocellular carcinoma (HCC) is currently based on the Milan criteria. The University of California, San Francisco (UCSF) recently proposed an expansion of the selection criteria according to tumors characteristics on the explanted liver. This study: 1) assessed the validity of these criteria in an independent large series and 2) tested for the usefulness of these criteria when applied to pre-OLT tumor evaluation. Between 1985 and 1998, 479 patients were listed for liver transplantation (LT) for HCC and 467 were transplanted. According to pre-OLT (imaging at date of listing) or post-OLT (explanted liver) tumor characteristics, patients were retrospectively classified according to both the Milan and UCSF criteria. The 5-yr survival statistics were assessed by the Kaplan-Meier method and compared by the log-rank test. Pre-OLT UCSF criteria were analyzed according to an intention-to-treat principle. Based on the pre-OLT evaluation, 279 patients were Milan+, 44 patients were UCSF+ but Milan- (subgroup of patients that might benefit from the expansion), and 145 patients were UCSF- and Milan-. With a short median waiting time of 4 months, 5-yr survival was 60.1 +/- 3.0%, 45.6 +/- 7.8%, and 34.7 +/- 4.0%, respectively (P OLT evaluation, the UCSF criteria are associated with a 5-yr survival below 50%. Their applicability is therefore limited, despite similar survival rates compared to the Milan criteria, when the explanted liver is taken into account.

Prevalence and outcomes of heart transplantation in children with intellectual disability.

Science.gov (United States)

Wightman, Aaron; Bartlett, Heather L; Zhao, Qianqian; Smith, Jodi M

2017-03-01

Heart transplantation in children with intellectual disability is a controversial issue. We sought to describe the prevalence and outcomes of heart transplantation in children with intellectual disability and hypothesized that recipients with intellectual disability have comparable short-term outcomes compared to recipients without intellectual disability. We performed a retrospective cohort analysis of children receiving a first heart-alone transplant in the UNOS STAR database from 2008 to 2013. Recipients with intellectual disability were compared to those without using chi-square tests. Kaplan-Meier curves were constructed for patient and graft survival. Cox proportional hazard models were used to estimate the association between intellectual disability and graft failure and patient survival. Over the study period, 107 children with intellectual disability underwent initial heart transplantation, accounting for 8.9% of first pediatric heart transplants (total=1204). There was no difference in the incidence of acute rejection between groups in the first year after transplant. Mean functional status scores at follow-up improved in both groups after transplantation, but tended to be lower among children with intellectual disability than children without. Log-rank tests did not suggest significant differences in graft survival between those with and without intellectual disability during the first 4 years following transplantation. Children with intellectual disability constitute a significant portion of total heart transplants with short-term outcomes comparable to children without intellectual disability. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effect of Chinese herbal medicine on stroke patients with type 2 diabetes.

Science.gov (United States)

Tsai, Fuu-Jen; Ho, Tsung-Jung; Cheng, Chi-Fung; Liu, Xiang; Tsang, Hsinyi; Lin, Ting-Hsu; Liao, Chiu-Chu; Huang, Shao-Mei; Li, Ju-Pi; Lin, Cheng-Wen; Lin, Jaung-Geng; Lin, Jung-Chun; Lin, Chih-Chien; Liang, Wen-Miin; Lin, Ying-Ju

2017-03-22

Complications of type 2 diabetes (T2D) include stroke, which is a cerebrovascular disturbance characterized by reduced blood flow in the brain, leading to death or physical disability. Chinese herbal medicine (CHM) has been widely used in ancient China for the treatment of diabetes and stroke by supplementing Qi and activating blood circulation. This study aimed to investigate the frequencies and patterns of CHM treatment for stroke patients with T2D and the outcomes of long-term use in Taiwan. We identified 3079 stroke patients (ICD-9-CM: 430-438) with T2D. We allocated 618 stroke patients, matched for age, gender, and T2D-to-stroke duration, to both CHM and non-CHM groups. Chi-square test, conditional multivariable logistic regression, Kaplan-Meier method, and the log-rank test were used in this study. The CHM group was characterized by more cases of chronic obstructive pulmonary disease, ulcer disease, hyperlipidemia, tobacco use, and higher income. The cumulative survival probability was higher in the CHM group (Pherbs, respectively. The use of CHM as adjunctive therapy may improve the overall survival (OS) of stroke patients with T2D. The list of the comprehensive herbal medicines that they used might be useful in future large-scale, randomized clinical investigations of agent effectiveness, safety, and potential interactions with conventional treatments in stroke patients with T2D. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

Characteristics of Chinese herbal medicine usage and its effect on survival of lung cancer patients in Taiwan.

Science.gov (United States)

Li, Te-Mao; Yu, Yang-Hao; Tsai, Fuu-Jen; Cheng, Chi-Fung; Wu, Yang-Chang; Ho, Tsung-Jung; Liu, Xiang; Tsang, Hsinyi; Lin, Ting-Hsu; Liao, Chiu-Chu; Huang, Shao-Mei; Li, Ju-Pi; Lin, Jung-Chun; Lin, Chih-Chien; Liang, Wen-Miin; Lin, Ying-Ju

2018-03-01

In Taiwan, lung cancer remains one of the deadliest cancers. Survival of lung cancer patients remains low, ranging from 6% to 18%. Studies have shown that Chinese herbal medicine (CHM) can be used to induce cell apoptosis and exhibit anti-inflammatoryanti-inflammatory activities in cancer cells. This study aimed to investigate the frequencies and patterns of CHM treatment for lung cancer patients and the effect of CHM on their survival probability in Taiwan. We identified 6939 lung cancer patients (ICD-9-CM: 162). We allocated 264 CHM users and 528 CHM-non users, matched for age, gender, duration, and regular treatment. Chi-square test, conditional multivariable logistic regression, Kaplan-Meier method, and the log-rank test were used in this study. The CHM group was characterized by a longer follow up time and more cases of hyperlipidemia and liver cirrhosis. This group exhibited a lower mortality hazard ratio (0.48, 95% confidence interval [0.39-0.61], p herbs, respectively. Among them, BM was the core CHM of the major cluster, and Jie-Geng (JG) and Mai-Men-Dong-Tang (MMDT) were important CHMs by CHM network analysis. The use of CHM as an adjunctive therapy may reduce the mortality hazard ratio of lung cancer patients. The investigation of their comprehensive CHM prescription patterns might be useful in future large-scale, randomized clinical investigations of agent effectiveness, safety, and potential interactions with conventional treatments for lung cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Microsatellite instability is associated with reduced disease specific survival in stage III colon cancer.

Science.gov (United States)

Mohan, H M; Ryan, E; Balasubramanian, I; Kennelly, R; Geraghty, R; Sclafani, F; Fennelly, D; McDermott, R; Ryan, E J; O'Donoghue, D; Hyland, J M P; Martin, S T; O'Connell, P R; Gibbons, D; Winter, Des; Sheahan, K

2016-11-01

Up to 15% of colorectal cancers exhibit microsatellite instability (MSI), where errors in replication go unchecked due to defects in the mismatch repair system. This study aimed to determine survival in a large single-centre series of 1250 consecutive colorectal cancers subjected to universal MSI testing. Clinical and pathological features of patients with colorectal cancer identified on prospectively maintained colorectal and pathology databases at St. Vincent's University Hospital from 2004 to May 2012 were examined. Mismatch repair (MMR) status was determined by immunohistochemistry. Kaplan-Meier curves, the log-rank test and Cox regression were used to associate survival with clinical and pathological characteristics. Of the 1250 colorectal cancers in the study period, 11% exhibited MSI (n = 138). Patients with MSI tumours had significantly lower rates of lymph node and distant metastases (MSI N+ rate: 24.8% compared with MSS N+ rate: 46.2%, p colon cancer. However, patients with Stage III MSI colon cancers had a worse DSS than those with MSS tumours. Stage III MSI tumours exhibited higher rates of lymphovascular invasion and perineural invasion than Stage I/II MSI tumours. MSI is associated with a reduced risk of nodal and distant metastases, with an improved DSS in Stage I/II colon cancer. However, when MSI tumours progress to Stage III these patients had worse outcomes and pathological features. New strategies for this cohort of patients may be required to improve outcomes. Copyright © 2016. Published by Elsevier Ltd.

Outcomes of direct pulp capping: interrogating an insurance database.

Science.gov (United States)

Raedel, M; Hartmann, A; Bohm, S; Konstantinidis, I; Priess, H W; Walter, M H

2016-11-01

To evaluate the effectiveness of direct pulp capping under general practice conditions. It was hypothesized that direct pulp capping is an effective procedure in the majority of cases and prevents the need for root canal treatment or extraction. Claims data were collected from the digital database of a major German national health insurance company. Only patients who had been insurance members for the entire 3 year period 2010 to 2012 were eligible. Kaplan-Meier survival analyses were conducted for all teeth with direct pulp capping. Success was defined as not undergoing root canal treatment. Survival was defined as not undergoing extraction. Differences between survival functions were tested with the log rank test. A total of 148 312 teeth were included. The overall success rate was 71.6% at 3 years. The overall survival rate was 95.9% at 3 years. The success rates for single-rooted teeth (71.8%) and multirooted teeth (71.5%) were similar although significantly different (P 85 years.). After direct pulp capping, more than two-thirds of the affected teeth did not undergo root canal treatment within 3 years. Although this study has the typical limits of a claims data analysis, it can be concluded that direct pulp capping is an effective intervention to avoid root canal treatment and extraction in a general practice setting. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Computer Aided Design of Kaplan Turbine Piston with SolidWorks

OpenAIRE

Camelia Jianu

2010-01-01

The paper presents the steps for 3D computer aided design (CAD) of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.

Prognostic value of stem cell quantification in stage II colon cancer.

Directory of Open Access Journals (Sweden)

Maria Angeles Vaz

Full Text Available BACKGROUND: Cancer stem cells (CSCs are a subset of tumor cells with capacity to self-renew and generate the diverse cells that make up the tumor. The aim of this study is to evaluate the prognostic value of CSCs in a highly homogeneous population of stage II colon cancer. METHODS: One hundred stage II colon cancer patients treated by the same surgical team between 1977 and 2005 were retrospectively analyzed. None of the patients received adjuvant chemotherapy. Inmunohistochemistry expression of CD133, NANOG and CK20 was scored, using four levels: 50% positivity. Kaplan-Meier analysis and log rank test were used to compare survival. RESULTS: The average patient age was 68 years (patients were between 45-92 years of age and median follow up was 5.8 years. There was recurrent disease in 17 (17%; CD133 expression (defined by >10% positivity was shown in 60% of the tumors, in 95% for NANOG and 78% for CK20. No correlation was found among expression levels of CD133, NANOG or CK20 and relapse-free survival (RFS or overall survival (OS. However, a statistical significant correlation was found between established pathological prognostic factors and RFS and OS. CONCLUSIONS: Stem Cell quantification defined by CD133 and NANOG expression has no correlation with RFS or OS in this cohort of Stage II colon cancer.

Different effects of ERβ and TROP2 expression in Chinese patients with early-stage colon cancer.

Science.gov (United States)

Fang, Yu-Jing; Wang, Guo-Qiang; Lu, Zhen-Hai; Zhang, Lin; Li, Ji-Bin; Wu, Xiao-Jun; Ding, Pei-Rong; Ou, Qing-Jian; Zhang, Mei-Fang; Jiang, Wu; Pan, Zhi-Zhong; Wan, De-Sen

2012-12-01

Estrogen receptor beta (ERβ) and TROP2 expressed in colon carcinoma and might play an important role there. We explored the relationship of ERβ and TROP2 expression with the prognosis of early-stage colon cancer. ERβ and TROP2 levels were assessed by immunohistochemistry in normal mucosa and tumoral tissues from 220 Chinese patients with T(3)N(0)M(0) (stage IIa) and T(4)N(0)M(0) (stage IIb) colon cancer in the Cancer Center, Sun Yat-sen University, who underwent curative surgical resection between 1995 and 2003. The Cox proportional hazards regression model was applied to analyze the overall survival (OS) data, and the ROC curve, Kaplan-Meier estimate, log rank test, and Jackknife method were used to show the effect of ERβ and TROP2 expression at different stages of cancer. The 5-year survival rates were not significantly different between the patients with stage IIa and stage IIb colon cancer (83 vs. 80 %, respectively). The high expression of ERβ was related to decreasing OS in stage IIa and stage IIb colon cancer, while the high expression of TROP2 was related to decreasing OS in stage IIb colon cancer. The expression of ERβ and TROP2 has tumor-suppressive and tumor-promoting effect in stage IIa and stage IIb colon cancer, respectively.

Can we eliminate neoadjuvant chemoradiotherapy in favor of neoadjuvant multiagent chemotherapy for select stage II/III rectal adenocarcinomas: Analysis of the National Cancer Data base.

Science.gov (United States)

Cassidy, Richard J; Liu, Yuan; Patel, Kirtesh; Zhong, Jim; Steuer, Conor E; Kooby, David A; Russell, Maria C; Gillespie, Theresa W; Landry, Jerome C

2017-03-01

Stage II and III rectal cancers have been effectively treated with neoadjuvant chemoradiotherapy (NCRT) followed by definitive resection. Advancements in surgical technique and systemic therapy have prompted investigation of neoadjuvant multiagent chemotherapy (NMAC) regimens with the elimination of radiation (RT). The objective of the current study was to investigate factors that predict for the use of NCRT versus NMAC and compare outcomes using the National Cancer Data Base (NCDB) for select stage II and III rectal cancers. In the NCDB, 21,707 patients from 2004 through 2012 with clinical T2N1 (cT2N1), cT3N0, or cT3N1 rectal cancers were identified who had received NCRT or NMAC followed by low anterior resection. Kaplan-Meier analyses, log-rank tests, and Cox-proportional hazards regression analyses were conducted along with propensity score matching analysis to reduce treatment selection bias. The 5-year actuarial overall survival (OS) rate was 75% for patients who received NCRT versus 67.2% for those who received NMAC (P elimination of neoadjuvant RT for select patients with stage II and III rectal adenocarcinoma was associated with worse OS and should not be recommended outside of a clinical trial. Cancer 2017;123:783-93. © 2016 American Cancer Society. © 2016 American Cancer Society.

Long-term Prognosis of Anti-Neutrophil Cytoplasmic Antibody-Negative Renal Vasculitis: Cohort Study in Korea.

Science.gov (United States)

Lee, Sung Woo; Yu, Mi-Yeon; Baek, Seon Ha; Ahn, Shin-Young; Kim, Sejoong; Na, Ki Young; Chae, Dong-Wan; Chin, Ho Jun

2016-04-01

Few studies have reported on the long-term prognosis of anti-neutrophil cytoplasmic antibody (ANCA)-negative renal vasculitis. Between April 2003 and December 2013, 48 patients were diagnosed with renal vasculitis. Their ANCA status was tested using indirect immunofluorescence and enzyme-linked immunosorbent assays. During a median (interquartile range) follow-up duration of 933.5 (257.5-2,079.0) days, 41.7% of patients progressed to end stage renal disease (ESRD) and 43.8% died from any cause. Of 48 patients, 6 and 42 were ANCA-negative and positive, respectively. The rate of ESRD within 3 months was higher in ANCA-negative patients than in ANCA-positive patients (P = 0.038). In Kaplan-Meier survival analysis, ANCA-negative patients showed shorter renal survival than did ANCA-positive patients (log-rank P = 0.033). In univariate Cox-proportional hazard regression analysis, ANCA-negative patients showed increased risk of ESRD, with a hazard ratio 3.190 (95% confidence interval, 1.028-9.895, P = 0.045). However, the effect of ANCA status on renal survival was not statistically significant in multivariate analysis. Finally, ANCA status did not significantly affect patient survival. In conclusion, long-term patient and renal survival of ANCA-negative renal vasculitis patients did not differ from those of ANCA-positive renal vasculitis patients. Therefore, different treatment strategy depending on ANCA status might be unnecessary.

Severe Obesity Impacts Recurrence-Free Survival of Women with High-Risk Endometrial Cancer: Results of a French Multicenter Study.

Science.gov (United States)

Canlorbe, Geoffroy; Bendifallah, Sofiane; Raimond, Emilie; Graesslin, Olivier; Hudry, Delphine; Coutant, Charles; Touboul, Cyril; Bleu, Géraldine; Collinet, Pierre; Darai, Emile; Ballester, Marcos

2015-08-01

Studies focusing on the impact of obesity on survival in endometrial cancer (EC) have reported controversial results and few data exist on the impact of obesity on recurrence rate and recurrence-free survival (RFS). The aim of this study was to assess the impact of obesity on surgical staging and RFS in EC according to the European Society of Medical Oncology (ESMO) risk groups. Data of 729 women with EC who received primary surgical treatment between January 2000 and December 2012 were abstracted from a multicenter database. RFS distributions according to body mass index (BMI) in each ESMO risk group were estimated using the Kaplan-Meier method. Survival was evaluated using the log-rank test, and the Cox proportional hazards model was used to determine influence of multiple variables. Distribution of the 729 women with EC according to BMI was BMI women with a BMI ≥ 35 (72 %) than for those with a BMI obese women in the low-/intermediate-risk groups, but a BMI ≥ 35 was independently correlated to a poorer RFS (hazard ratio 12.5; 95 % confidence interval 3.1-51.3) for women in the high-risk group. Severe obesity negatively impacts RFS in women with high-risk EC, underlining the importance of complete surgical staging and adapted adjuvant therapies in this subgroup of women.

Overexpression of NIMA-related kinase 2 is associated with poor prognoses in malignant glioma.

Science.gov (United States)

Liu, Huajie; Liu, Bin; Hou, Xianzeng; Pang, Bo; Guo, Pengbo; Jiang, Wanli; Ding, Qian; Zhang, Rui; Xin, Tao; Guo, Hua; Xu, Shangchen; Pang, Qi

2017-05-01

Eleated expression of NIMA-related kinase 2 (NEK2) was frequently observed in a variety of malignant cancers, and it appears to be involved in the initiation, maintenance, progression, metastasis of cancer and is positively associated with poor prognosis. We sought to investigate NEK2 expression and its predictive roles in malignant gliomas, and study the correlation of NEK2 protein expression with proliferation, clinical parameters, overall survival and some other parameters. We investigate NEK2 protein expression in 99 samples of malignant gliomas, including 35 WHO grade II, 22 grade III, and 42 grade IV gliomas, by immunohistochemistry and western blot (n = 50). We then made correlative analysis of protein overexpression using the Kaplan-Meier method, Log rank test, and Cox proportional-hazards model analysis. NEK2 protein was overexpressed in malignant gliomas, but not in normal brain tissues. Overexpression of NEK2 correlated with malignancy, proliferation and adverse overall survival in gliomas. Moreover, chemotherapy, resection extent and WHO grade also correlate with overall survival in gliomas. However, within WHO grade II glioma subgroup, NEK2 overexpression showed no impact on overall survival. The present study firstly reveals that NEK2 protein is widely overexpressed in gliomas. NEK2 overexpression correlates significantly with malignancy (WHO grades), proliferation (Ki-67) and prognosis in malignant gliomas. NEK2 is a potential gene therapy target and prognostic indicator.

[Local recurrence based on size after conservative surgery in breast cancer stage T1-T2. A population-based study].

Science.gov (United States)

Martínez-Ramos, David; Fortea-Sanchis, Carlos; Escrig-Sos, Javier; Prats-de Puig, Miguel; Queralt-Martín, Raquel; Salvador-Sanchis, José Luís

2014-01-01

Conservative surgery can be regarded as the standard treatment for most early stage breast tumors. However, a minority of patients treated with conservative surgery will present local or locoregional recurrence. Therefore, it is of interest to evaluate the possible factors associated with this recurrence. A population-based retrospective study using data from the Tumor Registry of Castellón (Valencia, Spain) of patients operated on for primary nonmetastatic breast cancer between January 2000 and December 2008 was designed. Kaplan-Meier curves and log-rank test to estimate 5-year local recurrence were used. Two groups of patients were defined, one with conservative surgery and another with nonconservative surgery. Cox multivariate analysis was conducted. The total number of patients was 410. Average local recurrence was 6.8%. In univariate analysis, only tumor size and lymph node involvement showed significant differences. On multivariate analysis, independent prognostic factors were conservative surgery (hazard ratio [HR] 4.62; 95% confidence interval [CI]: 1.12-16.82), number of positive lymph nodes (HR 1.07; 95% CI: 1.01-1.17) and tumor size (in mm) (HR 1.02; 95% CI: 1.01-1.06). Local recurrence after breast-conserving surgery is higher in tumors >2 cm. Although tumor size should not be a contraindication for conservative surgery, it should be a risk factor to be considered.

The prognostic value of peripheral CD4+CD25+ T lymphocytes among early stage and triple negative breast cancer patients receiving dendritic cells-cytokine induced killer cells infusion.

Science.gov (United States)

Song, Qing-Kun; Ren, Jun; Zhou, Xin-Na; Wang, Xiao-Li; Song, Guo-Hong; Di, Li-Jun; Yu, Jing; Hobeika, Amy; Morse, Michael A; Yuan, Yan-Hua; Yang, Hua-Bing; Lyerly, Herbert Kim

2015-12-01

This study aimed to assess the prognostic value of CD4+CD25+ T lymphocyte in peripheral blood among breast cancer patients treated with adoptive T lymphocytes immunotherapy. 217 patients participated in the follow-up study. CD4+CD25+ proportion was measured by flow cytometry in peripheral T cells. The median survival was estimated by Kaplan-Meier curve, Log-rank test and Cox hazard proportion regression model, between groups of CD4+CD25+ proportion more than 5% and less than or equal to 5% in peripheral T cells. Peripheral CD4+CD25+ T lymphocytes had not a relationship with progression-free survival. It was featured that above 5% peripheral CD4+CD25+ proportion of T cells was related with the median overall survival by a shorten of 51 months (p < 0.05) with the HR 1.65 (95%CI 1.04, 2.62). Above 5% CD4+CD25+proportion of T cells produced the HR to be 1.76 (95%CI 1.07, 2.87) In stage 0-II patients, and 3.59 (95%CI 1.05, 12.29) in triple negative breast cancer patients. Cellular immunity restoration recovered by adoptive T cell infusions which resulted in less proportion of peripheral CD4+CD25+T lymphocytes could be a potential prognostic indicator among early stage and triple negative patients.

The prognostic utility of baseline alpha-fetoprotein for hepatocellular carcinoma patients.

Science.gov (United States)

Silva, Jack P; Gorman, Richard A; Berger, Nicholas G; Tsai, Susan; Christians, Kathleen K; Clarke, Callisia N; Mogal, Harveshp; Gamblin, T Clark

2017-12-01

Alpha-fetoprotein (AFP) has a valuable role in postoperative surveillance for hepatocellular carcinoma (HCC) recurrence. The utility of pretreatment or baseline AFP remains controversial. The present study hypothesized that elevated baseline AFP levels are associated with worse overall survival in HCC patients. Adult HCC patients were identified using the National Cancer Database (2004-2013). Patients were stratified according to baseline AFP measurements into the following groups: Negative (2000). The primary outcome was overall survival (OS), which was analyzed by log-rank test and graphed using Kaplan-Meier method. Multivariate regression modeling was used to determine hazard ratios (HR) for OS. Of 41 107 patients identified, 15 809 (33.6%) were Negative. Median overall survival was highest in the Negative group, followed by Borderline, Elevated, and Highly Elevated (28.7 vs 18.9 vs 8.8 vs 3.2 months; P < 0.001). On multivariate analysis, overall survival hazard ratios for the Borderline, Elevated, and Highly Elevated groups were 1.18 (P = 0.267), 1.94 (P < 0.001), and 1.77 (P = 0.007), respectively (reference Negative). Baseline AFP independently predicted overall survival in HCC patients regardless of treatment plan. A baseline AFP value is a simple and effective method to assist in expected survival for HCC patients. © 2017 Wiley Periodicals, Inc.

Six-month bracket failure rate with a flowable composite: A split-mouth randomized controlled trial

Directory of Open Access Journals (Sweden)

Sindhuja Krishnan

Full Text Available ABSTRACT INTRODUCTION: The use of flowable composites as an orthodontic bonding adhesive merits great attention because of their adequate bond strength, ease of clinical handling and reduced number of steps in bonding. OBJECTIVE: The aim of this Randomized Controlled Trial was to comparatively evaluate over a 6-month period the bond failure rate of a flowable composite (Heliosit Orthodontic, Ivoclar Vivadent AG, Schaan and a conventional orthodontic bonding adhesive (Transbond XT, 3M Unitek. METHODS: 53 consecutive patients (23 males and 30 females who fulfilled the inclusion and exclusion criteria were included in the study. A total of 891 brackets were analyzed, where 444 brackets were bonded using Heliosit Orthodontic and 447 brackets were bonded using Transbond XT. The survival rates of brackets were estimated with the Kaplan-Meier analysis. Bracket survival distributions for bonding adhesives, tooth location and dental arch were compared with the log-rank test. RESULTS: The failure rates of the Transbond XT and the Heliosit Orthodontic groups were 8.1% and 6% respectively. No significant differences in the survival rates were observed between them (p= 0.242. There was no statistically significant difference in the bond failure rates when the clinical performance of the maxillary versus the mandibular arches and the anterior versus the posterior segments were compared. CONCLUSIONS: Both systems had clinically acceptable bond failure rates and are adequate for orthodontic bonding needs.

Use of Oncept melanoma vaccine in 69 canine oral malignant melanomas in the UK.

Science.gov (United States)

Verganti, S; Berlato, D; Blackwood, L; Amores-Fuster, I; Polton, G A; Elders, R; Doyle, R; Taylor, A; Murphy, S

2017-01-01

Oral malignant melanomas carry a poor-to-guarded prognosis because of their local invasiveness and high metastatic propensity. The Oncept melanoma vaccine is licensed to treat dogs with stage II or III locally-controlled oral malignant melanoma and this retrospective study aimed to assess survival of affected dogs treated with the vaccine in the UK. Medical records of dogs with histopathologically-confirmed oral malignant melanoma that received the vaccine as part of their treatment were evaluated. Survival analyses for potential prognostic factors were performed. Sixty-nine dogs were included; 56 dogs, staged I to III, and with previous locoregional therapy, had a median survival time of 455 days (95% CI: 324 to 586 days). Based on Kaplan-Meier survival analysis with associated log-rank testing, no significant prognostic factors were identified for this population. Of the 13 patients with macroscopic disease treated with vaccine alone or in combination therapy, eight showed clinical response. Three patients with stage IV oral malignant melanoma survived 171, 178 and 288 days from diagnosis. Patients treated with the melanoma vaccine in our study had survival times similar to their counterparts receiving the vaccine in the USA. There were observed responses in patients with macroscopic disease and so the vaccine could be considered as palliative treatment in dogs with stage IV disease. © 2017 British Small Animal Veterinary Association.

Gender differences among recidivist trauma patients.

Science.gov (United States)

Kwan, Rita O; Cureton, Elizabeth L; Dozier, Kristopher C; Victorino, Gregory P

2011-01-01

Gender differences among trauma recidivist patients are not well-understood. We hypothesized that males are more likely to be repeatedly involved in the trauma system and have a shorter time to recurrence between repeat episodes of injury compared with females. A retrospective analysis of trauma patients treated at an urban university-based trauma center was performed. Variables including gender, race, insurance status, age, mechanism of injury, outcomes, and injury secondary to domestic violence were compared. Differences were compared using χ(2) tests and log-rank (Mantel-Cox) Kaplan-Meier cumulative event curves. We identified 689 trauma recidivist patients (4.0% of all trauma visits) over a 10-y period. Compared to single-visit patients, recidivist patients were more likely to be male (87% versus 73%), uninsured (78% versus 66%), and have injuries secondary to assaults (54% versus 37%) (P trauma visit was shorter for females compared with males (23 ± 2.5 versus 30 ± 1.2 mo, P trauma than were male recidivists (69% versus 43%, P trauma patients have a much shorter time to recurrence for a second traumatic injury than do males. Female recidivists have a high likelihood of assault-associated injuries and domestic violence. Trauma centers should screen for domestic violence among trauma patients to aid in preventing further repeat episodes of injury. Copyright © 2011 Elsevier Inc. All rights reserved.

Prognostic factors in primary adenocarcinoma of the small intestine: 13-year single institution experience

Directory of Open Access Journals (Sweden)

Jacobs Michael J

2008-01-01

Full Text Available Abstract Background Adenocarcinoma of the small bowel is a relatively rare malignancy as compared to the other malignancies of the gastrointestinal tract. Nonspecific presentation and infrequent occurrence often leads to a delay in diagnosis and consequent poor prognosis. Various other factors are of prognostic importance while managing these tumors. Methods The medical records of a total of 27 patients treated for adenocarcinoma of the small bowel at Providence Hospital and Medical Centers from year 1990 through 2003 were reviewed retrospectively. Data were analyzed using SPSS software (version 10.0; SPSS, Inc., Chicago, IL. Survival analyses were calculated using the Kaplan Meier method with the log rank test to assess the statistical significance. The socio-demographics (age, gender were calculated using frequency analyses. Results The patients included nine males and eighteen females with a median age at diagnosis of 62 years. Only 48% of the patients had an accurate preoperative diagnosis while another 33% had a diagnosis suspicious of small bowel malignancy. None of the patients presented in stage 1. The cumulative five-year survival was 30% while the median survival was 3.3 years. There was no 30-day mortality in the postoperative period in our series. Conclusion The univariate analysis demonstrated that tumor grade, stage at presentation, lymph nodal metastasis and resection margins were significant predictors of survival.

Nutritional factors as predictors of response to radio-chemotherapy and survival in unresectable squamous head and neck carcinoma

International Nuclear Information System (INIS)

Salas, Sebastien; Deville, Jean-Laurent; Giorgi, Roch; Pignon, Thierry; Bagarry, Danielle; Barrau, Karine; Zanaret, Michel; Giovanni, Antoine; Bourgeois, Aude; Favre, Roger; Duffaud, Florence

2008-01-01

Background and purpose: This study sought to evaluate nutritional prognostic factors before treatment in patients with unresectable head and neck cancer treated by concomitant radio-chemotherapy. Methods and materials: Seventy-two consecutive patients were treated. We studied the potential effects of CRP, Alb, preAlb, orosomucoid, weight, weight history, BMI, PINI, OPR and NRI on response to treatment, Event-Free Survival (EFS) and Overall Survival (OS). Effects of potential risk factors on OS and on EFS were analyzed by computing Kaplan-Meier estimates, and curves were compared using the log-rank test. Results: All biological nutritional factors were statistically correlated with the response to radio-chemotherapy. In multivariate analysis, only CRP (p = 0.004) remained statistically significant. A statistical correlation was found between Alb and EFS in multivariate analysis (p = 0.04). The factors influencing OS in univariate analysis were Alb (p = 0.008), CRP (p = 0.004), orosomucoid (p = 0.01) and NRI (p = 0.01), response to radio-chemotherapy (p < 0.001) and staging (p = 0.04). In multivariate analysis, only the response to radio-chemotherapy (p < 0.001) remained significant. Conclusions: This study illustrates the prognostic value of nutritional status. CRP and Alb may be useful in the assessment of advanced head and neck cancer patients at diagnosis and for stratifying patients taking part in randomized trials

High frequency of tumor cells with nuclear Egr-1 protein expression in human bladder cancer is associated with disease progression

International Nuclear Information System (INIS)

Egerod, Frederikke Lihme; Bartels, Annette; Fristrup, Niels; Borre, Michael; Ørntoft, Torben F; Oleksiewicz, Martin B; Brünner, Nils; Dyrskjøt, Lars

2009-01-01

Egr-1 (early growth response-1 transcription factor) has been proposed to be involved in invasion and metastasis processes of human bladder cancer, but Egr-1 protein expression levels in human bladder cancer have not been investigated. In the present study we investigated the expression levels of Egr-1 protein in early stages of human bladder cancer and correlated it to later progression. Expression of Egr-1 protein in human bladder cancer was examined by immunohistochemistry, on a tissue microarray constructed from tumors from 289 patients with non-muscle invasive urothelial bladder cancer. The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling were found to localize at the tumor front in some of the tumor biopsies. The results from this study support a potential involvement of Egr-1 in the progression from non-muscle invasive bladder cancers to muscle invasive bladder cancer

Clinical course of Crohn's disease first diagnosed at surgery for acute abdomen.

Science.gov (United States)

Latella, G; Cocco, A; Angelucci, E; Viscido, A; Bacci, S; Necozione, S; Caprilli, R

2009-04-01

The severity of clinical activity of Crohn's disease is high during the first year after diagnosis and decreases thereafter. Approximately 50% of patients require steroids and immunosuppressants and 75% need surgery during their lifetime. The clinical course of patients with Crohn's disease first diagnosed at surgery has never been investigated. To assess the clinical course of Crohn's disease first diagnosed at surgery for acute abdomen and to evaluate the need for medical and surgical treatment in this subset of patients. Hospital clinical records of 490 consecutive Crohn's disease patients were reviewed. Patients were classified according to the Vienna criteria. Sex, extraintestinal manifestations, family history of inflammatory bowel diseases, appendectomy, smoking habit and medical/surgical treatments performed during the follow-up period were assessed. Kaplan-Meier survival method and Cox proportional hazards regression model. Of the 490 Crohn's disease patients, 115 had diagnosis of Crohn's disease at surgery for acute abdomen (Group A) and 375 by conventional clinical, radiological, endoscopic and histologic criteria (Group B). Patients in Group A showed a low risk of further surgery (Log Rank test pacute abdomen showed a low risk for reintervention and less use of steroids and immunosuppressants during follow-up than those not operated upon at diagnosis. Early surgery may represent a valid approach in the initial management of patients with Crohn's disease, at least in the subset of patients with ileal and complicated disease.

[An analysis of 68 invasive lobular breast cancer cases in clinicopathological characteristics and the prognostic determinants].

