WorldWideScience

Sample records for kaplan-meier log-rank test

  1. Biostatistics with emphasis on life table survival rate calculations (including Kaplan Meier) and the logrank test

    International Nuclear Information System (INIS)

    Mould, Richard F.

    1995-01-01

    Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method

  2. Biostatistics with emphasis on life table survival rate calculations (including Kaplan Meier) and the logrank test

    Energy Technology Data Exchange (ETDEWEB)

    Mould, Richard F

    1995-07-01

    Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.

  3. A versatile test for equality of two survival functions based on weighted differences of Kaplan-Meier curves.

    Science.gov (United States)

    Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J

    2015-12-10

    With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.

  4. The Kaplan-Meier Theatre

    Science.gov (United States)

    Gerds, Thomas A.

    2016-01-01

    Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.

  5. Understanding survival analysis: Kaplan-Meier estimate.

    Science.gov (United States)

    Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal

    2010-10-01

    Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.

  6. Modified Weighted Kaplan-Meier Estimator

    Directory of Open Access Journals (Sweden)

    Mohammad Shafiq

    2007-01-01

    Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.

  7. About an adaptively weighted Kaplan-Meier estimate.

    Science.gov (United States)

    Plante, Jean-François

    2009-09-01

    The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.

  8. Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

    International Nuclear Information System (INIS)

    Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.

    1996-01-01

    It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs

  9. Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

    Energy Technology Data Exchange (ETDEWEB)

    Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)

    1996-12-01

    It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.

  10. The Kaplan-Meier Integral in the Presence of Covariates

    DEFF Research Database (Denmark)

    Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis

    2017-01-01

    In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...

  11. Adaptive designs for the one-sample log-rank test.

    Science.gov (United States)

    Schmidt, Rene; Faldum, Andreas; Kwiecien, Robert

    2017-09-22

    Traditional designs in phase IIa cancer trials are single-arm designs with a binary outcome, for example, tumor response. In some settings, however, a time-to-event endpoint might appear more appropriate, particularly in the presence of loss to follow-up. Then the one-sample log-rank test might be the method of choice. It allows to compare the survival curve of the patients under treatment to a prespecified reference survival curve. The reference curve usually represents the expected survival under standard of the care. In this work, convergence of the one-sample log-rank statistic to Brownian motion is proven using Rebolledo's martingale central limit theorem while accounting for staggered entry times of the patients. On this basis, a confirmatory adaptive one-sample log-rank test is proposed where provision is made for data dependent sample size reassessment. The focus is to apply the inverse normal method. This is done in two different directions. The first strategy exploits the independent increments property of the one-sample log-rank statistic. The second strategy is based on the patient-wise separation principle. It is shown by simulation that the proposed adaptive test might help to rescue an underpowered trial and at the same time lowers the average sample number (ASN) under the null hypothesis as compared to a single-stage fixed sample design. © 2017, The International Biometric Society.

  12. Application of Kaplan-Meier analysis in reliability evaluation of products cast from aluminium alloys

    OpenAIRE

    J. Szymszal; A. Gierek; J. Kliś

    2010-01-01

    The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...

  13. Competing risk bias was common in Kaplan-Meier risk estimates published in prominent medical journals.

    Science.gov (United States)

    van Walraven, Carl; McAlister, Finlay A

    2016-01-01

    Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.

    Science.gov (United States)

    Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A

    2015-11-01

    Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and

  15. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves

    Directory of Open Access Journals (Sweden)

    Guyot Patricia

    2012-02-01

    Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  16. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves.

    Science.gov (United States)

    Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J

    2012-02-01

    The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  17. The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method

    NARCIS (Netherlands)

    Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia

    2011-01-01

    Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the

  18. KMWin--a convenient tool for graphical presentation of results from Kaplan-Meier survival time analysis.

    Science.gov (United States)

    Gross, Arnd; Ziepert, Marita; Scholz, Markus

    2012-01-01

    Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.

  19. KMWin – A Convenient Tool for Graphical Presentation of Results from Kaplan-Meier Survival Time Analysis

    Science.gov (United States)

    Gross, Arnd; Ziepert, Marita; Scholz, Markus

    2012-01-01

    Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912

  20. KMWin--a convenient tool for graphical presentation of results from Kaplan-Meier survival time analysis.

    Directory of Open Access Journals (Sweden)

    Arnd Gross

    Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.

  1. Kaplan-Meier survival analysis overestimates cumulative incidence of health-related events in competing risk settings: a meta-analysis.

    Science.gov (United States)

    Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A

    2018-01-01

    Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. The Kaplan-Meier theatre

    DEFF Research Database (Denmark)

    Gerds, Thomas Alexander

    2016-01-01

    Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...

  3. Permutational distribution of the log-rank statistic under random censorship with applications to carcinogenicity assays.

    Science.gov (United States)

    Heimann, G; Neuhaus, G

    1998-03-01

    In the random censorship model, the log-rank test is often used for comparing a control group with different dose groups. If the number of tumors is small, so-called exact methods are often applied for computing critical values from a permutational distribution. Two of these exact methods are discussed and shown to be incorrect. The correct permutational distribution is derived and studied with respect to its behavior under unequal censoring in the light of recent results proving that the permutational version and the unconditional version of the log-rank test are asymptotically equivalent even under unequal censoring. The log-rank test is studied by simulations of a realistic scenario from a bioassay with small numbers of tumors.

  4. Exercise Capacity and the Obesity Paradox in Heart Failure: The FIT (Henry Ford Exercise Testing) Project.

    Science.gov (United States)

    McAuley, Paul A; Keteyian, Steven J; Brawner, Clinton A; Dardari, Zeina A; Al Rifai, Mahmoud; Ehrman, Jonathan K; Al-Mallah, Mouaz H; Whelton, Seamus P; Blaha, Michael J

    2018-05-03

    To assess the influence of exercise capacity and body mass index (BMI) on 10-year mortality in patients with heart failure (HF) and to synthesize these results with those of previous studies. This large biracial sample included 774 men and women (mean age, 60±13 years; 372 [48%] black) with a baseline diagnosis of HF from the Henry Ford Exercise Testing (FIT) Project. All patients completed a symptom-limited maximal treadmill stress test from January 1, 1991, through May 31, 2009. Patients were grouped by World Health Organization BMI categories for Kaplan-Meier survival analyses and stratified by exercise capacity (<4 and ≥4 metabolic equivalents [METs] of task). Associations of BMI and exercise capacity with all-cause mortality were assessed using multivariable-adjusted Cox proportional hazards models. During a mean follow-up of 10.1±4.6 years, 380 patients (49%) died. Kaplan-Meier survival plots revealed a significant positive association between BMI category and survival for exercise capacity less than 4 METs (log-rank, P=.05), but not greater than or equal to 4 METs (P=.76). In the multivariable-adjusted models, exercise capacity (per 1 MET) was inversely associated, but BMI was not associated, with all-cause mortality (hazard ratio, 0.89; 95% CI, 0.85-0.94; P<.001 and hazard ratio, 0.99; 95% CI, 0.97-1.01; P=.16, respectively). Maximal exercise capacity modified the relationship between BMI and long-term survival in patients with HF, upholding the presence of an exercise capacity-obesity paradox dichotomy as observed over the short-term in previous studies. Copyright © 2018 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  5. Applying Kaplan-Meier to Item Response Data

    Science.gov (United States)

    McNeish, Daniel

    2018-01-01

    Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…

  6. Carbonic anhydrase IX and response to postmastectomy radiotherapy in high-risk breast cancer: a subgroup analysis of the DBCG82 b and c trials

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...

  7. MNS16A minisatellite genotypes in relation to risk of glioma and meningioma and to glioblastoma outcome

    DEFF Research Database (Denmark)

    Andersson, U.; Osterman, P.; Sjostrom, S.

    2009-01-01

    was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...

  8. Permanent pacemaker implantation in octogenarians with unexplained syncope and positive electrophysiologic testing.

    Science.gov (United States)

    Giannopoulos, Georgios; Kossyvakis, Charalampos; Panagopoulou, Vasiliki; Tsiachris, Dimitrios; Doudoumis, Konstantinos; Mavri, Maria; Vrachatis, Dimitrios; Letsas, Konstantinos; Efremidis, Michael; Katsivas, Apostolos; Lekakis, John; Deftereos, Spyridon

    2017-05-01

    Syncope is a common problem in the elderly, and a permanent pacemaker is a therapeutic option when a bradycardic etiology is revealed. However, the benefit of pacing when no association of symptoms to bradycardia has been shown is not clear, especially in the elderly. The aim of this study was to evaluate the effect of pacing on syncope-free mortality in patients aged 80 years or older with unexplained syncope and "positive" invasive electrophysiologic testing (EPT). This was an observational study. A positive EPT for the purposes of this study was defined by at least 1 of the following: a corrected sinus node recovery time of >525 ms, a basic HV interval of >55 ms, detection of infra-Hisian block, or appearance of second-degree atrioventricular block on atrial decremental pacing at a paced cycle length of >400 ms. Among the 2435 screened patients, 228 eligible patients were identified, 145 of whom were implanted with a pacemaker. Kaplan-Meier analysis determined that time to event (syncope or death) was 50.1 months (95% confidence interval 45.4-54.8 months) with a pacemaker vs 37.8 months (95% confidence interval 31.3-44.4 months) without a pacemaker (log-rank test, P = .001). The 4-year time-dependent estimate of the rate of syncope was 12% vs 44% (P pacemaker implantation was independently associated with longer syncope-free survival. Significant differences were also shown in the individual components of the primary outcome measure (syncope and death from any cause). Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  9. Targeting cell migration and the endoplasmic reticulum stress response with calmodulin antagonists: a clinically tested small molecule phenocopy of SEC62 gene silencing in human tumor cells

    International Nuclear Information System (INIS)

    Linxweiler, Maximilian; Greiner, Markus; Schorr, Stefan; Schäuble, Nico; Jung, Martin; Linxweiler, Johannes; Langer, Frank; Schäfers, Hans-Joachim; Cavalié, Adolfo; Zimmermann, Richard

    2013-01-01

    Tumor cells benefit from their ability to avoid apoptosis and invade other tissues. The endoplasmic reticulum (ER) membrane protein Sec62 is a key player in these processes. Sec62 is essential for cell migration and protects tumor cells against thapsigargin-induced ER stress, which are both linked to cytosolic Ca 2+ . SEC62 silencing leads to elevated cytosolic Ca 2+ and increased ER Ca 2+ leakage after thapsigargin treatment. Sec62 protein levels are significantly increased in different tumors, including prostate, lung and thyroid cancer. In lung cancer, the influence of Sec62 protein levels on patient survival was analyzed using the Kaplan-Meier method and log-rank test. To elucidate the underlying pathophysiological functions of Sec62, Ca 2+ imaging techniques, real-time cell analysis and cell migration assays were performed. The effects of treatment with the calmodulin antagonists, trifluoperazine (TFP) and ophiobolin A, on cellular Ca 2+ homeostasis, cell growth and cell migration were compared with the effects of siRNA-mediated Sec62 depletion or the expression of a mutated SEC62 variant in vitro. Using Biacore analysis we examined the Ca 2+ -sensitive interaction of Sec62 with the Sec61 complex. Sec62 overproduction significantly correlated with reduced patient survival. Therefore, Sec62 is not only a predictive marker for this type of tumor, but also an interesting therapeutic target. The present study suggests a regulatory function for Sec62 in the major Ca 2+ leakage channel in the ER, Sec61, by a direct and Ca 2+ -sensitive interaction. A Ca 2+ -binding motif in Sec62 is essential for its molecular function. Treatment of cells with calmodulin antagonists mimicked Sec62 depletion by inhibiting cell migration and rendering the cells sensitive to thapsigargin treatment. Targeting tumors that overproduce Sec62 with calmodulin antagonists in combination with targeted thapsigargin analogues may offer novel personalized therapeutic options

  10. Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2

    DEFF Research Database (Denmark)

    Sarkisian, Laura; Saaby, L.; Poulsen, T. S.

    2015-01-01

    -year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...

  11. Randomized Phase III Trial to Test Accelerated Versus Standard Fractionation in Combination With Concurrent Cisplatin for Head and Neck Carcinomas in the Radiation Therapy Oncology Group 0129 Trial: Long-Term Report of Efficacy and Toxicity

    Science.gov (United States)

    Nguyen-Tan, Phuc Felix; Zhang, Qiang; Ang, K. Kian; Weber, Randal S.; Rosenthal, David I.; Soulieres, Denis; Kim, Harold; Silverman, Craig; Raben, Adam; Galloway, Thomas J.; Fortin, André; Gore, Elizabeth; Westra, William H.; Chung, Christine H.; Jordan, Richard C.; Gillison, Maura L.; List, Marcie; Le, Quynh-Thu

    2014-01-01

    Purpose We tested the efficacy and toxicity of cisplatin plus accelerated fractionation with a concomitant boost (AFX-C) versus standard fractionation (SFX) in locally advanced head and neck carcinoma (LA-HNC). Patients and Methods Patients had stage III to IV carcinoma of the oral cavity, oropharynx, hypopharynx, or larynx. Radiation therapy schedules were 70 Gy in 35 fractions over 7 weeks (SFX) or 72 Gy in 42 fractions over 6 weeks (AFX-C). Cisplatin doses were 100 mg/m2 once every 3 weeks for two (AFX-C) or three (SFX) cycles. Toxicities were scored by using National Cancer Institute Common Toxicity Criteria 2.0 and the Radiation Therapy Oncology Group/European Organisation for Research and Treatment of Cancer criteria. Overall survival (OS) and progression-free survival (PFS) rates were estimated by using the Kaplan-Meier method and were compared by using the one-sided log-rank test. Locoregional failure (LRF) and distant metastasis (DM) rates were estimated by using the cumulative incidence method and Gray's test. Results In all, 721 of 743 patients were analyzable (361, SFX; 360, AFX-C). At a median follow-up of 7.9 years (range, 0.3 to 10.1 years) for 355 surviving patients, no differences were observed in OS (hazard ratio [HR], 0.96; 95% CI, 0.79 to 1.18; P = .37; 8-year survival, 48% v 48%), PFS (HR, 1.02; 95% CI, 0.84 to 1.24; P = .52; 8-year estimate, 42% v 41%), LRF (HR, 1.08; 95% CI, 0.84 to 1.38; P = .78; 8-year estimate, 37% v 39%), or DM (HR, 0.83; 95% CI, 0.56 to 1.24; P = .16; 8-year estimate, 15% v 13%). For oropharyngeal cancer, p16-positive patients had better OS than p16-negative patients (HR, 0.30; 95% CI, 0.21 to 0.42; P < .001; 8-year survival, 70.9% v 30.2%). There were no statistically significant differences in the grade 3 to 5 acute or late toxicities between the two arms and p-16 status. Conclusion When combined with cisplatin, AFX-C neither improved outcome nor increased late toxicity in patients with LA-HNC. Long-term high survival

  12. Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy

    International Nuclear Information System (INIS)

    Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.

    2000-01-01

    Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de

  13. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

  14. Increased 30-day mortality in patients with diabetes undergoing surgery for colorectal cancer

    DEFF Research Database (Denmark)

    Fransgaard, T; Thygesen, L C; Gögenur, I

    2016-01-01

    with the use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The 30-day mortality was examined by the Kaplan-Meier method with the log-rank test and the Cox regression model used to test statistical significance. RESULTS: The study included 29 353 patients, of whom...... 3250 had preexisting diabetes. The 30-day mortality was significantly increased in patients with CRC and preexisting diabetes (adjusted hazard ratio 1.17, 95% CI 1.01-1.35, P = 0.03). The type of antidiabetic medication used was not associated with 30-day mortality. CONCLUSION: Preexisting diabetes...

  15. Growth pattern of colorectal liver metastasis as a marker of recurrence risk

    DEFF Research Database (Denmark)

    Eefsen, R L; Vermeulen, P B; Christensen, I J

    2015-01-01

    from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...

  16. Volume-Based F-18 FDG PET/CT Imaging Markers Provide Supplemental Prognostic Information to Histologic Grading in Patients With High-Grade Bone or Soft Tissue Sarcoma

    DEFF Research Database (Denmark)

    Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid

    2015-01-01

    analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...

  17. The 434(G>C) polymorphism in the eosinophil cationic protein gene and its association with tissue eosinophilia in oral squamous cell carcinomas

    DEFF Research Database (Denmark)

    Pereira, Michele C; Oliveira, Denise T; Olivieri, Eloísa H R

    2010-01-01

    OBJECTIVE: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G>C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic...... of ECP-gene polymorphism 434(G>C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test...

  18. High frequency of tumor cells with nuclear Egr-1 protein expression in human bladder cancer is associated with disease progression

    DEFF Research Database (Denmark)

    Egerod, Frederikke N S Lihme; Bartels, Annette; Fristrup, Niels

    2009-01-01

    bladder cancer. RESULTS: The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling...... than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling...

  19. Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer

    DEFF Research Database (Denmark)

    Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim

    2017-01-01

    OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...

  20. Clinical Study of Acute Vasoreactivity Testing in Patients with Chronic Thromboembolic Pulmonary Hypertension

    Institute of Scientific and Technical Information of China (English)

    Qi-Xia Xu; Yuan-Hua Yang; Jie Geng; Zhen-Guo Zhai; Juan-Ni Gong; Ji-Feng Li; Xiao Tang

    2017-01-01

    Background:The clinical significance of acute vasoreactivity testing (AVT) in patients with chronic thromboembolic pulmonary hypertension (CTEPH) remains unclear.We analyzed changes in hemodynamics and oxygenation dynamics indices after AVT in patients with CTEPH using patients with pulmonary arterial hypertension (PAH) as controls.Methods:We analyzed retrospectively the results of AVT in 80 patients with PAH and 175 patients with CTEPH registered in the research database ofBeijing Chao-Yang Hospital between October 2005 and August 2014.Demographic variables,cardiopulmonary indicators,and laboratory findings were compared in these two subgroups.A long-term follow-up was conducted in patients with CTEPH.Between-group comparisons were performed using the independent-sample t-test or the rank sum test,within-group comparisons were conducted using the paired t-test or the Wilcoxon signed-rank test,and count data were analyzed using the Chi-squared test.Survival was estimated using the Kaplan-Meier method and log-rank test.Results:The rates of positive response to AVT were similar in the CTEPH (25/175,14.3%) and PAH (9/80,11.3%) groups (P > 0.05).Factors significantly associated a positive response to AVT in the CTEPH group were level of N-terminal pro-brain natriuretic peptide (≤1131.000 ng/L),mean pulmonary arterial pressure (mPAP,≤44.500 mmHg),pulmonary vascular resistance (PVR,≤846.500 dyn·s1·m-5),cardiac output (CO,≥3.475 L/min),and mixed venous oxygen partial pressure (PvO2,≥35.150 mmHg).Inhalation of iloprost resulted in similar changes in mean blood pressure,mPAP,PVR,systemic vascular resistance,CO,arterial oxygen saturation (SaO2),mixed venous oxygen saturation,partial pressure of oxygen in arterial blood (PaO2),PvO2,and intrapulmonary shunt (Qs/Qt) in the PAH and CTEPH groups (all P > 0.05).The survival time in patients with CTEPH with a negative response to AVT was somewhat shorter than that in AVT-responders although the difference was

  1. A review and comparison of methods for recreating individual patient data from published Kaplan-Meier survival curves for economic evaluations: a simulation study.

    Science.gov (United States)

    Wan, Xiaomin; Peng, Liubao; Li, Yuanjian

    2015-01-01

    In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.

  2. Perioperative Blood Transfusion as a Significant Predictor of Biochemical Recurrence and Survival after Radical Prostatectomy in Patients with Prostate Cancer.

    Directory of Open Access Journals (Sweden)

    Jung Kwon Kim

    Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.

  3. On the Importance of Accounting for Competing Risks in Pediatric Cancer Trials Designed to Delay or Avoid Radiotherapy: I. Basic Concepts and First Analyses

    International Nuclear Information System (INIS)

    Tai, Bee-Choo; Grundy, Richard G.; Machin, David

    2010-01-01

    Purpose: In trials designed to delay or avoid irradiation among children with malignant brain tumor, although irradiation after disease progression is an important event, patients who have disease progression may decline radiotherapy (RT), or those without disease progression may opt for elective RT. To accurately describe the cumulative need for RT in such instances, it is crucial to account for these distinct events and to evaluate how each contributes to the delay or advancement of irradiation via a competing risks analysis. Methods and Materials: We describe the summary of competing events in such trials using competing risks methods based on cumulative incidence functions and Gray's test. The results obtained are contrasted with standard survival methods based on Kaplan-Meier curves, cause-specific hazard functions and log-rank test. Results: The Kaplan-Meier method overestimates all event-specific rates. The cause-specific hazard analysis showed reduction in hazards for all events (A: RT after progression; B: no RT after progression; C: elective RT) among children with ependymoma. For event A, a higher cumulative incidence was reported for ependymoma. Although Gray's test failed to detect any difference (p = 0.331) between histologic subtypes, the log-rank test suggested marginal evidence (p = 0.057). Similarly, for event C, the log-rank test found stronger evidence of reduction in hazard among those with ependymoma (p = 0.005) as compared with Gray's test (p = 0.086). Conclusions: To evaluate treatment differences, failing to account for competing risks using appropriate methodology may lead to incorrect interpretations.

  4. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b and c

    International Nuclear Information System (INIS)

    Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.

    2008-01-01

    Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be

  5. The effect of quitting smoking on the risk of unfavorable events after surgical treatment of oral potentially malignant lesions

    DEFF Research Database (Denmark)

    Vladimirov, B S; Schiødt, Morten

    2009-01-01

    smokers at the time of diagnosis and were treated surgically. Patients were advised to quit smoking at each visit. The change of smoking habits and occurrence of unfavorable events were noted during follow-up. Descriptive statistics, Fischer's exact test, Kaplan-Meier curves with log-rank test, and Cox......The aim of this study was to examine if cessation of smoking after surgical excision of oral potentially malignant lesions in smokers reduced the risk of recurrences, development of new lesions or malignancies. 51 patients with oral leukoplakia or erythroplakia were included. They were daily...... proportional hazards model were used for analysis. 16 patients (31%) quit smoking during the observation period. Only one quitter (6%) developed recurrence compared with 11 continuing smokers (33%) (p

  6. Changes in acute response to radiation after implementation of new national guidelines for head and neck cancer

    DEFF Research Database (Denmark)

    Hansen, C. R.; Bertelsen, Anders; Zukauskaite, R.

    2015-01-01

    of volume of CTV1 for most institutions which previously used different margins. Change in CTV1 volume definition could influence the risk and time evolution of adverse effects e.g. mucositis. This study investigates change in acute response during RT in a centre where GTV to CTV1 margin was increased from......Purpose/Objective: New national guidelines (GL) for radiotherapy (RT) of head and neck cancer (HNC) were implemented at the beginning of 2013. One purpose of the new GL was to nationally standardise the expansion from GTV to high risk CTV (CTV1). This standardisation has resulted in change...... endpoints were dichotomized, grade 0- 1 vs 2+ or 0-2 vs 3+. Potential change in actuarial cumulative incidence (One minus the Kaplan Meier estimator) of mucositis was tested using the log-rank test. To stratify for the potential effect between non-accelerated (5 fx/w) and accelerated (6/10 fx/w) treatments...

  7. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

    DEFF Research Database (Denmark)

    Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

  8. Prognostic value of MLH1 promoter methylation in male patients with esophageal squamous cell carcinoma.

    Science.gov (United States)

    Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei

    2017-04-01

    The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.

  9. Comparison of colorectal and gastric cancer: Survival and prognostic factors

    International Nuclear Information System (INIS)

    Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R

    2009-01-01

    Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)

  10. Maternal smoking during pregnancy and the risk of pediatric cardiovascular diseases of the offspring: A population-based cohort study with up to 18-years of follow up.

    Science.gov (United States)

    Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal

    2018-06-01

    Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Factors affecting commencement and cessation of smoking behaviour in Malaysian adults

    Directory of Open Access Journals (Sweden)

    Ghani Wan

    2012-03-01

    Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.

  12. Prior history of non-melanoma skin cancer is associated with increased mortality in patients with chronic lymphocytic leukemia

    Science.gov (United States)

    Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola

    2009-01-01

    We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092

  13. Enhanced Predictive Capability of a 1-Hour Oral Glucose Tolerance Test

    DEFF Research Database (Denmark)

    Pareek, Manan; Bhatt, Deepak L; Nielsen, Mette L

    2018-01-01

    OBJECTIVE: To examine whether the 1-h blood glucose measurement would be a more suitable screening tool for assessing the risk of diabetes and its complications than the 2-h measurement. RESEARCH DESIGN AND METHODS: We conducted a prospective population-based cohort study of 4,867 men, randomly...... selected from prespecified birth cohorts between 1921 and 1949, who underwent an oral glucose tolerance test with blood glucose measurements at 0, 1, and 2 h. Subjects were followed for up to 39 years, with registry-based recording of events. Discriminative abilities of elevated 1-h (≥8.6 mmol/L) versus 2......-h (≥7.8 mmol/L) glucose for predicting incident type 2 diabetes, vascular complications, and mortality were compared using Kaplan-Meier analysis, Cox proportional hazards regression, and net reclassification improvement. RESULTS: Median age was 48 years (interquartile range [IQR] 48-49). During...

  14. Primary mediastinal large B-cell lymphoma: Clinical features, prognostic factors and survival with RCHOP in Arab patients in the PET scan era.

    Science.gov (United States)

    Al Shemmari, Salem; Sankaranarayanan, Sreedharan P; Krishnan, Yamini

    2014-07-01

    PMBCL is a distinct type of nonhodgkins lymphoma with specific clinicopathological features. To clarify clinical features, treatment alternatives and outcomes, we evaluated 28 Arab patients treated with chemotherapy or radiotherapy between 2006 and 2011. PMBCL lymphoma patients identified according to WHO classification and treated at KCCC between 2006 and 2011 were included in this study. Demographic and clinical data are presented as means or medians. Overall survival was estimated using the Kaplan-Meier method. Survival rates were compared using the log-rank test. A P lymphoma entity seen in the young with good survival. The role of PET scan for response evaluation and the type of consolidation therapy needs to be further clarified.

  15. Risk of invasive breast cancer and ductal carcinoma in situ in women with atypical papillary lesions of the breast.

    Science.gov (United States)

    Cuneo, Kyle C; Dash, Rajesh C; Wilke, Lee G; Horton, Janet K; Koontz, Bridget F

    2012-09-01

    Benign papillary lesions of the breast include papilloma and papillomatosis. A retrospective analysis of patients with a papillary breast lesion diagnosed between October 1992 and December 2009 was performed. Patients were excluded if they had a previous or concurrent diagnosis of invasive or in situ cancer or less than 6 months of follow-up. The Kaplan-Meier method was used to determine the risk of developing subsequent malignancy. The log rank test was used to compare groups of patients. Median follow-up for the 167 patients included in the study was 4.6 years. Fifty-one patients had a papillary lesion with atypia and 116 patients had a papillary lesion without atypia. Patients with a papillary lesion with atypia were more likely to develop invasive or in situ breast cancer with a 5 year risk of 13.0% versus 4.6% in patients with no atypia (p = 0.03). © 2012 Wiley Periodicals, Inc.

  16. Survival pathological prognosis factors in breast cancer

    International Nuclear Information System (INIS)

    Gonzalez-Longoria Boada, Lourdes B.

    2012-01-01

    A descriptive and longitudinal study of 273 women with breast cancer belonging to Granma province was carried out from 2003 to 2004, in order to analyze the survival of this female population, reason why the method of Kaplan Meier was used for the calculation of the mentioned variable and the Log Rank test was used for the comparison of curves. Patients with higher survival at 5 years were those who had tumors of 2 cm or less (87.5%), histological grade I (90.3%), nuclear grade I (88.3%), as well as the absence of vascular, lymphatic or lymph node invasion (with 80.6; 74.9 and 6.1% respectively). Also, tumor size, histological and nuclear grade, nodal status, as well as lymphatic and vascular invasion constituted prognosis factors, which favored the individualization of therapeutic behaviors

  17. Long-Term Safety of In Utero Exposure to Anti-TNFα Drugs for the Treatment of Inflammatory Bowel Disease

    DEFF Research Database (Denmark)

    Chaparro, M; Verreth, A; Lobaton, T

    2018-01-01

    OBJECTIVES: The long-term safety of exposure to anti-tumor necrosis factor (anti-TNFα) drugs during pregnancy has received little attention. We aimed to compare the relative risk of severe infections in children of mothers with inflammatory bowel disease (IBD) who were exposed to anti-TNFα drugs...... in utero with that of children who were not exposed to the drugs. METHODS: Retrospective multicenter cohort study. Exposed cohort: children from mothers with IBD receiving anti-TNFα medication (with or without thiopurines) at any time during pregnancy or during the 3 months before conception. Non......-exposed cohort: children from mothers with IBD not treated with anti-TNFα agents or thiopurines at any time during pregnancy or the 3 months before conception. The cumulative incidence of severe infections after birth was estimated using Kaplan-Meier curves, which were compared using the log-rank test. Cox...

  18. Association between poor clinical prognosis and sleep duration among breast cancer patients

    Directory of Open Access Journals (Sweden)

    Thalyta Cristina Mansano-Schlosser

    Full Text Available ABSTRACT Objective: to investigate the association between clinical progression and the quality and duration of sleep in women with breast cancer. Method: longitudinal study, with 114 participants, conducted in a hospital in Brazil. The instruments used were: questionnaire for sociodemographic and clinical characterization, Pittsburgh Sleep Quality Index; Beck Depression Inventory and Herth Hope Scale. Data were analyzed through descriptive statistics and survival analyses (outcome: poor clinical progression, using the Kaplan-Meier curve, Log-rank test and Cox proportional model. Results: a higher probability of poor clinical progression was verified in women with sleep durations of less than six hours or nine hours and over (p=.0173. Conclusion: the results suggest the importance of further studies that seek to verify whether the quantitative management of sleep disorders would have an impact on the progression of breast cancer. Women should be encouraged to report sleep problems to nurses.

  19. Lenalidomide-induced myelosuppression is associated with renal dysfunction: adverse events evaluation of treatment-naïve patients undergoing front-line lenalidomide and dexamethasone therapy.

    Science.gov (United States)

    Niesvizky, Ruben; Naib, Tara; Christos, Paul J; Jayabalan, David; Furst, Jessica R; Jalbrzikowski, Jessica; Zafar, Faiza; Mark, Tomer; Lent, Richard; Pearse, Roger N; Ely, Scott; Leonard, John P; Mazumdar, Madhu; Chen-Kiang, Selina; Coleman, Morton

    2007-09-01

    Data on 72 patients receiving lenalidomide/dexamethasone for multiple myeloma (MM) was used to determine the factors that are associated with lenalidomide-induced myelosuppression. Eight of 14 patients with grade > or =3 myelosuppression had baseline creatinine clearance (CrCl) < or =0.67 ml/s. Kaplan-Meier analysis by log-rank test demonstrated a significant association (P < 0.0001) between renal insufficiency and time to myelosuppression (hazard ratio = 8.4; 95% confidence interval 2.9-24.7, P = 0.0001). Therefore, CrCl is inversely associated with significant myelosuppression. Caution should be exercised when lenalidomide therapy is commenced and CrCl should be incorporated as a determinant of the initial dosing of lenalidomide in MM patients.

  20. Aplicación y técnicas del análisis de supervivencia en las investigaciones clínicas Application and techniques of survival analysis in clinical research

    Directory of Open Access Journals (Sweden)

    Anissa Gramatges Ortiz

    2002-08-01

    Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated

  1. Compliance with Supportive Periodontal Treatment in Patients with Dental Implants.

    Science.gov (United States)

    Hu, Kai-Fang; Lin, Ying-Chu; Ho, Kun-Yen; Chou, Yu-Hsiang

    The need for dental implants is increasing, and supportive periodontal treatment can achieve long-term success and prevent peri-implantitis. Contributing factors to noncompliance with long-term scheduled supportive periodontal treatment remain unclear. To investigate whether demographic and clinical characteristics are associated with noncompliance, the authors analyzed data for patients who had received dental implants. The authors recruited patients participating in a supportive periodontal treatment program after receiving permanent prostheses on implants placed from 2005 to 2013. Demographic data and dental treatment histories were collected. Compliance was defined as a record of participation in a standard supportive periodontal treatment program for at least 1 year. The chi-square test, log-rank test, Kaplan-Meier survival curve, and Cox proportional hazards model were used for statistical analysis. The study included 120 patients (259 implants, 60% compliance). The two groups (compliant and noncompliant) differed significantly in frequency distributions for sex (P = .0017), educational level (P = .0325), and histories of substance use (P = .0016), periodontitis (P = .0005), and root planing or flap surgery (P = .0002). The Kaplan-Meier survival curves and log-rank test showed that increases in cumulative continuation rates were significantly associated with male sex (P = .0025); body mass index ≥ 24 kg/m² (P = .0093); and a history of periodontitis (P implant placement, root planing or flap surgery was the crucial factor in determining compliance with supportive periodontal treatment. However, well-designed large-scale studies with a larger sample size are needed to confirm the findings of this study.

  2. Prospective Randomized Trial Comparing Efficacy of Topical Loteprednol Etabonate 0.5% Versus Cyclosporine-A 0.05% for Treatment of Dry Eye Syndrome Following Hematopoietic Stem Cell Transplantation.

    Science.gov (United States)

    Boynton, Grace E; Raoof, Duna; Niziol, Leslie M; Hussain, Munira; Mian, Shahzad I

    2015-07-01

    To evaluate the safety and efficacy of topical loteprednol etabonate (LE) 0.5% compared with cyclosporine A (CsA) 0.05% for the prophylaxis and treatment of dry eye syndrome (DES) after hematopoietic stem cell transplantation (HSCT). Seventy-five patients were randomized to LE (n = 76 eyes of 38 patients) or CsA (n = 74 eyes of 37 patients) pre-HSCT. Lissamine green and fluorescein staining, tear break-up time, tear osmolarity (Osm), Schirmer score (Sch), intraocular pressure, visual acuity, and Ocular Surface Disease Index were assessed pre-HSCT, 3, 6, 9, and 12 months post-HSCT. There were no differences in DES incidence (P = 0.22; log-rank test) or progression (P = 0.41; log-rank test) between the 2 treatment arms during the course of the study. Among eyes with no DES at enrollment, the Kaplan-Meier analysis yielded a 90% rate of DES development in cyclosporine-treated eyes and a 79% rate of DES development in LE-treated eyes by 12 months post-HSCT. The Kaplan-Meier analysis of eyes with DES at enrollment demonstrated a 38% rate of disease progression among cyclosporine-treated eyes and a 26% rate of disease progression among loteprednol-treated eyes by 12 months. No patient in either group had an elevation of 10 mm Hg or greater from baseline at any study visit, and no patients had their treatment discontinued for elevation in intraocular pressure. Pre-HSCT initiation of LE 0.5% appears to be safe and may be as effective as CsA 0.5% for the treatment and prophylaxis of DES following HSCT.

  3. Perioperative and mid-term oncologic outcomes of robotic assisted radical cystectomy with totally intracorporeal neobladder: Results of a propensity score matched comparison with open cohort from a single-centre series.

    Science.gov (United States)

    Simone, Giuseppe; Tuderti, Gabriele; Misuraca, Leonardo; Anceschi, Umberto; Ferriero, Mariaconsiglia; Minisola, Francesco; Guaglianone, Salvatore; Gallucci, Michele

    2018-04-17

    In this study, we compared perioperative and oncologic outcomes of patients treated with either open or robot-assisted radical cystectomy and intracorporeal neobladder at a tertiary care center. The institutional prospective bladder cancer database was queried for "cystectomy with curative intent" and "neobladder". All patients underwent robot-assisted radical cystectomy and intracorporeal neobladder or open radical cystectomy and orthotopic neobladder for high-grade non-muscle invasive bladder cancer or muscle invasive bladder cancer with a follow-up length ≥2 years were included. A 1:1 propensity score matching analysis was used. Kaplan-Meier method was performed to compare oncologic outcomes of selected cohorts. Survival rates were computed at 1,2,3 and 4 years after surgery and the log rank test was applied to assess statistical significance between the matched groups. Overall, 363 patients (299 open and 64 robotic) were included. Open radical cystectomy patients were more frequently male (p = 0.08), with higher pT stages (p = 0.003), lower incidence of urothelial histologies (p = 0.05) and lesser adoption of neoadjuvant chemotherapy (open radical cystectomy cases (all p ≥ 0.22). Open cohort showed a higher rate of perioperative overall complications (91.3% vs 42.2%, p 0.001). At Kaplan-Meier analysis robotic and open cohorts displayed comparable disease-free survival (log-rank p = 0.746), cancer-specific survival (p = 0.753) and overall-survival rates (p = 0.909). Robot-assisted radical cystectomy and intracorporeal neobladder provides comparable oncologic outcomes of open radical cystectomy and orthotopic neobladder at intermediate term survival analysis. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

  4. Predictors of survival in surgically treated patients of spinal metastasis

    Directory of Open Access Journals (Sweden)

    Pravin Padalkar

    2011-01-01

    Full Text Available Background: The spinal metastasis occurs in up to 40% of cancer patient. We compared the Tokuhashi and Tomita scoring systems, two commonly used scoring systems for prognosis in spinal metastases. We also assessed the different variables separately with respect to their value in predicting postsurgical life expectancy. Finally, we suggest criteria for selecting patients for surgery based on the postoperative survival pattern. Materials and Methods: We retrospectively analyzed 102 patients who had been operated for metastatic disease of the spine. Predictive scoring was done according to the scoring systems proposed by Tokuhashi and Tomita. Overall survival was assessed using Kaplan-Meier survival analysis. Using the log rank test and Cox regression model we assessed the value of the individual components of each scoring system for predicting survival in these patients. Result: The factors that were most significantly associated with survival were the general condition score (Karnofsky Performance Scale (P=.000, log rank test, metastasis to internal organs (P=.0002 log rank test, and number of extraspinal bone metastases (P=.0058. Type of primary tumor was not found to be significantly associated with survival according to the revised Tokuhashi scoring system (P=.9131, log rank test. Stepwise logistic regression revealed that the Tomita score correlated more closely with survival than the Tokuhashi score. Conclusion: The patient′s performance status, extent of visceral metastasis, and extent of bone metastases are significant predictors of survival in patients with metastatic disease. Both revised Tokuhashi and Tomita scores were significantly correlated with survival. A revised Tokuhashi score of 7 or more and a Tomita score of 6 or less indicated >50% chance of surviving 6 months postoperatively. We recommend that the Tomita score be used for prognostication in patients who are contemplating surgery, as it is simpler to score and has a higher

  5. Simple prognostic model for patients with advanced cancer based on performance status.

    Science.gov (United States)

    Jang, Raymond W; Caraiscos, Valerie B; Swami, Nadia; Banerjee, Subrata; Mak, Ernie; Kaya, Ebru; Rodin, Gary; Bryson, John; Ridley, Julia Z; Le, Lisa W; Zimmermann, Camilla

    2014-09-01

    Providing survival estimates is important for decision making in oncology care. The purpose of this study was to provide survival estimates for outpatients with advanced cancer, using the Eastern Cooperative Oncology Group (ECOG), Palliative Performance Scale (PPS), and Karnofsky Performance Status (KPS) scales, and to compare their ability to predict survival. ECOG, PPS, and KPS were completed by physicians for each new patient attending the Princess Margaret Cancer Centre outpatient Oncology Palliative Care Clinic (OPCC) from April 2007 to February 2010. Survival analysis was performed using the Kaplan-Meier method. The log-rank test for trend was employed to test for differences in survival curves for each level of performance status (PS), and the concordance index (C-statistic) was used to test the predictive discriminatory ability of each PS measure. Measures were completed for 1,655 patients. PS delineated survival well for all three scales according to the log-rank test for trend (P statistic was similar for all three scales and ranged from 0.63 to 0.64. We present a simple tool that uses PS alone to prognosticate in advanced cancer, and has similar discriminatory ability to more complex models. Copyright © 2014 by American Society of Clinical Oncology.

  6. Removal of Endobronchial Malignant Mass by Cryotherapy Improved Performance Status to Receive Chemotherapy

    Science.gov (United States)

    Hsieh, Meng-Heng; Wang, Tsai-Yu; Yu, Chih-Teng; Chou, Chun-Liang; Lin, Shu-Min; Kuo, Chih-Hsi; Chung, Fu-Tsai

    2014-01-01

    Although malignant endobronchial mass (MEM) has poor prognosis, cryotherapy is reportedly a palliative treatment. Clinical data on postcryotherapy MEM patients in a university-affiliated hospital between 2007 and 2011 were evaluated. Survival curve with or without postcryotherapy chemotherapy and performance status (PS) improvement of these subjects were analyzed using the Kaplan-Meier method. There were 59 patients (42 males), with median age of 64 years (range, 51–76, and median performance status of 2 (interquartile range [IQR], 2-3). Postcryotherapy complications included minor bleeding (n = 12) and need for multiple procedures (n = 10), while outcomes were relief of symptoms (n = 51), improved PS (n = 45), and ability to receive chemotherapy (n = 40). The survival of patients with chemotherapy postcryotherapy was longer than that of patients without such chemotherapy (median, 534 versus 106 days; log-rank test, P = 0.007; hazard ratio, 0.25; 95% confidence interval, 0.10–0.69). The survival of patients with PS improvement postcryotherapy was longer than that of patients without PS improvement (median, 406 versus 106 days; log-rank test, P = 0.02; hazard ratio, 0.28; 95% confidence interval, 0.10–0.81). Cryotherapy is a feasible treatment for MEM. With better PS after cryotherapy, further chemotherapy becomes possible for patients to improve survival when MEM caused dyspnea and poor PS. PMID:25383370

  7. The 5-year incidence of bleb-related infection and its risk factors after filtering surgeries with adjunctive mitomycin C: collaborative bleb-related infection incidence and treatment study 2.

    Science.gov (United States)

    Yamamoto, Tetsuya; Sawada, Akira; Mayama, Chihiro; Araie, Makoto; Ohkubo, Shinji; Sugiyama, Kazuhisa; Kuwayama, Yasuaki

    2014-05-01

    To report the 5-year incidence of bleb-related infection after mitomycin C-augmented glaucoma filtering surgery and to investigate the risk factors for infections. Prospective, observational cohort study. A total of 1098 eyes of 1098 glaucoma patients who had undergone mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation performed at 34 clinical centers. Patients were followed up at 6-month intervals for 5 years, with special attention given to bleb-related infections. The follow-up data were analyzed via Kaplan-Meier survival analysis and the Cox proportional hazards model. Incidence of bleb-related infection over 5 years and risk factors for infections. Of the 1098 eyes, a bleb-related infection developed in 21 eyes. Kaplan-Meier survival analysis revealed that the incidence of bleb-related infection was 2.2±0.5% (cumulative incidence ± standard error) at the 5-year follow-up for all cases, whereas it was 7.9±3.1% and 1.7±0.4% for cases with and without a history of bleb leakage, respectively (P = 0.000, log-rank test). When only eyes with a well-functioning bleb were counted, it was 3.9±1.0%. No differences were found between the trabeculectomy cases and the combined surgery cases (P = 0.398, log-rank test) or between cases with a fornix-based flap and those with a limbal-based flap (P = 0.651, log-rank test). The Cox model revealed that a history of bleb leakage and younger age were risk factors for infections. The 5-year cumulative incidence of bleb-related infection was 2.2±0.5% in eyes treated with mitomycin C-augmented trabeculectomy or trabeculectomy combined with phacoemulsification and intraocular lens implantation in our prospective, multicenter study. Bleb leakage and younger age were the main risk factors for infections. Copyright © 2014 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

  8. A genetic polymorphism in TOX3 is associated with survival of gastric cancer in a Chinese population.

    Directory of Open Access Journals (Sweden)

    Xiaojing Zhang

    Full Text Available PURPOSE: Recently, genetic polymorphism (rs3803662C>T in TOX3 was reported to induce the risk of breast cancer. In this study, we hypothesized that rs3803662 could influence gastric cancer survival outcomes. METHODS: With multiplex SNaPshot method, we genotyped TOX3 rs3803662 in 880 gastric patients with surgical resection. The association between genotype and survival outcomes was performed by the Kaplan-Meier method, Cox regression analysis models and the log-rank test. RESULTS: There was no association in the analyses of rs3803662 and survival of gastric cancer. However, the stratified analysis by histology showed that rs3803662 CT/TT genotype was associated with a significantly better survival for diffuse-type gastric cancer (log-rank p = 0.030, hazard ratio [HR]  = 0.67, 95% confidence interval [CI]  = 0.46-0.96, than the CC genotype. In addition, this favorable effect was especially obvious among gastric cancer patients with tumor size >5 cm, T3 and T4 depth of invasion, lymph node metastasis, no drinking, no distant metastasis, no chemotherapy and gastric cardia cancer. CONCLUSIONS: TOX3 rs3803662 might play an important role in the prognostic outcome and treatment of gastric cancer, especially perhaps further help in explaining the reduced risk of death associated with diffuse-type gastric cancer.

  9. Clinical Efficiency of Two Sequences of Orthodontic Wires to Correct Crowding of the Lower Anterior Teeth

    Directory of Open Access Journals (Sweden)

    Cláudia Maria de Castro Serafim

    2015-01-01

    Full Text Available This study compared time to correction of mandibular anterior crowding using two arch wire sequences, one with conventional nickel-titanium (NiTi arch wires and the other with conventional and NiTi heat-activated arch wires. Twenty-two boys and girls (mean age: 16.68 ± 2.66 with moderate crowding (3–6 mm were assigned randomly to one of two groups and followed up for five months (six assessments when arch wires were changed. Time to crowding correction was analyzed statistically using the Kaplan-Meier method. Data were collected during the five-month follow-up, and time to correction was compared between groups using the log rank test. At the end of follow-up, mandibular crowding was corrected in 100% of the cases in the group treated with the sequence that included NiTi heat-activated arch wires, whereas about 30% of those treated with NiTi arch wires were not completely corrected. There was a significant difference in time to complete treatment between groups (log rank = 5.996; p<0.05. In the group treated with the sequence that included heat-activated wires, alignment and leveling of mandibular anterior teeth were completed earlier than in the group treated only with conventional NiTi arch wires. Clinical trial registration is found at RBR-7g5zng.

  10. A Matched Case-Control Study on Open and Endovascular Treatment of Popliteal Artery Aneurysms.

    Science.gov (United States)

    Dorigo, W; Fargion, A; Masciello, F; Piffaretti, G; Pratesi, G; Giacomelli, E; Pratesi, C

    2018-01-01

    To compare early and late results of open and endovascular management of popliteal artery aneurysm in a retrospective single-center matched case-control study Methods: From 1981 to 2015, 309 consecutive interventions for popliteal artery aneurysm were performed in our institution, in 59 cases with endovascular repair and in 250 cases with open repair. Endovascular repair was preferred in older asymptomatic patients, while open repair was offered more frequently to patients with a thrombosed popliteal artery aneurysm and a poor run-off status. A one-to-one coarsened exact matching on the basis of the baseline demographic, clinical, and anatomical covariates significantly different between the two treatment options was performed and two equivalent groups of 56 endovascular repairs and open repairs were generated. The two groups were compared in terms of perioperative results with χ 2 test and of follow-up outcomes with the Kaplan-Meier curves and log-rank test. There were no differences between the two groups in terms of perioperative outcomes. Median duration of follow-up was 38 months. Five-year survival rates were 94% in endovascular repair group and 89.5% in open repair group (p = 0.4, log-rank 0.6). Primary patency rates at 1, 3, and 5 years were 81%, 78%, and 72% in endovascular repair group and 82.5%, 80%, and 64% in open repair group (p = 0.8, log-rank 0.01). Freedom from reintervention at 5 years was 65.5% in endovascular repair group and 76% in open repair group (p = 0.2, log-rank 1.2). Secondary patency at 1, 3, and 5 years was 94%, 86%, and 74% in endovascular repair group, and 94%, 89%, and 71% in open repair group, respectively (p = 0.9, log-rank 0.01). The rates of limb preservation at 5 years were 94% in endovascular repair group and 86.4% in open repair group (p = 0.3, log-rank 0.8). Open repair and endovascular repair of popliteal artery aneurysms provided in this retrospective single-center experience similar perioperative and follow-up results in

  11. Prognostic relevance of cytochrome C oxidase in primary glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Corinne E Griguer

    Full Text Available Patients with primary glioblastoma multiforme (GBM have one of the lowest overall survival rates among cancer patients, and reliable biomarkers are necessary to predict patient outcome. Cytochrome c oxidase (CcO promotes the switch from glycolytic to OXPHOS metabolism, and increased CcO activity in tumors has been associated with tumor progression after chemotherapy failure. Thus, we investigated the relationship between tumor CcO activity and the survival of patients diagnosed with primary GBM. A total of 84 patients with grade IV glioma were evaluated in this retrospective cohort study. Cumulative survival was calculated by the Kaplan-Meier method and analyzed by the log-rank test, and univariate and multivariate analyses were performed with the Cox regression model. Mitochondrial CcO activity was determined by spectrophotometrically measuring the oxidation of cytochrome c. High CcO activity was detected in a subset of glioma tumors (∼30%, and was an independent prognostic factor for shorter progression-free survival and overall survival [P = 0.0087 by the log-rank test, hazard ratio = 3.57 for progression-free survival; P<0.001 by the log-rank test, hazard ratio = 10.75 for overall survival]. The median survival time for patients with low tumor CcO activity was 14.3 months, compared with 6.3 months for patients with high tumor CcO activity. High CcO activity occurs in a significant subset of high-grade glioma patients and is an independent predictor of poor outcome. Thus, CcO activity may serve as a useful molecular marker for the categorization and targeted therapy of GBMs.

  12. Factors Predictive of Symptomatic Radiation Injury After Linear Accelerator-Based Stereotactic Radiosurgery for Intracerebral Arteriovenous Malformations

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Christopher, E-mail: cherbert@bccancer.bc.ca [Department of Radiation Oncology, British Columbia Cancer Agency, Vancouver, BC (Canada); Moiseenko, Vitali [Department of Medical Physics, British Columbia Cancer Agency, Vancouver, BC (Canada); McKenzie, Michael [Department of Radiation Oncology, British Columbia Cancer Agency, Vancouver, BC (Canada); Redekop, Gary [Division of Neurosurgery, Vancouver General Hospital, University of British Columbia, Vancouver, BC (Canada); Hsu, Fred [Department of Radiation Oncology, British Columbia Cancer Agency, Abbotsford, BC (Canada); Gete, Ermias; Gill, Brad; Lee, Richard; Luchka, Kurt [Department of Medical Physics, British Columbia Cancer Agency, Vancouver, BC (Canada); Haw, Charles [Division of Neurosurgery, Vancouver General Hospital, University of British Columbia, Vancouver, BC (Canada); Lee, Andrew [Department of Neurosurgery, Royal Columbian Hospital, New Westminster, BC (Canada); Toyota, Brian [Division of Neurosurgery, Vancouver General Hospital, University of British Columbia, Vancouver, BC (Canada); Martin, Montgomery [Department of Medical Imaging, British Columbia Cancer Agency, Vancouver, BC (Canada)

    2012-07-01

    Purpose: To investigate predictive factors in the development of symptomatic radiation injury after treatment with linear accelerator-based stereotactic radiosurgery for intracerebral arteriovenous malformations and relate the findings to the conclusions drawn by Quantitative Analysis of Normal Tissue Effects in the Clinic (QUANTEC). Methods and Materials: Archived plans for 73 patients who were treated at the British Columbia Cancer Agency were studied. Actuarial estimates of freedom from radiation injury were calculated using the Kaplan-Meier method. Univariate and multivariate Cox proportional hazards models were used for analysis of incidence of radiation injury. Log-rank test was used to search for dosimetric parameters associated with freedom from radiation injury. Results: Symptomatic radiation injury was exhibited by 14 of 73 patients (19.2%). Actuarial rate of symptomatic radiation injury was 23.0% at 4 years. Most patients (78.5%) had mild to moderate deficits according to Common Terminology Criteria for Adverse Events, version 4.0. On univariate analysis, lesion volume and diameter, dose to isocenter, and a V{sub x} for doses {>=}8 Gy showed statistical significance. Only lesion diameter showed statistical significance (p < 0.05) in a multivariate model. According to the log-rank test, AVM volumes >5 cm{sup 3} and diameters >30 mm were significantly associated with the risk of radiation injury (p < 0.01). The V{sub 12} also showed strong association with the incidence of radiation injury. Actuarial incidence of radiation injury was 16.8% if V{sub 12} was <28 cm{sup 3} and 53.2% if >28 cm{sup 3} (log-rank test, p = 0.001). Conclusions: This study confirms that the risk of developing symptomatic radiation injury after radiosurgery is related to lesion diameter and volume and irradiated volume. Results suggest a higher tolerance than proposed by QUANTEC. The widely differing findings reported in the literature, however, raise considerable uncertainties.