Science.gov (United States)

Liu, Q; Xiang, H Y; Ye, J M; Xu, L; Zhang, H; Zhang, S; Duan, X N; Liu, Y H

2018-02-01

Objective: To study the clinicopathological characteristics and the prognostic determinants of the invasive lobular carcinoma breast cancer. Methods: This was a retrospective single-center study of invasive lobular breast cancer cases diagnosed from January 2008 to December 2014 at Peking University First Hospital Breast Disease Center. The study enrolled 68 invasive lobular breast cancer patients, which represented 3.64% (68/1 870) of total invasive breast cancer. The median age of all selected patients was 46 years ranging from 36 to 83 years. All patients were restaged based on the 8(th) edition of AJCC cancer staging system and follow-up data including disease-free survival (DFS) and overall survival (OS) were analyzed to explore the prognostic determinants. The 5-year OS and DFS were calculated using Kaplan-Meier method; the significance of correlations between clinicopathological features and prognostic factors was estimated using log-rank test. Results: There were significant differences in OS between patients with different anatomic stage, prognostic stage, lymph node metastasis, progesterone receptor (PR) expression, lymphvascular invasion and perineural invasion (χ(2:) 4.318 to 32.394, all P invasion (χ(2:) 4.347 to 27.369, all P invasion are the prognostic factors of invasive lobular breast cancer. Regard to invasive lobular breast cancer patients, clinicians should pay close attention to the differences between prognostic stage and anatomic stage.

Factors influencing the treatment outcome for patients with T2N0 glottic carcinoma treated by definitive radiotherapy

International Nuclear Information System (INIS)

Fukuda, Ichiro; Kanehira, Chihiro; Kobayashi, Masao; Aoki, Manabu; Takagi, Sayako; Shirahama, Jun; Honda, Chikara

2007-01-01

The purpose of this study was to determine the prognostic factors affecting local outcomes for patients with T2N0 glottic carcinoma treated by definitive radiotherapy. A total of 48 patients with T2N0 squamous cell carcinoma treated by definitive radiotherapy between 1992 and 2005 were studied. Cumulative probability of overall survival, cause-specific survival, local control and larynx-preserving were calculated according the Kaplan-Meier method, and the prognostic significance of patient's age, number of subsites involved, impaired cord mobility, anterior commisure involved, total dose and overall treatment time were analyzed using the log-rank test in univariate analysis and Cox regression in multivariate analysis. Follow-up ranged from 13 to 141 months (median, 62 months). Five-year survivals were: overall, 95.3%; cause-specific, 97.9% and five years rates were local control, 61.4%; larynx-preserving, 76.4%. Multivariate analyses of the six parameters showed that overall treatment time significantly influenced the probability of local control, and impaired mobility and overall treatment time affected the probability of larynx-preserving. Our study showed that longer overall treatment time significantly worsened the percentage of local control and larynx-preserving for patients with T2N0 glottic carcinoma treated with definitive radiotherapy. Therefore, we suggest treating, the patients in a shorter treatment course. (author)

Does protein energy malnutrition affect the outcome in Tunisian cirrhotic patients?

Science.gov (United States)

Ennaifer, Rym; Cheikh, Myriam; Romdhane, Haifa; Sabbagh, Safa; Ben Nejma, Houda; Bougassas, Wassila; Bel Hadj, Najet

2016-02-01

Malnutrition is commonly seen in cirrhotic patients and has been shown to adversely affect outcome. However, it remains associated with the severity of cirrhosis. Therefore, its role as an independent prognostic factor is still under debate. The aims of our study were to determine the prevalence of malnutrition in cirrhotic patients and determine whether this condition was an independent prognostic factor. We prospectively analyzed the nutritional status of 104 consecutive patients with cirrhosis Subjective global nutritional assessment (SGA) and anthropometry [dry body mass index (BMI), triceps skinfold (TSF), arm muscle circumference (AMC)] were used for the evaluation of the nutritional status. Complications of cirrhosis during follow-up and patient's survival were recorded. Global survival and survival without complications was studied by Kaplan Meier method and using Log Rank test. Prevalence of malnutrition ranged from 16.3 and 62.5% according to the method of nutritional assessment used. Survival without complications was reduced in malnourished patients. This difference was significant when assessing malnutrition by dry BMI (p=0.001). In multivariate analysis, malnutrition defined by dry BMImalnutrition was an independent predictor of complications in cirrhosis. However, it did not appear as an independent prognostic factor for global survival. These results raise again difficulties to clarify whether malnutrition influence itself the prognosis of cirrhosis or if it is only related to the severity of cirrhosis.

Tracheal and Crico-Tracheal Resection and Anastomosis for Malignancies Involving the Thyroid Gland and the Airway.

Science.gov (United States)

Piazza, Cesare; Del Bon, Francesca; Barbieri, Diego; Grazioli, Paola; Paderno, Alberto; Perotti, Pietro; Lombardi, Davide; Peretti, Giorgio; Nicolai, Piero

2016-02-01

To evaluate outcomes in different malignancies involving the thyroid and infiltrating the airway submitted to tracheal (TRA) or crico-tracheal resection and anastomosis (CTRA). Retrospective charts review of 27 patients affected by thyroid malignancies involving the airway treated by TRA/CTRA in a single academic institution. Kaplan-Meier curves were used to evaluate the overall (OS) and disease-specific (DSS) survivals and local (LC) and loco-regional control (LRC). Impact on survival of age, comorbidities, previous radiotherapy, types of TRA/CTRA, Shin's stage (II, III, IV), grading (well vs poorly differentiated), and length of airway resected was calculated by the log-rank test. Overall survival and DSS at 3 and 5 years were 82.3% and 71.6%, respectively. Local control and LRC in the entire group were 82.3% at 3 and 5 years. Crico-tracheal resection and anastomosis involving the cricoid arch and plate (type C) and tumor differentiation significantly affected OS and DSS (both P < .001). Type C CTRA and tumor differentiation significantly impacted on LC (P = .002 and P = .009, respectively). Grading and extension of CTRA to the cricoid plate are the most important factors for oncologic outcomes in thyroid malignancies infiltrating the airway. Except for poorly differentiated tumors, TRA/CTRA allows adequate LC even in advanced stage lesions involving the crico-tracheal junction. © The Author(s) 2015.

Postoperative radiotherapy for stage II and III rectal cancer

International Nuclear Information System (INIS)

Qian Liting; Song Yongwen; Liu Xinfan; Yu Zihao; Qian Tunan; Li Yexiong

2003-01-01

Objective: To evaluate the impact of postoperative adjuvant radiotherapy, compared with surgery alone for rectal cancer. Methods: From January 1994 to October 1997, 192 patients with stage II or III rectal cancer were treated by radical resection and postoperative radiotherapy (Group S + R) and 51 patients with the same stage lesions underwent surgery alone (Group S). The median dose of radiation was 50(32-62) Gy. Kaplan-Meier method and Log-rank test were used for analysis. Results: The 5-year overall and disease-free survival rates were 60.3% and 58.3%, respectively. The overall 5-year survival rate was 59.4% in Group S + R and 64.7% in Group S, and the 5-year disease-free survival rates were 57.0% and 66.4%, respectively. There were no significant differences between either group (P=0.601 and P=0.424). The disease-free survival was not significantly prolonged in Group S + R as compared with that of Group S. The local recurrence rate was evidently reduced in Group S + R (15.8% v 26.8%, P=0.043). Conclusion: Local recurrence is a major cause of morbidity and mortality in rectal cancer. Postoperative radiotherapy, though reduces the incidence of local recurrence, does not improve the survival in the treatment of stage II and III diseases

Severe Pulmonary Toxicity After Myeloablative Conditioning Using Total Body Irradiation: An Assessment of Risk Factors

International Nuclear Information System (INIS)

Kelsey, Chris R.; Horwitz, Mitchell E.; Chino, Junzo P.; Craciunescu, Oana; Steffey, Beverly; Folz, Rodney J.; Chao, Nelson J.; Rizzieri, David A.; Marks, Lawrence B.

2011-01-01

Purpose: To assess factors associated with severe pulmonary toxicity after myeloablative conditioning using total body irradiation (TBI) followed by allogeneic stem cell transplantation. Methods and Materials: A total of 101 adult patients who underwent TBI-based myeloablative conditioning for hematologic malignancies at Duke University between 1998 and 2008 were reviewed. TBI was combined with high-dose cyclophosphamide, melphalan, fludarabine, or etoposide, depending on the underlying disease. Acute pulmonary toxicity, occurring within 90 days of transplantation, was scored using Common Terminology Criteria for Adverse Events version 3.0. Actuarial overall survival and the cumulative incidence of acute pulmonary toxicity were calculated via the Kaplan-Meier method and compared using a log-rank test. A binary logistic regression analysis was performed to assess factors independently associated with acute severe pulmonary toxicity. Results: The 90-day actuarial risk of developing severe (Grade 3-5) pulmonary toxicity was 33%. Actuarial survival at 90 days was 49% in patients with severe pulmonary toxicity vs. 94% in patients without (p < 0.001). On multivariate analysis, the number of prior chemotherapy regimens was the only factor independently associated with development of severe pulmonary toxicity (odds ratio, 2.7 per regimen). Conclusions: Severe acute pulmonary toxicity is prevalent after TBI-based myeloablative conditioning regimens, occurring in approximately 33% of patients. The number of prior chemotherapy regimens appears to be an important risk factor.

Adjuvant treatment for resected rectal cancer: impact of standard and intensified postoperative chemotherapy on disease-free survival in patients undergoing preoperative chemoradiation-a propensity score-matched analysis of an observational database.

Science.gov (United States)

Garlipp, Benjamin; Ptok, Henry; Benedix, Frank; Otto, Ronny; Popp, Felix; Ridwelski, Karsten; Gastinger, Ingo; Benckert, Christoph; Lippert, Hans; Bruns, Christiane

2016-12-01

Adjuvant chemotherapy for resected rectal cancer is widely used. However, studies on adjuvant treatment following neoadjuvant chemoradiotherapy (CRT) and total mesorectal excision (TME) have yielded conflicting results. Recent studies have focused on adding oxaliplatin to both preoperative and postoperative therapy, making it difficult to assess the impact of adjuvant oxaliplatin alone. This study was aimed at determining the impact of (i) any adjuvant treatment and (ii) oxaliplatin-containing adjuvant treatment on disease-free survival in CRT-pretreated, R0-resected rectal cancer patients. Patients undergoing R0 TME following 5-fluorouracil (5FU)-only-based CRT between January 1, 2008, and December 31, 2010, were selected from a nationwide registry. After propensity score matching (PSM), comparison of disease-free survival (DFS) using Kaplan-Meier analysis and log-rank test was performed in (i) patients receiving no vs. any adjuvant treatment and (ii) patients treated with adjuvant 5FU/capecitabine without vs. with oxaliplatin. Out of 1497 patients, 520 matched pairs were generated for analysis of no vs. any adjuvant treatment. Mean DFS was significantly prolonged with adjuvant treatment (81.8 ± 2.06 vs. 70.1 ± 3.02 months, p rectal cancer patients treated with neoadjuvant CRT and TME surgery under routine conditions, adjuvant chemotherapy significantly improved DFS. No benefit was observed for the addition of oxaliplatin to adjuvant chemotherapy in this setting.

HIF1-alpha overexpression indicates a good prognosis in early stage squamous cell carcinomas of the oral floor

Directory of Open Access Journals (Sweden)

Joos Ulrich

2005-07-01

Full Text Available Abstract Background Hypoxia-inducible factor 1 (HIF-1 is a transcription factor, which plays a central role in biologic processes under hypoxic conditions, especially concerning tumour angiogenesis. HIF-1α is the relevant, oxygen-dependent subunit and its overexpression has been associated with a poor prognosis in a variety of malignant tumours. Therefore, HIF-1α expression in early stage oral carcinomas was evaluated in relation to established clinico-pathological features in order to determine its value as a prognostic marker. Methods 85 patients with histologically proven surgically treated T1/2 squamous cell carcinoma (SCC of the oral floor were eligible for the study. Tumor specimens were investigated by means of tissue micro arrays (TMAs and immunohistochemistry for the expression of HIF-1. Correlations between clinical features and the expression of HIF-1 were evaluated by Kaplan-Meier curves, log-rank tests and multivariate Cox regression analysis. Results HIF-1α was frequently overexpressed in a probably non-hypoxia related fashion. The expression of HIF-1α was related with a significantly improved 5-year survival rate (p Conclusion HIF-1α overexpression is an indicator of favourable prognosis in T1 and T2 SCC of the oral floor. Node negative patients lacking HIF-1α expression may therefore be considered for adjuvant radiotherapy.

Nutrition support can bring survival benefit to high nutrition risk gastric cancer patients who received chemotherapy.

Science.gov (United States)

Qiu, Miaozhen; Zhou, Yi-xin; Jin, Yin; Wang, Zi-xian; Wei, Xiao-li; Han, Hong-yu; Ye, Wen-feng; Zhou, Zhi-wei; Zhang, Dong-sheng; Wang, Feng-hua; Li, Yu-hong; Yang, Da-jun; Xu, Rui-hua

2015-07-01

The aim of our study is firstly to evaluate the prevalence and prognostic value of nutrition risk in gastric cancer patients and secondly to explore whether the nutrition support can prolong the survival of advanced gastric cancer patients. It contained two study periods. In the first period, we prospectively evaluated the nutritional risk of gastric adenocarcinoma patients from 2009 to 2011 using the method of European Nutritional Risk Screening (NRS) 2002. The Kaplan-Meier method and log-rank test were used to evaluate the prognostic value of high nutrition risk. The second period was between 2012 and 2013. We prospectively gave the nutrition support to stage IV gastric cancer patients whose NRS is ≥3. There were 830 patients in the first period, 50.7% patients with a NRS ≥ 3. Patients with NRS ≥ 3 presented a significantly higher percentage of stage IV diseases, elevated values of C-reactive protein, and hypoproteinemia. The median survival was significantly higher in NRS nutrition support. The median survival was 14.3 and 9.6 months for patients with and without NRS shift, respectively, P = 0.001. NRS ≥ 3 was an independent adverse prognostic factor in gastric cancer patients. For stage IV patients whose NRS ≥ 3, the nutrition support might be helpful to improve the prognosis.

[Determinants of survival in HIV patients receiving antiretroviral therapy in Goma, Democratic Republic of Congo].

Science.gov (United States)

Akilimali, P Z; Mutombo, P B; Kayembe, P K; Kaba, D K; Mapatano, M A

2014-06-01

The study aimed to identify factors associated with the survival of patients receiving antiretroviral therapy. A historic cohort of HIV patients from two major hospitals in Goma (Democratic Republic of Congo) was followed from 2004 to 2012. The Kaplan-Meier method was used to describe the probability of survival as a function of time since inclusion into the cohort. The log-rank test was used to compare survival curves based on determinants. The Cox regression model identified the determinants of survival since treatment induction. The median follow-up time was 3.56 years (IQR=2.22-5.39). The mortality rate was 40 deaths per 1000 person-years. Male gender (RR: 2.56; 95 %CI 1.66-4.83), advanced clinical stage (RR: 2.12; 95 %CI 1.15-3.90), low CD4 count (CD4 < 50) (RR: 2.05; 95 %CI : 1.22-3.45), anemia (RR: 3.95; 95 %CI 2.60-6.01), chemoprophylaxis with cotrimoxazole (RR: 4.29, 95 % CI 2.69-6.86) and period of treatment initiation (2010-2011) (RR: 3.34; 95 %CI 1.24-8.98) were statistically associated with short survival. Initiation of treatment at an early stage of the disease with use of less toxic molecules and an increased surveillance especially of male patients are recommended to reduce mortality. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Comparison of characteristics and healing course of diabetic foot ulcers by etiological classification: neuropathic, ischemic, and neuro-ischemic type.

Science.gov (United States)

Yotsu, Rie Roselyne; Pham, Ngoc Minh; Oe, Makoto; Nagase, Takeshi; Sanada, Hiromi; Hara, Hisao; Fukuda, Shoji; Fujitani, Junko; Yamamoto-Honda, Ritsuko; Kajio, Hiroshi; Noda, Mitsuhiko; Tamaki, Takeshi

2014-01-01

To identify differences in the characteristics of patients with diabetic foot ulcers (DFUs) according to their etiological classification and to compare their healing time. Over a 4.5-year period, 73 patients with DFUs were recruited. DFUs were etiologically classified as being of neuropathic, ischemic, or neuro-ischemic origin. Descriptive analyses were performed to characterize study subjects, foot-related factors, and healing outcome and time. Duration of healing was assessed using the Kaplan-Meier method. Healing time among the three types was compared using the log rank test. The number of patients manifesting neuropathic, ischemic, and neuro-ischemic ulcers was 30, 20, and 14, respectively. Differences were identified for age, diabetes duration, body mass index, hypertension, and estimated glomerular filtration rate. Patients with neuro-ischemic ulcers had better ankle-brachial index, skin perfusion pressure (SPP), and transcutaneous oxygen pressure values compared to those with ischemic ulcers. The average time in which 50% of patients had healed wounds was 70, 113, and 233 days for neuropathic, neuro-ischemic, and ischemic ulcers, respectively. Main factors associated with healing were age and SPP values. Based on the etiological ulcer type, DFU healing course and several patient factors differed. Failure to consider the differences in DFU etiology may have led to heterogeneity of results in previous studies on DFUs. Copyright © 2014 Elsevier Inc. All rights reserved.

Thrombotic Thrombocytopenic Purpura in Black People: Impact of Ethnicity on Survival and Genetic Risk Factors.

Directory of Open Access Journals (Sweden)

Suella Martino

Full Text Available Black people are at increased risk of thrombotic thrombocytopenic purpura (TTP. Whether clinical presentation of TTP in Black patients has specific features is unknown. We assessed here differences in TTP presentation and outcome between Black and White patients. Clinical presentation was comparable between both ethnic groups. However, prognosis differed with a lower death rate in Black patients than in White patients (2.7% versus 11.6%, respectively, P = .04. Ethnicity, increasing age and neurologic involvement were retained as risk factors for death in a multivariable model (P < .05 all. Sixty-day overall survival estimated by the Kaplan-Meier curves and compared with the Log-Rank test confirmed that Black patients had a better survival than White patients (P = .03. Salvage therapies were similarly performed between both groups, suggesting that disease severity was comparable. The comparison of HLA-DRB1*11, -DRB1*04 and -DQB1*03 allele frequencies between Black patients and healthy Black individuals revealed no significant difference. However, the protective allele against TTP, HLA-DRB1*04, was dramatically decreased in Black individuals in comparison with White individuals. Black people with TTP may have a better survival than White patients despite a comparable disease severity. A low natural frequency of HLA-DRB1*04 in Black ethnicity may account for the greater risk of TTP in this population.

Hypofractionated radiation therapy in the treatment of epidemic Kaposi sarcoma - A prospective randomized trial

International Nuclear Information System (INIS)

Singh, Niveditha B.; Lakier, Roy H.; Donde, Bernard

2008-01-01

Purpose: To compare a conventional fractionation regimen with a hypofractionated regimen in the treatment of Epidemic Kaposi sarcoma with radiation therapy. Materials and methods: Sixty patients were randomized to receive a standard regimen of 24 Gy in 12 fractions (ARM A) or the study regimen of 20 Gy in five fractions (ARM B). Radiation technique was individualized. Treatment response, local control and toxicity were recorded. Results: Thirty five sites were treated in ARM A and 30 sites in ARM B. Treatment arms were similar for gender, ECOG performance score, treated site, antiretroviral therapy usage, T stage, I stage and S stage. The overall survival using the Kaplan Meier method was 37% at 1 year. Complete responses were recorded at 28 sites (13 Arm A, 15 Arm B), partial responses at 19 sites (8 Arm A, 11 Arm B) and stable disease at three sites (2 Arm A, 1 Arm B). The mean time to maximum objective response was 3 months (range: 1-14 months). Response rates and local control were equal in the two arms (p = 0.73 and 0.77, respectively, log rank test). Acute skin toxicity (p = 0.77) and late skin toxicity (p = 0.24) were equal in the two arms. Conclusion: The two treatment regimens produced equivalent results for treatment response, local recurrence-free survival and toxicity

Profiling the careers of Thoroughbred horses racing in Hong Kong between 2000 and 2010.

Science.gov (United States)

Velie, B D; Stewart, B D; Lam, K; Wade, C M; Hamilton, N A

2013-11-01

Research in Thoroughbred racehorses is often specific to horses from a given racing population or region. In order to investigate trends in racehorse careers across populations accurately, population-specific benchmarks for performance outcomes must be established. To provide summary statistics for performance outcomes for Thoroughbreds racing in Hong Kong between 2000 and 2010 and to document and provide evidence on the current differences in racing careers across sexes and regions of origin for horses racing in Hong Kong. Performance data on the population of Thoroughbreds racing in Hong Kong between 3 September 2000 and 12 March 2011 (n = 4950) were acquired and used to describe and compare the careers of Thoroughbred racehorses in Hong Kong. Career length, number of career starts and number of spells from racing per year were evaluated. Kaplan-Meier survival curves, stratified by sex, age group, country of origin and region of origin were produced for career length. A Cox's proportional hazards model was fitted to assess factors influencing the risk of retirement from racing in Hong Kong. Log-rank tests for equality of career length survivor functions showed significant differences (Phorse originates, with specific effects on each performance outcome also varying between regions. Future research should take into account these potential differences when comparing results across populations. © 2013 EVJ Ltd.

[Analysis of clinicopathologic and survival characteristics in patients with right-or left-sided colon cancer].

Science.gov (United States)

Hu, Junjie; Zhou, Zhixiang; Liang, Jianwei; Zhou, Haitao; Wang, Zheng; Zhang, Xingmao; Zeng, Weigen

2015-07-28

This study aimed to clarify the clinical and histological parameters, and survival difference between right- and left-sided colon cancer. We retrospectively analyzed the medical records (2006.1-2009.12) of 1 088 consecutive colon cancer patients who received surgery at our hospital. Right- and left-sided colon cancers were compared regarding the clinical and histological parameters. The survival analysis was performed by the Kaplan-Meier method, and the log-rank test was used to determine the statistical significance of differences. Right-sided colon cancer was associated with older age, a more advanced state, and poorly differentiated and undifferentiated adenocarcinoma (25.2% vs 13.2%), mucinous adenocarcinoma (33.5% vs 17.3%) and vascular invasion (9.9% vs 3.9%) were more commonly seen in right-sided colon cancer compared with right-sided colon cancer, and all these differences were statistically significant. Median overall survival was right, 67 months; and left, 68 months. The five-years overall survival of right- and left-sided colon cancer was I/II stage, 91.4% vs 88.6% (P = 0.819); III stage, 66.1% vs 75.4% (P = 0.010); and IV stage, 27.8% vs 38.5% (P = 0.020) respectively. Right- and left-sided colon cancers are significantly different regarding clinical and histological parameters. Right-sided colon cancers in stage III and IV have a worse prognosis.

High mortality in diabetic recipients of high KDPI deceased donor kidneys.

Science.gov (United States)

Pelletier, Ronald P; Pesavento, Todd E; Rajab, Amer; Henry, Mitchell L

2016-08-01

Deceased donor (DD) kidney quality is determined by calculating the Kidney Donor Profile Index (KDPI). Optimizing high KDPI (≥85%) DD transplant outcome is challenging. This retrospective study was performed to review our high KDPI DD transplant results to identify clinical practices that can improve future outcomes. We retrospectively calculated the KDPI for 895 DD kidney recipients transplanted between 1/2002 and 11/2013. Age, race, body mass index (BMI), retransplantation, gender, diabetes (DM), dialysis time, and preexisting coronary artery disease (CAD) (previous myocardial infarction (MI), coronary artery bypass (CABG), or stenting) were determined for all recipients. About 29.7% (266/895) of transplants were from donors with a KDPI ≥85%. By Cox regression older age, diabetes, female gender, and dialysis time >4 years correlated with shorter patient survival time. Diabetics with CAD who received a high KDPI donor kidney had a significantly increased risk of death (HR 4.33 (CI 1.82-10.30), P=.001) compared to low KDPI kidney recipients. The Kaplan-Meier survival curve for diabetic recipients of high KDPI kidneys was significantly worse if they had preexisting CAD (P<.001 by log-rank test). Patient survival using high KDPI donor kidneys may be improved by avoiding diabetic candidates with preexisting CAD. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Mini dental implants retaining mandibular overdentures: A dental practice-based retrospective analysis.

Science.gov (United States)

Schwindling, Franz Sebastian; Schwindling, Franz-Peter

2016-07-01

The purpose of this study was to assess the survival of mini dental implants (MDI) and to measure prosthetic maintenance needs in a dental practice-based setting. Patients with mandibular removable dentures were provided with MDI to improve denture retention. Complications and maintenance were analyzed by use of patient records and evaluated with Kaplan-Meier curves and the log rank test at a significance level of 0.05. Ninety-nine MDI were placed in 25 patients (mean age: 72 years). Two MDI fractured during placement and eight implants failed during the first weeks. No more implants were lost for up to seven years, resulting in 92% survival. Implant survival differed significantly depending on whether the maxilla was provided with complete dentures (94.9%) or with partial dentures (81%). All prostheses were in use at the time of data extraction. Denture base fractures were observed in six cases, an incidence of fractures of 24%. Some minor intervention was necessary: one resin tooth fractured, retention rings were changed in five cases, and repeated relining was required for 16% of the dentures. After mid-term observation, survival of MDI was good. However, the incidence of denture base fractures and of minor prosthetic complications should not be under-estimated. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Natural history and surgical treatment of chordoma: a retrospective cohort study

Directory of Open Access Journals (Sweden)

Samuel Aguiar Júnior

Full Text Available CONTEXT AND OBJECTIVE: Chordoma is a rare tumor with a high risk of locoregional recurrences. The aim of this study was analyze the long-term results from treating this pathological condition.DESIGN AND SETTING: Cohort study in a single hospital in São Paulo, Brazil.METHODS: This was a retrospective cohort study on 42 patients with chordoma who were treated at Hospital A. C. Camargo between 1980 and 2006. The hospital records were reviewed and a descriptive analysis was performed on the clinical-pathological variables. Survival curves were estimated using the Kaplan-Meier method and these were compared using the log-rank test.RESULTS: Nineteen patients were men and 23 were women. Twenty-five tumors (59.5% were located in the sacrum, eleven (26.2% in the skull base and six (14.3% in the mobile spine. Surgery was performed on 28 patients (66.7%. The resection was considered to have negative margins in 14 cases and positive margins in 14 cases. The five-year overall survival (OS was 45.4%. For surgical patients, the five-year OS was 64.3% (82.2% for negative margins and 51.9% for positive margins. In the inoperable group, OS was 37.7% at 24 months and 0% at five years.CONCLUSION: Complete resection is related to local control and definitively has a positive impact on long-term survival.

Preclinical demonstration of synergistic Active Nutrients/Drug (AND combination as a potential treatment for malignant pleural mesothelioma.

Directory of Open Access Journals (Sweden)

Viviana Volta

Full Text Available Malignant pleural mesothelioma (MPM is a poor prognosis disease lacking adequate therapy. We have previously shown that ascorbic acid administration is toxic to MPM cells. Here we evaluated a new combined therapy consisting of ascorbate/epigallocatechin-3-gallate/gemcitabine mixture (called AND, for Active Nutrients/Drug. In vitro effects of AND therapy on various MPM cell lines revealed a synergistic cytotoxic mechanism. In vivo experiments on a xenograft mouse model for MPM, obtained by REN cells injection in immunocompromised mice, showed that AND strongly reduced the size of primary tumor as well as the number and size of metastases, and prevented abdominal hemorrhage. Kaplan Meier curves and the log-rank test indicated a marked increase in the survival of AND-treated animals. Histochemical analysis of dissected tumors showed that AND induced a shift from cell proliferation to apoptosis in cancer cells. Lysates of tumors from AND-treated mice, analyzed with an antibody array, revealed decreased TIMP-1 and -2 expressions and no effects on angiogenesis regulating factors. Multiplex analysis for signaling protein phosphorylation exhibited inactivation of cell proliferation pathways. The complex of data showed that the AND treatment is synergistic in vitro on MPM cells, and blocks in vivo tumor progression and metastasization in REN-based xenografts. Hence, the AND combination is proposed as a new treatment for MPM.

Outcome with lenalidomide plus dexamethasone followed by early autologous stem cell transplantation in patients with newly diagnosed multiple myeloma on the ECOG-ACRIN E4A03 randomized clinical trial: long-term follow-up.

Science.gov (United States)

Biran, N; Jacobus, S; Vesole, D H; Callander, N S; Fonseca, R; Williams, M E; Abonour, R; Katz, M S; Rajkumar, S V; Greipp, P R; Siegel, D S

2016-09-02

In Eastern Cooperative Oncology Group-ACRIN E4A03, on completion of four cycles of therapy, newly diagnosed multiple myeloma patients had the option of proceeding to autologous peripheral blood stem cell transplant (ASCT) or continuing on their assigned therapy lenalidomide plus low-dose dexamethasone (Ld) or lenalidomide plus high-dose dexamethasone (LD). This landmark analysis compared the outcome of 431 patients surviving their first four cycles of therapy pursuing early ASCT to those continuing on their assigned therapy. Survival distributions were estimated using the Kaplan-Meier method and compared with log-rank test. Ninety patients (21%) opted for early ASCT. The 1-, 2-, 3-, 4- and 5-year survival probability estimates were higher for early ASCT versus no early ASCT at 99, 93, 91, 85 and 80% versus 94, 84, 75, 65 and 57%, respectively. The median overall survival (OS) in the early versus no early ASCT group was not reached (NR) versus 5.78 years. In patients 50, 0.25). In patients ⩾65 years of age, median OS in the early versus no early ASCT was NR versus 5.11 years. ASCT dropped out of statistical significance (P=0.080). Patients opting for ASCT after induction Ld/LD had a higher survival probability and improvement in OS regardless of dexamethasone dose density.

Comparison of transmission dynamics between Streptococcus uberis and Streptococcus agalactiae intramammary infections.

Science.gov (United States)

Leelahapongsathon, Kansuda; Schukken, Ynte Hein; Pinyopummintr, Tanu; Suriyasathaporn, Witaya

2016-02-01

The objectives of study were to determine the transmission parameters (β), durations of infection, and basic reproductive numbers (R0) of both Streptococcus agalactiae and Streptococcus uberis as pathogens causing mastitis outbreaks in dairy herds. A 10-mo longitudinal study was performed using 2 smallholder dairy herds with mastitis outbreaks caused by Strep. agalactiae and Strep. uberis, respectively. Both herds had poor mastitis control management and did not change their milking management during the entire study period. Quarter milk samples were collected at monthly intervals from all lactating animals in each herd for bacteriological identification. The durations of infection for Strep. uberis intramammary infection (IMI) and Strep. agalactiae IMI were examined using Kaplan-Meier survival curves, and the Kaplan-Meier survival functions for Strep. uberis IMI and Strep. agalactiae IMI were compared using log rank survival-test. The spread of Strep. uberis and Strep. agalactiae through the population was determined by transmission parameter, β, the probability per unit of time that one infectious quarter will infect another quarter, assuming that all other quarters are susceptible. For the Strep. uberis outbreak herd (31 cows), 56 new infections and 28 quarters with spontaneous cure were observed. For the Strep. agalactiae outbreak herd (19 cows), 26 new infections and 9 quarters with spontaneous cure were observed. The duration of infection for Strep. agalactiae (mean=270.84 d) was significantly longer than the duration of infection for Strep. uberis (mean=187.88 d). The transmission parameters (β) estimated (including 95% confidence interval) for Strep. uberis IMI and Strep. agalactiae IMI were 0.0155 (0.0035-0.0693) and 0.0068 (0.0008-0.0606), respectively. The R0 (including 95% confidence interval) during the study were 2.91 (0.63-13.47) and 1.86 (0.21-16.61) for Strep. uberis IMI and Strep. agalactiae IMI, respectively. In conclusion, the transmission

A versatile curve-fit model for linear to deeply concave rank abundance curves

NARCIS (Netherlands)

Neuteboom, J.H.; Struik, P.C.

2005-01-01

A new, flexible curve-fit model for linear to concave rank abundance curves was conceptualized and validated using observational data. The model links the geometric-series model and log-series model and can also fit deeply concave rank abundance curves. The model is based ¿ in an unconventional way

A combined QSAR and partial order ranking approach to risk assessment.

Science.gov (United States)

Carlsen, L

2006-04-01

QSAR generated data appear as an attractive alternative to experimental data as foreseen in the proposed new chemicals legislation REACH. A preliminary risk assessment for the aquatic environment can be based on few factors, i.e. the octanol-water partition coefficient (Kow), the vapour pressure (VP) and the potential biodegradability of the compound in combination with the predicted no-effect concentration (PNEC) and the actual tonnage in which the substance is produced. Application of partial order ranking, allowing simultaneous inclusion of several parameters leads to a mutual prioritisation of the investigated substances, the prioritisation possibly being further analysed through the concept of linear extensions and average ranks. The ranking uses endpoint values (log Kow and log VP) derived from strictly linear 'noise-deficient' QSAR models as input parameters. Biodegradation estimates were adopted from the BioWin module of the EPI Suite. The population growth impairment of Tetrahymena pyriformis was used as a surrogate for fish lethality.

[Computerized ranking test in three French universities: Staff experience and students' feedback].

Science.gov (United States)

Roux, D; Meyer, G; Cymbalista, F; Bouaziz, J-D; Falgarone, G; Tesniere, A; Gervais, J; Cariou, A; Peffault de Latour, R; Marat, M; Moenaert, E; Guebli, T; Rodriguez, O; Lefort, A; Dreyfuss, D; Hajage, D; Ricard, J-D

2016-03-01

The year 2016 will be pivotal for the evaluation of French medical students with the introduction of the first computerized National Ranking Test (ECNi). The SIDES, online electronic system for medical student evaluation, was created for this purpose. All the universities have already organized faculty exams but few a joint computerized ranking test at several universities simultaneously. We report our experience on the organization of a mock ECNi by universities Paris Descartes, Paris Diderot and Paris 13. Docimological, administrative and technical working groups were created to organize this ECNi. Students in their fifth year of medical studies, who will be the first students to sit for the official ECNi in 2016, were invited to attend this mock exam that represented more than 50% of what will be proposed in 2016. A final electronic questionnaire allowed a docimological and organizational evaluation by students. An analysis of ratings and rankings and their distribution on a 1000-point scale were performed. Sixty-four percent of enrolled students (i.e., 654) attended the three half-day exams. No difference in total score and ranking between the three universities was observed. Students' feedback was extremely positive. Normalized over 1000 points, 99% of students were scored on 300 points only. Progressive clinical cases were the most discriminating test. The organization of a mock ECNi involving multiple universities was a docimological and technical success but required an important administrative, technical and teaching investment. Copyright © 2016 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.

Regional Lymph Node Uptake of [{sup 18}F]Fluorodeoxyglucose After Definitive Chemoradiation Therapy Predicts Local-Regional Failure of Locally Advanced Non-Small Cell Lung Cancer: Results of ACRIN 6668/RTOG 0235

Energy Technology Data Exchange (ETDEWEB)

Markovina, Stephanie [Mallinckrodt Institute of Radiology and Alvin J. Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri (United States); Duan, Fenghai [Department of Biostatistics and Center for Statistical Sciences, Brown University School of Public Health, Providence, Rhode Island (United States); Snyder, Bradley S. [Center for Statistical Sciences, Brown University School of Public Health, Providence, Rhode Island (United States); Siegel, Barry A. [Mallinckrodt Institute of Radiology and Alvin J. Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri (United States); Machtay, Mitchell [Department of Radiation Oncology, Case Western Reserve University, Cleveland, Ohio (United States); Bradley, Jeffrey D., E-mail: jbradley@radonc.wustl.edu [Mallinckrodt Institute of Radiology and Alvin J. Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri (United States)

2015-11-01

Purpose: The American College of Radiology Imaging Network (ACRIN) 6668/Radiation Therapy Oncology Group (RTOG) 0235 study demonstrated that standardized uptake values (SUV) on post-treatment [{sup 18}F]fluorodeoxyglucose-positron emission tomography (FDG-PET) correlated with survival in locally advanced non-small cell lung cancer (NSCLC). This secondary analysis determined whether SUV of regional lymph nodes (RLNs) on post-treatment FDG-PET correlated with patient outcomes. Methods and Materials: Included for analysis were patients treated with concurrent chemoradiation therapy, using radiation doses ≥60 Gy, with identifiable FDG-avid RLNs (distinct from primary tumor) on pretreatment FDG-PET, and post-treatment FDG-PET data. ACRIN core laboratory SUV measurements were used. Event time was calculated from the date of post-treatment FDG-PET. Local-regional failure was defined as failure within the treated RT volume and reported by the treating institution. Statistical analyses included Wilcoxon signed rank test, Kaplan-Meier curves (log rank test), and Cox proportional hazards regression modeling. Results: Of 234 trial-eligible patients, 139 (59%) had uptake in both primary tumor and RLNs on pretreatment FDG-PET and had SUV data from post-treatment FDG-PET. Maximum SUV was greater for primary tumor than for RLNs before treatment (P<.001) but not different post-treatment (P=.320). Post-treatment SUV of RLNs was not associated with overall survival. However, elevated post-treatment SUV of RLNs, both the absolute value and the percentage of residual activity compared to the pretreatment SUV were associated with inferior local-regional control (P<.001). Conclusions: High residual metabolic activity in RLNs on post-treatment FDG-PET is associated with worse local-regional control. Based on these data, future trials evaluating a radiation therapy boost should consider inclusion of both primary tumor and FDG-avid RLNs in the boost volume to maximize local

Regional Lymph Node Uptake of ["1"8F]Fluorodeoxyglucose After Definitive Chemoradiation Therapy Predicts Local-Regional Failure of Locally Advanced Non-Small Cell Lung Cancer: Results of ACRIN 6668/RTOG 0235

International Nuclear Information System (INIS)

Markovina, Stephanie; Duan, Fenghai; Snyder, Bradley S.; Siegel, Barry A.; Machtay, Mitchell; Bradley, Jeffrey D.

2015-01-01

Purpose: The American College of Radiology Imaging Network (ACRIN) 6668/Radiation Therapy Oncology Group (RTOG) 0235 study demonstrated that standardized uptake values (SUV) on post-treatment ["1"8F]fluorodeoxyglucose-positron emission tomography (FDG-PET) correlated with survival in locally advanced non-small cell lung cancer (NSCLC). This secondary analysis determined whether SUV of regional lymph nodes (RLNs) on post-treatment FDG-PET correlated with patient outcomes. Methods and Materials: Included for analysis were patients treated with concurrent chemoradiation therapy, using radiation doses ≥60 Gy, with identifiable FDG-avid RLNs (distinct from primary tumor) on pretreatment FDG-PET, and post-treatment FDG-PET data. ACRIN core laboratory SUV measurements were used. Event time was calculated from the date of post-treatment FDG-PET. Local-regional failure was defined as failure within the treated RT volume and reported by the treating institution. Statistical analyses included Wilcoxon signed rank test, Kaplan-Meier curves (log rank test), and Cox proportional hazards regression modeling. Results: Of 234 trial-eligible patients, 139 (59%) had uptake in both primary tumor and RLNs on pretreatment FDG-PET and had SUV data from post-treatment FDG-PET. Maximum SUV was greater for primary tumor than for RLNs before treatment (P<.001) but not different post-treatment (P=.320). Post-treatment SUV of RLNs was not associated with overall survival. However, elevated post-treatment SUV of RLNs, both the absolute value and the percentage of residual activity compared to the pretreatment SUV were associated with inferior local-regional control (P<.001). Conclusions: High residual metabolic activity in RLNs on post-treatment FDG-PET is associated with worse local-regional control. Based on these data, future trials evaluating a radiation therapy boost should consider inclusion of both primary tumor and FDG-avid RLNs in the boost volume to maximize local-regional control.

Inflation of type I error rates by unequal variances associated with parametric, nonparametric, and Rank-Transformation Tests

Directory of Open Access Journals (Sweden)

Donald W. Zimmerman

2004-01-01

Full Text Available It is well known that the two-sample Student t test fails to maintain its significance level when the variances of treatment groups are unequal, and, at the same time, sample sizes are unequal. However, introductory textbooks in psychology and education often maintain that the test is robust to variance heterogeneity when sample sizes are equal. The present study discloses that, for a wide variety of non-normal distributions, especially skewed distributions, the Type I error probabilities of both the t test and the Wilcoxon-Mann-Whitney test are substantially inflated by heterogeneous variances, even when sample sizes are equal. The Type I error rate of the t test performed on ranks replacing the scores (rank-transformed data is inflated in the same way and always corresponds closely to that of the Wilcoxon-Mann-Whitney test. For many probability densities, the distortion of the significance level is far greater after transformation to ranks and, contrary to known asymptotic properties, the magnitude of the inflation is an increasing function of sample size. Although nonparametric tests of location also can be sensitive to differences in the shape of distributions apart from location, the Wilcoxon-Mann-Whitney test and rank-transformation tests apparently are influenced mainly by skewness that is accompanied by specious differences in the means of ranks.

Association between Low Serum Bicarbonate Concentrations and Cardiovascular Disease in Patients in the End-Stage of Renal Disease

Directory of Open Access Journals (Sweden)

Vaia D. Raikou

2016-11-01

Full Text Available Background: Metabolic acidosis, a common condition particularly in the end-stage of renal disease patients, results in malnutrition, inflammation and oxidative stress. In this study, we focused on the association between low serum bicarbonate and cardiovascular disease in patients on intermittent dialysis. Methods: We studied 52 on-line-pre-dilution hemodiafiltration (on-l HDF patients, 32 males and 20 females, with a mean age of 58.01 ± 15.4 years old. Metabolic acidosis was determined by serum bicarbonate concentrations less than 22 mmol/L. Residual renal function (RRF was defined by interdialytic urine volume. Kaplan–Meier curves and Cox regression models were performed to predict coronary artery disease (CAD, defined by ejection fraction <50%, or diastolic dysfunction congestive heart failure (CHF and peripheral vascular disease (PVD. Results: Kaplan–Meier analyses showed that a lower or higher than 22 mmol/L serum bicarbonate metabolic acidosis status was significantly associated with both PVD and diastolic dysfunction (log-rank = 5.07, p = 0.02 and log-rank = 5.84, p = 0.01, respectively. A similar prevalence of serum bicarbonate on CAD or CHF by low ejection fraction was not shown. The RRF was associated with PVD event and serum bicarbonate less than 22 mmol/L (log-rank = 5.49, p = 0.01 and log-rank = 3.9, p = 0.04, respectively. Cox regression analysis revealed that serum bicarbonate and RRF were significant risk factors for PVD after adjustment for confounders. Furthermore, RRF adjusted for covariates was shown to be a significant risk factor for diastolic dysfunction. Conclusion: Low serum bicarbonate was associated with peripheral vascular disease and diastolic dysfunction in intermittent dialysis. The residual renal function may impact patients’ outcomes through its relationship with metabolic acidosis status, particularly for peripheral vascular disease manifestation.

Synergistic Effects of Citalopram and Morphine in the Renal Colic Pain Relief; a Randomized Clinical Trial

Directory of Open Access Journals (Sweden)

Mehrdad Esmailian

2014-03-01

Full Text Available Introduction: Although the synergistic effects of opioids and other analgesic drugs such as non-steroidal anti-inflammatory drugs (NSAIDs have been established in relieving acute pain due to renal calculi, no studies today have evaluated the concomitant administration of opiates and other drugs with analgesic effects, such as serotonin re-uptake inhibitors. Considering the high prevalence of renal colic, the present study was carried out to compare the effect of concomitant prescription of morphine and a placebo with that of morphine and citalopram on the management of acute pain due to renal calculi. Methods: The present double-blind randomized clinical trial was carried out from October 2012 to March 2013 in the Al-Zahra educational Hospital in Isfahan, Iran. A total of 90 patients with acute renal colic pain were randomly divided into two groups of 45 subjects. The subjects in one group received morphine/ placebo and another one morphine/citalopram. The patients’ pain severity was determined by visual analogue scale (VAS before and 20 minutes after administration of medications. In case of persistent pain the second or even third dose was administered and the pain severity was once again determined. Data were analyzed with STATA 11.0 using chi-squared, two-way ANOVA, Bonferroni post hoc test, and log rank test. Results: The decrease in pain severity in the morphine/citalopram group was significantly compared to the morphine/placebo group and the time before administration of the medications (p<0.001. In contrast, administration of morphine/placebo did not have a significant effect on pain severity at this interval (p=0.32. Kaplan-Meier curve showed that the first injection was successful in relieving pain in 15 (33.3% and 26 (57.8% subjects in the morphine/placebo and morphine/citalopram groups, respectively. The second injection of these medications resulted in therapeutic success in 35 (87.8% and 42 (95.6% subjects in the above groups

Edge Contrast of the FLAIR Hyperintense Region Predicts Survival in Patients with High-Grade Gliomas following Treatment with Bevacizumab.

Science.gov (United States)

Bahrami, N; Piccioni, D; Karunamuni, R; Chang, Y-H; White, N; Delfanti, R; Seibert, T M; Hattangadi-Gluth, J A; Dale, A; Farid, N; McDonald, C R

2018-04-05

Treatment with bevacizumab is standard of care for recurrent high-grade gliomas; however, monitoring response to treatment following bevacizumab remains a challenge. The purpose of this study was to determine whether quantifying the sharpness of the fluid-attenuated inversion recovery hyperintense border using a measure derived from texture analysis-edge contrast-improves the evaluation of response to bevacizumab in patients with high-grade gliomas. MRIs were evaluated in 33 patients with high-grade gliomas before and after the initiation of bevacizumab. Volumes of interest within the FLAIR hyperintense region were segmented. Edge contrast magnitude for each VOI was extracted using gradients of the 3D FLAIR images. Cox proportional hazards models were generated to determine the relationship between edge contrast and progression-free survival/overall survival using age and the extent of surgical resection as covariates. After bevacizumab, lower edge contrast of the FLAIR hyperintense region was associated with poorer progression-free survival ( P = .009) and overall survival ( P = .022) among patients with high-grade gliomas. Kaplan-Meier curves revealed that edge contrast cutoff significantly stratified patients for both progression-free survival (log-rank χ 2 = 8.3, P = .003) and overall survival (log-rank χ 2 = 5.5, P = .019). Texture analysis using edge contrast of the FLAIR hyperintense region may be an important predictive indicator in patients with high-grade gliomas following treatment with bevacizumab. Specifically, low FLAIR edge contrast may partially reflect areas of early tumor infiltration. This study adds to a growing body of literature proposing that quantifying features may be important for determining outcomes in patients with high-grade gliomas. © 2018 by American Journal of Neuroradiology.

A multivariate rank test for comparing mass size distributions

KAUST Repository

Lombard, F.

2012-04-01

Particle size analyses of a raw material are commonplace in the mineral processing industry. Knowledge of particle size distributions is crucial in planning milling operations to enable an optimum degree of liberation of valuable mineral phases, to minimize plant losses due to an excess of oversize or undersize material or to attain a size distribution that fits a contractual specification. The problem addressed in the present paper is how to test the equality of two or more underlying size distributions. A distinguishing feature of these size distributions is that they are not based on counts of individual particles. Rather, they are mass size distributions giving the fractions of the total mass of a sampled material lying in each of a number of size intervals. As such, the data are compositional in nature, using the terminology of Aitchison [1] that is, multivariate vectors the components of which add to 100%. In the literature, various versions of Hotelling\\'s T 2 have been used to compare matched pairs of such compositional data. In this paper, we propose a robust test procedure based on ranks as a competitor to Hotelling\\'s T 2. In contrast to the latter statistic, the power of the rank test is not unduly affected by the presence of outliers or of zeros among the data. © 2012 Copyright Taylor and Francis Group, LLC.

Effect of tooth whitening strips on fatigue resistance and flexural strength of bovine dentin in vitro.

Directory of Open Access Journals (Sweden)

Laura E Tam

Full Text Available To determine the effects of whitening strips on bovine dentin fatigue resistance and flexural strength in vitro.A total of eighty bovine dentin specimens (2x2x17mm were treated with either: control glycerine gel on plastic film wrap or whitening strips containing 9.5% hydrogen peroxide. Treatment was applied for 30 minutes, twice a day, for 1- or 4-weeks. After the last treatment, ten specimens per group were randomly selected to undergo fatigue testing (106 cycles, 3Hz, 20N while the other ten were subjected to flexural strength testing after ten days of storage in artificial saliva. Kaplan-Meier method with a log rank test, Wilcoxon test and Cox regression were used to assess fatigue test results (p<0.05. One-way ANOVA and Tukey's tests were used to compare the flexural strength results (p<0.05.There were significant differences in survival during the fatigue test among the groups (p<0.001. Treatment (control or bleach was a significant factor for specimen survival (p<0.001, Exp(B = 33.45. There were significant differences in mean flexural strength (p<0.001. No significant difference was found between "1-wk control" and "4-wk control". The mean flexural strength and fatigue resistance of the "4-wk bleach" were significantly lower than all the other groups.The use of whitening strips reduced the fatigue resistance and flexural strength of bovine dentin in vitro. Until the effect of whitening strips on mechanical properties of human dentin is fully elucidated, it remains prudent to advise patients to avoid excessive direct use of whitening strips on dentin.

Testing rank-dependent utility theory for health outcomes.

Science.gov (United States)

Oliver, Adam

2003-10-01

Systematic violations of expected utility theory (EU) have been reported in the context of both money and health outcomes. Rank-dependent utility theory (RDU) is currently the most popular and influential alternative theory of choice under circumstances of risk. This paper reports a test of the descriptive performance of RDU compared to EU in the context of health. When one of the options is certain, violations of EU that can be explained by RDU are found. When both options are risky, no evidence that RDU is a descriptive improvement over EU is found, though this finding may be due to the low power of the tests. Copyright 2002 John Wiley & Sons, Ltd.

Impact of prior urethral manipulation on outcome of anastomotic urethroplasty for post-traumatic urethral stricture.

Science.gov (United States)

Singh, Bhupendra P; Andankar, Mukund G; Swain, Sanjaya K; Das, Krishanu; Dassi, Vimal; Kaswan, Harish K; Agrawal, Vipul; Pathak, Hemant R

2010-01-01

To determine the impact of earlier urethral interventions on the outcomes of anastomotic urethroplasty in post-traumatic stricture urethra. From October 1995 to March 2008, a total of 58 patients with post-traumatic posterior urethral stricture underwent anastomotic urethroplasty. Eighteen patients had earlier undergone urethral intervention in the form of urethrotomy (3), endoscopic realignment (7), or open urethroplasty (8). Success was defined as no obstructive urinary symptoms, maximum urine flow rate > or = 15 mL/s, normal urethral imaging and/or urethroscopy, and no need of any intervention in the follow-up period. Patients who met the above objective criteria after needing 1 urethrotomy following urethroplasty were defined to have satisfactory outcome and were included in satisfactory result rate along with patients who had a successful outcome. Results were analyzed using unpaired t test, chi-square test, binary logistic regression, Kaplan-Meier curves, and log rank test. Previous interventions in the form of endoscopic realignment or urethroplasty have significant adverse effect on the success rate of subsequent anastomotic urethroplasty for post-traumatic posterior urethral strictures (P urethrotomies (up to 2 times) did not affect the outcome of subsequent anastomotic urethroplasty. Length of stricture and age of patient did not predict the outcome in traumatic posterior urethral strictures in logistic regression analysis. Previous failed railroading or urethroplasty significantly decrease the success of subsequent anastomotic urethroplasty. Hence, a primary realignment or urethroplasty should be avoided in suboptimal conditions and the cases of post-traumatic urethral stricture should be referred to centers with such expertise. 2010 Elsevier Inc. All rights reserved.

Experience in the management of ECMO therapy as a mortality risk factor.

Science.gov (United States)

Guilló Moreno, V; Gutiérrez Martínez, A; Romero Berrocal, A; Sánchez Castilla, M; García-Fernández, J

2018-02-01

The extracorporeal oxygenation membrane (ECMO) is a system that provides circulatory and respiratory assistance to patients in cardiac or respiratory failure refractory to conventional treatment. It is a therapy with numerous associated complications and high mortality. Multidisciplinary management and experienced teams increase survival. Our purpose is to evaluate and analyse the effect of the learning curve on mortality. Retrospective and observational study of 31 patients, from January 2012 to December 2015. Patients were separated into 2periods. These periods were divided by the establishment of an ECMO protocol. We compared the quantitative variables by performing the Mann-Whitney U test. For the categorical qualitative variables we performed the chi-square test or Fisher exact statistic as appropriate. The survival curve was computed using the Kaplan-Meier method, and the analysis of statistical significance using the Log-rank test. Data analysis was performed with the STATA programme 14. Survival curves show the tendency to lower mortality in the subsequent period (P=0.0601). The overall mortality rate in the initial period was higher than in the subsequent period (P=0.042). In another analysis, we compared the characteristics of the 2groups and concluded that they were homogeneous. The degree of experience is an independent factor for mortality. The application of a care protocol is fundamental to facilitate the management of ECMO therapy. Copyright © 2017 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry.

Science.gov (United States)

Gawlick, Ute; Lu, Kim C; Douthit, Miriam A; Diggs, Brian S; Schuff, Kathryn G; Herzig, Daniel O; Tsikitis, Vassiliki L

2013-05-01

Determining the molecular profile of colon and rectal cancers offers the possibility of personalized cancer treatment. The purpose of this study was to determine whether known genetic mutations associated with colorectal carcinogenesis differ between colon and rectal cancers and whether they are associated with survival. The Oregon Colorectal Cancer Registry is a prospectively maintained, institutional review board-approved tissue repository with associated demographic and clinical information. The registry was queried for any patient with molecular analysis paired with clinical data. Patient demographics, tumor characteristics, microsatellite instability status, and mutational analysis for p53, AKT, BRAF, KRAS, MET, NRAS, and PIK3CA were analyzed. Categorical variables were compared using chi-square tests. Continuous variables between groups were analyzed using Mann-Whitney U tests. Kaplan-Meier analysis was used for survival studies. Comparisons of survival were made using log-rank tests. The registry included 370 patients: 69% with colon cancer and 31% with rectal cancer. Eighty percent of colon cancers and 68% of rectal cancers were stages III and IV. Mutational analysis found no significant differences in detected mutations between colon and rectal cancers, except that there were significantly more BRAF mutations in colon cancers compared with rectal cancers (10% vs 0%, P colon versus rectal cancers when stratified by the presence of KRAS, PIK3CA, and BRAF mutations. Stage III and IV colon and rectal cancers share similar molecular profiles, except that there were significantly more BRAF mutations in colon cancers compared with rectal cancers. Copyright © 2013 Elsevier Inc. All rights reserved.

La competitividad logística en Latinoamérica: índice logístico vs. propuesta metodológica

Directory of Open Access Journals (Sweden)

Marco Alberto Valenzo Jiménez

2016-02-01

Full Text Available Este artículo muestra la situación actual de la competitividad logística en los países latinoamericanos, tomando como base el informe denominado “Connecting to Compite” (Trade Logistics in the Global Economy, 2007 del Banco Mundial. Este informe muestra el ranking de las posiciones que tienen los países latinoamericanos en materia de logística y en el cual se analizan las variables —aduanas, infraestructura, embarques internacionales, competencia logística, trazabilidad y seguimiento, costos logísticos domésticos y tiempo de entrega— que contiene la metodología utilizada por el Banco Mundial. La plataforma de estudio de este artículo parte del índice de competitividad logística, que, mediante la aplicación de la metodología “Valenzo – Martínez” permite analizar la base de datos de una manera más profunda, y da como resultado una escala de competitividad logística que nos muestra el nivel general de la competitividad logística en Latinoamérica, así como también el nivel de competitividad por variable, para, de esta manera, permitir una fácil interpretación de los resultados.

Optimizing Earth Data Search Ranking using Deep Learning and Real-time User Behaviour

Science.gov (United States)

Jiang, Y.; Yang, C. P.; Armstrong, E. M.; Huang, T.; Moroni, D. F.; McGibbney, L. J.; Greguska, F. R., III

2017-12-01

Finding Earth science data has been a challenging problem given both the quantity of data available and the heterogeneity of the data across a wide variety of domains. Current search engines in most geospatial data portals tend to induce end users to focus on one single data characteristic dimension (e.g., term frequency-inverse document frequency (TF-IDF) score, popularity, release date, etc.). This approach largely fails to take account of users' multidimensional preferences for geospatial data, and hence may likely result in a less than optimal user experience in discovering the most applicable dataset out of a vast range of available datasets. With users interacting with search engines, sufficient information is already hidden in the log files. Compared with explicit feedback data, information that can be derived/extracted from log files is virtually free and substantially more timely. In this dissertation, I propose an online deep learning framework that can quickly update the learning function based on real-time user clickstream data. The contributions of this framework include 1) a log processor that can ingest, process and create training data from web logs in a real-time manner; 2) a query understanding module to better interpret users' search intent using web log processing results and metadata; 3) a feature extractor that identifies ranking features representing users' multidimensional interests of geospatial data; and 4) a deep learning based ranking algorithm that can be trained incrementally using user behavior data. The search ranking results will be evaluated using precision at K and normalized discounted cumulative gain (NDCG).

Risk factors associated with prognosis of progressive stages of acute-on-chronic hepatitis B liver failure

Directory of Open Access Journals (Sweden)

YE Peiyan

2013-04-01

Full Text Available ObjectiveTo identify the risk factors associated with progression of acute-on-chronic liver failure (ACLF occurring in patients with chronic hepatitis B virus (HBV infection (CHB. MethodsThe clinical, demographic, treatment and outcome data of 180 ACLF patients with concomitant CHB managed in our hospital between June 2009 and September 2012 were retrospectively reviewed. Clinical data, taken at baseline, included markers of inflammation/infection (white blood cell (WBC count, coagulation (prothrombin time (PT and prothrombin activity (PTA, and liver function (alanine aminotransferase (ALT, aspartate aminotransferase (AST, total bilirubin (TBil, direct bilirubin (DBil, choninesterase (CHE, albumin (Alb, globulin (Glb, total cholesterol (TC, and ammonia. In-hospital treatments included supplementation with traditional Chinese medicine-based therapies, such as Tuihuang decoction and detoxification enema. The primary outcome was survival during hospitalization. The patients were grouped for analysis according to ACLF stage (early, n=93; mid, n=61; late, n=26 and the risk factors associated with each stage were identified by using univariate (log-rank test and multivariate (Cox’s test regression analyses. The association of risk factors with patient survival was assessed by Kaplan-Meier curve analysis. ResultsThe three ACLF groups showed significantly different amounts of leukocytes, with the late ACLF group showing the highest WBC. The late ACLF group also showed significantly lower Glb and TC. There was a trend in reduced cumulative survival rate and shorter time to death that significantly corresponded to progressive stages of ACLF (early ACLF＞mid ACLF＞late ACLF; all P＜0.001. One-hundred-and-twenty-six (70.0% of the patients died during their hospitalization, and multivariate regression analysis of this entire patient population identified absence of colonic enema, presence of hepatic encephalopathy, presence of hepatorenal syndrome, PTA

Survival benefits of remote ischemic conditioning in sepsis.

Science.gov (United States)

Joseph, Bellal; Khalil, Mazhar; Hashmi, Ammar; Hecker, Louise; Kulvatunyou, Narong; Tang, Andrew; Friese, Randall S; Rhee, Peter

2017-06-01

Sepsis remains the leading cause of death in the surgical intensive care unit. Prior studies have demonstrated a survival benefit of remote ischemic conditioning (RIC) in many disease states. The aim of this study was to determine the effects of RIC on survival in sepsis in an animal model and to assess alterations in inflammatory biochemical profiles. We hypothesized that RIC alters inflammatory biochemical profiles resulting in decreased mortality in a septic mouse model. Eight to 12 week C57BL/6 mice received intra-peritoneal injection of 12.5-mg/kg lipopolysaccharide (LPS). Septic animals in the experimental group underwent RIC at 0, 2, and 6 h after LPS by surgical exploration and alternate clamping of the femoral artery. Six 4-min cycles of ischemia-reperfusion were performed. Primary outcome was survival at 5-d after LPS injection. Secondary outcome was to assess the following serum cytokine levels: interferon-γ (IFN-γ), interleukin (IL)-10, IL-1β, and tumor necrosis factoralpha (TNFα) at the baseline before LPS injection, 0 hour after LPS injection, and at 2, 4, 24 hours after induction of sepsis (RIC was performed at 2 h after LPS injection). Kaplan-Meier survival analysis and log-rank test were used. ANOVA test was used to compare cytokine measurements. We performed experiments on 44 mice: 14 sham and 30 RIC mice (10 at each time point). Overall survival was higher in the experimental group compared to the sham group (57% versus 21%; P = 0.02), with the highest survival rate observed in the 2-hour post-RIC group (70%). On Kaplan-Meier analysis, 2-h post-RIC group had increased survival at 5 days after LPS (P = 0.04) with hazard ratio of 0.3 (95% confidence interval = 0.09-0.98). In the RIC group, serum concentrations of IFN-γ, IL-10, IL-1β, and TNFα peaked at 2 h after LPS and then decreased significantly over 24 hours (P sepsis and has the potential for implementation in the clinical practice. Early implementation of RIC may play an

Predictive value of CHFR and MLH1 methylation in human gastric cancer.

Science.gov (United States)

Li, Yazhuo; Yang, Yunsheng; Lu, Youyong; Herman, James G; Brock, Malcolm V; Zhao, Po; Guo, Mingzhou

2015-04-01

Gastric carcinoma (GC) has one of the highest mortality rates of cancer diseases and has a high incidence rate in China. Palliative chemotherapy is the main treatment for advanced gastric cancer. It is necessary to compare the effectiveness and toxicities of different regimens. This study explores the possibility of methylation of DNA damage repair genes serving as a prognostic and chemo-sensitive marker in human gastric cancer. The methylation status of five DNA damage repair genes (CHFR, FANCF, MGMT, MLH1, and RASSF1A) was detected by nested methylation-specific PCR in 102 paraffin-embedded gastric cancer samples. Chi-square or Fisher's exact tests were used to evaluate the association of methylation status and clinic-pathological factors. The Kaplan-Meier method and Cox proportional hazards models were employed to analyze the association of methylation status and chemo-sensitivity. The results indicate that CHFR, MLH1, RASSF1A, MGMT, and FANCF were methylated in 34.3% (35/102), 21.6% (22/102), 12.7% (13/102), 9.8% (10/102), and 0% (0/102) of samples, respectively. No association was found between methylation of CHFR, MLH1, RASSF1A, MGMT, or FANCF with gender, age, tumor size, tumor differentiation, lymph node metastasis, and TNM stage. In docetaxel-treated gastric cancer patients, resistance to docetaxel was found in CHFR unmethylated patients by Cox proportional hazards model (HR 0.243, 95% CI, 0.069-0.859, p = 0.028), and overall survival is longer in the CHFR methylated group compared with the CHFR unmethylated group (log-rank, p = 0.036). In oxaliplatin-treated gastric cancer patients, resistance to oxaliplatin was found in MLH1 methylated patients (HR 2.988, 95% CI, 1.064-8.394, p = 0.038), and overall survival was longer in the MLH1 unmethylated group compared with the MLH1 methylated group (log-rank, p = 0.046). CHFR is frequently methylated in human gastric cancer, and CHFR methylation may serve as a docetaxel-sensitive marker. MLH1 methylation was

Standard of Care Versus Metastases-directed Therapy for PET-detected Nodal Oligorecurrent Prostate Cancer Following Multimodality Treatment: A Multi-institutional Case-control Study.

Science.gov (United States)

Steuber, T; Jilg, C; Tennstedt, P; De Bruycker, A; Tilki, D; Decaestecker, K; Zilli, T; Jereczek-Fossa, B A; Wetterauer, U; Grosu, A L; Schultze-Seemann, W; Heinzer, H; Graefen, M; Morlacco, A; Karnes, R J; Ost, P

2018-03-10

Most prostate cancer (PCa) patients with a biochemical failure following primary multimodality treatment (surgery and postoperative radiotherapy) relapse in the nodes. To perform a matched-case analysis in men with lymph node recurrent PCa comparing standard of care (SOC) with metastasis-directed therapy (MDT). PCa patients with a prostate-specific antigen (PSA) progression following multimodality treatment were included in this retrospective multi-institutional analysis. The SOC cohort (n=1816) received immediate or delayed androgen deprivation therapy administered at PSA progression. The MDT cohort (n=263) received either salvage lymph node dissection (n=166) or stereotactic body radiotherapy (n=97) at PSA progression to a positron emission tomography-detected nodal recurrence. The primary endpoint, cancer-specific survival (CSS), was analyzed using the Kaplan-Meier method, log-rank test, Cox proportional hazards models, and propensity score-matched analyses. At a median follow-up of 70 (interquartile range: 48-98) mo, MDT was associated with an improved CSS on univariate (p=0.029) and multivariate analysis (hazard ratio: 0.33, 95% confidence interval [CI]: 0.17-0.64) adjusted for the year of radical prostatectomy (RP), age at RP, PSA at RP, time from RP to PSA progression, Gleason score, surgical margin status, pT- and pN-stage. In total, 659 men were matched (3:1 ratio). The 5-yr CSS was 98.6% (95% CI: 94.3-99.6) and 95.7% (95% CI: 93.2-97.3) for MDT and SOC, respectively (p=0.005, log-rank). The main limitations of our study are its retrospective design and lack of standardization of systemic treatment in the SOC cohort. MDT for nodal oligorecurrent PCa improves CSS as compared with SOC. These retrospective data from a multi-institutional pooled analysis should be considered as hypothesis-generating and inform future randomized trials in this setting. Prostate cancer patients experiencing a lymph node recurrence might benefit from local treatments directed at

Chronic consequences of acute injuries: worse survival after discharge.

Science.gov (United States)

Shafi, Shahid; Renfro, Lindsay A; Barnes, Sunni; Rayan, Nadine; Gentilello, Larry M; Fleming, Neil; Ballard, David

2012-09-01

The Trauma Quality Improvement Program uses inhospital mortality to measure quality of care, which assumes patients who survive injury are not likely to suffer higher mortality after discharge. We hypothesized that survival rates in trauma patients who survive to discharge remain stable afterward. Patients treated at an urban Level I trauma center (2006-2008) were linked with the Social Security Administration Death Master File. Survival rates were measured at 30, 90, and 180 days and 1 and 2 years from injury among two groups of trauma patients who survived to discharge: major trauma (Abbreviated Injury Scale score ≥ 3 injuries, n = 2,238) and minor trauma (Abbreviated Injury Scale score ≤ 2 injuries, n = 1,171). Control groups matched to each trauma group by age and sex were simulated from the US general population using annual survival probabilities from census data. Kaplan-Meier and log-rank analyses conditional upon survival to each time point were used to determine changes in risk of mortality after discharge. Cox proportional hazards models with left truncation at the time of discharge were used to determine independent predictors of mortality after discharge. The survival rate in trauma patients with major injuries was 92% at 30 days posttrauma and declined to 84% by 3 years (p > 0.05 compared with general population). Minor trauma patients experienced a survival rate similar to the general population. Age and injury severity were the only independent predictors of long-term mortality given survival to discharge. Log-rank tests conditional on survival to each time point showed that mortality risk in patients with major injuries remained significantly higher than the general population for up to 6 months after injury. The survival rate of trauma patients with major injuries remains significantly lower than survival for minor trauma patients and the general population for several months postdischarge. Surveillance for early identification and treatment of

Linear accelerator-based stereotactic radiosurgery for brainstem metastases: the Dana-Farber/Brigham and Women's Cancer Center experience.