  13. The efficacy of postoperative radiotherapy in localized primary soft tissue sarcoma treated with conservative surgery

    International Nuclear Information System (INIS)

    Zhao, Ru-Ping; Yu, Xiao-Li; Zhang, Zhen; Jia, Li-Juan; Feng, Yan; Yang, Zhao-Zhi; Chen, Xing-Xing; Wang, Jian; Ma, Sheng-Lin; Guo, Xiao-Mao

    2016-01-01

    To evaluate the efficacy of postoperative radiotherapy (RT) on local failure-free survival (LFFS), distant metastasis-free survival (DMFS) and overall survival (OS) in patients with localized primary soft tissue sarcoma (STS) and to identify prognostic factors. Between January 2000 and July 2010, 220 consecutive patients with localized primary STS, who received conservative surgery with or without postoperative RT, were enrolled in the study. Survival curves were constructed by the Kaplan-Meier method and log-rank test was used to assess statistical significance. Multivariate analysis was applied to identify the prognostic factors. After a median follow-up of 68 months (range, 5–127 months), the 5-year LFFS, DMFS and OS were 70.0, 78.2 and 71.2 %, respectively. Tumor size, histological subtypes, margin status and postoperative RT were independent predictors for OS. Postoperative RT was associated with a significant reduced local recurrence risk versus surgery alone (hazard ratio [HR] = 0.408, 95 % confidence interval [CI] 0.235–0.707, P = 0.001), with 5-year LFFS of 81.1 and 63.6 %, respectively (log-rank, P = 0.004). The log-rank test showed that postoperative RT had a tendency of improving OS compared with surgery alone, with 5-year OS of 74.8 and 65.0 %, respectively (P = 0.089). Multivariate analysis demonstrated that postoperative RT significantly reduced mortality rate compared with surgery alone (HR = 0.512, 95 % CI 0.296–0.886, p = 0.017), especially in patients with liposarcoma (p = 0.034). Postoperative radiotherapy reduce both local recurrence and STS mortality in patients with localized primary STS. The efficacy of RT on survival warrants further prospective study. The online version of this article (doi:10.1186/s13014-016-0605-y) contains supplementary material, which is available to authorized users

  14. Establishment of a 12-gene expression signature to predict colon cancer prognosis

    Directory of Open Access Journals (Sweden)

    Dalong Sun

    2018-06-01

    Full Text Available A robust and accurate gene expression signature is essential to assist oncologists to determine which subset of patients at similar Tumor-Lymph Node-Metastasis (TNM stage has high recurrence risk and could benefit from adjuvant therapies. Here we applied a two-step supervised machine-learning method and established a 12-gene expression signature to precisely predict colon adenocarcinoma (COAD prognosis by using COAD RNA-seq transcriptome data from The Cancer Genome Atlas (TCGA. The predictive performance of the 12-gene signature was validated with two independent gene expression microarray datasets: GSE39582 includes 566 COAD cases for the development of six molecular subtypes with distinct clinical, molecular and survival characteristics; GSE17538 is a dataset containing 232 colon cancer patients for the generation of a metastasis gene expression profile to predict recurrence and death in COAD patients. The signature could effectively separate the poor prognosis patients from good prognosis group (disease specific survival (DSS: Kaplan Meier (KM Log Rank p = 0.0034; overall survival (OS: KM Log Rank p = 0.0336 in GSE17538. For patients with proficient mismatch repair system (pMMR in GSE39582, the signature could also effectively distinguish high risk group from low risk group (OS: KM Log Rank p = 0.005; Relapse free survival (RFS: KM Log Rank p = 0.022. Interestingly, advanced stage patients were significantly enriched in high 12-gene score group (Fisher’s exact test p = 0.0003. After stage stratification, the signature could still distinguish poor prognosis patients in GSE17538 from good prognosis within stage II (Log Rank p = 0.01 and stage II & III (Log Rank p = 0.017 in the outcome of DFS. Within stage III or II/III pMMR patients treated with Adjuvant Chemotherapies (ACT and patients with higher 12-gene score showed poorer prognosis (III, OS: KM Log Rank p = 0.046; III & II, OS: KM Log Rank p = 0.041. Among stage II/III pMMR patients

  15. Targeted intraoperative radiotherapy tumour bed boost during breast-conserving surgery after neoadjuvant chemotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Kolberg, Hans-Christian; Akpolat-Basci, Leyla; Stephanou, Miltiades [Marienhospital Bottrop gGmbH, Department of Gynecology and Obstetrics, Bottrop (Germany); Loevey, Gyoergy [BORAD, Bottrop (Germany); Fasching, Peter A. [University of Erlangen, Erlangen (Germany); Untch, Michael [Helios Klinikum Berlin-Buch, Berlin (Germany); Liedtke, Cornelia [University Hospital Schleswig-Holstein/Campus Luebeck, Luebeck (Germany); Bulsara, Max [University of Notre Dame, Fremantle (Australia); University College, London (United Kingdom); Vaidya, Jayant S. [University College, London (United Kingdom)

    2017-01-15

    The use of targeted intraoperative radiotherapy (TARGIT-IORT) as a tumour bed boost during breast-conserving surgery (BCS) for breast cancer has been reported since 1998. We present its use in patients undergoing breast conservation following neoadjuvant therapy (NACT). In this retrospective study involving 116 patients after NACT we compared outcomes of 61 patients who received a tumour bed boost with IORT during lumpectomy versus 55 patients treated in the previous 13 months with external (EBRT) boost. All patients received whole breast radiotherapy. Local recurrence-free survival (LRFS), disease-free survival (DFS), distant disease-free survival (DDFS), breast cancer mortality (BCM), non-breast cancer mortality (NBCM) and overall mortality (OS) were compared. Median follow up was 49 months. The differences in LRFS, DFS and BCM were not statistically significant. The 5-year Kaplan-Meier estimate of OS was significantly better by 15% with IORT: IORT 2 events (96.7%, 95%CI 87.5-99.2), EBRT 9 events (81.7%, 95%CI 67.6-90.1), hazard ratio (HR) 0.19 (0.04-0.87), log rank p = 0.016, mainly due to a reduction of 10.1% in NBCM: IORT 100%, EBRT 89.9% (77.3-95.7), HR (not calculable), log rank p = 0.015. The DDFS was as follows: IORT 3 events (95.1%, 85.5-98.4), EBRT 12 events (69.0%, 49.1-82.4), HR 0.23 (0.06-0.80), log rank p = 0.012. IORT during lumpectomy after neoadjuvant chemotherapy as a tumour bed boost appears to give results that are not worse than external beam radiotherapy boost. These data give further support to the inclusion of such patients in the TARGIT-B (boost) randomised trial that is testing whether IORT boost is superior to EBRT boost. (orig.) [German] Die intraoperative Radiotherapie (TARGIT-IORT) als vorgezogener Boost im Rahmen der brusterhaltenden Therapie (BET) ist seit 1998 Gegenstand der wissenschaftlichen Diskussion. Wir praesentieren Daten zum Einsatz der IORT bei der BET nach neoadjuvanter Therapie (NACT). In diese retrospektive Analyse

  16. Heart transplant outcomes in recipients of Centers for Disease Control (CDC) high risk donors.

    Science.gov (United States)

    Tsiouris, Athanasios; Wilson, Lynn; Sekar, Rajesh B; Mangi, Abeel A; Yun, James J

    2016-12-01

    A lack of donor hearts remains a major limitation of heart transplantation. Hearts from Centers for Disease Control (CDC) high-risk donors can be utilized with specific recipient consent. However, outcomes of heart transplantation with CDC high-risk donors are not well known. We sought to define outcomes, including posttransplant hepatitis and human immunodeficiency virus (HIV) status, in recipients of CDC high-risk donor hearts at our institution. All heart transplant recipients from August 2010 to December 2014 (n = 74) were reviewed. Comparison of 1) CDC high-risk donor (HRD) versus 2) standard-risk donor (SRD) groups were performed using chi-squared tests for nominal data and Wilcoxon two-sample tests for continuous variables. Survival was estimated with Kaplan-Meier curves. Of 74 heart transplant recipients reviewed, 66 (89%) received a SRD heart and eight (11%) received a CDC HRD heart. We found no significant differences in recipient age, sex, waiting list 1A status, pretransplant left ventricular assist device (LVAD) support, cytomegalovirus (CMV) status, and graft ischemia times (p = NS) between the HRD and SRD groups. All of the eight HRD were seronegative at the time of transplant. Postoperatively, there was no significant difference in rejection rates at six and 12 months posttransplant. Importantly, no HRD recipients acquired hepatitis or HIV. Survival in HRD versus SRD recipients was not significantly different by Kaplan-Meier analysis (log rank p = 0.644) at five years posttransplant. Heart transplants that were seronegative at the time of transplant had similar posttransplant graft function, rejection rates, and five-year posttransplant survival versus recipients of SRD hearts. At our institution, no cases of hepatitis or HIV occurred in HRD recipients in early follow-up. © 2016 Wiley Periodicals, Inc.

  17. Short-term outcomes after incontinent conduit for gynecologic cancer: comparison of ileal, sigmoid, and transverse colon.

    Science.gov (United States)

    Tabbaa, Zaid M; Janco, Jo Marie T; Mariani, Andrea; Dowdy, Sean C; McGree, Michaela E; Weaver, Amy L; Cliby, William A

    2014-06-01

    The aim of this study is to estimate the overall rates of significant incontinent conduit-related complications and compare rates between conduit types. This was a retrospective review of 166 patients who underwent incontinent urinary diversion from April 1993 through April 2013. Patients were categorized by conduit type-ileal, sigmoid colon, and transverse colon. Significant conduit-related complications were assessed at 30 and 90days after surgery. Significant conduit-related complication was defined as any of the following: ureteral stricture, conduit leak, conduit obstruction, conduit ischemia, ureteral anastomotic leak, stent obstruction requiring intervention via interventional radiology procedure or reoperation, and renal failure. A total of 166 patients underwent formation of an incontinent urinary conduit, most commonly during exenteration for gynecologic malignancy. There were 129 ileal, 11 transverse colon, and 26 sigmoid conduits. The overall significant conduit-related complication rate within 30days was 15.1%. Complication rates for ileal, transverse and sigmoid conduits were 14.7%, 0%, and 23.1%, respectively (Fisher's exact test, p=0.24). By 90days, the Kaplan-Meier estimated rates of significant complications were 21.8% overall, and 22.3%, 0%, and 28.9%, respectively, by conduit type (log-rank test, p=0.19). The most common significant conduit-related complications were conduit or ureteral anastomotic leaks and conduit obstructions. By 1 and 2years following surgery, the Kaplan-Meier estimated overall rate of significant conduit-related complication increased to 26.5% and 30.1%, respectively. Our study suggests that there are multiple appropriate tissue sites for use in incontinent conduit formation, and surgical approach should be individualized. Most significant conduit-related complications occur within 90days after surgery. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Abnormal sleep duration associated with hastened depressive recurrence in bipolar disorder.

    Science.gov (United States)

    Gershon, Anda; Do, Dennis; Satyanarayana, Satyanand; Shah, Saloni; Yuen, Laura D; Hooshmand, Farnaz; Miller, Shefali; Wang, Po W; Ketter, Terence A

    2017-08-15

    Abnormal sleep duration (ASD, disorder (BD), and often persists beyond acute mood episodes. Few longitudinal studies have examined the ASD's impact upon BD illness course. The current study examined the longitudinal impact of ASD upon bipolar depressive recurrence/recovery. Outpatients referred to the Stanford BD Clinic during 2000-2011 were assessed with the Systematic Treatment Enhancement Program for BD (STEP-BD) Affective Disorders Evaluation at baseline, and with the Clinical Monitoring Form at monthly follow-ups for up to two years of naturalistic treatment. Prevalence and clinical correlates of ASD in 93 recovered (euthymic ≥8 weeks) and 153 depressed BD patients were assessed. Kaplan-Meier analyses (Log-Rank tests) assessed relationships between baseline ASD and longitudinal depressive severity, with Cox Proportional Hazard analyses assessing potential mediators. ASD was only half as common among recovered versus depressed BD outpatients, but was significantly associated with hastened depressive recurrence (Log-Rank p=0.007), mediated by lifetime anxiety disorder and attenuated by lifetime history of psychosis, and had only a non-significant tendency towards association with delayed depressive recovery (Log-Rank p=0.07). In both recovered and depressed BD outpatients, baseline ASD did not have significant association with any baseline BD illness characteristic. Self-reported sleep duration. Limited generalizability beyond our predominately white, female, educated, insured American BD specialty clinic sample. Baseline ASD among recovered BD patients may be a risk marker for hastened depressive recurrence, suggesting it could be an important therapeutic target between mood episodes. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Proton Beam Radiotherapy for Uveal Melanomas at Nice Teaching Hospital: 16 Years' Experience

    International Nuclear Information System (INIS)

    Caujolle, Jean-Pierre; Mammar, Hamid; Chamorey, Emmanuel Phar; Pinon, Fabien; Herault, Joel; Gastaud, Pierre

    2010-01-01

    Purpose: To present the results of uveal melanomas treated at Nice Teaching Hospital. Methods and Materials: This retrospective study included 886 consecutive patients referred to our clinic for the treatment of uveal melanomas by proton beam radiotherapy from June 1991 to December 2007. Survival rates were determined by using Kaplan-Meier estimates, and prognostic factors were evaluated using the log-rank test or Cox model. Results: The number (percent total) of subjects staged according to the TNM classification system (6th edition) of malignant tumors included 39 stage T1 (4.4%), 420 stage T2 (47.40%), 409 stage T3 (46.16%), and 18 stage T4 (2.03%) patients. The median follow-up was 63.7 months. The Kaplan-Meier overall survival rate at 5 years according to the sixth edition TNM classification was 92% for T1, 89% for T2, 67% for T3, and 62% for T4; and at 10 years, 86% for T1, 78% for T2, 43% for T3, and 41% for T4. Five factors were found to be associated with an increased death rate: advanced age, tumor thickness, largest tumor basal diameter, tumor volume, and tumor volume-to-eyeball volume ratio. The metastasis-free survival rates were 88.3 % at 5 years and 76.4 % at 10 years. The local control rates were 93.9% at 5 years and 92.1% at 10 years. The ocular conservation rates were 91.1% at 5 years and 87.3% at 10 years. Conclusions: We report the results of a large series of patients treated for uveal melanomas with a very long follow-up. Despite the large tumor volume treated, our results were similar to previously published findings relating to proton beam therapy.

  20. Adjuvant Ab Interno Tumor Treatment After Proton Beam Irradiation.

    Science.gov (United States)

    Seibel, Ira; Riechardt, Aline I; Heufelder, Jens; Cordini, Dino; Joussen, Antonia M

    2017-06-01

    This study was performed to show long-term outcomes concerning globe preservation in uveal melanoma patients after proton beam therapy with the main focus on outcomes according to different adjuvant ab interno surgical procedures. Retrospective cohort study. All patients treated with primary proton beam therapy for choroidal or ciliary body melanoma between June 1998 and June 2015 were included. A total of 2499 patients underwent primary proton beam therapy, with local tumor control and globe preservation rates of 95.9% and 94.8% after 5 years, respectively. A total of 110 (4.4%) patients required secondary enucleation. Unresponsive neovascular glaucoma was the leading cause of secondary enucleation in 78 of the 2499 patients (3.1%). The 5-year enucleation-free survival rate was 94.8% in the endoresection group, 94.3% in the endodrainage group, and 93.5% in the comparator group. The log-rank test showed P = .014 (comparator group vs endoresection group) and P = .06 (comparator group vs endodrainage-vitrectomy group). Patients treated with endoresection or endodrainage-vitrectomy developed less radiation retinopathy (30.5% and 37.4% after 5 years, P = .001 and P = .048 [Kaplan-Meier], respectively) and less neovascular glaucoma (11.6% and 21.3% after 5 years, P = .001 and P = .01 [Kaplan-Meier], respectively) compared with the comparator group (52.3% radiation retinopathy and 57.8% neovascular glaucoma after 5 years). This study suggests that in larger tumors the enucleation and neovascular glaucoma rates might be reduced by adjuvant surgical procedures. Although endoresection is the most promising adjuvant treatment option, the endodrainage-vitrectomy is recommended in patients who are ineligible for endoresection. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Adjuvant Medications That Improve Survival after Locoregional Therapy.

    Science.gov (United States)

    Boas, F Edward; Ziv, Etay; Yarmohammadi, Hooman; Brown, Karen T; Erinjeri, Joseph P; Sofocleous, Constantinos T; Harding, James J; Solomon, Stephen B

    2017-07-01

    To determine if outpatient medications taken at the time of liver tumor embolization or ablation affect survival. A retrospective review was done of 2,032 liver tumor embolization, radioembolization, and ablation procedures performed in 1,092 patients from June 2009 to April 2016. Pathology, hepatocellular carcinoma (HCC) stage (American Joint Committee on Cancer), neuroendocrine tumor (NET) grade, initial locoregional therapy, overall survival after initial locoregional therapy, Child-Pugh score, Eastern Cooperative Oncology Group performance status, Charlson Comorbidity Index, and outpatient medications taken at the time of locoregional therapy were analyzed for each patient. Kaplan-Meier survival curves were calculated for patients taking 29 medications or medication classes (including prescription and nonprescription medications) for reasons unrelated to their primary cancer diagnosis. Kaplan-Meier curves were compared using the log-rank test. For patients with HCC initially treated with embolization (n = 304 patients), the following medications were associated with improved survival when taken at the time of embolization: beta-blockers (P = .0007), aspirin (P = .0008) and other nonsteroidal antiinflammatory drugs (P = .009), proton pump inhibitors (P = .004), and antivirals for hepatitis B or C (P = .01). For colorectal liver metastases initially treated with ablation (n = 172 patients), beta-blockers were associated with improved survival when taken at the time of ablation (P = .02). Aspirin and beta-blockers are associated with significantly improved survival when taken at the time of embolization for HCC. Aspirin was not associated with survival differences after locoregional therapy for NET or colorectal liver metastases, suggesting an HCC-specific effect. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

  2. Longterm Hydroxychloroquine Therapy and Low-dose Aspirin May Have an Additive Effectiveness in the Primary Prevention of Cardiovascular Events in Patients with Systemic Lupus Erythematosus.

    Science.gov (United States)

    Fasano, Serena; Pierro, Luciana; Pantano, Ilenia; Iudici, Michele; Valentini, Gabriele

    2017-07-01

    Systemic lupus erythematosus (SLE) is associated with an increased risk of cardiovascular disease (CVD). Thromboprophylaxis with low-dose aspirin (ASA) and hydroxychloroquine (HCQ) seems promising in SLE. We investigated the effects of HCQ cumulative dosages (c-HCQ) and the possible synergistic efficacy of ASA and HCQ in preventing a first CV event (CVE) in patients with SLE. Patients consecutively admitted to our center who, at admission, satisfied the 1997 American College of Rheumatology and/or 2012 Systemic Lupus Collaborating Clinics classification criteria for SLE, and had not experienced any CVE, were enrolled. The occurrence of a thrombotic event, use of ASA, and c-HCQ were recorded. Kaplan-Meier analysis was performed to determine the c-HCQ associated with a lower incidence of CVE. Cox regression analysis served to identify factors associated with a first CVE. For the study, 189 patients with SLE were enrolled and monitored for 13 years (median). Ten CVE occurred during followup. At Kaplan-Meier analysis, the CVE-free rate was higher in ASA-treated patients administered a c-HCQ > 600 g (standard HCQ dose for at least 5 yrs) than in patients receiving ASA alone, or with a c-HCQ dose < 600 g (log-rank test chi-square = 4.01, p = 0.04). Multivariate analysis showed that antimalarials plus ASA protected against thrombosis (HR 0.041 and HR 0.047, respectively), while antiphospholipid antibodies (HR 17.965) and hypertension (HR 18.054) increased the risk of a first CVE. Our results suggest that prolonged use of HCQ plus ASA is thromboprotective in SLE and provides additional evidence for its continued use in patients with SLE.

  3. Prevalence and mortality of cancer among HIV-infected inpatients in Beijing, China.

    Science.gov (United States)

    Yang, Jun; Su, Shu; Zhao, Hongxin; Wang, Dennis; Wang, Jiali; Zhang, Fujie; Zhao, Yan

    2016-02-16

    Cancer is responsible for elevated HIV-related morbidity and mortality. Research on HIV-infected patients with concurrent cancer is rare in China. The purpose of our study was to investigate the prevalence and risk factors associated with cancer among HIV-infected inpatients in Beijing, and to investigate the mortality and risk factors among HIV-infected inpatients with cancer. Hospital records from a total of 1946 HIV-infected patients were collected from the Beijing Ditan Hospital. The data, from 2008 to 2013, were collected retrospectively. The cancer diagnoses included AIDS-defining cancers (ADC) and non-AIDS defining cancers (NADC). Logistic regression was used to identify risk factors predicting the concurrence of cancer with HIV. Mortality was examined using Kaplan-Meier estimates and Cox proportional hazards models. 7.7 % (149 cases) of all HIV-infected inpatients had concurrent cancer at their first hospital admission; of those, 33.6 % (50 cases) had ADCs, and 66.4 % (99 cases) had NADCs. The most prevalent NADCs were Hodgkin's lymphoma, gastrointestinal cancer, liver cancer, and lung cancer. Patients who did not accept antiretroviral therapy (ART) were more likely to suffer from cancer [AOR = 2.07 (1.42-3.01), p = 0.001]. Kaplan-Meier curves indicated that the survival probability of HIV-positive cancer patients was significantly lower than that of HIV-positive cancer-free patients (log-rank test, p cancer, the mortality was also higher among those who did not receive ART [AHR = 2.19 (1.84-2.61), p cancer concurrence among hospitalized HIV-infected patients was 7.7 %. Concurrent cancer also increased mortality among HIV-infected patients. ART was protective against concurrent cancer as well as mortality among HIV-infected cancer patients. These results highlight the importance of promoting cancer screening and early ART initiation among HIV-infected patients.

  4. Multiple factor analysis of metachronous upper urinary tract transitional cell carcinoma after radical cystectomy

    Directory of Open Access Journals (Sweden)

    P. Wang

    2007-07-01

    Full Text Available Transitional cell carcinoma (TCC of the urothelium is often multifocal and subsequent tumors may occur anywhere in the urinary tract after the treatment of a primary carcinoma. Patients initially presenting a bladder cancer are at significant risk of developing metachronous tumors in the upper urinary tract (UUT. We evaluated the prognostic factors of primary invasive bladder cancer that may predict a metachronous UUT TCC after radical cystectomy. The records of 476 patients who underwent radical cystectomy for primary invasive bladder TCC from 1989 to 2001 were reviewed retrospectively. The prognostic factors of UUT TCC were determined by multivariate analysis using the COX proportional hazards regression model. Kaplan-Meier analysis was also used to assess the variable incidence of UUT TCC according to different risk factors. Twenty-two patients (4.6%. developed metachronous UUT TCC. Multiplicity, prostatic urethral involvement by the bladder cancer and the associated carcinoma in situ (CIS were significant and independent factors affecting the occurrence of metachronous UUT TCC (P = 0.0425, 0.0082, and 0.0006, respectively. These results were supported, to some extent, by analysis of the UUT TCC disease-free rate by the Kaplan-Meier method, whereby patients with prostatic urethral involvement or with associated CIS demonstrated a significantly lower metachronous UUT TCC disease-free rate than patients without prostatic urethral involvement or without associated CIS (log-rank test, P = 0.0116 and 0.0075, respectively. Multiple tumors, prostatic urethral involvement and associated CIS were risk factors for metachronous UUT TCC, a conclusion that may be useful for designing follow-up strategies for primary invasive bladder cancer after radical cystectomy.

  5. Eigentumors for prediction of treatment failure in patients with early-stage breast cancer using dynamic contrast-enhanced MRI: a feasibility study

    Science.gov (United States)

    Chan, H. M.; van der Velden, B. H. M.; E Loo, C.; Gilhuijs, K. G. A.

    2017-08-01

    We present a radiomics model to discriminate between patients at low risk and those at high risk of treatment failure at long-term follow-up based on eigentumors: principal components computed from volumes encompassing tumors in washin and washout images of pre-treatment dynamic contrast-enhanced (DCE-) MR images. Eigentumors were computed from the images of 563 patients from the MARGINS study. Subsequently, a least absolute shrinkage selection operator (LASSO) selected candidates from the components that contained 90% of the variance of the data. The model for prediction of survival after treatment (median follow-up time 86 months) was based on logistic regression. Receiver operating characteristic (ROC) analysis was applied and area-under-the-curve (AUC) values were computed as measures of training and cross-validated performances. The discriminating potential of the model was confirmed using Kaplan-Meier survival curves and log-rank tests. From the 322 principal components that explained 90% of the variance of the data, the LASSO selected 28 components. The ROC curves of the model yielded AUC values of 0.88, 0.77 and 0.73, for the training, leave-one-out cross-validated and bootstrapped performances, respectively. The bootstrapped Kaplan-Meier survival curves confirmed significant separation for all tumors (P  <  0.0001). Survival analysis on immunohistochemical subgroups shows significant separation for the estrogen-receptor subtype tumors (P  <  0.0001) and the triple-negative subtype tumors (P  =  0.0039), but not for tumors of the HER2 subtype (P  =  0.41). The results of this retrospective study show the potential of early-stage pre-treatment eigentumors for use in prediction of treatment failure of breast cancer.

  6. Left ventricular dyssynchrony assessed by gated SPECT phase analysis is an independent predictor of death in patients with advanced coronary artery disease and reduced left ventricular function not undergoing cardiac resynchronization therapy

    Energy Technology Data Exchange (ETDEWEB)

    Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)

    2012-10-15

    Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)

  7. Endolymphatic sac surgery versus tenotomy of the stapedius and tensor tympani muscles in the management of patients with unilateral definite Meniere's disease.

    Science.gov (United States)

    Albu, Silviu; Babighian, Gregorio; Amadori, Maurizio; Trabalzini, Franco

    2015-12-01

    This study aims to compare the outcomes of patients with Meniere's disease submitted to either endolymphatic mastoid shunt (ES) or tenotomy of the stapedius and tensor tympani muscles (TSTM). This is a retrospective chart review of patients treated with ES or TSTM between 2000 and 2010 and followed up for at least 12 months. The main outcomes were represented by: (1) vertigo class, hearing stage and functional level according to the American Academy of Otolaryngology-Head and Neck Surgery criteria; (2) adjustment of dizziness handicap inventory (DHI) and (3) complete and substantial vertigo control using the Kaplan-Meier survival method. Sixty-three patients met the inclusion criteria: 34 underwent ES and 29 TSTM. The baseline demographic characteristics, the hearing stage, the functional level, the DHI and hearing levels were not different between the two groups. No significant difference in vertigo class was demonstrated: 66 % of TSTM patients attained class A compared to 44 % in the ES group (p = 0.14). Kaplan-Meier survival curves specific to class A showed significant differences, favoring TSTM (log-rank test, p = 0.022). TSTM patients demonstrated significantly improved functional level (p = 0.0004) and improved DHI scores (p = 0.001). Eight ES patients (25 %) demanded a second surgical attempt compared to none in the TSTM. Aural fullness was significantly improved in TSTM group (p = 0.01), while the difference in tinnitus improvement was non-significant. Hearing preservation was significantly better in TSTM group (p = 0.001). TSTM is a safe surgical procedure, with significant vertigo control rates, and important hearing preservation rates. More patients and longer follow-up are needed to support our preliminary findings.

  8. Graft survival rate of renal transplantation during a period of 10 years in Iran

    Directory of Open Access Journals (Sweden)

    Fatemeh Shahbazi

    2015-01-01

    Full Text Available Background: Kidney transplantation is a preferred treatment for many patients with end-stage renal disease (ESRD and is far more profitable than hemodialysis. Analyzing renal transplantation data can help to evaluate the effectiveness of transplantation interventions. The aim of this study was to determine the organ survival rate after kidney transplantation during a period of 10 years (March 2001-March 2011 among transplanted patients in Arak, Markazi Province, Iran. Materials and Methods: In this historical cohort study, all recipients of kidney transplantation from Arak, Markazi Province, Iran who had medical records in Valiasr Hospital and "charity for kidney patients" of Arak, Markazi Province, Iran during a period of 10 years from March 2001 to March 2011 were included. Data collected by using checklists were completed from patients′ hospital records. Kaplan-Meier method was used to determine the graft cumulative survival rate, log-rank test to compare survival curves in subgroups, and Cox regression model to define the hazard ratio and for ruling out the intervening factors. Statistical analysis was conducted by Statistical Package for the Social Sciences (SPSS 20 and Stata 11. Results: Mean duration of follow-up was 55.43 ± 42.02 months. By using the Kaplan-Meier method, the cumulative probability of graft survival at 1, 3, 5, 7, and 10 years was 99.1, 97.7, 94.3, 85.7, and 62.1%, respectively. The number of dialysis by controlling the effect of other variables had a significant association with the risk of graft failure [hazard ratios and 95% confidence interval (CI: 1.47 (1.02-2.13]. Conclusion: This study showed that the graft survival rate was satisfactory in this community and was similar to the results of single-center studies in the world. Dialysis time after transplantation was a significant predictor of survival in the recipients of kidney transplantation that should be considered.

  9. Dose escalation with 3D conformal treatment: five year outcomes, treatment optimization, and future directions

    International Nuclear Information System (INIS)

    Hanks, Gerald E.; Hanlon, Alexandra L. M.S.; Schultheiss, Timothy E.; Pinover, Wayne H.; Movsas, Benjamin; Epstein, Barry E.; Hunt, Margie

    1998-01-01

    Purpose: To report the 5-year outcomes of dose escalation with 3D conformal treatment (3DCRT) of prostate cancer. Methods and Materials: Two hundred thirty-two consecutive patients were treated with 3DCRT alone between 6/89 and 10/92 with ICRU reporting point dose that increased from 63 to 79 Gy. The median follow-up was 60 months, and any patient free of clinical or biochemical evidence of disease was termed bNED. Biochemical failure was defined as prostate-specific antigen (PSA) rising on two consecutive recordings and exceeding 1.5 ng/ml. Morbidity was reported by the Radiation Therapy Oncology Group (RTOG) scale, the Late Effects Normal Tissue (LENT) scale, and a Fox Chase modification of the latter (FC-LENT). All patients were treated with a four-field technique with a 1 cm clinical target volume (CTV) to planning target volume (PTV) margin to the prostate or prostate boost; the CTV and gross tumor volume (GTV) were the same. Actuarial rates of outcome were calculated by Kaplan-Meier and cumulative incidence methods and compared using the log rank and Gray's test statistic, respectively. Cox regression models were used to establish prognostic factors predictive of the various measures of outcome. Five-year Kaplan-Meier bNED rates were utilized by dose group to estimate logit response models for bNED and late morbidity. Results: PSA 10 ng/ml based on 5-year bNED results. No dose response was observed for patients with pretreatment PSA 10 ng/ml strongly suggests that clinical trials employing radiation should investigate the use of 3DCRT and prostate doses of 76-80 Gy

  10. The Risk of Herpes Zoster in Patients with Non-small Cell Lung Cancer according to Chemotherapy Regimens: Tyrosine Kinase Inhibitors versus Cytotoxic Chemotherapy.

    Science.gov (United States)

    Choi, Ji Young; Kim, Miso; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Heo, Dae Seog; Jo, Seong Jin

    2018-04-05

    Despite the successful use of tyrosine kinase inhibitors (TKIs) in cancer patients, their effect on herpes zoster development has not been studied. The aim of this study was to evaluate and compare the effects of epidermal growth factor receptor (EGFR) TKI and cytotoxic chemotherapy on the risk of herpes zoster development in non-small cell lung cancer (NSCLC) patients. We conducted a medical review of all eligible NSCLC patients in Seoul National University hospital between 2002 and 2015. We classified patients based on whether they previously underwent EGFR TKI therapy into either the TKI group or the cytotoxic group. We compared the incidence rates of herpes zoster during TKI therapy and cytotoxic chemotherapy. Additionally, the longitudinal risk of herpes zoster from TKIs was analyzed using the incidence rate ratio (IRR) of the TKI group to the cytotoxic group and the log-rank test of the Kaplan-Meier method. Of the 2,981 NSCLC patients, 54 patients (1.54%) developed herpes zoster. In the TKI group (2,002 patients), the IRR of herpes zoster during TKI therapy compared to that during cytotoxic chemotherapy was 1.05 (95% confidence interval [CI], 0.53 to 2.09). The IRR of the TKI group compared to the cytotoxic group was 1.33 (95% CI, 0.64 to 2.76). The Kaplan-Meier cumulative risk of both groups was not significantly different. Our results show that the incidence rate of herpes zoster in the TKI group was not statistically different from the incidence in the cytotoxic group during and after chemotherapy in NSCLC patients.

  11. Red cell distribution width and its association with mortality in neonatal sepsis.

    Science.gov (United States)

    Martin, Snehal L; Desai, Saumil; Nanavati, Ruchi; Colah, Roshan B; Ghosh, Kanjaksha; Mukherjee, Malay B

    2018-01-08

    Neonatal sepsis is a major cause of mortality in the developing countries. However, with current severity scores and laboratory parameters, predicting outcomes of neonatal sepsis is a serious challenge. Red cell distribution width (RDW) is a readily available pragmatic means to predict outcomes of various comorbidities in adults and children, without causing any additional blood loss. However, its utility in neonates remains unexplored. Hence, the objective of the present study was to evaluate the association of RDW with neonatal sepsis and its role as a predictive marker for mortality. This Prospective observational study was carried out in a Level IIIB NICU for a period of 3 years. It involved comparison of RDW values of septic neonates with those of controls (matched for gestational age and birth weight) with an equal allocation ratio. A total of 251 septic neonates along with 251 controls >28 weeks of gestational age were enrolled. The RDW was derived from complete blood count done within first 6 hours of life. After arranging the RDW (median; interquartile range (IQR)), the values were categorized as those above the 50th percentile i.e. ≥20% and those below the 50th percentile i.e. rates of the above two groups were assessed using the Kaplan-Meier curve and the log rank test. RDW levels were significantly higher among the neonatal sepsis cases (19.90%) as compared to the controls (18.90%) with a p value of < .001. RDW was significantly higher amongst the nonsurvivors than survivors (p < .003). Kaplan-Meier curve showed that septic neonates having RDW values ≥20% had significantly increased mortality (p < .02) with a hazard ratio of 0.5. High RDW is associated with neonatal sepsis and is an independent outcome predictor for mortality associated with neonatal sepsis.

  12. Association of oestrogen receptor beta 2 (ERβ2/ERβcx) with outcome of adjuvant endocrine treatment for primary breast cancer – a retrospective study

    International Nuclear Information System (INIS)

    Vinayagam, Raman; Sibson, D Ross; Holcombe, Christopher; Aachi, Vijay; Davies, Michael PA

    2007-01-01

    Oestrogen receptor beta (ERβ) modulates ERα activity; wild type ERβ (ERβ1) and its splice variants may therefore impact on hormone responsiveness of breast cancer. ERβ2/ERβcx acts as a dominant negative inhibitor of ERα and expression of ERβ2 mRNA has been proposed as a candidate marker for outcome in primary breast cancer following adjuvant endocrine therapy. We therefore now assess ERβ2 protein by immunostaining and mRNA by quantitative RT-PCR in relation to treatment outcome. ERβ2-specific immunostaining was quantified in 141 primary breast cancer cases receiving adjuvant endocrine therapy, but no neoadjuvant therapy or adjuvant chemotherapy. The expression of mRNA for ERβ2/ERβcx was measured in 100 cases by quantitative RT-PCR. Statistical analysis of breast cancer relapse and breast cancer survival was performed using Kaplan Meier log-rank tests and Cox's univariate and multivariate survival analysis. High ERβ2 immunostaining (Allred score >5) and high ERβ2 mRNA levels were independently associated with significantly better outcome across the whole cohort, including both ERα positive and negative cases (Log-Rank P < 0.05). However, only ERβ2 mRNA levels were significantly associated with better outcome in the ERα + subgroup (Log-Rank P = 0.01) and this was independent of grade, size, nodal status and progesterone receptor status (Cox hazard ratio 0.31 P = 0.02 for relapse; 0.17 P = 0.01 for survival). High ERβ2 mRNA was also associated with better outcome in node negative cases (Log Rank P < 0.001). ERβ2 protein levels were greater in ERα positive cases (T-test P = 0.00001), possibly explaining the association with better outcome. Levels of ERβ2 protein did not correlate ERβ2 mRNA levels, but 34% of cases had both high mRNA and protein and had a significantly better outcome (Log-Rank relapse P < 0.005). High ERβ2 protein levels were associated with ERα expression. Although most cases with high ERβ2 mRNA had strong ERβ2

  13. Relationship between LAPTM4B Gene Polymorphism and Prognosis of Patients following Tumor Resection for Colorectal and Esophageal Cancers

    Science.gov (United States)

    Xing, Xiaofang; Du, Hong; Zhou, Chunlian; Zhang, Qingyun; Hao, Chunyi; Wen, Xianzi; Ji, Jiafu

    2016-01-01

    Background Lysosome-associated transmembrane-4 beta (LAPTM4B) is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients. Method Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort), 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher’s exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model. Results LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts). LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045). Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS) in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively), but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively). Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR) = 0.432; 95% confidence interval (CI) = 0.243–0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638–1.804 and 0.998, HR = 1.000, 95% CI = 0.663–1.530, respectively). Conclusion These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might

  14. Relationship between LAPTM4B Gene Polymorphism and Prognosis of Patients following Tumor Resection for Colorectal and Esophageal Cancers.

    Directory of Open Access Journals (Sweden)

    Xiaojing Cheng

    Full Text Available Lysosome-associated transmembrane-4 beta (LAPTM4B is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients.Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort, 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher's exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model.LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts. LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045. Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively, but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively. Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR = 0.432; 95% confidence interval (CI = 0.243-0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638-1.804 and 0.998, HR = 1.000, 95% CI = 0.663-1.530, respectively.These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might be a useful prognostic indicator for

  15. Association between poor clinical prognosis and sleep duration among breast cancer patients.

    Science.gov (United States)

    Mansano-Schlosser, Thalyta Cristina; Ceolim, Maria Filomena

    2017-06-05

    to investigate the association between clinical progression and the quality and duration of sleep in women with breast cancer. longitudinal study, with 114 participants, conducted in a hospital in Brazil. The instruments used were: questionnaire for sociodemographic and clinical characterization, Pittsburgh Sleep Quality Index; Beck Depression Inventory and Herth Hope Scale. Data were analyzed through descriptive statistics and survival analyses (outcome: poor clinical progression), using the Kaplan-Meier curve, Log-rank test and Cox proportional model. a higher probability of poor clinical progression was verified in women with sleep durations of less than six hours or nine hours and over (p=.0173). the results suggest the importance of further studies that seek to verify whether the quantitative management of sleep disorders would have an impact on the progression of breast cancer. Women should be encouraged to report sleep problems to nurses. mensurar a associação entre evolução clínica e qualidade e duração do sono em mulheres com câncer de mama. estudo longitudinal, com 114 participantes, realizado em um hospital do Brasil. Os instrumentos utilizados foram: questionário para caracterização sociodemográfica e clínica, Índice de Qualidade do Sono de Pittsburgh; Inventário de Depressão de Beck e Escala de Esperança de Herth. Os dados foram analisados via análises descritivas e de sobrevivência (resultado: evolução clínica desfavorável), utilizando-se a curva de Kaplan-Meier, o teste log-rank e o modelo proporcional de Cox. verificou-se maior probabilidade de evolução clínica desfavorável em mulheres com duração de sono inferior a seis ou mais de nove horas (p = 0,0173). os resultados sugerem a importância de mais estudos que buscam verificar se a gestão quantitativa dos distúrbios do sono teria um impacto sobre a evolução do câncer de mama. As mulheres devem ser encorajadas a relatar isso espontaneamente aos enfermeiros. medir

  16. Efficacy of qualitative response assessment interpretation criteria at 18F-FDG PET-CT for predicting outcome in locally advanced cervical carcinoma treated with chemoradiotherapy

    International Nuclear Information System (INIS)

    Scarsbrook, Andrew; Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag; Swift, Sarah; Cooper, Rachel

    2017-01-01

    To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced

  17. Efficacy of qualitative response assessment interpretation criteria at 18F-FDG PET-CT for predicting outcome in locally advanced cervical carcinoma treated with chemoradiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Scarsbrook, Andrew [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); University of Leeds, Leeds Institute of Cancer and Pathology, Leeds (United Kingdom); Vaidyanathan, Sriram; Chowdhury, Fahmid; Patel, Chirag [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Leeds Teaching Hospitals NHS Trust, Department of Nuclear Medicine, Level 1, Bexley Wing, St James' s University Hospital, Leeds (United Kingdom); Swift, Sarah [Leeds Teaching Hospitals NHS Trust, Department of Radiology, Leeds (United Kingdom); Cooper, Rachel [Leeds Teaching Hospitals NHS Trust, Department of Clinical Oncology, Leeds (United Kingdom)

    2017-04-15

    To evaluate the utility of a standardized qualitative scoring system for treatment response assessment at 18F-FDG PET-CT in patients undergoing chemoradiotherapy for locally advanced cervical carcinoma and correlate this with subsequent patient outcome. Ninety-six consecutive patients with locally advanced cervical carcinoma treated with radical chemoradiotherapy (CRT) in a single centre between 2011 and 2014 underwent 18F-FDG PET-CT approximately 3 months post-treatment. Tumour metabolic response was assessed qualitatively using a 5-point scale ranging from background level activity only through to progressive metabolic disease. Clinical and radiological (MRI pelvis) follow-up was performed in all patients. Progression-free (PFS) and overall survival (OS) was calculated using the Kaplan-Meier method (Mantel-Cox log-rank) and correlated with qualitative score using Chi-squared test. Forty patients (41.7 %) demonstrated complete metabolic response (CMR) on post-treatment PET-CT (Score 1/2) with 38 patients (95.0 %) remaining disease free after a minimum follow-up period of 18 months. Twenty-four patients (25.0 %) had indeterminate residual uptake (ID, Score 3) at primary or nodal sites after treatment, of these eight patients (33.3 %) relapsed on follow-up, including all patients with residual nodal uptake (n = 4). 11 of 17 patients (64.7 %) with significant residual uptake (partial metabolic response, PMR, Score 4) subsequently relapsed. In 15 patients (15.6 %) PET-CT demonstrated progressive disease (PD, Score 5) following treatment. Kaplan-Meier analysis showed a highly statistically significant difference in PFS and OS between patients with CMR, indeterminate uptake, PMR and PD (Log-rank, P < 0.0001). Chi-squared test demonstrated a highly statistically significant association between increasing qualitative score and risk of recurrence or death (P < 0.001). Use of a 5-point qualitative scoring system to assess metabolic response to CRT in locally advanced

  18. A population-based study on the association between educational length, prostate-specific antigen testing and use of prostate biopsies.

    Science.gov (United States)

    Nordström, Tobias; Bratt, Ola; Örtegren, Joakim; Aly, Markus; Adolfsson, Jan; Grönberg, Henrik

    2016-01-01

    The aim of this study was to determine whether educational length affects prostate-specific antigen (PSA) testing and the time to prostate biopsy for men with raised PSA values. Using register data on all men in Stockholm County in 2013 (n = 1,052,841), the limited-duration point prevalence of PSA testing and time between test and prostate biopsy or repeat testing were analysed. Patterns of follow-up were assessed using Kaplan-Meier product limit estimators and Cox proportional hazard models. Educational length was categorized as short (≤ 9 years), intermediate (10-12 years) or long (≥ 13 years). PSA testing increased with educational length in all age groups. Among men aged 50-69 years, 61% with long and 54% with short education had had a PSA test within the preceding 10 years (p prostate biopsy within 12 months. After adjusting for PSA level and age, educational length was still associated with the chance of having a prostate biopsy in men with PSA 4-10 ng/ml (hazard ratio 1.22, 95% CI 1.12-1.31), but not in men with higher PSA values. PSA testing increased with educational length. Men with long education were more likely to have a prostate biopsy after an increased PSA value below 10 ng/ml than men with short education. These differences may contribute to the worse prostate cancer outcomes observed among men with lower socioeconomic status.

  19. Comparison of Parkinson risk in Ashkenazi Jewish Gaucher patients and GBA heterozygotes

    Science.gov (United States)

    Alcalay, Roy N.; Dinur, Tama; Quinn, Timothy; Sakanaka, Karina; Levy, Oren; Waters, Cheryl; Fahn, Stanley; Dorovski, Tsvyatko; Chung, Wendy K; Pauciulo, Michael; Nichols, William; Rana, Huma Q.; Balwani, Manisha; Bier, Louise; Elstein, Deborah; Zimran, Ari

    2014-01-01

    Importance Information on age-specific risk for Parkinson disease (PD) in Gaucher disease (GD) patients and glucocerebrosidase (GBA) heterozygotes is important for understanding the pathophysiology of the genetic association and for counseling these populations. Objective To estimate the age-specific risk of PD in Ashkenazi Jewish (AJ) patients with Type-1 GD and in GBA heterozygotes. Setting Two tertiary Gaucher centers and a Parkinson’s tertiary center. Participants GD patients at Shaare Zedek, Jerusalem, Israel (n=332) and Mount Sinai School of Medicine, NY (n=95), and GBA non-carrier non-PD spouse controls at Columbia University, NY (n=77). All were AJ and most GD patients (98.1%) carried at least one N370S mutation. Main outcome measure Main outcome measure was a diagnosis of PD. Diagnosis was established in GD patients on examination. We used a validated family history interview that identifies PD with a sensitivity of 95.5% and specificity of 96.2% to identify PD in family members. Kaplan-Meier survival curves were used to estimate age-specific PD risk among GD patients (n=427), among their parents, who are obligate GBA mutation carriers (heterozygotes, n=694) and among non-carriers (parents of non-PD non-GD controls, n=154). The age-specific risk was compared among groups using the log-rank test. Results Among those who developed PD, patients with GD had a younger age-at-onset than GBA heterozygotes (54.2, versus 65.2, p=0.003). Estimated age-specific risk for PD at ages 60 and 80 was 4.7% and 9.1% among GD patients, 1.5% and 7.7% among heterozygotes, and 0.7% and 2.1% among non-carriers. PD risk was higher in GD patients than non-carriers (p=0.008, log-rank test) and in heterozygotes than non-carriers (p=0.026, log-rank test) but did not reach significance between GD patients and GBA heterozygotes (p=0.074, log-rank test). Conclusion GD patients and GBA heterozygotes have an increased age-specific risk for PD compared to controls, with a similar

  20. One year Survival Rate of Ketac Molar versus Vitro Molar for Occlusoproximal ART Restorations: a RCT

    Directory of Open Access Journals (Sweden)

    PACHECO Anna Luisa de Brito

    2017-11-01

    Full Text Available Abstract Good survival rates for single-surface Atraumatic Restorative Treatment (ART restorations have been reported, while multi-surface ART restorations have not shown similar results. The aim of this study was to evaluate the survival rate of occluso-proximal ART restorations using two different filling materials: Ketac Molar EasyMix (3M ESPE and Vitro Molar (DFL. A total of 117 primary molars with occluso-proximal caries lesions were selected in 4 to 8 years old children in Barueri city, Brazil. Only one tooth was selected per child. The subjetcs were randomly allocated in two groups according to the filling material. All treatments were performed following the ART premises and all restorations were evaluated after 2, 6 and 12 months. Restoration survival was evaluated using Kaplan-Meier survival analysis and Log-rank test, while Cox regression analysis was used for testing association with clinical factors (α = 5%. There was no difference in survival rate between the materials tested, (HR = 1.60, CI = 0.98–2.62, p = 0.058. The overall survival rate of restorations was 42.74% and the survival rate per group was Ketac Molar = 50,8% and Vitro Molar G2 = 34.5%. Cox regression test showed no association between the analyzed clinical variables and the success of the restorations. After 12 months evaluation, no difference in the survival rate of ART occluso-proximal restorations was found between tested materials.

  1. Parental consanguineous marriages and clinical response to chemotherapy in locally advanced breast cancer patients.

    Science.gov (United States)

    Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam

    2011-03-28

    The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  2. Secreted protein acidic and rich in cysteine (SPARC is associated with nasopharyngeal carcinoma metastasis and poor prognosis

    Directory of Open Access Journals (Sweden)

    Wang Hai-Yun

    2012-02-01

    Full Text Available Abstract Background The aim of the present study was to analyse the expression of Secreted protein acidic and rich in cysteine (SPARC in nasopharyngeal carcinoma (NPC specimens, and to evaluate its correlation with clinicopathologic features, including survival of patients with NPC Methods NPC tissue microarrays (TMAs were constructed from Sun Yat-sen University Cancer Center (SYSUCC, another three centers on mainland China, Singapore and Hong Kong. Using quantitative RT-PCR and Western-blotting techniques, we detected mRNA and protein expression of SPARC in NPC cell lines and immortalized nasopharyngeal epithelial cells (NPECs induced by Bmi-1 (NPEC2 Bmi-1. The difference of SPARC expression in the cell lines was tested using a t-test method. The relationship between the SPARC expression and clinicopathological data was assessed by chi-square. Survival analysis was estimated using the Kaplan-Meier approach with log-rank test. Univariate and multivariate analyses of clinical variables were performed using Cox proportional hazards regression models. Results The expression levels of SPARC mRNA and protein were markedly higher in NPC cell lines than in NPEC2 Bmi-1. Especially, the expression levels of SPARC mRNA and protein were much lower in the 6-10B than in the 5-8 F (P = 0.002, P = 0.001. SPARC immunostaining revealed cytoplasmic localization in NPC cells and no staining in the stroma and epithelium. In addition, high level of SPARC positively correlated with the status of distant metastasis (P = 0.001 and WHO histological classification (P = 0.023. NPC patients with high SPARC expression also had a significantly poorer prognosis than patients with low SPARC expression (log-rank test, P P P Conclusions SPARC expression is common in NPC patients. Our data shows that elevated SPARC expression is a potential unfavorable prognostic factor for patients with NPC.

  3. Treatment of malignant biliary occlusion by means of transhepatic percutaneous biliary drainage with insertion of metal stents - results of an 8-year follow-up and analysis of the prognostic parameters; Behandlung der malignen Gallenwegsstenose mittels perkutaner transhepatischer Metallendoprothesenimplantation: 8 Jahres-Ergebnisse und Analyse prognostischer Faktoren

    Energy Technology Data Exchange (ETDEWEB)

    Alfke, H.; Alfke, B.; Froelich, J.J.; Klose, K.J.; Wagner, H.J. [Klinik fuer Strahlendiagnostik Philipps Univ. Marburg (Germany)

    2003-08-01

    Purpose: To analyze outcome and predictive factors for patient survival and patency rates of unresectable malignant biliary obstruction treated with percutaneous transhepatic insertion of metal stents. Materials and Methods: This is a retroselective analysis of 130 patients treated in one interventional radiological center with data collected from patient records and by telephone interviews. The procedure-related data had been prospectively documented in a computer data base. The Kaplan-Meier analysis was performed for univariate and multivariate comparison of survival and patency rates with the log-rank test used for different tumor types. Predictive factors for survival and 30-day mortality were analyzed by a stepwise logistic regression. Results: Underlying causes of malignant biliary obstructions were cholangiocarcinoma in 50, pancreatic carcinoma in 29, liver metastases in 27, gallbladder carcinoma in 20, and other tumors in 4 patients. The technical success rate was 99%, the complication rate 27% and the 30-day mortality 11%. Primary patency rates (406 days with a median of 207 days) did not differ significantly for different tumor types. The survival rates were significantly (p = 0.03 by log-rank test) better for patients with cholangiocarcinoma than for patients with pancreatic carcinoma and liver metastases. Multiple regression analysis revealed no predictive factor for patient survival and 30-day mortality. Conclusion: Percutaneous transhepatic insertion of metal biliary endoprostheses offers a good initial and long-term relief of jaundice caused by malignant biliary obstruction. Although survival rates for patients with cholangiocarcinoma are better than for other causes of malignant biliary obstruction, a clear predictive factor is lacking for patients undergoing palliative biliary stent insertion. (orig.) [German] Ziel: Ergebnisse der perkutanen transhepatischen Metallendoprothesenimplantation bei malignen Gallenwegsverschluessen zu evaluieren und

  4. Oxygen uptake efficiency slope and peak oxygen consumption predict prognosis in children with tetralogy of Fallot.

    Science.gov (United States)

    Tsai, Yun-Jeng; Li, Min-Hui; Tsai, Wan-Jung; Tuan, Sheng-Hui; Liao, Tin-Yun; Lin, Ko-Long

    2016-07-01

    Oxygen uptake efficiency slope (OUES) and peak oxygen consumption (VO2peak) are exercise parameters that can predict cardiac morbidity in patients with numerous heart diseases. But the predictive value in patients with tetralogy of Fallot is still undetermined, especially in children. We evaluated the prognostic value of OUES and VO2peak in children with total repair of tetralogy of Fallot. Retrospective cohort study. Forty tetralogy of Fallot patients younger than 12 years old were recruited. They underwent a cardiopulmonary exercise test during the follow-up period after total repair surgery. The results of the cardiopulmonary exercise test were used to predict the cardiac related hospitalization in the following two years after the test. OUES normalized by body surface area (OUES/BSA) and the percentage of predicted VO2peak appeared to be predictive for two-year cardiac related hospitalization. Receiver operating characteristic curve analysis demonstrated that the best threshold value for OUES/BSA was 1.029 (area under the curve = 0.70, p = 0.03), and for VO2peak was 74% of age prediction (area under the curve = 0.72, p = 0.02). The aforementioned findings were confirmed by Kaplan-Meier plots and log-rank test. OUES/BSA and VO2peak are useful predictors of cardiac-related hospitalization in children with total repair of tetralogy of Fallot. © The European Society of Cardiology 2015.

  5. Assessment by survival analysis of the radioprotective properties of propolis and its polyphenolic compounds

    International Nuclear Information System (INIS)

    Orsolic, N.; Benkovic, V.; Horvat-Knezevic, A.; Basic, I.; Kopjar, N.; Kosalec, I.; Bakmaz, M.; Mihaljevic, Z.; Bendelja, K.

    2007-01-01

    The radioprotective effects of propolis and polyphenolic compounds from propolis on the radiation-induced mortality of mice exposed to 9 Gy of γ-irradiation were studied. Intraperitoneal (i.p.) treatment of mice at doses of 100 mgkg -1 body weight of propolis (water or ethanolic extract; water-soluble derivative of propolis (WSDP) or ethanolic extract of propolis (EEP)) or its polyphenolic compounds (quercetin, naringin caffeic acid, chrysin) consecutively for 3 d before irradiation, delayed the onset of mortality and reduced the symptoms of radiation sickness. All test compounds provided protection against hematopoietic death (death within 30 d after irradiation). The greatest protection was achieved with quercetin; the number of survivors at the termination of the experiment was 63%. According to statistical analyses by the Kaplan-Meier method and the log-rank test, a significant difference between test components and control was found (p<0.001). Treatment with test components after lethal irradiation was ineffective. These results suggest that propolis and its polyphenolic compounds given to mice before irradiation protect mice from the lethal effects of whole-body irradiation. (author)

  6. Comparison of DNA aneuploidy, chromosome 1 abnormalities, MYCN amplification and CD44 expression as prognostic factors in neuroblastoma.

    Science.gov (United States)

    Christiansen, H; Sahin, K; Berthold, F; Hero, B; Terpe, H J; Lampert, F

    1995-01-01

    A comparison of the prognostic impact of five molecular variables in a large series was made, including tests of their nonrandom association and multivariate analysis. Molecular data were available for 377 patients and MYCN amplification, cytogenetic chromosome 1p deletion, loss of chromosome 1p heterozygosity, DNA ploidy and CD44 expression were investigated. Their interdependence and influence on event-free survival was tested uni- and multivariately using Pearson's chi 2-test, Kaplan-Meier estimates, log rank tests and the Cox's regression model. MYCN amplification was present in 18% (58/322) of cases and predicted poorer prognosis in localised (P < 0.001), metastatic (P = 0.002) and even 4S (P = 0.040) disease. CD44 expression was found in 86% (127/148) of cases, and was a marker for favourable outcome in patients with neuroblastoma stages 1-3 (P = 0.003) and 4 (P = 0.017). Chromosome 1p deletion was cytogenetically detected in 51% (28/55), and indicated reduced event-free survival in localised neuroblastoma (P = 0.020). DNA ploidy and loss of heterozygosity on chromosome 1p were of less prognostic value. Most factors of prognostic significance were associated with each other. By multivariate analysis, MYCN was selected as the only relevant factor. Risk estimation of high discriminating power is, therefore, possible for patients with localised and metastatic neuroblastoma using stage and MYCN.

  7. Systemic treatment with CAR-engineered T cells against PSCA delays subcutaneous tumor growth and prolongs survival of mice

    International Nuclear Information System (INIS)

    Hillerdal, Victoria; Ramachandran, Mohanraj; Leja, Justyna; Essand, Magnus

    2014-01-01

    Adoptive transfer of T cells genetically engineered with a chimeric antigen receptor (CAR) has successfully been used to treat both chronic and acute lymphocytic leukemia as well as other hematological cancers. Experimental therapy with CAR-engineered T cells has also shown promising results on solid tumors. The prostate stem cell antigen (PSCA) is a protein expressed on the surface of prostate epithelial cells as well as in primary and metastatic prostate cancer cells and therefore a promising target for immunotherapy of prostate cancer. We developed a third-generation CAR against PSCA including the CD28, OX-40 and CD3 ζ signaling domains. T cells were transduced with a lentivirus encoding the PSCA-CAR and evaluated for cytokine production (paired Student’s t-test), proliferation (paired Student’s t-test), CD107a expression (paired Student’s t-test) and target cell killing in vitro and tumor growth and survival in vivo (Log-rank test comparing Kaplan-Meier survival curves). PSCA-CAR T cells exhibit specific interferon (IFN)-γ and interleukin (IL)-2 secretion and specific proliferation in response to PSCA-expressing target cells. Furthermore, the PSCA-CAR-engineered T cells efficiently kill PSCA-expressing tumor cells in vitro and systemic treatment with PSCA-CAR-engineered T cells significantly delays subcutaneous tumor growth and prolongs survival of mice. Our data confirms that PSCA-CAR T cells may be developed for treatment of prostate cancer

  8. Prospective Randomized Trial of Prone Accelerated Intensity Modulated Breast Radiation Therapy With a Daily Versus Weekly Boost to the Tumor Bed

    International Nuclear Information System (INIS)

    Cooper, Benjamin T.; Formenti-Ujlaki, George F.; Li, Xiaochun; Shin, Samuel M.; Fenton-Kerimian, Maria; Guth, Amber; Roses, Daniel F.; Hitchen, Christine J.; Rosenstein, Barry S.; Dewyngaert, J. Keith; Goldberg, Judith D.; Formenti, Silvia C.

    2016-01-01

    Purpose: To report the results of a prospective randomized trial comparing a daily versus weekly boost to the tumor cavity during the course of accelerated radiation to the breast with patients in the prone position. Methods and Materials: From 2009 to 2012, 400 patients with stage 0 to II breast cancer who had undergone segmental mastectomy participated in an institutional review board–approved trial testing prone breast radiation therapy to 40.5 Gy in 15 fractions 5 d/wk to the whole breast, after randomization to a concomitant daily boost to the tumor bed of 0.5 Gy, or a weekly boost of 2 Gy, on Friday. The present noninferiority trial tested the primary hypothesis that a weekly boost produced no more acute toxicity than did a daily boost. The recurrence-free survival was estimated for both treatment arms using the Kaplan-Meier method; the relative risk of recurrence or death was estimated, and the 2 arms were compared using the log-rank test. Results: At a median follow-up period of 45 months, no deaths related to breast cancer had occurred. The weekly boost regimen produced no more grade ≥2 acute toxicity than did the daily boost regimen (8.1% vs 10.4%; noninferiority Z = −2.52; P=.006). No statistically significant difference was found in the cumulative incidence of long-term fibrosis or telangiectasia of grade ≥2 between the 2 arms (log-rank P=.923). Two local and two distant recurrences developed in the daily treatment arm and three local and one distant developed in the weekly arm. The 4-year recurrence-free survival rate was not different between the 2 treatment arms (98% for both arms). Conclusions: A tumor bed boost delivered either daily or weekly was tolerated similarly during accelerated prone breast radiation therapy, with excellent control of disease and comparable cosmetic results.