Science.gov (United States)

Kelly, Paul J; Lin, Yijie Brittany; Yu, Alvin Y C; Ropper, Alexander E; Nguyen, Paul L; Marcus, Karen J; Hacker, Fred L; Weiss, Stephanie E

2011-09-01

To review the safety and efficacy of linear accelerator-based stereotactic radiosurgery (SRS) for brainstem metastases. We reviewed all patients with brain metastases treated with SRS at DF/BWCC from 2001 to 2009 to identify patients who had SRS to a single brainstem metastasis. Overall survival and freedom-from-local failure rates were calculated from the date of SRS using the Kaplan-Meier method. Prognostic factors were evaluated using the log-rank test and Cox proportional hazards model. A total of 24 consecutive patients with brainstem metastases had SRS. At the time of SRS, 21/24 had metastatic lesions elsewhere within the brain. 23/24 had undergone prior WBRT. Primary diagnoses included eight NSCLC, eight breast cancer, three melanoma, three renal cell carcinoma and two others. Median dose was 13 Gy (range, 8-16). One patient had fractionated SRS 5 Gy ×5. Median target volume was 0.2 cc (range, 0.02-2.39). The median age was 57 years (range, 42-92). Follow-up information was available in 22/24 cases. At the time of analysis, 18/22 patients (82%) had died. The median overall survival time was 5.3 months (range, 0.8-21.1 months). The only prognostic factor that trended toward statistical significance for overall survival was the absence of synchronous brain metastasis at the time of SRS; 1-year overall survival was 31% with versus 67% without synchronous brain metastasis (log rank P = 0.11). Non-significant factors included primary tumor histology and status of extracranial disease (progressing vs. stable/absent). Local failure occurred in 4/22 cases (18%). Actuarial freedom from local failure for all cases was 78.6% at 1 year. RTOG grade 3 toxicities were recorded in two patients (ataxia, confusion). Linac-based SRS for small volume brainstem metastases using a median dose of 13 Gy is associated with acceptable local control and low morbidity.

Pretreatment 18F-FDG PET Textural Features in Locally Advanced Non-Small Cell Lung Cancer: Secondary Analysis of ACRIN 6668/RTOG 0235.

Science.gov (United States)

Ohri, Nitin; Duan, Fenghai; Snyder, Bradley S; Wei, Bo; Machtay, Mitchell; Alavi, Abass; Siegel, Barry A; Johnson, Douglas W; Bradley, Jeffrey D; DeNittis, Albert; Werner-Wasik, Maria; El Naqa, Issam

2016-06-01

In a secondary analysis of American College of Radiology Imaging Network (ACRIN) 6668/RTOG 0235, high pretreatment metabolic tumor volume (MTV) on (18)F-FDG PET was found to be a poor prognostic factor for patients treated with chemoradiotherapy for locally advanced non-small cell lung cancer (NSCLC). Here we utilize the same dataset to explore whether heterogeneity metrics based on PET textural features can provide additional prognostic information. Patients with locally advanced NSCLC underwent (18)F-FDG PET prior to treatment. A gradient-based segmentation tool was used to contour each patient's primary tumor. MTV, maximum SUV, and 43 textural features were extracted for each tumor. To address overfitting and high collinearity among PET features, the least absolute shrinkage and selection operator (LASSO) method was applied to identify features that were independent predictors of overall survival (OS) after adjusting for MTV. Recursive binary partitioning in a conditional inference framework was utilized to identify optimal thresholds. Kaplan-Meier curves and log-rank testing were used to compare outcomes among patient groups. Two hundred one patients met inclusion criteria. The LASSO procedure identified 1 textural feature (SumMean) as an independent predictor of OS. The optimal cutpoint for MTV was 93.3 cm(3), and the optimal SumMean cutpoint for tumors above 93.3 cm(3) was 0.018. This grouped patients into three categories: low tumor MTV (n = 155; median OS, 22.6 mo), high tumor MTV and high SumMean (n = 23; median OS, 20.0 mo), and high tumor MTV and low SumMean (n = 23; median OS, 6.2 mo; log-rank P textural PET features in the context of established prognostic factors. We have also identified a promising feature that may have prognostic value in locally advanced NSCLC patients with large tumors who are treated with chemoradiotherapy. Validation studies are warranted. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

Impact of heart rate in atrial fibrillation versus sinus rhythm on mortality in octogenarian patients with acute coronary syndrome.

Science.gov (United States)

Li, Shijun; Barywani, Salim; Fu, Michael

2017-01-01

Association of heart rate (HR) with mortality in patients with acute coronary syndrome (ACS) and aged ≥ 80 years are underrepresented in clinical trials. We therefore aimed to investigate the association of HR in atrial fibrillation (AF) versus sinus rhythm (SR) with all-cause mortality in octogenarian patients with ACS. A total of 336 patients with ACS patients and aged ≥ 80 years were enrolled into the current study. The end point of interest was death from any cause. Association of HR in AF versus SR with mortality was analyzed by Kaplan-Meier curve following log-rank test and multivariable Cox regression analysis. In total, 63 (87.5%) of patients with AF were dead and 147 (59.8%) of patients with SR were dead during the follow-up period. The best cut-off was 80 bpm, with a sensitivity of 62% and specificity of 66%. HR ≤ 80 bpm in SR but not in AF was associated with better outcome as compared with HR > 80 bpm (Chi-Square = 26.55, Log rank P < 0.001). In SR subgroup, the hazard ratios of HR ≤ 80 bpm were 0.51(95% CI 0.37-0.70, P < 0.001) adjusted for age, 0.46 (95%CI 0.33-0.63, P < 0.001) adjusted for gender, 0.62 (95%CI 0.42- 0.93, P = 0.020) adjusted for multivariables respectively. In AF subgroup, the hazard ratios of HR ≤ 80 bpm were 0.83(95% CI 0.49-1.38, P = 0.464) adjusted for age, 0.96 (95%CI 0.59-1.58, P = 0.882) adjusted for gender, 0.72(95% CI 0.41-1.26, P = 0.249) adjusted for multivariables respectively. The current study demonstrates that heart rate is an independent prognostic predictor for all-cause mortality, and HR ≤ 80 bpm is associated with improved outcome in SR but not in AF in octogenarian patients with ACS.

[Correlation between post-stroke pneumonia and outcome in patients with acute brain infarction].

Science.gov (United States)

Li, S J; Hu, H Q; Wang, X L; Cao, B Z

2016-09-20

Objective: To investigate the correlation between post-stroke pneumonia and outcome in patients with acute brain infarction. Methods: Consecutive acute cerebral infarction patients who were hospitalized in Department of Neurology, Jinan Military General Hospital were prospectively recruited from August 2010 to August 2014. The baseline data including age, sex, the National Institute of Health Stroke Scale (NIHSS) scores, type of Oxfordshire Community Stroke Project (OCSP: total anterior circulation infarct, partial anterior circulation infarct, posterior circulation infarct and lacunar infarct), fasting blood glucose etc. after admission were recorded. Post-stroke pneumonia was diagnosed by treating physician according to criteria for hospital-acquired pneumonia of the Centers for Disease Control and Prevention. Recovery was assessed by modified Rankin Scale (mRS) 180 days after stroke by telephone interview (mRS≤2 reflected good prognosis, and mRS>2 reflected unfavorable prognosis). Multinominal Logistic regression analysis, Kaplan-Meier curve and log rank test were used. Results: A total of 1 249 patients were enrolled, among them 173 patients were lost during follow-up. A total of 159 patients had post-stroke pneumonia, while 1 090 patients were without post-stroke. Compared with patients without post-stoke pneumonia, patients with post-stroke pneumonia were older (67±13 vs 63±12 years, P =0.000), more severe (NIHSS, 15(14) vs 4(4), P =0.000). Compared with patients without post-stoke pneumonia, more patients with post-stroke pneumonia suffered from heart failure (12.58% vs 3.40%, P =0.000), atrial fibrillation (26.42% vs 8.81%, P =0.000), myocardial infarction (10.06% vs 5.05%, P =0.016), recurrent brain infarction (30.19% vs 22.66%, P =0.045), total anterior circulation infarct type of OCSP (46.54% vs 19.63%, P =0.000), posterior circulation infarct of OCSP (39.62% vs 25.51%, P =0.001); more patients suffered from disorder of consciousness (60.38% vs 9

Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

OpenAIRE

Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu

2015-01-01

Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...

Logging-while-drilling (LWD) pressure test

Energy Technology Data Exchange (ETDEWEB)

Thirud, Aase P.

2003-07-01

Statoil and Halliburton have completed a successful test of a new ground-breaking formation evaluation technology on the Norwegian shelf. An LWD formation tester, the GeoTapTM sensor, was used to quantify formation pressure during drilling operations. The inaugural job was completed by Halliburton's Sperry-Sun product service line onboard the Bideford Dolphin at the Borg Field while drilling a horizontal production well in the Vigdis Extension development. The GeoTap tool, part of Sperry-Sun's StellarTM MWD/LWT suite, was run in combination with a complete logging-while-drilling sensor package and the Geo-Pilot rotary steerable drilling system. Repeat formation pressures were taken and successfully transmitted to surface. This is the first time this type of technology has been successfully applied on the Norwegian shelf.

Survival and mortality among users and non-users of hydroxyurea with sickle cell disease.

Science.gov (United States)

de Araujo, Olinda Maria Rodrigues; Ivo, Maria Lúcia; Ferreira Júnior, Marcos Antonio; Pontes, Elenir Rose Jardim Cury; Bispo, Ieda Maria Gonçalves Pacce; de Oliveira, Eveny Cristine Luna

2015-01-01

to estimate survival, mortality and cause of death among users or not of hydroxyurea with sickle cell disease. cohort study with retrospective data collection, from 1980 to 2010 of patients receiving inpatient treatment in two Brazilian public hospitals. The survival probability was determined using the Kaplan-Meier estimator, survival calculations (SPSS version 10.0), comparison between survival curves, using the log rank method. The level of significance was p=0.05. of 63 patients, 87% had sickle cell anemia, with 39 using hydroxyurea, with a mean time of use of the drug of 20.0±10.0 years and a mean dose of 17.37±5.4 to 20.94±7.2 mg/kg/day, raising the fetal hemoglobin. In the comparison between those using hydroxyurea and those not, the survival curve was greater among the users (p=0.014). A total of 10 deaths occurred, with a mean age of 28.1 years old, and with Acute Respiratory Failure as the main cause. the survival curve is greater among the users of hydroxyurea. The results indicate the importance of the nurse incorporating therapeutic advances of hydroxyurea in her care actions.

The association between gender and pediatric respiratory morbidity.

Science.gov (United States)

Ben-Shmuel, Atar; Sheiner, Eyal; Wainstock, Tamar; Landau, Daniella; Vaknin, Flear; Walfisch, Asnat

2018-06-26

To evaluate the association between newborn gender and the risk for later pediatric respiratory morbidity. A population based cohort analysis was performed by comparing the risk of long-term respiratory morbidity (until 18 years of age) according to gender. Respiratory morbidity included hospitalizations involving pneumonia, asthma, bronchitis, bronchiolitis, upper respiratory tract infection (URTI), influenza, and bronchiectasis. Deliveries occurred between the years 1991 and 2014 in a tertiary medical center. Kaplan-Meier survival curves were constructed to compare cumulative respiratory morbidity. A Cox proportional hazards model controlled for confounders. During the study period 240 953 newborns met the inclusion criteria. Among them, 118 113 were females (49.0%) and 122 840 were males (51.0%). During the 18 years of follow-up, 13 719 (5.7%) different newborns were hospitalized with respiratory related morbidity. Males had significantly higher rates of respiratory morbidity as compared with females (6.4% vs 4.9% respectively, P respiratory morbidity (log rank P respiratory morbidity while adjusting for gestational age, birthweight, and other confounders (HR 1.29, 95% CI 1.25-1.34, P respiratory morbidity, independent of obstetrical characteristics such as gestational age and birthweight. © 2018 Wiley Periodicals, Inc.

Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against Prostate Cancer

Science.gov (United States)

2017-08-01

28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival

RBPJ and EphrinB2 as Molecular Targets to Treat Brain Arteriovenous Malformation in Notch4 Induced Mouse Model

Science.gov (United States)

2017-10-01

of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to

rpsftm: An R Package for Rank Preserving Structural Failure Time Models.

Science.gov (United States)

Allison, Annabel; White, Ian R; Bond, Simon

2017-12-04

Treatment switching in a randomised controlled trial occurs when participants change from their randomised treatment to the other trial treatment during the study. Failure to account for treatment switching in the analysis (i.e. by performing a standard intention-to-treat analysis) can lead to biased estimates of treatment efficacy. The rank preserving structural failure time model (RPSFTM) is a method used to adjust for treatment switching in trials with survival outcomes. The RPSFTM is due to Robins and Tsiatis (1991) and has been developed by White et al. (1997, 1999). The method is randomisation based and uses only the randomised treatment group, observed event times, and treatment history in order to estimate a causal treatment effect. The treatment effect, ψ , is estimated by balancing counter-factual event times (that would be observed if no treatment were received) between treatment groups. G-estimation is used to find the value of ψ such that a test statistic Z ( ψ ) = 0. This is usually the test statistic used in the intention-to-treat analysis, for example, the log rank test statistic. We present an R package that implements the method of rpsftm.

Concurrent chemoradiotherapy plus adjuvant chemotherapy versus concurrent chemoradiotherapy in locoregionally advanced nasopharyngeal carcinoma. A matched-pair multicenter analysis of outcomes

Energy Technology Data Exchange (ETDEWEB)

Dong, Yi-Yuan [Affiliated Hospital of Guilin Medical University, Department of Radiation Oncology, Guilin (China); Guilin Medical University Affiliated Hospital, Department of Otorhinolaryngology, Guilin (China); Xiang, Chun [Nan Xishan Hospital, Department of Otorhinolaryngology, Guilin (China); Lu, Jian-Xun [Affiliated Hospital of Youjiang Medical University for Nationalities, Department of Oncology, Baise (China); Su, Yi-Xin [Lingshan People' s Hospital, Department of Radiation Oncology, Lingshan (China); Pan, Yu-Fei [Nan Xishan Hospital, Department of Radiation Oncology, Guilin (China); Cai, Rui; Zhang, Rong-Jun; He, Zhuo-Kai; Liu, Mei-Lian; Huang, Hui; Bai, Xue; Tang, Hua-Ying; Shi, Yun-Hua; Wang, Yan; Jiang, Wei [Affiliated Hospital of Guilin Medical University, Department of Radiation Oncology, Guilin (China)

2016-06-15

The benefit of adjuvant chemotherapy (AC) in locoregionally advanced nasopharyngeal carcinoma (NPC) is controversial. This study compared concurrent chemoradiotherapy plus AC (CCRT/AC) with CCRT. Pair-matched analysis based on eight clinicopathological features of 244 patients treated with platinum-based CCRT/AC or CCRT alone was performed. Survival outcomes were assessed using the Kaplan-Meier method and log-rank test. Toxicities and response rates were compared using Fisher's exact test. Four-year overall survival, progression-free survival, distant failure-free survival, and locoregional failure-free survival were 72 %, 61 %, 71 %, and 81 %, respectively, for the CCRT arm, compared to 74 % (hazard ratio, HR 0.89; 95 % confidence interval, CI 0.64-1.23; P = 0.474), 62 % (HR 0.91, 95 % CI 0.68-1.20, P = 0.489), 73 % (HR 0.84, 95 % CI 0.59-1.18, P = 0.316), and 84 % (HR 0.84, 95 % CI 0.52-1.24, P = 0.323), respectively, for the CCRT/AC arm. Cox multivariate regression analysis demonstrated AC was not an independent prognostic factor. Overall, there was a higher incidence of grade 3-4 toxicities in the CCRT/AC arm. The most common grade 3-4 adverse events in the CCRT/AC arm were vomiting (27 %), nausea (43 %), leukopenia/neutropenia (23 %), thrombocytopenia (8.8 %), and anemia (6.2 %). Addition of AC to CCRT increased toxicities but did not improve survival in locoregionally advanced NPC. (orig.) [German] Der Nutzen der adjuvanten Chemotherapie (AC) bei lokoregional fortgeschrittenem nasopharyngealem Karzinom (NPC) ist kontrovers. In dieser Studie wurde die simultane Radiochemotherapie (''concurrent chemoradiotherapy'', CCRT) plus adjuvante Chemotherapie (AC) mit einer alleinigen CCRT verglichen. Die Matched-pair-Analyse basiert auf acht klinisch-pathologischen Merkmalen von 244 Patienten, die mit platinbasierter CCRT/AC oder alleiniger CCRT behandelt wurden. Die Ueberlebensendpunkte wurden mit der Kaplan-Meier-Methode und dem Log-Rang-Test

Computer Aided Design of Kaplan Turbine Piston with\tSolidWorks

Directory of Open Access Journals (Sweden)

Camelia Jianu

2010-10-01

Full Text Available The paper presents the steps for 3D computer aided design (CAD of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.

Use of improved hydrologic testing and borehole geophysical logging methods for aquifer characterization

International Nuclear Information System (INIS)

Newcomer, D.R.; Hall, S.H.; Vermeul, V.R.

1996-01-01

Depth-discrete aquifer information was obtained using recently developed adaptations and improvements to conventional characterization techniques. These improvements included running neutron porosity and bulk density geophysical logging tools through a cased hole, performing an enhanced point-dilution tracer test for monitoring tracer concentration as a function of time and depth, and using pressure derivatives for diagnostic and quantitative analysis of constant rate discharge test data. Data results from the use of these techniques were used to develop a conceptual model of a heterogeneous aquifer. Depth-discrete aquifer information was required to effectively design field-scale deployment and monitoring of an in situ bioremediation technology. The bioremediation study site is located on the US Department of Energy's Hanford site. The study is being conducted by the Pacific Northwest National Laboratory to demonstrate in situ bioremediation of carbon tetrachloride (CCl 4 ). Geophysical logging and point-dilution tracer test results provided the relative distribution of porosity and horizontal hydraulic conductivity, respectively, with depth and correlated well. Hydraulic pumping tests were conducted to estimate mean values for transmissivity and effective hydraulic conductivity. Tracer test and geophysical logging results indicated that ground water flow was predominant in the upper approximate 10 feet of the aquifer investigated. These results were used to delineate a more representative interval thickness for estimating effective hydraulic conductivity. Hydraulic conductivity, calculated using this representative interval, was estimated to be 73 ft/d, approximately three times higher than that calculated using the full length of the screened test interval

Different goodness of fit tests for Rayleigh distribution in ranked set sampling

Directory of Open Access Journals (Sweden)

Amer Al-Omari

2016-03-01

Full Text Available In this paper, different goodness of fit tests for the Rayleigh distribution are considered based on simple random sampling (SRS and ranked set sampling (RSS techniques. The performance of the suggested estimators is evaluated in terms of the power of the tests by using Monte Carlo simulation. It is found that the suggested RSS tests perform better than their counterparts  in SRS.

Serum tetranectin is an independent prognostic marker in colorectal cancer and weakly correlated with plasma suPAR, plasma PAI-1 and serum CEA

DEFF Research Database (Denmark)

Høgdall, Claus K; Christensen, Ib J; Stephens, Ross W

2002-01-01

PAR and CEA had a 2.43 increased risk as compared to a patient with median levels of these biochemical markers. Significant correlations were found with Dukes' stages for all the biochemical markers and between the respective biochemical markers. The findings confirm that TN is a strong prognostic factor...... activator (uPAR) and carcinoembryonic antigen (CEA). Significantly shorter survival was found for patients with TN levels below a cut-off point of 7.5 mg/l compared to patients with levels above, as illustrated by Kaplan-Meier curves. By Cox analyses, log TN, log soluble uPAR as well as log CEA were found...... to have an independent prognostic value for survival (log TN: HR = 0.47, 95% CI: 0.29-0.76); log soluble uPAR: HR = 1.65, 95% CI: 1.18-2.31; log CEA: HR = 1.I1, 95% CI: 1.03-1.20). Based on the multivariate model, a patient with a combination of low levels of TN and PAI-1 and elevated levels of soluble u...

http Log Analysis

DEFF Research Database (Denmark)

Bøving, Kristian Billeskov; Simonsen, Jesper

2004-01-01

This article documents how log analysis can inform qualitative studies concerning the usage of web-based information systems (WIS). No prior research has used http log files as data to study collaboration between multiple users in organisational settings. We investigate how to perform http log...... analysis; what http log analysis says about the nature of collaborative WIS use; and how results from http log analysis may support other data collection methods such as surveys, interviews, and observation. The analysis of log files initially lends itself to research designs, which serve to test...... hypotheses using a quantitative methodology. We show that http log analysis can also be valuable in qualitative research such as case studies. The results from http log analysis can be triangulated with other data sources and for example serve as a means of supporting the interpretation of interview data...

Improved Governing of Kaplan Turbine Hydropower Plants Operating Island Grids

OpenAIRE

Gustafsson, Martin

2013-01-01

To reduce the consequences of a major fault in the electric power grid, functioning parts of the grid can be divided into smaller grid islands. The grid islands are operated isolated from the power network, which places new demands on a faster frequency regulation. This thesis investigates a Kaplan turbine hydropower plant operating an island grid. The Kaplan turbine has two control signals, the wicket gate and the turbine blade positions, controlling the mechanical power. The inputs are comb...

Linear-rank testing of a non-binary, responder-analysis, efficacy score to evaluate pharmacotherapies for substance use disorders.

Science.gov (United States)

Holmes, Tyson H; Li, Shou-Hua; McCann, David J

2016-11-23

The design of pharmacological trials for management of substance use disorders is shifting toward outcomes of successful individual-level behavior (abstinence or no heavy use). While binary success/failure analyses are common, McCann and Li (CNS Neurosci Ther 2012; 18: 414-418) introduced "number of beyond-threshold weeks of success" (NOBWOS) scores to avoid dichotomized outcomes. NOBWOS scoring employs an efficacy "hurdle" with values reflecting duration of success. Here, we evaluate NOBWOS scores rigorously. Formal analysis of mathematical structure of NOBWOS scores is followed by simulation studies spanning diverse conditions to assess operating characteristics of five linear-rank tests on NOBWOS scores. Simulations include assessment of Fisher's exact test applied to hurdle component. On average, statistical power was approximately equal for five linear-rank tests. Under none of conditions examined did Fisher's exact test exhibit greater statistical power than any of the linear-rank tests. These linear-rank tests provide good Type I and Type II error control for comparing distributions of NOBWOS scores between groups (e.g. active vs. placebo). All methods were applied to re-analyses of data from four clinical trials of differing lengths and substances of abuse. These linear-rank tests agreed across all trials in rejecting (or not) their null (equality of distributions) at ≤ 0.05. © The Author(s) 2016.

Comparison of multianalyte proficiency test results by sum of ranking differences, principal component analysis, and hierarchical cluster analysis.

Science.gov (United States)

Škrbić, Biljana; Héberger, Károly; Durišić-Mladenović, Nataša

2013-10-01

Sum of ranking differences (SRD) was applied for comparing multianalyte results obtained by several analytical methods used in one or in different laboratories, i.e., for ranking the overall performances of the methods (or laboratories) in simultaneous determination of the same set of analytes. The data sets for testing of the SRD applicability contained the results reported during one of the proficiency tests (PTs) organized by EU Reference Laboratory for Polycyclic Aromatic Hydrocarbons (EU-RL-PAH). In this way, the SRD was also tested as a discriminant method alternative to existing average performance scores used to compare mutlianalyte PT results. SRD should be used along with the z scores--the most commonly used PT performance statistics. SRD was further developed to handle the same rankings (ties) among laboratories. Two benchmark concentration series were selected as reference: (a) the assigned PAH concentrations (determined precisely beforehand by the EU-RL-PAH) and (b) the averages of all individual PAH concentrations determined by each laboratory. Ranking relative to the assigned values and also to the average (or median) values pointed to the laboratories with the most extreme results, as well as revealed groups of laboratories with similar overall performances. SRD reveals differences between methods or laboratories even if classical test(s) cannot. The ranking was validated using comparison of ranks by random numbers (a randomization test) and using seven folds cross-validation, which highlighted the similarities among the (methods used in) laboratories. Principal component analysis and hierarchical cluster analysis justified the findings based on SRD ranking/grouping. If the PAH-concentrations are row-scaled, (i.e., z scores are analyzed as input for ranking) SRD can still be used for checking the normality of errors. Moreover, cross-validation of SRD on z scores groups the laboratories similarly. The SRD technique is general in nature, i.e., it can

Ranking nano-enabled hybrid media for simultaneous removal of contaminants with different chemistries: Pseudo-equilibrium sorption tests versus column tests.

Science.gov (United States)

Custodio, Tomas; Garcia, Jose; Markovski, Jasmina; McKay Gifford, James; Hristovski, Kiril D; Olson, Larry W

2017-12-15

The underlying hypothesis of this study was that pseudo-equilibrium and column testing conditions would provide the same sorbent ranking trends although the values of sorbents' performance descriptors (e.g. sorption capacity) may vary because of different kinetics and competition effects induced by the two testing approaches. To address this hypothesis, nano-enabled hybrid media were fabricated and its removal performances were assessed for two model contaminants under multi-point batch pseudo-equilibrium and continuous-flow conditions. Calculation of simultaneous removal capacity indices (SRC) demonstrated that the more resource demanding continuous-flow tests are able to generate the same performance rankings as the ones obtained by conducing the simpler pseudo-equilibrium tests. Furthermore, continuous overlap between the 98% confidence boundaries for each SRC index trend, not only validated the hypothesis that both testing conditions provide the same ranking trends, but also pointed that SRC indices are statistically the same for each media, regardless of employed method. In scenarios where rapid screening of new media is required to obtain the best performing synthesis formulation, use of pseudo-equilibrium tests proved to be reliable. Considering that kinetics induced effects on sorption capacity must not be neglected, more resource demanding column test could be conducted only with the top performing media that exhibit the highest sorption capacity. Copyright © 2017 Elsevier B.V. All rights reserved.

Finding differentially expressed genes in high dimensional data: Rank based test statistic via a distance measure.

Science.gov (United States)

Mathur, Sunil; Sadana, Ajit

2015-12-01

We present a rank-based test statistic for the identification of differentially expressed genes using a distance measure. The proposed test statistic is highly robust against extreme values and does not assume the distribution of parent population. Simulation studies show that the proposed test is more powerful than some of the commonly used methods, such as paired t-test, Wilcoxon signed rank test, and significance analysis of microarray (SAM) under certain non-normal distributions. The asymptotic distribution of the test statistic, and the p-value function are discussed. The application of proposed method is shown using a real-life data set. © The Author(s) 2011.

Kaplan og Norton bør læses af hele ledelsen

DEFF Research Database (Denmark)

Bukh, Per Nikolaj

2009-01-01

Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april......Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april...

Proton Beam Therapy and Concurrent Chemotherapy for Esophageal Cancer

Energy Technology Data Exchange (ETDEWEB)

Lin, Steven H., E-mail: shlin@mdanderson.org [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Komaki, Ritsuko; Liao Zhongxing [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Wei, Caimiao [Department of Biostatistics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Myles, Bevan [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Guo Xiaomao [Department of Radiation Oncology, Fudan University Cancer Hospital, Shanghai (China); Palmer, Matthew [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Mohan, Radhe [Department of Physics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Swisher, Stephen G.; Hofstetter, Wayne L. [Department of Thoracic and Cardiovascular Surgery, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Ajani, Jaffer A. [Department of Gastrointestinal Medical Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Cox, James D. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

2012-07-01

Purpose: Proton beam therapy (PBT) is a promising modality for the management of thoracic malignancies. We report our preliminary experience of treating esophageal cancer patients with concurrent chemotherapy (CChT) and PBT (CChT/PBT) at MD Anderson Cancer Center. Methods and Materials: This is an analysis of 62 esophageal cancer patients enrolled on a prospective study evaluating normal tissue toxicity from CChT/PBT from 2006 to 2010. Patients were treated with passive scattering PBT with two- or three-field beam arrangement using 180 to 250 MV protons. We used the Kaplan-Meier method to assess time-to-event outcomes and compared the distributions between groups using the log-rank test. Results: The median follow-up time was 20.1 months for survivors. The median age was 68 years (range, 38-86). Most patients were males (82%) who had adenocarcinomas (76%) and Stage II-III disease (84%). The median radiation dose was 50.4 Gy (RBE [relative biologic equivalence]) (range, 36-57.6). The most common grade 2 to 3 acute toxicities from CChT/PBT were esophagitis (46.8%), fatigue (43.6%), nausea (33.9%), anorexia (30.1%), and radiation dermatitis (16.1%). There were two cases of grade 2 and 3 radiation pneumonitis and two cases of grade 5 toxicities. A total of 29 patients (46.8%) received preoperative CChT/PBT, with one postoperative death. The pathologic complete response (pCR) rate for the surgical cohort was 28%, and the pCR and near CR rates (0%-1% residual cells) were 50%. While there were significantly fewer local-regional recurrences in the preoperative group (3/29) than in the definitive CChT/PBT group (16/33) (log-rank test, p = 0.005), there were no differences in distant metastatic (DM)-free interval or overall survival (OS) between the two groups. Conclusions: This is the first report of patients treated with PBT/CChT for esophageal cancer. Our data suggest that this modality is associated with a few severe toxicities, but the pathologic response and clinical

Risk of colorectal cancer among immigrants to Ontario, Canada.

Science.gov (United States)

Paszat, Lawrence; Sutradhar, Rinku; Liu, Ying; Baxter, Nancy N; Tinmouth, Jill; Rabeneck, Linda

2017-07-06

The risk of colorectal cancer (CRC) varies around the world and between females and males. We aimed to compare the risk of CRC among immigrants to Ontario, Canada, to its general population. We used an exposure-control matched design. We identified persons in the Immigration, Refugees and Citizenship Canada Permanent Resident Database with first eligibility for the Ontario Health Insurance Plan between July 1, 1991 and June 30, 2008 at age 40 years or older, and matched five controls by year of birth and sex on the immigrant's first eligibility date. We identified CRC from the Ontario Cancer Registry between the index date and December 31, 2014. All analyses were stratified by sex. We calculated crude and relative rates of CRC. We estimated risk of CRC over time by the Kaplan-Meier method and compared immigrants to controls in age and sex stratified strata using log-rank tests. We modeled the hazard of CRC using Cox proportional hazards regression, accounting for within-cluster correlation by a robust sandwich variance estimation approach, and assessed an interaction with time since eligibility. Among females, 1877 cases of CRC were observed among 209,843 immigrants, and 16,517 cases among 1,049,215 controls; the crude relative rate among female immigrants was 0.623. Among males, 1956 cases of CRC were observed among 191,792 immigrants and 18,329 cases among 958,960 controls; the crude relative rate among male immigrants was 0.582.. Comparing immigrants to controls in all age and sex stratified strata, the log rank test p  = 75 years at index, where p = 0.01. The age-adjusted hazard ratio (HR) for CRC among female immigrants was 0.63 (95% CI 0.59, 0.67) during the first 10 years, and 0.66 (95% CI 0.59, 0.74) thereafter. Among male immigrants the age-adjusted HR = 0.55 (95% CI 0.52, 0.59) during the first 10 years and increased to 0.63 (95% CI 0.57, 0.71) thereafter. The adjusted HR > = 1 only among immigrants born in Europe and Central Asia. The risk

Statin treatment may lower the risk of postradiation epilepsy in patients with nasopharyngeal carcinoma.

Science.gov (United States)

Rong, Xiaoming; Yin, Jing; Wang, Hongxuan; Zhang, Xiaoni; Peng, Ying

2017-12-01

This study aimed to clarify the effect of statins on preventing the risk of postradiation epilepsy. We performed a retrospective analysis of neurological nasopharyngeal carcinoma patients with a history of radiotherapy. Patients with a history of epilepsy before radiation and those who received prophylactically antiepileptic treatment were excluded. The demographic and clinical data of these patients were collected through chart review. We used Kaplan-Meier analysis (log-rank test) to examine the effect of statins on epilepsy-free survival. Cox regression analysis was utilized to identify independent predictive variables. Our study included 532 patients (405 males and 127 females) with a mean follow-up of 28.1 months. During follow-up, 471 (88.5%) patients developed radiation-induced brain necrosis (RN). Within a mean latency of 24.1 months, 88 (16.5%) patients experienced epilepsy, of whom 27 (27 of 88, 30.7%) patients suffered from epilepsy before the diagnosis of RN. Thirty-six (36 of 88, 40.9%) cases of epilepsy occurred after RN onset, and in 22 cases (22 of 88, 25.0%) epilepsy was the first presentation of RN. Three patients suffered from epilepsy but did not have RN. Eighty-eight patients in our cohort were treated with statins because of hyperlipidemia or prevention of cardiocerebrovascular diseases, of whom six (6.8%) developed epilepsy, whereas in those without statin, the epileptic rate was 18.5%. Log-rank test found that there was a significant difference in epilepsy-free survival between patients who used statins and those who did not (p = 0.016). After adjusting for confounding variables, multivariate Cox regression analysis revealed that statin use could still significantly reduce the risk of epilepsy after radiation (hazard ratio = 0.36, 95% confidence interval = 0.15-0.82, p = 0.015). However, for the patients who already suffered from RN, statin treatment did not lower the risk of post-RN epilepsy. Early statin use may reduce the risk of

HER-2 immunohistochemical expression as prognostic marker in high-grade T1 bladder cancer (T1G3

Directory of Open Access Journals (Sweden)

Luca Bongiovanni

2013-06-01

Full Text Available Objectives: To evaluate if the Human epidermal growth factor receptor 2 (HER-2 expression levels may be used as potential prognostic marker in high grade T1 blad- der cancer (T1G3 Methods: Specimens from transurethral resection of bladder tumour (TURBT of 103 patients with high-grade T1 bladder cancer were collected. This pathologic database was reviewed. Four-year follow-up data were matched with pathologic data. Eighty-three patients entered the study. HER-2 staining was performed. Patients were grouped for HER-2 status. Statistical analysis included Kaplan Meier survival analysis and Log-rank test. Results: Pathological review of TURBT specimens confirmed high-grade T1 transitional cell bladder cancer in all patients. Median follow-up was 12 months (mean 23,5; range 3-48. Twenty-one patients (25.4% present strong HER-2 expression (3+, 28 (33.7% moderate expression (2+, 26 (33.7% weak staining (1+ and 8 (9.6% negative expression (0. Thirty- one patients of 83 (37.4% had not evidence of disease, 41 (49.4% recurred, 11 (13.2% had a progression of disease. Forty-one patients had high grade T1 recurrence. Patients with HER-2 status 0 did not showed progression of disease. Patients with HER-2 status 3+, undergoing cys- tectomy because progression of disease, had a pathological stage > pT2 and a nodal involve- ment. Median Disease-Free Survival (DFS for all patients was 12 months (DFS probability (pDFS = 49.3%; 95% CI, -11.1/+10.1. Median DFS in HER-2 groups was 8 (pDFS 37.5%; 95% CI,-28.8/+29.9, 24 (pDFS 46.1%; 95% CI,-19.5/+17.5, 20 (pDFS 46.4%; 95% CI,-18.8/+16.9 and 10 months (pDFS 47.6%; 95% CI,-21.9/+19.1 respectively in HER-2 status 0,1+,2+,3+. Log-Rank test is not statistically significant (p = 0,39. Conclusions: This study showed that HER-2 expression does not represent a prognostic mark- er of recurrence/progression of disease in high-grade T1 bladder cancer.

Log files for testing usability

NARCIS (Netherlands)

Klein Teeselink, G.; Siepe, A.H.M.; Pijper, de J.R.

1999-01-01

The aim of this study is to gain insight in the usefulness of log file analysis as a method to evaluate the usability of individual interface components and their influence on the usability of the overall user interface. We selected a music player as application, with four different interfaces and

Software Application for Data Collection and Analysis in Acute Myeloid Leukemia

Directory of Open Access Journals (Sweden)

Anca BACÂREA

2011-03-01

Full Text Available Aim: It is important in the context of the informatics development and also of medical research, that new software technology to be integrated in order to achieve easier research. The aim of this study was to develop a software application that uses few resources, and that enable data collection, their primary processing in statistical terms (e.g. mean, median, etc., drawing of survival curves and survival Log Rank statistic testing according to the collected parameters. Material and Method: For this purpose, a database in SQLite3 was developed. Because the database engine is embedded in the Database Management System (DBMS this program allows absolute portability. Graphical interface was made in wxWidgets. Statistical calculations were obtained using R software (the `addons` E1071 was used for descriptive statistics and the `Survival `for testing survival and Northest for Kaplan Meier survival curve. Patients were cases admitted and treated in the Hematology Department of County Emergency Hospital Tîrgu Mureş hospitalized and treated during 2007-2010. Results: We created a GUI in wxWidgets to collect the desired medical data: age, date of diagnosis, date of death, blood count values, and the CD leukocyte markers detected by flow cytometry. Entwining of medical data collection and processing statistics (for acute myeloid leukemia - survival, prognostic factors evaluation is a further step in medical research. Conclusion: The tool presented is a useful for research. Application in acute myeloid leukemia derives from the author's interest in the subject; development of this tool in other directions is possible and desirable.

Preventive and curative effects of acupuncture on the common cold: a multicentre randomized controlled trial in Japan.

Science.gov (United States)

Kawakita, Kenji; Shichidou, Toshiyuki; Inoue, Etsuko; Nabeta, Tomoyuki; Kitakouji, Hiroshi; Aizawa, Shigekatsu; Nishida, Atsushi; Yamaguchi, Nobuo; Takahashi, Norihito; Yano, Tadashi; Tanzawa, Syouhachi

2004-12-01

To determine the preventive and curative effects of manual acupuncture on the symptoms of the common cold. Students and staff in five Japanese acupuncture schools (n=326) were randomly allocated to acupuncture and no-treatment control groups. A specific needling point (Y point) on the neck was used bilaterally. Fine acupuncture needles were gently manipulated for 15 s, evoking de qi sensation. Acupuncture treatments were performed four times during the 2-week experimental period with a 2-week follow-up period. A common cold diary was scored daily for 4 weeks, and a common cold questionnaire was scored before each acupuncture treatment and twice at weekly intervals. A reliability test for the questionnaire was performed on the last day of recording. Five of the 326 subjects who were recruited dropped out. The diary score in the acupuncture group tended to decrease after treatment, but the difference between groups was not significant (Kaplan-Meier survival analysis, log rank test P=0.53, Cox regression analysis, P>0.05). Statistically significantly fewer symptoms were reported in the questionnaire by the acupuncture group than control group (P=0.024, general linear model, repeated measure). Significant inter-centre (Pcold. A significantly positive effect of acupuncture was demonstrated in the summed questionnaire data, although a highly significant inter-centre difference was observed. Needling on the neck using the Japanese fine needle manipulating technique was shown to be effective and safe. The use of acupuncture for symptoms of the common cold symptoms should be considered, although further evidence from placebo controlled RCTs is required.

Clinical Usefulness of Measuring Red Blood Cell Distribution Width in Patients with Hepatitis B Virus-Related Acute-On-Chronic Liver Failure.

Science.gov (United States)

Jin, Lei; Gao, Yufeng; Ye, Jun; Zou, Guizhou; Li, Xu

2017-09-01

The red blood cell distribution width (RDW) is increased in chronic liver disease, but its clinical significance in hepatitis B virus-related acute-on-chronic liver failure (HBV-ACLF) is still unclear. The aim of the present study was to investigate the clinical significance of RDW in HBV-ACLF patients. The medical records of HBV-ACLF patients who were admitted to The Second Affiliated Hospital of Anhui Medical University between April 2012 and December 2015 were retrospectively reviewed. Correlations between RDW, neutrophil lymphocyte ratio (NLR), and the model for end-stage liver disease (MELD) scores were analyzed using the Spearman's approach. Multivariable stepwise logistic regression test was used to evaluate independent clinical parameters predicting 3-month mortality of HBV-ACLF patients. The association between RDW and hospitalization outcome was estimated by receiver operating curve (ROC) analysis. Patient survival was estimated by Kaplan-Meier analysis and subsequently compared by log-rank test. Sixty-two HBV-ACLF patients and sixty CHB patients were enrolled. RDW were increased in HBVACLF patients and positively correlated with the NLR as well as MELD scores. Multivariate analysis demonstrated that RDW value was an independent predictor for mortality. RDW had an area under the ROC of 0.799 in predicting 3-month mortality of HBV-ACLF patients. Patients with HBV-ACLF who had RDW > 17% showed significantly poorer survival than those who had RDW ≤ 17%. RDW values are significantly increased in patients with HBV-ACLF. Moreover, RDW values are an independent predicting factor for an in-hospital mortality in patients with HBV-ACLF.

Long-term prognosis in patients continuing taking antithrombotics after peptic ulcer bleeding.

Science.gov (United States)

Wang, Xi-Xu; Dong, Bo; Hong, Biao; Gong, Yi-Qun; Wang, Wei; Wang, Jue; Zhou, Zhen-Yu; Jiang, Wei-Jun

2017-01-28

To investigate the long-term prognosis in peptic ulcer patients continuing taking antithrombotics after ulcer bleeding, and to determine the risk factors that influence the prognosis. All clinical data of peptic ulcer patients treated from January 1, 2009 to January 1, 2014 were retrospectively collected and analyzed. Patients were divided into either a continuing group to continue taking antithrombotic drugs after ulcer bleeding or a discontinuing group to discontinue antithrombotic drugs. The primary outcome of follow-up in peptic ulcer bleeding patients was recurrent bleeding, and secondary outcome was death or acute cardiovascular disease occurrence. The final date of follow-up was December 31, 2014. Basic demographic data, complications, and disease classifications were analyzed and compared by t - or χ 2 -test. The number of patients that achieved various outcomes was counted and analyzed statistically. A survival curve was drawn using the Kaplan-Meier method, and the difference was compared using the log-rank test. COX regression multivariate analysis was applied to analyze risk factors for the prognosis of peptic ulcer patients. A total of 167 patients were enrolled into this study. As for the baseline information, differences in age, smoking, alcohol abuse, and acute cardiovascular diseases were statistically significant between the continuing and discontinuing groups (70.8 ± 11.4 vs 62.4 ± 12.0, P peptic ulcer bleeding, continuing antithrombotics increases the risk of recurrent bleeding events, while discontinuing antithrombotics would increase the risk of death and developing cardiovascular disease. This suggests that clinicians should comprehensively consider the use of antithrombotics after peptic ulcer bleeding.

Disparities in cervical cancer survival among Asian American women

Science.gov (United States)

Nghiem, Van T.; Davies, Kalatu R.; Chan, Wenyaw; Mulla, Zuber D.; Cantor, Scott B.

2015-01-01

Purpose We compared overall survival and influencing factors between Asian American women as a whole and by subgroup with white women with cervical cancer. Methods Cervical cancer data were from the Surveillance, Epidemiology, and End Results registry; socioeconomic information was from the Area Health Resource File. We used standard tests to compare characteristics between groups; the Kaplan-Meier method with log-rank test to assess overall survival and compare it between groups; and Cox proportional hazards models to determine the effect of race and other covariates on overall survival (with/without age-stratification). Results Being 3.3 years older than white women at diagnosis (pAsian American women were more likely to be in a spousal relationship, had more progressive disease, and were better off socioeconomically. Women of Filipino, Japanese, and Korean origin had similar clinical characteristics compared with white women. Asian American women had higher 36- and 60-month survival rates (p=0.004 and p=0.013, respectively), higher overall survival rates (p=0.049), and longer overall survival durations after adjusting for age and other covariates (hazard ratio=0.77, 95% confidence interval: 0.68–0.86). Overall survival differed across age strata between the two racial groups. With the exception of women of Japanese or Korean origin, Asian American women grouped by geographic origin had better overall survival than white women. Conclusions Although Asian American women, except those of Japanese or Korean origin, had better overall survival than white women, their older age at cervical cancer diagnosis suggests that they have less access to screening programs. PMID:26552330

Disparities in cervical cancer survival among Asian-American women.

Science.gov (United States)

Nghiem, Van T; Davies, Kalatu R; Chan, Wenyaw; Mulla, Zuber D; Cantor, Scott B

2016-01-01

We compared overall survival and influencing factors between Asian-American women as a whole and by subgroup with white women with cervical cancer. Cervical cancer data were from the Surveillance, Epidemiology, and End Results registry; socioeconomic information was from the Area Health Resource File. We used standard tests to compare characteristics between groups; the Kaplan-Meier method with log-rank test to assess overall survival and compare it between groups; and Cox proportional hazards models to determine the effect of race and other covariates on overall survival (with and/or without age stratification). Being 3.3 years older than white women at diagnosis (P Asian-American women were more likely to be in a spousal relationship, had more progressive disease, and were better off socioeconomically. Women of Filipino, Japanese, and Korean origin had similar clinical characteristics compared to white women. Asian-American women had higher 36- and 60-month survival rates (P = .004 and P = .013, respectively), higher overall survival rates (P = .049), and longer overall survival durations after adjusting for age and other covariates (hazard ratio = 0.77, 95% confidence interval: 0.68-0.86). Overall survival differed across age strata between the two racial groups. With the exception of women of Japanese or Korean origin, Asian-American women grouped by geographic origin had better overall survival than white women. Although Asian-American women, except those of Japanese or Korean origin, had better overall survival than white women, their older age at cervical cancer diagnosis suggests that they have less access to screening programs. Copyright © 2016 Elsevier Inc. All rights reserved.

Postoperative radiotherapy in salivary ductal carcinoma: a single institution experience

Energy Technology Data Exchange (ETDEWEB)

Kim, Tae Hyung; Kim, Mi Sun; Choi, Seo Hee; Suh, Yang Gun; Koh, Yoon Woo; Kim, Se Hun; Choi, Eun Chang; Keum, Ki Chang [Yonsei University College of Medicine, Seoul (Korea, Republic of)

2014-09-15

We reviewed treatment outcomes and prognostic factors for patients with salivary ductal carcinoma (SDC) treated with surgery and postoperative radiotherapy from 2005 to 2012. A total of 16 patients were identified and 15 eligible patients were included in analysis. Median age was 61 years (range, 40 to 71 years) and 12 patients (80%) were men. Twelve patients (80%) had a tumor in the parotid gland, 9 (60%) had T3 or T4 disease, and 9 (60%) had positive nodal disease. All patients underwent surgery and postoperative radiotherapy. Postoperative radiotherapy was delivered using 3-dimensional conformal radiotherapy or intensity-modulated radiotherapy. Locoregional failure-free survival (LRFFS), distant failure-free survival (DFFS), progression-free survival (PFS), and overall survival (OS) were calculated using the Kaplan-Meier method. Differences in survival based on risk factors were tested using a log-rank test. Median total radiotherapy dose was 60 Gy (range, 52.5 to 63.6 Gy). Four patients received concurrent weekly chemotherapy with cisplatin. Among 10 patients who underwent surgery with neck dissection, 7 received modified radical neck dissection. With a median follow-up time of 38 months (range, 24 to 105 months), 4-year rates were 86% for LRFFS, 51% for DFFS, 46% for PFS, and 93% for OS. Local failure was observed in 2 patients (13%), and distant failure was observed in 7 (47%). The lung was the most common involved site of distant metastasis. Surgery and postoperative radiotherapy in SDC patients resulted in good local control, but high distant metastasis remained a major challenge.

RankProdIt: A web-interactive Rank Products analysis tool

Directory of Open Access Journals (Sweden)

Laing Emma

2010-08-01

Full Text Available Abstract Background The first objective of a DNA microarray experiment is typically to generate a list of genes or probes that are found to be differentially expressed or represented (in the case of comparative genomic hybridizations and/or copy number variation between two conditions or strains. Rank Products analysis comprises a robust algorithm for deriving such lists from microarray experiments that comprise small numbers of replicates, for example, less than the number required for the commonly used t-test. Currently, users wishing to apply Rank Products analysis to their own microarray data sets have been restricted to the use of command line-based software which can limit its usage within the biological community. Findings Here we have developed a web interface to existing Rank Products analysis tools allowing users to quickly process their data in an intuitive and step-wise manner to obtain the respective Rank Product or Rank Sum, probability of false prediction and p-values in a downloadable file. Conclusions The online interactive Rank Products analysis tool RankProdIt, for analysis of any data set containing measurements for multiple replicated conditions, is available at: http://strep-microarray.sbs.surrey.ac.uk/RankProducts

Power and sample size evaluation for the Cochran-Mantel-Haenszel mean score (Wilcoxon rank sum) test and the Cochran-Armitage test for trend.

Science.gov (United States)

Lachin, John M

2011-11-10

The power of a chi-square test, and thus the required sample size, are a function of the noncentrality parameter that can be obtained as the limiting expectation of the test statistic under an alternative hypothesis specification. Herein, we apply this principle to derive simple expressions for two tests that are commonly applied to discrete ordinal data. The Wilcoxon rank sum test for the equality of distributions in two groups is algebraically equivalent to the Mann-Whitney test. The Kruskal-Wallis test applies to multiple groups. These tests are equivalent to a Cochran-Mantel-Haenszel mean score test using rank scores for a set of C-discrete categories. Although various authors have assessed the power function of the Wilcoxon and Mann-Whitney tests, herein it is shown that the power of these tests with discrete observations, that is, with tied ranks, is readily provided by the power function of the corresponding Cochran-Mantel-Haenszel mean scores test for two and R > 2 groups. These expressions yield results virtually identical to those derived previously for rank scores and also apply to other score functions. The Cochran-Armitage test for trend assesses whether there is an monotonically increasing or decreasing trend in the proportions with a positive outcome or response over the C-ordered categories of an ordinal independent variable, for example, dose. Herein, it is shown that the power of the test is a function of the slope of the response probabilities over the ordinal scores assigned to the groups that yields simple expressions for the power of the test. Copyright © 2011 John Wiley & Sons, Ltd.

Case Report: Meier-Gorlin syndrome: Report of an additional patient ...

African Journals Online (AJOL)

We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.

EMMPRIN expression positively correlates with WHO grades of astrocytomas and meningiomas.

Science.gov (United States)

Tsai, Wen-Chiuan; Chen, Ying; Huang, Li-Chun; Lee, Herng-Sheng; Ma, Hsin-I; Huang, Shih-Ming; Sytwu, Huey-Kang; Hueng, Dueng-Yuan

2013-09-01

High-grade primary brain tumors possessed poor outcome due to invasiveness. Extracellular matrix metalloproteinase inducer (EMMPRIN) stimulates peri-tumoral fibroblasts to secrete matrix metalloproteinase and promote invasiveness. This study hypothesized that high-grade brain tumors overexpress EMMPRIN. Analyzing the public delinked database from the Gene Expression Omnibus profile, the results showed that the EMMPRIN mRNA level was higher in WHO grade IV (n = 81) than in grade III (n = 19, p EMMPRIN levels positively correlated with WHO grades for astrocytomas (p = 0.008) and meningiomas (p = 0.048). EMMPRIN mRNA levels in conventional glioma cell lines (n = 36) was not less than those in glioma primary culture cells (n = 27) and glioblastoma stem-like cells (n = 12). The GBM8401, U87MG, and LN229 human glioma cell lines also overexpressed EMMPRIN. Hematoxylin and eosin, IHC, and immunofluorescence staining of xenografts confirmed that high-grade brain tumors overexpressed EMMPRIN. Lastly, Kaplan-Meier analysis revealed poorer survival in WHO grade IV (n = 56) than in grade III astrocytomas (n = 21, by log-rank test; p = 0.0001, 95 % CI: 1.842-3.053). However, in high-grade astrocytomas, there was no difference in survival between high and low EMMPRIN mRNA levels. Thus, this study identified that high-grade brain tumors overexpress EMMPRIN, which positively correlates with WHO grades in human astrocytomas and meningiomas, and suggests that EMMPRIN may be a therapeutic target of brain tumor.

Prognostic Importance of Small Prostate Size in Men Receiving Definitive Prostate Brachytherapy

International Nuclear Information System (INIS)

Taira, Al V.; Merrick, Gregory S.; Galbreath, Robert W.; Butler, Wayne M.; Adamovich, Edward; Wallner, Kent E.

2012-01-01

Purpose: To assess whether small prostate size is an adverse prognostic factor in men undergoing brachytherapy in the same manner in which it seems to be for men undergoing radical prostatectomy. Methods and Materials: From April 1995 to June 2008, 2024 patients underwent brachytherapy by a single brachytherapist. Median follow-up was 7.4 years. The role of small prostate size (≤20 cm 3 ) as a prognostic factor for biochemical progression-free survival, cause-specific survival, and all-cause mortality was investigated. The differences in survival between men with small and larger prostates were compared using Kaplan-Meier curves and log-rank tests. Results: Median prostate size for the entire cohort was 32.7 cm 3 . For the 167 men with small prostates, median prostate size was 17.4 cm 3 . There was no difference in biochemical progression-free survival (95.2% vs 96.2%, P=.603), cause-specific survival (97.7% vs 98.3%, P=.546), or all-cause mortality (78.0% vs 77.2%, P=.838) at 10 years for men with small prostates compared with men with larger prostates. On univariate and multivariate analysis, small prostate size was not associated with any of the primary outcome measures. Conclusion: Men with small prostates treated with brachytherapy have excellent outcomes and are at no higher risk of treatment failure than men with larger glands. High-quality implants with adequate margins seem sufficient to address the increased adverse risk factors associated with small prostate size.

Plasma uric acid and tumor volume are highly predictive of outcome in nasopharyngeal carcinoma patients receiving intensity modulated radiotherapy

International Nuclear Information System (INIS)

Lin, Hui; Lin, Huan-Xin; Ge, Nan; Wang, Hong-Zhi; Sun, Rui; Hu, Wei-Han

2013-01-01

The combined predictive value of plasma uric acid and primary tumor volume in nasopharyngeal carcinoma (NPC) patients receiving intensity modulated radiation therapy (IMRT) has not yet been determined. In this retrospective study, plasma uric acid level was measured after treatment in 130 histologically-proven NPC patients treated with IMRT. Tumor volume was calculated from treatment planning CT scans. Overall (OS), progression-free (PFS) and distant metastasis-free (DMFS) survival were compared using Kaplan-Meier analysis and the log rank test, and Cox multivariate and univariate regression models were created. Patients with a small tumor volume (<27 mL) had a significantly better DMFS, PFS and OS than patients with a large tumor volume. Patients with a high post-treatment plasma uric acid level (>301 μmol/L) had a better DMFS, PFS and OS than patients with a low post-treatment plasma uric acid level. Patients with a small tumor volume and high post-treatment plasma uric acid level had a favorable prognosis compared to patients with a large tumor volume and low post-treatment plasma uric acid level (7-year overall OS, 100% vs. 48.7%, P <0.001 and PFS, 100% vs. 69.5%, P <0.001). Post-treatment plasma uric acid level and pre-treatment tumor volume have predictive value for outcome in NPC patients receiving IMRT. NPC patients with a large tumor volume and low post-treatment plasma uric acid level may benefit from additional aggressive treatment after IMRT

Malignant transformation of oral submucous fibrosis in Taiwan: A nationwide population-based retrospective cohort study.

Science.gov (United States)

Yang, Po-Yu; Chen, Yi-Tzu; Wang, Yu-Hsun; Su, Ni-Yu; Yu, Hui-Chieh; Chang, Yu-Chao

2017-11-01

Oral submucous fibrosis (OSF) is one of the well-recognized oral potentially malignant disorders. In this study, we investigated the malignant transformation of OSF in a Taiwanese population. A retrospective cohort study was analyzed from Taiwan's National Health Insurance Research Database. A comparison cohort was randomly frequency-matched with the OSF cohort according to age, sex, and index year. Oral leukoplakia (OL) was further stratified to evaluate for the possible synergistic effects of OSF-associated malignant transformation. In this cohort, 71 (9.13%) of 778 cases of OSF were observed to transform into oral cancer. The malignant transformation rate was 29.26-fold in the OSF cohort than in the comparison cohort after adjustment (95% confidence intervals 20.55-41.67). To further stratify with OL, OSF with OL (52.46%; 95% confidence intervals 34.88-78.91) had higher risk of malignant transformation rate than OSF alone (29.84%; 95% confidence intervals 20.99-42.42). The Kaplan-Meier plot revealed the rate free of malignant transformation was significant over the 13-year follow-up period (log-rank test, Ptransformation was 5.1, 2.7, and 2.2 years for non-OSF, OSF alone, and OSF with OL, respectively. Oral submucous fibrosis patients exhibited a significantly higher risk of malignant transformation than those without OSF. OL could enhance malignant transformation in patients with OSF. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Optimising Controlled Human Malaria Infection Studies Using Cryopreserved P. falciparum Parasites Administered by Needle and Syringe.

Directory of Open Access Journals (Sweden)

Susanne H Sheehy

Full Text Available Controlled human malaria infection (CHMI studies have become a routine tool to evaluate efficacy of candidate anti-malarial drugs and vaccines. To date, CHMI trials have mostly been conducted using the bite of infected mosquitoes, restricting the number of trial sites that can perform CHMI studies. Aseptic, cryopreserved P. falciparum sporozoites (PfSPZ Challenge provide a potentially more accurate, reproducible and practical alternative, allowing a known number of sporozoites to be administered simply by injection.We sought to assess the infectivity of PfSPZ Challenge administered in different dosing regimens to malaria-naive healthy adults (n = 18. Six participants received 2,500 sporozoites intradermally (ID, six received 2,500 sporozoites intramuscularly (IM and six received 25,000 sporozoites IM.Five out of six participants receiving 2,500 sporozoites ID, 3/6 participants receiving 2,500 sporozoites IM and 6/6 participants receiving 25,000 sporozoites IM were successfully infected. The median time to diagnosis was 13.2, 17.8 and 12.7 days for 2,500 sporozoites ID, 2,500 sporozoites IM and 25,000 sporozoites IM respectively (Kaplan Meier method; p = 0.024 log rank test.2,500 sporozoites ID and 25,000 sporozoites IM have similar infectivities. Given the dose response in infectivity seen with IM administration, further work should evaluate increasing doses of PfSPZ Challenge IM to identify a dosing regimen that reliably infects 100% of participants.ClinicalTrials.gov NCT01465048.

Clinical Impact of Emphysema Evaluated by High-Resolution Computed Tomography on Idiopathic Pulmonary Fibrosis Diagnosed by Surgical Lung Biopsy.

Science.gov (United States)

Kohashi, Yasuo; Arai, Toru; Sugimoto, Chikatoshi; Tachibana, Kazunobu; Akira, Masanori; Kitaichi, Masanori; Hayashi, Seiji; Inoue, Yoshikazu

2016-01-01

The prognosis of combined cases of pulmonary fibrosis and emphysema is unresolved partially because radiological differentiation between usual interstitial pneumonia and nonspecific interstitial pneumonia is difficult in coexisting emphysema cases. The purpose of this study was to clarify the clinical impact of emphysema on the survival of patients with idiopathic pulmonary fibrosis (IPF). One hundred and seven patients with interstitial lung diseases were diagnosed by surgical lung biopsies between 2006 and 2012, and 47 patients were diagnosed with IPF through multidisciplinary discussion. Emphysema on high-resolution computed tomography scans was evaluated semiquantitatively by visual scoring. Eight out of the 47 IPF patients showed a higher emphysema score (>3) and were diagnosed to have IPF-emphysema. The median survival time of patients with IPF-emphysema (1,734 days) from the initial diagnosis was significantly shorter than that of patients with IPF alone (2,229 days) by Kaplan-Meier analysis (p = 0.007, log-rank test). Univariate Cox proportional hazard regression analyses revealed that a higher total emphysema score (>3.0) was a significantly poor prognostic factor in addition to Krebs von den Lungen-6, surfactant protein-D, arterial oxygen tension, percent forced vital capacity, and percent diffusing capacity of carbon monoxide (%DLCO). Multivariate Cox proportional hazard regression analyses with the stepwise method showed that higher total emphysema score (>3) and %DLCO were significantly poor prognostic factors. The prognosis of IPF-emphysema was significantly worse than that of IPF alone. © 2016 S. Karger AG, Basel.

Prognostic value of cell cycle regulatory proteins in muscle-infiltrating bladder cancer.

Science.gov (United States)

Galmozzi, Fabia; Rubagotti, Alessandra; Romagnoli, Andrea; Carmignani, Giorgio; Perdelli, Luisa; Gatteschi, Beatrice; Boccardo, Francesco

2006-12-01

The aims of this study were to investigate the expression levels of proteins involved in cell cycle regulation in specimens of bladder cancer and to correlate them with the clinicopathological characteristics, proliferative activity and survival. Eighty-two specimens obtained from patients affected by muscle-invasive bladder cancer were evaluated immunohistochemically for p53, p21 and cyclin D1 expression, as well as for the tumour proliferation index, Ki-67. The statistical analysis included Kaplan-Meier curves with log-rank test and Cox proportional hazards models. In univariate analyses, low Ki-67 proliferation index (P = 0.045) and negative p21 immunoreactivity (P = 0.04) were associated to patient's overall survival (OS), but in multivariate models p21 did not reach statistical significance. When the combinations of the variables were assessed in two separate multivariate models that included tumour stage, grading, lymph node status, vascular invasion and perineural invasion, the combined variables p21/Ki-67 or p21/cyclin D1 expression were independent predictors for OS; in particular, patients with positive p21/high Ki-67 (P = 0.015) or positive p21/negative cyclin D1 (P = 0.04) showed the worst survival outcome. Important alterations in the cell cycle regulatory pathways occur in muscle-invasive bladder cancer and the combined use of cell cycle regulators appears to provide significant prognostic information that could be used to select the patients most suitable for multimodal therapeutic approaches.

Serum YKL-40 independently predicts outcome after transcatheter arterial chemoembolization of hepatocellular carcinoma.

Directory of Open Access Journals (Sweden)

Cheng-Bao Zhu

Full Text Available Transcatheter arterial chemoembolization (TACE is the most widely used treatment option for unresectable hepatocellular carcinoma (HCC. Elevated serum YKL-40 level has been shown to predict poor prognosis in HCC patients undergoing resection. This study was designed to validate the prognostic significance of serum YKL-40 in patients with HCC undergoing TACE treatment.Serum YKL-40 level was determined by enzyme-linked immunosorbent assay. Overall survival (OS was evaluated with the Kaplan-Meier method and compared by the log-rank test. Multivariate study with Cox proportional hazard model was used to evaluate independent prognostic variables of OS.The median pretreatment serum YKL-40 in HCC patients with was significantly higher than that in healthy controls (P<0.001. The YKL-40 could predict survival precisely either in a dichotomized or continuous fashion (P<0.001 and P = 0.001, respectively. Multivariate Cox regression analysis indicated that serum YKL-40 was an independent prognostic factor for OS in HCC patients (P = 0.001. In further stratified analyses, YKL-40 could discriminate the outcomes of patients with low and high alpha-fetoprotein (AFP level (P = 0.006 and 0.016, respectively. Furthermore, the combination of serum YKL-40 and AFP had more capacity to predict patients' outcomes.Serum YKL-40 was demonstrated to be an independent prognostic biomarker in HCC patients treated with TACE. Our results need confirmation in an independent study.

Cancer association study of aminoacyl-tRNA synthetase signaling network in glioblastoma.

Directory of Open Access Journals (Sweden)

Yong-Wan Kim

Full Text Available Aminoacyl-tRNA synthetases (ARSs and ARS-interacting multifunctional proteins (AIMPs exhibit remarkable functional versatility beyond their catalytic activities in protein synthesis. Their non-canonical functions have been pathologically linked to cancers. Here we described our integrative genome-wide analysis of ARSs to show cancer-associated activities in glioblastoma multiforme (GBM, the most aggressive malignant primary brain tumor. We first selected 23 ARS/AIMPs (together referred to as ARSN, 124 cancer-associated druggable target genes (DTGs and 404 protein-protein interactors (PPIs of ARSs using NCI's cancer gene index. 254 GBM affymetrix microarray data in The Cancer Genome Atlas (TCGA were used to identify the probe sets whose expression were most strongly correlated with survival (Kaplan-Meier plots versus survival times, log-rank t-test <0.05. The analysis identified 122 probe sets as survival signatures, including 5 of ARSN (VARS, QARS, CARS, NARS, FARS, and 115 of DTGs and PPIs (PARD3, RXRB, ATP5C1, HSP90AA1, CD44, THRA, TRAF2, KRT10, MED12, etc. Of note, 61 survival-related probes were differentially expressed in three different prognosis subgroups in GBM patients and showed correlation with established prognosis markers such as age and phenotypic molecular signatures. CARS and FARS also showed significantly higher association with different molecular networks in GBM patients. Taken together, our findings demonstrate evidence for an ARSN biology-dominant contribution in the biology of GBM.

Comparative analysis of whole mount processing and systematic sampling of radical prostatectomy specimens: pathological outcomes and risk of biochemical recurrence.

Science.gov (United States)

Salem, Shady; Chang, Sam S; Clark, Peter E; Davis, Rodney; Herrell, S Duke; Kordan, Yakup; Wills, Marcia L; Shappell, Scott B; Baumgartner, Roxelyn; Phillips, Sharon; Smith, Joseph A; Cookson, Michael S; Barocas, Daniel A

2010-10-01

Whole mount processing is more resource intensive than routine systematic sampling of radical retropubic prostatectomy specimens. We compared whole mount and systematic sampling for detecting pathological outcomes, and compared the prognostic value of pathological findings across pathological methods. We included men (608 whole mount and 525 systematic sampling samples) with no prior treatment who underwent radical retropubic prostatectomy at Vanderbilt University Medical Center between January 2000 and June 2008. We used univariate and multivariate analysis to compare the pathological outcome detection rate between pathological methods. Kaplan-Meier curves and the log rank test were used to compare the prognostic value of pathological findings across pathological methods. There were no significant differences between the whole mount and the systematic sampling groups in detecting extraprostatic extension (25% vs 30%), positive surgical margins (31% vs 31%), pathological Gleason score less than 7 (49% vs 43%), 7 (39% vs 43%) or greater than 7 (12% vs 13%), seminal vesicle invasion (8% vs 10%) or lymph node involvement (3% vs 5%). Tumor volume was higher in the systematic sampling group and whole mount detected more multiple surgical margins (each p systematic sampling yield similar pathological information. Each method stratifies patients into comparable risk groups for biochemical recurrence. Thus, while whole mount is more resource intensive, it does not appear to result in improved detection of clinically important pathological outcomes or prognostication. Copyright © 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Reclassification and treatment of odontogenic keratocysts: A cohort study

Directory of Open Access Journals (Sweden)

Ophir Ribeiro-Júnior

2017-12-01

Full Text Available Abstract: The odontogenic keratocyst (OKC is a recurrent cyst that has been recently reclassified from an odontogenic tumor to an odontogenic cyst. The aim of the present study was to investigate its treatment and address issues related to its association with nevoid basal cell carcinoma syndrome (NBCCS. Lesions from the cohort of patients included in the present study consisted of 40 OKCs, of which 27 lesions were treated by enucleation (GE and 13 underwent decompression (GD. Complementary treatment occurred in 38 (95% lesions, of which 10 underwent isolated peripheral ostectomy (GO and 28 underwent peripheral ostectomy combined with Carnoy's solution (GC. Thirteen lesions were associated with NBCCS (GS, while the others (n=27 were non-syndromic lesions (GnS. The recurrence-free periods (RFP in the sample groups were compared using the Kaplan-Meier function and log-rank test at a significance level of 5% (p 0.05 or increased CRR for the decompression (15.4% over five years. Application of Carnoy's solution did not increase the efficacy of the peripheral ostectomy, but was related to a CRR of 0% for the syndromic lesions over five years. Therefore, 1 decompression did not increase the recurrence risk; 2 peripheral ostectomy demonstrated a similar efficacy as the combination with Carnoy's solution; 3 the association of NBCCS did not seem to significantly influence OKC recurrence; and 4 syndromic lesions seem to behave in the same manner as non-syndromic lesions when submitted to complementary treatments.

Contemporary management of penile cancer: greater than 15 year MSKCC experience.