  9. Prospective Randomized Trial of Prone Accelerated Intensity Modulated Breast Radiation Therapy With a Daily Versus Weekly Boost to the Tumor Bed

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, Benjamin T.; Formenti-Ujlaki, George F. [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Li, Xiaochun [Division of Biostatistics, Departments of Population Health and Environmental Medicine, New York University School of Medicine, New York, New York (United States); Shin, Samuel M.; Fenton-Kerimian, Maria [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Guth, Amber; Roses, Daniel F. [Department of Surgery, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Hitchen, Christine J. [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Rosenstein, Barry S. [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Department of Radiation Oncology, Icahn School of Medicine at Mount Sinai, New York, New York (United States); Dewyngaert, J. Keith [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States); Goldberg, Judith D. [Division of Biostatistics, Departments of Population Health and Environmental Medicine, New York University School of Medicine, New York, New York (United States); Formenti, Silvia C., E-mail: formenti@med.cornell.edu [Department of Radiation Oncology, New York University School of Medicine and Langone Medical Center, New York, New York (United States)

    2016-06-01

    Purpose: To report the results of a prospective randomized trial comparing a daily versus weekly boost to the tumor cavity during the course of accelerated radiation to the breast with patients in the prone position. Methods and Materials: From 2009 to 2012, 400 patients with stage 0 to II breast cancer who had undergone segmental mastectomy participated in an institutional review board–approved trial testing prone breast radiation therapy to 40.5 Gy in 15 fractions 5 d/wk to the whole breast, after randomization to a concomitant daily boost to the tumor bed of 0.5 Gy, or a weekly boost of 2 Gy, on Friday. The present noninferiority trial tested the primary hypothesis that a weekly boost produced no more acute toxicity than did a daily boost. The recurrence-free survival was estimated for both treatment arms using the Kaplan-Meier method; the relative risk of recurrence or death was estimated, and the 2 arms were compared using the log-rank test. Results: At a median follow-up period of 45 months, no deaths related to breast cancer had occurred. The weekly boost regimen produced no more grade ≥2 acute toxicity than did the daily boost regimen (8.1% vs 10.4%; noninferiority Z = −2.52; P=.006). No statistically significant difference was found in the cumulative incidence of long-term fibrosis or telangiectasia of grade ≥2 between the 2 arms (log-rank P=.923). Two local and two distant recurrences developed in the daily treatment arm and three local and one distant developed in the weekly arm. The 4-year recurrence-free survival rate was not different between the 2 treatment arms (98% for both arms). Conclusions: A tumor bed boost delivered either daily or weekly was tolerated similarly during accelerated prone breast radiation therapy, with excellent control of disease and comparable cosmetic results.

  10. Application of the BAR score as a predictor of short- and long-term survival in liver transplantation patients.

    Science.gov (United States)

    de Campos Junior, Ivan Dias; Stucchi, Raquel Silveira Bello; Udo, Elisabete Yoko; Boin, Ilka de Fátima Santana Ferreira

    2015-01-01

    The balance of risk (BAR) is a prediction system after liver transplantation. To assess the BAR system, a retrospective observational study was performed in 402 patients who had transplant surgery between 1997 and 2012. The BAR score was computed for each patient. Receiver operating characteristic curve analysis with the Hosmer-Lemeshow test was used to calculate sensitivity, specificity, and model calibration. The cutoff value with the best Youden index was selected. Statistical analysis employed the Kaplan-Meier method (log-rank test) for survival, the Mann-Whitney test for group comparison, and multiple logistic regression analysis. 3-month survival was 46% for BAR ≥ 11 and 77% for BAR BAR ≥ 11 and 69% for BAR BAR ≥ 11 [odds ratio (OR) 3.08; 95% confidence interval (CI) 1.75-5.42; p = 0.001] and intrasurgical use of packed red blood cells (RBC) above 6 units (OR 4.49; 95% CI 2.73-7.39; p = 0.001). For survival BAR ≥ 11 (OR 2.94; 95% CI 1.67-5.16; p = 0.001) and RBC >6 units (OR 2.99; 95% CI 1.92-4.64; p = 0.001). Our study contributes to the incorporation of the BAR system into Brazilian transplantation centers.

  11. Pendidikan Kesehatan Reproduksi Formal dan Hubungan Seksual Pranikah Remaja Indonesia

    Directory of Open Access Journals (Sweden)

    Anggriyani Wahyu Pinandari

    2015-08-01

    by sexual and reproductive revolution. Potential problems in this era are the increase of premarital sexual behavior, unwanted pregnancy, sexual transmitted infection and drug abuse. This study aimed to examine the influence of formal reproductive health education to delay premarital sexual intercourse among Indonesian teenagers and young adults. Cross sectional study analyzed as retrospective cohort used data of Indonesian Teenage Reproductive Health Survey in 2012 (10,980 men and 8,902 women. Effects of formal reproductive health education to delay sexual intercourse behavior was analyzed using kaplan meier curve, log-rank test, and chi square test, meanwhile multivariat analysis used logistic regression. All tests used confidence interval 95% and p value = 0.05. Results of survival analysis of abstinence committing sexual intercourse showed that teenagers who didn’t receive or only receive one of reproductive health education materials had bigger hazard ratio (respectively 1.55 (CI=1.32 – 1.82; 0.99 (CI=0.86 – 1.15 and 2.26 (CI=1.43 – 3.56. Receiving complete information gave longer abstinence time. Drug abuse, smoking, alcohol, men, aged between 20 – 24 years old and poor were more likely to commit premarital sexual intercourse. Receipt of reproductive health information at formal education level may delay the occurrence of premarital sexual intercourse.

  12. Low-cost glass ionomer cement as ART sealant in permanent molars: a randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Daniela HESSE

    2015-01-01

    Full Text Available Clinical trials are normally performed with well-known brands of glass ionomer cement (GIC, but the cost of these materials is high for public healthcare in less-affluent communities. Given the need to research cheaper materials, it seems pertinent to investigate the retention rate of a low-cost GIC applied as atraumatic restorative treatment (ART sealants in two centers in Brazil. Four hundred and thirty-seven 6-to-8-year-old schoolchildren were selected in two cities in Brazil. The children were randomly divided into two groups, according to the tested GIC applied in the first permanent molars. The retention rate was evaluated after 3, 6 and 12 months. Kaplan-Meier survival analysis and the log-rank test were performed. The variables were tested for association with sealant longevity, using logistic regression analyses (α = 5%. The retention rate of sealants after 12 months was 19.1%. The high-cost GIC brand presented a 2-fold-more-likely-to-survive rate than the low-cost brand (p < 0.001. Significant difference was also found between the cities where the treatments were performed, in that Barueri presented a higher sealant survival rate than Recife (p < 0.001. The retention rate of a low-cost GIC sealant brand was markedly lower than that of a well-known GIC sealant brand.

  13. Psychotherapy use in bipolar disorder: Association with functioning and illness severity.

    Science.gov (United States)

    Sylvia, Louisa G; Thase, Michael E; Reilly-Harrington, Noreen A; Salcedo, Stephanie; Brody, Benjamin; Kinrys, Gustavo; Kemp, David; Shelton, Richard C; McElroy, Susan L; Kocsis, James H; Bobo, William V; Kamali, Masoud; McInnis, Melvin; Friedman, Edward; Tohen, Mauricio; Bowden, Charles L; Ketter, Terence A; Singh, Vivek; Calabrese, Joseph; Nierenberg, Andrew A; Rabideau, Dustin J; Elson, Constance M; Deckersbach, Thilo

    2015-05-01

    This study examines characteristics of individuals with bipolar disorder who sought psychotherapy versus those who did not. Bipolar CHOICE was an 11-site comparative effectiveness study of lithium versus quetiapine in symptomatic outpatients (N = 482) with bipolar disorder. At baseline, participants' psychotherapy use within the past 3 months, mood, functioning, and overall health were assessed. Logistic regressions were used to test whether psychotherapy users and non-users differed on various demographic and clinical variables at baseline. Mixed-effects regression was used to determine whether psychotherapy groups differed on response to treatment over the 6-month study. Kaplan-Meier plots and log-rank tests were employed to test whether there were any differences in time to recovery (CGI-BP ≤ 2 for at least 8 weeks) between the groups. Thirty one percent of participants reported using psychotherapy services. Psychotherapy users reported greater medication side effect burden than non-users and were more likely to have moderate to high suicide risk and at least one anxiety disorder. Participants not utilizing medications or psychotherapy had greater mania symptom severity, were younger, and less educated than medication only users. Medication only users were more likely to be married than the other participants. These data suggest that a minority of individuals with bipolar disorder attend psychotherapy services, and those that do have greater illness burden. © The Royal Australian and New Zealand College of Psychiatrists 2015.

  14. Feasibility and safety of extended adjuvant temozolomide beyond six cycles for patients with glioblastoma.

    Science.gov (United States)

    Hsieh, S Yp; Chan, D Tm; Kam, M Km; Loong, H Hf; Tsang, W K; Poon, D Mc; Ng, S Cp; Poon, W S

    2017-12-01

    Temozolomide is the first chemotherapeutic agent proven effective for patients with newly diagnosed glioblastoma. The drug is well tolerated for its low toxicity. The current standard practice is concomitant chemoradiotherapy for 6 weeks followed by 6 cycles of adjuvant temozolomide. Some Caucasian studies have suggested that patients might benefit from extended adjuvant cycles of temozolomide (>6 cycles) to lengthen both progression-free survival and overall survival. In the present study, we compared differences in survival and toxicity profile between patients who received conventional 6-cycle temozolomide and those who received more than 6 cycles of temozolomide. Patients with newly diagnosed glioblastoma without progressive disease and completed concomitant chemoradiotherapy during a 4-year period were studied. Progression-free survival was compared using Kaplan-Meier survival curves. t Test, U test, and correlation were chosen accordingly to examine the impact of age, extent of resection, MGMT promoter methylation status and adjuvant cycles on progression-free survival. For factors with a P value of cycles of temozolomide (n=7) and 43.4 months for those who received more than 6 cycles (n=7) [P=0.007, log-rank test]. Two patients in the former group and one in the latter group encountered grade 1 toxicity and recovered following dose adjustment. Cycles of adjuvant temozolomide were correlated with progression-free survival (P=0.016, hazard ratio=0.68). Extended cycles of temozolomide are safe and feasible for Chinese patients with disease responsive to temozolomide.

  15. Does underwater flash photography affect the behaviour, movement and site persistence of seahorses?

    Science.gov (United States)

    Harasti, D; Gladstone, W

    2013-11-01

    The effect of flash photography on seahorse species has never been tested. An experiment was established to test the effect of flash photography and the handling of Hippocampus whitei, a medium-sized seahorse species endemic to Australia, on their behavioural responses, movements and site persistence. A total of 24 H. whitei were utilized in the experiment with eight in each of the three treatments (flash photography, handling and control). The effect of underwater flash photography on H. whitei movements was not significant; however, the effect of handling H. whitei to take a photograph had a significant effect on their short-term behavioural responses to the photographer. Kaplan-Meier log-rank test revealed that there was no significant difference in site persistence of H. whitei from each of the three treatments and that flash photography had no long-term effects on their site persistence. It is concluded that the use of flash photography by divers is a safe and viable technique with H. whitei, particularly if photographs can be used for individual identification purposes. © 2013 The Fisheries Society of the British Isles.

  16. Are comorbid anxiety disorders a risk factor for suicide attempts in patients with mood disorders? A two-year prospective study.

    Science.gov (United States)

    Abreu, L N; Oquendo, M A; Galfavy, H; Burke, A; Grunebaum, M F; Sher, L; Sullivan, G M; Sublette, M E; Mann, J; Lafer, B

    2018-01-01

    Comorbid anxiety disorders have been considered a risk factor for suicidal behavior in patients with mood disorders, although results are controversial. The aim of this two-year prospective study was to determine if lifetime and current comorbid anxiety disorders at baseline were risk factors for suicide attempts during the two-year follow-up. We evaluated 667 patients with mood disorders (504 with major depression and 167 with bipolar disorder) divided in two groups: those with lifetime comorbid anxiety disorders (n=229) and those without (n=438). Assessments were performed at baseline and at 3, 12, and 24 months. Kaplan-Meier survival analysis and log-rank test were used to evaluate the relationship between anxiety disorders and suicide attempts. Cox proportional hazard regression was performed to investigate clinical and demographic variables that were associated with suicide attempts during follow-up. Of the initial sample of 667 patients, 480 had all three follow-up interviews. During the follow-up, 63 patients (13.1%) attempted suicide at least once. There was no significant difference in survival curves for patients with and without comorbid anxiety disorders (log-rank test=0.269; P=0.604). Female gender (HR=3.66, P=0.001), previous suicide attempts (HR=3.27, P=0.001) and higher scores in the Buss-Durkee Hostility Inventory (HR=1.05, P≤0.001) were associated with future suicide attempts. Our results suggest that comorbid anxiety disorders were not risk factors for suicide attempts. Further studies were needed to determine the role of anxiety disorders as risk factors for suicide attempts. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. Two types of lacunar infarcts: further arguments from a study on prognosis.

    Science.gov (United States)

    de Jong, G; Kessels, F; Lodder, J

    2002-08-01

    Earlier, we found that lacunar stroke patients with > or =1 asymptomatic lacunar infarcts on CT had leukoaraiosis and hypertension significantly more often than patients without such lesions, and we hypothesized that 2 types of small-vessel disease could be distinguished during life: arteriolosclerosis and microatheromatosis, respectively. Differences in prognosis might sustain this hypothesis of 2 lacunar stroke entities. Therefore, we performed a follow-up in 333 patients with first lacunar stroke, distinguishing those with > or =1 asymptomatic lacunar lesions (LACI+) from those without such lesions (LACI-). Cross-sectional follow-up was performed after 785+/-479 days (mean+/-SD) in 104 LACI+ patients and 865+/-545 days in 229 LACI- patients. Mortality at the end of follow-up was 33% in LACI+ and 21% in LACI- patients [odds ratio (OR), 1.74; 95% confidence interval (CI), 1.01 to 3.01]. Stroke recurrence rate was 21% in LACI+ and 11% in LACI- (OR, 2.09; 95% CI, 1.08 to 4.06). Forty percent of LACI+ and 26% of LACI- patients had unfavorable outcome at the end of follow-up (OR, 1.95; 95% CI, 1.17 to 3.26). Kaplan-Meier curves showed less favorable survival in LACI+ (log-rank test, P=0.0218) and survival free of stroke (log-rank test, P=0.0121) than in LACI-. When we restricted the analysis to patients with both silent lesions and leukoaraiosis (n=63) compared with those without (n=196), differences were even more pronounced. Prognosis for mortality, recurrent stroke, and overall functional outcome in lacunar stroke patients with > or =1 silent lacunar lesions is more unfavorable than in patients without such lesions. These findings sustain the idea of 2 lacunar stroke entities.

  18. Conservative management or gamma knife radiosurgery for vestibular schwannoma: tumor growth, symptoms, and quality of life.

    Science.gov (United States)

    Breivik, Cathrine Nansdal; Nilsen, Roy Miodini; Myrseth, Erling; Pedersen, Paal Henning; Varughese, Jobin K; Chaudhry, Aqeel Asghar; Lund-Johansen, Morten

    2013-07-01

    There are few reports about the course of vestibular schwannoma (VS) patients following gamma knife radiosurgery (GKRS) compared with the course following conservative management (CM). In this study, we present prospectively collected data of 237 patients with unilateral VS extending outside the internal acoustic canal who received either GKRS (113) or CM (124). The aim was to measure the effect of GKRS compared with the natural course on tumor growth rate and hearing loss. Secondary end points were postinclusion additional treatment, quality of life (QoL), and symptom development. The patients underwent magnetic resonance imaging scans, clinical examination, and QoL assessment by SF-36 questionnaire. Statistics were performed by using Spearman correlation coefficient, Kaplan-Meier plot, Poisson regression model, mixed linear regression models, and mixed logistic regression models. Mean follow-up time was 55.0 months (26.1 standard deviation, range 10-132). Thirteen patients were lost to follow-up. Serviceable hearing was lost in 54 of 71 (76%) (CM) and 34 of 53 (64%) (GKRS) patients during the study period (not significant, log-rank test). There was a significant reduction in tumor volume over time in the GKRS group. The need for treatment following initial GKRS or CM differed at highly significant levels (log-rank test, P < .001). Symptom and QoL development did not differ significantly between the groups. In VS patients, GKRS reduces the tumor growth rate and thereby the incidence rate of new treatment about tenfold. Hearing is lost at similar rates in both groups. Symptoms and QoL seem not to be significantly affected by GKRS.

  19. Relationship between mono-hydroxy-carbazepine serum concentrations and adverse effects in patients on oxcarbazepine monotherapy.

    Science.gov (United States)

    Sattler, Annika; Schaefer, Marion; May, Theodor W

    2015-09-01

    To evaluate the relationship between serum concentrations of mono-hydroxy-carbazepine (MHD), the main metabolite of oxcarbazepine (OXC), and the occurrence of adverse effects (AE) in a large group of patients on OXC monotherapy. An antiepileptic drug (AED) therapeutic drug monitoring (TDM) database was analyzed especially with regard to OXC dosage, MHD serum concentration, and the occurrence of AE. In total, 893 blood samples of 442 patients were included in this retrospective study. The statistical evaluation was performed by means of Kaplan-Meier estimates, log-rank tests and generalized estimating equations (GEE). At least one AE was reported in 78 (17.6%) of the 442 patients. At MHD serum concentrations of 30.0 μg/ml and 43.7 μg/ml and OXC dosages of 33.1 mg/kg and 62.3 mg/kg, 25% and 75% of patients, respectively, experienced at least one AE. Log-rank tests indicated that younger patients (<18 years) may be able to tolerate higher MHD serum levels (p = 0.006) and higher OXC dosages per body weight (p < 0.001) compared to adult patients (≥ 18 years). Furthermore, AEs occurred at higher body-weight adjusted OXC dosages of extended release formulations compared to immediate-release formulations (p = 0.010), whereas MHD serum levels at which AEs occurred did not differ significantly between formulations (p = 0.125). Multivariate GEE confirmed the results. The occurrence of AEs is significantly (and non-linearly) dependent on MHD serum level, whereas the dependence of OXC dosage is less distinctive. But, tolerability of OXC seems to depend on age of the patients as well as on pharmaceutical formulation of OXC. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  20. S-shaped versus conventional straight skin incision: Impact on primary functional maturation, stenosis and thrombosis of autogenous radiocephalic arteriovenous fistula: Impact of incision on maturation, stenosis & failure of RCAVF. Study design: Prospective observational comparative.

    Science.gov (United States)

    Kordzadeh, Ali; Panayiotopolous, Yiannis

    2017-10-01

    The objective of this study is to test the null hypothesis that an S-shaped surgical incision versus conventional (straight) skin incision in the creation of autogenous radiocephalic arteriovenous fistulas (RCAVFs) have no impact on the primary end-point of primary functional maturation and secondary end points of stenosis and thrombosis. A prospective observational comparative consecutive study with intention-to-treat on individuals undergoing only radiocephalic arteriovenous fistula (RCAVFs) over a period of 12 months was conducted. Variables on patient's demographics, comorbidities, anesthesia type, mean arterial blood pressure, thrill, laterality, cephalic vein and radial artery diameter were collated. The test of probability was assessed through Chi-Square, Kaplan-Meier survival estimator and Log-Rank analysis. Total of n = 83 individuals with median age of 67 years (IQR, 20-89) and male predominance 83% during this period were subjected to RCAVF formation. Total of n = 45 patients in straight skin incision were compared to n = 38 individuals in S-shaped group. Despite equal prevalence of demographics, comorbidities, anesthesia type, mean arterial blood pressure (MAP), thrill, laterality, cephalic vein and radial artery diameter ( p  > 0.05) higher incidence of juxta-anastomotic stenosis was noted in the straight skin incision group ( p  = 0.029) in comparative and survival analysis (Log-Rank, p  = 0.036). The maturation of the entire cohort was 69% (S-shaped 76% vs. straight group 62%) (p > 0.05). The outcome of this study demonstrates that S-shaped surgical skin incision is associated with a lower incidence of stenosis in comparison to straight incision type in RCAVF formation.

  1. Frailty Index Developed From a Cancer-Specific Geriatric Assessment and the Association With Mortality Among Older Adults With Cancer.

    Science.gov (United States)

    Guerard, Emily J; Deal, Allison M; Chang, YunKyung; Williams, Grant R; Nyrop, Kirsten A; Pergolotti, Mackenzi; Muss, Hyman B; Sanoff, Hanna K; Lund, Jennifer L

    2017-07-01

    Background: An objective measure is needed to identify frail older adults with cancer who are at increased risk for poor health outcomes. The primary objective of this study was to develop a frailty index from a cancer-specific geriatric assessment (GA) and evaluate its ability to predict all-cause mortality among older adults with cancer. Patients and Methods: Using a unique and novel data set that brings together GA data with cancer-specific and long-term mortality data, we developed the Carolina Frailty Index (CFI) from a cancer-specific GA based on the principles of deficit accumulation. CFI scores (range, 0-1) were categorized as robust (0-0.2), pre-frail (0.2-0.35), and frail (>0.35). The primary outcome for evaluating predictive validity was all-cause mortality. The Kaplan-Meier method and log-rank tests were used to compare survival between frailty groups, and Cox proportional hazards regression models were used to evaluate associations. Results: In our sample of 546 older adults with cancer, the median age was 72 years, 72% were women, 85% were white, and 47% had a breast cancer diagnosis. Overall, 58% of patients were robust, 24% were pre-frail, and 18% were frail. The estimated 5-year survival rate was 72% in robust patients, 58% in pre-frail patients, and 34% in frail patients (log-rank test, P older adults with cancer, a finding that was independent of age, sex, cancer type and stage, and number of medical comorbidities. The CFI has the potential to become a tool that oncologists can use to objectively identify frailty in older adults with cancer. Copyright © 2017 by the National Comprehensive Cancer Network.

  2. Conservative neck dissection in oral cancer patients: A 5 years retrospective study

    Directory of Open Access Journals (Sweden)

    Wan Mahadzir Wan Mustafa

    2016-06-01

    Full Text Available The impact of ablative oral cancer surgery was studied, with reference to recurrence and nodal metastasis,  survival probability and prognostic indicators and to determine if ethnicity influences the survival of patients. Patients who underwent major ablative surgery of the head and neck region with neck dissection were identified and assessed. Those with stage I-IV oral and oropharyngeal malignancies necessitating resection with or without radiotherapy from 2004 to 2009 were included in this study. All individuals had a pre-operative assessment and post operative assessment. Survival distributions were analyzed using Kaplan-Meier curves. Eighty seven patients (males: 38%; females: 62% were included in this study, with an age range of 21-85 years. Some 78% underwent neck dissections while 63% had surgery and radiotherapy. Nodal and primary site recurrence was 5.7% and 20.5%. The median survival time was 57 months. One year Overall Survival (OS rate was 72.7% and three year overall survival rate 61.5%. The log-rank test showed a significant difference of survival between Malay and Chinese patients (Bonferroni correction p=0.033. Recurrence-Free Survival (RFS analysis revealed that 25% of the patients have reached the event of recurrence at 46 months. The three year survival rate was 76.1%. In the RFS analysis, the log-rank test showed a significant difference in the event of recurrence and nodal metastasis (p<0.001. Conservative neck effectively controls neck metastases. Ethnicity influence  survival.

  3. Predictors for adverse outcome after iliac angioplasty and stenting for limb-threatening ischemia.

    Science.gov (United States)

    Timaran, Carlos H; Stevens, Scott L; Freeman, Michael B; Goldman, Mitchell H

    2002-09-01

    The role of iliac artery angioplasty and stenting (IAS) for the treatment of limb-threatening ischemia is not defined. IAS has been used primarily for patients with disabling claudication. Because poorer results have been shown in patients with critical ischemia after iliac artery angioplasty, the purpose of this study was to estimate the influence of risk factors on the outcome of iliac angioplasty and stent placement in patients with limb-threatening ischemia. During a 5-year period (from 1996 to 2001), 85 iliac angioplasty and stent placement procedures (107 stents) were performed in 31 women and 43 men with limb-threatening ischemia. Patients with claudication were specifically excluded. The criteria prepared by the Ad Hoc Committee on Reporting Standards (Society for Vascular Surgery/International Society for Cardiovascular Surgery) were followed to define the variables. The TransAtlantic InterSociety Consensus classification was used to characterize the type of iliac lesions. Both univariate (Kaplan-Meier [KM]) and multivariate analyses (Cox proportional hazards model) were used to determine the association between variables, cumulative patency, limb salvage, and survival. Indications for iliac angioplasty with stenting were ischemic rest pain (56%) and tissue loss (44%). Primary stenting was performed in 36 patients (42%). Stents were placed selectively after iliac angioplasty mainly for residual stenosis or pressure gradient (43%). Overall, primary stent patency rate was 90% at 1 year, 74% at 3 years, and 69% at 5 years. Primary stent patency rate was significantly reduced in women compared with men (KM, log-rank test, P 1.6 mg/dL; KM, log-rank test, P IAS. Limb salvage, as shown in this study, is not affected by previous iliac stent failure.

  4. Development of a nomogram combining clinical staging with 18F-FDG PET/CT image features in non-small-cell lung cancer stage I-III

    International Nuclear Information System (INIS)

    Desseroit, Marie-Charlotte; Visvikis, Dimitris; Majdoub, Mohamed; Hatt, Mathieu; Tixier, Florent; Perdrisot, Remy; Cheze Le Rest, Catherine; Guillevin, Remy

    2016-01-01

    Our goal was to develop a nomogram by exploiting intratumour heterogeneity on CT and PET images from routine 18 F-FDG PET/CT acquisitions to identify patients with the poorest prognosis. This retrospective study included 116 patients with NSCLC stage I, II or III and with staging 18 F-FDG PET/CT imaging. Primary tumour volumes were delineated using the FLAB algorithm and 3D Slicer trademark on PET and CT images, respectively. PET and CT heterogeneities were quantified using texture analysis. The reproducibility of the CT features was assessed on a separate test-retest dataset. The stratification power of the PET/CT features was evaluated using the Kaplan-Meier method and the log-rank test. The best standard metric (functional volume) was combined with the least redundant and most prognostic PET/CT heterogeneity features to build the nomogram. PET entropy and CT zone percentage had the highest complementary values with clinical stage and functional volume. The nomogram improved stratification amongst patients with stage II and III disease, allowing identification of patients with the poorest prognosis (clinical stage III, large tumour volume, high PET heterogeneity and low CT heterogeneity). Intratumour heterogeneity quantified using textural features on both CT and PET images from routine staging 18 F-FDG PET/CT acquisitions can be used to create a nomogram with higher stratification power than staging alone. (orig.)

  5. ABCA Transporter Gene Expression and Poor Outcome in Epithelial Ovarian Cancer

    DEFF Research Database (Denmark)

    Hedditch, Ellen L; Gao, Bo; Russell, Amanda J

    2014-01-01

    -wide association study. Impact of short interfering RNA-mediated gene suppression was determined by colony forming and migration assays. Association with survival was assessed with Kaplan-Meier analysis and log-rank tests. All statistical tests were two-sided. RESULTS: Associations with outcome were observed...... with ABC transporters of the "A" subfamily, but not with multidrug transporters. High-level expression of ABCA1, ABCA6, ABCA8, and ABCA9 in primary tumors was statistically significantly associated with reduced survival in serous ovarian cancer patients. Low levels of ABCA5 and the C-allele of rs536009...... ABCA1, ABCA5 and ABCA9 gene expression = 33.2 months, 95% CI = 26.4 to 40.1; vs 55.3 months in the group with favorable ABCA gene expression, 95% CI = 49.8 to 60.8; P = .001), independently of tumor stage or surgical debulking status. Suppression of cholesterol transporter ABCA1 inhibited ovarian...

  6. Prevalence and outcomes of heart transplantation in children with intellectual disability.

    Science.gov (United States)

    Wightman, Aaron; Bartlett, Heather L; Zhao, Qianqian; Smith, Jodi M

    2017-03-01

    Heart transplantation in children with intellectual disability is a controversial issue. We sought to describe the prevalence and outcomes of heart transplantation in children with intellectual disability and hypothesized that recipients with intellectual disability have comparable short-term outcomes compared to recipients without intellectual disability. We performed a retrospective cohort analysis of children receiving a first heart-alone transplant in the UNOS STAR database from 2008 to 2013. Recipients with intellectual disability were compared to those without using chi-square tests. Kaplan-Meier curves were constructed for patient and graft survival. Cox proportional hazard models were used to estimate the association between intellectual disability and graft failure and patient survival. Over the study period, 107 children with intellectual disability underwent initial heart transplantation, accounting for 8.9% of first pediatric heart transplants (total=1204). There was no difference in the incidence of acute rejection between groups in the first year after transplant. Mean functional status scores at follow-up improved in both groups after transplantation, but tended to be lower among children with intellectual disability than children without. Log-rank tests did not suggest significant differences in graft survival between those with and without intellectual disability during the first 4 years following transplantation. Children with intellectual disability constitute a significant portion of total heart transplants with short-term outcomes comparable to children without intellectual disability. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Combined detection of preoperative serum CEA, CA19-9 and CA242 improve prognostic prediction of surgically treated colorectal cancer patients.

    Science.gov (United States)

    Wang, Jingtao; Wang, Xiao; Yu, Fudong; Chen, Jian; Zhao, Senlin; Zhang, Dongyuan; Yu, Yang; Liu, Xisheng; Tang, Huamei; Peng, Zhihai

    2015-01-01

    We assessed the prognostic significance of preoperative serum carcinoembryonic antigen (CEA), carbohydrate antigen 19-9 (CA19-9) and carbohydrate antigen 242 (CA242) levels in surgically treated colorectal cancer patients. The relationship of preoperative serum CEA, CA19-9 and CA242 levels with disease characteristics was investigated in 310 patients. Correlation between tumor markers was investigated using Pearson correlation test. Univariate and multivariate survival analyses were used to study the relationship between preoperative tumor markers and prognosis [disease free survival (DFS) and overall survival (OS)]. Kaplan-Meier analysis with log rank test was used to assess the impact of tumor marker levels on survival. Positive rate of preoperative serum CEA, CA19-9 and CA242 were 54.84%, 47.42% and 37.10%, respectively. High preoperative CEA level was associated with tumor size (P = 0.038), T stage (P tumor AJCC stage (P = 0.023). Preoperative CA242 positively correlated with CEA (P markers was of independent prognostic value in CRC (HR = 2.532, 95% CI: 1.400-4.579, P = 0.002 for OS; and HR = 2.366, 95% CI: 1.334-4.196, P = 0.003 for DFS). Combined detection of preoperative serum CEA, CA19-9 and CA242 is of independent prognostic value for management of CRC patients treated surgically.

  8. Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

    Science.gov (United States)

    Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan

    2009-01-01

    Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differences were tested using the Log-rank test. Results Fifteen (16%) pathogenic mutations (12 in BRCA1 and 3 in BRCA2), of which six were novel BRCA1 mutations were identified. None of the cases showed CHEK2*1100delC mutation. Many reported polymorphisms in the exonic and intronic regions of BRCA1 and BRCA2 were also seen. The mutation status and the polymorphisms were analyzed for association with the clinico-pathological features like age, stage, grade, histology, disease status, survival (overall and disease free) and with prognostic molecular markers (ER, PR, c-erbB2 and p53). Conclusion The stage of the disease at diagnosis was the only statistically significant (p < 0.0035) prognostic parameter. The mutation frequency and the polymorphisms were similar to reports on other ethnic populations. The lack of association between the clinico-pathological variables, mutation status and the disease status is likely to be due to the small numbers. PMID:19656415

  9. Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

    Directory of Open Access Journals (Sweden)

    Soumittra Nagasamy

    2009-08-01

    Full Text Available Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differences were tested using the Log-rank test. Results Fifteen (16% pathogenic mutations (12 in BRCA1 and 3 in BRCA2, of which six were novel BRCA1 mutations were identified. None of the cases showed CHEK2*1100delC mutation. Many reported polymorphisms in the exonic and intronic regions of BRCA1 and BRCA2 were also seen. The mutation status and the polymorphisms were analyzed for association with the clinico-pathological features like age, stage, grade, histology, disease status, survival (overall and disease free and with prognostic molecular markers (ER, PR, c-erbB2 and p53. Conclusion The stage of the disease at diagnosis was the only statistically significant (p

  10. The Poor Survival among Pulmonary Tuberculosis Patients in Chiapas, Mexico: The Case of Los Altos Region

    Science.gov (United States)

    Nájera-Ortiz, J. C.; Sánchez-Pérez, H. J.; Ochoa-Díaz-López, H.; Leal-Fernández, G.; Navarro-Giné, A.

    2012-01-01

    Objective. To analyse survival in patients with pulmonary tuberculosis (PTB) and factors associated with such survival. Design. Study of a cohort of patients aged over 14 years diagnosed with PTB from January 1, 1998 to July 31, 2005. During 2004–2006 a home visit was made to each patient and, during 2008-2009, they were visited again. During these visits a follow-up interview was administered; when the patient had died, a verbal autopsy was conducted with family members. Statistical analysis consisted of survival tests, Kaplan-Meier log-rank test and Cox regression. Results. Of 305 studied patients, 68 had died due to PTB by the time of the first evaluation, 237 were followed-up for a second evaluation, and 10 of them had died of PTB. According to the Cox regression, age (over 45 years) and treatment duration (under six months) were associated with a poorer survival. When treatment duration was excluded, the association between poorer survival with age persisted, whereas with having been treated via DOTS strategy, was barely significant. Conclusions. In the studied area it is necessary that patients receive a complete treatment scheme, and to give priority to patients aged over 45 years. PMID:22701170

  11. Perinatal stroke and the risk of developing childhood epilepsy

    Science.gov (United States)

    Golomb, Meredith R.; Garg, Bhuwan P.; Carvalho, Karen S.; Johnson, Cynthia S.; Williams, Linda S.

    2008-01-01

    Objectives To describe the prevalence of epilepsy after 6 months-of-age in children with perinatal stroke and examine whether perinatal data predict epilepsy onset and resolution. Study design A retrospective review of 64 children with perinatal stroke. In children with at least 6 months of follow-up data, Kaplan-Meier curves, univariate log-rank tests, and Cox proportional hazards models were used to examine predictors of time to development of seizures, and time to resolution of seizures in children with epilepsy. The association of risk factors with the presence of epilepsy at any time after 6 months-of-age was examined using Fisher’s exact test. Results Forty-one of the 61 children with at least 6 months of follow-up data (67%) had epilepsy between 6 months-of-age and last follow-up, but in 13 of 41 seizures eventually resolved and anticonvulsants were discontinued. Infarct on prenatal ultrasound (p=0.0065) and family history of epilepsy (p=0.0093) were significantly associated with time to development of seizures after 6 months-of-age in the univariate analysis. No assessed variables were associated with time to resolution of epilepsy or with the presence of epilepsy after 6 months-of-age. Conclusions Childhood epilepsy is frequent after perinatal stroke. Evidence of infarction on prenatal ultrasound and a family history of epilepsy predict earlier onset of active seizures. PMID:17889079

  12. Characteristics and outcomes of patients with Ewing sarcoma over 40 years of age at diagnosis.

    Science.gov (United States)

    Karski, Erin E; Matthay, Katherine K; Neuhaus, John M; Goldsby, Robert E; Dubois, Steven G

    2013-02-01

    The peak incidence of Ewing sarcoma (EWS) is in adolescence, with little known about patients who are ≥40 years at diagnosis. We describe the clinical characteristics and survival of this rare group. This retrospective cohort study utilized the Surveillance Epidemiology and End Results database. 2780 patients were identified; including 383 patients diagnosed ≥40 years. Patient characteristics between age groups were compared using chi-squared tests. Survival from diagnosis to death was estimated via Kaplan-Meier methods, compared with log-rank tests, and modeled using multivariable Cox methods. A competing risks analysis was performed to evaluate death due to cancer. Patients ≥40 years of age were more likely to have extra-skeletal tumors (66.1% vs. 31.7%; p extra-skeletal tumors, metastatic disease, and axial primary tumors suggesting a difference in tumor biology. Independent of differences in these characteristics, older patients also have a lower survival rate. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Effect of Chinese herbal medicine on stroke patients with type 2 diabetes.

    Science.gov (United States)

    Tsai, Fuu-Jen; Ho, Tsung-Jung; Cheng, Chi-Fung; Liu, Xiang; Tsang, Hsinyi; Lin, Ting-Hsu; Liao, Chiu-Chu; Huang, Shao-Mei; Li, Ju-Pi; Lin, Cheng-Wen; Lin, Jaung-Geng; Lin, Jung-Chun; Lin, Chih-Chien; Liang, Wen-Miin; Lin, Ying-Ju

    2017-03-22

    Complications of type 2 diabetes (T2D) include stroke, which is a cerebrovascular disturbance characterized by reduced blood flow in the brain, leading to death or physical disability. Chinese herbal medicine (CHM) has been widely used in ancient China for the treatment of diabetes and stroke by supplementing Qi and activating blood circulation. This study aimed to investigate the frequencies and patterns of CHM treatment for stroke patients with T2D and the outcomes of long-term use in Taiwan. We identified 3079 stroke patients (ICD-9-CM: 430-438) with T2D. We allocated 618 stroke patients, matched for age, gender, and T2D-to-stroke duration, to both CHM and non-CHM groups. Chi-square test, conditional multivariable logistic regression, Kaplan-Meier method, and the log-rank test were used in this study. The CHM group was characterized by more cases of chronic obstructive pulmonary disease, ulcer disease, hyperlipidemia, tobacco use, and higher income. The cumulative survival probability was higher in the CHM group (Pherbs, respectively. The use of CHM as adjunctive therapy may improve the overall survival (OS) of stroke patients with T2D. The list of the comprehensive herbal medicines that they used might be useful in future large-scale, randomized clinical investigations of agent effectiveness, safety, and potential interactions with conventional treatments in stroke patients with T2D. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  14. Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.

    Science.gov (United States)

    Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J

    2014-03-01

    Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.

  15. Large cell lymphoma in children and adolescents of the Instituto Nacional de Cancerologia E.S.E. (Bogota, Colombia): 1980-2001

    International Nuclear Information System (INIS)

    De los Reyes I; Martinez, T; Vizcaino M; Moreno C

    2005-01-01

    Objective: to characterize and establish the survival of pediatric patients with lymphoma treated at the National Cancer Institute of Colombia, the period 1980-2001. Methods: clinical records of nineteen patients were reviewed, diagnosis was confirmed by morphology, and immune-phenotype was established with CD20, CD30, CD43, CD45RB, CD45RO, CD68, CD3, ALK, tdt and S-100 antibodies. Associations were established by using Fisher's exact test, Kaplan-Meier's method for survival, and the log rank test to compare survival trends. Results: ten patients were girls; the age median was eleven years, with a range between three and sixteen years. Seven cases presented lymphoma at the neck, which was the most frequent localization, nine patients were at stage l; the most frequent immune-phenotype was that of T cells, with eleven cases. Thirteen patients presented complete remission. After two years, event-free survival was 47.3%, disease-free survival was 99.8%, and global survival 68%. After five years, event-free survival was 28,8%. Conclusion: a bigger number of patients must be studied in order to establish more precise estimations concerning clinical features and survival

  16. Clinical and Radiologic Outcomes of Submerged and Nonsubmerged Bone-Level Implants with Internal Hexagonal Connections in Immediate Implantation: A 5-Year Retrospective Study.

    Science.gov (United States)

    Wu, Shiyu; Wu, Xiayi; Shrestha, Rachana; Lin, Jinying; Feng, Zhicai; Liu, Yudong; Shi, Yunlin; Huang, Baoxin; Li, Zhipeng; Liu, Quan; Zhang, Xiaocong; Hu, Mingxuan; Chen, Zhuofan

    2018-02-01

    To evaluate the 5-year clinical and radiologic outcome of immediate implantation using submerged and nonsubmerged techniques with bone-level implants and internal hexagonal connections and the effects of potential influencing factors. A total of 114 bone-level implants (XiVE S plus) with internal hexagonal connections inserted into 72 patients were included. Patients were followed up for 5 years. A t-test was used to statistically evaluate the marginal bone loss between the submerged and nonsubmerged groups. The cumulative survival rate (CSR) was calculated according to the life table method and illustrated with Kaplan-Meier survival curves. Comparisons of the CSR between healing protocols, guided bone regeneration, implants with different sites, lengths, and diameters were performed using log-rank tests. The 5-year cumulative implant survival rates with submerged and nonsubmerged healing were 94% and 96%, respectively. No statistically significant differences in terms of marginal bone loss, healing protocol, application of guided bone regeneration, implant site, or length were observed. High CSRs and good marginal bone levels were achieved 5 years after immediate implantation of bone-level implants with internal hexagonal connections using both the submerged and nonsubmerged techniques. Factors such as implant length, site, and application of guided bone regeneration did not have an impact on the long-term success of the implants. © 2017 by the American College of Prosthodontists.

  17. Impact of Socioeconomic Status and Ethnicity on Melanoma Presentation and Recurrence in Caucasian Patients.

    Science.gov (United States)

    Salvaggio, Christine; Han, Sung Won; Martires, Kathryn; Robinson, Eric; Madankumar, Reshmi; Gumaste, Priyanka; Polsky, David; Stein, Jennifer; Berman, Russell; Shapiro, Richard; Zhong, Judy; Osman, Iman

    2016-01-01

    The impact of ethnicity and the socioeconomic status (SES) among Caucasians is not well studied. Here, we examine the impact of income on melanoma presentation and prognosis within a Caucasian cohort, accounting for ethnicity, as some reports suggest increased melanoma incidence in Ashkenazi Jewish (AJ) BRCA mutation carriers. We studied prospectively enrolled primary melanoma patients at New York University. SES data were estimated using United States' Census Bureau data and patient zip codes. We evaluated associations between ethnicity, SES, and baseline characteristics using the χ² test and multivariate logistic regression. We compared survival distributions using Kaplan-Meier curves, log-rank tests, and Cox proportional hazard ratios. Of the 1,339 enrolled patients, AJ represented 32% (n = 423). Apart from AJ being older at presentation (p < 0.001), no significant differences were observed in baseline characteristics between ethnic groups. Patients with a median household income (MHI) lower than the median of the cohort were significantly more likely to present with advanced stages (p < 0.001) compared to patients with a higher MHI. Shorter overall (p = 0.016) and post-recurrence survival (p = 0.042) was also observed in patients from lower-income households. Data suggest that disparities in melanoma presentation in Caucasians stratify according to income independent of ethnic background. © 2016 S. Karger AG, Basel.

  18. Median Survival Time of Endometrial Cancer Patients with Lymphovascular Invasion at the Hospital Universiti Sains Malaysia.

    Science.gov (United States)

    Asyikeen, Wan Adnan Wan Nor; Siti-Azrin, Ab Hamid; Jalil, Nur Asyilla Che; Zin, Anani Aila Mat; Othman, Nor Hayati

    2016-11-01

    Endometrial cancer is the most common gynaecologic malignancy among females worldwide. The purpose of this study was to determine the median survival time of endometrial cancer patients at the Hospital Universiti Sains Malaysia (USM). A list of 121 endometrial cancer cases registered at Hospital USM between 2000 until 2011 was retrospectively reviewed. The survival time of the endometrial cancer patients was estimated by Kaplan-Meier survival analysis. Log-rank tests were performed to compare the survival of the patients based on socio-demographics and clinical presentation. Only 108 patients, 87.0%, were included who were of Malay ethnicity. Previous history included menopause in 67.6% of patients and diabetes mellitus in 39.8% of patients; additionally, 63.4% of patients were nulliparous. Tumour staging was as follows: 24.5% stage I, 10.8% stage II, 26.5% stage III and 38.2% stage IV. The overall median survival time of the endometrial cancer patients was 70.20 months (95% confidence interval (CI): 51.79, 88.61). The significant factors were age, the presence of lymphovascular invasion and treatment received. The overall survival of endometrial cancer was low. A prospective study needs to be carried out to discover more effective and accurate tests for the early detection of endometrial cancer.

  19. The Poor Survival among Pulmonary Tuberculosis Patients in Chiapas, Mexico: The Case of Los Altos Region

    Directory of Open Access Journals (Sweden)

    J. C. Nájera-Ortiz

    2012-01-01

    Full Text Available Objective. To analyse survival in patients with pulmonary tuberculosis (PTB and factors associated with such survival. Design. Study of a cohort of patients aged over 14 years diagnosed with PTB from January 1, 1998 to July 31, 2005. During 2004–2006 a home visit was made to each patient and, during 2008-2009, they were visited again. During these visits a follow-up interview was administered; when the patient had died, a verbal autopsy was conducted with family members. Statistical analysis consisted of survival tests, Kaplan-Meier log-rank test and Cox regression. Results. Of 305 studied patients, 68 had died due to PTB by the time of the first evaluation, 237 were followed-up for a second evaluation, and 10 of them had died of PTB. According to the Cox regression, age (over 45 years and treatment duration (under six months were associated with a poorer survival. When treatment duration was excluded, the association between poorer survival with age persisted, whereas with having been treated via DOTS strategy, was barely significant. Conclusions. In the studied area it is necessary that patients receive a complete treatment scheme, and to give priority to patients aged over 45 years.

  20. RELATIONSHIP BETWEEN THE PROANGIOGENIC ROLE OF EG-VEGF, CLINICOPATHOLOGICAL CHARACTERISTICS AND SURVIVAL IN TUMORAL OVARY.

    Science.gov (United States)

    Lozneanu, Ludmila; Avădănei, Roxana; Cîmpean, Anca Maria; Giuşcă, Simona Eliza; Amălinei, Cornelia; Căruntu, Irina-Draga

    2015-01-01

    To prove the presence of EG-VEGF in tumor ovary and to analyze its involvement in the ovarian carcinogenesis, as promoter of angiogenesis, in relationship with the clinicopathological prognostic factors and survival. The study group comprises tumor tissue specimens from 50 cases of surgically treated ovarian cancer that were immunohistochemically investigated. A scoring system based on the percentage of positive cells and the intensity of staining was applied for the semiquantitative assessment of EG-VEGF, as negative or positive. Statistics involved χ2 test, and Kaplan-Meier and log-rank test. EG-VEGF was positive in 35 cases (70%) and negative in 15 cases (30%). Our data confirmed the predominance of EG-VEGF positivity in the serous subiype as compared to endometrioid and clear cell subtypes, and its absence in mucinous subtype. Moreover, we demonstrated that EG-VEGF is overexpressed mainly in high-grade ovarian carcinomas (type II) than in low-grade ones. Significant differences were registered between the EG-VEGF positive or negative expression and tumor stage and histological subtypes, respectively. Survival analysis showed no differences in patient's survival and EG-VEGF positive and negative cases. The analysis of EG-VEGF expression in ovarian tumors points out the relationship between the enhanced potential for tumor angiogenesis and the tumor aggressivity.

  1. Outcomes of direct pulp capping: interrogating an insurance database.

    Science.gov (United States)

    Raedel, M; Hartmann, A; Bohm, S; Konstantinidis, I; Priess, H W; Walter, M H

    2016-11-01

    To evaluate the effectiveness of direct pulp capping under general practice conditions. It was hypothesized that direct pulp capping is an effective procedure in the majority of cases and prevents the need for root canal treatment or extraction. Claims data were collected from the digital database of a major German national health insurance company. Only patients who had been insurance members for the entire 3 year period 2010 to 2012 were eligible. Kaplan-Meier survival analyses were conducted for all teeth with direct pulp capping. Success was defined as not undergoing root canal treatment. Survival was defined as not undergoing extraction. Differences between survival functions were tested with the log rank test. A total of 148 312 teeth were included. The overall success rate was 71.6% at 3 years. The overall survival rate was 95.9% at 3 years. The success rates for single-rooted teeth (71.8%) and multirooted teeth (71.5%) were similar although significantly different (P 85 years.). After direct pulp capping, more than two-thirds of the affected teeth did not undergo root canal treatment within 3 years. Although this study has the typical limits of a claims data analysis, it can be concluded that direct pulp capping is an effective intervention to avoid root canal treatment and extraction in a general practice setting. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  2. Microsatellite instability is associated with reduced disease specific survival in stage III colon cancer.

    Science.gov (United States)

    Mohan, H M; Ryan, E; Balasubramanian, I; Kennelly, R; Geraghty, R; Sclafani, F; Fennelly, D; McDermott, R; Ryan, E J; O'Donoghue, D; Hyland, J M P; Martin, S T; O'Connell, P R; Gibbons, D; Winter, Des; Sheahan, K

    2016-11-01

    Up to 15% of colorectal cancers exhibit microsatellite instability (MSI), where errors in replication go unchecked due to defects in the mismatch repair system. This study aimed to determine survival in a large single-centre series of 1250 consecutive colorectal cancers subjected to universal MSI testing. Clinical and pathological features of patients with colorectal cancer identified on prospectively maintained colorectal and pathology databases at St. Vincent's University Hospital from 2004 to May 2012 were examined. Mismatch repair (MMR) status was determined by immunohistochemistry. Kaplan-Meier curves, the log-rank test and Cox regression were used to associate survival with clinical and pathological characteristics. Of the 1250 colorectal cancers in the study period, 11% exhibited MSI (n = 138). Patients with MSI tumours had significantly lower rates of lymph node and distant metastases (MSI N+ rate: 24.8% compared with MSS N+ rate: 46.2%, p colon cancer. However, patients with Stage III MSI colon cancers had a worse DSS than those with MSS tumours. Stage III MSI tumours exhibited higher rates of lymphovascular invasion and perineural invasion than Stage I/II MSI tumours. MSI is associated with a reduced risk of nodal and distant metastases, with an improved DSS in Stage I/II colon cancer. However, when MSI tumours progress to Stage III these patients had worse outcomes and pathological features. New strategies for this cohort of patients may be required to improve outcomes. Copyright © 2016. Published by Elsevier Ltd.

  3. Prognostic factors in patients with malignant pleural effusion: Is it possible to predict mortality in patients with good performance status?

    Science.gov (United States)

    Abrao, Fernando Conrado; Peixoto, Renata D'Alpino; de Abreu, Igor Renato Louro Bruno; Janini, Maria Cláudia; Viana, Geisa Garcia; de Oliveira, Mariana Campello; Younes, Riad Naim

    2016-04-01

    The aim of this study was to identify predictors of mortality only in patients with malignant pleural effusion (MPE) showing good performance status which required pleural palliative procedures. All patients with MPE submitted to pleural palliative procedure were enrolled in a prospective study between 2013 and 2014. Patients with Eastern cooperative oncology group (ECOG) score zero, one, and two were considered with good performance status. The possible prognostic factors were tested for significance using the log-rank test (Kaplan-Meier method) and those with significance on univariate analysis were entered into a multivariable Cox model. A total of 64 patients were included in the analysis. Median follow-up time for surviving patients was 263 days. Median survival for the entire cohort was not reached yet. In the multivariate analysis, gastrointestinal primary site (P = 0.006), low albumin concentration in the pleural fluid (P = 0.017), and high serum NLR (P = 0.007) were associated with mortality. In our cohort of ECOG 0-2 patients with MPE submitted to pleural palliative procedures, gastrointestinal malignancy compared to other sites, low pleural fluid albumin and high NLR were significantly associated with mortality. The identification of these prognostic factors may assist the choice of the optimal palliative technique. J. Surg. Oncol. 2016;113:570-574. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. The Role of Adjuvant Radiation in Uterine Sarcomas

    International Nuclear Information System (INIS)

    Sampath, Sagus; Schultheiss, Timothy E.; Ryu, Janice K.; Wong, Jeffrey Y.C.

    2010-01-01

    Purpose: To determine clinical and pathological factors significant for overall survival (OS) and local-regional failure-free survival (LRFFS) in uterine sarcoma as they relate to adjuvant radiotherapy (AR). Methods and Materials: A retrospective analysis of 3,650 patients with uterine sarcoma was conducted using the National Oncology Database, a proprietary database of aggregated tumor registries owned by Impac Medical Systems (Sunnyvale, CA). Adjuvant radiotherapy was defined as postoperative external beam radiation to the pelvis, with or without brachytherapy. Prognostic factors were identified by multivariate analysis (MVA) using the Cox proportional hazards model. The Kaplan-Meier method was used to estimate survival, with significant differences (p < 0.05) determined using the log-rank test. Results: The median follow-up time was 59 months, with a 5-year OS of 37%. Significant prognostic factors for OS were stage, race/ethnicity, grade, age, histology, lymph node status, and surgical treatment (p < 0.01 for all factors). Use of AR was not predictive for OS. For nonmetastatic cancer patients receiving definitive surgery (n = 2,206), the 5-year LRFFS was 87%. In this group, stage, grade, histology, and AR were prognostic for LRFFS (p < 0.05), with AR associated with improved outcome compared with surgery alone (hazard ratio = 0.4, p < 0.001). Patients with carcinosarcoma, endometrial stromal sarcoma, leiomyosarcoma, poorly differentiated tumors, and negative lymph nodes had reduced local-regional failure (LRF) with AR (log-rank, p < 0.05 for all). Conclusion: In the largest retrospective analysis of uterine sarcoma published thus far, AR conferred a 53% reduction in the risk of LRF at 5 years. Use of AR may have broader indications than what are currently accepted in clinical practice.

  5. Chronic consequences of acute injuries: worse survival after discharge.

    Science.gov (United States)

    Shafi, Shahid; Renfro, Lindsay A; Barnes, Sunni; Rayan, Nadine; Gentilello, Larry M; Fleming, Neil; Ballard, David

    2012-09-01

    The Trauma Quality Improvement Program uses inhospital mortality to measure quality of care, which assumes patients who survive injury are not likely to suffer higher mortality after discharge. We hypothesized that survival rates in trauma patients who survive to discharge remain stable afterward. Patients treated at an urban Level I trauma center (2006-2008) were linked with the Social Security Administration Death Master File. Survival rates were measured at 30, 90, and 180 days and 1 and 2 years from injury among two groups of trauma patients who survived to discharge: major trauma (Abbreviated Injury Scale score ≥ 3 injuries, n = 2,238) and minor trauma (Abbreviated Injury Scale score ≤ 2 injuries, n = 1,171). Control groups matched to each trauma group by age and sex were simulated from the US general population using annual survival probabilities from census data. Kaplan-Meier and log-rank analyses conditional upon survival to each time point were used to determine changes in risk of mortality after discharge. Cox proportional hazards models with left truncation at the time of discharge were used to determine independent predictors of mortality after discharge. The survival rate in trauma patients with major injuries was 92% at 30 days posttrauma and declined to 84% by 3 years (p > 0.05 compared with general population). Minor trauma patients experienced a survival rate similar to the general population. Age and injury severity were the only independent predictors of long-term mortality given survival to discharge. Log-rank tests conditional on survival to each time point showed that mortality risk in patients with major injuries remained significantly higher than the general population for up to 6 months after injury. The survival rate of trauma patients with major injuries remains significantly lower than survival for minor trauma patients and the general population for several months postdischarge. Surveillance for early identification and treatment of

  6. Association of single nucleotide polymorphisms in promoter of matrix metalloproteinase-2, 8 genes with bladder cancer risk in Northern India.

    Science.gov (United States)

    Srivastava, Priyanka; Kapoor, Rakesh; Mittal, Rama D

    2013-02-01

    Matrix metalloproteinases (MMPs) are expressed in melanocytes and their overexpression has been linked to tumor development, progression, and metastasis. At the genetic level, following functional promoter polymorphisms are known to modify the gene transcription: -1306 C > T, -735 C > T in MMP2, and 799 C > T in MMP8 gene. Hence we hypothesize that functional polymorphisms in the 2 MMP SNPs in promoter region may modulate the risk for bladder cancer (BC) progression in North Indian population. Genotyping for these polymorphisms were done in a group of 200 BC and 200 age matched, similar ethnicity unrelated healthy controls using PCR-based methods. Two-sided χ(2), Cox-regression was utilized to evaluate the associations between genotype and various clinical and epidemiologic factors. Multivariate analyses were conducted using logistic regression, adjusting for known BC confounders such as age and gender. Survival analysis was done using the Kaplan-Meier method and differences in survival were assessed using the log rank test. Individuals with MMP2 (-1306) TT genotype as well as T allele were at higher risk of BC (P, 0.042; OR, 2.85; P, 0.001; OR, 1.76). This effect was even more apparent in case of CT+TT (P T were associated with high risk of recurrence in BCG treated patients (HR, 4.32; P, 0.006 and HR, 2.06; P, 0.047) thus showing reduced recurrence free survival (CT+TT/CC = 34/45 months; log rank P, 0.039). Our data suggested that variant allele of MMP2 1306C > T was associated with high risk of tumor recurrence and reduced recurrence free survival in superficial BC patients. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Time of default in tuberculosis patients on directly observed treatment.

    Science.gov (United States)

    Pardeshi, Geeta S

    2010-09-01

    Default remains an important challenge for the Revised National Tuberculosis Control Programme, which has achieved improved cure rates. This study describes the pattern of time of default in patients on DOTS. Tuberculosis Unit in District Tuberculosis Centre, Yavatmal, India; Retrospective cohort study. This analysis was done among the cohort of patients of registered at the Tuberculosis Unit during the year 2004. The time of default was assessed from the tuberculosis register. The sputum smear conversion and treatment outcome were also assessed. Kaplan-Meier plots and log rank tests. Overall, the default rate amongst the 716 patients registered at the Tuberculosis Unit was 10.33%. There was a significant difference in the default rate over time between the three DOTS categories (log rank statistic= 15.49, P=0.0004). Amongst the 331 smear-positive patients, the cumulative default rates at the end of intensive phase were 4% and 16%; while by end of treatment period, the default rates were 6% and 31% in category I and category II, respectively. A majority of the smear-positive patients in category II belonged to the group 'treatment after default' (56/95), and 30% of them defaulted during re-treatment. The sputum smear conversion rate at the end of intensive phase was 84%. Amongst 36 patients without smear conversion at the end of intensive phase, 55% had treatment failure. Patients defaulting in intensive phase of treatment and without smear conversion at the end of intensive phase should be retrieved on a priority basis. Default constitutes not only a major reason for patients needing re-treatment but also a risk for repeated default.