Science.gov (United States)

Moses, Kelvin A; Winer, Andrew; Sfakianos, John P; Poon, Stephen A; Kent, Matthew; Bernstein, Melanie; Russo, Paul; Dalbagni, Guido

2014-04-01

Penile cancer is a rare malignancy, and few guidelines are available to define treatment paradigms. For greater understanding of the natural history of surgically treated penile cancer, we analyzed the experience at our institution. Using an institutional database, we identified 127 patients treated for squamous cell carcinoma of the penis from 1995-2011. Cancer-specific survival (CSS) was calculated using the Kaplan-Meier method. Survival data were compared using the log-rank test. The difference in risk of cancer-specific death by lymph node status and histological grade was determined by univariate Cox regression analysis. Five year CSS for pTis, pT1, pT2, and pT3/4 was 100%, 84% (95% CI 58%-95%), 54% (95% CI 33%-71%), and 54% (95% CI 25%-76%), respectively (p ≤ .005). Three year CSS for patients with N0, N+, and Nx disease was 90% (95% CI 47%-99%), 65% (95% CI 47%-79%), and 86% (95% CI 73%-93%), respectively (p = .03). The receipt of neoadjuvant chemotherapy did not change per 5 year period over the 16 years of our study. Median follow up was 2.8 years. Penile cancer patients with advanced disease had poor survival. Tumor stage and nodal status were significant predictors of CSS. Penis-sparing approaches may be considered for most patients; however, pathological stage and grade dictate the management and ultimate outcome. Further studies are necessary to clarify the benefits of chemotherapy in this disease.

Tumor size and prognosis in patients with Wilms tumor

Directory of Open Access Journals (Sweden)

Valentina Oliveira Provenzi

2015-03-01

Full Text Available OBJECTIVE: Investigate the relationship of the tumor volume after preoperative chemotherapy (TVAPQ and before preoperative chemotherapy (TVBPQ with overall survival at two and at five years, and lifetime. METHODS: Our sample consisted of consecutive patients evaluated in the period from 1989 to 2009 in an Onco-Hematology Service. Clinical, histological and volumetric data were collected from the medical records. For analysis, chi-square, Kaplan-Meier, log-rank and Cox regression tests were used. RESULTS: The sample consisted of 32 patients, 53.1% were male with a median age at diagnosis of 43 months. There was a significant association between TVAPQ>500mL and the difference between the TVBPQ and TVAPQ (p=0.015 and histologic types of risk (p=0.008. It was also verified an association between the difference between the TVBPQ and TVAPQ and the predominant stromal tumor (p=0.037. When assessing the TVAPQ of all patients, without a cutoff, there was an association of the variable with lifetime (p=0.013, i.e., for each increase of 10mL in TVAPQ there was an average increase of 2% in the risk of death. CONCLUSIONS: Although our results indicate that the TVAPQ could be considered alone as a predictor of poor prognosis regardless of the cutoff suggested in the literature, more studies are needed to replace the histology and staging by tumor size as best prognostic variable.

Outcome predictors in the management of intramedullary classic ependymoma: An integrative survival analysis.

Science.gov (United States)

Wang, Yinqing; Cai, Ranze; Wang, Rui; Wang, Chunhua; Chen, Chunmei

2018-06-01

This is a retrospective study.The aim of this study was to illustrate the survival outcomes of patients with classic ependymoma (CE) and identify potential prognostic factors.CE is the most common category of spinal ependymomas, but few published studies have discussed predictors of the survival outcome.A Boolean search of the PubMed, Embase, and OVID databases was conducted by 2 investigators independently. The objects were intramedullary grade II ependymoma according to 2007 WHO classification. Univariate Kaplan-Meier analysis and Log-Rank tests were performed to identify variables associated with progression-free survival (PFS) or overall survival (OS). Multivariate Cox regression was performed to assess hazard ratios (HRs) with 95% confidence intervals (95% CIs). Statistical analysis was performed by SPSS version 23.0 (IBM Corp.) with statistical significance defined as P analysis showed that patients who had undergone total resection (TR) had better PFS and OS than those with subtotal resection (STR) and biopsy (P = .002, P = .004, respectively). Within either univariate or multivariate analysis (P = .000, P = .07, respectively), histological type was an independent prognostic factor for PFS of CE [papillary type: HR 0.002, 95% CI (0.000-0.073), P = .001, tanycytic type: HR 0.010, 95% CI (0.000-0.218), P = .003].It was the first integrative analysis of CE to elucidate the correlation between kinds of factors and prognostic outcomes. Definite histological type and safely TR were foundation of CE's management. 4.

Impact of periodontal maintenance on tooth survival in patients with removable partial dentures.

Science.gov (United States)

Tada, Sayaka; Allen, Patrick Finbarr; Ikebe, Kazunori; Matsuda, Ken-ichi; Maeda, Yoshinobu

2015-01-01

Removable partial dentures (RPDs) may have a negative impact on oral health and have the potential to cause further tooth loss, especially of abutment teeth. However, no evidence indicates the effective interval of regular periodontal maintenance after RPD provision. This practice-based cohort study aimed to examine the impact of regular periodontal maintenance visits on survival of RPD abutment teeth. One hundred and ninety-two patients had been previously provided with 304 new clasp-retained RPDs at Osaka University Dental Hospital, Japan. Using the Kaplan-Meier method and log-rank test, 1094 abutments were analysed to illustrate survival curves and to compare each curve. According to the frequency of periodontal maintenance, study samples were divided into three groups; every 3-6 months (3-6M) group, 1-year (1Y) group and no-maintenance (NM) group. Seven-year cumulative survival rates were 83.7% (3-6M), 75.5% (1Y) and 71.9% (NM) respectively. Survival of abutment teeth in the 3-6M group was significantly better than both 1Y (p = 0.005) and NM (p < 0.001) groups. These longitudinal clinical data indicates that periodontal maintenance at least once in 6 months had the most favourable outcome. Frequent periodontal maintenance after RPD provision could be effective in preventing further tooth loss. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

123I-MIBG imaging detects cardiac involvement and predicts cardiac events in Churg-Strauss syndrome

International Nuclear Information System (INIS)

Horiguchi, Yoriko; Morita, Yukiko; Tsurikisawa, Naomi; Akiyama, Kazuo

2011-01-01

In Churg-Strauss syndrome (CSS) it is important to detect cardiac involvement, which predicts poor prognosis. This study evaluated whether 123 I-metaiodobenzylguanidine (MIBG) scintigraphy could detect cardiac damage and predict cardiac events in CSS. 123 I-MIBG scintigraphy was performed in 28 patients with CSS, 12 of whom had cardiac involvement. The early and delayed heart to mediastinum ratio (early H/M and delayed H/M) and washout rate were calculated by using 123 I-MIBG scintigraphy and compared with those in control subjects. Early H/M and delayed H/M were significantly lower and the washout rate was significantly higher in patients with cardiac involvement than in those without and in controls (early H/M, p = 0.0024, p = 0.0001; delayed H/M, p = 0.0002, p = 0.0001; washout rate, p = 0.0012, p = 0.0052 vs those without and vs controls, respectively). Accuracy for detecting cardiac involvement was 86% for delayed H/M and washout rate and 79% for early H/M and B-type natriuretic peptide (BNP). Kaplan-Meier analysis showed significantly lower cardiac event-free rates in patients with early H/M ≤ 2.18 and BNP > 21.8 pg/ml than those with early H/M > 2.18 and BNP ≤ 21.8 pg/ml (log-rank test p = 0.006). Cardiac sympathetic nerve function was damaged in CSS patients with cardiac involvement. 123 I-MIBG scintigraphy was useful in detecting cardiac involvement and in predicting cardiac events. (orig.)

Relationship Between Preoperative Sarcopenia Status and Immuno-nutritional Parameters in Patients with Early-stage Non-small Cell Lung Cancer.

Science.gov (United States)

Shoji, Fumihiro; Matsubara, Taichi; Kozuma, Yuka; Haratake, Naoki; Akamine, Takaki; Takamori, Shinkichi; Katsura, Masakazu; Toyokawa, Gouji; Okamoto, Tatsuro; Maehara, Yoshihiko

2017-12-01

Although the skeletal muscle in the region of the third lumbar vertebra (L3) is generally assessed in order to judge sarcopenia, not every patient with non-small cell lung cancer (NSCLC) undergoes computed tomography including the L3 region. We hypothesized that immuno-nutritional parameters could predict the existence of sarcopenia in patients with NSCLC. The aim of this study was to retrospectively investigate the correlation between preoperative sarcopenia and immuno-nutritional parameters in patients with early-stage NSCLC. We selected 147 of patients with pathological stage I NSCLC who underwent preoperative measurement of immuno-nutritional parameters and CT including the L3 region. Preoperative sarcopenia was significantly associated with female gender (p=0.0003) and poor prognosis (p=0.0322). In Kaplan-Meier analysis of overall survival (OS) by preoperative sarcopenia status, the sarcopenic group had significantly shorter OS than the non-sarcopenic group (5-year OS: 87.27% vs. 77.37%, p=0.0131, log-rank test). In multivariate analysis, the preoperative sarcopenia status (hazard ratio=5.138; 95% confidence interval=2.305-11.676; psarcopenia status was significantly related to controlling nutritional status score (p=0.0071) and Geriatric Nutritional Risk Index (GNRI) (psarcopenia status and GNRI (r=0.348, psarcopenia which was associated with poor outcome in patients with early-stage NSCLC. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Is there a survival benefit within a German primary care-based disease management program?

Science.gov (United States)

Miksch, Antje; Laux, Gunter; Ose, Dominik; Joos, Stefanie; Campbell, Stephen; Riens, Burgi; Szecsenyi, Joachim

2010-01-01

To compare the mortality rate of patients with type 2 diabetes who were enrolled in the German diabetes disease management program (DMP) with the mortality rate of those who were not enrolled. This observational study was part of the ELSID study (Evaluation of a Large Scale Implementation of disease management programs) in Germany. Participants had type 2 diabetes and were either enrolled or not enrolled in the DMP. The DMP provides systems-based, multifaceted, and patient-centered interventions. To reduce imbalances between the groups, a matched sample was created using sex, age, retirement status, federal state, pharmacy-based cost groups, and diagnostic-cost groups as matching criteria. Cox proportional hazards regression model and the Kaplan-Meier method were used to assess overall mortality. The observation period was 3 years beginning on January 1, 2006. A total of 11,079 patients were included in the analysis. As of January 1, 2006, 2300 patients were enrolled in the DMP and 8779 were receiving routine care. There were 1927 matched pairs of patients in the DMP group and the non-DMP group. The overall mortality rate was 11.3% in the DMP and 14.4% in the non-DMP group (log-rank test P German diabetes DMP and reduced mortality. This reduced mortality cannot be attributed directly to the DMP. However, further research should evaluate whether a primary care-based DMP contributes to increased life expectancy in patients with diabetes.

Colon cancer with unresectable synchronous metastases: the AAAP scoring system for predicting the outcome after primary tumour resection.

Science.gov (United States)

Li, Z M; Peng, Y F; Du, C Z; Gu, J

2016-03-01

The aim of this study was to develop a prognostic scoring system to predict the outcome of patients with unresectable metastatic colon cancer who received primary colon tumour resection. Patients with confirmed metastatic colon cancer treated at the Peking University Cancer Hospital between 2003 and 2012 were reviewed retrospectively. The correlation of clinicopathological factors with overall survival was analysed using the Kaplan-Meier method and the log-rank test. Independent prognostic factors were identified using a Cox proportional hazards regression model and were then combined to form a prognostic scoring system. A total of 110 eligible patients were included in the study. The median survival time was 10.4 months and the 2-year overall survival (OS) rate was 21.8%. Age over 70 years, an alkaline phosphatase (ALP) level over 160 IU/l, ascites, a platelet/lymphocyte ratio (PLR) above 162 and no postoperative therapy were independently associated with a shorter OS in multivariate analysis. Age, ALP, ascites and PLR were subsequently combined to form the so-called AAAP scoring system. Patients were classified into high, medium and low risk groups according to the score obtained. There were significant differences in OS between each group (P colonic cancer who underwent primary tumour resection. The AAAP scoring system may be a useful tool for surgical decision making. Colorectal Disease © 2015 The Association of Coloproctology of Great Britain and Ireland.

Comparison of the 7(th) and proposed 8(th) editions of the AJCC/UICC TNM staging system for non-small cell lung cancer undergoing radical surgery.

Science.gov (United States)

Jin, Ying; Chen, Ming; Yu, Xinmin

2016-09-19

The present study aims to compare the 7(th) and the proposed 8(th) edition of the AJCC/UICC TNM staging system for NSCLC in a cohort of patients from a single institution. A total of 408 patients with NSCLC who underwent radical surgery were analyzed retrospectively. Survivals were analyzed using the Kaplan -Meier method and were compared using the log-rank test. Multivariate analysis was performed by the Cox proportional hazard model. The Akaike information criterion (AIC) and C-index were applied to compare the two prognostic systems with different numbers of stages. The 7(th) AJCC T categories, the proposed 8(th) AJCC T categories, N categories, visceral pleural invasion, and vessel invasion were found to have statistically significant associations with disease-free survival (DFS) on univariate analysis. In the 7(th) edition staging system as well as in the proposed 8(th) edition, T categories, N categories, and pleural invasion were independent factors for DFS on multivariate analysis. The AIC value was smaller for the 8(th) edition compared to the 7(th) edition staging system. The C-index value was larger for the 8(th) edition compared to the 7(th) edition staging system. Based on the data from our single center, the proposed 8(th) AJCC T classification seems to be superior to the 7(th) AJCC T classification in terms of DFS for patients with NSCLC underwent radical surgery.

Factors Predicting Ventilator Dependence in Patients with Ventilator-Associated Pneumonia

Directory of Open Access Journals (Sweden)

Chia-Cheng Tseng

2012-01-01

Full Text Available Objectives. To determine risk factors associated with ventilator dependence in patients with ventilator-associated pneumonia (VAP. Study Design. A retrospective study was conducted at Chang Gung Memorial Hospital, Kaohsiung, from January 1, 2007 to January 31, 2008. Methods. This study evaluated 163 adult patients (aged ≥18 years. Eligibility was evaluated according to the criterion for VAP, Sequential Organ Failure Assessment (SOFA score, Acute Physiological Assessment and Chronic Health Evaluation II (APACHE II score. Oxygenation index, underlying comorbidities, septic shock status, previous tracheostomy status, and factors related to pneumonia were collected for analysis. Results. Of the 163 VAP patients in the study, 90 patients survived, yielding a mortality rate of 44.8%. Among the 90 surviving patients, only 36 (40% had been weaned off ventilators at the time of discharge. Multivariate logistic regression analysis was used to identify underlying factors such as congestive cardiac failure (P=0.009, initial high oxygenation index value (P=0.04, increased SOFA scores (P=0.01, and increased APACHE II scores (P=0.02 as independent predictors of ventilator dependence. Results from the Kaplan-Meier method indicate that initial therapy with antibiotics could increase the ventilator weaning rate (log Rank test, P<0.001. Conclusions. Preexisting cardiopulmonary function, high APACHE II and SOFA scores, and high oxygenation index were the strongest predictors of ventilator dependence. Initial empiric antibiotic treatment can improve ventilator weaning rates at the time of discharge.

Dramatic impact of blood transfusion on cancer-specific survival after radical cystectomy irrespective of tumor stage.

Science.gov (United States)

Buchner, Alexander; Grimm, Tobias; Schneevoigt, Birte-Swantje; Wittmann, Georg; Kretschmer, Alexander; Jokisch, Friedrich; Grabbert, Markus; Apfelbeck, Maria; Schulz, Gerald; Gratzke, Christian; Stief, Christian G; Karl, Alexander

2017-04-01

The aim of the present study was to determine the influence of intraoperative and postoperative blood transfusion on cancer-specific outcome. Follow-up data were collected from 722 patients undergoing radical cystectomy for urothelial carcinoma of the bladder (UCB) between 2004 and 2014. Median follow-up was 26 months (interquartile range 12-61 months). Outcome was analyzed in relation to the amount of intraoperative and postoperative blood transfusion and different tumor stages. The primary endpoint was cancer-specific survival (CSS) after cystectomy. Kaplan-Meier analysis with log-rank test and Cox regression models were used. Intraoperative blood transfusion was given in 36% (263/722) and postoperative blood transfusion in 18% (132/722). In patients with and without intraoperative blood transfusion, 5 year CSS was 48% and 67%, respectively (p blood transfusion, 5 year CSS was 48% and 63%, respectively (p transfused red blood cell (RBC) units [intraoperatively: hazard ratio (HR) = 1.08, 95% confidence interval (CI) 1.01-1.15, p = .023; postoperatively: HR = 1.14, 95% CI 1.07-1.21, p transfusions was also found in favorable subgroups (pT1 tumor, hemoglobin ≥13 mg/dl, p = .004) and in a high-volume surgeon subgroup (n = 244, p Blood transfusions during and after radical cystectomy were independent prognostic factors for CSS in this retrospective study. Therefore, efforts should be made to reduce the necessity of intraoperative and postoperative blood transfusion in cystectomy patients.

Prognostic classification index in Iranian colorectal cancer patients: Survival tree analysis

Directory of Open Access Journals (Sweden)

Amal Saki Malehi

2016-01-01

Full Text Available Aims: The aim of this study was to determine the prognostic index for separating homogenous subgroups in colorectal cancer (CRC patients based on clinicopathological characteristics using survival tree analysis. Methods: The current study was conducted at the Research Center of Gastroenterology and Liver Disease, Shahid Beheshti Medical University in Tehran, between January 2004 and January 2009. A total of 739 patients who already have been diagnosed with CRC based on pathologic report were enrolled. The data included demographic and clinical-pathological characteristic of patients. Tree-structured survival analysis based on a recursive partitioning algorithm was implemented to evaluate prognostic factors. The probability curves were calculated according to the Kaplan-Meier method, and the hazard ratio was estimated as an interest effect size. Result: There were 526 males (71.2% of these patients. The mean survival time (from diagnosis time was 42.46± (3.4. Survival tree identified three variables as main prognostic factors and based on their four prognostic subgroups was constructed. The log-rank test showed good separation of survival curves. Patients with Stage I-IIIA and treated with surgery as the first treatment showed low risk (median = 34 months whereas patients with stage IIIB, IV, and more than 68 years have the worse survival outcome (median = 9.5 months. Conclusion: Constructing the prognostic classification index via survival tree can aid the researchers to assess interaction between clinical variables and determining the cumulative effect of these variables on survival outcome.

Analysis of a novel protocol of combined induction chemotherapy and concurrent chemoradiation in unresected non-small-cell lung cancer: a ten-year experience with vinblastine, Cisplatin, and radiation therapy.

Science.gov (United States)

Waters, Eugenie; Dingle, Brian; Rodrigues, George; Vincent, Mark; Ash, Robert; Dar, Rashid; Inculet, Richard; Kocha, Walter; Malthaner, Richard; Sanatani, Michael; Stitt, Larry; Yaremko, Brian; Younus, Jawaid; Yu, Edward

2010-07-01

The London Regional Cancer Program (LRCP) uses a unique schedule of induction plus concurrent chemoradiation, termed VCRT (vinblastine, cisplatin, and radiation therapy), for the treatment of a subset of unresectable stage IIIA and IIIB non-small-cell lung cancer (NSCLC). This analysis was conducted to better understand the outcomes in VCRT-treated patients. We report a retrospective analysis of a large cohort of patients who underwent VCRT at the LRCP over a 10-year period, from 1996 to 2006. The analysis focused on OS, toxicities, and the outcomes from completion surgery in a small subset of patients. A total of 294 patients were included and 5-year OS, determined using Kaplan-Meier methodology, was 19.8% with a MST of 18.2 months. Reported grade 3-4 toxicities included neutropenia (39%), anemia (10%), pneumonitis (1%), and esophagitis (3%). Significant differences in survival between groups of patients were demonstrated with log-rank tests for completion surgery, use of radiation therapy, and cisplatin dose. Similarly, Univariate Cox regression showed that completion surgery, use of radiation therapy, cisplatin dose, and vinblastine dose were associated with increased survival. This retrospective analysis of a large cohort of patients reveals an OS for VCRT comparable to that reported in the literature for other current combined chemoradiation protocols. The success of this protocol seems to be dose dependent and the outcomes in those who underwent completion surgery suggests that pathologic complete remission is possible for IIIA and IIIB NSCLC.

Postoperative radiotherapy in patients with salivary duct carcinoma. Clinical outcomes and prognostic factors

International Nuclear Information System (INIS)

Shinoto, Makoto; Shioyama, Yoshiyuki; Nakamura, Katsumasa

2013-01-01

This study sought to investigate the clinical outcome and the role of postoperative radiotherapy for patients with salivary duct carcinoma (SDC) who had undergone surgery and postoperative radiotherapy. We performed a retrospective analysis of 25 SDC patients treated between 1998 and 2011 with surgery and postoperative radiotherapy. The median prescribed dose was 60 Gy (range, 49.5-61.4 Gy). The clinical target volume (CTV) was defined as the tumor bed in four patients, the tumor bed and ipsilateral neck in 14 patients, and the tumor bed and bilateral neck in six patients. Local control (LC), disease-free survival (DFS) and overall survival (OS) were estimated using the Kaplan-Meier method, and prognostic variables were analyzed with the log-rank test. The 5-year LC, DFS and OS were 67%, 45% and 47%, respectively. Disease recurrence was found in 12 patients: seven as local, four as regional and eight as distant failure. Perineural and lymphovascular invasion was a significant prognostic factor for LC (P=0.03). Local failure was common, and the presence of local recurrence significantly affected the OS (P<0.05). We conclude that surgery and postoperative radiotherapy is expected to decrease the risk of local failure and contribute to good prognoses for patients with SDC. It might be advisable to have the CTV include the cranial nerves involved and the corresponding parts of the skull base in cases of pathologically positive perineural invasion. (author)

Prolonged methylprednisolone therapy after the pulse treatment for patients with moderate-to-severe paraquat poisoning: A retrospective analysis.

Science.gov (United States)

Gao, Jie; Feng, ShunYi; Wang, Jian; Yang, SiYuan; Li, Yong

2017-06-01

This retrospective study aims to evaluate the effect of prolonged methylprednisolone (MP) therapy on the mortality of patients with moderate-to-severe paraquat (PQ) poisoning after the pulse treatment.We performed a retrospective analysis of patients with acute moderate-to-severe PQ poisoning that were admitted to the emergency department from May 2012 to August 2016. Out of 138 patients, 60 were treated with pulse treatment (15 mg kg day MP for 3 days) and 78 were treated with prolonged MP therapy after pulse treatment (15 mg kg day MP for 3 days; afterward, the dosage was reduced in half every 2 days, and the MP therapy was terminated until 0.47 mg kg day). Kaplan-Meier method was used to compare the mortality between the 2 groups. Cox proportional hazard models were used to estimate the hazard ratios (HR) and 95% confidence intervals (CI).The mortality of the prolonged MP therapy after pulse treatment group was lower than that of the pulse group (47.4% vs 63.3%; log-rank tests, P  =  .003). According to the multivariate Cox analysis, the prolonged MP therapy after pulse treatment was significantly associated with a lower mortality risk (HR: 0.31, 95% CI: 0.19-0.52, P treatment caused more incidences of leucopenia than the pulse treatment alone (25.6% vs 11.7%, P  =  .04).The prolonged MP therapy after pulse treatment can reduce the mortality of moderate-to-severe PQ poisoning patients.

Oncocytic adrenocortical neoplasms--a clinicopathologic study of 13 new cases emphasizing the importance of their recognition.

Science.gov (United States)

Wong, Daniel D; Spagnolo, Dominic V; Bisceglia, Michele; Havlat, Marek; McCallum, Dugald; Platten, Michael A

2011-04-01

Oncocytic adrenocortical neoplasms (OANs) are a rare but important subtype of adrenal tumors with unique clinical and morphological features. We present 13 previously unpublished cases, of which 3 were classified as benign, 2 as having borderline malignant potential, and 8 as malignant according to the Lin-Weiss-Bisceglia criteria. Seven tumors (54%) showed evidence of endocrine activity. All were composed of more than 90% oncocytes confirmed immunohistochemically using the antimitochondrial antibody mES-13 and ultrastructurally in 4 cases. Small oncocytes were a frequent finding that challenges the conventional notion of oncocytes as necessarily having abundant cytoplasm. Most cases were immunoreactive for vimentin, synaptophysin, inhibin-α, melan A, and calretinin, the latter being a novel finding in this group of neoplasms. Cytokeratin positivity with AE1/AE3 and CAM5.2 was variable. The literature was comprehensively reviewed to identify all cases of OANs reported to date. Hormone production is not as uncommon as previously believed, occurring in 30%. The Lin-Weiss-Bisceglia criteria were retrospectively applied to all published cases with sufficient information and were shown to effectively separate tumors according to their future risk of recurrence and survival using Kaplan-Meier survival curves (log-rank test, P interval = 27.5-88.5 months), providing the first preliminary evidence that the prognosis of malignant OANs is likely to be more favorable than conventional adrenocortical carcinomas, in which the reported median survival is between 14 and 32 months. Copyright © 2011 Elsevier Inc. All rights reserved.

Childhood lupus nephritis: 12 years of experience from a developing country's perspective.

Science.gov (United States)

Samanta, Moumita; Nandi, Madhumita; Mondal, Rakesh; Hazra, Avijit; Sarkar, Sumatra; Sabui, Tapas; Kundu, Chanchal Kumar; Biswas, Arnab

2017-09-01

To assess the long-term outcome of lupus nephritis in children with systemic lupus erythematosus followed up over 12 years at a tertiary care teaching hospital in Eastern India. This is a retrospective observational study of the clinicopathological presentation, management, and outcome in 46 children with lupus nephritis over a period of 12 years at a tertiary teaching hospital in Eastern India. Mortality was compared between different lupus classes and therapy groups with Kaplan-Meier analysis and log-rank test. The incidence of lupus nephritis was 58.97% [95% confidence interval (CI) 48.06%-59.89%] with the mean age at presentation being 10.2±2.43 years (range 5.5-14.5) years. Majority belonged to class IV (30.43%), followed by class II (26.91%), class III (23.91), and class V (8.70%). Outcome analysis of children with lupus nephritis over 12 years revealed that 24 (52.17%) achieved complete remission of disease activity, 5 attained partial remission, 4 continued to have active disease, 5 developed end-stage renal disease (ESRD), and 8 died. Overall mortality thus observed was 17.39% with septicemia in the background of ESRD being the commonest cause. No significant difference in mortality was observed between different lupus nephritis classes or therapy arm groups. The study throws light on various aspects of lupus nephritis and their long-term outcome patterns in children from developing countries such as India.

Mid-regional pro-atrial natriuretic peptide as a prognostic marker for all-cause mortality in patients with symptomatic coronary artery disease.

Science.gov (United States)

von Haehling, Stephan; Papassotiriou, Jana; Hartmann, Oliver; Doehner, Wolfram; Stellos, Konstantinos; Geisler, Tobias; Wurster, Thomas; Schuster, Andreas; Botnar, Rene M; Gawaz, Meinrad; Bigalke, Boris

2012-11-01

In the present study, we investigated the prognostic value of MR-proANP (mid-regional pro-atrial natriuretic peptide). We consecutively evaluated a catheterization laboratory cohort of 2700 patients with symptomatic CAD (coronary artery disease) [74.1% male; ACS (acute coronary syndrome), n=1316; SAP (stable angina pectoris), n=1384] presenting to the Cardiology Department of a large primary care hospital, all of whom underwent coronary angiography. Serum MR-proANP and other laboratory markers were sampled at the time of presentation or in the catheterization laboratory. Clinical outcome was assessed by hospital chart analysis and telephone interviews. The primary end point was all-cause death at 3 months after enrolment. Follow-up data were complete in 2621 patients (97.1%). Using ROC (receiver operating characteristic) curves, the AUC (area under the curve) of 0.73 [95% CI (confidence interval), 0.67-0.79] for MR-proANP was significantly higher compared with 0.58 (95% CI, 0.55-0.62) for Tn-I (troponin-I; DeLong test, P=0.0024). According to ROC analysis, the optimal cut-off value of MR-proANP was at 236 pmol/l for all-cause death, which helped to find a significantly increased rate of all-cause death (n=76) at 3 months in patients with elevated baseline concentrations (≥236 pmol/l) compared with patients with a lower concentration level in Kaplan-Meier survival analysis (log rank, Pvalue and confirm the appropriate cut-off value.

Rhabdomyosarcoma of the lower female genital tract: an analysis of 144 cases.

Science.gov (United States)

Nasioudis, Dimitrios; Alevizakos, Michail; Chapman-Davis, Eloise; Witkin, Steven S; Holcomb, Kevin

2017-08-01

The aim of the present study was to elucidate the clinico-pathological characteristics of female patients with lower genital tract rhabdomyosarcoma (RMS) stratified by age group and investigate their prognosis, using a multi-institutional database. The National Cancer Institute's Surveillance, Epidemiology, and End Results (SEER) database was accessed (1973-2013) and a cohort of females diagnosed with RMS of the lower genital tract (vulva, vagina, cervix) was drawn. Five-year overall survival (OS) rate was estimated following generation of Kaplan-Meier curves and compared with the log-rank test. A total of 144 eligible cases were identified; 51.4 and 48.6% originated from the vagina/vulva and the cervix, respectively. Median patient age was 16 years and distant metastases were rare (ten cases). The majority of tumors were of embryonal histology (75.7%). Non-embryonal RMS was more prevalent in the older patient groups. Tumors originating from the cervix were more common among adolescents and premenopausal women. Rate of LN involvement was 52.9 and 20% for vulvovaginal and cervical tumors (p = 0.02). Five-year OS rate was 68.4%; factors associated with better OS were younger age, absence of distant metastasis, embryonal histology, negative LNs, and performance of surgery. For prepubertal girls and adolescents, radical surgery did not confer a survival benefit compared to local tumor excision. RMS of the lower genital tract primarily affects prepubertal girls and adolescents, who have excellent survival rates; however, outcomes for adults remain poor.

Low dose rate brachytherapy (LDR-BT) as monotherapy for early stage prostate cancer in Italy: practice and outcome analysis in a series of 2237 patients from 11 institutions.

Science.gov (United States)

Fellin, Giovanni; Mirri, Maria A; Santoro, Luigi; Jereczek-Fossa, Barbara A; Divan, Claudio; Mussari, Salvatore; Ziglio, Francesco; La Face, Beniamino; Barbera, Fernando; Buglione, Michela; Bandera, Laura; Ghedi, Barbara; Di Muzio, Nadia G; Losa, Andrea; Mangili, Paola; Nava, Luciano; Chiarlone, Renato; Ciscognetti, Nunzia; Gastaldi, Emilio; Cattani, Federica; Spoto, Ruggero; Vavassori, Andrea; Giglioli, Francesca R; Guarneri, Alessia; Cerboneschi, Valentina; Mignogna, Marcello; Paoluzzi, Mauro; Ravaglia, Valentina; Chiumento, Costanza; Clemente, Stefania; Fusco, Vincenzo; Santini, Roberto; Stefanacci, Marco; Mangiacotti, Francesco P; Martini, Marco; Palloni, Tiziana; Schinaia, Giuseppe; Lazzari, Grazia; Silvano, Giovanni; Magrini, Stefano; Ricardi, Umberto; Santoni, Riccardo; Orecchia, Roberto

2016-09-01

Low-dose-rate brachytherapy (LDR-BT) in localized prostate cancer is available since 15 years in Italy. We realized the first national multicentre and multidisciplinary data collection to evaluate LDR-BT practice, given as monotherapy, and outcome in terms of biochemical failure. Between May 1998 and December 2011, 2237 patients with early-stage prostate cancer from 11 Italian community and academic hospitals were treated with iodine-125 ((125)I) or palladium-103 LDR-BT as monotherapy and followed up for at least 2 years. (125)I seeds were implanted in 97.7% of the patients: the mean dose received by 90% of target volume was 145 Gy; the mean target volume receiving 100% of prescribed dose (V100) was 91.1%. Biochemical failure-free survival (BFFS), disease-specific survival (DSS) and overall survival (OS) were estimated using Kaplan-Meier method. Log-rank test and multivariable Cox regression were used to evaluate the relationship of covariates with outcomes. Median follow-up time was 65 months. 5- and 7-year DSS, OS and BFFS were 99 and 98%, 94 and 89%, and 92 and 88%, respectively. At multivariate analysis, the National Comprehensive Cancer Network score (p LDR-BT. This first multicentre Italian report confirms LDR-BT as an excellent curative modality for low-/intermediate-risk prostate cancer. Multidisciplinary teams may help to select adequately patients to be treated with brachytherapy, with a direct impact on the implant quality and, possibly, on outcome.

Survival outcome of malignant minor salivary tumors in Pakistani population

Directory of Open Access Journals (Sweden)

Hassan Iqbal

2014-01-01

Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.

Proton-pump inhibitors for prevention of upper gastrointestinal bleeding in patients undergoing dialysis.

Science.gov (United States)

Song, Young Rim; Kim, Hyung Jik; Kim, Jwa-Kyung; Kim, Sung Gyun; Kim, Sung Eun

2015-04-28

To investigate the preventive effects of low-dose proton-pump inhibitors (PPIs) for upper gastrointestinal bleeding (UGIB) in end-stage renal disease. This was a retrospective cohort study that reviewed 544 patients with end-stage renal disease who started dialysis at our center between 2005 and 2013. We examined the incidence of UGIB in 175 patients treated with low-dose PPIs and 369 patients not treated with PPIs (control group). During the study period, 41 patients developed UGIB, a rate of 14.4/1000 person-years. The mean time between the start of dialysis and UGIB events was 26.3 ± 29.6 mo. Bleeding occurred in only two patients in the PPI group (2.5/1000 person-years) and in 39 patients in the control group (19.2/1000 person-years). Kaplan-Meier analysis of cumulative non-bleeding survival showed that the probability of UGIB was significantly lower in the PPI group than in the control group (log-rank test, P < 0.001). Univariate analysis showed that coronary artery disease, PPI use, anti-coagulation, and anti-platelet therapy were associated with UGIB. After adjustments for the potential factors influencing risk of UGIB, PPI use was shown to be significantly beneficial in reducing UGIB compared to the control group (HR = 13.7, 95%CI: 1.8-101.6; P = 0.011). The use of low-dose PPIs in patients with end-stage renal disease is associated with a low frequency of UGIB.

Normal stress-only myocardial single photon emission computed tomography predicts good outcome in patients with coronary artery stenoses between 40 and 70.