  8. Atrial Fibrillation and Coronary Artery Disease as Risk Factors of Retinal Artery Occlusion: A Nationwide Population-Based Study

    Directory of Open Access Journals (Sweden)

    Ju-Chuan Yen

    2015-01-01

    Full Text Available We use Taiwanese national health insurance research database (NHIRD to investigate whether thrombolism (carotid artery disease (CAD as a surrogate or embolism (atrial fibrillation (AF as a surrogate plays roles in later retinal artery occlusion (RAO development and examine their relative weights. The relative risks of RAO between AF and CAD patients and controls were compared by estimating the crude hazard ratio with logistic regression. Kaplan-Meier analysis was used to calculate the cumulative incidence rates of developing RAO, and a log-rank test was used to analyze the differences between the survival curves. Separate Cox proportional hazard regressions were done to compute the RAO-free rate after adjusting for possible confounding factors such as age and sex. The crude hazard ratios were 7.98 for the AF group and 5.27 for the CAD group, and the adjusted hazard ratios were 8.32 and 5.34 for the AF and CAD groups, respectively. The observation time with RAO-free was shorter for AF compared with CAD group (1490 versus 1819 days. AF and CAD were both risk factors for RAO with different hazard ratios. To tackle both AF and CAD is crucial for curbing RAO.

  9. Overexpression of NIMA-related kinase 2 is associated with poor prognoses in malignant glioma.

    Science.gov (United States)

    Liu, Huajie; Liu, Bin; Hou, Xianzeng; Pang, Bo; Guo, Pengbo; Jiang, Wanli; Ding, Qian; Zhang, Rui; Xin, Tao; Guo, Hua; Xu, Shangchen; Pang, Qi

    2017-05-01

    Eleated expression of NIMA-related kinase 2 (NEK2) was frequently observed in a variety of malignant cancers, and it appears to be involved in the initiation, maintenance, progression, metastasis of cancer and is positively associated with poor prognosis. We sought to investigate NEK2 expression and its predictive roles in malignant gliomas, and study the correlation of NEK2 protein expression with proliferation, clinical parameters, overall survival and some other parameters. We investigate NEK2 protein expression in 99 samples of malignant gliomas, including 35 WHO grade II, 22 grade III, and 42 grade IV gliomas, by immunohistochemistry and western blot (n = 50). We then made correlative analysis of protein overexpression using the Kaplan-Meier method, Log rank test, and Cox proportional-hazards model analysis. NEK2 protein was overexpressed in malignant gliomas, but not in normal brain tissues. Overexpression of NEK2 correlated with malignancy, proliferation and adverse overall survival in gliomas. Moreover, chemotherapy, resection extent and WHO grade also correlate with overall survival in gliomas. However, within WHO grade II glioma subgroup, NEK2 overexpression showed no impact on overall survival. The present study firstly reveals that NEK2 protein is widely overexpressed in gliomas. NEK2 overexpression correlates significantly with malignancy (WHO grades), proliferation (Ki-67) and prognosis in malignant gliomas. NEK2 is a potential gene therapy target and prognostic indicator.

  10. Gender differences among recidivist trauma patients.

    Science.gov (United States)

    Kwan, Rita O; Cureton, Elizabeth L; Dozier, Kristopher C; Victorino, Gregory P

    2011-01-01

    Gender differences among trauma recidivist patients are not well-understood. We hypothesized that males are more likely to be repeatedly involved in the trauma system and have a shorter time to recurrence between repeat episodes of injury compared with females. A retrospective analysis of trauma patients treated at an urban university-based trauma center was performed. Variables including gender, race, insurance status, age, mechanism of injury, outcomes, and injury secondary to domestic violence were compared. Differences were compared using χ(2) tests and log-rank (Mantel-Cox) Kaplan-Meier cumulative event curves. We identified 689 trauma recidivist patients (4.0% of all trauma visits) over a 10-y period. Compared to single-visit patients, recidivist patients were more likely to be male (87% versus 73%), uninsured (78% versus 66%), and have injuries secondary to assaults (54% versus 37%) (P trauma visit was shorter for females compared with males (23 ± 2.5 versus 30 ± 1.2 mo, P trauma than were male recidivists (69% versus 43%, P trauma patients have a much shorter time to recurrence for a second traumatic injury than do males. Female recidivists have a high likelihood of assault-associated injuries and domestic violence. Trauma centers should screen for domestic violence among trauma patients to aid in preventing further repeat episodes of injury. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Sequential Oxygenation Index and Organ Dysfunction Assessment within the First 3 Days of Mechanical Ventilation Predict the Outcome of Adult Patients with Severe Acute Respiratory Failure

    Directory of Open Access Journals (Sweden)

    Hsu-Ching Kao

    2013-01-01

    Full Text Available Objective. To determine early predictors of outcomes of adult patients with severe acute respiratory failure. Method. 100 consecutive adult patients with severe acute respiratory failure were evaluated in this retrospective study. Data including comorbidities, Sequential Organ Failure Assessment (SOFA score, Acute Physiological Assessment and Chronic Health Evaluation II (APACHE II score, PaO2, FiO2, PaO2/FiO2, PEEP, mean airway pressure (mPaw, and oxygenation index (OI on the 1st and the 3rd day of mechanical ventilation, and change in OI within 3 days were recorded. Primary outcome was hospital mortality; secondary outcome measure was ventilator weaning failure. Results. 38 out of 100 (38% patients died within the study period. 48 patients (48% failed to wean from ventilator. Multivariate analysis showed day 3 OI ( and SOFA ( score were independent predictors of hospital mortality. Preexisting cerebrovascular accident (CVA ( was the predictor of weaning failure. Results from Kaplan-Meier method demonstrated that higher day 3 OI was associated with shorter survival time (log-Rank test, . Conclusion. Early OI (within 3 days and SOFA score were predictors of mortality in severe acute respiratory failure. In the future, prospective studies measuring serial OIs in a larger scale of study cohort is required to further consolidate our findings.

  12. The effect of semirigid dressings on below-knee amputations.

    Science.gov (United States)

    MacLean, N; Fick, G H

    1994-07-01

    The effect of using semirigid dressings (SRDs) on the residual limb of individuals who have had below-knee amputations as a consequence of peripheral vascular disease was investigated, with the primary question being: Does the time to readiness for prosthetic fitting for patients treated with the SRDs differ from that of patients treated with soft dressings? Forty patients entered the study and were alternately assigned to one of two groups. Nineteen patients were assigned to the SRD group, and 21 patients were assigned to the soft dressing group. The time from surgery to readiness for prosthetic fitting was recorded for each patient. Kaplan-Meier survival curves were generated for each group, and the results were analyzed with the log-rank test. There was a difference between the two curves, and an examination of the curves suggests that the expected time to readiness for prosthetic fitting for patients treated with the SRDs would be less than half that of patients treated with soft dressings. The results suggest that a patient may be ready for prosthetic fitting sooner if treated with SRDs instead of soft dressings.

  13. Readiness for change and short-term outcomes of female adolescents in residential treatment for anorexia nervosa.

    Science.gov (United States)

    McHugh, Matthew D

    2007-11-01

    To determine if readiness for change (RFC) at admission predicted length of stay (LOS) and short-term outcomes among female adolescents in residential treatment for anorexia nervosa (AN). Using a prospective cohort design to collect data from participants (N = 65) at admission and discharge, Kaplan-Meier survival analysis and Cox regression tested whether RFC on admission predicted time in LOS to a favorable short-term outcome--a composite endpoint based on minimum criteria for weight gain, drive for thinness, depression, anxiety, and health-related quality of life (HRQOL). Participants with low RFC had a mean survival time to a favorable short-term outcome of 59.4 days compared to 34.1 days for those with high RFC (log rank = 8.44, df = 1, p = .003). The probability of a favorable short-term outcome was 5.30 times greater for participants with high RFC. Readiness for change is a useful predictor of a favorable short-term outcome and should be considered in the assessment profile of patients with AN. (c) 2007 by Wiley Periodicals, Inc.

  14. Severe Obesity Impacts Recurrence-Free Survival of Women with High-Risk Endometrial Cancer: Results of a French Multicenter Study.

    Science.gov (United States)

    Canlorbe, Geoffroy; Bendifallah, Sofiane; Raimond, Emilie; Graesslin, Olivier; Hudry, Delphine; Coutant, Charles; Touboul, Cyril; Bleu, Géraldine; Collinet, Pierre; Darai, Emile; Ballester, Marcos

    2015-08-01

    Studies focusing on the impact of obesity on survival in endometrial cancer (EC) have reported controversial results and few data exist on the impact of obesity on recurrence rate and recurrence-free survival (RFS). The aim of this study was to assess the impact of obesity on surgical staging and RFS in EC according to the European Society of Medical Oncology (ESMO) risk groups. Data of 729 women with EC who received primary surgical treatment between January 2000 and December 2012 were abstracted from a multicenter database. RFS distributions according to body mass index (BMI) in each ESMO risk group were estimated using the Kaplan-Meier method. Survival was evaluated using the log-rank test, and the Cox proportional hazards model was used to determine influence of multiple variables. Distribution of the 729 women with EC according to BMI was BMI women with a BMI ≥ 35 (72 %) than for those with a BMI obese women in the low-/intermediate-risk groups, but a BMI ≥ 35 was independently correlated to a poorer RFS (hazard ratio 12.5; 95 % confidence interval 3.1-51.3) for women in the high-risk group. Severe obesity negatively impacts RFS in women with high-risk EC, underlining the importance of complete surgical staging and adapted adjuvant therapies in this subgroup of women.

  15. New-Onset Diabetes Mellitus in Liver Transplant Recipients With Hepatitis C: Analysis of the National Database.

    Science.gov (United States)

    Li, Z; Sun, F; Hu, Z; Xiang, J; Zhou, J; Yan, S; Wu, J; Zhou, L; Zheng, S

    2016-01-01

    New-onset diabetes mellitus (NODM) after liver transplantation (LT) occurs with increased frequency in recipients with hepatitis C virus (HCV). We compared the incidence and risk factors for NODM in HCV vs non-HCV recipients. Among 24,956 liver recipients, 18,741 without pretransplantation diabetes were identified. NODM-free survival was analyzed using Kaplan-Meier and log-rank tests, and risk factors for NODM were examined using multivariate Cox regression analysis. The overall incidence of NODM was 13.0% at 1 year after LT. At 1, 2, 3, and 5 years after LT, incidence of NODM in HCV recipients was 14.4%, 4.3%, 3.1%, and 3.5%, respectively, compared with 11.9%, 3.5%, 3.2%, and 6.4%, respectively, in non-HCV recipients. HCV recipients had a higher risk of NODM than non-HCV recipients (hazard ratio 1.17 [1.09-1.27], P diabetes mellitus. Risk factors in non-HCV recipients were male recipient, BMI, and recipients with nonalcoholic steatohepatitis diagnosis. HCV recipients have a higher incidence and more risk factors for NODM than non-HCV recipients. Early identification of modifiable risk factors will assist clinical interventions to prevent NODM complications after LT. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Clinical Impact of Emphysema Evaluated by High-Resolution Computed Tomography on Idiopathic Pulmonary Fibrosis Diagnosed by Surgical Lung Biopsy.

    Science.gov (United States)

    Kohashi, Yasuo; Arai, Toru; Sugimoto, Chikatoshi; Tachibana, Kazunobu; Akira, Masanori; Kitaichi, Masanori; Hayashi, Seiji; Inoue, Yoshikazu

    2016-01-01

    The prognosis of combined cases of pulmonary fibrosis and emphysema is unresolved partially because radiological differentiation between usual interstitial pneumonia and nonspecific interstitial pneumonia is difficult in coexisting emphysema cases. The purpose of this study was to clarify the clinical impact of emphysema on the survival of patients with idiopathic pulmonary fibrosis (IPF). One hundred and seven patients with interstitial lung diseases were diagnosed by surgical lung biopsies between 2006 and 2012, and 47 patients were diagnosed with IPF through multidisciplinary discussion. Emphysema on high-resolution computed tomography scans was evaluated semiquantitatively by visual scoring. Eight out of the 47 IPF patients showed a higher emphysema score (>3) and were diagnosed to have IPF-emphysema. The median survival time of patients with IPF-emphysema (1,734 days) from the initial diagnosis was significantly shorter than that of patients with IPF alone (2,229 days) by Kaplan-Meier analysis (p = 0.007, log-rank test). Univariate Cox proportional hazard regression analyses revealed that a higher total emphysema score (>3.0) was a significantly poor prognostic factor in addition to Krebs von den Lungen-6, surfactant protein-D, arterial oxygen tension, percent forced vital capacity, and percent diffusing capacity of carbon monoxide (%DLCO). Multivariate Cox proportional hazard regression analyses with the stepwise method showed that higher total emphysema score (>3) and %DLCO were significantly poor prognostic factors. The prognosis of IPF-emphysema was significantly worse than that of IPF alone. © 2016 S. Karger AG, Basel.

  17. Long-term Prognosis of Anti-Neutrophil Cytoplasmic Antibody-Negative Renal Vasculitis: Cohort Study in Korea.

    Science.gov (United States)

    Lee, Sung Woo; Yu, Mi-Yeon; Baek, Seon Ha; Ahn, Shin-Young; Kim, Sejoong; Na, Ki Young; Chae, Dong-Wan; Chin, Ho Jun

    2016-04-01

    Few studies have reported on the long-term prognosis of anti-neutrophil cytoplasmic antibody (ANCA)-negative renal vasculitis. Between April 2003 and December 2013, 48 patients were diagnosed with renal vasculitis. Their ANCA status was tested using indirect immunofluorescence and enzyme-linked immunosorbent assays. During a median (interquartile range) follow-up duration of 933.5 (257.5-2,079.0) days, 41.7% of patients progressed to end stage renal disease (ESRD) and 43.8% died from any cause. Of 48 patients, 6 and 42 were ANCA-negative and positive, respectively. The rate of ESRD within 3 months was higher in ANCA-negative patients than in ANCA-positive patients (P = 0.038). In Kaplan-Meier survival analysis, ANCA-negative patients showed shorter renal survival than did ANCA-positive patients (log-rank P = 0.033). In univariate Cox-proportional hazard regression analysis, ANCA-negative patients showed increased risk of ESRD, with a hazard ratio 3.190 (95% confidence interval, 1.028-9.895, P = 0.045). However, the effect of ANCA status on renal survival was not statistically significant in multivariate analysis. Finally, ANCA status did not significantly affect patient survival. In conclusion, long-term patient and renal survival of ANCA-negative renal vasculitis patients did not differ from those of ANCA-positive renal vasculitis patients. Therefore, different treatment strategy depending on ANCA status might be unnecessary.

  18. Comparison of minocycline and azithromycin for the treatment of mild scrub typhus in northern China.

    Science.gov (United States)

    Zhao, Minxing; Wang, Ting; Yuan, Xiaoyu; Du, Weiming; Lin, Miaoxin; Shen, Yanbo

    2016-09-01

    Scrub typhus, caused by Orientia tsutsugamushi, has recently emerged in northern China where the disease had not been known to exist. Although doxycycline and azithromycin are the recommended agents for the treatment of scrub typhus, clinical responses depend both on the susceptibilities of various O. tsutsugamushi strains and the severity of the disease. A retrospective analysis was conducted on patients diagnosed with mild scrub typhus from August 2013 to January 2016 in the Affiliated Hospital of Nantong University, northern China. A total of 40 patients who received minocycline treatment and 34 patients who received azithromycin treatment were included in the analysis. All patients except one defervesced within 120 h after initiating antimicrobial therapy. Kaplan-Meier curves in association with log-rank test showed that the median time to defervescence was significantly shorter for the minocycline-treated group than the azithromycin-treated group (P = 0.003). There were no serious adverse events during treatment. No relapse occurred in either group during the 1-month follow-up period. In conclusion, both minocycline and azithromycin are effective and safe for the treatment of mild scrub typhus, but minocycline is more active than azithromycin against O. tsutsugamushi infection acquired in northern China. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  19. Patient factors associated with lung transplant referral and waitlist for patients with cystic fibrosis and pulmonary fibrosis.

    Science.gov (United States)

    Liu, Yuan; Vela, Monica; Rudakevych, Tanya; Wigfield, Christopher; Garrity, Edward; Saunders, Milda R

    2017-03-01

    Since 2005, the Lung Allocation Score (LAS) has prioritized patient benefit and post-transplant survival, reducing waitlist to transplant time to fibrosis (CF) and pulmonary fibrosis (PF). We analyzed the times from transplant eligibility to referral, work-up and waitlisting using Kaplan-Meier curves and log-rank tests. Overall, the referral rate for transplant-eligible patients was 64%. Of those referred, approximately 36% reach the lung transplant waitlist. Referred CF patients were significantly more likely to reach the transplant waitlist than PF patients (CF 60% vs PF 22%, p < 0.05). In addition, CF patients had a shorter wait from transplant eligibility to waitlist than PF patients (329 vs 2,369 days, respectively [25th percentile], p < 0.05). Patients with PF and CF both faced delays from eligibility to referral and waitlist. Quality improvement efforts are needed to better identify and refer appropriate patients for lung transplant evaluation. Targeted interventions may facilitate more efficient evaluation completion and waitlist appearance. Copyright © 2017 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  20. Efficacy of icotinib versus traditional chemotherapy as first-line treatment for preventing brain metastasis from advanced lung adenocarcinoma in patients with epidermal growth factor receptor-sensitive mutation.

    Science.gov (United States)

    Zhao, Xiao; Zhu, Guangqin; Chen, Huoming; Yang, Ping; Li, Fang; Du, Nan

    2016-01-01

    This study aimed to investigate the potential use of icotinib as first-line treatment to prevent brain metastasis from advanced lung adenocarcinoma. This investigation was designed as a retrospective nonrandomized controlled study. Enrolled patients received either icotinib or traditional chemotherapy as their first-line treatment. The therapeutic efficacy was compared among patients with advanced. (stages IIIB and IV) lung adenocarcinoma with epidermal growth factor receptor (EGFR)-sensitive mutation. The primary endpoint was the cumulative incidence of brain metastasis, whereas, the secondary endpoint was overall survival(OS). Death without brain metastasis was considered a competitive risk to calculate the cumulative risk of brain metastasis. Survival analysis was conducted using the Kaplan-Meier method and statistical significance was determined using the log-rank test. The present study included 396 patients with 131 in the icotinib group and 265 in the chemotherapy group. Among those with EGFR-sensitive mutation, the cumulative risk of brain metastasis was lower in the icotinib group than in the chemotherapy group. However, no significant difference in OS was observed between the two groups. Icotinib can effectively reduce the incidence of brain metastasis and therefore improve prognosis in advanced lung adenocarcinoma patients with EGFR.sensitive mutation.

  1. Efficacy of icotinib versus traditional chemotherapy as first-line treatment for preventing brain metastasis from advanced lung adenocarcinoma in patients with epidermal growth factor receptor-sensitive mutation

    Directory of Open Access Journals (Sweden)

    Xiao Zhao

    2014-01-01

    Full Text Available Objective: This study aimed to investigate the potential use of icotinib as first-line treatment to prevent brain metastasis from advanced lung adenocarcinoma. Patients and Methods: This investigation was designed as a retrospective nonrandomized controlled study. Enrolled patients received either icotinib or traditional chemotherapy as their first-line treatment. The therapeutic efficacy was compared among patients with advanced (stages IIIB and IV lung adenocarcinoma with epidermal growth factor receptor (EGFR-sensitive mutation. The primary endpoint was the cumulative incidence of brain metastasis, whereas the secondary endpoint was overall survival (OS. Death without brain metastasis was considered a competitive risk to calculate the cumulative risk of brain metastasis. Survival analysis was conducted using the Kaplan-Meier method and statistical significance were determined using the log-rank test. Results: The present study included 396 patients with 131 in the icotinib group and 265 in the chemotherapy group. Among those with EGFR-sensitive mutation, the cumulative risk of brain metastasis was lower in the icotinib group than in the chemotherapy group. However, no significant difference in OS was observed between the two groups. Conclusion: Icotinib can effectively reduce the incidence of brain metastasis and therefore improve prognosis in advanced lung adenocarcinoma patients with EGFR-sensitive mutation.

  2. Nutritional factors as predictors of response to radio-chemotherapy and survival in unresectable squamous head and neck carcinoma

    International Nuclear Information System (INIS)

    Salas, Sebastien; Deville, Jean-Laurent; Giorgi, Roch; Pignon, Thierry; Bagarry, Danielle; Barrau, Karine; Zanaret, Michel; Giovanni, Antoine; Bourgeois, Aude; Favre, Roger; Duffaud, Florence

    2008-01-01

    Background and purpose: This study sought to evaluate nutritional prognostic factors before treatment in patients with unresectable head and neck cancer treated by concomitant radio-chemotherapy. Methods and materials: Seventy-two consecutive patients were treated. We studied the potential effects of CRP, Alb, preAlb, orosomucoid, weight, weight history, BMI, PINI, OPR and NRI on response to treatment, Event-Free Survival (EFS) and Overall Survival (OS). Effects of potential risk factors on OS and on EFS were analyzed by computing Kaplan-Meier estimates, and curves were compared using the log-rank test. Results: All biological nutritional factors were statistically correlated with the response to radio-chemotherapy. In multivariate analysis, only CRP (p = 0.004) remained statistically significant. A statistical correlation was found between Alb and EFS in multivariate analysis (p = 0.04). The factors influencing OS in univariate analysis were Alb (p = 0.008), CRP (p = 0.004), orosomucoid (p = 0.01) and NRI (p = 0.01), response to radio-chemotherapy (p < 0.001) and staging (p = 0.04). In multivariate analysis, only the response to radio-chemotherapy (p < 0.001) remained significant. Conclusions: This study illustrates the prognostic value of nutritional status. CRP and Alb may be useful in the assessment of advanced head and neck cancer patients at diagnosis and for stratifying patients taking part in randomized trials

  3. High frequency of tumor cells with nuclear Egr-1 protein expression in human bladder cancer is associated with disease progression

    International Nuclear Information System (INIS)

    Egerod, Frederikke Lihme; Bartels, Annette; Fristrup, Niels; Borre, Michael; Ørntoft, Torben F; Oleksiewicz, Martin B; Brünner, Nils; Dyrskjøt, Lars

    2009-01-01

    Egr-1 (early growth response-1 transcription factor) has been proposed to be involved in invasion and metastasis processes of human bladder cancer, but Egr-1 protein expression levels in human bladder cancer have not been investigated. In the present study we investigated the expression levels of Egr-1 protein in early stages of human bladder cancer and correlated it to later progression. Expression of Egr-1 protein in human bladder cancer was examined by immunohistochemistry, on a tissue microarray constructed from tumors from 289 patients with non-muscle invasive urothelial bladder cancer. The frequency of tumor cells with nuclear Egr-1 immunolabelling correlated to bladder cancer stage, grade and to later progression to muscle-invasive bladder cancer (T2-4). Stage T1 tumors exhibited significantly higher frequencies of tumor cells with nuclear Egr-1 immunolabelling than Ta tumors (P = 0.001). Furthermore, Kaplan-Meier survival analysis showed that a high frequency of tumor cells with nuclear Egr-1 immunolabelling was significantly associated with a higher risk of progression to stage T2-4 (log-rank test, P = 0.035). Tumor cells with nuclear Egr-1 immunolabelling were found to localize at the tumor front in some of the tumor biopsies. The results from this study support a potential involvement of Egr-1 in the progression from non-muscle invasive bladder cancers to muscle invasive bladder cancer

  4. Tumor size and prognosis in patients with Wilms tumor

    Directory of Open Access Journals (Sweden)

    Valentina Oliveira Provenzi

    2015-03-01

    Full Text Available OBJECTIVE: Investigate the relationship of the tumor volume after preoperative chemotherapy (TVAPQ and before preoperative chemotherapy (TVBPQ with overall survival at two and at five years, and lifetime. METHODS: Our sample consisted of consecutive patients evaluated in the period from 1989 to 2009 in an Onco-Hematology Service. Clinical, histological and volumetric data were collected from the medical records. For analysis, chi-square, Kaplan-Meier, log-rank and Cox regression tests were used. RESULTS: The sample consisted of 32 patients, 53.1% were male with a median age at diagnosis of 43 months. There was a significant association between TVAPQ>500mL and the difference between the TVBPQ and TVAPQ (p=0.015 and histologic types of risk (p=0.008. It was also verified an association between the difference between the TVBPQ and TVAPQ and the predominant stromal tumor (p=0.037. When assessing the TVAPQ of all patients, without a cutoff, there was an association of the variable with lifetime (p=0.013, i.e., for each increase of 10mL in TVAPQ there was an average increase of 2% in the risk of death. CONCLUSIONS: Although our results indicate that the TVAPQ could be considered alone as a predictor of poor prognosis regardless of the cutoff suggested in the literature, more studies are needed to replace the histology and staging by tumor size as best prognostic variable.

  5. The prognostic utility of baseline alpha-fetoprotein for hepatocellular carcinoma patients.

    Science.gov (United States)

    Silva, Jack P; Gorman, Richard A; Berger, Nicholas G; Tsai, Susan; Christians, Kathleen K; Clarke, Callisia N; Mogal, Harveshp; Gamblin, T Clark

    2017-12-01

    Alpha-fetoprotein (AFP) has a valuable role in postoperative surveillance for hepatocellular carcinoma (HCC) recurrence. The utility of pretreatment or baseline AFP remains controversial. The present study hypothesized that elevated baseline AFP levels are associated with worse overall survival in HCC patients. Adult HCC patients were identified using the National Cancer Database (2004-2013). Patients were stratified according to baseline AFP measurements into the following groups: Negative (2000). The primary outcome was overall survival (OS), which was analyzed by log-rank test and graphed using Kaplan-Meier method. Multivariate regression modeling was used to determine hazard ratios (HR) for OS. Of 41 107 patients identified, 15 809 (33.6%) were Negative. Median overall survival was highest in the Negative group, followed by Borderline, Elevated, and Highly Elevated (28.7 vs 18.9 vs 8.8 vs 3.2 months; P < 0.001). On multivariate analysis, overall survival hazard ratios for the Borderline, Elevated, and Highly Elevated groups were 1.18 (P = 0.267), 1.94 (P < 0.001), and 1.77 (P = 0.007), respectively (reference Negative). Baseline AFP independently predicted overall survival in HCC patients regardless of treatment plan. A baseline AFP value is a simple and effective method to assist in expected survival for HCC patients. © 2017 Wiley Periodicals, Inc.

  6. Serum YKL-40 independently predicts outcome after transcatheter arterial chemoembolization of hepatocellular carcinoma.

    Directory of Open Access Journals (Sweden)

    Cheng-Bao Zhu

    Full Text Available Transcatheter arterial chemoembolization (TACE is the most widely used treatment option for unresectable hepatocellular carcinoma (HCC. Elevated serum YKL-40 level has been shown to predict poor prognosis in HCC patients undergoing resection. This study was designed to validate the prognostic significance of serum YKL-40 in patients with HCC undergoing TACE treatment.Serum YKL-40 level was determined by enzyme-linked immunosorbent assay. Overall survival (OS was evaluated with the Kaplan-Meier method and compared by the log-rank test. Multivariate study with Cox proportional hazard model was used to evaluate independent prognostic variables of OS.The median pretreatment serum YKL-40 in HCC patients with was significantly higher than that in healthy controls (P<0.001. The YKL-40 could predict survival precisely either in a dichotomized or continuous fashion (P<0.001 and P = 0.001, respectively. Multivariate Cox regression analysis indicated that serum YKL-40 was an independent prognostic factor for OS in HCC patients (P = 0.001. In further stratified analyses, YKL-40 could discriminate the outcomes of patients with low and high alpha-fetoprotein (AFP level (P = 0.006 and 0.016, respectively. Furthermore, the combination of serum YKL-40 and AFP had more capacity to predict patients' outcomes.Serum YKL-40 was demonstrated to be an independent prognostic biomarker in HCC patients treated with TACE. Our results need confirmation in an independent study.

  7. Impact of periodontal maintenance on tooth survival in patients with removable partial dentures.

    Science.gov (United States)

    Tada, Sayaka; Allen, Patrick Finbarr; Ikebe, Kazunori; Matsuda, Ken-ichi; Maeda, Yoshinobu

    2015-01-01

    Removable partial dentures (RPDs) may have a negative impact on oral health and have the potential to cause further tooth loss, especially of abutment teeth. However, no evidence indicates the effective interval of regular periodontal maintenance after RPD provision. This practice-based cohort study aimed to examine the impact of regular periodontal maintenance visits on survival of RPD abutment teeth. One hundred and ninety-two patients had been previously provided with 304 new clasp-retained RPDs at Osaka University Dental Hospital, Japan. Using the Kaplan-Meier method and log-rank test, 1094 abutments were analysed to illustrate survival curves and to compare each curve. According to the frequency of periodontal maintenance, study samples were divided into three groups; every 3-6 months (3-6M) group, 1-year (1Y) group and no-maintenance (NM) group. Seven-year cumulative survival rates were 83.7% (3-6M), 75.5% (1Y) and 71.9% (NM) respectively. Survival of abutment teeth in the 3-6M group was significantly better than both 1Y (p = 0.005) and NM (p < 0.001) groups. These longitudinal clinical data indicates that periodontal maintenance at least once in 6 months had the most favourable outcome. Frequent periodontal maintenance after RPD provision could be effective in preventing further tooth loss. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Clinical course of Crohn's disease first diagnosed at surgery for acute abdomen.

    Science.gov (United States)

    Latella, G; Cocco, A; Angelucci, E; Viscido, A; Bacci, S; Necozione, S; Caprilli, R

    2009-04-01

    The severity of clinical activity of Crohn's disease is high during the first year after diagnosis and decreases thereafter. Approximately 50% of patients require steroids and immunosuppressants and 75% need surgery during their lifetime. The clinical course of patients with Crohn's disease first diagnosed at surgery has never been investigated. To assess the clinical course of Crohn's disease first diagnosed at surgery for acute abdomen and to evaluate the need for medical and surgical treatment in this subset of patients. Hospital clinical records of 490 consecutive Crohn's disease patients were reviewed. Patients were classified according to the Vienna criteria. Sex, extraintestinal manifestations, family history of inflammatory bowel diseases, appendectomy, smoking habit and medical/surgical treatments performed during the follow-up period were assessed. Kaplan-Meier survival method and Cox proportional hazards regression model. Of the 490 Crohn's disease patients, 115 had diagnosis of Crohn's disease at surgery for acute abdomen (Group A) and 375 by conventional clinical, radiological, endoscopic and histologic criteria (Group B). Patients in Group A showed a low risk of further surgery (Log Rank test pacute abdomen showed a low risk for reintervention and less use of steroids and immunosuppressants during follow-up than those not operated upon at diagnosis. Early surgery may represent a valid approach in the initial management of patients with Crohn's disease, at least in the subset of patients with ileal and complicated disease.

  9. Prognostic Factors of Uterine Serous Carcinoma-A Multicenter Study.

    Science.gov (United States)

    Zhong, Xiaozhu; Wang, Jianliu; Kaku, Tengen; Wang, Zhiqi; Li, Xiaoping; Wei, Lihui

    2018-04-04

    The prognostic factors of uterine serous carcinoma (USC) vary among studies, and there is no report of Chinese USC patients. The aim of this study was to investigate the clinicopathological characteristics and prognostic factors in Chinese patients with USC. Patients with USC from 13 authoritative university hospitals in China and treated between 2004 and 2014 were retrospectively reviewed. Three-year disease-free survival rate (DFSR), cumulative recurrence, and cumulative mortality were estimated by Kaplan-Meier analyses and log-rank tests. Multivariate Cox regression analysis was used to model the association of potential prognostic factors with clinical outcomes. Data of a total of 241 patients were reviewed. The median follow-up was 26 months (range, 1-128 months). Median age was 60 years (range, 39-84 years), and 58.0% had stages I-II disease. The 3-year DFSR and cumulative recurrence were 46.8% and 27.7%. Advanced stage (III and IV) (P = 0.004), myometrial invasion (P = 0.001), adnexal involvement (P USC. Prospective studies are needed to confirm these results.

  10. CXCR4 expression varies significantly among different subtypes of glioblastoma multiforme (GBM) and its low expression or hypermethylation might predict favorable overall survival.

    Science.gov (United States)

    Ma, Xinlong; Shang, Feng; Zhu, Weidong; Lin, Qingtang

    2017-09-01

    CXCR4 is an oncogene in glioblastoma multiforme (GBM) but the mechanism of its dysregulation and its prognostic value in GBM have not been fully understood. Bioinformatic analysis was performed by using R2 and the UCSC Xena browser based on data from GSE16011 in GEO datasets and in GBM cohort in TCGA database (TCGA-GBM). Kaplan Meier curves of overall survival (OS) were generated to assess the association between CXCR4 expression/methylation and OS in patients with GBM. GBM patients with high CXCR4 expression had significantly worse 5 and 10 yrs OS (p GBM subtypes, there was an inverse relationship between overall DNA methylation and CXCR4 expression. CXCR4 expression was significantly lower in CpG island methylation phenotype (CIMP) group than in non CIMP group. Log rank test results showed that patients with high CXCR4 methylation (first tertile) had significantly better 5 yrs OS (p = 0.038). CXCR4 expression is regulated by DNA methylation in GBM and its low expression or hypermethylation might indicate favorable OS in GBM patients.

  11. Prognostic factors in primary adenocarcinoma of the small intestine: 13-year single institution experience

    Directory of Open Access Journals (Sweden)

    Jacobs Michael J

    2008-01-01

    Full Text Available Abstract Background Adenocarcinoma of the small bowel is a relatively rare malignancy as compared to the other malignancies of the gastrointestinal tract. Nonspecific presentation and infrequent occurrence often leads to a delay in diagnosis and consequent poor prognosis. Various other factors are of prognostic importance while managing these tumors. Methods The medical records of a total of 27 patients treated for adenocarcinoma of the small bowel at Providence Hospital and Medical Centers from year 1990 through 2003 were reviewed retrospectively. Data were analyzed using SPSS software (version 10.0; SPSS, Inc., Chicago, IL. Survival analyses were calculated using the Kaplan Meier method with the log rank test to assess the statistical significance. The socio-demographics (age, gender were calculated using frequency analyses. Results The patients included nine males and eighteen females with a median age at diagnosis of 62 years. Only 48% of the patients had an accurate preoperative diagnosis while another 33% had a diagnosis suspicious of small bowel malignancy. None of the patients presented in stage 1. The cumulative five-year survival was 30% while the median survival was 3.3 years. There was no 30-day mortality in the postoperative period in our series. Conclusion The univariate analysis demonstrated that tumor grade, stage at presentation, lymph nodal metastasis and resection margins were significant predictors of survival.

  12. Four decades of the kidney transplantation program at the Institute Nacional de Ciencias Médicas y Nutrición Salvador Zubirán in Mexico City.

    Science.gov (United States)

    Morales-Buenrostro, Luis E; Marino-Vázquez, Lluvia A; Alberú, Josefina

    2009-01-01

    This is a retrospective study that includes four decades of kidney transplant program at our Institute, with a total of 923 kidney transplants in 872 recipients. In this report, the effect of variables in recipient, donor, and transplant on long-term graft survival was analyzed using the Kaplan Meier method with log-rank test for survival comparisons. Global graft survival at our center-analyzed by censoring for death-with-functioning-graft-for 1, 5 and 10 years was 93%, 83% and 74%, respectively, with median survival of 24.5 years. When analyzed for all-cause graft loss, 1, 5 and 10 year survival was 90%, 76% and 61%, with 12.8-year median survival. Variables associated with lower graft survival censored for death-with-functioning-graft were transplantation in an earlier decade, less histocompatibility, younger kidney transplant recipients, no induction therapy, and double drug initial immunosuppression. After Cox's regression multivariate analysis, the risk factors that remained associated with worse survival were younger recipient, earlier transplant decade, and deceased donor.

  13. Intermediate-term patency of upper arm arteriovenous fistulae for hemodialysis access in children.

    Science.gov (United States)

    Haricharan, Ramanath N; Aprahamian, Charles J; Morgan, Traci L; Harmon, Carroll M; Barnhart, Douglas C

    2008-01-01

    The goal of this study was to estimate the 2-year cumulative thrombosis-free survival of basilic vein transposition (BVT) and brachiocephalic fistulae in children. All children who underwent BVT or brachiocephalic fistula construction at a tertiary care children's hospital from June 2001 to July 2006 were reviewed. Kaplan-Meier analysis, log-rank test, and proportional hazards regression were done. Sixteen children (7 girls) with inadequate forearm veins underwent creation of 18 fistulae (12 BVT, 6 brachiocephalic). Median age was 14 (9-19) years. Mean (+/-SE) operative times for BVT and brachiocephalic fistulae were 3.4 (+/- 0.6) hours and 1.9 (+/-0.4) hours, respectively. The overall 2-year cumulative survival rate was 74% (BVT, 66%; brachiocephalic fistula, 83%). Four fistulae failed (1 brachiocephalic, 3 BVT) and 14 fistulae were censored (5, patent fistula; 4, renal transplantation; 2, unrelated death; 1, elective conversion to peritoneal dialysis; 1, surgical ligation of fistula; 1, lost to follow-up). Of 18 fistulae, 6 underwent additional interventions (4, percutaneous angioplasty; 2, surgical thrombectomy). There were no significant differences in survival times based on fistula type, prior transplant status, age, or operative time. Brachiocephalic and BVT fistulae create reliable hemodialysis access for children who have inadequate forearm veins to allow construction of more distal fistulae.

  14. Impact of posterior rhabdosphincter reconstruction during robot-assisted radical prostatectomy: retrospective analysis of time to continence.

    Science.gov (United States)

    Woo, Jason R; Shikanov, Sergey; Zorn, Kevin C; Shalhav, Arieh L; Zagaja, Gregory P

    2009-12-01

    Posterior rhabdosphincter (PR) reconstruction during robot-assisted radical prostatectomy (RARP) was introduced in an attempt to improve postoperative continence. In the present study, we evaluate time to achieve continence in patients who are undergoing RARP with and without PR reconstruction. A prospective RARP database was searched for most recent cases that were accomplished with PR reconstruction (group 1, n = 69) or with standard technique (group 2, n = 63). We performed the analysis applying two definitions of continence: 0 pads per day or 0-1 security pad per day. Patients were evaluated by telephone interview. Statistical analysis was carried out using the Kaplan-Meier method and log-rank test. With PR reconstruction, continence was improved when defined as 0-1 security pad per day (median time of 90 vs 150 days; P = 0.01). This difference did not achieve statistical significance when continence was defined as 0 pads per day (P = 0.12). A statistically significant improvement in continence rate and time to achieve continence is seen in patients who are undergoing PR reconstruction during RARP, with continence defined as 0-1 security/safety pad per day. A larger, prospective and randomized study is needed to better understand the impact of this technique on postoperative continence.

  15. The prognostic value of peripheral CD4+CD25+ T lymphocytes among early stage and triple negative breast cancer patients receiving dendritic cells-cytokine induced killer cells infusion.

    Science.gov (United States)

    Song, Qing-Kun; Ren, Jun; Zhou, Xin-Na; Wang, Xiao-Li; Song, Guo-Hong; Di, Li-Jun; Yu, Jing; Hobeika, Amy; Morse, Michael A; Yuan, Yan-Hua; Yang, Hua-Bing; Lyerly, Herbert Kim

    2015-12-01

    This study aimed to assess the prognostic value of CD4+CD25+ T lymphocyte in peripheral blood among breast cancer patients treated with adoptive T lymphocytes immunotherapy. 217 patients participated in the follow-up study. CD4+CD25+ proportion was measured by flow cytometry in peripheral T cells. The median survival was estimated by Kaplan-Meier curve, Log-rank test and Cox hazard proportion regression model, between groups of CD4+CD25+ proportion more than 5% and less than or equal to 5% in peripheral T cells. Peripheral CD4+CD25+ T lymphocytes had not a relationship with progression-free survival. It was featured that above 5% peripheral CD4+CD25+ proportion of T cells was related with the median overall survival by a shorten of 51 months (p < 0.05) with the HR 1.65 (95%CI 1.04, 2.62). Above 5% CD4+CD25+proportion of T cells produced the HR to be 1.76 (95%CI 1.07, 2.87) In stage 0-II patients, and 3.59 (95%CI 1.05, 12.29) in triple negative breast cancer patients. Cellular immunity restoration recovered by adoptive T cell infusions which resulted in less proportion of peripheral CD4+CD25+T lymphocytes could be a potential prognostic indicator among early stage and triple negative patients.

  16. Prognostic value of cell cycle regulatory proteins in muscle-infiltrating bladder cancer.

    Science.gov (United States)

    Galmozzi, Fabia; Rubagotti, Alessandra; Romagnoli, Andrea; Carmignani, Giorgio; Perdelli, Luisa; Gatteschi, Beatrice; Boccardo, Francesco

    2006-12-01

    The aims of this study were to investigate the expression levels of proteins involved in cell cycle regulation in specimens of bladder cancer and to correlate them with the clinicopathological characteristics, proliferative activity and survival. Eighty-two specimens obtained from patients affected by muscle-invasive bladder cancer were evaluated immunohistochemically for p53, p21 and cyclin D1 expression, as well as for the tumour proliferation index, Ki-67. The statistical analysis included Kaplan-Meier curves with log-rank test and Cox proportional hazards models. In univariate analyses, low Ki-67 proliferation index (P = 0.045) and negative p21 immunoreactivity (P = 0.04) were associated to patient's overall survival (OS), but in multivariate models p21 did not reach statistical significance. When the combinations of the variables were assessed in two separate multivariate models that included tumour stage, grading, lymph node status, vascular invasion and perineural invasion, the combined variables p21/Ki-67 or p21/cyclin D1 expression were independent predictors for OS; in particular, patients with positive p21/high Ki-67 (P = 0.015) or positive p21/negative cyclin D1 (P = 0.04) showed the worst survival outcome. Important alterations in the cell cycle regulatory pathways occur in muscle-invasive bladder cancer and the combined use of cell cycle regulators appears to provide significant prognostic information that could be used to select the patients most suitable for multimodal therapeutic approaches.

  17. TOKYO criteria 2014 for transpapillary biliary stenting.

    Science.gov (United States)

    Isayama, Hiroyuki; Hamada, Tsuyoshi; Yasuda, Ichiro; Itoi, Takao; Ryozawa, Shomei; Nakai, Yousuke; Kogure, Hirofumi; Koike, Kazuhiko

    2015-01-01

    It is difficult to carry out meta-analyses or to compare the results of different studies of biliary stents because there is no uniform evaluation method. Therefore, a standardized reporting system is required. We propose a new standardized system for reporting on biliary stents, the 'TOKYO criteria 2014', based on a consensus among Japanese pancreatobiliary endoscopists. Instead of stent occlusion, we use recurrent biliary obstruction, which includes occlusion and migration. The time to recurrent biliary obstruction was estimated using Kaplan-Meier analysis with the log-rank test. We can evaluate both plastic and self-expandable metallic stents (uncovered and covered). We also propose specification of the cause of recurrent biliary obstruction, identification of complications other than recurrent biliary obstruction, indication of severity, measures of technical and clinical success, and a standard for clinical care. Most importantly, the TOKYO criteria 2014 allow comparison of biliary stent quality across studies. Because blocked stents can be drained not only using transpapillary techniques but also by an endoscopic ultrasonography-guided transmural procedure, we should devise an evaluation method that includes transmural stenting in the near future. © 2014 The Authors. Digestive Endoscopy © 2014 Japan Gastroenterological Endoscopy Society.

  18. Nutrition support can bring survival benefit to high nutrition risk gastric cancer patients who received chemotherapy.

    Science.gov (United States)

    Qiu, Miaozhen; Zhou, Yi-xin; Jin, Yin; Wang, Zi-xian; Wei, Xiao-li; Han, Hong-yu; Ye, Wen-feng; Zhou, Zhi-wei; Zhang, Dong-sheng; Wang, Feng-hua; Li, Yu-hong; Yang, Da-jun; Xu, Rui-hua

    2015-07-01

    The aim of our study is firstly to evaluate the prevalence and prognostic value of nutrition risk in gastric cancer patients and secondly to explore whether the nutrition support can prolong the survival of advanced gastric cancer patients. It contained two study periods. In the first period, we prospectively evaluated the nutritional risk of gastric adenocarcinoma patients from 2009 to 2011 using the method of European Nutritional Risk Screening (NRS) 2002. The Kaplan-Meier method and log-rank test were used to evaluate the prognostic value of high nutrition risk. The second period was between 2012 and 2013. We prospectively gave the nutrition support to stage IV gastric cancer patients whose NRS is ≥3. There were 830 patients in the first period, 50.7% patients with a NRS ≥ 3. Patients with NRS ≥ 3 presented a significantly higher percentage of stage IV diseases, elevated values of C-reactive protein, and hypoproteinemia. The median survival was significantly higher in NRS nutrition support. The median survival was 14.3 and 9.6 months for patients with and without NRS shift, respectively, P = 0.001. NRS ≥ 3 was an independent adverse prognostic factor in gastric cancer patients. For stage IV patients whose NRS ≥ 3, the nutrition support might be helpful to improve the prognosis.

  19. Prognostic nutritional index is associated with survival after total gastrectomy for patients with gastric cancer.

    Science.gov (United States)

    Ishizuka, Mitsuru; Oyama, Yusuke; Abe, Akihito; Tago, Kazuma; Tanaka, Genki; Kubota, Keiichi

    2014-08-01

    To investigate the influence of clinical characteristics including nutritional markers on postoperative survival in patients undergoing total gastrectomy (TG) for gastric cancer (GC). One hundred fifty-four patients were enrolled. Uni- and multivariate analyses using the Cox proportional hazard model were performed to explore the most valuable clinical characteristic that was associated with postoperative survival. Multivariate analysis using twelve clinical characteristics selected from univariate analyses revealed that age (≤ 72/>72), carcinoembryonic antigen (≤ 20/>20) (ng/ml), white blood cell count (≤ 9.5/>9.5) (× 10(3)/mm(3)), prognostic nutritional index (PNI) (≤ 45/>45) and lymph node metastasis (negative/positive) were associated with postoperative survival. Kaplan-Meier analysis and log-rank test showed that patients with higher PNI (>45) had a higher postoperative survival rate than those with lower PNI (≤ 45) (p<0.001). PNI is associated with postoperative survival of patients undergoing TG for GC and is able to divide such patients into two independent groups before surgery. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  20. Survival outcome of malignant minor salivary tumors in Pakistani population

    Directory of Open Access Journals (Sweden)

    Hassan Iqbal

    2014-01-01

    Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.

  1. [Local recurrence based on size after conservative surgery in breast cancer stage T1-T2. A population-based study].

    Science.gov (United States)

    Martínez-Ramos, David; Fortea-Sanchis, Carlos; Escrig-Sos, Javier; Prats-de Puig, Miguel; Queralt-Martín, Raquel; Salvador-Sanchis, José Luís

    2014-01-01

    Conservative surgery can be regarded as the standard treatment for most early stage breast tumors. However, a minority of patients treated with conservative surgery will present local or locoregional recurrence. Therefore, it is of interest to evaluate the possible factors associated with this recurrence. A population-based retrospective study using data from the Tumor Registry of Castellón (Valencia, Spain) of patients operated on for primary nonmetastatic breast cancer between January 2000 and December 2008 was designed. Kaplan-Meier curves and log-rank test to estimate 5-year local recurrence were used. Two groups of patients were defined, one with conservative surgery and another with nonconservative surgery. Cox multivariate analysis was conducted. The total number of patients was 410. Average local recurrence was 6.8%. In univariate analysis, only tumor size and lymph node involvement showed significant differences. On multivariate analysis, independent prognostic factors were conservative surgery (hazard ratio [HR] 4.62; 95% confidence interval [CI]: 1.12-16.82), number of positive lymph nodes (HR 1.07; 95% CI: 1.01-1.17) and tumor size (in mm) (HR 1.02; 95% CI: 1.01-1.06). Local recurrence after breast-conserving surgery is higher in tumors >2 cm. Although tumor size should not be a contraindication for conservative surgery, it should be a risk factor to be considered.

  2. Prognostic value of preoperative intratumoral FDG uptake heterogeneity in patients with epithelial ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Maria; Kim, Hee Seung; Chung, Hyun Hoon; Kim, Jae-Weon; Park, Noh-Hyun; Song, Yong Sang [Seoul National University College of Medicine, Department of Obstetrics and Gynecology, Cancer Research Institute, Seoul (Korea, Republic of); Lee, Hyunjong; Cheon, Gi Jeong [Seoul National University College of Medicine, Department of Nuclear Medicine, Cancer Research Institute, Seoul (Korea, Republic of)

    2017-01-15

    To investigate the prognostic value of intratumoral FDG uptake heterogeneity (IFH) derived from PET/CT in patients with epithelial ovarian cancer (EOC). We retrospectively reviewed patients with pathologically proven epithelial ovarian cancer who underwent preoperative {sup 18}F-FDG PET/CT scans. PET/CT parameters such as maximum and average standardized uptake values (SUV{sub max} and SUV{sub avg}), sum of all metabolic tumour volume (MTV), cumulative total lesion glycolysis (TLG) and IFH were assessed. Regression analyses were used to identify clinicopathological and imaging variables associated with disease-free survival (DFS). Clinicopathological data were reviewed for 61 eligible patients. The median duration of DFS was 13 months (range, 6-26 months), and 18 (29.5 %) patients experienced recurrence. High IFH values were associated with tumour recurrence (P = 0.005, hazard ratio 4.504, 95 % CI 1.572-12.902). The Kaplan-Meier survival graphs showed that DFS significantly differed in groups categorized based on IFH (P = 0.002, log-rank test). Moreover, there were significant differences in DFS (P = 0.009) and IFH (P = 0.040) between patients with and without recurrence. Preoperative IFH measured by {sup 18}F-FDG PET/CT was significantly associated with EOC recurrence. FDG-based heterogeneity could be a useful and potential predicator of EOC recurrence before treatment. (orig.)

  3. Prognostic value of total lesion glycolysis on preoperative {sup 18}F-FDG PET/CT in patients with uterine carcinosarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong-Won [Sungkyunkwan University School of Medicine, Department of Obstetrics and Gynecology, Seoul (Korea, Republic of); Sungkyunkwan University School of Medicine, Samsung Advanced Institute for Health Sciences and Technology, Seoul (Korea, Republic of); Heo, Eun Jin [Sungkyunkwan University School of Medicine, Department of Obstetrics and Gynecology, Seoul (Korea, Republic of); Moon, Seung Hwan [Sungkyunkwan University School of Medicine, Department of Nuclear Medicine, Seoul (Korea, Republic of); Lee, Hyunjong; Cheon, Gi Jeong [Seoul National University College of Medicine, Department of Nuclear Medicine, Seoul (Korea, Republic of); Lee, Maria; Kim, Hee Seung; Chung, Hyun Hoon [Seoul National University College of Medicine, Department of Obstetrics and Gynecology, Cancer Research Institute, Seoul (Korea, Republic of)

    2016-11-15

    To investigate the relationship between functional tumour parameters measured during preoperative {sup 18}F-FDG PET/CT and clinical outcomes in patients with uterine carcinosarcoma. For patients with pathologically proven uterine carcinosarcoma, we determined the maximal and average standardized uptake values, cumulative total lesion glycolysis (TLG) and sum of all metabolic tumour volumes (MTVs). Their predictive value for recurrence and the effects of pretreatment functional tumour activity on patient survival were compared. Clinicopathological data from 28 eligible patients were reviewed. The median duration of progression-free survival was 18.6 months (range 6.1-84.5 months), and 10 (35.7 %) patients experienced recurrences. Univariate analyses showed significant associations between recurrence and tumour size, lymph node metastasis, high TLG and MTV values, and ovarian invasion. Multivariate analysis identified high TLG value as an independent risk factor for recurrence (p = 0.048, hazard ratio 115.261, 95 % confidence interval 1.041-12,765.483). Kaplan-Meier survival curves showed that progression-free survival significantly differed in groups categorized according to TLG (p = 0.007, log-rank test). Preoperative TLG measured with {sup 18}F-FDG PET/CT was statistically significantly associated with uterine carcinosarcoma recurrence. Metabolic parameters can provide useful quantitative criteria for disease prognostication in patients with uterine carcinosarcoma before treatment. (orig.)

  4. Ten-year survival rates of teeth adjacent to treated and untreated posterior bounded edentulous spaces.

    Science.gov (United States)

    Aquilino, S A; Shugars, D A; Bader, J D; White, B A

    2001-05-01

    Failure to replace a single missing posterior tooth may lead to a variety of dental problems, which may ultimately result in tooth loss. However, little is known about the fate of the adjacent teeth if a missing posterior tooth is not replaced. This retrospective study evaluated the survival of teeth adjacent to treated and untreated posterior bounded edentulous spaces. Data were obtained from electronic treatment records from the Kaiser Permanente Dental Care Program, Portland, Ore. A final sample of 317 patients who met the study inclusion criteria was identified. Each bounded edentulous space was placed in 1 of 3 treatment categories: untreated, restored with a fixed partial denture, or restored with a removable partial denture. Subsequent treatment and the status of the teeth adjacent to the bounded edentulous space were followed through December 1999. Ten-year Kaplan-Meier survival estimates were generated for each treatment group, and differences in survival were evaluated with the log-rank chi-square test (alpha=.05). There was a significant difference in survival among the 3 treatment categories (P=.005). Spaces restored with a fixed partial denture had longer 10-year survival estimates (92%) than those that remained untreated (81%). Spaces restored with a removable partial denture had the poorest 10-year survival rate (56%). Under the conditions and selection bias associated with this retrospective study, the survival of teeth adjacent to a single posterior edentulous space was negatively associated with removable partial denture placement compared with no treatment or the use of a fixed partial denture.

  5. [Survival rate for breast cancer in Rabat (Morocco) 2005-2008].

    Science.gov (United States)

    Mechita, Nada Bennani; Tazi, Mohammed Adnane; Er-Raki, Abdelouahed; Mrabet, Mustapha; Saadi, Asma; Benjaafar, Noureddine; Razine, Rachid

    2016-01-01

    Breast cancer is a public health problem in Morocco. This study aims to estimate the survival rate for patients with breast cancer living in Rabat. We conducted a prognostic study of female patients with breast cancer diagnosed during 2005-2008, living in Rabat and whose data were recorded in the Rabat Cancer Registry. The date of inclusion in this study corresponded with the date on which cancer was histologically confirmed. Survival rate was estimated using the Kaplan-Meier method and the comparison between the different classes of a variable was made using the log rank test. The study of factors associated with survival was performed using the Cox model. During the study period 628 cases of breast cancer were collected. Mortality rate was 19.9%. Overall 1-year survival rate was 97.1%, 89.2% at 3 years and 80.6% at 5 years. In multivariate analysis, breast cancer survival was statistically lower in patients over 70 years of age (p <0.001) with large tumor size (p < 0.001), advanced-stage adenopathies (p = 0.007), metastases (p < 0.001) and not using hormone therapy (p = 0.002). Large tumor size and metastases are poor prognostic factors in breast cancer, hence the need to strengthen screening programs.

  6. Prognostic value of stem cell quantification in stage II colon cancer.

    Directory of Open Access Journals (Sweden)

    Maria Angeles Vaz

    Full Text Available BACKGROUND: Cancer stem cells (CSCs are a subset of tumor cells with capacity to self-renew and generate the diverse cells that make up the tumor. The aim of this study is to evaluate the prognostic value of CSCs in a highly homogeneous population of stage II colon cancer. METHODS: One hundred stage II colon cancer patients treated by the same surgical team between 1977 and 2005 were retrospectively analyzed. None of the patients received adjuvant chemotherapy. Inmunohistochemistry expression of CD133, NANOG and CK20 was scored, using four levels: 50% positivity. Kaplan-Meier analysis and log rank test were used to compare survival. RESULTS: The average patient age was 68 years (patients were between 45-92 years of age and median follow up was 5.8 years. There was recurrent disease in 17 (17%; CD133 expression (defined by >10% positivity was shown in 60% of the tumors, in 95% for NANOG and 78% for CK20. No correlation was found among expression levels of CD133, NANOG or CK20 and relapse-free survival (RFS or overall survival (OS. However, a statistical significant correlation was found between established pathological prognostic factors and RFS and OS. CONCLUSIONS: Stem Cell quantification defined by CD133 and NANOG expression has no correlation with RFS or OS in this cohort of Stage II colon cancer.

  7. Different effects of ERβ and TROP2 expression in Chinese patients with early-stage colon cancer.

    Science.gov (United States)

    Fang, Yu-Jing; Wang, Guo-Qiang; Lu, Zhen-Hai; Zhang, Lin; Li, Ji-Bin; Wu, Xiao-Jun; Ding, Pei-Rong; Ou, Qing-Jian; Zhang, Mei-Fang; Jiang, Wu; Pan, Zhi-Zhong; Wan, De-Sen

    2012-12-01

    Estrogen receptor beta (ERβ) and TROP2 expressed in colon carcinoma and might play an important role there. We explored the relationship of ERβ and TROP2 expression with the prognosis of early-stage colon cancer. ERβ and TROP2 levels were assessed by immunohistochemistry in normal mucosa and tumoral tissues from 220 Chinese patients with T(3)N(0)M(0) (stage IIa) and T(4)N(0)M(0) (stage IIb) colon cancer in the Cancer Center, Sun Yat-sen University, who underwent curative surgical resection between 1995 and 2003. The Cox proportional hazards regression model was applied to analyze the overall survival (OS) data, and the ROC curve, Kaplan-Meier estimate, log rank test, and Jackknife method were used to show the effect of ERβ and TROP2 expression at different stages of cancer. The 5-year survival rates were not significantly different between the patients with stage IIa and stage IIb colon cancer (83 vs. 80 %, respectively). The high expression of ERβ was related to decreasing OS in stage IIa and stage IIb colon cancer, while the high expression of TROP2 was related to decreasing OS in stage IIb colon cancer. The expression of ERβ and TROP2 has tumor-suppressive and tumor-promoting effect in stage IIa and stage IIb colon cancer, respectively.

  8. Sleep disorders and an increased risk of Parkinson's disease in individuals with non-apnea sleep disorders: a population-based cohort study.

    Science.gov (United States)

    Hsiao, Yi-Han; Chen, Yung-Tai; Tseng, Ching-Ming; Wu, Li-An; Perng, Diahn-Warng; Chen, Yuh-Min; Chen, Tzeng-Ji; Chang, Shi-Chuan; Chou, Kun-Ta

    2017-10-01

    Sleep disorders are common non-motor symptoms in patients with Parkinson's disease. Our study aims to explore the relationship between non-apnea sleep disorders and future Parkinson's disease. This is a cohort study using a nationwide database. The participants were recruited from the Taiwan National Health Insurance Research Database between 2000 and 2003. A total of 91 273 adult patients who had non-apnea sleep disorders without pre-existing Parkinson's disease were enrolled. An age-, gender-, income-, urbanization- and Charlson comorbidity index score-matched control cohort consisting of 91 273 participants was selected for comparison. The two cohorts were followed for the occurrence of Parkinson's disease, death or until the end of 2010, whichever came first. The Kaplan-Meier analyses revealed patients with non-apnea sleep disorders tended to develop Parkinson's disease (log-rank test, P sleep disorders was an independent risk factor for the development of Parkinson's disease [crude hazard ratio: 1.63, 95% confidence interval (CI): 1.54-1.73, P sleep disorders, especially chronic insomnia, are associated with a higher risk for future Parkinson's disease. © 2017 European Sleep Research Society.

  9. Uterine Carcinosarcoma Confined to the Pelvis: A Retrospective Review and Outcome Analysis

    International Nuclear Information System (INIS)

    Li, H.; TenNapel, M.J.; Bhatia, S.K.; Ahmed, A.; Lin, L.; Jacobson, G.

    2014-01-01

    Objective. We compared the treatments of uterine carcinosarcoma at our institution and evaluated their impact on survival. Methods. A retrospective analysis was performed on 60 eligible patients with carcinosarcoma limited to the pelvis. Subjects were divided into four categories: surgery, surgery plus chemotherapy, surgery plus radiation therapy, and a combination of surgery, chemotherapy, and RT. The most commonly used chemotherapy was cisplatin and/or carboplatin and taxol. Radiotherapy included external beam radiation therapy (EBRT) alone or with high dose rate (HDR) brachytherapy or HDR brachytherapy alone. Survival probability data were computed using the Kaplan-Meier method. The differences between groups were compared using the log-rank test. Results. The combination of surgery and radiation therapy with or without chemotherapy is seen to improve overall survival (OS) compared to surgery alone (Ρ =0.044 and Ρ =0.028 resp.). Brachytherapy involving three HDR vaginal cylinder fractions shows an equally effective reduction in local recurrence compared to EBRT. Conclusion. Our study of a relatively large number of carcinosarcoma patients suggests that adjuvant radiation therapy improves OS compared to surgery alone. Brachytherapy with 3 HDR vaginal cylinder fractions is preferred because of its time-saving, better tolerance, low toxicity and equivalent OS, and local control compared to EBRT.

  10. Evaluation of the prognostic value of Okuda, Cancer of the Liver Italian Program, and Japan Integrated Staging systems for hepatocellular carcinoma patients undergoing radiotherapy

    International Nuclear Information System (INIS)

    Seong, Jinsil; Shim, Su Jung; Lee, Ik Jae; Han, Kwang Hyub; Chon, Chae Yoon; Ahn, Sang Hoon

    2007-01-01

    Purpose: The purpose of this study was to compare the validity of staging systems, as well as to identify the staging system with the best prognostic value, in hepatocellular carcinoma (HCC) patients treated with radiotherapy. Methods and Materials: From 1992 to 2003, a total of 305 patients undergoing radiotherapy for HCC were evaluated retrospectively. All patients were classified before radiation therapy by the following systems: tumor-node-metastasis (TNM), Okuda, Cancer of the Liver Italian Program (CLIP), and Japan Integrated Staging (JIS) score. Cumulative survival rates were obtained using the Kaplan-Meier method, and were statistically compared using the log-rank test. Results: Median survival time was 11 months. The 1-, 2-, 3-, 4-, and 5-year survival rates were 45.1%, 24.5%, 14.7%, 10.3%, and 6.4%, respectively. Significant differences in survival were observed between all TNM stages, between CLIP scores 2, 3 and 5, 6, as well as between JIS scores 1, 2, and 2, 3. Conclusions: Among the systems studied, the TNM staging approach appeared to be the best predictor of prognosis. Staging systems that reflect liver disease status (Okuda stage, CLIP, and JIS score) showed limitations in stratifying patients undergoing radiotherapy into different prognostic groups

  11. Reclassification and treatment of odontogenic keratocysts: A cohort study

    Directory of Open Access Journals (Sweden)

    Ophir Ribeiro-Júnior

    2017-12-01

    Full Text Available Abstract: The odontogenic keratocyst (OKC is a recurrent cyst that has been recently reclassified from an odontogenic tumor to an odontogenic cyst. The aim of the present study was to investigate its treatment and address issues related to its association with nevoid basal cell carcinoma syndrome (NBCCS. Lesions from the cohort of patients included in the present study consisted of 40 OKCs, of which 27 lesions were treated by enucleation (GE and 13 underwent decompression (GD. Complementary treatment occurred in 38 (95% lesions, of which 10 underwent isolated peripheral ostectomy (GO and 28 underwent peripheral ostectomy combined with Carnoy's solution (GC. Thirteen lesions were associated with NBCCS (GS, while the others (n=27 were non-syndromic lesions (GnS. The recurrence-free periods (RFP in the sample groups were compared using the Kaplan-Meier function and log-rank test at a significance level of 5% (p 0.05 or increased CRR for the decompression (15.4% over five years. Application of Carnoy's solution did not increase the efficacy of the peripheral ostectomy, but was related to a CRR of 0% for the syndromic lesions over five years. Therefore, 1 decompression did not increase the recurrence risk; 2 peripheral ostectomy demonstrated a similar efficacy as the combination with Carnoy's solution; 3 the association of NBCCS did not seem to significantly influence OKC recurrence; and 4 syndromic lesions seem to behave in the same manner as non-syndromic lesions when submitted to complementary treatments.

  12. Can we eliminate neoadjuvant chemoradiotherapy in favor of neoadjuvant multiagent chemotherapy for select stage II/III rectal adenocarcinomas: Analysis of the National Cancer Data base.

    Science.gov (United States)

    Cassidy, Richard J; Liu, Yuan; Patel, Kirtesh; Zhong, Jim; Steuer, Conor E; Kooby, David A; Russell, Maria C; Gillespie, Theresa W; Landry, Jerome C

    2017-03-01

    Stage II and III rectal cancers have been effectively treated with neoadjuvant chemoradiotherapy (NCRT) followed by definitive resection. Advancements in surgical technique and systemic therapy have prompted investigation of neoadjuvant multiagent chemotherapy (NMAC) regimens with the elimination of radiation (RT). The objective of the current study was to investigate factors that predict for the use of NCRT versus NMAC and compare outcomes using the National Cancer Data Base (NCDB) for select stage II and III rectal cancers. In the NCDB, 21,707 patients from 2004 through 2012 with clinical T2N1 (cT2N1), cT3N0, or cT3N1 rectal cancers were identified who had received NCRT or NMAC followed by low anterior resection. Kaplan-Meier analyses, log-rank tests, and Cox-proportional hazards regression analyses were conducted along with propensity score matching analysis to reduce treatment selection bias. The 5-year actuarial overall survival (OS) rate was 75% for patients who received NCRT versus 67.2% for those who received NMAC (P elimination of neoadjuvant RT for select patients with stage II and III rectal adenocarcinoma was associated with worse OS and should not be recommended outside of a clinical trial. Cancer 2017;123:783-93. © 2016 American Cancer Society. © 2016 American Cancer Society.

  13. Mortality in relation to the type of household among elderly people living in a community.

    Science.gov (United States)

    Nakanishi, N; Nakura, I; Nagano, K; Yoneda, H; Takatorige, T; Shinsho, F; Tatara, K

    1998-03-01

    The objective of this study was to determine whether there is an association of mortality with the type of household in elderly people. A cohort of 1,352 elderly people aged 65 years and over at baseline in October 1992 was followed for 42 months. Follow-up was completed for 1,266 (93.6%) (172 deceased and 1,094 alive). From the analysis using the Kaplan-Meier method and the log-rank test, male sex, older age group (75 years and over), no satisfaction with present dwelling, disability, no use of health checks, no practices of daily preventive health promotion, no participation in social activities, and no finding life worth living (no Ikigai) were univariately statistically significantly related to mortality. Furthermore, elderly people living with their spouse only or living alone had higher survival rates than those living with their spouse and children or living with their children, and the curves among the four subclasses of household were significantly different. From the Cox proportional hazards model, living with a spouse only remained as an independent predictor for survival, and living alone was not an increased risk factor for mortality, controlling for sex, age, housing conditions, disability, use of health management, and psychosocial conditions.

  14. Clinical implication of elevated human cervical cancer oncogene-1 expression in esophageal squamous cell carcinoma.

    Science.gov (United States)

    Liu, Ying; Li, Ke; Ren, Zhonghai; Li, Shenglei; Zhang, Hongyan; Fan, Qingxia

    2012-07-01

    The human cervical cancer oncogene 1 (HCCR-1), a novel human oncoprotein, has been shown to be upregulated in various human tumors and plays a critical role in tumorigenesis and tumor progression. Here, the authors investigated HCCR-1 level in esophageal squamous cell carcinoma (ESCC) tissues and assessed the correlation between HCCR-1 level and prognosis of the patients with ESCC. HCCR-1 levels were investigated by immunohistochemistry, in situ hybridization, real-time quantitative RT-PCR and Western blotting methods; Kaplan-Meier curve was used to evaluate the prognostic value of HCCR-1 level in patients with ESCC using log-rank test. HCCR-1 displayed high levels in ESCC tissues compared to squamous dysplasia tissues and normal esophageal epithelial tissues. No significant correlation was observed between the levels of HCCR-1 mRNA and protein and gender and age (all p>0.05) but obviously related to histological grade, clinical stage, and lymph node metastasis (all p<0.001). Moreover, the survival rate of the patients with low HCCR-1 levels was higher than that of the patients with high HCCR-1 levels (both p<0.05). These data demonstrate that HCCR-1 may be used as a novel predictor for the prognosis of the patients with ESCC.

  15. Prognostic classification index in Iranian colorectal cancer patients: Survival tree analysis

    Directory of Open Access Journals (Sweden)

    Amal Saki Malehi

    2016-01-01

    Full Text Available Aims: The aim of this study was to determine the prognostic index for separating homogenous subgroups in colorectal cancer (CRC patients based on clinicopathological characteristics using survival tree analysis. Methods: The current study was conducted at the Research Center of Gastroenterology and Liver Disease, Shahid Beheshti Medical University in Tehran, between January 2004 and January 2009. A total of 739 patients who already have been diagnosed with CRC based on pathologic report were enrolled. The data included demographic and clinical-pathological characteristic of patients. Tree-structured survival analysis based on a recursive partitioning algorithm was implemented to evaluate prognostic factors. The probability curves were calculated according to the Kaplan-Meier method, and the hazard ratio was estimated as an interest effect size. Result: There were 526 males (71.2% of these patients. The mean survival time (from diagnosis time was 42.46± (3.4. Survival tree identified three variables as main prognostic factors and based on their four prognostic subgroups was constructed. The log-rank test showed good separation of survival curves. Patients with Stage I-IIIA and treated with surgery as the first treatment showed low risk (median = 34 months whereas patients with stage IIIB, IV, and more than 68 years have the worse survival outcome (median = 9.5 months. Conclusion: Constructing the prognostic classification index via survival tree can aid the researchers to assess interaction between clinical variables and determining the cumulative effect of these variables on survival outcome.

  16. Postoperative radiotherapy for stage II and III rectal cancer

    International Nuclear Information System (INIS)

    Qian Liting; Song Yongwen; Liu Xinfan; Yu Zihao; Qian Tunan; Li Yexiong

    2003-01-01

    Objective: To evaluate the impact of postoperative adjuvant radiotherapy, compared with surgery alone for rectal cancer. Methods: From January 1994 to October 1997, 192 patients with stage II or III rectal cancer were treated by radical resection and postoperative radiotherapy (Group S + R) and 51 patients with the same stage lesions underwent surgery alone (Group S). The median dose of radiation was 50(32-62) Gy. Kaplan-Meier method and Log-rank test were used for analysis. Results: The 5-year overall and disease-free survival rates were 60.3% and 58.3%, respectively. The overall 5-year survival rate was 59.4% in Group S + R and 64.7% in Group S, and the 5-year disease-free survival rates were 57.0% and 66.4%, respectively. There were no significant differences between either group (P=0.601 and P=0.424). The disease-free survival was not significantly prolonged in Group S + R as compared with that of Group S. The local recurrence rate was evidently reduced in Group S + R (15.8% v 26.8%, P=0.043). Conclusion: Local recurrence is a major cause of morbidity and mortality in rectal cancer. Postoperative radiotherapy, though reduces the incidence of local recurrence, does not improve the survival in the treatment of stage II and III diseases

  17. KRAS polymorphisms are associated with survival of CRC in Chinese population.

    Science.gov (United States)

    Dai, Qiong; Wei, Hui Lian; Huang, Juan; Zhou, Tie Jun; Chai, Li; Yang, Zhi-Hui

    2016-04-01

    rs12245, rs12587, rs9266, rs1137282, rs61764370, and rs712 of KRAS oncogene are characterized in the 3'UTR. The study highlights the important role of these polymorphisms playing in the susceptibility, oxaliplatin-based chemotherapy sensitivity, progression, and prognosis of CRC. Improved multiplex ligation detection reaction (iMLDR) technique is used for genotyping. An unconditional logistic regression model was used to estimate the association of certain polymorphism and CRC risk. The Kaplan-Meier method, log-rank test, and Cox regression model were used to evaluate the effects of polymorphisms on survival analysis. Results demonstrated that TT genotype and T allele of rs712 were associated with the increased risk of CRC; the patients with GG genotype and G allele of rs61764370 had a shorter survival and a higher risk of relapse or metastasis of CRC. Our studies supported the conclusions that rs61764370 and rs712 polymorphisms of the KRAS are functional and it may play an important role in the development of CRC and oxaliplatin-based chemotherapy efficiency and prognosis of CRC.

  18. Clinical characteristics associated with mortality of patients with anaerobic bacteremia.

    Science.gov (United States)

    Umemura, Takumi; Hamada, Yukihiro; Yamagishi, Yuka; Suematsu, Hiroyuki; Mikamo, Hiroshige

    2016-06-01

    The presence of anaerobes in the blood stream is known to be associated with a higher rate of mortality. However, few prognostic risk factor analyses examining whether a patient's background characteristics are associated with the prognosis have been reported. We performed a retrospective case-controlled study to assess the prognostic factors associated with death from anaerobic bacteremia. Seventy-four patients with anaerobic bacteremia were treated between January 2005 and December 2014 at Aichi Medical University Hospital. The clinical information included drug susceptibility was used for analysis of prognostic factors for 30-day mortality. Multivariate logistic analyses revealed an association between the 30-day mortality rate and malignancy (OR: 3.64, 95% CI: 1.08-12.31) and clindamycin resistance (OR: 7.93, 95% CI: 2.33-27.94). The result of Kaplan-Meier analysis of mortality showed that the 30-day survival rate was 83% in clindamycin susceptible and 38.1% in clindamycin resistant anaerobes causing bacteremia. The result of log-rank test also showed that susceptibility to clindamycin affected mortality (P anaerobic bacteremia with a higher risk of 30-day mortality. The results of this study are important for the early and appropriate management of patients with anaerobic bacteremia. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. The Impact of Anastomotic Angle for Re-Occlusion of Brachioaxillary Graft Arteriovenous Fistula after Percutaneous Thromboaspiration

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Keon Young; Jin, Gong Yong; Hwang, Seung Bae; Choi, Eun Jung; Song, Ji Soo; Han, Young Min; Kwon, Keun Sang [Chonbuk National University Hospital and Medical School, Jeonju (Korea, Republic of)

    2013-03-15

    The purpose of this study is to evaluate the factors that affect graft patency in brachioaxillary graft arteriovenous fistula patients. A retrospective study was conducted on 33 patients (20 men, 13 women; mean age, 67.5 years; mean interval to first stenosis, 17 months), who had performed percutaneous angioplasty for first episode of stenosis after brachioaxillary graft surgery. We evaluated the relevant factors affecting the graft patency after first episode of stenosis, such as age, sex, underlying disease (hypertension, diabetes mellitus, hyperlipidemia, cardiovascular disease, cerebrovascular attack), anastomotic angle between graft and axillary vein, and anastomotic angle between the graft and brachial artery. Kaplan-Meier method and log rank test and receiver operating characteristics curve analysis were used in statistical analysis. Graft patency rates after 1 month, 6 months, and 12 months were 75.8%, 39.4%, and 9.1%. There was a correlation between graft-axillary vein anastomotic angle and patency rates (r = 0.372, p = 0.033); larger the venous anastomotic angle, the longer patency rate. However, it does not come up with significant results in patency rates on age, sex, underlying disease, and graft-brachial artery angle. In patients with brachioaxillary graft arteriovenous fistula, as venous anastomotic angle more obtuse, the graft patency may be longer.

  20. EMMPRIN expression positively correlates with WHO grades of astrocytomas and meningiomas.

    Science.gov (United States)

    Tsai, Wen-Chiuan; Chen, Ying; Huang, Li-Chun; Lee, Herng-Sheng; Ma, Hsin-I; Huang, Shih-Ming; Sytwu, Huey-Kang; Hueng, Dueng-Yuan

    2013-09-01

    High-grade primary brain tumors possessed poor outcome due to invasiveness. Extracellular matrix metalloproteinase inducer (EMMPRIN) stimulates peri-tumoral fibroblasts to secrete matrix metalloproteinase and promote invasiveness. This study hypothesized that high-grade brain tumors overexpress EMMPRIN. Analyzing the public delinked database from the Gene Expression Omnibus profile, the results showed that the EMMPRIN mRNA level was higher in WHO grade IV (n = 81) than in grade III (n = 19, p EMMPRIN levels positively correlated with WHO grades for astrocytomas (p = 0.008) and meningiomas (p = 0.048). EMMPRIN mRNA levels in conventional glioma cell lines (n = 36) was not less than those in glioma primary culture cells (n = 27) and glioblastoma stem-like cells (n = 12). The GBM8401, U87MG, and LN229 human glioma cell lines also overexpressed EMMPRIN. Hematoxylin and eosin, IHC, and immunofluorescence staining of xenografts confirmed that high-grade brain tumors overexpressed EMMPRIN. Lastly, Kaplan-Meier analysis revealed poorer survival in WHO grade IV (n = 56) than in grade III astrocytomas (n = 21, by log-rank test; p = 0.0001, 95 % CI: 1.842-3.053). However, in high-grade astrocytomas, there was no difference in survival between high and low EMMPRIN mRNA levels. Thus, this study identified that high-grade brain tumors overexpress EMMPRIN, which positively correlates with WHO grades in human astrocytomas and meningiomas, and suggests that EMMPRIN may be a therapeutic target of brain tumor.

  1. Metabolic Characteristics and Risks Associated with Stone Recurrence in Korean Young Adult Stone Patients.

    Science.gov (United States)

    Kang, Ho Won; Seo, Sung Pil; Kim, Won Tae; Kim, Yong-June; Yun, Seok-Joong; Kim, Wun-Jae; Lee, Sang-Cheol

    2017-08-01

    The aim of this study was to assess the metabolic characteristics and risks of stone recurrence in young adult stone patients in Korea. The medical records of 1532 patients presenting with renal or ureteric stones at our stone clinic between 1994 and 2015 were retrospectively reviewed. Patients were grouped according to age (young adult, 18-29 years; intermediate onset, 30-59 years; old age, ≥60 years) at first presentation, and measurements of clinicometabolic characteristics and risks of stone recurrence were compared. Overall, excretion of urinary stone-forming substances was highest in the intermediate onset group, followed by the young adult and old age groups. Importantly, excretion of urinary citrate was lowest in the young adult group. Kaplan-Meier analyses identified a significant difference between the three age groups in terms of stone recurrence (log rank test, p adult stone patients. Younger age (18-29 years) at first stone presentation was a significant risk factor for stone recurrence, and urinary citrate excretion was an independent risk factor affecting recurrence in this group. Metabolic evaluation and potassium citrate therapy should be considered for young adult stone patients to prevent recurrence.

  2. [Determinants of survival in HIV patients receiving antiretroviral therapy in Goma, Democratic Republic of Congo].

    Science.gov (United States)

    Akilimali, P Z; Mutombo, P B; Kayembe, P K; Kaba, D K; Mapatano, M A

    2014-06-01

    The study aimed to identify factors associated with the survival of patients receiving antiretroviral therapy. A historic cohort of HIV patients from two major hospitals in Goma (Democratic Republic of Congo) was followed from 2004 to 2012. The Kaplan-Meier method was used to describe the probability of survival as a function of time since inclusion into the cohort. The log-rank test was used to compare survival curves based on determinants. The Cox regression model identified the determinants of survival since treatment induction. The median follow-up time was 3.56 years (IQR=2.22-5.39). The mortality rate was 40 deaths per 1000 person-years. Male gender (RR: 2.56; 95 %CI 1.66-4.83), advanced clinical stage (RR: 2.12; 95 %CI 1.15-3.90), low CD4 count (CD4 < 50) (RR: 2.05; 95 %CI : 1.22-3.45), anemia (RR: 3.95; 95 %CI 2.60-6.01), chemoprophylaxis with cotrimoxazole (RR: 4.29, 95 % CI 2.69-6.86) and period of treatment initiation (2010-2011) (RR: 3.34; 95 %CI 1.24-8.98) were statistically associated with short survival. Initiation of treatment at an early stage of the disease with use of less toxic molecules and an increased surveillance especially of male patients are recommended to reduce mortality. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  3. Improving standard of care through introduction of laparoscopy for the surgical management of gynecological malignancies.

    Science.gov (United States)

    Bogani, Giorgio; Cromi, Antonella; Serati, Maurizio; Di Naro, Edoardo; Casarin, Jvan; Pinelli, Ciro; Candeloro, Ilario; Sturla, Davide; Ghezzi, Fabio

    2015-05-01

    This study aimed to evaluate the impact on perioperative and medium-term oncologic outcomes of the implementation of laparoscopy into a preexisting oncologic setting. Data from consecutive 736 patients undergoing surgery for apparent early stage gynecological malignancies (endometrial, cervical, and adnexal cancers) between 2000 and 2011 were reviewed. Complications were graded per the Accordion classification. Survival outcomes within the first 5 years were analyzed using Kaplan-Meier method. Overall, 493 (67%), 162 (22%), and 81 (11%) had surgery for apparent early stage endometrial, cervical, and adnexal cancer. We assisted at an increase of the number of patients undergoing surgery via laparoscopy through the years (from 10% in the years 2000-2003 to 82% in years 2008-2011; P 0.05). The introduction of laparoscopy did not adversely affect medium-term (within 5 years) survival outcomes of patients undergoing surgery for apparent early stage cancers of the endometrium, uterine cervix, and adnexa (P > 0.05 log-rank test). The introduction of laparoscopy into a preexisting oncologic service allows an improvement of standard of care due to a gain in perioperative results, without detriments of medium-term oncologic outcomes.

  4. Atrophic gastritis and enlarged gastric folds diagnosed by double-contrast upper gastrointestinal barium X-ray radiography are useful to predict future gastric cancer development based on the 3-year prospective observation.

    Science.gov (United States)

    Yamamichi, Nobutake; Hirano, Chigaya; Ichinose, Masao; Takahashi, Yu; Minatsuki, Chihiro; Matsuda, Rie; Nakayama, Chiemi; Shimamoto, Takeshi; Kodashima, Shinya; Ono, Satoshi; Tsuji, Yosuke; Niimi, Keiko; Sakaguchi, Yoshiki; Kataoka, Yosuke; Saito, Itaru; Asada-Hirayama, Itsuko; Takeuchi, Chihiro; Yakabi, Seiichi; Kaikimoto, Hikaru; Matsumoto, Yuta; Yamaguchi, Daisuke; Kageyama-Yahara, Natsuko; Fujishiro, Mitsuhiro; Wada, Ryoichi; Mitsushima, Toru; Koike, Kazuhiko

    2016-07-01

    Double-contrast upper gastrointestinal barium X-ray radiography (UGI-XR) is the standard gastric cancer screening method in Japan. Atrophic gastritis and enlarged gastric folds are considered the two major features of Helicobacter pylori-induced chronic gastritis, but the clinical meaning of evaluating them by UGI-XR has not been elucidated. We analyzed healthy UGI-XR examinees without a history of gastrectomy, previous Helicobacter pylori eradication and usage of gastric acid suppressants. Of the 6433 subjects, 1936 (30.1 %) had atrophic gastritis and 1253 (19.5 %) had enlarged gastric folds. During the 3-year prospective observational follow-up, gastric cancer developed in seven subjects, six of whom (85.7 %) had atrophic gastritis with H. pylori infection and five of whom (71.4 %) had enlarged gastric folds with H. pylori infection. The Kaplan-Meier method with log-rank testing revealed that both UGI-XR-based atrophic gastritis (p = 0.0011) and enlarged gastric folds (p = 0.0003) are significant predictors for future gastric cancer incidence.

  5. Comparative analysis of whole mount processing and systematic sampling of radical prostatectomy specimens: pathological outcomes and risk of biochemical recurrence.

    Science.gov (United States)

    Salem, Shady; Chang, Sam S; Clark, Peter E; Davis, Rodney; Herrell, S Duke; Kordan, Yakup; Wills, Marcia L; Shappell, Scott B; Baumgartner, Roxelyn; Phillips, Sharon; Smith, Joseph A; Cookson, Michael S; Barocas, Daniel A

    2010-10-01

    Whole mount processing is more resource intensive than routine systematic sampling of radical retropubic prostatectomy specimens. We compared whole mount and systematic sampling for detecting pathological outcomes, and compared the prognostic value of pathological findings across pathological methods. We included men (608 whole mount and 525 systematic sampling samples) with no prior treatment who underwent radical retropubic prostatectomy at Vanderbilt University Medical Center between January 2000 and June 2008. We used univariate and multivariate analysis to compare the pathological outcome detection rate between pathological methods. Kaplan-Meier curves and the log rank test were used to compare the prognostic value of pathological findings across pathological methods. There were no significant differences between the whole mount and the systematic sampling groups in detecting extraprostatic extension (25% vs 30%), positive surgical margins (31% vs 31%), pathological Gleason score less than 7 (49% vs 43%), 7 (39% vs 43%) or greater than 7 (12% vs 13%), seminal vesicle invasion (8% vs 10%) or lymph node involvement (3% vs 5%). Tumor volume was higher in the systematic sampling group and whole mount detected more multiple surgical margins (each p systematic sampling yield similar pathological information. Each method stratifies patients into comparable risk groups for biochemical recurrence. Thus, while whole mount is more resource intensive, it does not appear to result in improved detection of clinically important pathological outcomes or prognostication. Copyright © 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  6. Six-month bracket failure rate with a flowable composite: A split-mouth randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Sindhuja Krishnan

    Full Text Available ABSTRACT INTRODUCTION: The use of flowable composites as an orthodontic bonding adhesive merits great attention because of their adequate bond strength, ease of clinical handling and reduced number of steps in bonding. OBJECTIVE: The aim of this Randomized Controlled Trial was to comparatively evaluate over a 6-month period the bond failure rate of a flowable composite (Heliosit Orthodontic, Ivoclar Vivadent AG, Schaan and a conventional orthodontic bonding adhesive (Transbond XT, 3M Unitek. METHODS: 53 consecutive patients (23 males and 30 females who fulfilled the inclusion and exclusion criteria were included in the study. A total of 891 brackets were analyzed, where 444 brackets were bonded using Heliosit Orthodontic and 447 brackets were bonded using Transbond XT. The survival rates of brackets were estimated with the Kaplan-Meier analysis. Bracket survival distributions for bonding adhesives, tooth location and dental arch were compared with the log-rank test. RESULTS: The failure rates of the Transbond XT and the Heliosit Orthodontic groups were 8.1% and 6% respectively. No significant differences in the survival rates were observed between them (p= 0.242. There was no statistically significant difference in the bond failure rates when the clinical performance of the maxillary versus the mandibular arches and the anterior versus the posterior segments were compared. CONCLUSIONS: Both systems had clinically acceptable bond failure rates and are adequate for orthodontic bonding needs.

  7. Time trends in recurrence of juvenile nasopharyngeal angiofibroma: Experience of the past 4 decades.

    Science.gov (United States)

    Mishra, Anupam; Mishra, Subhash Chandra

    2016-01-01

    An analysis of time distribution of juvenile nasopharyngeal angiofibroma (JNA) from the last 4 decades is presented. Sixty recurrences were analyzed as per actuarial survival. SPSS software was used to generate Kaplan-Meier (KM) curves and time distributions were compared by Log-rank, Breslow and Tarone-Ware test. The overall recurrence rate was 17.59%. Majority underwent open transpalatal approach(es) without embolization. The probability of detecting a recurrence was 95% in first 24months and comparison of KM curves of 4 different time periods was not significant. This is the first and largest series to address the time-distribution. The required follow up period is 2years. Our recurrence is just half of the largest series (reported so far) suggesting the superiority of transpalatal techniques. The similarity of curves suggests less likelihood for recent technical advances to influence the recurrence that as per our hypothesis is more likely to reflect tumor biology per se. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Use of Oncept melanoma vaccine in 69 canine oral malignant melanomas in the UK.

    Science.gov (United States)

    Verganti, S; Berlato, D; Blackwood, L; Amores-Fuster, I; Polton, G A; Elders, R; Doyle, R; Taylor, A; Murphy, S

    2017-01-01

    Oral malignant melanomas carry a poor-to-guarded prognosis because of their local invasiveness and high metastatic propensity. The Oncept melanoma vaccine is licensed to treat dogs with stage II or III locally-controlled oral malignant melanoma and this retrospective study aimed to assess survival of affected dogs treated with the vaccine in the UK. Medical records of dogs with histopathologically-confirmed oral malignant melanoma that received the vaccine as part of their treatment were evaluated. Survival analyses for potential prognostic factors were performed. Sixty-nine dogs were included; 56 dogs, staged I to III, and with previous locoregional therapy, had a median survival time of 455 days (95% CI: 324 to 586 days). Based on Kaplan-Meier survival analysis with associated log-rank testing, no significant prognostic factors were identified for this population. Of the 13 patients with macroscopic disease treated with vaccine alone or in combination therapy, eight showed clinical response. Three patients with stage IV oral malignant melanoma survived 171, 178 and 288 days from diagnosis. Patients treated with the melanoma vaccine in our study had survival times similar to their counterparts receiving the vaccine in the USA. There were observed responses in patients with macroscopic disease and so the vaccine could be considered as palliative treatment in dogs with stage IV disease. © 2017 British Small Animal Veterinary Association.

  9. Cancer association study of aminoacyl-tRNA synthetase signaling network in glioblastoma.

    Directory of Open Access Journals (Sweden)

    Yong-Wan Kim

    Full Text Available Aminoacyl-tRNA synthetases (ARSs and ARS-interacting multifunctional proteins (AIMPs exhibit remarkable functional versatility beyond their catalytic activities in protein synthesis. Their non-canonical functions have been pathologically linked to cancers. Here we described our integrative genome-wide analysis of ARSs to show cancer-associated activities in glioblastoma multiforme (GBM, the most aggressive malignant primary brain tumor. We first selected 23 ARS/AIMPs (together referred to as ARSN, 124 cancer-associated druggable target genes (DTGs and 404 protein-protein interactors (PPIs of ARSs using NCI's cancer gene index. 254 GBM affymetrix microarray data in The Cancer Genome Atlas (TCGA were used to identify the probe sets whose expression were most strongly correlated with survival (Kaplan-Meier plots versus survival times, log-rank t-test <0.05. The analysis identified 122 probe sets as survival signatures, including 5 of ARSN (VARS, QARS, CARS, NARS, FARS, and 115 of DTGs and PPIs (PARD3, RXRB, ATP5C1, HSP90AA1, CD44, THRA, TRAF2, KRT10, MED12, etc. Of note, 61 survival-related probes were differentially expressed in three different prognosis subgroups in GBM patients and showed correlation with established prognosis markers such as age and phenotypic molecular signatures. CARS and FARS also showed significantly higher association with different molecular networks in GBM patients. Taken together, our findings demonstrate evidence for an ARSN biology-dominant contribution in the biology of GBM.

  10. Postoperative radiotherapy in patients with salivary duct carcinoma. Clinical outcomes and prognostic factors

    International Nuclear Information System (INIS)

    Shinoto, Makoto; Shioyama, Yoshiyuki; Nakamura, Katsumasa

    2013-01-01

    This study sought to investigate the clinical outcome and the role of postoperative radiotherapy for patients with salivary duct carcinoma (SDC) who had undergone surgery and postoperative radiotherapy. We performed a retrospective analysis of 25 SDC patients treated between 1998 and 2011 with surgery and postoperative radiotherapy. The median prescribed dose was 60 Gy (range, 49.5-61.4 Gy). The clinical target volume (CTV) was defined as the tumor bed in four patients, the tumor bed and ipsilateral neck in 14 patients, and the tumor bed and bilateral neck in six patients. Local control (LC), disease-free survival (DFS) and overall survival (OS) were estimated using the Kaplan-Meier method, and prognostic variables were analyzed with the log-rank test. The 5-year LC, DFS and OS were 67%, 45% and 47%, respectively. Disease recurrence was found in 12 patients: seven as local, four as regional and eight as distant failure. Perineural and lymphovascular invasion was a significant prognostic factor for LC (P=0.03). Local failure was common, and the presence of local recurrence significantly affected the OS (P<0.05). We conclude that surgery and postoperative radiotherapy is expected to decrease the risk of local failure and contribute to good prognoses for patients with SDC. It might be advisable to have the CTV include the cranial nerves involved and the corresponding parts of the skull base in cases of pathologically positive perineural invasion. (author)

  11. Adjuvant treatment for resected rectal cancer: impact of standard and intensified postoperative chemotherapy on disease-free survival in patients undergoing preoperative chemoradiation-a propensity score-matched analysis of an observational database.

    Science.gov (United States)

    Garlipp, Benjamin; Ptok, Henry; Benedix, Frank; Otto, Ronny; Popp, Felix; Ridwelski, Karsten; Gastinger, Ingo; Benckert, Christoph; Lippert, Hans; Bruns, Christiane

    2016-12-01

    Adjuvant chemotherapy for resected rectal cancer is widely used. However, studies on adjuvant treatment following neoadjuvant chemoradiotherapy (CRT) and total mesorectal excision (TME) have yielded conflicting results. Recent studies have focused on adding oxaliplatin to both preoperative and postoperative therapy, making it difficult to assess the impact of adjuvant oxaliplatin alone. This study was aimed at determining the impact of (i) any adjuvant treatment and (ii) oxaliplatin-containing adjuvant treatment on disease-free survival in CRT-pretreated, R0-resected rectal cancer patients. Patients undergoing R0 TME following 5-fluorouracil (5FU)-only-based CRT between January 1, 2008, and December 31, 2010, were selected from a nationwide registry. After propensity score matching (PSM), comparison of disease-free survival (DFS) using Kaplan-Meier analysis and log-rank test was performed in (i) patients receiving no vs. any adjuvant treatment and (ii) patients treated with adjuvant 5FU/capecitabine without vs. with oxaliplatin. Out of 1497 patients, 520 matched pairs were generated for analysis of no vs. any adjuvant treatment. Mean DFS was significantly prolonged with adjuvant treatment (81.8 ± 2.06 vs. 70.1 ± 3.02 months, p rectal cancer patients treated with neoadjuvant CRT and TME surgery under routine conditions, adjuvant chemotherapy significantly improved DFS. No benefit was observed for the addition of oxaliplatin to adjuvant chemotherapy in this setting.

  12. Thymidine phosphorylase and hypoxia-inducible factor 1-α expression in clinical stage II/III rectal cancer: association with response to neoadjuvant chemoradiation therapy and prognosis.

    Science.gov (United States)

    Lin, Shuhan; Lai, Hao; Qin, Yuzhou; Chen, Jiansi; Lin, Yuan

    2015-01-01

    The aim of this study was to determine whether pretreatment status of thymidine phosphorylase (TP), and hypoxia-inducible factor alpha (HIF-1α) could predict pathologic response to neoadjuvant chemoradiation therapy with oxaliplatin and capecitabine (XELOXART) and outcomes for clinical stage II/III rectal cancer patients. A total of 180 patients diagnosed with clinical stage II/III rectal cancer received XELOXART. The status of TP, and HIF-1α were determined in pretreatment biopsies by immunohistochemistry (IHC). Tumor response was assessed in resected regimens using the tumor regression grade system and TNM staging system. 5-year disease free survival (DFS) and 5-year overall survival (OS) were evaluated with the Kaplan-Meier method and were compared by the log-rank test. Over expression of TP and low expression of HIF-1α were associated with pathologic response to XELOXART and better outcomes (DFS and OS) in clinical stage II/III rectal cancer patients (P rectal cancer received XELOXART. Additional well-designed, large sample, multicenter, prospective studies are needed to confirm the result of this study.

  13. Analysis of a novel protocol of combined induction chemotherapy and concurrent chemoradiation in unresected non-small-cell lung cancer: a ten-year experience with vinblastine, Cisplatin, and radiation therapy.

    Science.gov (United States)

    Waters, Eugenie; Dingle, Brian; Rodrigues, George; Vincent, Mark; Ash, Robert; Dar, Rashid; Inculet, Richard; Kocha, Walter; Malthaner, Richard; Sanatani, Michael; Stitt, Larry; Yaremko, Brian; Younus, Jawaid; Yu, Edward

    2010-07-01

    The London Regional Cancer Program (LRCP) uses a unique schedule of induction plus concurrent chemoradiation, termed VCRT (vinblastine, cisplatin, and radiation therapy), for the treatment of a subset of unresectable stage IIIA and IIIB non-small-cell lung cancer (NSCLC). This analysis was conducted to better understand the outcomes in VCRT-treated patients. We report a retrospective analysis of a large cohort of patients who underwent VCRT at the LRCP over a 10-year period, from 1996 to 2006. The analysis focused on OS, toxicities, and the outcomes from completion surgery in a small subset of patients. A total of 294 patients were included and 5-year OS, determined using Kaplan-Meier methodology, was 19.8% with a MST of 18.2 months. Reported grade 3-4 toxicities included neutropenia (39%), anemia (10%), pneumonitis (1%), and esophagitis (3%). Significant differences in survival between groups of patients were demonstrated with log-rank tests for completion surgery, use of radiation therapy, and cisplatin dose. Similarly, Univariate Cox regression showed that completion surgery, use of radiation therapy, cisplatin dose, and vinblastine dose were associated with increased survival. This retrospective analysis of a large cohort of patients reveals an OS for VCRT comparable to that reported in the literature for other current combined chemoradiation protocols. The success of this protocol seems to be dose dependent and the outcomes in those who underwent completion surgery suggests that pathologic complete remission is possible for IIIA and IIIB NSCLC.

  14. Radiochemotherapy in Anal Cancer: cCR, clinical outcomes and quality of life using two different treatment schedules.

    Science.gov (United States)

    Di Santo, Sara; Trignani, Marianna; Neri, Matteo; Milano, Angelo; Innocenti, Paolo; Taraborrelli, Maria; Augurio, Antonietta; Vinciguerra, Annamaria; Di Tommaso, Monica; Ursini, Lucia Anna; Di Pilla, Angelo; Di Nicola, Marta; Genovesi, Domenico

    2015-01-01

    Main endpoint was a response rate to therapy; secondary endpoints were disease-free survival, overall survival, acute and late toxicities, specially in terms of anorectal and urinary continence. Radiochemotherapy for anal cancer achieves a good clinical response, locoregional control, anal function preservation. However, oncologic outcomes can differ using radiotherapy plus fluorouracil and mytomicin vs. cisplatin and fluorouracil. Between 2000 and 2012, 27 anal cancer patients receiving radiotherapy combined with two different radiochemotherapy schedules, fluorouracil and mytomicin (group A) and cisplatin plus fluorouracil (group B). The Kaplan-Meier method was also used to estimate local control, overall survival and disease free survival. Statistical significance between curves was evaluated using the Log-rank test. Complete pathological response was found in 85.2% of patients, with higher rates of response in the group A (100% vs. 63.6%, p = 0.039). No significantly difference was found between the two groups for the other endpoints. Low rates of both acute and late toxicities were recorded. Radiotherapy plus fluorouracil and mytomicin provide a better complete pathological response than radiotherapy plus cisplatin and fluorouracil and a greater rate of anal sphincter function preservation. Globally, radiochemotherapy of the anal cancer provides excellent clinical outcomes with a good profile of acute and late toxicity, without difference between the two groups studied.

  15. Severe Pulmonary Toxicity After Myeloablative Conditioning Using Total Body Irradiation: An Assessment of Risk Factors

    International Nuclear Information System (INIS)

    Kelsey, Chris R.; Horwitz, Mitchell E.; Chino, Junzo P.; Craciunescu, Oana; Steffey, Beverly; Folz, Rodney J.; Chao, Nelson J.; Rizzieri, David A.; Marks, Lawrence B.

    2011-01-01

    Purpose: To assess factors associated with severe pulmonary toxicity after myeloablative conditioning using total body irradiation (TBI) followed by allogeneic stem cell transplantation. Methods and Materials: A total of 101 adult patients who underwent TBI-based myeloablative conditioning for hematologic malignancies at Duke University between 1998 and 2008 were reviewed. TBI was combined with high-dose cyclophosphamide, melphalan, fludarabine, or etoposide, depending on the underlying disease. Acute pulmonary toxicity, occurring within 90 days of transplantation, was scored using Common Terminology Criteria for Adverse Events version 3.0. Actuarial overall survival and the cumulative incidence of acute pulmonary toxicity were calculated via the Kaplan-Meier method and compared using a log-rank test. A binary logistic regression analysis was performed to assess factors independently associated with acute severe pulmonary toxicity. Results: The 90-day actuarial risk of developing severe (Grade 3-5) pulmonary toxicity was 33%. Actuarial survival at 90 days was 49% in patients with severe pulmonary toxicity vs. 94% in patients without (p < 0.001). On multivariate analysis, the number of prior chemotherapy regimens was the only factor independently associated with development of severe pulmonary toxicity (odds ratio, 2.7 per regimen). Conclusions: Severe acute pulmonary toxicity is prevalent after TBI-based myeloablative conditioning regimens, occurring in approximately 33% of patients. The number of prior chemotherapy regimens appears to be an important risk factor.

  16. Increased Risk of Anxiety or Depression After Traumatic Spinal Cord Injury in Patients with Preexisting Hyperlipidemia: A Population-Based Study.

    Science.gov (United States)

    Lim, Sher-Wei; Eric Nyam, Tee-Tau; Ho, Chung-Han; Shiue, Yow-Ling; Wang, Jhi-Joung; Chio, Chung-Ching; Kuo, Jinn-Rung

    2017-10-01

    Anxiety or depression (AD) is a common complication after traumatic spinal cord injury (tSCI). This study sought to investigate the role of preexisting hyperlipidemia in new-onset AD after tSCI using a longitudinal population database. This retrospective cohort study used Longitudinal Health Insurance Database data from January 1997 to December 2011. The case and comparison groups were individuals who experienced tSCI and who did and did not have preexisting hyperlipidemia, respectively. Kaplan-Meier curves were plotted, and log-rank test was used to compare the differences between these 2 groups. A Cox regression model was used to estimate the relative risk of AD. A total of 26,892 adult patients were enrolled in this study. After 1:3 matching with age and gender, it showed 1) tSCI patients with preexisting hyperlipidemia have a 1.32-fold adjusted hazard ratio (HR) compared with those without hyperlipidemia (P 2; HR, 1.9; 95% CI 1.2-2.9), and those with a history of stroke (HR, 1.7; 95% CI 1.0-2.7). Preexisting hyperlipidemia is an independent predictor of new-onset AD in patients with tSCI, especially in those who are younger, male, have a higher CCI score, and have stroke. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Mortality predictors of HIV-infected patients on antiretroviral therapy in Debre Tabor General Hospital and Woreta Health Center, South Gondar Zone, Northwest Ethiopia

    Directory of Open Access Journals (Sweden)

    Mekonnen Assefa Ahunie

    2017-02-01

    Full Text Available Objective: To investigate the mortality predictors of HIV-infected individuals who were receiving antiretroviral treatment. Methods: Data were extracted from medical records of 698 antiretroviral therapy (ART users enrolled at Debre Tabor General Hospital and Woreta Health Center from January 2005 to June 2014 and sociodemographic, clinical and ART-related data were collected. Mortality was compared by using time-to-event Kaplan-Meier method and log rank test and Cox regression analysis were used to identify the predictors of mortality. Results: The overall mortality rate was 1.5 per 100 persons per year. Ambulatory and bedridden patients had four- and seven-fold higher risk of death [adjusted hazard ratio (HR = 4.2, 95% confidence interval (CI: 1.7–10.7 and adjusted HR = 6.5, 95% CI: 2.0–20.7, respectively] as compared to those patients who had worked functional status. Patients who had poor antiretroviral drug adherence had five times higher risk of death (adjusted HR = 5.1, 95% CI: 1.6–16.3 than patients who had good antiretroviral adherence. Conclusions: Mortality rate was highly observed in the early phase of antiretroviral treatment. Poor ART adherence, being ambulatory and bedridden functional status was independent predictors of mortality.

  18. Infectious Complications of Radiologically Inserted Hickman Catheters in Patients with Hematologic Disorders

    International Nuclear Information System (INIS)

    Bakker, Jeannette; Overhagen, Hans van; Wielenga, Jenne; Marie, Siem de; Nouwen, Jan; Ridder, Marie A.J. de; Lameris, Johan S.

    1998-01-01

    Purpose: To assess the incidence of infections and its influence on the survival of radiologically inserted Hickman catheters (HCs) in patients with hematologic disorders and to determine factors associated with premature HC removal. Methods: Survival and complications of 175 HCs in 115 patients were studied retrospectively. To describe the data the Kaplan-Meier method and the log-rank test were used, using the date of HC removal due to HC-related infection as endpoint. A stratified Cox regression model was used to determine explanatory factors. Results: Seventy (40%) HCs were removed prematurely because of proven or probable HC-related infections. The incidence of infection leading to HC removal was 4.78 per 1000 catheter-days for proven HC infections. Univariate analysis revealed that acute myeloid leukemia, acute lymphocytic leukemia, or treatment for these diseases, gender, each subsequent catheter in the same patient and insertion site increased the risk of premature removal of the catheter due to infection. Conclusion: Infection is a major problem in patients with HCs. Unfortunately, the factors associated with increased infection rates that were found in this study cannot be influenced. Further studies are necessary to determine the role of environmental conditions in a radiology suite in relation to the risk of developing a catheter-related infection

  19. Relationship Between Preoperative Sarcopenia Status and Immuno-nutritional Parameters in Patients with Early-stage Non-small Cell Lung Cancer.

    Science.gov (United States)

    Shoji, Fumihiro; Matsubara, Taichi; Kozuma, Yuka; Haratake, Naoki; Akamine, Takaki; Takamori, Shinkichi; Katsura, Masakazu; Toyokawa, Gouji; Okamoto, Tatsuro; Maehara, Yoshihiko

    2017-12-01

    Although the skeletal muscle in the region of the third lumbar vertebra (L3) is generally assessed in order to judge sarcopenia, not every patient with non-small cell lung cancer (NSCLC) undergoes computed tomography including the L3 region. We hypothesized that immuno-nutritional parameters could predict the existence of sarcopenia in patients with NSCLC. The aim of this study was to retrospectively investigate the correlation between preoperative sarcopenia and immuno-nutritional parameters in patients with early-stage NSCLC. We selected 147 of patients with pathological stage I NSCLC who underwent preoperative measurement of immuno-nutritional parameters and CT including the L3 region. Preoperative sarcopenia was significantly associated with female gender (p=0.0003) and poor prognosis (p=0.0322). In Kaplan-Meier analysis of overall survival (OS) by preoperative sarcopenia status, the sarcopenic group had significantly shorter OS than the non-sarcopenic group (5-year OS: 87.27% vs. 77.37%, p=0.0131, log-rank test). In multivariate analysis, the preoperative sarcopenia status (hazard ratio=5.138; 95% confidence interval=2.305-11.676; psarcopenia status was significantly related to controlling nutritional status score (p=0.0071) and Geriatric Nutritional Risk Index (GNRI) (psarcopenia status and GNRI (r=0.348, psarcopenia which was associated with poor outcome in patients with early-stage NSCLC. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  20. Does protein energy malnutrition affect the outcome in Tunisian cirrhotic patients?

    Science.gov (United States)

    Ennaifer, Rym; Cheikh, Myriam; Romdhane, Haifa; Sabbagh, Safa; Ben Nejma, Houda; Bougassas, Wassila; Bel Hadj, Najet

    2016-02-01

    Malnutrition is commonly seen in cirrhotic patients and has been shown to adversely affect outcome. However, it remains associated with the severity of cirrhosis. Therefore, its role as an independent prognostic factor is still under debate. The aims of our study were to determine the prevalence of malnutrition in cirrhotic patients and determine whether this condition was an independent prognostic factor. We prospectively analyzed the nutritional status of 104 consecutive patients with cirrhosis Subjective global nutritional assessment (SGA) and anthropometry [dry body mass index (BMI), triceps skinfold (TSF), arm muscle circumference (AMC)] were used for the evaluation of the nutritional status. Complications of cirrhosis during follow-up and patient's survival were recorded. Global survival and survival without complications was studied by Kaplan Meier method and using Log Rank test. Prevalence of malnutrition ranged from 16.3 and 62.5% according to the method of nutritional assessment used. Survival without complications was reduced in malnourished patients. This difference was significant when assessing malnutrition by dry BMI (p=0.001). In multivariate analysis, malnutrition defined by dry BMImalnutrition was an independent predictor of complications in cirrhosis. However, it did not appear as an independent prognostic factor for global survival. These results raise again difficulties to clarify whether malnutrition influence itself the prognosis of cirrhosis or if it is only related to the severity of cirrhosis.

  1. Colon cancer with unresectable synchronous metastases: the AAAP scoring system for predicting the outcome after primary tumour resection.

    Science.gov (United States)

    Li, Z M; Peng, Y F; Du, C Z; Gu, J

    2016-03-01

    The aim of this study was to develop a prognostic scoring system to predict the outcome of patients with unresectable metastatic colon cancer who received primary colon tumour resection. Patients with confirmed metastatic colon cancer treated at the Peking University Cancer Hospital between 2003 and 2012 were reviewed retrospectively. The correlation of clinicopathological factors with overall survival was analysed using the Kaplan-Meier method and the log-rank test. Independent prognostic factors were identified using a Cox proportional hazards regression model and were then combined to form a prognostic scoring system. A total of 110 eligible patients were included in the study. The median survival time was 10.4 months and the 2-year overall survival (OS) rate was 21.8%. Age over 70 years, an alkaline phosphatase (ALP) level over 160 IU/l, ascites, a platelet/lymphocyte ratio (PLR) above 162 and no postoperative therapy were independently associated with a shorter OS in multivariate analysis. Age, ALP, ascites and PLR were subsequently combined to form the so-called AAAP scoring system. Patients were classified into high, medium and low risk groups according to the score obtained. There were significant differences in OS between each group (P colonic cancer who underwent primary tumour resection. The AAAP scoring system may be a useful tool for surgical decision making. Colorectal Disease © 2015 The Association of Coloproctology of Great Britain and Ireland.

  2. Factors influencing the treatment outcome for patients with T2N0 glottic carcinoma treated by definitive radiotherapy

    International Nuclear Information System (INIS)

    Fukuda, Ichiro; Kanehira, Chihiro; Kobayashi, Masao; Aoki, Manabu; Takagi, Sayako; Shirahama, Jun; Honda, Chikara

    2007-01-01

    The purpose of this study was to determine the prognostic factors affecting local outcomes for patients with T2N0 glottic carcinoma treated by definitive radiotherapy. A total of 48 patients with T2N0 squamous cell carcinoma treated by definitive radiotherapy between 1992 and 2005 were studied. Cumulative probability of overall survival, cause-specific survival, local control and larynx-preserving were calculated according the Kaplan-Meier method, and the prognostic significance of patient's age, number of subsites involved, impaired cord mobility, anterior commisure involved, total dose and overall treatment time were analyzed using the log-rank test in univariate analysis and Cox regression in multivariate analysis. Follow-up ranged from 13 to 141 months (median, 62 months). Five-year survivals were: overall, 95.3%; cause-specific, 97.9% and five years rates were local control, 61.4%; larynx-preserving, 76.4%. Multivariate analyses of the six parameters showed that overall treatment time significantly influenced the probability of local control, and impaired mobility and overall treatment time affected the probability of larynx-preserving. Our study showed that longer overall treatment time significantly worsened the percentage of local control and larynx-preserving for patients with T2N0 glottic carcinoma treated with definitive radiotherapy. Therefore, we suggest treating, the patients in a shorter treatment course. (author)

  3. Early perfusion changes within 1 week of systemic treatment measured by dynamic contrast-enhanced MRI may predict survival in patients with advanced hepatocellular carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Bang-Bin; Yu, Chih-Wei; Liang, Po-Chin [National Taiwan University College of Medicine and Hospital, Department of Medical Imaging and Radiology, Taipei City (China); Hsu, Chao-Yu [National Taiwan University College of Medicine and Hospital, Department of Medical Imaging and Radiology, Taipei City (China); Taipei Hospital, Ministry of Health and Welfare, Department of Radiology, New Taipei City (China); Hsu, Chiun; Hsu, Chih-Hung; Cheng, Ann-Lii [National Taiwan University College of Medicine and Hospital, Department of Oncology, Taipei City (China); Shih, Tiffany Ting-Fang [National Taiwan University College of Medicine and Hospital, Department of Medical Imaging and Radiology, Taipei City (China); Taipei City Hospital, Department of Medical Imaging, Taipei City (China); National Taiwan University Hospital, Department of Medical Imaging, Taipei (China)

    2017-07-15

    To correlate early changes in the parameters of dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) within 1 week of systemic therapy with overall survival (OS) in patients with advanced hepatocellular carcinoma (HCC). Eighty-nine patients with advanced HCC underwent DCE-MRI before and within 1 week following systemic therapy. The relative changes of six DCE-MRI parameters (Peak, Slope, AUC, Ktrans, Kep and Ve) of the tumours were correlated with OS using the Kaplan-Meier model and the double-sided log-rank test. All patients died and the median survival was 174 days. Among the six DCE-MRI parameters, reductions in Peak, AUC, and Ktrans, were significantly correlated with one another. In addition, patients with a high Peak reduction following treatment had longer OS (P = 0.023) compared with those with a low Peak reduction. In multivariate analysis, a high Peak reduction was an independent favourable prognostic factor in all patients [hazard ratio (HR), 0.622; P = 0.038] after controlling for age, sex, treatment methods, tumour size and stage, and Eastern Cooperative Oncology Group performance status. Early perfusion changes within 1 week following systemic therapy measured by DCE-MRI may aid in the prediction of the clinical outcome in patients with advanced HCC. (orig.)