Science.gov (United States)

Jiang, Zhixin; Liu, Yangqing; Xin, Chaofan; Zhou, Yanli; Wang, Cheng; Zhao, Zhongqiang; Li, Chunxiang; Li, Dianfu

2016-09-01

Normal stress myocardial single photon emission computed tomography (SPECT) usually indicates good physiologic function of all coronary lesions, and also indicates a good outcome. We hypothesize that it can still predict good outcome in patients with coronary stenoses between 40 and 70%. A group of patients who underwent stress myocardial SPECT after coronary angiography were consecutively recruited in our center. Patients were eligible if they had one or more coronary stenoses between 40 and 70%. Patients with coronary stenoses greater than 50% diameter of left main or greater than 70% diameter of nonleft main epicardial vessels, and left ventricular ejection fraction less than 50% were excluded. The outcome was defined as major adverse events, including cardiac death, nonfatal myocardial infarction, and revascularization. Patients' survival curves were constructed accorded to the method of Kaplan and Meier and compared using the log-rank test. A study cohort of 77 patients was enrolled. According to the summed stress score, 43 patients were assigned to the perfusion defect group and 34 patients were assigned to the perfusion normal group. The follow-up duration was 6.4±0.3 years. In the perfusion normal group, only one of 34 (2.9%) patients developed major adverse events. In the perfusion defect group, six of 43 (14%) developed major adverse events, P-value of 0.041. It is safe to defer a percutaneous coronary intervention in patients with coronary stenoses between 40 and 70% and normal stress myocardial SPECT.

Comparison of differentiated thyroid cancer in children and adolescents (≤20 years) with young adults.

Science.gov (United States)

Alzahrani, Ali S; Alkhafaji, Dania; Tuli, Mahmoud; Al-Hindi, Hindi; Sadiq, Bakr Bin

2016-04-01

Age is a major prognostic factor in differentiated thyroid cancer (DTC). It is not clear if paediatric DTC has a different histopathological profile and outcome than DTC in adult patients age. To assess whether DTC in children and adolescents differs from young age group by comparing paediatric DTC (age ≤ 20) with DTC in patients >20 to age. We studied all cases of paediatric DTC seen during the period 1998-2011. We compared this group with a large sample of 213 consecutive adult patients in the age group >20 to age 17 years (range, 8-20)] and 213 young adult patients [median age 33 years (range, 20·5-44·9)]. There was no difference in gender distribution, tumour subtypes, size and tumour multifocality, but there was a significantly higher rate of extrathyroidal extension [40/75 (53·3%) vs 81/213 (38·0%), P = 0·03], lymph node [57/73 (78%) vs 102/183 (55·7%), P adult groups. Kaplan-Meier analysis showed a higher risk of persistent/recurrent disease in the paediatric group than adults (log-rank test 0·03). However, there was no mortality secondary to DTC in both groups. Paediatric DTC is distinct from DTC in the young adults (age >20 to <45 years). It is characterized by a higher rate of extrathyroidal extension, lymph node and distant metastases and a higher risk of persistent/recurrent DTC. © 2015 John Wiley & Sons Ltd.

Volume-based quantitative FDG PET/CT metrics and their association with optimal debulking and progression-free survival in patients with recurrent ovarian cancer undergoing secondary cytoreductive surgery

International Nuclear Information System (INIS)

Vargas, H.A.; Burger, I.A.; Micco, M.; Sosa, R.E.; Weber, W.; Hricak, H.; Sala, E.; Goldman, D.A.; Chi, D.S.

2015-01-01

Our aim was to evaluate the associations between quantitative 18 F-fluorodeoxyglucose positron-emission tomography (FDG-PET) uptake metrics, optimal debulking (OD) and progression-free survival (PFS) in patients with recurrent ovarian cancer undergoing secondary cytoreductive surgery. Fifty-five patients with recurrent ovarian cancer underwent FDG-PET/CT within 90 days prior to surgery. Standardized uptake values (SUV max ), metabolically active tumour volumes (MTV), and total lesion glycolysis (TLG) were measured on PET. Exact logistic regression, Kaplan-Meier curves and the log-rank test were used to assess associations between imaging metrics, OD and PFS. MTV (p = 0.0025) and TLG (p = 0.0043) were associated with OD; however, there was no significant association between SUV max and debulking status (p = 0.83). Patients with an MTV above 7.52 mL and/or a TLG above 35.94 g had significantly shorter PFS (p = 0.0191 for MTV and p = 0.0069 for TLG). SUV max was not significantly related to PFS (p = 0.10). PFS estimates at 3.5 years after surgery were 0.42 for patients with an MTV ≤ 7.52 mL and 0.19 for patients with an MTV > 7.52 mL; 0.46 for patients with a TLG ≤ 35.94 g and 0.15 for patients with a TLG > 35.94 g. FDG-PET metrics that reflect metabolic tumour burden are associated with optimal secondary cytoreductive surgery and progression-free survival in patients with recurrent ovarian cancer. (orig.)

Socioeconomic status is an independent predictor of biochemical recurrence among patients with prostate cancer who undergo radical prostatectomy

Directory of Open Access Journals (Sweden)

Victor Srougi

2011-08-01

Full Text Available PURPOSE: Socioeconomic status (SES may influence cancer characteristics and behavior in several aspects. We analyzed PCa characteristics and behavior among low income uninsured men, and compare them to high income patients with health insurance in a developing country. MATERIALS AND METHODS: A retrospective case-control study was performed on 934 patients with clinically localized PCa who underwent radical prostatectomy between March, 1999 and July, 2009. Patients were divided in two groups, according to their SES. In group 1 (n=380, all had low income, low educational levels and couldn't afford medical insurance. In group 2 (n=554, all had higher income, higher education and had medical insurance. RESULTS: Patients from group 1 were older, had higher Gleason scores, higher rates of seminal vesicle and bladder neck involvement. The Kaplan Meier disease-free survival curve demonstrated that after a follow-up of four years, about 50% of uninsured patients had biochemical recurrence, versus 21% of insured patients (Log rank test: p < 0.001. A multivariate Cox regression analysis for the risk of disease recurrence demonstrated that only PSA levels, Gleason score, seminal vesicle involvement and SES were statistically significant variables. Patients with a low SES presented 1.8 times the risk of recurrence as compared to patients with a high SES. CONCLUSIONS: Patients with low SES were older, presented more aggressive PCa characteristics and a high rate of disease recurrence. A low SES constituted an independent predictor for disease recurrence.

The expression of FAT1 is associated with overall survival in children with medulloblastoma.

Science.gov (United States)

Yu, Jianzhong; Li, Hao

2017-01-21

The FAT1 gene is involved in some cancers; however, its role in medulloblastoma is less clear. This study investigated the effects of FAT1 expression on the prognosis of medulloblastoma patients. Whole exome sequencing was undertaken in 40 medulloblastoma patient samples. FAT1 mRNA and protein expression levels in normal and brain tumor tissues were determined by fluorescence quantitative PCR and immunohistochemistry, respectively. The association of FAT1 expression with overall survival (OS) was examined by Kaplan-Meier curve analysis with a log-rank test. Following lentiviral-mediated FAT1 knockdown using shRNA in Daoy cells, proliferation, Wnt signaling, and β-catenin protein expression were determined. Eight FAT1 missense mutations were detected in 7 patients. FAT1 mRNA expression in tumors was significantly lower than in adjacent normal tissue (p = 0.043). The OS of patients with high FAT1 protein expression was significantly longer than that of patients with low FAT1 protein expression (median survival time: 24.3 vs 4.8 months, respectively; p = 0.002). shFAT1 cells had significantly higher proliferation rates than shControl cells (p≤0.028). Furthermore, the mRNA expression of LEF1, β-catenin, and cyclin D1 was significantly upregulated in shFAT1-Daoy cells (p≤0.018). Low FAT1 expression was associated with poor prognosis in children with medulloblastoma. Furthermore, FAT1 may act on Wnt signaling pathway to exert its antitumor effect.

Prognostic and Predictive Value of CpG Island Methylator Phenotype in Patients with Locally Advanced Nonmetastatic Sporadic Colorectal Cancer

Directory of Open Access Journals (Sweden)

Yuwei Wang

2014-01-01

Full Text Available Purpose. In the present study, the prognostic significance of CpG island methylator phenotype (CIMP in stage II/III sporadic colorectal cancer was evaluated using a five-gene panel. Methods. Fifty stage II/III colorectal cancer patients who received radical resection were included in this study. Promoter methylation of p14ARF, hMLH1, p16INK4a, MGMT, and MINT1 was determined by methylation specific polymerase chain reaction (MSP. CIMP positive was defined as hypermethylation of three or more of the five genes. Impact factors on disease-free survival (DFS and overall survival (OS were analyzed using Kaplan-Meier method (log-rank test and adjusted Cox proportional hazards model. Results. Twenty-four percent (12/50 of patients were characterized as CIMP positive. Univariate analysis showed stage III (P=0.049 and CIMP positive (P=0.014 patients who had significantly inferior DFS. In Cox regression analysis, CIMP positive epigenotype was independently related with poor DFS with HR = 2.935 and 95% CI: 1.193–7.220 (P=0.019. In patients with CIMP positive tumor, those receiving adjuvant chemotherapy had a poor DFS than those without adjuvant chemotherapy (P=0.023. Conclusions. CIMP positive was significantly correlated with decreased DFS in stage II/III colorectal cancer. Patients with CIMP positive locally advanced sporadic colorectal cancers may not benefit from 5-fluorouracil based adjuvant chemotherapy.

Prediction of Mortality after Emergent Transjugular Intrahepatic Portosystemic Shunt Placement: Use of APACHE II, Child-Pugh and MELD Scores in Asian Patients with Refractory Variceal Hemorrhage

International Nuclear Information System (INIS)

Tzeng, Wen Sheng; Wu, Reng Hong; Lin, Ching Yih; Chen, Jyh Jou; Sheu, Ming Juen; Koay, Lok Beng; Lee, Chuan

2009-01-01

This study was designed to determine if existing methods of grading liver function that have been developed in non-Asian patients with cirrhosis can be used to predict mortality in Asian patients treated for refractory variceal hemorrhage by the use of the transjugular intrahepatic portosystemic shunt (TIPS) procedure. Data for 107 consecutive patients who underwent an emergency TIPS procedure were retrospectively analyzed. Acute physiology and chronic health evaluation (APACHE II), Child-Pugh and model for end-stage liver disease (MELD) scores were calculated. Survival analyses were performed to evaluate the ability of the various models to predict 30-day, 60-day and 360-day mortality. The ability of stratified APACHE II, Child-Pugh, and MELD scores to predict survival was assessed by the use of Kaplan-Meier analysis with the log-rank test. No patient died during the TIPS procedure, but 82 patients died during the follow-up period. Thirty patients died within 30 days after the TIPS procedure; 37 patients died within 60 days and 53 patients died within 360 days. Univariate analysis indicated that hepatorenal syndrome, use of inotropic agents and mechanical ventilation were associated with elevated 30-day mortality (p 11 or an MELD score > 20 predicted increased risk of death at 30, 60 and 360 days (p 11 or an MELD score > 20 are predictive of mortality in Asian patients with refractory variceal hemorrhage treated with the TIPS procedure. An APACHE II score is not predictive of early mortality in this patient population

The prognostic value of time parameters in adjuvant radiotherapy of head and neck cancer. A retrospective analysis of 138 patients

International Nuclear Information System (INIS)

Dietl, B.; Schaefer, C.; Koelbl, O.

2005-01-01

Purpose: to answer the question, how the parameters waiting time, radiation treatment time and overall treatment time (OTT) influenced the endpoints overall (OS), event-free (EFS) and local recurrence-free survival (LRFS) in patients with locally advanced head-and-neck cancer, who had received postoperative radiotherapy. Patients and methods: 138 patients were included into a retrospective analysis from 10/1993 to 05/2000. Besides the time parameters waiting time, radiation treatment time and OTT, tumor- and therapy-related parameters (T-, N-, R-status, grading, tumor site, surgical technique, and postoperative hemoglobin < 12 g/dl) with potential impact on the endpoints were investigated in the univariate analysis (Kaplan-Meier log-rank test). Individual parameters with a significant impact (p = 0.05) were subjected to a multivariate Cox regression analysis. Results: besides a postoperative hemoglobin value < 12 g/dl, in the univariate analysis an OTT ≥ 105 days negatively influenced all endpoints, as well as a radiation treatment time ≥ 60 days. On multivariate Cox regression analysis, postoperative hemoglobin < 12 g/dl and an OTT ≥ 105 days were identified as independent negative prognostic factors for all endpoints. Conclusion: the waiting time should be managed according to the ASARA (as short as reasonably achievable) recommendation, radiation treatment should not be protracted exceeding an overall treatment of 105 days. Generally, time parameters should be routinely included in the standard tumor documentation, thus facilitating further evaluation of these prognostically relevant factors. (orig.)

The Prognostic Value of 18F-FDG Uptake Ratio Between the Right and Left Ventricles in Idiopathic Pulmonary Arterial Hypertension.

Science.gov (United States)

Li, Wen; Wang, Lei; Xiong, Chang-Ming; Yang, Tao; Zhang, Yan; Gu, Qing; Yang, Yong; Ni, Xin-Hai; Liu, Zhi-Hong; Fang, Wei; He, Jian-Guo

2015-11-01

Metabolic changes occur in the right ventricle (RV) under increased afterload in pulmonary arterial hypertension. FDG PET imaging has potential to assess RV function. In this study, we aimed to determine the prognostic value of metabolic changes of RV using FDG PET imaging in idiopathic pulmonary arterial hypertension (IPAH). In this prospective investigation, patients newly diagnosed with IPAH were recruited. Patients underwent right heart catheterization, FDG PET imaging, and cardiac MR (CMR) within 1 week. Right ventricle hemodynamics, glucose metabolism derived from the FDG uptake levels, and functional parameters were obtained. The FDG uptake ratio between the RV and the left ventricle (LV) and its relation with the patients' survival were analyzed. A total of 45 IPAH patients were enrolled in this study, which included 13 male (28.9%) and 32 female (71.1%). The median follow-up time of this study was 1043 days. At the end of the follow-up, 36 patients survived, whereas 9 patients were deceased because of right heart failure. Multivariate Cox proportional hazard analysis showed that the ratio between the corrected RV and LV FDG uptake (cRV/LV) in both glucose-loading (cRV/LVg) and fasting (cRV/LVf) conditions independently predicted the mortality after adjusting for pulmonary vascular resistance index, mean right atrial pressure, and World Health Organization functional class. Kaplan-Meier survival analysis showed that patients with cRV/LVf greater than 143.65% in fasting condition (log rank, P = 0.030) or cRV/LVg greater than 120.55% in glucose-loading condition (log rank, P = 0.014) had worse prognosis. The FDG uptake ratio between the RV and LV can be an independent predictor for long-term prognosis of IPAH patients.

Diagnostic and prognostic value of N-terminal pro B-type natriuretic peptide (NT-proBNP) in patients with chronic aortic regurgitation.

Science.gov (United States)

Weber, Michael; Hausen, Michael; Arnold, Roman; Moellmann, Helge; Nef, Holger; Elsaesser, Albrecht; Mitrovic, Vesselin; Hamm, Christian

2008-07-21

BNP and its N-terminal fragment NT-proBNP have proven to be of diagnostic and prognostic value in patients with valvular aortic stenosis. Data regarding those biomarkers in patients with chronic aortic regurgitation (AR) are sparse. Thus it was the aim of the present study to evaluate the diagnostic and the long term prognostic value of NT-proBNP in patients presenting with AR. This study included 60 patients with isolated AR of varying severity (AR I mild, AR II moderate and AR III severe) and preserved left ventricular function. Patients were followed over a median period of 824 (770-921) days. NT-proBNP at baseline was related to disease severity and to functional status (161 (70-456) pg/ml in AR I, 226 (100-666) pg/ml in AR II and 1268 (522-5446) pg/ml in AR III (p=0.003)). Patients (n=6) experiencing an adverse event had higher NT-proBNP values at baseline as event free survivors (1271 (613-2992) pg/ml vs. 215 (92-534) pg/ml; p=0.034). The AUC of the ROC curve for NT-proBNP as a predictor for an adverse event was 0.76 (pvalue of 602 pg/ml. Consequently, in Kaplan-Meier analysis NT-proBNP values dichotomised at this cut-off were able to discriminate patients with an adverse outcome in the entire study group (Log rank 9.98, p=0.0016) and even better in the conservative group (Log rank 26.92, p<0.001). NT-proBNP is linked to disease severity in patients with chronic aortic regurgitation reflecting hemodynamic stress due to volume overload. It provides prognostic information for the clinical outcome and thus might be a useful biomarker for risk stratification.

Clinical outcomes in patients with node-negative breast cancer treated based on the recurrence score results: evidence from a large prospectively designed registry.

Science.gov (United States)

Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky

2017-01-01

The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n  = 304) and 11-25 ( n  = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.

Clinical Significance of Preoperative Albumin and Globulin Ratio in Patients with Gastric Cancer Undergoing Treatment

Directory of Open Access Journals (Sweden)

Min-jie Mao

2017-01-01

Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.

Accounting for measurement error in log regression models with applications to accelerated testing.

Science.gov (United States)

Richardson, Robert; Tolley, H Dennis; Evenson, William E; Lunt, Barry M

2018-01-01

In regression settings, parameter estimates will be biased when the explanatory variables are measured with error. This bias can significantly affect modeling goals. In particular, accelerated lifetime testing involves an extrapolation of the fitted model, and a small amount of bias in parameter estimates may result in a significant increase in the bias of the extrapolated predictions. Additionally, bias may arise when the stochastic component of a log regression model is assumed to be multiplicative when the actual underlying stochastic component is additive. To account for these possible sources of bias, a log regression model with measurement error and additive error is approximated by a weighted regression model which can be estimated using Iteratively Re-weighted Least Squares. Using the reduced Eyring equation in an accelerated testing setting, the model is compared to previously accepted approaches to modeling accelerated testing data with both simulations and real data.

Accounting for measurement error in log regression models with applications to accelerated testing.

Directory of Open Access Journals (Sweden)

Robert Richardson

Full Text Available In regression settings, parameter estimates will be biased when the explanatory variables are measured with error. This bias can significantly affect modeling goals. In particular, accelerated lifetime testing involves an extrapolation of the fitted model, and a small amount of bias in parameter estimates may result in a significant increase in the bias of the extrapolated predictions. Additionally, bias may arise when the stochastic component of a log regression model is assumed to be multiplicative when the actual underlying stochastic component is additive. To account for these possible sources of bias, a log regression model with measurement error and additive error is approximated by a weighted regression model which can be estimated using Iteratively Re-weighted Least Squares. Using the reduced Eyring equation in an accelerated testing setting, the model is compared to previously accepted approaches to modeling accelerated testing data with both simulations and real data.

Rankings of International Achievement Test Performance and Economic Strength: Correlation or Conjecture?

Science.gov (United States)

Tienken, Christopher H.

2008-01-01

Examining a popular political notion, this article presents results from a series of Spearman Rho calculations conducted to investigate relationships between countries' rankings on international tests of mathematics and science and future economic competitiveness as measured by the 2006 World Economic Forum's Growth Competitiveness Index (GCI).…

Targeting cell migration and the endoplasmic reticulum stress response with calmodulin antagonists: a clinically tested small molecule phenocopy of SEC62 gene silencing in human tumor cells

International Nuclear Information System (INIS)

Linxweiler, Maximilian; Greiner, Markus; Schorr, Stefan; Schäuble, Nico; Jung, Martin; Linxweiler, Johannes; Langer, Frank; Schäfers, Hans-Joachim; Cavalié, Adolfo; Zimmermann, Richard

2013-01-01

Tumor cells benefit from their ability to avoid apoptosis and invade other tissues. The endoplasmic reticulum (ER) membrane protein Sec62 is a key player in these processes. Sec62 is essential for cell migration and protects tumor cells against thapsigargin-induced ER stress, which are both linked to cytosolic Ca 2+ . SEC62 silencing leads to elevated cytosolic Ca 2+ and increased ER Ca 2+ leakage after thapsigargin treatment. Sec62 protein levels are significantly increased in different tumors, including prostate, lung and thyroid cancer. In lung cancer, the influence of Sec62 protein levels on patient survival was analyzed using the Kaplan-Meier method and log-rank test. To elucidate the underlying pathophysiological functions of Sec62, Ca 2+ imaging techniques, real-time cell analysis and cell migration assays were performed. The effects of treatment with the calmodulin antagonists, trifluoperazine (TFP) and ophiobolin A, on cellular Ca 2+ homeostasis, cell growth and cell migration were compared with the effects of siRNA-mediated Sec62 depletion or the expression of a mutated SEC62 variant in vitro. Using Biacore analysis we examined the Ca 2+ -sensitive interaction of Sec62 with the Sec61 complex. Sec62 overproduction significantly correlated with reduced patient survival. Therefore, Sec62 is not only a predictive marker for this type of tumor, but also an interesting therapeutic target. The present study suggests a regulatory function for Sec62 in the major Ca 2+ leakage channel in the ER, Sec61, by a direct and Ca 2+ -sensitive interaction. A Ca 2+ -binding motif in Sec62 is essential for its molecular function. Treatment of cells with calmodulin antagonists mimicked Sec62 depletion by inhibiting cell migration and rendering the cells sensitive to thapsigargin treatment. Targeting tumors that overproduce Sec62 with calmodulin antagonists in combination with targeted thapsigargin analogues may offer novel personalized therapeutic options

Geophysical borehole logging test procedure: Final draft

International Nuclear Information System (INIS)

1986-09-01

The purpose of geophysical borehole logging from the At-Depth Facility (ADF) is to provide information which will assist in characterizing the site geologic conditions and in classifying the engineering characteristics of the rock mass in the vicinity of the ADF. The direct goals of borehole logging include identification of lithologic units and their correlation from hole to hole, identification of fractured or otherwise porous or permeable zones, quantitative or semi-quantitative estimation of various formation properties, and evaluation of factors such as the borehole diameter and orientation. 11 figs., 4 tabs

The Prognostic Value of Haplotypes in the Vascular Endothelial Growth Factor

DEFF Research Database (Denmark)

Hansen, Torben Frøstrup; Spindler, Karen-Lise Garm; Andersen, Rikke Fredslund

2010-01-01

Abstract: New prognostic markers in patients with colorectal cancer (CRC) are a prerequisite for individualized treatment. Prognostic importance of single nucleotide polymorphisms (SNPs) in the vascular endothelial growth factor A (VEGF-A) gene has been proposed. The objective of the present study...... using the PHASE program. The prognostic influence was evaluated using Kaplan-Meir plots and log rank tests. Cox regression method was used to analyze the independent prognostic importance of different markers. All three SNPs were significantly related to survival. A haplotype combination, responsible...... findings in a second and independent cohort. Haplotype combinations call for further investigation. Keywords: colorectal neoplasm; single nucleotide polymorphisms; haplotypes; vascular endothelial growth factor A; survival...

HbA1c level cannot predict the treatment outcome of smear-positive non-multi-drug-resistant HIV-negative pulmonary tuberculosis inpatients

Science.gov (United States)

Tashiro, Ken; Horita, Nobuyuki; Nagai, Kenjiro; Ikeda, Misako; Shinkai, Masaharu; Yamamoto, Masaki; Sato, Takashi; Hara, Yu; Nagakura, Hideyuki; Shibata, Yuji; Watanabe, Hiroki; Nakashima, Kentaro; Ushio, Ryota; Nagashima, Akimichi; Narita, Atsuya; Kobayashi, Nobuaki; Kudo, Makoto; Kaneko, Takeshi

2017-01-01

We conducted a single-center retrospective cohort study to evaluate whether the HbA1c level on admission could predict the in-hospital treatment outcome of smear-positive non-multi-drug-resistant HIV-negative culture-proven pulmonary tuberculosis inpatients. Our standard regimens under the direct observation were HRZE or HRE for the first two months followed by combination therapy with isoniazid and rifampicin. Our cohort consisted of consecutive 239 patients consisted of 147 men and 92 women with a median age of 73 years. The HbA1c level of patients whose HbA1c was above 7.0% on admission showed clear declining trends after admission. HbA1c on admission had no Spearman’s rank correlation with time to discharge alive (r = 0.17) and time to becoming non-infective (r = 0.17). By Kaplan-Meier curves and a log-rank trend test, HbA1c quartile subgroups showed no association with times to discharge alive (p = 0.431), becoming non-infective (p = 0.113), and in-hospital death (p = 0.427). Based on multi-variate Cox analysis, HbA1c on admission had no significant impact on time to discharge alive (hazard ratio = 1.03, 95% CI 0.89–1.20, p = 0.659), becoming non-infective (hazard ratio = 0.93, 95% CI 0.80–1.06, p = 0.277), and in-hospital death (hazard ratio = 0.68, 0.43–1.07, p = 0.097). In conclusion, the HbA1c level on admission did not seem to affect in-hospital tuberculosis treatment outcomes in Japanese cohort. PMID:28406247

Clinicopathologic significance of fascin, extracellular matrix metalloproteinase inducer, and ezrin expressions in colorectal adenocarcinoma

Directory of Open Access Journals (Sweden)

Eun-Joo Jung

2011-01-01

Full Text Available Background: The over expression of fascin, extracellular matrix metalloproteinase inducer (EMMPRIN, and ezrin proteins has been associated with poor prognosis in various carcinomas and sarcomas. However, very few studies have reported the relationship between the expression of fascin, EMMPRIN, and ezrin proteins and the clinico-pathologic parameters of colorectal carcinomas. Aims: The aim was to investigate the relationship between fascin, EMMPRIN, and ezrin proteins in colorectal adenocarcinomas and their correlation with clinico-pathologic parameters. Settings and Design: The expression of fascin, EMMPRIN, and ezrin proteins was studied in 210 colorectal adenocarcinoma patients through immunohistochemical staining. Materials and Methods: Immunohistochemical staining by the avidin-biotin peroxidase method was done. The scoring of each protein expression was done and divided into three groups (negative, low-, and high-expression groups. Statistical Analysis: A chi-square test, and Kendall′s tau-b correlation test were used for comparing. Survival analysis was performed using the Kaplan-Meier method with log-rank tests and the Cox proportional hazard model. Results: The percentages of the high-expression group of fascin, EMMPRIN, and ezrin proteins in colorectal adenocarcinomas were 24%, 73%, and 62%, respectively. Weak positive correlations were observed among these protein expressions. An increased expression of the fascin protein was significantly associated with advanced tumor depth and shorter survival times, and a high expression of fascin protein was an independent prognostic factor in univariate and multivariate survival analyses. EMMPRIN and ezrin protein expressions were not associated with the clinico-pathologic parameters. Conclusions: The high expression of fascin protein may be an unfavorable prognostic marker for individual colorectal cancer patients.

Comparative Study of Inguinal Hernia Repair Rates After Radical Prostatectomy or External Beam Radiotherapy

International Nuclear Information System (INIS)

Lughezzani, Giovanni; Sun, Maxine; Perrotte, Paul; Alasker, Ahmed; Jeldres, Claudio; Isbarn, Hendrik; Budaeus, Lars; Lattouf, Jean-Baptiste; Valiquette, Luc; Benard, Francois; Saad, Fred; Graefen, Markus; Montorsi, Francesco; Karakiewicz, Pierre I.

2010-01-01

Purpose: We tested the hypothesis that patients treated for localized prostate cancer with radical prostatectomy (RP) have a higher risk of requiring an inguinal hernia (IH) repair than their counterparts treated with external beam radiotherapy (EBRT). Methods and Materials: Within the Quebec Health Plan database, we identified 6,422 men treated with RP and 4,685 men treated with EBRT for localized prostate cancer between 1990 and 2000, in addition to 6,933 control patients who underwent a prostate biopsy. From among that population, we identified patients who underwent a unilateral or bilateral hernia repair after either RP or EBRT. Kaplan-Meier plots showed IH repair-free survival rates. Univariable and multivariable Cox regression models tested the predictors of IH repair after RP or EBRT. Covariates consisted of age, year of surgery, and Charlson Comorbidity Index. Results: IH repair-free survival rates at 1, 2, 5, and 10 years were 96.8, 94.3, 90.5, and 86.2% vs. 98.9, 98.0, 95.4, and 92.2%, respectively, in RP vs. EBRT patients (log-rank test, p < 0.001). IH repair-free survival rates in the biopsy population were 98.3, 97.1, 94.9, and 90.2% at the same four time points. In multivariable Cox regression models, RP predisposed to a 2.3-fold higher risk of IH repair than EBRT (p < 0.001). Besides therapy type, patient age (p < 0.001) represented the only other independent predictor of IH repair. Conclusions: RP predisposes to a higher rate of IH repair relative to EBRT. This observation should be considered at informed consent.

The overexpression of p16 is not a surrogate marker for high-risk human papilloma virus genotypes and predicts clinical outcomes for vulvar cancer.

Science.gov (United States)

Sznurkowski, Jacek J; Żawrocki, Anton; Biernat, Wojciech

2016-07-13

We aimed to evaluate the correlation between p16(ink4a)-overexpression and high risk (hr)HPV-DNA in vulvar squamous cell carcinoma (vSCC) tumors as well as the impact of both biomarkers on the prognosis of vSCC patients. PCR-detection of (hr)HPV-DNA and immunohistochemical staining for p16(ink4a) were conducted in 85 vSCC tumors. Survival analyses included the Kaplan-Meier method, log-rank test and Cox proportional hazards model. p16(ink4a)-overexpression and (hr)HPV-DNA were detected in 35 and 37 of the 85 tumors, respectively. Among the 35 p16(ink4a)-positive tumors, 10 lacked (hr)HPV-DNA (29 %). Among the 50 p16(ink4a)-negative tumors, (hr)HPV-DNA was detected in 12 cases (24 %). The median follow-up was 89.20 months (range 1.7-189.5 months). P16(ink4a)-overexpression, but not (hr)HPV-DNA positivity of the primary tumor, was correlated with prolonged overall survival (OS) (p = 0.009). P16(ink4a)-overexpression predicted a better response to radiotherapy (p overexpression (p = 0.022), and adjuvant RTX (p overexpression (HR 1-2.11, 95 % CI 1.13-3.95, p = 0.001) are independent prognostic factors. The discovered overlap suggests the use of p16(ink4a) in combination with HPV-DNA detection as an ancillary test for future research and clinical studies in vSCC. The prognostic and predictive value of p16(ink4a)-overexpression should be tested in larger cohort studies.

Population-based outcomes after brain radiotherapy in patients with brain metastases from breast cancer in the Pre-Trastuzumab and Trastuzumab eras

International Nuclear Information System (INIS)

Karam, Irene; Hamilton, Sarah; Nichol, Alan; Woods, Ryan; Speers, Caroline; Kennecke, Hagen; Tyldesley, Scott

2013-01-01

To evaluate the survival of patients with human epidermal growth factor receptor 2 (HER2) positive and negative metastatic breast cancer irradiated for brain metastases before and after the availability of trastuzumab (T). Women diagnosed with brain metastasis from breast cancer in two eras between 2000 and 2007 (T-era, n = 441) and 1986 to 1992 (PreT-era, n = 307), treated with whole brain radiotherapy (RT) were identified. In the T-era, HER2 testing was part of routine clinical practice, and in the preT-era 128/307 (42%) cases had HER2 testing performed retrospectively on tissue microarrays. Overall survival (OS) was estimated using the Kaplan-Meier method and comparisons between eras used log-rank tests. In the preT- and T-era cohorts, the rate of HER2 positivity was 40% (176/441) and 26% (33/128) (p < 0.001). The median time from diagnosis to brain RT was longer in the preT-era (3.3 years versus 2.3 years, p < 0.001). Survival after brain RT was improved in the T-era compared to the preT-era (1-year OS 26% versus 12%, p < 0.001). The 1-year OS rate for HER2 negative patients was 20% in both eras (p = 0.97). Among HER2 positive patients, the 1-year OS in the preT-era was 5% compared to 40% in the T-era (p < 0.001). Distinct from patients with HER2 negative disease in whom no difference in survival after brain RT was observed over time, patients with HER2 positive brain metastases experienced significantly improved survival subsequent to the availability of trastuzumab

Mobile spine chordoma: results of 166 patients from the AOSpine Knowledge Forum Tumor database.

Science.gov (United States)

Gokaslan, Ziya L; Zadnik, Patricia L; Sciubba, Daniel M; Germscheid, Niccole; Goodwin, C Rory; Wolinsky, Jean-Paul; Bettegowda, Chetan; Groves, Mari L; Luzzati, Alessandro; Rhines, Laurence D; Fisher, Charles G; Varga, Peter Pal; Dekutoski, Mark B; Clarke, Michelle J; Fehlings, Michael G; Quraishi, Nasir A; Chou, Dean; Reynolds, Jeremy J; Williams, Richard P; Kawahara, Norio; Boriani, Stefano

2016-04-01

A chordoma is an indolent primary spinal tumor that has devastating effects on the patient's life. These lesions are chemoresistant, resistant to conventional radiotherapy, and moderately sensitive to proton therapy; however, en bloc resection remains the preferred treatment for optimizing patient outcomes. While multiple small and largely retrospective studies have investigated the outcomes following en bloc resection of chordomas in the sacrum, there have been few large-scale studies on patients with chordomas of the mobile spine. The goal of this study was to review the outcomes of surgically treated patients with mobile spine chordomas at multiple international centers with respect to local recurrence and survival. This multiinstitutional retrospective study collected data between 1988 and 2012 about prognosis-predicting factors, including various clinical characteristics and surgical techniques for mobile spine chordoma. Tumors were classified according to the Enneking principles and analyzed in 2 treatment cohorts: Enneking-appropriate (EA) and Enneking-inappropriate (EI) cohorts. Patients were categorized as EA when the final pathological assessment of the margin matched the Enneking recommendation; otherwise, they were categorized as EI. Descriptive statistics were used to summarize the data (Student t-test, chi-square, and Fisher exact tests). Recurrence and survival data were analyzed using Kaplan-Meier survival curves, log-rank tests, and multivariate Cox proportional hazard modeling. A total of 166 patients (55 female and 111 male patients) with mobile spine chordoma were included. The median patient follow-up was 2.6 years (range 1 day to 22.5 years). Fifty-eight (41%) patients were EA and 84 (59%) patients were EI. The type of biopsy (p mobile spine.