  4. Is there a survival benefit within a German primary care-based disease management program?

    Science.gov (United States)

    Miksch, Antje; Laux, Gunter; Ose, Dominik; Joos, Stefanie; Campbell, Stephen; Riens, Burgi; Szecsenyi, Joachim

    2010-01-01

    To compare the mortality rate of patients with type 2 diabetes who were enrolled in the German diabetes disease management program (DMP) with the mortality rate of those who were not enrolled. This observational study was part of the ELSID study (Evaluation of a Large Scale Implementation of disease management programs) in Germany. Participants had type 2 diabetes and were either enrolled or not enrolled in the DMP. The DMP provides systems-based, multifaceted, and patient-centered interventions. To reduce imbalances between the groups, a matched sample was created using sex, age, retirement status, federal state, pharmacy-based cost groups, and diagnostic-cost groups as matching criteria. Cox proportional hazards regression model and the Kaplan-Meier method were used to assess overall mortality. The observation period was 3 years beginning on January 1, 2006. A total of 11,079 patients were included in the analysis. As of January 1, 2006, 2300 patients were enrolled in the DMP and 8779 were receiving routine care. There were 1927 matched pairs of patients in the DMP group and the non-DMP group. The overall mortality rate was 11.3% in the DMP and 14.4% in the non-DMP group (log-rank test P German diabetes DMP and reduced mortality. This reduced mortality cannot be attributed directly to the DMP. However, further research should evaluate whether a primary care-based DMP contributes to increased life expectancy in patients with diabetes.

  5. Tracheal and Crico-Tracheal Resection and Anastomosis for Malignancies Involving the Thyroid Gland and the Airway.

    Science.gov (United States)

    Piazza, Cesare; Del Bon, Francesca; Barbieri, Diego; Grazioli, Paola; Paderno, Alberto; Perotti, Pietro; Lombardi, Davide; Peretti, Giorgio; Nicolai, Piero

    2016-02-01

    To evaluate outcomes in different malignancies involving the thyroid and infiltrating the airway submitted to tracheal (TRA) or crico-tracheal resection and anastomosis (CTRA). Retrospective charts review of 27 patients affected by thyroid malignancies involving the airway treated by TRA/CTRA in a single academic institution. Kaplan-Meier curves were used to evaluate the overall (OS) and disease-specific (DSS) survivals and local (LC) and loco-regional control (LRC). Impact on survival of age, comorbidities, previous radiotherapy, types of TRA/CTRA, Shin's stage (II, III, IV), grading (well vs poorly differentiated), and length of airway resected was calculated by the log-rank test. Overall survival and DSS at 3 and 5 years were 82.3% and 71.6%, respectively. Local control and LRC in the entire group were 82.3% at 3 and 5 years. Crico-tracheal resection and anastomosis involving the cricoid arch and plate (type C) and tumor differentiation significantly affected OS and DSS (both P < .001). Type C CTRA and tumor differentiation significantly impacted on LC (P = .002 and P = .009, respectively). Grading and extension of CTRA to the cricoid plate are the most important factors for oncologic outcomes in thyroid malignancies infiltrating the airway. Except for poorly differentiated tumors, TRA/CTRA allows adequate LC even in advanced stage lesions involving the crico-tracheal junction. © The Author(s) 2015.

  6. The value of molecular expression of KIT and KIT ligand analysed using real-time polymerase chain reaction and immunohistochemistry as a prognostic indicator for canine cutaneous mast cell tumours.

    Science.gov (United States)

    Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M

    2015-03-01

    This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.

  7. [An analysis of 68 invasive lobular breast cancer cases in clinicopathological characteristics and the prognostic determinants].

    Science.gov (United States)

    Liu, Q; Xiang, H Y; Ye, J M; Xu, L; Zhang, H; Zhang, S; Duan, X N; Liu, Y H

    2018-02-01

    Objective: To study the clinicopathological characteristics and the prognostic determinants of the invasive lobular carcinoma breast cancer. Methods: This was a retrospective single-center study of invasive lobular breast cancer cases diagnosed from January 2008 to December 2014 at Peking University First Hospital Breast Disease Center. The study enrolled 68 invasive lobular breast cancer patients, which represented 3.64% (68/1 870) of total invasive breast cancer. The median age of all selected patients was 46 years ranging from 36 to 83 years. All patients were restaged based on the 8(th) edition of AJCC cancer staging system and follow-up data including disease-free survival (DFS) and overall survival (OS) were analyzed to explore the prognostic determinants. The 5-year OS and DFS were calculated using Kaplan-Meier method; the significance of correlations between clinicopathological features and prognostic factors was estimated using log-rank test. Results: There were significant differences in OS between patients with different anatomic stage, prognostic stage, lymph node metastasis, progesterone receptor (PR) expression, lymphvascular invasion and perineural invasion (χ(2:) 4.318 to 32.394, all P invasion (χ(2:) 4.347 to 27.369, all P invasion are the prognostic factors of invasive lobular breast cancer. Regard to invasive lobular breast cancer patients, clinicians should pay close attention to the differences between prognostic stage and anatomic stage.

  8. Long-term results of interventional treatment of large unresectable hepatocellular carcinoma (HCC): significant survival benefit from combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) compared to TACE monotherapy

    International Nuclear Information System (INIS)

    Lubienski, A.; Bitsch, R.G.; Grenacher, L.; Kauffmann, G.W.; Schemmer, P.; Duex, M.

    2004-01-01

    Purpose: A retrospective analysis of long-term efficacy of combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) and TACE monotherapy was conducted in patients with large, non-resectable hepatocellular carcinoma (HCC). Methods and Materials: Fifty patients with large, unresectable HCC lesions underwent selective TACE. Liver cirrhosis was present in 42 patients, due to alcohol abuse (n = 22) and viral infection (n = 17). In three patients, the underlying cause for liver cirrhosis remained unclear. Child A cirrhosis was found in 22 and Child B cirrhosis in 20 patients. Repeated and combined TACE and PEI were performed in 22 patients and repeated TACE monotherapy was performed in 28 patients. Survival and complication rates were determined and compared. Results: The 6-, 12-, 24- and 36-month survival rates were 61%, 21%, 4%, and 4% for TACE monotherapy and 77%, 55%, 39% and 22% for combined TACE and PEI (Kaplan-Meier method). The kind of treatment significantly affected the survival rate (p=0.002 log-rank test). Severe side effects were present in two patients of the monotherapy group and in three patients of the combination therapy group. (orig.)

  9. HIF1-alpha overexpression indicates a good prognosis in early stage squamous cell carcinomas of the oral floor

    Directory of Open Access Journals (Sweden)

    Joos Ulrich

    2005-07-01

    Full Text Available Abstract Background Hypoxia-inducible factor 1 (HIF-1 is a transcription factor, which plays a central role in biologic processes under hypoxic conditions, especially concerning tumour angiogenesis. HIF-1α is the relevant, oxygen-dependent subunit and its overexpression has been associated with a poor prognosis in a variety of malignant tumours. Therefore, HIF-1α expression in early stage oral carcinomas was evaluated in relation to established clinico-pathological features in order to determine its value as a prognostic marker. Methods 85 patients with histologically proven surgically treated T1/2 squamous cell carcinoma (SCC of the oral floor were eligible for the study. Tumor specimens were investigated by means of tissue micro arrays (TMAs and immunohistochemistry for the expression of HIF-1. Correlations between clinical features and the expression of HIF-1 were evaluated by Kaplan-Meier curves, log-rank tests and multivariate Cox regression analysis. Results HIF-1α was frequently overexpressed in a probably non-hypoxia related fashion. The expression of HIF-1α was related with a significantly improved 5-year survival rate (p Conclusion HIF-1α overexpression is an indicator of favourable prognosis in T1 and T2 SCC of the oral floor. Node negative patients lacking HIF-1α expression may therefore be considered for adjuvant radiotherapy.

  10. Preoperative High-Dose Steroid Has Long-Term Beneficial Effects for Myasthenia Gravis

    Directory of Open Access Journals (Sweden)

    Syuichi Tetsuka

    2013-01-01

    Full Text Available Previous studies addressing preoperative steroid treatment have revealed that control of myasthenia gravis (MG with steroids prior to surgery appeared to stabilize postoperative status. The purpose of our study was to clarify the clinical benefits of the preoperative programmed high-dose steroid treatment on the long-term outcomes of MG patients. We retrospectively reviewed the records of 171 MG patients who were followed up after undergoing thymectomy in our hospital between 1988 and 2006. One hundred and thirteen patients in the programmed treatment group had received preoperative steroid treatment, while 58 patients received no steroid treatment during the preoperative period. Clinical remission, which was defined as the achievement of the modified pharmacologic remission (PR for at least 1 year, and clinical benefits were compared between the two groups. With regard to the remission after thymectomy, Kaplan-Meier life-table curves for patients in the preoperative steroid treatment group versus those for patients in the no steroid preoperative treatment group revealed a significantly higher probability of the PR in the preoperative steroid treatment group (log-rank test, P<0.01. This study might be the first, as per our knowledge, to indicate that preoperative programmed high-dose steroid treatment has long-term beneficial effects for MG patients.

  11. Oncocytic adrenocortical neoplasms--a clinicopathologic study of 13 new cases emphasizing the importance of their recognition.

    Science.gov (United States)

    Wong, Daniel D; Spagnolo, Dominic V; Bisceglia, Michele; Havlat, Marek; McCallum, Dugald; Platten, Michael A

    2011-04-01

    Oncocytic adrenocortical neoplasms (OANs) are a rare but important subtype of adrenal tumors with unique clinical and morphological features. We present 13 previously unpublished cases, of which 3 were classified as benign, 2 as having borderline malignant potential, and 8 as malignant according to the Lin-Weiss-Bisceglia criteria. Seven tumors (54%) showed evidence of endocrine activity. All were composed of more than 90% oncocytes confirmed immunohistochemically using the antimitochondrial antibody mES-13 and ultrastructurally in 4 cases. Small oncocytes were a frequent finding that challenges the conventional notion of oncocytes as necessarily having abundant cytoplasm. Most cases were immunoreactive for vimentin, synaptophysin, inhibin-α, melan A, and calretinin, the latter being a novel finding in this group of neoplasms. Cytokeratin positivity with AE1/AE3 and CAM5.2 was variable. The literature was comprehensively reviewed to identify all cases of OANs reported to date. Hormone production is not as uncommon as previously believed, occurring in 30%. The Lin-Weiss-Bisceglia criteria were retrospectively applied to all published cases with sufficient information and were shown to effectively separate tumors according to their future risk of recurrence and survival using Kaplan-Meier survival curves (log-rank test, P interval = 27.5-88.5 months), providing the first preliminary evidence that the prognosis of malignant OANs is likely to be more favorable than conventional adrenocortical carcinomas, in which the reported median survival is between 14 and 32 months. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Childhood lupus nephritis: 12 years of experience from a developing country's perspective.

    Science.gov (United States)

    Samanta, Moumita; Nandi, Madhumita; Mondal, Rakesh; Hazra, Avijit; Sarkar, Sumatra; Sabui, Tapas; Kundu, Chanchal Kumar; Biswas, Arnab

    2017-09-01

    To assess the long-term outcome of lupus nephritis in children with systemic lupus erythematosus followed up over 12 years at a tertiary care teaching hospital in Eastern India. This is a retrospective observational study of the clinicopathological presentation, management, and outcome in 46 children with lupus nephritis over a period of 12 years at a tertiary teaching hospital in Eastern India. Mortality was compared between different lupus classes and therapy groups with Kaplan-Meier analysis and log-rank test. The incidence of lupus nephritis was 58.97% [95% confidence interval (CI) 48.06%-59.89%] with the mean age at presentation being 10.2±2.43 years (range 5.5-14.5) years. Majority belonged to class IV (30.43%), followed by class II (26.91%), class III (23.91), and class V (8.70%). Outcome analysis of children with lupus nephritis over 12 years revealed that 24 (52.17%) achieved complete remission of disease activity, 5 attained partial remission, 4 continued to have active disease, 5 developed end-stage renal disease (ESRD), and 8 died. Overall mortality thus observed was 17.39% with septicemia in the background of ESRD being the commonest cause. No significant difference in mortality was observed between different lupus nephritis classes or therapy arm groups. The study throws light on various aspects of lupus nephritis and their long-term outcome patterns in children from developing countries such as India.

  13. Clinical performance of ART restorations in primary teeth: a survival analysis.

    Science.gov (United States)

    Faccin, Elise Sasso; Ferreira, Simone Helena; Kramer, Paulo Floriani; Ardenghi, Thiago Machado; Feldens, Carlos Alberto

    2009-01-01

    To assess the survival of Atraumatic Restorative Treatment (ART) restorations in primary teeth performed in a dental clinical setting. One hundred and five single-surface ART restorations placed in 56 preschool children (mean age 31 months) were included. Final-year dental students performed the restorations using standard ART procedures with hand instruments. A resin-modified glass ionomer cement (Vitremer 3M/ESPE) was used as a restorative material. Performances of the restorations were assessed directly by the ART evaluation criteria. Follow-up period ranged from 6 to 48 months. Survival estimates for restoration longevity were evaluated using the Kaplan-Meier method. Log-rank test (P ART restorations were 89%, 85% and 72% in 6 to 11, 12 to 24 and 25 to 48 months of evaluation respectively. Differences in success rates among demographic and clinical characteristics were not statistically significant. High survivals rates of the ART restorations found in this study seem to indicate the reliability of this approach as an appropriate treatment option for primary teeth in a clinical setting.

  14. Effect of Kuanxiong Aerosol () on Patients with Angina Pectoris: A Non-inferiority Multi-center Randomized Controlled Trial.

    Science.gov (United States)

    Yang, Qiao-Ning; Bai, Rui-Na; Dong, Guo-Ju; Ge, Chang-Jiang; Zhou, Jing-Min; Huang, Li; He, Yan; Wang, Jun; Ren, Ai-Hua; Huang, Zhan-Quan; Zhu, Guang-Li; Lu, Shu; Xiong, Shang-Quan; Xian, Shao-Xiang; Zhu, Zhi-Jun; Shi, Da-Zhuo; Lu, Shu-Zheng; Li, Li-Zhi; Chen, Ke-Ji

    2018-05-01

    To evaluate the effect and safety of Kuanxiong Aerosol (, KA) on patients with angina pectoris. Block randomization was performed to randomly allocate 750 patients into KA (376 cases) and control groups (374 cases). During an angina attack, the KA group received 3 consecutive sublingual sprays of KA (0.6 mL per spray). The control group received 1 sublingual nitroglycerin tablet (NT, 0.5 mg/tablet). Log-rank tests and Kaplan-Meier estimations were used to estimate the angina remission rates at 6 time-points after treatment (1, 2, 3, 4, 5, and >5 min). Logistic regression analysis was performed to observe the factors inflfluencing the rate of effective angina remission, and the remission rates and incidences of adverse reactions were compared for different Canadian Cardiovascular Society (CCS) classes of angina. The 5-min remission rates in the KA and control groups were not signifificantly different (94.41% vs. 90.64%, P>0.05). The angina CCS class signifificantly inflfluenced the rate of remission (95% confidence interval = 0.483-0.740, P0.05), while they were signifificantly better for KA in the CCSI and II subgroups (Pangina. Furthermore, in CCSII and III patients, KA is superior to NT, with a lower incidence of adverse reactions. (Registration No. ChiCTRIPR-15007204).

  15. Impact of neoadjuvant chemotherapy on complications of minimally invasive radical cystectomy.

    Science.gov (United States)

    Lizée, D; Salas, R S; Barret, E; Galiano, M; Di Trapani, E; Montorsi, F; Cathelineau, X

    2017-03-01

    Neoadjuvant chemotherapy (NC) before minimally invasive radical cystectomy (MIRC) is considered a standard of care in muscle-invasive bladder cancer or recurrent high-risk non-muscle-invasive bladder cancer. To evaluate the impact of NC on morbidity and mortality after MIRC. We prospectively evaluated 135 patients who underwent MIRC (laparoscopic: n=100; robotic: n=35) between 2007 and 2013 with ≥90 days of follow-up (median age: 66 year). Complications were analyzed and graded according to the Clavien Dindo classification system. Logistic regression models were used to evaluate the impact of NC on postoperative complications. Kaplan-Meier methods with the log-rank test were used for cancer-specific survival probabilities and differences between the 2groups (MIRC with and without NC). Sixty-two of 135 patients received NC. A total of 118 patients (87.4%) developed 179 complications, chiefly infectious (48.0%) or gastrointestinal (21.2%), ≤90 days after surgery; 3 patients died bladder cancer who had NC versus no NC. We did not find any significant differences in terms of early or late complications, length of stay, or reintervention. The oncologic outcomes regarding NC were encouraging. Copyright © 2016. Publicado por Elsevier España, S.L.U.

  16. Comparison of the 7(th) and proposed 8(th) editions of the AJCC/UICC TNM staging system for non-small cell lung cancer undergoing radical surgery.

    Science.gov (United States)

    Jin, Ying; Chen, Ming; Yu, Xinmin

    2016-09-19

    The present study aims to compare the 7(th) and the proposed 8(th) edition of the AJCC/UICC TNM staging system for NSCLC in a cohort of patients from a single institution. A total of 408 patients with NSCLC who underwent radical surgery were analyzed retrospectively. Survivals were analyzed using the Kaplan -Meier method and were compared using the log-rank test. Multivariate analysis was performed by the Cox proportional hazard model. The Akaike information criterion (AIC) and C-index were applied to compare the two prognostic systems with different numbers of stages. The 7(th) AJCC T categories, the proposed 8(th) AJCC T categories, N categories, visceral pleural invasion, and vessel invasion were found to have statistically significant associations with disease-free survival (DFS) on univariate analysis. In the 7(th) edition staging system as well as in the proposed 8(th) edition, T categories, N categories, and pleural invasion were independent factors for DFS on multivariate analysis. The AIC value was smaller for the 8(th) edition compared to the 7(th) edition staging system. The C-index value was larger for the 8(th) edition compared to the 7(th) edition staging system. Based on the data from our single center, the proposed 8(th) AJCC T classification seems to be superior to the 7(th) AJCC T classification in terms of DFS for patients with NSCLC underwent radical surgery.

  17. Factors Predicting Ventilator Dependence in Patients with Ventilator-Associated Pneumonia

    Directory of Open Access Journals (Sweden)

    Chia-Cheng Tseng

    2012-01-01

    Full Text Available Objectives. To determine risk factors associated with ventilator dependence in patients with ventilator-associated pneumonia (VAP. Study Design. A retrospective study was conducted at Chang Gung Memorial Hospital, Kaohsiung, from January 1, 2007 to January 31, 2008. Methods. This study evaluated 163 adult patients (aged ≥18 years. Eligibility was evaluated according to the criterion for VAP, Sequential Organ Failure Assessment (SOFA score, Acute Physiological Assessment and Chronic Health Evaluation II (APACHE II score. Oxygenation index, underlying comorbidities, septic shock status, previous tracheostomy status, and factors related to pneumonia were collected for analysis. Results. Of the 163 VAP patients in the study, 90 patients survived, yielding a mortality rate of 44.8%. Among the 90 surviving patients, only 36 (40% had been weaned off ventilators at the time of discharge. Multivariate logistic regression analysis was used to identify underlying factors such as congestive cardiac failure (P=0.009, initial high oxygenation index value (P=0.04, increased SOFA scores (P=0.01, and increased APACHE II scores (P=0.02 as independent predictors of ventilator dependence. Results from the Kaplan-Meier method indicate that initial therapy with antibiotics could increase the ventilator weaning rate (log Rank test, P<0.001. Conclusions. Preexisting cardiopulmonary function, high APACHE II and SOFA scores, and high oxygenation index were the strongest predictors of ventilator dependence. Initial empiric antibiotic treatment can improve ventilator weaning rates at the time of discharge.

  18. Hypofractionated radiation therapy in the treatment of epidemic Kaposi sarcoma - A prospective randomized trial

    International Nuclear Information System (INIS)

    Singh, Niveditha B.; Lakier, Roy H.; Donde, Bernard

    2008-01-01

    Purpose: To compare a conventional fractionation regimen with a hypofractionated regimen in the treatment of Epidemic Kaposi sarcoma with radiation therapy. Materials and methods: Sixty patients were randomized to receive a standard regimen of 24 Gy in 12 fractions (ARM A) or the study regimen of 20 Gy in five fractions (ARM B). Radiation technique was individualized. Treatment response, local control and toxicity were recorded. Results: Thirty five sites were treated in ARM A and 30 sites in ARM B. Treatment arms were similar for gender, ECOG performance score, treated site, antiretroviral therapy usage, T stage, I stage and S stage. The overall survival using the Kaplan Meier method was 37% at 1 year. Complete responses were recorded at 28 sites (13 Arm A, 15 Arm B), partial responses at 19 sites (8 Arm A, 11 Arm B) and stable disease at three sites (2 Arm A, 1 Arm B). The mean time to maximum objective response was 3 months (range: 1-14 months). Response rates and local control were equal in the two arms (p = 0.73 and 0.77, respectively, log rank test). Acute skin toxicity (p = 0.77) and late skin toxicity (p = 0.24) were equal in the two arms. Conclusion: The two treatment regimens produced equivalent results for treatment response, local recurrence-free survival and toxicity

  19. Thrombotic Thrombocytopenic Purpura in Black People: Impact of Ethnicity on Survival and Genetic Risk Factors.

    Directory of Open Access Journals (Sweden)

    Suella Martino

    Full Text Available Black people are at increased risk of thrombotic thrombocytopenic purpura (TTP. Whether clinical presentation of TTP in Black patients has specific features is unknown. We assessed here differences in TTP presentation and outcome between Black and White patients. Clinical presentation was comparable between both ethnic groups. However, prognosis differed with a lower death rate in Black patients than in White patients (2.7% versus 11.6%, respectively, P = .04. Ethnicity, increasing age and neurologic involvement were retained as risk factors for death in a multivariable model (P < .05 all. Sixty-day overall survival estimated by the Kaplan-Meier curves and compared with the Log-Rank test confirmed that Black patients had a better survival than White patients (P = .03. Salvage therapies were similarly performed between both groups, suggesting that disease severity was comparable. The comparison of HLA-DRB1*11, -DRB1*04 and -DQB1*03 allele frequencies between Black patients and healthy Black individuals revealed no significant difference. However, the protective allele against TTP, HLA-DRB1*04, was dramatically decreased in Black individuals in comparison with White individuals. Black people with TTP may have a better survival than White patients despite a comparable disease severity. A low natural frequency of HLA-DRB1*04 in Black ethnicity may account for the greater risk of TTP in this population.

  20. Comparison of characteristics and healing course of diabetic foot ulcers by etiological classification: neuropathic, ischemic, and neuro-ischemic type.

    Science.gov (United States)

    Yotsu, Rie Roselyne; Pham, Ngoc Minh; Oe, Makoto; Nagase, Takeshi; Sanada, Hiromi; Hara, Hisao; Fukuda, Shoji; Fujitani, Junko; Yamamoto-Honda, Ritsuko; Kajio, Hiroshi; Noda, Mitsuhiko; Tamaki, Takeshi

    2014-01-01

    To identify differences in the characteristics of patients with diabetic foot ulcers (DFUs) according to their etiological classification and to compare their healing time. Over a 4.5-year period, 73 patients with DFUs were recruited. DFUs were etiologically classified as being of neuropathic, ischemic, or neuro-ischemic origin. Descriptive analyses were performed to characterize study subjects, foot-related factors, and healing outcome and time. Duration of healing was assessed using the Kaplan-Meier method. Healing time among the three types was compared using the log rank test. The number of patients manifesting neuropathic, ischemic, and neuro-ischemic ulcers was 30, 20, and 14, respectively. Differences were identified for age, diabetes duration, body mass index, hypertension, and estimated glomerular filtration rate. Patients with neuro-ischemic ulcers had better ankle-brachial index, skin perfusion pressure (SPP), and transcutaneous oxygen pressure values compared to those with ischemic ulcers. The average time in which 50% of patients had healed wounds was 70, 113, and 233 days for neuropathic, neuro-ischemic, and ischemic ulcers, respectively. Main factors associated with healing were age and SPP values. Based on the etiological ulcer type, DFU healing course and several patient factors differed. Failure to consider the differences in DFU etiology may have led to heterogeneity of results in previous studies on DFUs. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. The Role of Pretreatment FDG-PET in Nasopharyngeal Carcinoma Treated With Intensity-Modulated Radiotherapy

    International Nuclear Information System (INIS)

    Liu, Wen-Shan; Wu, Ming-Fang; Tseng, Hsien-Chun; Liu, Jung-Tung; Weng, Jui-Hung; Li, Yueh-Chun; Lee, Jong-Kang

    2012-01-01

    Purpose: Pretreatment with 2- [ 18 F] fluorodeoxyglucose positron emission tomography ( 18 F-FDG-PET) was evaluated as a predictor of local failure-free survival (LFFS), disease-free survival (DFS), and overall survival (OS) in patients with nonkeratinizing nasopharyngeal carcinoma (NPC) treated with intensity-modulated radiation therapy (IMRT) alone or concurrently with chemotherapy (CCRT). Patients and Methods: Seventy-five M0 NPC patients who received FDG-PET before treatment were analyzed. The primary tumor FDG uptake was measured as the maximum standardized uptake value (SUVmax). The LFFS, DFS, and OS were calculated by the Kaplan-Meier method, and the differences were evaluated on log-rank test. The prognostic significance was assessed by univariate and multivariate analyses. Results: Eighteen patients received IMRT alone and 57 received CCRT. The mean SUVmax was significantly higher in 12 patients with locoregional or distant failure than in those without failure (p 18 F-FDG uptake (SUVmax >5) indicates poor outcome in patients with NPC.

  2. Prognostic value of N-terminal prohormone brain natriuretic peptide for in-hospital and long-term outcomes in patients with infective endocarditis.

    Science.gov (United States)

    Wei, Xue-Biao; Liu, Yuan-Hui; He, Peng-Cheng; Yu, Dan-Qing; Zhou, Ying-Ling; Tan, Ning; Chen, Ji-Yan

    2017-05-01

    Background Limited research studies with a large sample size were performed to evaluate the prognostic value of N-terminal pro-B-type natriuretic peptide (NT-proBNP) for in-hospital or long-term poor outcomes in patients with infective endocarditis. Methods A total of 703 patients with infective endocarditis were enrolled and divided into four groups according to admission NT-pro-BNP (pg/mL) quartiles: Q1 (3522). Multivariate regression was used to determine independent risk of NT-proBNP for in-hospital and one-year death. Results In-hospital death occurred in 9.0% of patients. The in-hospital mortality was increased from the lowest to the highest NT-proBNP quartiles (1.1%, 3.4%, 9.1% and 22.3%, P  2260 pg/mL had 76.2% sensitivity and 69.1% specificity for predicting in-hospital death. Kaplan-Meier analysis showed that patients with NT-proBNP > 2260 pg/ml had a worse prognosis than those without (log-rank test 18.84, P endocarditis.

  3. Comparison of Long-Term Outcomes of Postmastectomy Radiotherapy between Breast Cancer Patients with and without Immediate Flap Reconstruction.

    Directory of Open Access Journals (Sweden)

    Hsin-Hua Lee

    Full Text Available To compare the long-term clinical outcomes of postmastectomy radiotherapy (PMRT between breast cancer patients with and without immediate transverse rectus abdominis myocutaneous (TRAM flap reconstruction.The study included 492 patients with stage II or III breast cancer who underwent modified radical mastectomy (MRM and chemotherapy followed by PMRT between 1997 and 2011. Cox regression model and Kaplan-Meier curves were calculated, and the log-rank test was used to evaluate the differences between overall and disease-free survival rates in the 2 groups.Among 492 patients, 213 patients had immediate TRAM flap reconstruction. The mean follow-up was 7.2 years (range, 11-191 months. The 5-year and 10-year disease free survival rates were 81% and 76% for the TRAM flap group and 78% and 73% for the non-flap group. The 5-year and 10-year overall survival rates were 89% and 73% for the TRAM flap group and 83% and 74% for the non-flap group.There exists no statistically significant difference in the rates of local recurrence, distant metastasis, disease-free and overall survival when comparing immediate TRAM flap reconstruction with no reconstruction. Our results suggest that immediate TRAM flap reconstruction does not compromise long term clinical outcomes in breast cancer patients requiring PMRT.

  4. Long-term results of interventional treatment of large unresectable hepatocellular carcinoma (HCC): significant survival benefit from combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) compared to TACE monotherapy; Langzeitergebnisse der interventionellen Therapie von grossen, inoperablen hepatozellulaeren Karzinomen (HCC): signifikanter Ueberlebensvorteil von transarterieller Chemoembolisation (TACE) und perkutaner Ethanolinjektion (PEI) gegenueber der TACE-Monotherapie

    Energy Technology Data Exchange (ETDEWEB)

    Lubienski, A.; Bitsch, R.G.; Grenacher, L.; Kauffmann, G.W. [Radiologische Universitaetsklinik Heidelberg, Abt. Radiodiagnostik, Heidelberg (Germany); Schemmer, P. [Chirurgische Universitaetsklinik Heidelberg (Germany); Duex, M. [Radiologisches Zentralinstitut Krankenhaus Nordwest Frankfurt (Germany)

    2004-12-01

    Purpose: A retrospective analysis of long-term efficacy of combined transcatheter arterial chemoembolization (TACE) and percutaneous ethanol injection (PEI) and TACE monotherapy was conducted in patients with large, non-resectable hepatocellular carcinoma (HCC). Methods and Materials: Fifty patients with large, unresectable HCC lesions underwent selective TACE. Liver cirrhosis was present in 42 patients, due to alcohol abuse (n = 22) and viral infection (n = 17). In three patients, the underlying cause for liver cirrhosis remained unclear. Child A cirrhosis was found in 22 and Child B cirrhosis in 20 patients. Repeated and combined TACE and PEI were performed in 22 patients and repeated TACE monotherapy was performed in 28 patients. Survival and complication rates were determined and compared. Results: The 6-, 12-, 24- and 36-month survival rates were 61%, 21%, 4%, and 4% for TACE monotherapy and 77%, 55%, 39% and 22% for combined TACE and PEI (Kaplan-Meier method). The kind of treatment significantly affected the survival rate (p=0.002 log-rank test). Severe side effects were present in two patients of the monotherapy group and in three patients of the combination therapy group. (orig.)

  5. High mortality in diabetic recipients of high KDPI deceased donor kidneys.

    Science.gov (United States)

    Pelletier, Ronald P; Pesavento, Todd E; Rajab, Amer; Henry, Mitchell L

    2016-08-01

    Deceased donor (DD) kidney quality is determined by calculating the Kidney Donor Profile Index (KDPI). Optimizing high KDPI (≥85%) DD transplant outcome is challenging. This retrospective study was performed to review our high KDPI DD transplant results to identify clinical practices that can improve future outcomes. We retrospectively calculated the KDPI for 895 DD kidney recipients transplanted between 1/2002 and 11/2013. Age, race, body mass index (BMI), retransplantation, gender, diabetes (DM), dialysis time, and preexisting coronary artery disease (CAD) (previous myocardial infarction (MI), coronary artery bypass (CABG), or stenting) were determined for all recipients. About 29.7% (266/895) of transplants were from donors with a KDPI ≥85%. By Cox regression older age, diabetes, female gender, and dialysis time >4 years correlated with shorter patient survival time. Diabetics with CAD who received a high KDPI donor kidney had a significantly increased risk of death (HR 4.33 (CI 1.82-10.30), P=.001) compared to low KDPI kidney recipients. The Kaplan-Meier survival curve for diabetic recipients of high KDPI kidneys was significantly worse if they had preexisting CAD (P<.001 by log-rank test). Patient survival using high KDPI donor kidneys may be improved by avoiding diabetic candidates with preexisting CAD. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Merkel cell carcinoma of the head and neck: poorer prognosis than non-head and neck sites.

    Science.gov (United States)

    Morand, G B; Madana, J; Da Silva, S D; Hier, M P; Mlynarek, A M; Black, M J

    2016-04-01

    Merkel cell carcinoma is a rare, aggressive neurocutaneous malignancy. This study investigated whether patients with Merkel cell carcinoma in the head and neck had poorer outcomes than patients with Merkel cell carcinoma located elsewhere. A retrospective study was performed of patients with Merkel cell carcinoma treated at the Jewish General Hospital in Montréal, Canada, from 1993 to 2013. Associations between clinicopathological characteristics and disease-free and disease-specific survival rates were examined according to the Kaplan-Meier method. Twenty-seven patients were identified. Although basic clinicopathological characteristics and treatments were similar between head and neck and non-head and neck Merkel cell carcinoma groups, disease-free and disease-specific survival rates were significantly lower in the head and neck Merkel cell carcinoma group (log-rank test; p = 0.043 and p = 0.001, respectively). Mortality was mainly due to distant metastasis. Patients with head and neck Merkel cell carcinoma had poorer survival rates than patients with non-head and neck Merkel cell carcinoma in our study. The tendency to obtain close margins, a less predictable metastatic pattern, and/or intrinsic tumour factors related to the head and neck may explain this discrepancy.

  7. Mini dental implants retaining mandibular overdentures: A dental practice-based retrospective analysis.

    Science.gov (United States)

    Schwindling, Franz Sebastian; Schwindling, Franz-Peter

    2016-07-01

    The purpose of this study was to assess the survival of mini dental implants (MDI) and to measure prosthetic maintenance needs in a dental practice-based setting. Patients with mandibular removable dentures were provided with MDI to improve denture retention. Complications and maintenance were analyzed by use of patient records and evaluated with Kaplan-Meier curves and the log rank test at a significance level of 0.05. Ninety-nine MDI were placed in 25 patients (mean age: 72 years). Two MDI fractured during placement and eight implants failed during the first weeks. No more implants were lost for up to seven years, resulting in 92% survival. Implant survival differed significantly depending on whether the maxilla was provided with complete dentures (94.9%) or with partial dentures (81%). All prostheses were in use at the time of data extraction. Denture base fractures were observed in six cases, an incidence of fractures of 24%. Some minor intervention was necessary: one resin tooth fractured, retention rings were changed in five cases, and repeated relining was required for 16% of the dentures. After mid-term observation, survival of MDI was good. However, the incidence of denture base fractures and of minor prosthetic complications should not be under-estimated. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Socioeconomic status is an independent predictor of biochemical recurrence among patients with prostate cancer who undergo radical prostatectomy

    Directory of Open Access Journals (Sweden)

    Victor Srougi

    2011-08-01

    Full Text Available PURPOSE: Socioeconomic status (SES may influence cancer characteristics and behavior in several aspects. We analyzed PCa characteristics and behavior among low income uninsured men, and compare them to high income patients with health insurance in a developing country. MATERIALS AND METHODS: A retrospective case-control study was performed on 934 patients with clinically localized PCa who underwent radical prostatectomy between March, 1999 and July, 2009. Patients were divided in two groups, according to their SES. In group 1 (n=380, all had low income, low educational levels and couldn't afford medical insurance. In group 2 (n=554, all had higher income, higher education and had medical insurance. RESULTS: Patients from group 1 were older, had higher Gleason scores, higher rates of seminal vesicle and bladder neck involvement. The Kaplan Meier disease-free survival curve demonstrated that after a follow-up of four years, about 50% of uninsured patients had biochemical recurrence, versus 21% of insured patients (Log rank test: p < 0.001. A multivariate Cox regression analysis for the risk of disease recurrence demonstrated that only PSA levels, Gleason score, seminal vesicle involvement and SES were statistically significant variables. Patients with a low SES presented 1.8 times the risk of recurrence as compared to patients with a high SES. CONCLUSIONS: Patients with low SES were older, presented more aggressive PCa characteristics and a high rate of disease recurrence. A low SES constituted an independent predictor for disease recurrence.

  9. Natural history and surgical treatment of chordoma: a retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Samuel Aguiar Júnior

    Full Text Available CONTEXT AND OBJECTIVE: Chordoma is a rare tumor with a high risk of locoregional recurrences. The aim of this study was analyze the long-term results from treating this pathological condition.DESIGN AND SETTING: Cohort study in a single hospital in São Paulo, Brazil.METHODS: This was a retrospective cohort study on 42 patients with chordoma who were treated at Hospital A. C. Camargo between 1980 and 2006. The hospital records were reviewed and a descriptive analysis was performed on the clinical-pathological variables. Survival curves were estimated using the Kaplan-Meier method and these were compared using the log-rank test.RESULTS: Nineteen patients were men and 23 were women. Twenty-five tumors (59.5% were located in the sacrum, eleven (26.2% in the skull base and six (14.3% in the mobile spine. Surgery was performed on 28 patients (66.7%. The resection was considered to have negative margins in 14 cases and positive margins in 14 cases. The five-year overall survival (OS was 45.4%. For surgical patients, the five-year OS was 64.3% (82.2% for negative margins and 51.9% for positive margins. In the inoperable group, OS was 37.7% at 24 months and 0% at five years.CONCLUSION: Complete resection is related to local control and definitively has a positive impact on long-term survival.

  10. Comparison of differentiated thyroid cancer in children and adolescents (≤20 years) with young adults.

    Science.gov (United States)

    Alzahrani, Ali S; Alkhafaji, Dania; Tuli, Mahmoud; Al-Hindi, Hindi; Sadiq, Bakr Bin

    2016-04-01

    Age is a major prognostic factor in differentiated thyroid cancer (DTC). It is not clear if paediatric DTC has a different histopathological profile and outcome than DTC in adult patients age. To assess whether DTC in children and adolescents differs from young age group by comparing paediatric DTC (age ≤ 20) with DTC in patients >20 to age. We studied all cases of paediatric DTC seen during the period 1998-2011. We compared this group with a large sample of 213 consecutive adult patients in the age group >20 to age 17 years (range, 8-20)] and 213 young adult patients [median age 33 years (range, 20·5-44·9)]. There was no difference in gender distribution, tumour subtypes, size and tumour multifocality, but there was a significantly higher rate of extrathyroidal extension [40/75 (53·3%) vs 81/213 (38·0%), P = 0·03], lymph node [57/73 (78%) vs 102/183 (55·7%), P adult groups. Kaplan-Meier analysis showed a higher risk of persistent/recurrent disease in the paediatric group than adults (log-rank test 0·03). However, there was no mortality secondary to DTC in both groups. Paediatric DTC is distinct from DTC in the young adults (age >20 to <45 years). It is characterized by a higher rate of extrathyroidal extension, lymph node and distant metastases and a higher risk of persistent/recurrent DTC. © 2015 John Wiley & Sons Ltd.

  11. Profiling the careers of Thoroughbred horses racing in Hong Kong between 2000 and 2010.

    Science.gov (United States)

    Velie, B D; Stewart, B D; Lam, K; Wade, C M; Hamilton, N A

    2013-11-01

    Research in Thoroughbred racehorses is often specific to horses from a given racing population or region. In order to investigate trends in racehorse careers across populations accurately, population-specific benchmarks for performance outcomes must be established. To provide summary statistics for performance outcomes for Thoroughbreds racing in Hong Kong between 2000 and 2010 and to document and provide evidence on the current differences in racing careers across sexes and regions of origin for horses racing in Hong Kong. Performance data on the population of Thoroughbreds racing in Hong Kong between 3 September 2000 and 12 March 2011 (n = 4950) were acquired and used to describe and compare the careers of Thoroughbred racehorses in Hong Kong. Career length, number of career starts and number of spells from racing per year were evaluated. Kaplan-Meier survival curves, stratified by sex, age group, country of origin and region of origin were produced for career length. A Cox's proportional hazards model was fitted to assess factors influencing the risk of retirement from racing in Hong Kong. Log-rank tests for equality of career length survivor functions showed significant differences (Phorse originates, with specific effects on each performance outcome also varying between regions. Future research should take into account these potential differences when comparing results across populations. © 2013 EVJ Ltd.

  12. [Clinical characteristics and prognosis of colon cancer patient with extremely elevated carcinoembryonic antigen level].

    Science.gov (United States)

    Chen, Pengju; Yao, Yunfeng; Zhang, Dakui; Gu, Jin

    2015-10-01

    To explore the clinicopathological characteristics and prognosis of colon cancer patients with extremely elevated serum carcinoembryonic antigen(CEA) level before operation(>50 μg/L). Clinicopathological and follow-up data of 1250 patients with colonic adenocarcinoma undergoing primary tumor resection between January 2001 and December 2011 were retrospectively analyzed. All the patients were divided into three groups according to the preoperative serum CEA levels as normal group (0-5 μg/L, 721 cases), elevated group(5-50 μg/L, 408 cases) and extremely elevated(>50 μg/L, 121 cases). Kaplan-Meier method was used to analyze the overall survival and disease-free survival. Log-rank test was used to compare the survival between groups. Cox regression was used to screen the independent prognostic factors of colon cancer. Compared with normal and elevated groups, patients with extremely elevated CEA had more advanced T,N,M stages (Pcolon cancer (all PColon cancer patients with extremely elevated preoperative CEA levels are associated with more unfavorable pathological factors, advanced TNM stage and more distant metastases (especially the liver metastases) during the follow-up. The elevated degree of preoperative CEA level is an independent poor prognostic factor of patients with colon cancer.

  13. [Analysis of clinicopathologic and survival characteristics in patients with right-or left-sided colon cancer].

    Science.gov (United States)

    Hu, Junjie; Zhou, Zhixiang; Liang, Jianwei; Zhou, Haitao; Wang, Zheng; Zhang, Xingmao; Zeng, Weigen

    2015-07-28

    This study aimed to clarify the clinical and histological parameters, and survival difference between right- and left-sided colon cancer. We retrospectively analyzed the medical records (2006.1-2009.12) of 1 088 consecutive colon cancer patients who received surgery at our hospital. Right- and left-sided colon cancers were compared regarding the clinical and histological parameters. The survival analysis was performed by the Kaplan-Meier method, and the log-rank test was used to determine the statistical significance of differences. Right-sided colon cancer was associated with older age, a more advanced state, and poorly differentiated and undifferentiated adenocarcinoma (25.2% vs 13.2%), mucinous adenocarcinoma (33.5% vs 17.3%) and vascular invasion (9.9% vs 3.9%) were more commonly seen in right-sided colon cancer compared with right-sided colon cancer, and all these differences were statistically significant. Median overall survival was right, 67 months; and left, 68 months. The five-years overall survival of right- and left-sided colon cancer was I/II stage, 91.4% vs 88.6% (P = 0.819); III stage, 66.1% vs 75.4% (P = 0.010); and IV stage, 27.8% vs 38.5% (P = 0.020) respectively. Right- and left-sided colon cancers are significantly different regarding clinical and histological parameters. Right-sided colon cancers in stage III and IV have a worse prognosis.

  14. Preclinical demonstration of synergistic Active Nutrients/Drug (AND combination as a potential treatment for malignant pleural mesothelioma.

    Directory of Open Access Journals (Sweden)

    Viviana Volta

    Full Text Available Malignant pleural mesothelioma (MPM is a poor prognosis disease lacking adequate therapy. We have previously shown that ascorbic acid administration is toxic to MPM cells. Here we evaluated a new combined therapy consisting of ascorbate/epigallocatechin-3-gallate/gemcitabine mixture (called AND, for Active Nutrients/Drug. In vitro effects of AND therapy on various MPM cell lines revealed a synergistic cytotoxic mechanism. In vivo experiments on a xenograft mouse model for MPM, obtained by REN cells injection in immunocompromised mice, showed that AND strongly reduced the size of primary tumor as well as the number and size of metastases, and prevented abdominal hemorrhage. Kaplan Meier curves and the log-rank test indicated a marked increase in the survival of AND-treated animals. Histochemical analysis of dissected tumors showed that AND induced a shift from cell proliferation to apoptosis in cancer cells. Lysates of tumors from AND-treated mice, analyzed with an antibody array, revealed decreased TIMP-1 and -2 expressions and no effects on angiogenesis regulating factors. Multiplex analysis for signaling protein phosphorylation exhibited inactivation of cell proliferation pathways. The complex of data showed that the AND treatment is synergistic in vitro on MPM cells, and blocks in vivo tumor progression and metastasization in REN-based xenografts. Hence, the AND combination is proposed as a new treatment for MPM.

  15. Prognostic and Predictive Value of CpG Island Methylator Phenotype in Patients with Locally Advanced Nonmetastatic Sporadic Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Yuwei Wang

    2014-01-01

    Full Text Available Purpose. In the present study, the prognostic significance of CpG island methylator phenotype (CIMP in stage II/III sporadic colorectal cancer was evaluated using a five-gene panel. Methods. Fifty stage II/III colorectal cancer patients who received radical resection were included in this study. Promoter methylation of p14ARF, hMLH1, p16INK4a, MGMT, and MINT1 was determined by methylation specific polymerase chain reaction (MSP. CIMP positive was defined as hypermethylation of three or more of the five genes. Impact factors on disease-free survival (DFS and overall survival (OS were analyzed using Kaplan-Meier method (log-rank test and adjusted Cox proportional hazards model. Results. Twenty-four percent (12/50 of patients were characterized as CIMP positive. Univariate analysis showed stage III (P=0.049 and CIMP positive (P=0.014 patients who had significantly inferior DFS. In Cox regression analysis, CIMP positive epigenotype was independently related with poor DFS with HR = 2.935 and 95% CI: 1.193–7.220 (P=0.019. In patients with CIMP positive tumor, those receiving adjuvant chemotherapy had a poor DFS than those without adjuvant chemotherapy (P=0.023. Conclusions. CIMP positive was significantly correlated with decreased DFS in stage II/III colorectal cancer. Patients with CIMP positive locally advanced sporadic colorectal cancers may not benefit from 5-fluorouracil based adjuvant chemotherapy.

  16. Prediction of Mortality after Emergent Transjugular Intrahepatic Portosystemic Shunt Placement: Use of APACHE II, Child-Pugh and MELD Scores in Asian Patients with Refractory Variceal Hemorrhage

    International Nuclear Information System (INIS)

    Tzeng, Wen Sheng; Wu, Reng Hong; Lin, Ching Yih; Chen, Jyh Jou; Sheu, Ming Juen; Koay, Lok Beng; Lee, Chuan

    2009-01-01

    This study was designed to determine if existing methods of grading liver function that have been developed in non-Asian patients with cirrhosis can be used to predict mortality in Asian patients treated for refractory variceal hemorrhage by the use of the transjugular intrahepatic portosystemic shunt (TIPS) procedure. Data for 107 consecutive patients who underwent an emergency TIPS procedure were retrospectively analyzed. Acute physiology and chronic health evaluation (APACHE II), Child-Pugh and model for end-stage liver disease (MELD) scores were calculated. Survival analyses were performed to evaluate the ability of the various models to predict 30-day, 60-day and 360-day mortality. The ability of stratified APACHE II, Child-Pugh, and MELD scores to predict survival was assessed by the use of Kaplan-Meier analysis with the log-rank test. No patient died during the TIPS procedure, but 82 patients died during the follow-up period. Thirty patients died within 30 days after the TIPS procedure; 37 patients died within 60 days and 53 patients died within 360 days. Univariate analysis indicated that hepatorenal syndrome, use of inotropic agents and mechanical ventilation were associated with elevated 30-day mortality (p 11 or an MELD score > 20 predicted increased risk of death at 30, 60 and 360 days (p 11 or an MELD score > 20 are predictive of mortality in Asian patients with refractory variceal hemorrhage treated with the TIPS procedure. An APACHE II score is not predictive of early mortality in this patient population

  17. Outcome with lenalidomide plus dexamethasone followed by early autologous stem cell transplantation in patients with newly diagnosed multiple myeloma on the ECOG-ACRIN E4A03 randomized clinical trial: long-term follow-up.

    Science.gov (United States)

    Biran, N; Jacobus, S; Vesole, D H; Callander, N S; Fonseca, R; Williams, M E; Abonour, R; Katz, M S; Rajkumar, S V; Greipp, P R; Siegel, D S

    2016-09-02

    In Eastern Cooperative Oncology Group-ACRIN E4A03, on completion of four cycles of therapy, newly diagnosed multiple myeloma patients had the option of proceeding to autologous peripheral blood stem cell transplant (ASCT) or continuing on their assigned therapy lenalidomide plus low-dose dexamethasone (Ld) or lenalidomide plus high-dose dexamethasone (LD). This landmark analysis compared the outcome of 431 patients surviving their first four cycles of therapy pursuing early ASCT to those continuing on their assigned therapy. Survival distributions were estimated using the Kaplan-Meier method and compared with log-rank test. Ninety patients (21%) opted for early ASCT. The 1-, 2-, 3-, 4- and 5-year survival probability estimates were higher for early ASCT versus no early ASCT at 99, 93, 91, 85 and 80% versus 94, 84, 75, 65 and 57%, respectively. The median overall survival (OS) in the early versus no early ASCT group was not reached (NR) versus 5.78 years. In patients 50, 0.25). In patients ⩾65 years of age, median OS in the early versus no early ASCT was NR versus 5.11 years. ASCT dropped out of statistical significance (P=0.080). Patients opting for ASCT after induction Ld/LD had a higher survival probability and improvement in OS regardless of dexamethasone dose density.

  18. The prognostic value of time parameters in adjuvant radiotherapy of head and neck cancer. A retrospective analysis of 138 patients

    International Nuclear Information System (INIS)

    Dietl, B.; Schaefer, C.; Koelbl, O.

    2005-01-01

    Purpose: to answer the question, how the parameters waiting time, radiation treatment time and overall treatment time (OTT) influenced the endpoints overall (OS), event-free (EFS) and local recurrence-free survival (LRFS) in patients with locally advanced head-and-neck cancer, who had received postoperative radiotherapy. Patients and methods: 138 patients were included into a retrospective analysis from 10/1993 to 05/2000. Besides the time parameters waiting time, radiation treatment time and OTT, tumor- and therapy-related parameters (T-, N-, R-status, grading, tumor site, surgical technique, and postoperative hemoglobin < 12 g/dl) with potential impact on the endpoints were investigated in the univariate analysis (Kaplan-Meier log-rank test). Individual parameters with a significant impact (p = 0.05) were subjected to a multivariate Cox regression analysis. Results: besides a postoperative hemoglobin value < 12 g/dl, in the univariate analysis an OTT ≥ 105 days negatively influenced all endpoints, as well as a radiation treatment time ≥ 60 days. On multivariate Cox regression analysis, postoperative hemoglobin < 12 g/dl and an OTT ≥ 105 days were identified as independent negative prognostic factors for all endpoints. Conclusion: the waiting time should be managed according to the ASARA (as short as reasonably achievable) recommendation, radiation treatment should not be protracted exceeding an overall treatment of 105 days. Generally, time parameters should be routinely included in the standard tumor documentation, thus facilitating further evaluation of these prognostically relevant factors. (orig.)

  19. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  20. Incidence and Outcome of BRCA Mutations in Unselected Patients with Triple Receptor-Negative Breast Cancer.

    LENUS (Irish Health Repository)

    Gonzalez-Angulo, Ana M

    2011-03-01

    To investigate the incidence of germline and somatic BRCA1\\/2 mutations in unselected patients with triple-negative breast cancer (TNBC) and determine the prognostic significance of carrying a mutation. Methods: DNA was obtained from 77 TNBC and normal tissues. BRCA1\\/2 exons\\/flanking regions were sequenced from tumor and patients classified as mutant or wild type (WT). Sequencing was repeated from normal tissue to identify germline and somatic mutations. Patient characteristics were compared with chi-square. Survival was estimated by Kaplan-Meier method and compared with log-rank. Cox proportional hazards models were fit to determine the independent association of mutation status with outcome.

  1. Checking the predictive accuracy of basic symptoms against ultra high-risk criteria and testing of a multivariable prediction model: Evidence from a prospective three-year observational study of persons at clinical high-risk for psychosis.

    Science.gov (United States)

    Hengartner, M P; Heekeren, K; Dvorsky, D; Walitza, S; Rössler, W; Theodoridou, A

    2017-09-01

    The aim of this study was to critically examine the prognostic validity of various clinical high-risk (CHR) criteria alone and in combination with additional clinical characteristics. A total of 188 CHR positive persons from the region of Zurich, Switzerland (mean age 20.5 years; 60.2% male), meeting ultra high-risk (UHR) and/or basic symptoms (BS) criteria, were followed over three years. The test battery included the Structured Interview for Prodromal Syndromes (SIPS), verbal IQ and many other screening tools. Conversion to psychosis was defined according to ICD-10 criteria for schizophrenia (F20) or brief psychotic disorder (F23). Altogether n=24 persons developed manifest psychosis within three years and according to Kaplan-Meier survival analysis, the projected conversion rate was 17.5%. The predictive accuracy of UHR was statistically significant but poor (area under the curve [AUC]=0.65, Pthinking of binary at-risk criteria is necessary in order to improve the prognosis of psychotic disorders. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. HIV testing in the maternity ward and the start of breastfeeding: a survival analysis

    Directory of Open Access Journals (Sweden)

    Glaucia T. Possolli

    2015-08-01

    Full Text Available OBJECTIVE: The purpose of this study was to analyze the factors that influence of the time between birth and the beginning of breastfeeding, especially at the moment of the rapid HIV test results at hospital admission for delivery.METHODS: Cohort study of 932 pregnant women who underwent rapid HIV test admitted in the hospital for delivery in Baby-Friendly Hospitals. The survival curves of time from birth to the first feeding were estimated by the Kaplan-Meier method and the joint effect of independent variables by the Cox model with a hierarchical analysis. As the survival curves were not homogeneous among the five hospitals, hindering the principle of proportionality of risks, the data were divided into two groups according to the median time of onset of breastfeeding at birth in women undergoing rapid HIV testing.RESULTS: Hospitals with median time to breastfeeding onset at birth of up to 60 min were considered as early breastfeeding onset and those with higher medians were considered as late breastfeeding onset at birth. Risk factors common to hospitals considered to be with early and late breastfeeding onset at birth were: cesarean section (RR = 1.75 [95% CI: 1.38-2.22]; RR = 3.83 [95% CI: 3.03-4.85] and rapid test result after birth (RR = 1.45 [95% CI: 1.12-1.89]; RR = 1.65 [95% CI: 1.35-2.02], respectively; and hospitals with late onset: starting prenatal care in the third trimester (RR = 1.86 [95% CI: 1.16-2.97].CONCLUSIONS: The onset of breastfeeding is postponed, even in Baby-Friendly Hospitals, when the results of the rapid HIV test requested in the maternity are not available at the time of delivery.

  3. Variations in Duchenne muscular dystrophy course in a multi-ethnic UK population: potential influence of socio-economic factors.

    Science.gov (United States)

    Hufton, Margaret; Roper, Helen

    2017-08-01

    To explore variation in clinical course and steroid treatment in Duchenne muscular dystrophy (DMD) by ethnic origin and socio-economic status. In this longitudinal cohort study, clinical outcome was defined as age at loss of ambulation (LOA). Ages are presented as months for accurate calculation. Steroid use was reviewed against national guidelines. Kaplan-Meier survival analysis was used to determine probabilities over time of LOA. Log-rank test was used to evaluate comparisons between ethnic and socio-economic groups. From 2005 to 2014, 71 children were newly diagnosed with DMD. Complete data were available on 69, including 33 of white British heritage and 23 of South Asian heritage. Mean age at diagnosis (without known family history) was 45.7 months; white British ethnicity 42.1 months (range 14-86mo), South Asian ethnicity 50.2 months (range 5-98mo). Twenty-four males lost ambulation. Those of South Asian heritage lost ambulation earlier (mean LOA 105.8mo [8y 10mo]) than those of white British heritage (mean LOA 117.8mo [9y 10mo]): log-rank test score 0.012 (p<0.05). Those most deprived did worse: mean age at LOA 130.0 months (10y 10mo) for the top 20 per cent and 102.5 months (8y 6mo) in the lower 20 per cent: log-rank test score 0.035 (p<0.05). The most socially deprived were diagnosed earlier and started steroids earlier. Of those of South Asian heritage, 18 per cent declined steroids, compared with 9 per cent of white British heritage. Also, 44 per cent of those of South Asian heritage stopped steroids compared with 17 per cent of those of white British heritage. Patients from South Asian and deprived backgrounds had earlier LOA. Genetic disease modifiers are likely to be implicated, but social and cultural factors influence access to treatment. © 2017 Mac Keith Press.

  4. Stereotactic radiosurgery improves the survival in patients with solitary brain metastasis: a reasonable alternative to surgery

    International Nuclear Information System (INIS)

    Kwan, H. Cho; Hall, Walter A.; Lee, Andrew K.; Gerbi, Bruce J.; Higgins, Patrick D.; Nussbaum, Eric S.; Chung, K.K. Lee; Bohen, Marva; Clark, H. Brent

    1996-01-01

    Purpose: To evaluate the efficacy of stereotactic radiosurgery (SRS) in patients with solitary brain metastasis from extracranial primary cancer and to compare the outcome with that of external whole brain irradiation with or without surgical resection. Materials and Methods: Between September 1970 and November, 1995, 231 patients with solitary brain metastasis were treated at the Department of Radiation Oncology, University of Minnesota Hospital. One hundred twenty six patients (56%) were treated with external whole brain irradiation (WBI) only (Group 1), seventy three (32%) underwent surgical resection prior to WBI (Group 2) and thirty two (14%) underwent stereotactic radiosurgery (SRS) with WBI (Group 3). Lung (38%) was the most common site of primary cancer, followed by breast (15%), unknown primary (12%), gastro-intestinal tract (10%), skin (malignant melanoma: 9%), kidney (renal cell carcinoma: 8%) and others (9%). The median dose to the whole brain was 3750 cGy in 15 fractions (ranges from 2000 cGy to 5000 cGy). The median radiosurgical dose of 17.5 Gy (range, 12-40 Gy) was delivered to the 40%-90% isodose line encompassing the target. Eighteen patients were treated with SRS for recurrent or persistent disease following WBI and 14 patients received SRS as a boost in conjunction with WBI. Actuarial survival was calculated from the date of treatment according to the Kaplan-Meier method and statistical significance was assessed with the log-rank test. Results: The actuarial median survivals were 3.8 months for Group 1 (ranges from 1 to 84 months), 10.5 months for Group 2 (ranges from 1 to 125 months) and 9.8 months for Group 3 (ranges from 1 to 36 months). The survivals at one and two years were 19% and 6% for Group 1, 47% and 19% for Group 2, and 44% and 21% for Group 3, respectively. The survival advantage of Groups 2 or 3 over Group 1 was statistically significant (p < 0.0001 by log-rank test). There was no survival advantage of surgery (Group 2) over SRS

  5. Predictive Factors for Visual Field Conversion: Comparison of Scanning Laser Polarimetry and Optical Coherence Tomography.