How Do Executive Functions Fit with the Cattell-Horn-Carroll Model? Some Evidence from a Joint Factor Analysis of the Delis-Kaplan Executive Function System and the Woodcock-Johnson III Tests of Cognitive Abilities

Science.gov (United States)

Floyd, Randy G.; Bergeron, Renee; Hamilton, Gloria; Parra, Gilbert R.

2010-01-01

This study investigated the relations among executive functions and cognitive abilities through a joint exploratory factor analysis and joint confirmatory factor analysis of 25 test scores from the Delis-Kaplan Executive Function System and the Woodcock-Johnson III Tests of Cognitive Abilities. Participants were 100 children and adolescents…

Prognostic Significance of Interleukin-34 (IL-34) in Patients With Chronic Heart Failure With or Without Renal Insufficiency.

Science.gov (United States)

Tao, Rong; Fan, Qin; Zhang, Hang; Xie, Hongyang; Lu, Lin; Gu, Gang; Wang, Fang; Xi, Rui; Hu, Jian; Chen, Qiujing; Niu, Wenquan; Shen, Weifeng; Zhang, Ruiyan; Yan, Xiaoxiang

2017-04-01

Renal dysfunction, commonly associated with cardiac dysfunction, has predictive value for adverse long-term outcomes in heart failure (HF). We previously identified a novel renal biomarker, interleukin-34 (IL-34), elevated in HF patients and associated with kidney dysfunction and coronary artery disease during HF. However, the prognostic value of IL-34 in HF remains unclear, so that the present study aimed to determine it. This prospective, observational study included 510 consecutive HF patients with their serum IL-34 as well as other variables measured at baseline, and they were followed up for 2 years. The primary end point was a composite of cardiovascular death or a first HF hospitalization, with cardiovascular death, HF hospitalization, and all-cause mortality as secondary outcomes. There was a significant and gradual increase in risk as IL-34 increased, determined by log-rank tests with Kaplan-Meier curves. Serum IL-34 was also a significant prognostic predictor of the primary end point (1.301 [1.115-1.518]; P =0.001), cardiovascular death (1.347 [1.096-1.655]; P =0.005), HF hospitalization (1.234 [1.018-1.494]; P =0.032), and all-cause mortality (1.343 [1.115-1.618]; P =0.002) in HF as per SD increase in the log IL-34 level after adjusting for age, sex, traditional risk factors, and N-terminal pro-brain natriuretic peptide. Especially, IL-34 had a more-significant prognostic value in HF patients with kidney impairment than those without. IL-34 is a significant predictor of cardiovascular death, HF hospitalization, and all-cause mortality in chronic HF, especially when concomitant with renal dysfunction. Serum IL-34 measurement may provide new insights linking kidney impairment to poor HF outcomes beyond other renal markers. © 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

["That flesh, pink and perishable": analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain) in the presence of competing risks].

Science.gov (United States)

Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel

2009-01-01

To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.

Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System

Science.gov (United States)

Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola

2011-01-01

Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…

Optimal FDG PET/CT volumetric parameters for risk stratification in patients with locally advanced non-small cell lung cancer: results from the ACRIN 6668/RTOG 0235 trial

Energy Technology Data Exchange (ETDEWEB)

Salavati, Ali [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); University of Minnesota, Department of Radiology, Minneapolis, MN (United States); Duan, Fenghai [Brown University School of Public Health, Department of Biostatistics and Center for Statistical Sciences, Providence, RI (United States); Snyder, Bradley S. [Brown University School of Public Health, Center for Statistical Sciences, Providence, RI (United States); Wei, Bo [Emory University, Department of Biostatistics, Rollins School of Public Health, Atlanta, GA (United States); Houshmand, Sina; Alavi, Abass [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Khiewvan, Benjapa [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Mahidol University, Division of Nuclear Medicine, Department of Radiology, Faculty of Medicine Siriraj Hospital, Bangkok (Thailand); Opanowski, Adam [ACR Center for Research and Innovation, American College of Radiology, Philadelphia, PA (United States); Simone, Charles B. [University of Maryland Medical Center, Department of Radiation Oncology, Baltimore, MD (United States); Siegel, Barry A. [Washington University School of Medicine, Mallinckrodt Institute of Radiology and the Alvin J. Siteman Cancer Center, St, Louis, MO (United States); Machtay, Mitchell [Case Western Reserve University and University Hospitals Case Medical Center, Department of Radiation Oncology, Cleveland, OH (United States)

2017-11-15

In recent years, multiple studies have demonstrated the value of volumetric FDG-PET/CT parameters as independent prognostic factors in patients with non-small cell lung cancer (NSCLC). We aimed to determine the optimal cut-off points of pretreatment volumetric FDG-PET/CT parameters in predicting overall survival (OS) in patients with locally advanced NSCLC and to recommend imaging biomarkers appropriate for routine clinical applications. Patients with inoperable stage IIB/III NSCLC enrolled in ACRIN 6668/RTOG 0235 were included. Pretreatment FDG-PET scans were quantified using semiautomatic adaptive contrast-oriented thresholding and local-background partial-volume-effect-correction algorithms. For each patient, the following indices were measured: metabolic tumor volume (MTV), total lesion glycolysis (TLG), SUVmax, SUVmean, partial-volume-corrected TLG (pvcTLG), and pvcSUVmean for the whole-body, primary tumor, and regional lymph nodes. The association between each index and patient outcome was assessed using Cox proportional hazards regression. Optimal cut-off points were estimated using recursive binary partitioning in a conditional inference framework and used in Kaplan-Meier curves with log-rank testing. The discriminatory ability of each index was examined using time-dependent receiver operating characteristic (ROC) curves and corresponding area under the curve (AUC(t)). The study included 196 patients. Pretreatment whole-body and primary tumor MTV, TLG, and pvcTLG were independently prognostic of OS. Optimal cut-off points were 175.0, 270.9, and 35.5 cm{sup 3} for whole-body TLG, pvcTLG, and MTV, and were 168.2, 239.8, and 17.4 cm{sup 3} for primary tumor TLG, pvcTLG, and MTV, respectively. In time-dependent ROC analysis, AUC(t) for MTV and TLG were uniformly higher than that of SUV measures over all time points. Primary tumor and whole-body parameters demonstrated similar patterns of separation for those patients above versus below the optimal cut

Results of radiotherapy for meningeomas with high risk for local recurrence. A retrospective analysis; Ergebnisse der Strahlentherapie bei Meningeomen mit hohem Rezidivrisiko. Eine retrospektive Analyse

Energy Technology Data Exchange (ETDEWEB)

Winkler, C.; Dornfeld, S.; Friedrich, S.; Baumann, M. [Technische Univ. Dresden (Germany). Klinik und Poliklinik fuerStrahlentherapie und Radioonkologie; Schwarz, R. [Universitaetskrankenhaus Hamburg-Eppendorf (Germany). Abt. fuer Strahlentherapie

1998-12-01

Aim: Retrospective assessment of the efficacy of radiatiotherapy for meningeomas with high risk for local recurrence. Patients and methods: Records of 67 patients with meningeomas treated from 1974 to 1995 at 2 centres were analyzed. Follow-up time ranged from 0.8 to 213 months (median: 61 months). Radiation therapy was given either after local failure or after biopsy or subtotal resection. The ratio between malignant (n=20) and benign (n=47) meningenoma was 1:2.4. Median age of the patients was 55 years (7 to 77 years). Radiation treatment was given at 1.5 to 2 Gy per fraction to 36 to 79.5 Gy. Survival rates were calculated by the Kaplan-Meier method. Statistical comparisons were performed with the log-rank test and the Cox proportional hazards model. The Bonferroni method was used to correct for multiple comparisons. Results: Five- and 10-year disease-free survival rates were 82%{+-}5% (standard error) and 70%{+-}9%. Local control rates at 5 and 10 years were 78%{+-}5% and 68%{+-}9%. In uni- and multivariate analysis histology, sex, total dose and center showed no significant influence on the results. Patients age was significant for local control (univariate p=0.02; multivariate p=0.03) and disease-free survival (univariate/multivariate p=0.04). The postoperative tumor burden had a significant influence of disease-free survival (multivariate P=0.04). After Bonferroni correction no significant influenc e was observed. We did not observe late side effects, especially brain necrosis. Conclusions: Despite of the negative selection of our patients we observed high survival- and local control rates after radiation therapy. This underscores the role of radiation therapy in the treatment of meningeomas with high risk of local failure. (orig.) [Deutsch] Hintergrund: Retrospektive Auswertung der Behandlungsergebnisse der Bestrahlung von Meningeomen mit hohem Rezidivrisiko. Patienten und Methode: Im Zeitraum zwischen 1974 und 1995 wurden an zwei Zentren insgesamt 67

Multi-objective shape optimization of runner blade for Kaplan turbine

International Nuclear Information System (INIS)

Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V

2014-01-01

Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads

Multi-objective shape optimization of runner blade for Kaplan turbine

Science.gov (United States)

Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.

2014-03-01

Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.

Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

International Nuclear Information System (INIS)

Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H

2012-01-01

The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

Science.gov (United States)

Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.

2012-11-01

The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

Grid-based lattice summation of electrostatic potentials by assembled rank-structured tensor approximation

Science.gov (United States)

Khoromskaia, Venera; Khoromskij, Boris N.

2014-12-01

Our recent method for low-rank tensor representation of sums of the arbitrarily positioned electrostatic potentials discretized on a 3D Cartesian grid reduces the 3D tensor summation to operations involving only 1D vectors however retaining the linear complexity scaling in the number of potentials. Here, we introduce and study a novel tensor approach for fast and accurate assembled summation of a large number of lattice-allocated potentials represented on 3D N × N × N grid with the computational requirements only weakly dependent on the number of summed potentials. It is based on the assembled low-rank canonical tensor representations of the collected potentials using pointwise sums of shifted canonical vectors representing the single generating function, say the Newton kernel. For a sum of electrostatic potentials over L × L × L lattice embedded in a box the required storage scales linearly in the 1D grid-size, O(N) , while the numerical cost is estimated by O(NL) . For periodic boundary conditions, the storage demand remains proportional to the 1D grid-size of a unit cell, n = N / L, while the numerical cost reduces to O(N) , that outperforms the FFT-based Ewald-type summation algorithms of complexity O(N3 log N) . The complexity in the grid parameter N can be reduced even to the logarithmic scale O(log N) by using data-sparse representation of canonical N-vectors via the quantics tensor approximation. For justification, we prove an upper bound on the quantics ranks for the canonical vectors in the overall lattice sum. The presented approach is beneficial in applications which require further functional calculus with the lattice potential, say, scalar product with a function, integration or differentiation, which can be performed easily in tensor arithmetics on large 3D grids with 1D cost. Numerical tests illustrate the performance of the tensor summation method and confirm the estimated bounds on the tensor ranks.

Mortality of first world war military personnel: comparison of two military cohorts.

Science.gov (United States)

Wilson, Nick; Clement, Christine; Summers, Jennifer A; Bannister, John; Harper, Glyn

2014-12-16

To identify the impact of the first world war on the lifespan of participating military personnel (including in veterans who survived the war). Comparison of two cohorts of military personnel, followed to death. Military personnel leaving New Zealand to participate in the first world war. From a dataset of the New Zealand Expeditionary Forces, we randomly selected participants who embarked on troopships in 1914 and a comparison non-combat cohort who departed on troopships in late 1918 (350 in each group). Lifespan based on dates of birth and death from a range of sources (such as individual military files and an official database of birth and death records). A quarter of the 1914 cohort died during the war, with deaths from injury predominating (94%) over deaths from disease (6%). This cohort had a significantly shorter lifespan than the late 1918 "non-combat" cohort, with median ages of death being 65.9 versus 74.2, respectively (a difference of 8.3 years shown also in Kaplan-Meier survival curves, log rank Pworld war in 1914 from New Zealand lost around eight years of life (relative to a comparable military cohort). In the postwar period they continued to have an increased risk of premature death. © Wilson et al 2014.

The prognostic value of right ventricular long axis strain in non-ischaemic dilated cardiomyopathies using standard cardiac magnetic resonance imaging

Energy Technology Data Exchange (ETDEWEB)

Arenja, Nisha [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); Kantonsspital Olten, Department of Cardiology, Solothurner Spitaeler AG, Olten (Switzerland); Riffel, Johannes H.; Halder, Manuel; Djiokou, Charly N.; Fritz, Thomas; Andre, Florian; Siepen, Fabian aus dem; Zelniker, Thomas; Meder, Benjamin; Kayvanpour, Elham; Korosoglou, Grigorios [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); Katus, Hugo A. [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); DZHK (German Centre for Cardiovascular Research), partner site Heidelberg, Heidelberg (Germany); Buss, Sebastian J. [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); Das Radiologische Zentrum - Radiology Center, Sinsheim-Eberbach-Erbach-Walldorf-Heidelberg (Germany)

2017-09-15

To investigate the association of right ventricular long axis strain (RV-LAS), a parameter of longitudinal function, with outcome in patients with non-ischaemic dilated cardiomyopathy (NIDCM). In 441 patients with NIDCM, RV-LAS was analysed retrospectively by measuring the length between the epicardial border of the left ventricular apex and the middle of a line connecting the origins of the tricuspidal valve leaflets in end-diastole and end-systole on non-contrast standard cine sequences. The primary endpoint (cardiac death or heart transplantation) occurred in 41 patients, whereas 95 reached the combined endpoint (including cardiac decompensation and sustained ventricular arrhythmias) during a median follow-up of 4.2 years. Kaplan-Meier survival curves showed a poor outcome in patients with RV-LAS values below -10% (log-rank, p < 0.0001). In a risk stratification model RV-LAS improved prediction of outcome in addition to RV ejection fraction (RVEF) and presence of late gadolinium enhancement. Assessment of RV-LAS offered incremental information compared to clinical symptoms, biomarkers and RVEF. Even in the subgroup with normal RVEF (>45%, n = 213) reduced RV-LAS was still associated with poor outcome. Assessment of RV-LAS is an independent indicator of outcome in patients with NIDCM and offers incremental information beyond clinical and cardiac MR parameters. (orig.)

Leiomyosarcoma: One disease or distinct biologic entities based on site of origin?

Science.gov (United States)

Worhunsky, David J; Gupta, Mihir; Gholami, Sepideh; Tran, Thuy B; Ganjoo, Kristen N; van de Rijn, Matt; Visser, Brendan C; Norton, Jeffrey A; Poultsides, George A

2015-06-01

Leiomyosarcoma (LMS) can originate from the retroperitoneum, uterus, extremity, and trunk. It is unclear whether tumors of different origin represent discrete entities. We compared clinicopathologic features and outcomes following surgical resection of LMS stratified by site of origin. Patients with LMS undergoing resection at a single institution were retrospectively reviewed. Clinicopathologic variables were compared across sites. Survival was calculated using the Kaplan-Meier method and compared using log-rank and Cox regression analyses. From 1983 to 2011, 138 patients underwent surgical resection for LMS. Retroperitoneal and uterine LMS were larger, higher grade, and more commonly associated with synchronous metastases. However, disease-specific survival, recurrence-free survival, and recurrence patterns were not significantly different across the four sites. Synchronous metastases (HR 3.20, P < 0.001), but not site of origin, size, grade, or margin status, were independently associated with worse DSS. A significant number of recurrences and disease-related deaths were noted beyond 5 years. Although larger and higher grade, retroperitoneal and uterine LMS share similar survival and recurrence patterns with their trunk and extremity counterparts. LMS of various anatomic sites may not represent distinct disease processes based on clinical outcomes. The presence of metastatic disease remains the most important prognostic factor for LMS. © 2015 Wiley Periodicals, Inc.

Elevated levels of serum nidogen-2 in esophageal squamous cell carcinoma.

Science.gov (United States)

Chai, Annie Wai Yeeng; Cheung, Arthur Kwok Leung; Dai, Wei; Ko, Josephine Mun Yee; Lee, Nikki Pui Yue; Chan, Kin Tak; Law, Simon Ying-Kit; Lung, Maria Li

2018-02-14

Nidogen-2 (NID2), a secretory basement membrane protein, has been implicated as a potential biomarker in ovarian cancer and hepatocellular carcinoma. In this study, we aimed to investigate the utility of detecting serum NID2 levels for identification of esophageal squamous cell carcinoma (ESCC) patients and prediction of poor survival outcome. Using an in-house NID2 enzyme-linked immunosorbent assay (ELISA), serum samples from 101 ESCC patients and 50 healthy controls were screened for their NID2 levels. The serum NID2 levels in ESCC patients (median 24.4 μg/L) are significantly higher (p= 4.3e-09) than that of the healthy controls (median 15.85 μg/L). The receiver operating characteristic (ROC) curve demonstrated an area under the curve of 0.756. At the threshold of 17.95 μg/L, the sensitivity and specificity achieved are 0.76 and 0.63, respectively. Kaplan-Meier survival analysis revealed that patients with high serum NID2 levels (⩾ 32.6 μg/L) have significantly higher risk of death (HR = 1.984, 95% CI: 1.175-3.349; log-rank p-value = 0.012) compared to those with low serum NID2 levels (levels has potential diagnostic and prognostic value for ESCC patients.

Impact of radiotherapy for pediatric CNS atypical teratoid/rhabdoid tumor (single institute experience)

International Nuclear Information System (INIS)

Chen, Y.-W.; Wong, T.-T.; Ho, Donald Ming-Tak; Huang, P.-I.; Chang, K.-P.; Shiau, C.-Y.; Yen, S.-H.

2006-01-01

Purpose: To assess outcomes and prognostic factors in radiotherapy of pediatric central nervous system atypical teratoid/rhabdoid tumor (AT/RT). Methods and Materials: Seventeen patients with central nervous system AT/RT were retrospectively reviewed after curative radiotherapy as primary or adjuvant therapy between January 1990 and December 2003. Overall and failure-free survival rates were calculated using the Kaplan-Meier method. The log-rank method was used to compare the effects of dosage (>50 Gy or ≤50 Gy) and treatment duration (>45 days or ≤45 days). Multivariate analysis was performed for prognostic factors. Results: Median overall survival and failure-free survival were 17 and 11 months, respectively. The 3 longest-surviving patients were older, underwent gross tumor removal, and completed both craniospinal and focal boost irradiation. Multivariate analysis revealed a significant relationship between the following: overall survival and performance status (p = 0.019), failure-free survival and total irradiation dose (p = 0.037), time interval between surgery and radiotherapy initiation (p = 0.031), and time interval between surgery and radiotherapy end point (p = 0.047). Conclusion: Radiotherapy is crucial in the treatment of AT/RT. We recommend initiating radiotherapy immediately postoperatively and before systemic chemotherapy in pediatric patients ≥3 years of age

[Comparison of four MICS intraocular lenses regarding their rates of neodymium:YAG laser capsulotomy].

Science.gov (United States)

Spyridaki, M; Höh, H

2010-03-01

The aim of this study was to evaluate the incidence of posterior capsule opacification up to 50 months following 1.7-mm bimanual MICS-cataract surgery. Bimanual MICS cataract surgery was performed in 197 eyes (135 patients) via two 1.7-mm corneal incisions. Four MICS acrylic foldable IOLs were implanted: AcriSmart 48S-5, n = 54 (Acritec GmbH, Hennigsdorf, now AT.Smart 48S Carl-Zeiss-Meditec, AG, Jena, Germany), ThinLens UltraChoice 1.0, n = 53 (Technomed GmbH, Baesweiler, Germany), AcriFlex 46, n = 41 und AcriFlex 48 CSE, n = 7 (Acrimed GmbH, Berlin, now: Lentis L-303, Oculentis GmbH, Berlin, Germany) and CareFlex, n = 43 (w2o Medizintechnik AG, Bruchsal, Germany). Statistical analysis was performed using the Kaplan-Meier technique. High levels of completeness of follow-up rates were: ThinLens 96%, CareFlex 100%, AcriSmart 93%, AcriFlex 92%. The capsulotomy rate was 43.13% for ThinLens within a mean/max. follow-up period of 801/1131 days, 34.88% for CareFlex (565/872 days), 40% for AcriSmart (988/1506 days) and 15.91% for AcriFlex (728/975 days). By limiting the follow-up period to a comparable maximum of 850 days for all four IOLs, our capsulotomy rates were as follows: ThinLens 33.33%, CareFlex 32.56 %, AcriSmart 20.0% and AcriFlex 11.36%. MICS IOLs have higher capsulotomy rates than hydrophobic acrylic lenses and sharp-edged silicone lenses. In literature comparisons MICS-IOLs do not exceed the variance levels of capsulotomy rates of PMMA, hydrophilic acrylic and silicone lenses without sharp edges. Cases of decentration or luxation of MICS-IOLs following Neodym:YAG laser capsulotomy were not detected. Capsulotomy frequency with the CareFlex was statistically significantly higher in comparison to the AcriSmart (Log Rank Mantel Cox Test, p = 0.007) and AcriFlex (log rank Mantel Cox test, p = 0.002). Capsulotomy rates observed varied for the four MICS-IOL-types tested. The posterior capsule opacification frequency of the two best MICS-IOLs (AcriFlex, Acri

Estimation of the non records logs from existing logs using artificial neural networks

Directory of Open Access Journals (Sweden)

Mehdi Mohammad Salehi

2017-12-01

Full Text Available Finding the information of the hydrocarbon reservoirs from well logs is one of the main objectives of the engineers. But, missing the log records (due to many reasons such as broken instruments, unsuitable borehole and etc. is a major challenge to achieve it. Prediction of the density and resistivity logs (Rt, DT and LLS from the conventional wire-line logs in one of the Iranian southwest oil fields is the main purpose of this study. Multilayer neural network was applied to develop an intelligent predictive model for prediction of the logs. A total of 3000 data sets from 3 wells (A, B and C of the studied field were used. Among them, the data of A, B and C wells were used to constructing and testing the model, respectively. To evaluate the performance of the model, the mean square error (MSE and correlation coefficient (R2 in the test data were calculated. A comparison between the MSE of the proposed model and recently intelligent models shows that the proposed model is more accurate than others. Acceptable accuracy and using conventional well logging data are the highlight advantages of the proposed intelligent model.

Meier-Gorlin syndrome.

Science.gov (United States)

de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

2015-09-17

Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.

Sign rank versus Vapnik-Chervonenkis dimension

Science.gov (United States)

Alon, N.; Moran, Sh; Yehudayoff, A.

2017-12-01

This work studies the maximum possible sign rank of sign (N × N)-matrices with a given Vapnik-Chervonenkis dimension d. For d=1, this maximum is three. For d=2, this maximum is \\widetilde{\\Theta}(N1/2). For d >2, similar but slightly less accurate statements hold. The lower bounds improve on previous ones by Ben-David et al., and the upper bounds are novel. The lower bounds are obtained by probabilistic constructions, using a theorem of Warren in real algebraic topology. The upper bounds are obtained using a result of Welzl about spanning trees with low stabbing number, and using the moment curve. The upper bound technique is also used to: (i) provide estimates on the number of classes of a given Vapnik-Chervonenkis dimension, and the number of maximum classes of a given Vapnik-Chervonenkis dimension--answering a question of Frankl from 1989, and (ii) design an efficient algorithm that provides an O(N/log(N)) multiplicative approximation for the sign rank. We also observe a general connection between sign rank and spectral gaps which is based on Forster's argument. Consider the adjacency (N × N)-matrix of a Δ-regular graph with a second eigenvalue of absolute value λ and Δ ≤ N/2. We show that the sign rank of the signed version of this matrix is at least Δ/λ. We use this connection to prove the existence of a maximum class C\\subseteq\\{+/- 1\\}^N with Vapnik-Chervonenkis dimension 2 and sign rank \\widetilde{\\Theta}(N1/2). This answers a question of Ben-David et al. regarding the sign rank of large Vapnik-Chervonenkis classes. We also describe limitations of this approach, in the spirit of the Alon-Boppana theorem. We further describe connections to communication complexity, geometry, learning theory, and combinatorics. Bibliography: 69 titles.

Changes in white matter as determinant of global functional decline in older independent outpatients: three year follow-up of LADIS (leukoaraiosis and disability) study cohort

DEFF Research Database (Denmark)

Inzitari, Domenico; Pracucci, Giovanni; Poggesi, Anna

2009-01-01

cerebral infarcts and atrophy. MAIN OUTCOME MEASURE: Transition from no disability (defined as a score of 0 or 1 on the instrumental activities of daily living scale) to disability (score >/=2) or death over three year follow-up. Secondary outcomes were incident dementia and stroke. RESULTS: Over a mean...... follow-up period of 2.42 years (SD 0.97, median 2.94 years), information on the main outcome was available for 633 patients. The annual rate of transition or death was 10.5%, 15.1%, and 29.5%, respectively, for patients with mild, moderate, or severe age related changes in white matter (Kaplan-Meier log...

Effects of radiation therapy on tissue and serum concentrations of tumour associated trypsin inhibitor and their prognostic significance in rectal cancer patients

Directory of Open Access Journals (Sweden)

Stenman Ulf-Håkan

2011-08-01

Full Text Available Abstract Background We have previously demonstrated that elevated concentrations of tumour-associated trypsin inhibitor (TATI in both tumour tissue (t-TATI and in serum (s-TATI are associated with a poor prognosis in colorectal cancer patients. It was also found that s-TATI concentrations were lower in patients with rectal cancer compared to patients with colon cancer. In this study, we investigated the effects of neoadjuvant radiotherapy (RT on concentrations of t-TATI and s-TATI in patients with rectal cancer. Methods TATI was analysed in serum, normal mucosa and tumour tissue collected at various time points in 53 rectal cancer patients enrolled in a case-control study where 12 patients received surgery alone, 20 patients 5 × 5 Gy (short-term preoperative RT and 21 patients 25 × 2 Gy (long-term preoperative RT. T-TATI was analysed by immunohistochemistry and s-TATI was determined by an immunofluorometric assay. Mann-Whitney U test and Wilcoxon Z (Z test were used to assess t-TATI and s-TATI concentrations in relation to RT. Spearman's correlation (R test was used to explore the associations between t-TATI, s-TATI and clinicopathological parameters. Overall survival (OS according to high and low t-TATI and s-TATI concentrations was estimated by classification and regression tree analysis, Kaplan-Meier analysis and the log rank test. Results RT did not affect concentrations of t-TATI or s-TATI. In patients receiving short-term but not long-term RT, s-TATI concentrations were significantly higher 4 weeks post surgery than in serum drawn prior to surgery (Z = -3.366, P Conclusions The results presented here further validate the utility of t-TATI and s-TATI as prognostic biomarkers in patients with rectal cancer, independent of neoadjuvant RT.

High ASMA+ Fibroblasts and Low Cytoplasmic HMGB1+ Breast Cancer Cells Predict Poor Prognosis.

Science.gov (United States)

Amornsupak, Kamolporn; Jamjuntra, Pranisa; Warnnissorn, Malee; O-Charoenrat, Pornchai; Sa-Nguanraksa, Doonyapat; Thuwajit, Peti; Eccles, Suzanne A; Thuwajit, Chanitra

2017-10-01

The influence of cancer-associated fibroblasts (CAFs) and high mobility group box 1 (HMGB1) has been recognized in several cancers, although their roles in breast cancer are unclear. The present study aimed to determine the levels and prognostic significance of α-smooth muscle actin-positive (ASMA + ) CAFs, plus HMGB1 and receptor for advanced glycation end products (RAGE) in cancer cells. A total of 127 breast samples, including 96 malignant and 31 benign, were examined for ASMA, HMGB1, and RAGE by immunohistochemistry. The χ 2 test and Fisher's exact test were used to test the association of each protein with clinicopathologic parameters. The Kaplan-Meier method or log-rank test and Cox regression were used for survival analysis. ASMA + fibroblast infiltration was significantly increased in the tumor stroma compared with that in benign breast tissue. The levels of cytoplasmic HMGB1 and RAGE were significantly greater in the breast cancer tissue than in the benign breast tissues. High ASMA expression correlated significantly with large tumor size, clinical stage III-IV, and angiolymphatic and perinodal invasion. In contrast, increased cytoplasmic HMGB1 correlated significantly with small tumor size, pT stage, early clinical stage, luminal subtype (but not triple-negative subtype), and estrogen receptor and progesterone receptor expression. The levels of ASMA (hazard ratio, 14.162; P = .010) and tumor cytoplasmic HMGB1 (hazard ratio, 0.221; P = .005) could serve as independent prognostic markers for metastatic relapse in breast cancer patients. The ASMA-high/HMGB1-low profile provided the most reliable prediction of metastatic relapse. We present for the first time, to the best of our knowledge, the potential clinical implications of the combined assessment of ASMA + fibroblasts and cytoplasmic HMGB1 in breast cancer. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Hepatitis C virus recurrence after liver transplantation: a 10-year evaluation.

Science.gov (United States)

Gitto, Stefano; Belli, Luca Saverio; Vukotic, Ranka; Lorenzini, Stefania; Airoldi, Aldo; Cicero, Arrigo Francesco Giuseppe; Vangeli, Marcello; Brodosi, Lucia; Panno, Arianna Martello; Di Donato, Roberto; Cescon, Matteo; Grazi, Gian Luca; De Carlis, Luciano; Pinna, Antonio Daniele; Bernardi, Mauro; Andreone, Pietro

2015-04-07

To evaluate the predictors of 10-year survival of patients with hepatitis C recurrence. Data from 358 patients transplanted between 1989 and 2010 in two Italian transplant centers and with evidence of hepatitis C recurrence were analyzed. A χ(2), Fisher's exact test and Kruskal Wallis' test were used for categorical and continuous variables, respectively. Survival analysis was performed at 10 years after transplant using the Kaplan-Meier method, and a log-rank test was used to compare groups. A P level less than 0.05 was considered significant for all tests. Multivariate analysis of the predictive role of different variables on 10-year survival was performed by a stepwise Cox logistic regression. The ten-year survival of the entire population was 61.2%. Five groups of patients were identified according to the virological response or lack of a response to antiviral treatment and, among those who were not treated, according to the clinical status (mild hepatitis C recurrence, "too sick to be treated" and patients with comorbidities contraindicating the treatment). While the 10-year survival of treated and untreated patients was not different (59.1% vs 64.7%, P = 0.192), patients with a sustained virological response had a higher 10-year survival rate than both the "non-responders" (84.7% vs 39.8%, P < 0.0001) and too sick to be treated (84.7% vs 0%, P < 0.0001). Sustained virological responders had a survival rate comparable to patients untreated with mild recurrence (84.7% vs 89.3%). A sustained virological response and young donor age were independent predictors of 10-year survival. Sustained virological response significantly increased long-term survival. Awaiting the interferon-free regimen global availability, antiviral treatment might be questionable in selected subjects with mild hepatitis C recurrence.

NM23 protein expression in colorectal carcinoma using TMA (tissue microarray: association with metastases and survival

Directory of Open Access Journals (Sweden)

Levindo Alves de Oliveira

2010-12-01

Full Text Available CONTEXT: NM23, a metastasis suppressor gene, may be associated with prognosis in patients with colorectal carcinoma. OBJECTIVE: To analyze NM23 expression and its association with the presence of lymph node and liver metastases and survival in patients operated on for colorectal carcinoma. METHODS: One hundred thirty patients operated on for colorectal carcinoma were investigated. Tissue microarray blocks containing neoplastic tissue and tumor-adjacent non-neoplastic mucosa were obtained and analyzed by immunohistochemical staining using a monoclonal anti-NM23 antibody. Immunohistochemical expression was assessed using a semiquantitative scoring method, counting the percentage of stained cells. The results were compared regarding morphological and histological characteristics of the colorectal carcinoma, presence of lymph node and liver metastases, tumor staging, and patient survival. Statistical analysis was performed using the Mann-Whitney test, the Kruskal-Wallis test and Fisher's exact test. Survival analysis was performed using the Kaplan-Meier method and the log-rank test. RESULTS: NM23 expression was higher in colorectal carcinoma tissue than in adjacent non-neoplastic mucosa (P<0.0001. NM23 protein expression did not correlate with degree of cell differentiation (P = 0.57, vascular invasion (P = 0.85, lymphatic invasion (P = 0.41, perineural infiltration (P = 0.46, staging (P = 0.19, lymph node metastases (P = 0.08, or liver metastases (P = 0.59. Disease-free survival showed significant association (P = 0.01 with the intensity of NM23 protein immunohistochemical expression in colorectal carcinoma tissue, whereas overall survival showed no association with NM23 protein expression (P = 0.13. CONCLUSIONS: NM23 protein expression was higher in neoplastic colorectal carcinoma tissue than in adjacent non-neoplastic mucosa, showing no correlation with morphological aspects, presence of lymph node or liver metastases, colorectal carcinoma

ASURV: Astronomical SURVival Statistics

Science.gov (United States)

Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.

2014-06-01

ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.

VaRank: a simple and powerful tool for ranking genetic variants

Directory of Open Access Journals (Sweden)

Véronique Geoffroy

2015-03-01

Full Text Available Background. Most genetic disorders are caused by single nucleotide variations (SNVs or small insertion/deletions (indels. High throughput sequencing has broadened the catalogue of human variation, including common polymorphisms, rare variations or disease causing mutations. However, identifying one variation among hundreds or thousands of others is still a complex task for biologists, geneticists and clinicians.Results. We have developed VaRank, a command-line tool for the ranking of genetic variants detected by high-throughput sequencing. VaRank scores and prioritizes variants annotated either by Alamut Batch or SnpEff. A barcode allows users to quickly view the presence/absence of variants (with homozygote/heterozygote status in analyzed samples. VaRank supports the commonly used VCF input format for variants analysis thus allowing it to be easily integrated into NGS bioinformatics analysis pipelines. VaRank has been successfully applied to disease-gene identification as well as to molecular diagnostics setup for several hundred patients.Conclusions. VaRank is implemented in Tcl/Tk, a scripting language which is platform-independent but has been tested only on Unix environment. The source code is available under the GNU GPL, and together with sample data and detailed documentation can be downloaded from http://www.lbgi.fr/VaRank/.