    Science.gov (United States)

    Diekmann, Theresa; Schrems-Hoesl, Laura M; Mardin, Christian Y; Laemmer, Robert; Horn, Folkert K; Kruse, Friedrich E; Schrems, Wolfgang A

    2018-02-01

    The purpose of this study was to compare the ability of scanning laser polarimetry (SLP) and spectral-domain optical coherence tomography (SD-OCT) to predict future visual field conversion of subjects with ocular hypertension and early glaucoma. All patients were recruited from the Erlangen glaucoma registry and examined using standard automated perimetry, 24-hour intraocular pressure profile, and optic disc photography. Peripapillary retinal nerve fiber layer thickness (RNFL) measurements were obtained by SLP (GDx-VCC) and SD-OCT (Spectralis OCT). Positive and negative predictive values (PPV, NPV) were calculated for morphologic parameters of SLP and SD-OCT. Kaplan-Meier survival curves were plotted and log-rank tests were performed to compare the survival distributions. Contingency tables and Venn-diagrams were calculated to compare the predictive ability. The study included 207 patients-75 with ocular hypertension, 85 with early glaucoma, and 47 controls. Median follow-up was 4.5 years. A total of 29 patients (14.0%) developed visual field conversion during follow-up. SLP temporal-inferior RNFL [0.667; 95% confidence interval (CI), 0.281-0.935] and SD-OCT temporal-inferior RNFL (0.571; 95% CI, 0.317-0.802) achieved the highest PPV; nerve fiber indicator (0.923; 95% CI, 0.876-0.957) and SD-OCT mean (0.898; 95% CI, 0.847-0.937) achieved the highest NPV of all investigated parameters. The Kaplan-Meier curves confirmed significantly higher survival for subjects within normal limits of measurements of both devices (P<0.001). Venn diagrams tested with McNemar test statistics showed no significant difference for PPV (P=0.219) or NPV (P=0.678). Both GDx-VCC and SD-OCT demonstrate comparable results in predicting future visual field conversion if taking typical scans for GDx-VCC. In addition, the likelihood ratios suggest that GDx-VCC's nerve fiber indicator<30 may be the most useful parameter to confirm future nonconversion. (http://www.ClinicalTrials.gov number, NTC

  6. Risk factors associated with prognosis of progressive stages of acute-on-chronic hepatitis B liver failure

    Directory of Open Access Journals (Sweden)

    YE Peiyan

    2013-04-01

    Full Text Available ObjectiveTo identify the risk factors associated with progression of acute-on-chronic liver failure (ACLF occurring in patients with chronic hepatitis B virus (HBV infection (CHB. MethodsThe clinical, demographic, treatment and outcome data of 180 ACLF patients with concomitant CHB managed in our hospital between June 2009 and September 2012 were retrospectively reviewed. Clinical data, taken at baseline, included markers of inflammation/infection (white blood cell (WBC count, coagulation (prothrombin time (PT and prothrombin activity (PTA, and liver function (alanine aminotransferase (ALT, aspartate aminotransferase (AST, total bilirubin (TBil, direct bilirubin (DBil, choninesterase (CHE, albumin (Alb, globulin (Glb, total cholesterol (TC, and ammonia. In-hospital treatments included supplementation with traditional Chinese medicine-based therapies, such as Tuihuang decoction and detoxification enema. The primary outcome was survival during hospitalization. The patients were grouped for analysis according to ACLF stage (early, n=93; mid, n=61; late, n=26 and the risk factors associated with each stage were identified by using univariate (log-rank test and multivariate (Cox’s test regression analyses. The association of risk factors with patient survival was assessed by Kaplan-Meier curve analysis. ResultsThe three ACLF groups showed significantly different amounts of leukocytes, with the late ACLF group showing the highest WBC. The late ACLF group also showed significantly lower Glb and TC. There was a trend in reduced cumulative survival rate and shorter time to death that significantly corresponded to progressive stages of ACLF (early ACLF>mid ACLF>late ACLF; all P<0.001. One-hundred-and-twenty-six (70.0% of the patients died during their hospitalization, and multivariate regression analysis of this entire patient population identified absence of colonic enema, presence of hepatic encephalopathy, presence of hepatorenal syndrome, PTA

  7. 18F-FDG PET diagnostic and prognostic patterns do not overlap in Alzheimer's disease (AD) patients at the mild cognitive impairment (MCI) stage

    International Nuclear Information System (INIS)

    Morbelli, Silvia; Bauckneht, Matteo; Buschiazzo, Ambra; Nieri, Alberto; Sambuceti, Gianmario; Pagani, Marco; De Carli, Fabrizio

    2017-01-01

    We aimed to identify the cortical regions where hypometabolism can predict the speed of conversion to dementia in mild cognitive impairment due to Alzheimer's disease (MCI-AD). We selected from the clinical database of our tertiary center memory clinic, eighty-two consecutive MCI-AD that underwent 18F-fluorodeoxyglucose (FDG) PET at baseline during the first diagnostic work-up and were followed up at least until their clinical conversion to AD dementia. The whole group of MCI-AD was compared in SPM8 with a group of age-matched healthy controls (CTR) to verify the presence of AD diagnostic-pattern; then the correlation between conversion time and brain metabolism was assessed to identify the prognostic-pattern. Significance threshold was set at p < 0.05 False-Discovery-Rate (FDR) corrected at peak and at cluster level. Each MCI-AD was then compared with CTR by means of a SPM single-subject analysis and grouped according to presence of AD diagnostic-pattern and prognostic-pattern. Kaplan-Meier-analysis was used to evaluate if diagnostic- and/or prognostic-patterns can predict speed of conversion to dementia. Diagnostic-pattern corresponded to typical posterior hypometabolism (BA 7, 18, 19, 30, 31 and 40) and did not correlate with time to conversion, which was instead correlated with metabolic levels in right middle and inferior temporal gyri as well as in the fusiform gyrus (prognostic-pattern, BA 20, 21 and 38). At Kaplan-Meier analysis, patients with hypometabolism in the prognostic pattern converted to AD-dementia significantly earlier than patients not showing significant hypometabolism in the right middle and inferior temporal cortex (9 versus 19 months; Log rank p < 0.02, Breslow test: p < 0.003, Tarone-Ware test: p < 0.007). The present findings support the role of FDG PET as a robust progression biomarker even in a naturalist population of MCI-AD. However, not the AD-typical diagnostic-pattern in posterior regions but the middle and inferior temporal

  8. Stereotactic Body Radiation Therapy for Re-irradiation of Persistent or Recurrent Non-Small Cell Lung Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Trovo, Marco, E-mail: marcotrovo33@hotmail.com [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Minatel, Emilio; Durofil, Elena [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Polesel, Jerry [Department of Epidemiology and Biostatistics, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Avanzo, Michele [Department of Medical Physics, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Baresic, Tania [Department of Nuclear Medicine, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Bearz, Alessandra [Department of Medical Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy); Del Conte, Alessandro [Department of Medical Oncology, Pordenone General Hospital, Aviano, Pordenone (Italy); Franchin, Giovanni; Gobitti, Carlo; Rumeileh, Imad Abu; Trovo, Mauro G. [Department of Radiation Oncology, Centro di Riferimento Oncologico of Aviano, Pordenone (Italy)

    2014-04-01

    Purpose: To retrospectively assess toxicity and outcome of re-irradiation with stereotactic body radiation therapy (SBRT) in patients with recurrent or persistent non-small cell lung cancer (NSCLC), who were previously treated with radical radiation therapy (50-60 Gy). The secondary endpoint was to investigate whether there are dosimetric parameter predictors of severe radiation toxicity. Methods and Materials: The analysis was conducted in 17 patients with “in-field” recurrent/persistent centrally located NSCLC, who underwent re-irradiation with SBRT. SBRT consisted of 30 Gy in 5 to 6 fractions; these prescriptions would be equivalent for the tumor to 37.5 to 40 Gy, bringing the total 2-Gy-per-fraction cumulative dose to 87 to 100 Gy, considering the primary radiation therapy treatment. Actuarial analyses and survival were calculated by the Kaplan-Meier method, and P values were estimated by the log-rank test, starting from the date of completion of SBRT. Dosimetric parameters from the subgroups with and without grade ≥3 pulmonary toxicity were compared using a 2-tailed Student t test. Results: The median follow-up was 18 months (range, 4-57 months). Only 2 patients had local failure, corresponding to a local control rate of 86% at 1 year. The Kaplan-Meier estimates of overall survival (OS) rates at 1 and 2 years were 59% and 29%, respectively; the median OS was 19 months. Four patients (23%) experienced grade 3 radiation pneumonitis, and 1 patient developed fatal pneumonitis. One patient died of fatal hemoptysis 2 months after the completion of SBRT. Unexpectedly, heart maximum dose, D5 (minimum dose to at least 5% of the heart volume), and D10 were correlated with risk of radiation pneumonitis (P<.05). Conclusions: Re-irradiation with SBRT for recurrent/persistent centrally located NSCLC achieves excellent results in terms of local control. However, the high rate of severe toxicity reported in our study is of concern.

  9. Stereotactic Body Radiation Therapy for Re-irradiation of Persistent or Recurrent Non-Small Cell Lung Cancer

    International Nuclear Information System (INIS)

    Trovo, Marco; Minatel, Emilio; Durofil, Elena; Polesel, Jerry; Avanzo, Michele; Baresic, Tania; Bearz, Alessandra; Del Conte, Alessandro; Franchin, Giovanni; Gobitti, Carlo; Rumeileh, Imad Abu; Trovo, Mauro G.

    2014-01-01

    Purpose: To retrospectively assess toxicity and outcome of re-irradiation with stereotactic body radiation therapy (SBRT) in patients with recurrent or persistent non-small cell lung cancer (NSCLC), who were previously treated with radical radiation therapy (50-60 Gy). The secondary endpoint was to investigate whether there are dosimetric parameter predictors of severe radiation toxicity. Methods and Materials: The analysis was conducted in 17 patients with “in-field” recurrent/persistent centrally located NSCLC, who underwent re-irradiation with SBRT. SBRT consisted of 30 Gy in 5 to 6 fractions; these prescriptions would be equivalent for the tumor to 37.5 to 40 Gy, bringing the total 2-Gy-per-fraction cumulative dose to 87 to 100 Gy, considering the primary radiation therapy treatment. Actuarial analyses and survival were calculated by the Kaplan-Meier method, and P values were estimated by the log-rank test, starting from the date of completion of SBRT. Dosimetric parameters from the subgroups with and without grade ≥3 pulmonary toxicity were compared using a 2-tailed Student t test. Results: The median follow-up was 18 months (range, 4-57 months). Only 2 patients had local failure, corresponding to a local control rate of 86% at 1 year. The Kaplan-Meier estimates of overall survival (OS) rates at 1 and 2 years were 59% and 29%, respectively; the median OS was 19 months. Four patients (23%) experienced grade 3 radiation pneumonitis, and 1 patient developed fatal pneumonitis. One patient died of fatal hemoptysis 2 months after the completion of SBRT. Unexpectedly, heart maximum dose, D5 (minimum dose to at least 5% of the heart volume), and D10 were correlated with risk of radiation pneumonitis (P<.05). Conclusions: Re-irradiation with SBRT for recurrent/persistent centrally located NSCLC achieves excellent results in terms of local control. However, the high rate of severe toxicity reported in our study is of concern

  10. 18F-FDG PET diagnostic and prognostic patterns do not overlap in Alzheimer's disease (AD) patients at the mild cognitive impairment (MCI) stage

    Energy Technology Data Exchange (ETDEWEB)

    Morbelli, Silvia; Bauckneht, Matteo; Buschiazzo, Ambra; Nieri, Alberto; Sambuceti, Gianmario [Genoa Univ. (Italy). Dept. of Health Sciences; IRCCS AOU San Martino-IST, Genoa (Italy). Nuclear Medicine Unit; Arnaldi, Dario; Picco, Agnese; Pardini, Matteo; Brugnolo, Andrea; Girtler, Nicola; Nobili, Flavio [Genoa Univ. (Italy). Clinical Neurology, Department of Neuroscience (DINOGMI); IRCCS AOU San Martino-IST, Genoa (Italy); Pagani, Marco [Institute of Cognitive Sciences and Technologies, Rome (Italy); Karolinska Hospital, Stockholm (Sweden). Department of Nuclear Medicine; Chincarini, Andrea [Istituto Nazionale di Fisica Nucleare, Genoa (Italy); De Carli, Fabrizio [National Research Council, Genoa (Italy). Institute of Bioimaging and Molecular Physiology

    2017-11-15

    We aimed to identify the cortical regions where hypometabolism can predict the speed of conversion to dementia in mild cognitive impairment due to Alzheimer's disease (MCI-AD). We selected from the clinical database of our tertiary center memory clinic, eighty-two consecutive MCI-AD that underwent 18F-fluorodeoxyglucose (FDG) PET at baseline during the first diagnostic work-up and were followed up at least until their clinical conversion to AD dementia. The whole group of MCI-AD was compared in SPM8 with a group of age-matched healthy controls (CTR) to verify the presence of AD diagnostic-pattern; then the correlation between conversion time and brain metabolism was assessed to identify the prognostic-pattern. Significance threshold was set at p < 0.05 False-Discovery-Rate (FDR) corrected at peak and at cluster level. Each MCI-AD was then compared with CTR by means of a SPM single-subject analysis and grouped according to presence of AD diagnostic-pattern and prognostic-pattern. Kaplan-Meier-analysis was used to evaluate if diagnostic- and/or prognostic-patterns can predict speed of conversion to dementia. Diagnostic-pattern corresponded to typical posterior hypometabolism (BA 7, 18, 19, 30, 31 and 40) and did not correlate with time to conversion, which was instead correlated with metabolic levels in right middle and inferior temporal gyri as well as in the fusiform gyrus (prognostic-pattern, BA 20, 21 and 38). At Kaplan-Meier analysis, patients with hypometabolism in the prognostic pattern converted to AD-dementia significantly earlier than patients not showing significant hypometabolism in the right middle and inferior temporal cortex (9 versus 19 months; Log rank p < 0.02, Breslow test: p < 0.003, Tarone-Ware test: p < 0.007). The present findings support the role of FDG PET as a robust progression biomarker even in a naturalist population of MCI-AD. However, not the AD-typical diagnostic-pattern in posterior regions but the middle and inferior temporal

  11. Infrainguinal arterial reconstructions in patients with aortoiliac occlusive disease: the influence of iliac stenting.

    Science.gov (United States)

    Timaran, C H; Stevens, S L; Freeman, M B; Goldman, M H

    2001-12-01

    Iliac artery angioplasty (IAA) is an effective adjunct when combined with infrainguinal arterial reconstructions (IARs) in appropriate patients with multilevel occlusive disease. However, the effect of iliac artery stenting (IAS) on the outcome of patients undergoing distal bypass procedures is not defined. The purpose of this study was to estimate the influence of previous IAS for iliac occlusive disease on the outcome of IARs, compared with those after IAA alone or aortofemoral bypass grafting procedures (AFBs). During a 5-year period (1995-2000), 105 patients with previous intervention for iliac occlusive disease underwent 120 IARs. The criteria prepared by the Ad Hoc Committee on Reporting Standards (Society for Vascular Surgery/International Society for Cardiovascular Surgery) were followed to define the variables. The TransAtlantic Inter-Society Consensus classification was used to characterize the type of iliac lesions. Univariate (Kaplan-Meier) and multivariate analyses (Cox proportional hazards model) were used to determine the association between preoperative variables and cumulative primary patency. Forty-five IARs were performed in patients with an earlier IAS repair, 33 in patients with an earlier IAA repair, and 42 in patients with an earlier AFB repair. There were not significant differences between patients in the IAS and IAA groups, except for a more frequent use of polytetrafluoroethylene grafts for IARs in the IAS group (40% vs 15%; chi(2) test, P = .03). The 5-year primary patency rate for IARs was 68% in the IAS group, 46% in the IAA group, and 61% in the AFB group. Univariate analyses revealed that primary patency rates for IARs in patients with previous IAS were significantly higher than those in the IAA group (Kaplan-Meier, log-rank test, P = .02). Previous IAA repair was associated with a two-fold increased risk of IAR graft failure (relative risk, 2.2; 95% CI, 1.1-4.8; P = .04). IARs in patients with previous IAS have significantly

  12. Survival benefits of remote ischemic conditioning in sepsis.

    Science.gov (United States)

    Joseph, Bellal; Khalil, Mazhar; Hashmi, Ammar; Hecker, Louise; Kulvatunyou, Narong; Tang, Andrew; Friese, Randall S; Rhee, Peter

    2017-06-01

    Sepsis remains the leading cause of death in the surgical intensive care unit. Prior studies have demonstrated a survival benefit of remote ischemic conditioning (RIC) in many disease states. The aim of this study was to determine the effects of RIC on survival in sepsis in an animal model and to assess alterations in inflammatory biochemical profiles. We hypothesized that RIC alters inflammatory biochemical profiles resulting in decreased mortality in a septic mouse model. Eight to 12 week C57BL/6 mice received intra-peritoneal injection of 12.5-mg/kg lipopolysaccharide (LPS). Septic animals in the experimental group underwent RIC at 0, 2, and 6 h after LPS by surgical exploration and alternate clamping of the femoral artery. Six 4-min cycles of ischemia-reperfusion were performed. Primary outcome was survival at 5-d after LPS injection. Secondary outcome was to assess the following serum cytokine levels: interferon-γ (IFN-γ), interleukin (IL)-10, IL-1β, and tumor necrosis factoralpha (TNFα) at the baseline before LPS injection, 0 hour after LPS injection, and at 2, 4, 24 hours after induction of sepsis (RIC was performed at 2 h after LPS injection). Kaplan-Meier survival analysis and log-rank test were used. ANOVA test was used to compare cytokine measurements. We performed experiments on 44 mice: 14 sham and 30 RIC mice (10 at each time point). Overall survival was higher in the experimental group compared to the sham group (57% versus 21%; P = 0.02), with the highest survival rate observed in the 2-hour post-RIC group (70%). On Kaplan-Meier analysis, 2-h post-RIC group had increased survival at 5 days after LPS (P = 0.04) with hazard ratio of 0.3 (95% confidence interval = 0.09-0.98). In the RIC group, serum concentrations of IFN-γ, IL-10, IL-1β, and TNFα peaked at 2 h after LPS and then decreased significantly over 24 hours (P sepsis and has the potential for implementation in the clinical practice. Early implementation of RIC may play an

  13. Robust Intratumor Partitioning to Identify High-Risk Subregions in Lung Cancer: A Pilot Study

    International Nuclear Information System (INIS)

    Wu, Jia; Gensheimer, Michael F.; Dong, Xinzhe; Rubin, Daniel L.; Napel, Sandy; Diehn, Maximilian; Loo, Billy W.; Li, Ruijiang

    2016-01-01

    Purpose: To develop an intratumor partitioning framework for identifying high-risk subregions from "1"8F-fluorodeoxyglucose positron emission tomography (FDG-PET) and computed tomography (CT) imaging and to test whether tumor burden associated with the high-risk subregions is prognostic of outcomes in lung cancer. Methods and Materials: In this institutional review board–approved retrospective study, we analyzed the pretreatment FDG-PET and CT scans of 44 lung cancer patients treated with radiation therapy. A novel, intratumor partitioning method was developed, based on a 2-stage clustering process: first at the patient level, each tumor was over-segmented into many superpixels by k-means clustering of integrated PET and CT images; next, tumor subregions were identified by merging previously defined superpixels via population-level hierarchical clustering. The volume associated with each of the subregions was evaluated using Kaplan-Meier analysis regarding its prognostic capability in predicting overall survival (OS) and out-of-field progression (OFP). Results: Three spatially distinct subregions were identified within each tumor that were highly robust to uncertainty in PET/CT co-registration. Among these, the volume of the most metabolically active and metabolically heterogeneous solid component of the tumor was predictive of OS and OFP on the entire cohort, with a concordance index or CI of 0.66-0.67. When restricting the analysis to patients with stage III disease (n=32), the same subregion achieved an even higher CI of 0.75 (hazard ratio 3.93, log-rank P=.002) for predicting OS, and a CI of 0.76 (hazard ratio 4.84, log-rank P=.002) for predicting OFP. In comparison, conventional imaging markers, including tumor volume, maximum standardized uptake value, and metabolic tumor volume using threshold of 50% standardized uptake value maximum, were not predictive of OS or OFP, with CI mostly below 0.60 (log-rank P>.05). Conclusion: We propose a robust intratumor

  14. Robust Intratumor Partitioning to Identify High-Risk Subregions in Lung Cancer: A Pilot Study.

    Science.gov (United States)

    Wu, Jia; Gensheimer, Michael F; Dong, Xinzhe; Rubin, Daniel L; Napel, Sandy; Diehn, Maximilian; Loo, Billy W; Li, Ruijiang

    2016-08-01

    To develop an intratumor partitioning framework for identifying high-risk subregions from (18)F-fluorodeoxyglucose positron emission tomography (FDG-PET) and computed tomography (CT) imaging and to test whether tumor burden associated with the high-risk subregions is prognostic of outcomes in lung cancer. In this institutional review board-approved retrospective study, we analyzed the pretreatment FDG-PET and CT scans of 44 lung cancer patients treated with radiation therapy. A novel, intratumor partitioning method was developed, based on a 2-stage clustering process: first at the patient level, each tumor was over-segmented into many superpixels by k-means clustering of integrated PET and CT images; next, tumor subregions were identified by merging previously defined superpixels via population-level hierarchical clustering. The volume associated with each of the subregions was evaluated using Kaplan-Meier analysis regarding its prognostic capability in predicting overall survival (OS) and out-of-field progression (OFP). Three spatially distinct subregions were identified within each tumor that were highly robust to uncertainty in PET/CT co-registration. Among these, the volume of the most metabolically active and metabolically heterogeneous solid component of the tumor was predictive of OS and OFP on the entire cohort, with a concordance index or CI of 0.66-0.67. When restricting the analysis to patients with stage III disease (n=32), the same subregion achieved an even higher CI of 0.75 (hazard ratio 3.93, log-rank P=.002) for predicting OS, and a CI of 0.76 (hazard ratio 4.84, log-rank P=.002) for predicting OFP. In comparison, conventional imaging markers, including tumor volume, maximum standardized uptake value, and metabolic tumor volume using threshold of 50% standardized uptake value maximum, were not predictive of OS or OFP, with CI mostly below 0.60 (log-rank P>.05). We propose a robust intratumor partitioning method to identify clinically relevant, high

  15. Robust Intratumor Partitioning to Identify High-Risk Subregions in Lung Cancer: A Pilot Study

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Jia; Gensheimer, Michael F.; Dong, Xinzhe [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Rubin, Daniel L. [Department of Radiology, Stanford University School of Medicine, Stanford, California (United States); Department of Medicine (Biomedical Informatics Research), Stanford University School of Medicine, Stanford, California (United States); Napel, Sandy [Department of Radiology, Stanford University School of Medicine, Stanford, California (United States); Diehn, Maximilian [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Stanford Cancer Institute, Stanford University School of Medicine, Stanford, California (United States); Institute for Stem Cell Biology and Regenerative Medicine, Stanford University School of Medicine, Stanford, California (United States); Loo, Billy W. [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Stanford Cancer Institute, Stanford University School of Medicine, Stanford, California (United States); Li, Ruijiang, E-mail: rli2@stanford.edu [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Stanford Cancer Institute, Stanford University School of Medicine, Stanford, California (United States)

    2016-08-01

    Purpose: To develop an intratumor partitioning framework for identifying high-risk subregions from {sup 18}F-fluorodeoxyglucose positron emission tomography (FDG-PET) and computed tomography (CT) imaging and to test whether tumor burden associated with the high-risk subregions is prognostic of outcomes in lung cancer. Methods and Materials: In this institutional review board–approved retrospective study, we analyzed the pretreatment FDG-PET and CT scans of 44 lung cancer patients treated with radiation therapy. A novel, intratumor partitioning method was developed, based on a 2-stage clustering process: first at the patient level, each tumor was over-segmented into many superpixels by k-means clustering of integrated PET and CT images; next, tumor subregions were identified by merging previously defined superpixels via population-level hierarchical clustering. The volume associated with each of the subregions was evaluated using Kaplan-Meier analysis regarding its prognostic capability in predicting overall survival (OS) and out-of-field progression (OFP). Results: Three spatially distinct subregions were identified within each tumor that were highly robust to uncertainty in PET/CT co-registration. Among these, the volume of the most metabolically active and metabolically heterogeneous solid component of the tumor was predictive of OS and OFP on the entire cohort, with a concordance index or CI of 0.66-0.67. When restricting the analysis to patients with stage III disease (n=32), the same subregion achieved an even higher CI of 0.75 (hazard ratio 3.93, log-rank P=.002) for predicting OS, and a CI of 0.76 (hazard ratio 4.84, log-rank P=.002) for predicting OFP. In comparison, conventional imaging markers, including tumor volume, maximum standardized uptake value, and metabolic tumor volume using threshold of 50% standardized uptake value maximum, were not predictive of OS or OFP, with CI mostly below 0.60 (log-rank P>.05). Conclusion: We propose a robust

  16. Synergistic effects of cognitive impairment on physical disability in all-cause mortality among men aged 80 years and over: Results from longitudinal older veterans study.

    Directory of Open Access Journals (Sweden)

    Wan-Chen Yu

    Full Text Available We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan.This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI, geriatric syndromes, activities of daily living (ADL using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE. Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk.Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years. Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038 or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002 after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition.Physical disability

  17. Synergistic effects of cognitive impairment on physical disability in all-cause mortality among men aged 80 years and over: Results from longitudinal older veterans study.

    Science.gov (United States)

    Yu, Wan-Chen; Chou, Ming-Yueh; Peng, Li-Ning; Lin, Yu-Te; Liang, Chih-Kuang; Chen, Liang-Kung

    2017-01-01

    We evaluated effects of the interrelationship between physical disability and cognitive impairment on long-term mortality of men aged 80 years and older living in a retirement community in Taiwan. This prospective cohort study enrolled older men aged 80 and older living in a Veterans Care Home. Those with confirmed diagnosis of dementia were excluded. All participants received comprehensive geriatric assessment, including sociodemographic data, Charlson's Comorbidity Index (CCI), geriatric syndromes, activities of daily living (ADL) using the Barthel index and cognitive function using the Mini-Mental State Examination (MMSE). Subjects were categorized into normal cognitive function, mild cognitive deterioration, and moderate-to-severe cognitive impairment and were further stratified by physical disability status. Kaplan-Meier log-rank test was used for survival analysis. After adjusting for sociodemographic characteristics and geriatric syndromes, Cox proportional hazards model was constructed to examine associations between cognitive function, disability and increased mortality risk. Among 305 male subjects aged 85.1 ± 4.1 years, 89 subjects died during follow-up (mean follow-up: 1.87 ± 0.90 years). Kaplan-Meier unadjusted analysis showed reduced survival probability associated with moderate-to-severe cognitive status and physical disability. Mortality risk increased significantly only for physically disabled subjects with simultaneous mild cognitive deterioration (adjusted HR 1.951, 95% CI 1.036-3.673, p = 0.038) or moderate-to-severe cognitive impairment (aHR 2.722, 95% CI 1.430-5.181, p = 0.002) after adjusting for age, BMI, education levels, smoking status, polypharmacy, visual and hearing impairment, urinary incontinence, fall history, depressive symptoms and CCI. Mortality risk was not increased among physically independent subjects with or without cognitive impairment, and physically disabled subjects with intact cognition. Physical disability is a major

  18. Optimal FDG PET/CT volumetric parameters for risk stratification in patients with locally advanced non-small cell lung cancer: results from the ACRIN 6668/RTOG 0235 trial

    Energy Technology Data Exchange (ETDEWEB)

    Salavati, Ali [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); University of Minnesota, Department of Radiology, Minneapolis, MN (United States); Duan, Fenghai [Brown University School of Public Health, Department of Biostatistics and Center for Statistical Sciences, Providence, RI (United States); Snyder, Bradley S. [Brown University School of Public Health, Center for Statistical Sciences, Providence, RI (United States); Wei, Bo [Emory University, Department of Biostatistics, Rollins School of Public Health, Atlanta, GA (United States); Houshmand, Sina; Alavi, Abass [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Khiewvan, Benjapa [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Mahidol University, Division of Nuclear Medicine, Department of Radiology, Faculty of Medicine Siriraj Hospital, Bangkok (Thailand); Opanowski, Adam [ACR Center for Research and Innovation, American College of Radiology, Philadelphia, PA (United States); Simone, Charles B. [University of Maryland Medical Center, Department of Radiation Oncology, Baltimore, MD (United States); Siegel, Barry A. [Washington University School of Medicine, Mallinckrodt Institute of Radiology and the Alvin J. Siteman Cancer Center, St, Louis, MO (United States); Machtay, Mitchell [Case Western Reserve University and University Hospitals Case Medical Center, Department of Radiation Oncology, Cleveland, OH (United States)

    2017-11-15

    In recent years, multiple studies have demonstrated the value of volumetric FDG-PET/CT parameters as independent prognostic factors in patients with non-small cell lung cancer (NSCLC). We aimed to determine the optimal cut-off points of pretreatment volumetric FDG-PET/CT parameters in predicting overall survival (OS) in patients with locally advanced NSCLC and to recommend imaging biomarkers appropriate for routine clinical applications. Patients with inoperable stage IIB/III NSCLC enrolled in ACRIN 6668/RTOG 0235 were included. Pretreatment FDG-PET scans were quantified using semiautomatic adaptive contrast-oriented thresholding and local-background partial-volume-effect-correction algorithms. For each patient, the following indices were measured: metabolic tumor volume (MTV), total lesion glycolysis (TLG), SUVmax, SUVmean, partial-volume-corrected TLG (pvcTLG), and pvcSUVmean for the whole-body, primary tumor, and regional lymph nodes. The association between each index and patient outcome was assessed using Cox proportional hazards regression. Optimal cut-off points were estimated using recursive binary partitioning in a conditional inference framework and used in Kaplan-Meier curves with log-rank testing. The discriminatory ability of each index was examined using time-dependent receiver operating characteristic (ROC) curves and corresponding area under the curve (AUC(t)). The study included 196 patients. Pretreatment whole-body and primary tumor MTV, TLG, and pvcTLG were independently prognostic of OS. Optimal cut-off points were 175.0, 270.9, and 35.5 cm{sup 3} for whole-body TLG, pvcTLG, and MTV, and were 168.2, 239.8, and 17.4 cm{sup 3} for primary tumor TLG, pvcTLG, and MTV, respectively. In time-dependent ROC analysis, AUC(t) for MTV and TLG were uniformly higher than that of SUV measures over all time points. Primary tumor and whole-body parameters demonstrated similar patterns of separation for those patients above versus below the optimal cut

  19. Comparison of transmission dynamics between Streptococcus uberis and Streptococcus agalactiae intramammary infections.

    Science.gov (United States)

    Leelahapongsathon, Kansuda; Schukken, Ynte Hein; Pinyopummintr, Tanu; Suriyasathaporn, Witaya

    2016-02-01

    The objectives of study were to determine the transmission parameters (β), durations of infection, and basic reproductive numbers (R0) of both Streptococcus agalactiae and Streptococcus uberis as pathogens causing mastitis outbreaks in dairy herds. A 10-mo longitudinal study was performed using 2 smallholder dairy herds with mastitis outbreaks caused by Strep. agalactiae and Strep. uberis, respectively. Both herds had poor mastitis control management and did not change their milking management during the entire study period. Quarter milk samples were collected at monthly intervals from all lactating animals in each herd for bacteriological identification. The durations of infection for Strep. uberis intramammary infection (IMI) and Strep. agalactiae IMI were examined using Kaplan-Meier survival curves, and the Kaplan-Meier survival functions for Strep. uberis IMI and Strep. agalactiae IMI were compared using log rank survival-test. The spread of Strep. uberis and Strep. agalactiae through the population was determined by transmission parameter, β, the probability per unit of time that one infectious quarter will infect another quarter, assuming that all other quarters are susceptible. For the Strep. uberis outbreak herd (31 cows), 56 new infections and 28 quarters with spontaneous cure were observed. For the Strep. agalactiae outbreak herd (19 cows), 26 new infections and 9 quarters with spontaneous cure were observed. The duration of infection for Strep. agalactiae (mean=270.84 d) was significantly longer than the duration of infection for Strep. uberis (mean=187.88 d). The transmission parameters (β) estimated (including 95% confidence interval) for Strep. uberis IMI and Strep. agalactiae IMI were 0.0155 (0.0035-0.0693) and 0.0068 (0.0008-0.0606), respectively. The R0 (including 95% confidence interval) during the study were 2.91 (0.63-13.47) and 1.86 (0.21-16.61) for Strep. uberis IMI and Strep. agalactiae IMI, respectively. In conclusion, the transmission

  20. Effect of tooth whitening strips on fatigue resistance and flexural strength of bovine dentin in vitro.

    Directory of Open Access Journals (Sweden)

    Laura E Tam

    Full Text Available To determine the effects of whitening strips on bovine dentin fatigue resistance and flexural strength in vitro.A total of eighty bovine dentin specimens (2x2x17mm were treated with either: control glycerine gel on plastic film wrap or whitening strips containing 9.5% hydrogen peroxide. Treatment was applied for 30 minutes, twice a day, for 1- or 4-weeks. After the last treatment, ten specimens per group were randomly selected to undergo fatigue testing (106 cycles, 3Hz, 20N while the other ten were subjected to flexural strength testing after ten days of storage in artificial saliva. Kaplan-Meier method with a log rank test, Wilcoxon test and Cox regression were used to assess fatigue test results (p<0.05. One-way ANOVA and Tukey's tests were used to compare the flexural strength results (p<0.05.There were significant differences in survival during the fatigue test among the groups (p<0.001. Treatment (control or bleach was a significant factor for specimen survival (p<0.001, Exp(B = 33.45. There were significant differences in mean flexural strength (p<0.001. No significant difference was found between "1-wk control" and "4-wk control". The mean flexural strength and fatigue resistance of the "4-wk bleach" were significantly lower than all the other groups.The use of whitening strips reduced the fatigue resistance and flexural strength of bovine dentin in vitro. Until the effect of whitening strips on mechanical properties of human dentin is fully elucidated, it remains prudent to advise patients to avoid excessive direct use of whitening strips on dentin.

  1. Testing different brain metastasis grading systems in stereotactic radiosurgery: Radiation Therapy Oncology Group's RPA, SIR, BSBM, GPA, and modified RPA.

    Science.gov (United States)

    Serizawa, Toru; Higuchi, Yoshinori; Nagano, Osamu; Hirai, Tatsuo; Ono, Junichi; Saeki, Naokatsu; Miyakawa, Akifumi

    2012-12-01

    The authors conducted validity testing of the 5 major reported indices for radiosurgically treated brain metastases- the original Radiation Therapy Oncology Group's Recursive Partitioning Analysis (RPA), the Score Index for Radiosurgery in Brain Metastases (SIR), the Basic Score for Brain Metastases (BSBM), the Graded Prognostic Assessment (GPA), and the subclassification of RPA Class II proposed by Yamamoto-in nearly 2500 cases treated with Gamma Knife surgery (GKS), focusing on the preservation of neurological function as well as the traditional endpoint of overall survival. The authors analyzed data from 2445 cases treated with GKS by the first author (T.S.), the primary surgeon. The patient group consisted of 1716 patients treated between January 1998 and March 2008 (the Chiba series) and 729 patients treated between April 2008 and December 2011 (the Tokyo series). The interval from the date of GKS until the date of the patient's death (overall survival) and impaired activities of daily living (qualitative survival) were calculated using the Kaplan-Meier method, while the absolute risk for two adjacent classes of each grading system and both hazard ratios and 95% confidence intervals were estimated using the Cox proportional hazards model. For overall survival, there were highly statistically significant differences between each two adjacent patient groups characterized by class or score (all p values RPA appeared to be better than the original RPA and GPA. The modified RPA subclassification, proposed by Yamamoto, is well balanced in scoring simplicity with respect to case number distribution and statistical results for overall survival. However, a new or revised grading system is necessary for predicting qualitative survival and for selecting the optimal treatment for patients with brain metastasis treated by GKS.

  2. Preoperative Pulmonary Function Tests (PFTs) and Outcomes from Resected Early Stage Non-small Cell Lung Cancer (NSCLC).

    Science.gov (United States)

    Almquist, Daniel; Khanal, Nabin; Smith, Lynette; Ganti, Apar Kishor

    2018-05-01

    Preoperative pulmonary function tests (PFTs) predict operative morbidity and mortality after resection in lung cancer. However, the impact of preoperative PFTs on overall outcomes in surgically-resected stage I and II non-small cell lung cancer (NSCLC) has not been well studied. This is a retrospective study of 149 patients who underwent surgical resection as first-line treatment for stage I and II NSCLC at a single center between 2003 and 2014. PFTs [forced expiratory volume in 1 sec (FEV1), Diffusing Capacity (DLCO)], both absolute values and percent predicted values were categorized into quartiles. The Kaplan-Meier method and Cox regression analysis were used to determine whether PFTs predicted for overall survival (OS). Logistic regression was used to estimate the risk of postoperative complications and length of stay (LOS) greater than 10 days based on the results of PFTs. The median age of the cohort was 68 years. The cohort was predominantly males (98.6%), current or ex-smokers (98%), with stage I NSCLC (82.76%). The majority of patients underwent a lobectomy (n=121, 81.21%). The predominant tumor histology was adenocarcinoma (n=70, 47%) followed by squamous cell carcinoma (n=61, 41%). The median follow-up of surviving patients was 53.2 months. DLCO was found to be a significant predictor of OS (HR=0.93, 95% CI=0.87-0.99; p=0.03) on univariate analysis. Although PFTs did not predict for postoperative complications, worse PFTs were significant predictors of length of stay >10 days. Preoperative PFTs did not predict for survival from resected early-stage NSCLC, but did predict for prolonged hospital stay following surgery. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  3. High ASMA+ Fibroblasts and Low Cytoplasmic HMGB1+ Breast Cancer Cells Predict Poor Prognosis.

    Science.gov (United States)

    Amornsupak, Kamolporn; Jamjuntra, Pranisa; Warnnissorn, Malee; O-Charoenrat, Pornchai; Sa-Nguanraksa, Doonyapat; Thuwajit, Peti; Eccles, Suzanne A; Thuwajit, Chanitra

    2017-10-01

    The influence of cancer-associated fibroblasts (CAFs) and high mobility group box 1 (HMGB1) has been recognized in several cancers, although their roles in breast cancer are unclear. The present study aimed to determine the levels and prognostic significance of α-smooth muscle actin-positive (ASMA + ) CAFs, plus HMGB1 and receptor for advanced glycation end products (RAGE) in cancer cells. A total of 127 breast samples, including 96 malignant and 31 benign, were examined for ASMA, HMGB1, and RAGE by immunohistochemistry. The χ 2 test and Fisher's exact test were used to test the association of each protein with clinicopathologic parameters. The Kaplan-Meier method or log-rank test and Cox regression were used for survival analysis. ASMA + fibroblast infiltration was significantly increased in the tumor stroma compared with that in benign breast tissue. The levels of cytoplasmic HMGB1 and RAGE were significantly greater in the breast cancer tissue than in the benign breast tissues. High ASMA expression correlated significantly with large tumor size, clinical stage III-IV, and angiolymphatic and perinodal invasion. In contrast, increased cytoplasmic HMGB1 correlated significantly with small tumor size, pT stage, early clinical stage, luminal subtype (but not triple-negative subtype), and estrogen receptor and progesterone receptor expression. The levels of ASMA (hazard ratio, 14.162; P = .010) and tumor cytoplasmic HMGB1 (hazard ratio, 0.221; P = .005) could serve as independent prognostic markers for metastatic relapse in breast cancer patients. The ASMA-high/HMGB1-low profile provided the most reliable prediction of metastatic relapse. We present for the first time, to the best of our knowledge, the potential clinical implications of the combined assessment of ASMA + fibroblasts and cytoplasmic HMGB1 in breast cancer. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Hepatitis C virus recurrence after liver transplantation: a 10-year evaluation.

    Science.gov (United States)

    Gitto, Stefano; Belli, Luca Saverio; Vukotic, Ranka; Lorenzini, Stefania; Airoldi, Aldo; Cicero, Arrigo Francesco Giuseppe; Vangeli, Marcello; Brodosi, Lucia; Panno, Arianna Martello; Di Donato, Roberto; Cescon, Matteo; Grazi, Gian Luca; De Carlis, Luciano; Pinna, Antonio Daniele; Bernardi, Mauro; Andreone, Pietro

    2015-04-07

    To evaluate the predictors of 10-year survival of patients with hepatitis C recurrence. Data from 358 patients transplanted between 1989 and 2010 in two Italian transplant centers and with evidence of hepatitis C recurrence were analyzed. A χ(2), Fisher's exact test and Kruskal Wallis' test were used for categorical and continuous variables, respectively. Survival analysis was performed at 10 years after transplant using the Kaplan-Meier method, and a log-rank test was used to compare groups. A P level less than 0.05 was considered significant for all tests. Multivariate analysis of the predictive role of different variables on 10-year survival was performed by a stepwise Cox logistic regression. The ten-year survival of the entire population was 61.2%. Five groups of patients were identified according to the virological response or lack of a response to antiviral treatment and, among those who were not treated, according to the clinical status (mild hepatitis C recurrence, "too sick to be treated" and patients with comorbidities contraindicating the treatment). While the 10-year survival of treated and untreated patients was not different (59.1% vs 64.7%, P = 0.192), patients with a sustained virological response had a higher 10-year survival rate than both the "non-responders" (84.7% vs 39.8%, P < 0.0001) and too sick to be treated (84.7% vs 0%, P < 0.0001). Sustained virological responders had a survival rate comparable to patients untreated with mild recurrence (84.7% vs 89.3%). A sustained virological response and young donor age were independent predictors of 10-year survival. Sustained virological response significantly increased long-term survival. Awaiting the interferon-free regimen global availability, antiviral treatment might be questionable in selected subjects with mild hepatitis C recurrence.

  5. Effects of radiation therapy on tissue and serum concentrations of tumour associated trypsin inhibitor and their prognostic significance in rectal cancer patients

    Directory of Open Access Journals (Sweden)

    Stenman Ulf-Håkan

    2011-08-01

    Full Text Available Abstract Background We have previously demonstrated that elevated concentrations of tumour-associated trypsin inhibitor (TATI in both tumour tissue (t-TATI and in serum (s-TATI are associated with a poor prognosis in colorectal cancer patients. It was also found that s-TATI concentrations were lower in patients with rectal cancer compared to patients with colon cancer. In this study, we investigated the effects of neoadjuvant radiotherapy (RT on concentrations of t-TATI and s-TATI in patients with rectal cancer. Methods TATI was analysed in serum, normal mucosa and tumour tissue collected at various time points in 53 rectal cancer patients enrolled in a case-control study where 12 patients received surgery alone, 20 patients 5 × 5 Gy (short-term preoperative RT and 21 patients 25 × 2 Gy (long-term preoperative RT. T-TATI was analysed by immunohistochemistry and s-TATI was determined by an immunofluorometric assay. Mann-Whitney U test and Wilcoxon Z (Z test were used to assess t-TATI and s-TATI concentrations in relation to RT. Spearman's correlation (R test was used to explore the associations between t-TATI, s-TATI and clinicopathological parameters. Overall survival (OS according to high and low t-TATI and s-TATI concentrations was estimated by classification and regression tree analysis, Kaplan-Meier analysis and the log rank test. Results RT did not affect concentrations of t-TATI or s-TATI. In patients receiving short-term but not long-term RT, s-TATI concentrations were significantly higher 4 weeks post surgery than in serum drawn prior to surgery (Z = -3.366, P Conclusions The results presented here further validate the utility of t-TATI and s-TATI as prognostic biomarkers in patients with rectal cancer, independent of neoadjuvant RT.

  6. NM23 protein expression in colorectal carcinoma using TMA (tissue microarray: association with metastases and survival

    Directory of Open Access Journals (Sweden)

    Levindo Alves de Oliveira

    2010-12-01

    Full Text Available CONTEXT: NM23, a metastasis suppressor gene, may be associated with prognosis in patients with colorectal carcinoma. OBJECTIVE: To analyze NM23 expression and its association with the presence of lymph node and liver metastases and survival in patients operated on for colorectal carcinoma. METHODS: One hundred thirty patients operated on for colorectal carcinoma were investigated. Tissue microarray blocks containing neoplastic tissue and tumor-adjacent non-neoplastic mucosa were obtained and analyzed by immunohistochemical staining using a monoclonal anti-NM23 antibody. Immunohistochemical expression was assessed using a semiquantitative scoring method, counting the percentage of stained cells. The results were compared regarding morphological and histological characteristics of the colorectal carcinoma, presence of lymph node and liver metastases, tumor staging, and patient survival. Statistical analysis was performed using the Mann-Whitney test, the Kruskal-Wallis test and Fisher's exact test. Survival analysis was performed using the Kaplan-Meier method and the log-rank test. RESULTS: NM23 expression was higher in colorectal carcinoma tissue than in adjacent non-neoplastic mucosa (P<0.0001. NM23 protein expression did not correlate with degree of cell differentiation (P = 0.57, vascular invasion (P = 0.85, lymphatic invasion (P = 0.41, perineural infiltration (P = 0.46, staging (P = 0.19, lymph node metastases (P = 0.08, or liver metastases (P = 0.59. Disease-free survival showed significant association (P = 0.01 with the intensity of NM23 protein immunohistochemical expression in colorectal carcinoma tissue, whereas overall survival showed no association with NM23 protein expression (P = 0.13. CONCLUSIONS: NM23 protein expression was higher in neoplastic colorectal carcinoma tissue than in adjacent non-neoplastic mucosa, showing no correlation with morphological aspects, presence of lymph node or liver metastases, colorectal carcinoma

  7. Preoperative serum lipid profile and outcome in nonmetastatic colorectal cancer

    Directory of Open Access Journals (Sweden)

    Ting-Ting Hong

    2016-12-01

    Full Text Available Objective: A large portion of non-metastatic colorectal cancers (non-mCRCs recur after curative surgery. In addition to the traditional tumor-related factors, host-related factors are also required to accurately predict prognosis. A few studies have shown an association between the serum lipid profile and the survival and treatment response of patients with colorectal cancer. Methods: We retrospectively evaluated the prognostic significance of the preoperative serum lipid profile [total cholesterol (TC, triglyceride (TG, low-density lipoprotein cholesterol (LDL-C, and high-density lipoprotein cholesterol (HDL-C] in patients with non-mCRC treated with curative surgery. The Spearman rank correlation test was used to analyze associations between lipid levels and categorical variables. Lipid levels were modeled as four equal-sized quartiles based on the distribution among the whole cohort. Kaplan-Meier curves were used to estimate survival probabilities, and the log-rank test was used to detect differences between them. Multivariate fractional polynomial (MFP analysis was used to model any non-linear effects and avoid categorization. To evaluate the added prognostic value of lipids, the predictive power of two models (with and without lipids as covariates was compared by using Harrell's C-statistic and the Akaike information criterion (AIC. Results: A total of 266 patients with non-mCRC were enrolled in the present study. Spearman rank correlation test showed that TG levels inversely correlated with N stage (r = −0.20, P = 0.00 and Tumor-Node-Metastasis (TNM stage (r = −0.19, P = 0.00. HDL-C levels positively correlated with perineural invasion (PNI (r = 0.15, P = 0.02, and LDL-C levels inversely correlated with lymphovascular invasion (LVI (r = −0.12, P = 0.04. None of the four lipids predicted overall survival (OS in univariate or multivariate analyses adjusted for age, gender, T stage, N stage, TNM stage

  8. The overexpression of p16 is not a surrogate marker for high-risk human papilloma virus genotypes and predicts clinical outcomes for vulvar cancer.

    Science.gov (United States)

    Sznurkowski, Jacek J; Żawrocki, Anton; Biernat, Wojciech

    2016-07-13

    We aimed to evaluate the correlation between p16(ink4a)-overexpression and high risk (hr)HPV-DNA in vulvar squamous cell carcinoma (vSCC) tumors as well as the impact of both biomarkers on the prognosis of vSCC patients. PCR-detection of (hr)HPV-DNA and immunohistochemical staining for p16(ink4a) were conducted in 85 vSCC tumors. Survival analyses included the Kaplan-Meier method, log-rank test and Cox proportional hazards model. p16(ink4a)-overexpression and (hr)HPV-DNA were detected in 35 and 37 of the 85 tumors, respectively. Among the 35 p16(ink4a)-positive tumors, 10 lacked (hr)HPV-DNA (29 %). Among the 50 p16(ink4a)-negative tumors, (hr)HPV-DNA was detected in 12 cases (24 %). The median follow-up was 89.20 months (range 1.7-189.5 months). P16(ink4a)-overexpression, but not (hr)HPV-DNA positivity of the primary tumor, was correlated with prolonged overall survival (OS) (p = 0.009). P16(ink4a)-overexpression predicted a better response to radiotherapy (p overexpression (p = 0.022), and adjuvant RTX (p overexpression (HR 1-2.11, 95 % CI 1.13-3.95, p = 0.001) are independent prognostic factors. The discovered overlap suggests the use of p16(ink4a) in combination with HPV-DNA detection as an ancillary test for future research and clinical studies in vSCC. The prognostic and predictive value of p16(ink4a)-overexpression should be tested in larger cohort studies.

  9. Impact of prior urethral manipulation on outcome of anastomotic urethroplasty for post-traumatic urethral stricture.

    Science.gov (United States)

    Singh, Bhupendra P; Andankar, Mukund G; Swain, Sanjaya K; Das, Krishanu; Dassi, Vimal; Kaswan, Harish K; Agrawal, Vipul; Pathak, Hemant R

    2010-01-01

    To determine the impact of earlier urethral interventions on the outcomes of anastomotic urethroplasty in post-traumatic stricture urethra. From October 1995 to March 2008, a total of 58 patients with post-traumatic posterior urethral stricture underwent anastomotic urethroplasty. Eighteen patients had earlier undergone urethral intervention in the form of urethrotomy (3), endoscopic realignment (7), or open urethroplasty (8). Success was defined as no obstructive urinary symptoms, maximum urine flow rate > or = 15 mL/s, normal urethral imaging and/or urethroscopy, and no need of any intervention in the follow-up period. Patients who met the above objective criteria after needing 1 urethrotomy following urethroplasty were defined to have satisfactory outcome and were included in satisfactory result rate along with patients who had a successful outcome. Results were analyzed using unpaired t test, chi-square test, binary logistic regression, Kaplan-Meier curves, and log rank test. Previous interventions in the form of endoscopic realignment or urethroplasty have significant adverse effect on the success rate of subsequent anastomotic urethroplasty for post-traumatic posterior urethral strictures (P urethrotomies (up to 2 times) did not affect the outcome of subsequent anastomotic urethroplasty. Length of stricture and age of patient did not predict the outcome in traumatic posterior urethral strictures in logistic regression analysis. Previous failed railroading or urethroplasty significantly decrease the success of subsequent anastomotic urethroplasty. Hence, a primary realignment or urethroplasty should be avoided in suboptimal conditions and the cases of post-traumatic urethral stricture should be referred to centers with such expertise. 2010 Elsevier Inc. All rights reserved.

  10. Comparative Study of Inguinal Hernia Repair Rates After Radical Prostatectomy or External Beam Radiotherapy

    International Nuclear Information System (INIS)

    Lughezzani, Giovanni; Sun, Maxine; Perrotte, Paul; Alasker, Ahmed; Jeldres, Claudio; Isbarn, Hendrik; Budaeus, Lars; Lattouf, Jean-Baptiste; Valiquette, Luc; Benard, Francois; Saad, Fred; Graefen, Markus; Montorsi, Francesco; Karakiewicz, Pierre I.

    2010-01-01

    Purpose: We tested the hypothesis that patients treated for localized prostate cancer with radical prostatectomy (RP) have a higher risk of requiring an inguinal hernia (IH) repair than their counterparts treated with external beam radiotherapy (EBRT). Methods and Materials: Within the Quebec Health Plan database, we identified 6,422 men treated with RP and 4,685 men treated with EBRT for localized prostate cancer between 1990 and 2000, in addition to 6,933 control patients who underwent a prostate biopsy. From among that population, we identified patients who underwent a unilateral or bilateral hernia repair after either RP or EBRT. Kaplan-Meier plots showed IH repair-free survival rates. Univariable and multivariable Cox regression models tested the predictors of IH repair after RP or EBRT. Covariates consisted of age, year of surgery, and Charlson Comorbidity Index. Results: IH repair-free survival rates at 1, 2, 5, and 10 years were 96.8, 94.3, 90.5, and 86.2% vs. 98.9, 98.0, 95.4, and 92.2%, respectively, in RP vs. EBRT patients (log-rank test, p < 0.001). IH repair-free survival rates in the biopsy population were 98.3, 97.1, 94.9, and 90.2% at the same four time points. In multivariable Cox regression models, RP predisposed to a 2.3-fold higher risk of IH repair than EBRT (p < 0.001). Besides therapy type, patient age (p < 0.001) represented the only other independent predictor of IH repair. Conclusions: RP predisposes to a higher rate of IH repair relative to EBRT. This observation should be considered at informed consent.

  11. Hepatitis B and C Co-Infection in HIV Patients from the TREAT Asia HIV Observational Database: Analysis of Risk Factors and Survival

    Science.gov (United States)

    Chen, Marcelo; Wong, Wing-Wai; Law, Matthew G.; Kiertiburanakul, Sasisopin; Yunihastuti, Evy; Merati, Tuti Parwati; Lim, Poh Lian; Chaiwarith, Romanee; Phanuphak, Praphan; Lee, Man Po; Kumarasamy, Nagalingeswaran; Saphonn, Vonthanak; Ditangco, Rossana; Sim, Benedict L. H.; Nguyen, Kinh Van; Pujari, Sanjay; Kamarulzaman, Adeeba; Zhang, Fujie; Pham, Thuy Thanh; Choi, Jun Yong; Oka, Shinichi; Kantipong, Pacharee; Mustafa, Mahiran; Ratanasuwan, Winai; Durier, Nicolas; Chen, Yi-Ming Arthur

    2016-01-01

    Background We assessed the effects of hepatitis B (HBV) or hepatitis C (HCV) co-infection on outcomes of antiretroviral therapy (ART) in HIV-infected patients enrolled in the TREAT Asia HIV Observational Database (TAHOD), a multi-center cohort of HIV-infected patients in the Asia-Pacific region. Methods Patients testing HBs antigen (Ag) or HCV antibody (Ab) positive within enrollment into TAHOD were considered HBV or HCV co-infected. Factors associated with HBV and/or HCV co-infection were assessed by logistic regression models. Factors associated with post-ART HIV immunological response (CD4 change after six months) and virological response (HIV RNA <400 copies/ml after 12 months) were also determined. Survival was assessed by the Kaplan-Meier method and log rank test. Results A total of 7,455 subjects were recruited by December 2012. Of patients tested, 591/5656 (10.4%) were HBsAg positive, 794/5215 (15.2%) were HCVAb positive, and 88/4966 (1.8%) were positive for both markers. In multivariate analysis, HCV co-infection, age, route of HIV infection, baseline CD4 count, baseline HIV RNA, and HIV-1 subtype were associated with immunological recovery. Age, route of HIV infection, baseline CD4 count, baseline HIV RNA, ART regimen, prior ART and HIV-1 subtype, but not HBV or HCV co-infection, affected HIV RNA suppression. Risk factors affecting mortality included HCV co-infection, age, CDC stage, baseline CD4 count, baseline HIV RNA and prior mono/dual ART. Shortest survival was seen in subjects who were both HBV- and HCV-positive. Conclusion In this Asian cohort of HIV-infected patients, HCV co-infection, but not HBV co-infection, was associated with lower CD4 cell recovery after ART and increased mortality. PMID:26933963

  12. Synchronous Primary Cancers of the Endometrium and Ovary With the Same Histopathologic Type Versus Endometrial Cancer With Ovarian Metastasis: A Single Institution Review of 72 Cases.

    Science.gov (United States)

    Bese, Tugan; Sal, Veysel; Kahramanoglu, Ilker; Tokgozoglu, Nedim; Demirkiran, Fuat; Turan, Hasan; Ilvan, Sennur; Arvas, Macit

    2016-02-01

    The purpose of this study was to evaluate the clinicopathological characteristics and survival outcomes of women with simultaneous endometrial and ovarian carcinomas having the same histopathologic type. A review of medical records from 1997 to 2015 identified 72 patients with simultaneous carcinomas of the endometrium and ovary with the same histopathologic type. Patients with synchronous primary cancers of endometrium and ovary (SCEOs) were compared with patients with primary endometrial cancer with ovarian metastasis (ECOM). Clinical and pathological data were obtained from the patients' medical records. Clinicopathological variables including categorical data were analyzed by χ(2) or Fisher exact test and continuous data by a Student t test. A Kaplan-Meier survival analysis was performed and compared by using the log-rank test. A univariate and multivariate analysis of 72 patients with SCEO with the same histopathologic type revealed that SCEO is an independent prognostic factor of 10-year overall survival. There were 31 patients in the SCEO group and 41 patients in the ECOM group. With a mean follow-up time of 68.2 months, the 10-year overall survival rates were 61.3% and 36.6% in SCEO and ECOM groups, respectively (P = 0.029). Age, menopausal status, stage of ovarian cancer, performing lymphadenectomy, grade of endometrial tumor, omental metastasis, and residual tumor were found to be significant risk factors for recurrence in the synchronous group. The differentiation between SCEO and ECOM is of great clinical importance while our results showed a better prognosis for patients with SCEO compared with patients with ECOM. More aggressive therapeutic approaches may be considered for patients with SCEO who are older, postmenopausal, and/or have advanced grade of endometrial tumor, omental metastasis, and residual tumor. Lymphadenectomy should be performed in every patient with SCEO.

  13. Sealing properties of three luting agents used for complete cast crowns: a bacterial leakage study.

    Science.gov (United States)

    Zmener, O; Pameijer, C H; Rincon, S M H; Serrano, S A; Chaves, C

    2013-01-01

    To assess the sealing properties of three different luting materials used for cementation of full cast crowns on extracted human premolars. Thirty noncarious human premolars were prepared in a standardized fashion for full cast crown restorations. All margins were placed in dentin. After impressions of the preparations, stone dies were fabricated on which copings were waxed, which were cast in type III alloy using standardized laboratory methods. Teeth were randomly assigned to three groups of 10 samples each (n=10), for which the following cements were used: 1) a resin-modified glass ionomer cement, Rely X Luting Plus (3M ESPE, St Paul, MN, USA); 2) a self-adhesive resin cement, Maxcem Elite (Kerr Corporation, Orange, CA, USA); and 3) a glass ionomer cement, Ketac Cem (3M ESPE), the latter used as control. After cementation the samples were allowed to bench-set for 10 minutes, stored in water at 37°C, subjected to thermal cycling (2000×, between 5°C and 55°C, dwell time 35 seconds), and then stored in sterile phosphate buffer for seven days at 37°C. Subsequently, the occlusal surface was carefully reduced until the dentin was exposed. Finishing on wet sand paper removed the gold flash caused by grinding. After sterilization, the specimens were subjected to bacterial microleakage in a dual chamber apparatus for 60 days. Bacterial leakage was checked daily. Data were analyzed using the Kaplan-Meier survival test. Significant pairwise differences were analyzed using the log-rank test followed by Fisher exact test at a p<0.05 level of significance. Rely X Luting Plus showed the lowest microleakage scores, which statistically differed significantly from Maxcem Elite and Ketac Cem (p<0.05). Rely X Luting Plus cement displayed significantly lower microleakage scores than a self-adhesive resin-based and conventional glass ionomer cement.

  14. Clinicopathologic significance of fascin, extracellular matrix metalloproteinase inducer, and ezrin expressions in colorectal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Eun-Joo Jung

    2011-01-01

    Full Text Available Background: The over expression of fascin, extracellular matrix metalloproteinase inducer (EMMPRIN, and ezrin proteins has been associated with poor prognosis in various carcinomas and sarcomas. However, very few studies have reported the relationship between the expression of fascin, EMMPRIN, and ezrin proteins and the clinico-pathologic parameters of colorectal carcinomas. Aims: The aim was to investigate the relationship between fascin, EMMPRIN, and ezrin proteins in colorectal adenocarcinomas and their correlation with clinico-pathologic parameters. Settings and Design: The expression of fascin, EMMPRIN, and ezrin proteins was studied in 210 colorectal adenocarcinoma patients through immunohistochemical staining. Materials and Methods: Immunohistochemical staining by the avidin-biotin peroxidase method was done. The scoring of each protein expression was done and divided into three groups (negative, low-, and high-expression groups. Statistical Analysis: A chi-square test, and Kendall′s tau-b correlation test were used for comparing. Survival analysis was performed using the Kaplan-Meier method with log-rank tests and the Cox proportional hazard model. Results: The percentages of the high-expression group of fascin, EMMPRIN, and ezrin proteins in colorectal adenocarcinomas were 24%, 73%, and 62%, respectively. Weak positive correlations were observed among these protein expressions. An increased expression of the fascin protein was significantly associated with advanced tumor depth and shorter survival times, and a high expression of fascin protein was an independent prognostic factor in univariate and multivariate survival analyses. EMMPRIN and ezrin protein expressions were not associated with the clinico-pathologic parameters. Conclusions: The high expression of fascin protein may be an unfavorable prognostic marker for individual colorectal cancer patients.

  15. Technique-associated outcomes in horses following large colon resection.

    Science.gov (United States)

    Pezzanite, Lynn M; Hackett, Eileen S

    2017-11-01

    To compare survival and complications in horses undergoing large colon resection with either sutured end-to-end or stapled functional end-to-end anastomoses. Retrospective cohort study. Twenty-six client-owned horses with gastrointestinal disease. Retrospective data were retrieved from the medical records of 26 horses undergoing colectomy, including 14 horses with sutured end-to-end and 12 horses with stapled functional end-to-end anastomoses, between 2003 and 2016. Records were evaluated for signalment, medical and surgical treatments, and survival to hospital discharge. Long-term follow-up was obtained through owner contact. Continuous variables were compared with Mann-Whitney tests. Fisher's exact testing was used to compare survival to hospital discharge. Survival time was compared by constructing Kaplan-Meier survival curves and performing log-rank curve comparison testing. Mean age of horses undergoing colectomy was 13 years. Reason for colectomy was prophylaxis (12) or salvage (14). Mean surgical time was 169 minutes. Mean hospitalization time was 9 days, which did not differ with anastomosis type (P = .62). Nine of 12 horses undergoing stapled functional end-to-end anastomosis and 12 of 14 horses undergoing sutured end-to-end anastomosis survived to hospital discharge (P = .63). Survival time did not differ with anastomosis technique (P = .35). Short- and long-term survival outcomes are not different between sutured end-to-end or stapled functional end-to-end anastomoses in horses undergoing colectomy. © 2017 The American College of Veterinary Surgeons.

  16. Quality of Life after Post-Prostatectomy Intensity Modulated Radiation Therapy: Pelvic Nodal Irradiation Is Not Associated with Worse Bladder, Bowel, or Sexual Outcomes.

    Directory of Open Access Journals (Sweden)

    James M Melotek

    Full Text Available Limited data exist regarding toxicity and quality of life (QOL after post-prostatectomy intensity modulated radiation therapy (IMRT and whether pelvic nodal RT influences these outcomes.118 men were treated with curative-intent RT after radical prostatectomy. 69 men (58% received pelvic nodal RT. QOL data and physician-assigned toxicity were prospectively collected. Changes in QOL from baseline were assessed with Wilcoxon signed-rank tests and risk factors associated with each domain were identified with generalized estimating equation (GEE models. Late freedom from (FF toxicity was estimated by the Kaplan-Meier method and comparisons were tested using the log-rank test.Urinary irritation/obstruction, bowel, and sexual domain scores declined at 2 months (all P ≤ 0.01 but were no different than baseline at subsequent visits through 4 years of follow-up. At 4 years, FF grade 2+ GI toxicity was 90% and FF grade 2+ GU toxicity was 89%. On GEE analysis, pelvic nodal RT was associated with decreased bowel function (P = 0.09 and sexual function (P = 0.01. On multivariate analysis, however, there was no significant association with either decreased bowel (P = 0.31 or sexual (P = 0.84 function. There was also no association with either FF grade 2+ GI toxicity (P = 0.24 or grade 2+ GU toxicity (P = 0.51.Receipt of pelvic nodal RT was not associated with inferior QOL or toxicity compared to prostate bed alone RT. For the entire cohort, RT was associated with only temporary declines in patient-reported urinary, bowel, or sexual QOL.

  17. Experience in the management of ECMO therapy as a mortality risk factor.

    Science.gov (United States)

    Guilló Moreno, V; Gutiérrez Martínez, A; Romero Berrocal, A; Sánchez Castilla, M; García-Fernández, J

    2018-02-01

    The extracorporeal oxygenation membrane (ECMO) is a system that provides circulatory and respiratory assistance to patients in cardiac or respiratory failure refractory to conventional treatment. It is a therapy with numerous associated complications and high mortality. Multidisciplinary management and experienced teams increase survival. Our purpose is to evaluate and analyse the effect of the learning curve on mortality. Retrospective and observational study of 31 patients, from January 2012 to December 2015. Patients were separated into 2periods. These periods were divided by the establishment of an ECMO protocol. We compared the quantitative variables by performing the Mann-Whitney U test. For the categorical qualitative variables we performed the chi-square test or Fisher exact statistic as appropriate. The survival curve was computed using the Kaplan-Meier method, and the analysis of statistical significance using the Log-rank test. Data analysis was performed with the STATA programme 14. Survival curves show the tendency to lower mortality in the subsequent period (P=0.0601). The overall mortality rate in the initial period was higher than in the subsequent period (P=0.042). In another analysis, we compared the characteristics of the 2groups and concluded that they were homogeneous. The degree of experience is an independent factor for mortality. The application of a care protocol is fundamental to facilitate the management of ECMO therapy. Copyright © 2017 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  18. Podoplanin, ezrin, and Rho-A proteins may have joint participation in tumor invasion of lip cancer.

    Science.gov (United States)

    Assao, Agnes; Nonogaki, Suely; Lauris, José Roberto Pereira; Carvalho, André Lopes; Pinto, Clóvis Antônio Lopes; Soares, Fernando Augusto; Kowalski, Luiz Paulo; Oliveira, Denise Tostes

    2017-06-01

    Podoplanin and ezrin connection through Rho-A phosphorylation have been suggested as part of the activation pathway, in the process of tumor invasion and cell movement in oral squamous cell carcinomas. The aim of this study was to evaluate the correlation among podoplanin, ezrin, and Rho-A immunoexpressions in 91 squamous cells carcinomas of the lower lip and their influence in patient's prognosis. The immunoexpressions of podoplanin, ezrin, and Rho-A were evaluated through a semi-quantitative score method, based on the capture of 10 microscopic fields at the front of tumor invasion. The association and correlation of these proteins with the clinicopathological features were verified by Fischer's exact test and Spearman's test. The prognostic values were analyzed by Kaplan-Meier method and log-rank test. A statistically significant association between strong cytoplasmic podoplanin expression and alcohol (p = 0.024), loco-regional recurrences (p = 0.028), and lymph node metastasis (pN+) (p = 0.010) was found. The membranous (p = 0.000 and r = 0.384) and cytoplasmic (p = 0.000 and r = 0.344) podoplanin expression was statistically correlated with ezrin expression. Also, membranous podoplanin was significantly correlated with Rho-A expression (p = 0.006 and r = 0.282). The expressions of podoplanin, ezrin, and Rho-A were not significant prognostic factors for patients with squamous cell carcinomas of the lower lip. Therefore, our results confirm a correlation among podoplanin, ezrin, and Rho-A expressions in squamous cell carcinoma of the lip suggesting a cooperative participation of these proteins in cell movement and invasion. Furthermore, strong cytoplasmic podoplanin expression could be helpful to identify patients with squamous cell carcinoma of the lip and lower risk of loco-regional recurrences.

  19. Mobile spine chordoma: results of 166 patients from the AOSpine Knowledge Forum Tumor database.

    Science.gov (United States)

    Gokaslan, Ziya L; Zadnik, Patricia L; Sciubba, Daniel M; Germscheid, Niccole; Goodwin, C Rory; Wolinsky, Jean-Paul; Bettegowda, Chetan; Groves, Mari L; Luzzati, Alessandro; Rhines, Laurence D; Fisher, Charles G; Varga, Peter Pal; Dekutoski, Mark B; Clarke, Michelle J; Fehlings, Michael G; Quraishi, Nasir A; Chou, Dean; Reynolds, Jeremy J; Williams, Richard P; Kawahara, Norio; Boriani, Stefano

    2016-04-01

    A chordoma is an indolent primary spinal tumor that has devastating effects on the patient's life. These lesions are chemoresistant, resistant to conventional radiotherapy, and moderately sensitive to proton therapy; however, en bloc resection remains the preferred treatment for optimizing patient outcomes. While multiple small and largely retrospective studies have investigated the outcomes following en bloc resection of chordomas in the sacrum, there have been few large-scale studies on patients with chordomas of the mobile spine. The goal of this study was to review the outcomes of surgically treated patients with mobile spine chordomas at multiple international centers with respect to local recurrence and survival. This multiinstitutional retrospective study collected data between 1988 and 2012 about prognosis-predicting factors, including various clinical characteristics and surgical techniques for mobile spine chordoma. Tumors were classified according to the Enneking principles and analyzed in 2 treatment cohorts: Enneking-appropriate (EA) and Enneking-inappropriate (EI) cohorts. Patients were categorized as EA when the final pathological assessment of the margin matched the Enneking recommendation; otherwise, they were categorized as EI. Descriptive statistics were used to summarize the data (Student t-test, chi-square, and Fisher exact tests). Recurrence and survival data were analyzed using Kaplan-Meier survival curves, log-rank tests, and multivariate Cox proportional hazard modeling. A total of 166 patients (55 female and 111 male patients) with mobile spine chordoma were included. The median patient follow-up was 2.6 years (range 1 day to 22.5 years). Fifty-eight (41%) patients were EA and 84 (59%) patients were EI. The type of biopsy (p mobile spine.

  20. Population-based outcomes after brain radiotherapy in patients with brain metastases from breast cancer in the Pre-Trastuzumab and Trastuzumab eras

    International Nuclear Information System (INIS)

    Karam, Irene; Hamilton, Sarah; Nichol, Alan; Woods, Ryan; Speers, Caroline; Kennecke, Hagen; Tyldesley, Scott

    2013-01-01

    To evaluate the survival of patients with human epidermal growth factor receptor 2 (HER2) positive and negative metastatic breast cancer irradiated for brain metastases before and after the availability of trastuzumab (T). Women diagnosed with brain metastasis from breast cancer in two eras between 2000 and 2007 (T-era, n = 441) and 1986 to 1992 (PreT-era, n = 307), treated with whole brain radiotherapy (RT) were identified. In the T-era, HER2 testing was part of routine clinical practice, and in the preT-era 128/307 (42%) cases had HER2 testing performed retrospectively on tissue microarrays. Overall survival (OS) was estimated using the Kaplan-Meier method and comparisons between eras used log-rank tests. In the preT- and T-era cohorts, the rate of HER2 positivity was 40% (176/441) and 26% (33/128) (p < 0.001). The median time from diagnosis to brain RT was longer in the preT-era (3.3 years versus 2.3 years, p < 0.001). Survival after brain RT was improved in the T-era compared to the preT-era (1-year OS 26% versus 12%, p < 0.001). The 1-year OS rate for HER2 negative patients was 20% in both eras (p = 0.97). Among HER2 positive patients, the 1-year OS in the preT-era was 5% compared to 40% in the T-era (p < 0.001). Distinct from patients with HER2 negative disease in whom no difference in survival after brain RT was observed over time, patients with HER2 positive brain metastases experienced significantly improved survival subsequent to the availability of trastuzumab

  1. Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry.

    Science.gov (United States)

    Gawlick, Ute; Lu, Kim C; Douthit, Miriam A; Diggs, Brian S; Schuff, Kathryn G; Herzig, Daniel O; Tsikitis, Vassiliki L

    2013-05-01

    Determining the molecular profile of colon and rectal cancers offers the possibility of personalized cancer treatment. The purpose of this study was to determine whether known genetic mutations associated with colorectal carcinogenesis differ between colon and rectal cancers and whether they are associated with survival. The Oregon Colorectal Cancer Registry is a prospectively maintained, institutional review board-approved tissue repository with associated demographic and clinical information. The registry was queried for any patient with molecular analysis paired with clinical data. Patient demographics, tumor characteristics, microsatellite instability status, and mutational analysis for p53, AKT, BRAF, KRAS, MET, NRAS, and PIK3CA were analyzed. Categorical variables were compared using chi-square tests. Continuous variables between groups were analyzed using Mann-Whitney U tests. Kaplan-Meier analysis was used for survival studies. Comparisons of survival were made using log-rank tests. The registry included 370 patients: 69% with colon cancer and 31% with rectal cancer. Eighty percent of colon cancers and 68% of rectal cancers were stages III and IV. Mutational analysis found no significant differences in detected mutations between colon and rectal cancers, except that there were significantly more BRAF mutations in colon cancers compared with rectal cancers (10% vs 0%, P colon versus rectal cancers when stratified by the presence of KRAS, PIK3CA, and BRAF mutations. Stage III and IV colon and rectal cancers share similar molecular profiles, except that there were significantly more BRAF mutations in colon cancers compared with rectal cancers. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Statistical analysis of water-quality data containing multiple detection limits II: S-language software for nonparametric distribution modeling and hypothesis testing

    Science.gov (United States)

    Lee, L.; Helsel, D.

    2007-01-01

    Analysis of low concentrations of trace contaminants in environmental media often results in left-censored data that are below some limit of analytical precision. Interpretation of values becomes complicated when there are multiple detection limits in the data-perhaps as a result of changing analytical precision over time. Parametric and semi-parametric methods, such as maximum likelihood estimation and robust regression on order statistics, can be employed to model distributions of multiply censored data and provide estimates of summary statistics. However, these methods are based on assumptions about the underlying distribution of data. Nonparametric methods provide an alternative that does not require such assumptions. A standard nonparametric method for estimating summary statistics of multiply-censored data is the Kaplan-Meier (K-M) method. This method has seen widespread usage in the medical sciences within a general framework termed "survival analysis" where it is employed with right-censored time-to-failure data. However, K-M methods are equally valid for the left-censored data common in the geosciences. Our S-language software provides an analytical framework based on K-M methods that is tailored to the needs of the earth and environmental sciences community. This includes routines for the generation of empirical cumulative distribution functions, prediction or exceedance probabilities, and related confidence limits computation. Additionally, our software contains K-M-based routines for nonparametric hypothesis testing among an unlimited number of grouping variables. A primary characteristic of K-M methods is that they do not perform extrapolation and interpolation. Thus, these routines cannot be used to model statistics beyond the observed data range or when linear interpolation is desired. For such applications, the aforementioned parametric and semi-parametric methods must be used.

  3. Temozolomide during radiotherapy of glioblastoma multiforme. Daily administration improves survival

    Energy Technology Data Exchange (ETDEWEB)

    Nachbichler, Silke Birgit; Schupp, Gabi; Ballhausen, Hendrik; Niyazi, Maximilian; Belka, Claus [LMU Munich, Department of Radiation Oncology, Munich (Germany)

    2017-11-15

    Temozolomide-(TMZ)-based chemoradiotherapy defines the current gold standard for the treatment of newly diagnosed glioblastoma. Data regarding the influence of TMZ dose density during chemoradiotherapy are currently not available. We retrospectively compared outcomes in patients receiving no TMZ, TMZ during radiotherapy on radiotherapy days only, and TMZ constantly 7 days a week. From 2002-2012, a total of 432 patients with newly diagnosed glioblastoma received radiotherapy in our department: 118 patients had radiotherapy alone, 210 had chemoradiotherapy with TMZ (75 mg/m{sup 2}) daily (7/7), and 104 with TMZ only on radiotherapy days (5/7). Radiotherapy was applied to a total dose of 60 Gy. Median survival after radiotherapy alone was 9.1 months, compared to 12.6 months with 5/7-TMZ and to 15.7 months with 7/7-TMZ. The 1-year survival rates were 33, 52, and 64%, respectively. Kaplan-Meier analysis showed a significant improvement of TMZ-7/7 vs. 5/7 (p = 0.01 by the log-rank test), while 5/7-TMZ was still superior to no TMZ at all (p = 0.02). Multivariate Cox regression showed a significant influence of TMZ regimen (p = 0.009) on hazard rate (+58% between groups) even in the presence of confounding factors age, sex, resection status, and radiotherapy dose concept. Our results confirm the findings of the EORTC/NCIC trial. It seems that also a reduced TMZ scheme can at first prolong the survival of glioblastoma patients, but not as much as the daily administration. (orig.) [German] Eine Temozolomid-(TMZ-)basierte Radiochemotherapie ist der gegenwaertige Goldstandard in der Behandlung von neu diagnostizierten Glioblastomen. Daten bezueglich des Einflusses der TMZ-Dosisdichte waehrend der Radiochemotherapie sind derzeit nicht vorhanden. Wir haben retrospektiv die Ergebnisse von Patienten verglichen, die entweder kein TMZ, TMZ zur Strahlentherapie nur an Bestrahlungstagen oder TMZ konstant 7 Tage/Woche erhalten hatten. Von 2002-2012 bekamen insgesamt 432 Patienten mit

  4. Fatores prognósticos no carcinoma espinocelular de cavidade oral Prognostic factors in squamous cell carcinoma of the oral cavity

    Directory of Open Access Journals (Sweden)

    José Raphael de Moura Campos Montoro

    2008-12-01

    Full Text Available Devido à incerteza da evolução do câncer oral é que os pesquisadores procuram fatores que possam influenciar no prognóstico. OBJETIVO: Avaliar em pacientes com carcinoma espinocelular de cavidade oral variáveis que possam influenciar no tempo de sobrevida. MATERIAIS E MÉTODOS: Analisados dados de 45 pacientes no período de Janeiro de 2001 a Janeiro de 2006. As curvas de sobrevida foram estimadas pelo método de Kaplan-Meier e para compará-las os testes de log-rank e o modelo de regressão de Cox. Desenho do Estudo: Análise retrospectiva. RESULTADOS: A sobrevida global foi de 39% em 5 anos. Apenas as variáveis, metástase cervical (p=0,017, radioterapia pós-operatória (p=0,056 e margens comprometidas (p=0,004 tiveram significância estatística. A sobrevida foi menor em pacientes: com metástase cervical; com margens comprometidas e os submetidos à radioterapia pós-operatória, ou seja, nos tumores mais agressivos. Após ajustamento, a radioterapia não mostrou significância estatística. Provavelmente a sobrevida de 39% seja pelo elevado número de pacientes com metástase (52,2% e pelo fato da amostra ser basicamente de cânceres de língua e assoalho (82%, os de controle mais difícil. CONCLUSÃO: A metástase cervical e o comprometimento das margens cirúrgicas são os fatores prognósticos no carcinoma de cavidade oral que influenciaram na sobrevida.Researchers have been looking for factors that can influence the prognosis of oral cancer, because its outcome is highly uncertain. AIM: To evaluate variables that can impact the survival rate of patients with squamous-cell carcinoma of the oral cavity. MATERIAL AND METHODS: Data analysis of 45 patients from January, 2001 to January, 2006. Survival rate curves have been estimated using the Kaplan-Meier method and they have been compared through the log-rank test and the Cox regression standard. Study design: Retrospective analysis. RESULTS: Total five-year survival rate was of 39

  5. [Correlation between post-stroke pneumonia and outcome in patients with acute brain infarction].

    Science.gov (United States)

    Li, S J; Hu, H Q; Wang, X L; Cao, B Z

    2016-09-20

    Objective: To investigate the correlation between post-stroke pneumonia and outcome in patients with acute brain infarction. Methods: Consecutive acute cerebral infarction patients who were hospitalized in Department of Neurology, Jinan Military General Hospital were prospectively recruited from August 2010 to August 2014. The baseline data including age, sex, the National Institute of Health Stroke Scale (NIHSS) scores, type of Oxfordshire Community Stroke Project (OCSP: total anterior circulation infarct, partial anterior circulation infarct, posterior circulation infarct and lacunar infarct), fasting blood glucose etc. after admission were recorded. Post-stroke pneumonia was diagnosed by treating physician according to criteria for hospital-acquired pneumonia of the Centers for Disease Control and Prevention. Recovery was assessed by modified Rankin Scale (mRS) 180 days after stroke by telephone interview (mRS≤2 reflected good prognosis, and mRS>2 reflected unfavorable prognosis). Multinominal Logistic regression analysis, Kaplan-Meier curve and log rank test were used. Results: A total of 1 249 patients were enrolled, among them 173 patients were lost during follow-up. A total of 159 patients had post-stroke pneumonia, while 1 090 patients were without post-stroke. Compared with patients without post-stoke pneumonia, patients with post-stroke pneumonia were older (67±13 vs 63±12 years, P =0.000), more severe (NIHSS, 15(14) vs 4(4), P =0.000). Compared with patients without post-stoke pneumonia, more patients with post-stroke pneumonia suffered from heart failure (12.58% vs 3.40%, P =0.000), atrial fibrillation (26.42% vs 8.81%, P =0.000), myocardial infarction (10.06% vs 5.05%, P =0.016), recurrent brain infarction (30.19% vs 22.66%, P =0.045), total anterior circulation infarct type of OCSP (46.54% vs 19.63%, P =0.000), posterior circulation infarct of OCSP (39.62% vs 25.51%, P =0.001); more patients suffered from disorder of consciousness (60.38% vs 9

  6. Results of radiotherapy for meningeomas with high risk for local recurrence. A retrospective analysis; Ergebnisse der Strahlentherapie bei Meningeomen mit hohem Rezidivrisiko. Eine retrospektive Analyse

    Energy Technology Data Exchange (ETDEWEB)

    Winkler, C.; Dornfeld, S.; Friedrich, S.; Baumann, M. [Technische Univ. Dresden (Germany). Klinik und Poliklinik fuerStrahlentherapie und Radioonkologie; Schwarz, R. [Universitaetskrankenhaus Hamburg-Eppendorf (Germany). Abt. fuer Strahlentherapie

    1998-12-01

    Aim: Retrospective assessment of the efficacy of radiatiotherapy for meningeomas with high risk for local recurrence. Patients and methods: Records of 67 patients with meningeomas treated from 1974 to 1995 at 2 centres were analyzed. Follow-up time ranged from 0.8 to 213 months (median: 61 months). Radiation therapy was given either after local failure or after biopsy or subtotal resection. The ratio between malignant (n=20) and benign (n=47) meningenoma was 1:2.4. Median age of the patients was 55 years (7 to 77 years). Radiation treatment was given at 1.5 to 2 Gy per fraction to 36 to 79.5 Gy. Survival rates were calculated by the Kaplan-Meier method. Statistical comparisons were performed with the log-rank test and the Cox proportional hazards model. The Bonferroni method was used to correct for multiple comparisons. Results: Five- and 10-year disease-free survival rates were 82%{+-}5% (standard error) and 70%{+-}9%. Local control rates at 5 and 10 years were 78%{+-}5% and 68%{+-}9%. In uni- and multivariate analysis histology, sex, total dose and center showed no significant influence on the results. Patients age was significant for local control (univariate p=0.02; multivariate p=0.03) and disease-free survival (univariate/multivariate p=0.04). The postoperative tumor burden had a significant influence of disease-free survival (multivariate P=0.04). After Bonferroni correction no significant influenc e was observed. We did not observe late side effects, especially brain necrosis. Conclusions: Despite of the negative selection of our patients we observed high survival- and local control rates after radiation therapy. This underscores the role of radiation therapy in the treatment of meningeomas with high risk of local failure. (orig.) [Deutsch] Hintergrund: Retrospektive Auswertung der Behandlungsergebnisse der Bestrahlung von Meningeomen mit hohem Rezidivrisiko. Patienten und Methode: Im Zeitraum zwischen 1974 und 1995 wurden an zwei Zentren insgesamt 67

  7. Lower lip squamous cell carcinoma in patients with photosensitive disorders: Analysis of cases treated at the Brazilian National Cancer Institute (INCA) from 1999 to 2012.

    Science.gov (United States)

    Borges, J-F-P; Lanaro, N-D; Bernardo, V-G; Albano, R-M; Dias, F; de Faria, P-A-S; Pinto, L-F-R; Lourenço, S-Q-C

    2018-01-01

    Lower lip squamous cell carcinoma (LLSCC) is a common malignancy of the head and neck, being mainly a consequence of a chronic exposure to ultraviolet (UV) light solar radiation. Here, we evaluated the clinicopathological profile of patients with photosensitive disorders (xeroderma pigmentosum, lupus erythematosus and albinism) that developed LLSCC. Data from patients who had a diagnosed LLSCC with a prior xeroderma pigmentosum, lupus erythematosus or albinism diagnosis that were treated at INCA from 1999 to 2012 were collected from patients medical records (n=16). The control group was composed of 68 patients with LLSCC without a medical history of photosensitivity. The clinicopathological data of this study population were collected and the association between these variables was analyzed by Fisher's exact test. Survival curves were constructed using the Kaplan-Meier method and compared by log-rank test. All statistical analyses were performed using SPSS statistics package. The mean age of patients in the photosensitive and non-photosensitive groups was 42 years and 67 years, respectively (p<0.0001). A previous history of malignant diseases was more common in the photosensitive group (p=0.001). In both groups, most tumors showed a pathological stage I/II disease. Overall and cancer-specific survival were not statistically different. However, disease-free interval showed a significant difference (p=0.01) between the photosensitive and non-photosensitive patients. Photosensitive patients presented LLSCC at earlier age but it usually was not the primary tumor in these patients. Furthermore, a more aggressive pathological behavior was not seen when compared with tumors from non-photosensitive patients. The disease-free interval was lower in photosensitive patients, as expected.

  8. The Preoperative Composite Physiologic Index May Predict Mortality in Lung Cancer Patients with Combined Pulmonary Fibrosis and Emphysema.

    Science.gov (United States)

    Ueno, Fumika; Kitaguchi, Yoshiaki; Shiina, Takayuki; Asaka, Shiho; Miura, Kentaro; Yasuo, Masanori; Wada, Yosuke; Yoshizawa, Akihiko; Hanaoka, Masayuki

    2017-01-01

    It remains unclear whether the preoperative pulmonary function parameters and prognostic indices that are indicative of nutritional and immunological status are associated with prognosis in lung cancer patients with combined pulmonary fibrosis and emphysema (CPFE) who have undergone surgery. The aim of this study is to identify prognostic determinants in these patients. The medical records of all patients with lung cancer associated with CPFE who had undergone surgery at Shinshu University Hospital were retrospectively reviewed to obtain clinical data, including the results of preoperative pulmonary function tests and laboratory examinations, chest high-resolution computed tomography (HRCT), and survival. Univariate Cox proportional hazards regression analysis showed that a high pathological stage of the lung cancer, a higher preoperative serum carcinoembryonic antigen level, and a higher preoperative composite physiologic index (CPI) were associated with a high risk of death. Multivariate analysis showed that a high pathological stage of the lung cancer (HR: 1.579; p = 0.0305) and a higher preoperative CPI (HR: 1.034; p = 0.0174) were independently associated with a high risk of death. In contrast, the severity of fibrosis or emphysema on chest HRCT, the individual pulmonary function parameters, the prognostic nutritional index, the neutrophil-to-lymphocyte ratio, and the platelet-to-lymphocyte ratio were not associated with prognosis. In the Kaplan-Meier analysis, the log-rank test showed significant differences in survival between the high-CPI and the low-CPI group (p = 0.0234). The preoperative CPI may predict mortality and provide more powerful prognostic information than individual pulmonary function parameters in lung cancer patients with CPFE who have undergone surgery. © 2017 S. Karger AG, Basel.

  9. Expression features and prognostic significance of Yes-associated protein in hepatocellular carcinoma and cholangiocellular carcinoma

    Directory of Open Access Journals (Sweden)

    WANG Chun

    2017-07-01

    Full Text Available ObjectiveTo investigate the expression of Yes-associated protein (YAP in hepatocellular carcinoma (HCC and cholangiocellular carcinoma (CC and its association with clinical prognosis. MethodsSamples were collected from 190 patients who were treated in The Second Hospital Affiliated to Chongqing Medical University from July 2004 to July 2009, among whom 110 had HCC and 80 had CC. The difference in YAP expression and its association were analyzed in both groups, and patients′ prognosis was compared between the two groups. The chi-square test was used to investigate the association between YAP expression and clinicopathological features of HCC and CC, and the Kaplan-Meier method and the log-rank test were used to assess tumor-free survival rate and overall survival rate. A univariate Cox regression analysis was used to evaluate the influence of YAP expression on the prognosis of patients with HCC and CC. ResultsThe CC group had higher expression of YAP than the HCC group (68.7% vs 56.3%, P=0.036. High YAP expression in HCC and CC was significantly associated with tumor size (P<0.001 and P=0.024, alpha fetoprotein (P=0.009 and 0034, liver cirrhosis (P=0032 and 0.006, vascular invasion (P=0.011 and 0.028, and intrahepatic metastasis (P=0.049 and 0030. In both groups, the patients with high YAP expression had significantly lower tumor-free survival rate and overall survival rate than those with low YAP expression(all P<005. Multivariate analysis showed that high YAP expression is an adverse prognostic factor for tumor-free survival and overall survival in both groups (all P<005. ConclusionHigh YAP expression is frequently found in patients with HCC and CC, and high YAP expression is associated with low survival rate.

  10. Clinical Usefulness of Measuring Red Blood Cell Distribution Width in Patients with Hepatitis B Virus-Related Acute-On-Chronic Liver Failure.

    Science.gov (United States)

    Jin, Lei; Gao, Yufeng; Ye, Jun; Zou, Guizhou; Li, Xu

    2017-09-01

    The red blood cell distribution width (RDW) is increased in chronic liver disease, but its clinical significance in hepatitis B virus-related acute-on-chronic liver failure (HBV-ACLF) is still unclear. The aim of the present study was to investigate the clinical significance of RDW in HBV-ACLF patients. The medical records of HBV-ACLF patients who were admitted to The Second Affiliated Hospital of Anhui Medical University between April 2012 and December 2015 were retrospectively reviewed. Correlations between RDW, neutrophil lymphocyte ratio (NLR), and the model for end-stage liver disease (MELD) scores were analyzed using the Spearman's approach. Multivariable stepwise logistic regression test was used to evaluate independent clinical parameters predicting 3-month mortality of HBV-ACLF patients. The association between RDW and hospitalization outcome was estimated by receiver operating curve (ROC) analysis. Patient survival was estimated by Kaplan-Meier analysis and subsequently compared by log-rank test. Sixty-two HBV-ACLF patients and sixty CHB patients were enrolled. RDW were increased in HBVACLF patients and positively correlated with the NLR as well as MELD scores. Multivariate analysis demonstrated that RDW value was an independent predictor for mortality. RDW had an area under the ROC of 0.799 in predicting 3-month mortality of HBV-ACLF patients. Patients with HBV-ACLF who had RDW > 17% showed significantly poorer survival than those who had RDW ≤ 17%. RDW values are significantly increased in patients with HBV-ACLF. Moreover, RDW values are an independent predicting factor for an in-hospital mortality in patients with HBV-ACLF.

  11. Percutaneous treatment of thrombosed native arteriovenous dialysis fistula insufficiency: efficacy of mechanical thrombectomy with using the stone basket

    International Nuclear Information System (INIS)

    Kim, Young Hwan; Ko, Sung Min; Kim, Mi Jung; Kwon, Jung Hyeok; Sohn, Cheol Ho; Choi, Jin Soo; Park, Kyung Sik; Kim, Yong Joo

    2006-01-01

    We wanted to evaluate the procedural success after percutaneous treatment of thrombosed native arteriovenous dialysis fistula insufficiency and the efficacy of performing mechanical thrombectomy with using the stone basket. From March 2004 to June 2005, 36 thrombosed native hemodialysis access shunts in the upper limbs (brachiocephalic fistulas: 16 and radiocephalic fistulas: 20) were percutaneously treated in 30 patients. Declotting procedures were performed with using urokinase (100,00-200,000 unit) and manual catheter-directed thrombo-aspiration in all the patients. Angioplasty (6 mm in diameter and 4 cm in length) was performed at the identified area of the stenosis and /or with maceration of the thrombus. In 14 cases with massive thrombosis that was refractory to the above mentioned declotting procedures, mechanical thrombectomy with using a Wittich nitinol stone basket (Cook, Bloomington, IN) was performed. Data regarding the procedural success rate and the patency rate were analyzed by means of Fischer's exact test, and the Kaplan-Meier method with the Log-rank test was used for statistical inter-group comparisons between the brachiocephalic and radiocephalic fistulas. Successful declotting and restoration of thrill were achieved in 30 of 36 procedures (83%). Reestablishment of normal dialysis for at least one session was achieved in 29 of 36 procedures (81%). The procedural success rate for the brachiocephalic fistulas was 94% compared with 70% for the radiocephalic fistulas, but the difference was not statistically significant (ρ = 0.104). In the cases with performing mechanical thrombectomy and using the stone basket, procedural success was achieved in 93% (13/14). The expected patency rates at 3, 6 and 12 months were 78%, 61% and 51%, respectively. The patency rates after declotting procedures were not significantly different between the brachiocephalic and radiocephlaic fistulas (ρ = 0.871). Percutaneous treatment of thrombosed native arteriovenous

  12. Percutaneous treatment of thrombosed native arteriovenous dialysis fistula insufficiency: efficacy of mechanical thrombectomy with using the stone basket

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young Hwan; Ko, Sung Min; Kim, Mi Jung; Kwon, Jung Hyeok; Sohn, Cheol Ho; Choi, Jin Soo; Park, Kyung Sik [Dongsan Medical Center, Keimyung University College of Medicine, Daegu (Korea, Republic of); Kim, Yong Joo [Andong General Hospital, Andon (Korea, Republic of)

    2006-06-15

    We wanted to evaluate the procedural success after percutaneous treatment of thrombosed native arteriovenous dialysis fistula insufficiency and the efficacy of performing mechanical thrombectomy with using the stone basket. From March 2004 to June 2005, 36 thrombosed native hemodialysis access shunts in the upper limbs (brachiocephalic fistulas: 16 and radiocephalic fistulas: 20) were percutaneously treated in 30 patients. Declotting procedures were performed with using urokinase (100,00-200,000 unit) and manual catheter-directed thrombo-aspiration in all the patients. Angioplasty (6 mm in diameter and 4 cm in length) was performed at the identified area of the stenosis and /or with maceration of the thrombus. In 14 cases with massive thrombosis that was refractory to the above mentioned declotting procedures, mechanical thrombectomy with using a Wittich nitinol stone basket (Cook, Bloomington, IN) was performed. Data regarding the procedural success rate and the patency rate were analyzed by means of Fischer's exact test, and the Kaplan-Meier method with the Log-rank test was used for statistical inter-group comparisons between the brachiocephalic and radiocephalic fistulas. Successful declotting and restoration of thrill were achieved in 30 of 36 procedures (83%). Reestablishment of normal dialysis for at least one session was achieved in 29 of 36 procedures (81%). The procedural success rate for the brachiocephalic fistulas was 94% compared with 70% for the radiocephalic fistulas, but the difference was not statistically significant ({rho} = 0.104). In the cases with performing mechanical thrombectomy and using the stone basket, procedural success was achieved in 93% (13/14). The expected patency rates at 3, 6 and 12 months were 78%, 61% and 51%, respectively. The patency rates after declotting procedures were not significantly different between the brachiocephalic and radiocephlaic fistulas ({rho} = 0.871). Percutaneous treatment of thrombosed native

  13. Non-small cell lung cancer in never smokers: a clinical entity to be identified.

    Science.gov (United States)

    Santoro, Ilka Lopes; Ramos, Roberta Pulcheri; Franceschini, Juliana; Jamnik, Sergio; Fernandes, Ana Luisa Godoy

    2011-01-01

    It has been recognized that patients with non-small cell lung cancer who are lifelong never-smokers constitute a distinct clinical entity. The aim of this study was to assess clinical risk factors for survival among never-smokers with non-small cell lung cancer. All consecutive non-small cell lung cancer patients diagnosed (n = 285) between May 2005 and May 2009 were included. The clinical characteristics of never-smokers and ever-smokers (former and current) were compared using chi-squared or Student's t tests. Survival curves were calculated using the Kaplan-Meier method, and log-rank tests were used for survival comparisons. A Cox proportional hazards regression analysis was evaluated by adjusting for age (continuous variable), gender (female vs. male), smoking status (never- vs. ever-smoker), the Karnofsky Performance Status Scale (continuous variable), histological type (adenocarcinoma vs. non-adenocarcinoma), AJCC staging (early vs. advanced staging), and treatment (chemotherapy and/or radiotherapy vs. the best treatment support). Of the 285 non-small cell lung cancer patients, 56 patients were never-smokers. Univariate analyses indicated that the never-smoker patients were more likely to be female (68% vs. 32%) and have adenocarcinoma (70% vs. 51%). Overall median survival was 15.7 months (95% CI: 13.2 to 18.2). The never-smoker patients had a better survival rate than their counterpart, the ever-smokers. Never-smoker status, higher Karnofsky Performance Status, early staging, and treatment were independent and favorable prognostic factors for survival after adjusting for age, gender, and adenocarcinoma in multivariate analysis. Epidemiological differences exist between never- and ever-smokers with lung cancer. Overall survival among never-smokers was found to be higher and independent of gender and histological type.

  14. Non-small cell lung cancer in never smokers: a clinical entity to be identified

    Directory of Open Access Journals (Sweden)

    Ilka Lopes Santoro

    2011-01-01

    Full Text Available OBJECTIVES: It has been recognized that patients with non-small cell lung cancer who are lifelong never-smokers constitute a distinct clinical entity. The aim of this study was to assess clinical risk factors for survival among neversmokers with non-small cell lung cancer. METHODS: All consecutive non-small cell lung cancer patients diagnosed (n = 285 between May 2005 and May 2009 were included. The clinical characteristics of never-smokers and ever-smokers (former and current were compared using chi-squared or Student's t tests. Survival curves were calculated using the Kaplan-Meier method, and log-rank tests were used for survival comparisons. A Cox proportional hazards regression analysis was evaluated by adjusting for age (continuous variable, gender (female vs. male, smoking status (never- vs. ever-smoker, the Karnofsky Performance Status Scale (continuous variable, histological type (adenocarcinoma vs. non-adenocarcinoma, AJCC staging (early vs. advanced staging, and treatment (chemotherapy and/or radiotherapy vs. the best treatment support. RESULTS: Of the 285 non-small cell lung cancer patients, 56 patients were never-smokers. Univariate analyses indicated that the never-smoker patients were more likely to be female (68% vs. 32% and have adenocarcinoma (70% vs. 51%. Overall median survival was 15.7 months (95% CI: 13.2 to 18.2. The never-smoker patients had a better survival rate than their counterpart, the ever-smokers. Never-smoker status, higher Karnofsky Performance Status, early staging, and treatment were independent and favorable prognostic factors for survival after adjusting for age, gender, and adenocarcinoma in multivariate analysis. CONCLUSIONS: Epidemiological differences exist between never- and ever-smokers with lung cancer. Overall survival among never-smokers was found to be higher and independent of gender and histological type.

  15. DNA-dependent protein kinase catalytic subunit functions in metastasis and influences survival in advanced-stage laryngeal squamous cell carcinoma.

    Science.gov (United States)

    He, Sha-Sha; Chen, Yong; Shen, Xiao-Ming; Wang, Hong-Zhi; Sun, Peng; Dong, Jun; Guo, Gui-Fang; Chen, Ju-Gao; Xia, Liang-Ping; Hu, Pei-Li; Qiu, Hui-Juan; Liu, Shou-Sheng; Zhou, Yi-Xin; Wang, Wei; Hu, Wei-Han; Cai, Xiu-Yu

    2017-01-01

    Background: DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is known to function in several types of cancer. In this study, we investigated the expression and clinicopathologic significance of DNA-PKcs in laryngeal squamous cell carcinoma (LSCC). Methods: We conducted a retrospective study of 208 patients with advanced-stage LSCC treated at Sun Yat-sen University Cancer Center, Guangzhou, China. We assessed DNA-PKcs and p16INK4a (p16) status using immunohistochemistry. We examined the association between DNA-PKcs expression and clinicopathologic features and survival outcomes. To evaluate the independent prognostic relevance of DNA-PKcs, we used univariate and multivariate Cox regression models. We estimated overall survival (OS) and distant metastasis-free survival (DMFS) using the Kaplan-Meier method. Results: Immunohistochemical analyses revealed that 163/208 (78.4%) of the LSCC tissue samples exhibited high DNA-PKcs expression. High DNA-PKcs expression was significantly associated with survival outcomes ( P = 0.016) and distant metastasis ( P = 0.02; chi-squared test). High DNA-PKcs expression was associated with a significantly shorter OS and DMFS than low DNA-PKcs expression ( P = 0.029 and 0.033, respectively; log-rank test), and was associated with poor OS in the p16-positive subgroup ( P = 0.047). Multivariate analysis identified DNA-PKcs as an independent prognostic indicator of OS and DMFS in all patients ( P = 0.039 and 0.037, respectively). Conclusions : Our results suggest that patients with LSCC in whom DNA-PKcs expression is elevated have a higher incidence of distant metastasis and a poorer prognosis. DNA-PKcs may represent a marker of tumor progression in patients with p16-positive LSCC.

  16. Validation of the alpha-fetoprotein model for hepatocellular carcinoma recurrence after transplantation in an Asian population.

    Science.gov (United States)

    Rhu, Jinsoo; Kim, Jong Man; Choi, Gyu Seong; Kwon, Choon Hyuck David; Joh, Jae-Won

    2018-02-20

    This study was designed to validate the alpha-fetoprotein model for predicting recurrence after liver transplantation in Korean hepatocellular carcinoma patients. Patients who underwent liver transplantation for hepatocellular carcinoma at Samsung Medical Center between 2007 and 2015 were included. Recurrence, overall survival, and disease-specific survival of patients divided by both the Milan criteria and the alpha-fetoprotein model were compared using Kaplan-Meier log-rank test. The predictability of the alpha-fetoprotein model compared to the Milan criteria was tested by means of net reclassification improvement analysis applied to patients with a follow-up of at least 2 years. A total of 400 patients were included in the study. Patients within Milan criteria had 5-year recurrence, and overall survival rates of 20.9% and 76.3% respectively, compared to corresponding rates of 50.3% and 55.7%, respectively, for patients who were beyond Milan criteria. Alpha-fetoprotein model low risk patients had 5-year recurrence and overall survival rates of 21.1% and 76.2%, respectively, compared to corresponding rates of 57.7% and 52.2%, respectively, in high risk patients (P<0.001, all). Although overall net reclassification improvements were statistically nonsignificant for recurrence (NRI=1.7%, Z=0.30, p=0.7624), and overall survival (NRI=9.0%, Z=1.60, p=0.1098), they were significantly better for predicting no recurrence (NRI=6.6%, Z=3.16, p=0.0016) and no death. (NRI=7.7%, Z=3.65, p=0.0003) CONCLUSIONS: The alpha-fetoprotein model seems to be a promising tool for liver transplantation candidacy, but further investigation is needed.

  17. Clinical relevance of microRNA miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145 in colorectal cancer

    International Nuclear Information System (INIS)

    Schee, Kristina; Boye, Kjetil; Abrahamsen, Torveig Weum; Fodstad, Øystein; Flatmark, Kjersti

    2012-01-01

    MicroRNAs (miRNAs) regulate gene expression by binding to mRNA, and can function as oncogenes or tumor suppressors depending on the target. In this study, using qRT-PCR, we examined the expression of six miRNAs (miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145) in tumors from 193 prospectively recruited patients with colorectal cancer, and associations with clinicopathological parameters and patient outcome were analyzed. The miRNAs were chosen based on previous studies for their biomarker potential and suggested biological relevance in colorectal cancer. The miRNA expression was examined by qRT-PCR. Associations between miRNA expression and clinicopathological variables were explored using Mann–Whitney U and Kruskal-Wallis test while survival was estimated using the Kaplan-Meier method and compared using the log-rank test. MiR-101 was hardly expressed in the tumor samples, while for the other miRNAs, variable expression levels and expression ranges were observed, with miR-21 being most abundantly expressed relative to the reference (RNU44). In our study cohort, major clinical significance was demonstrated only for miR-31, as high expression was associated with advanced tumor stage and poor differentiation. No significant associations were found between expression of the investigated miRNAs and metastasis-free or overall survival. Investigating the expression of six miRNAs previously identified as candidate biomarkers in colorectal cancer, few clinically relevant associations were detected in our patient cohort. Our results emphasize the importance of validating potential tumor markers in independent patient cohorts, and indicate that the role of miRNAs as colorectal cancer biomarkers is still undetermined

  18. Comparison of success rate and onset time of two different anesthesia techniques

    Science.gov (United States)

    Haghighat, Abbas; Hasheminia, Dariush; Samandari, Mohammad-Hasan; Safarian, Vajihe; Davoudi, Amin

    2015-01-01

    Background Using local anesthetic is common to control the pain through blocking the nerve reversibly in dental procedures. Gow-Gates (GG) technique has a high success rate but less common. This study aimed to compare the onset time and success rate in GG and standard technique of inferior alveolar nerve block (IANB). Material and Methods This descriptive, single blind study was consisted of 136 patients (59 males and 77 females) who were randomly received GG or IANB for extraction of mandibular molar teeth. Comparisons between the successes of two anesthetic injection techniques were analyzed with Chi-square test. Incidence of pulpal anesthesia and soft tissue anesthesia were analyzed with Kaplan-Meier method. Mean onset times of pulpal anesthesia, soft tissue and lip numbness were analyzed with Log-Rank test. Comparisons were considered significant at P≤0.05 by using SPSS software ver.15. Results The incidence of pulpal anesthesia in the IANB group (canine 49.3%, premolar 60.3%) were not significantly different from the GG group (canine 41.3%, premolar 74.6%) (P=0.200 and P=0.723). The success rate in the IANB group (80.82%) was not significantly different from the GG group (92.02%) (P=0.123). Furthermore, onset time of lip and buccal soft tissue numbness in GG group (3.25, 4.96 minutes) was quite similar to IANB group (3.22, 4.89 minutes) (all Pvalues >0.05). Conclusions Although this study demonstrated higher clinical success rate for GG than IANB technique, no significant differences in success rates and onset time were observed between two techniques. Key words: Anesthesia, Inferior alveolar nerve, nerve block, success rate. PMID:25858085

  19. Software Application for Data Collection and Analysis in Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Anca BACÂREA

    2011-03-01

    Full Text Available Aim: It is important in the context of the informatics development and also of medical research, that new software technology to be integrated in order to achieve easier research. The aim of this study was to develop a software application that uses few resources, and that enable data collection, their primary processing in statistical terms (e.g. mean, median, etc., drawing of survival curves and survival Log Rank statistic testing according to the collected parameters. Material and Method: For this purpose, a database in SQLite3 was developed. Because the database engine is embedded in the Database Management System (DBMS this program allows absolute portability. Graphical interface was made in wxWidgets. Statistical calculations were obtained using R software (the `addons` E1071 was used for descriptive statistics and the `Survival `for testing survival and Northest for Kaplan Meier survival curve. Patients were cases admitted and treated in the Hematology Department of County Emergency Hospital Tîrgu Mureş hospitalized and treated during 2007-2010. Results: We created a GUI in wxWidgets to collect the desired medical data: age, date of diagnosis, date of death, blood count values, and the CD leukocyte markers detected by flow cytometry. Entwining of medical data collection and processing statistics (for acute myeloid leukemia - survival, prognostic factors evaluation is a further step in medical research. Conclusion: The tool presented is a useful for research. Application in acute myeloid leukemia derives from the author's interest in the subject; development of this tool in other directions is possible and desirable.

  20. Role of TPS in 125I brachytherapy for orbital tumors

    International Nuclear Information System (INIS)

    Ren Ling; Dai Haojie; Li Quan

    2012-01-01

    Objective: To investigate the role of TPS in 125 I brachytherapy for orbital tumors. Methods: Sixty-six patients with orbital tumor treated with 125 I seeds from 2005 to 2009 were retrospectively analyzed. Forty-three patients were treated using TPS guided brachytherapy and the prescribed dose was 140 Gy. Other 23 patients were treated without TPS but simply implanted with 125 I seeds at 1 cm intervals in parallel with each other intraoperatively. CT and TPS quality verification were performed postoperatively in all patients. Also, CT and (or) MRI examination were performed at 3, 6, 12 and 24 months after brachytherapy for follow-up. χ 2 test and Kaplan-Meier survival analysis with log-rank significance test were used with SPSS 17.0. Results: A total of 1070 125 I seeds were implanted in 66 cases, on average, (16.2 ± 7.3) seeds for each patient. The satisfaction rates of postoperative quality verification in patients with and without TPS pre-plans were 79.07% (34/43) and 43.48% (10/23) respectively (χ 2 =8.542, P=0.003). Ten patients were lost in follow-up. Local recurrence rates in patients with favorable postoperative quality verification were 0 (0/37) in 3 months, 6.25% (2/32) in 6 months, 13.64% (3/22) in 12 months and 3/9 in 24 months respectively, which were significantly different from those (5.26% (1/19), 16.67% (3/18), 30.77% (4/13), 6/6) in the patients with inferior postoperative quality verification (χ 2 =9.017, P=0.0003). Conclusions: TPS plays an important role in 125 I brachytherapy for orbital tumors. Also, postoperative quality verification by TPS may help predict the local recurrence after brachytherapy. (authors)

  1. Reirradiation in progressive high-grade gliomas: outcome, role of concurrent chemotherapy, prognostic factors and validation of a new prognostic score with an independent patient cohort

    International Nuclear Information System (INIS)

    Scholtyssek, Felix; Kortmann, Rolf-Dieter; Müller, Klaus; Zwiener, Isabella; Schlamann, Annika; Seidel, Clemens; Meixensberger, Jürgen; Bauer, Manfred; Hoffmann, Karl-Titus; Combs, Stephanie E; Bueren, André O von

    2013-01-01

    First, to evaluate outcome, the benefit of concurrent chemotherapy and prognostic factors in a cohort of sixty-four high-grade glioma patients who underwent a second course of radiation therapy at progression. Second, to validate a new prognostic score for overall survival after reirradiation of progressive gliomas with an independent patient cohort. All patients underwent fractionated reirradiation with a median physical dose of 36 Gy. Median planned target volume was 110.4 ml. Thirty-six patients received concurrent chemotherapy consisting in 24/36 cases (67%) of carboplatin and etoposide and in 12/36 cases (33%) of temozolomide. We used the Kaplan Meier method, log rank test and proportional hazards regression analysis for statistical assessment. Median overall survival from the start of reirradiation was 7.7 ± 0.7 months. Overall survival rates at 6 and 12 months were 60 ± 6% and 24 ± 6%, respectively. Despite relatively large target volumes we did not observe any major acute toxicity. Concurrent chemotherapy did not appear to improve outcome. In contrast, female gender, young age, WHO grade III histology, favorable Karnofsky performance score and complete resection of the tumor prior to reirradiation were identified as positive prognostic factors for overall survival. We finally validated a recent suggestion for a prognostic score with our independent but small patient cohort. Our preliminary findings suggest that its ability to discriminate between different prognostic groups is limited. Outcome of our patients was comparable to previous studies. Even in case of large target volumes reirradiation seems to be feasible without observing major toxicity. The benefit of concurrent chemotherapy is still elusive. A reassessment of the prognostic score, tested in this study, using a larger patient cohort is needed

  2. Squamous cell carcinoma of the oral cavity often overexpresses p16 but is rarely driven by human papillomavirus

    Science.gov (United States)

    Zafereo, Mark E.; Xu, Li; Dahlstrom, Kristina R.; Viamonte, Carlo A.; El-Naggar, Adel K.; Wei, Qingyi; Li, Guojun; Sturgis, Erich M.

    2016-01-01

    Objective Human papillomavirus (HPV) is a causal and prognostic factor for oropharyngeal cancer, but its role in squamous cell carcinoma of the oral cavity (SCCOC) is unclear. We sought to clarify HPV's role in SCCOC. Materials and Methods Patients with newly diagnosed SCCOC (N=460) were prospectively recruited, treated, and followed at one institution. p16/HPV status was determined by p16 immunohistochemistry (IHC) (N=210), PCR-based HPV 16/18 E6/7 DNA testing (N=403), and/or HPV in situ hybridization (ISH) (N=178). Kaplan-Meier curves and log-rank tests were used to compare survival by p16/HPV status. Results p16 expression was detected in 30% of tumors (62/210) and HPV 16/18 E6/7 DNA in 28% (114/403), although correlation between these two assays was poor (r=−0.01). Patients with p16-positive tumors were more likely to be younger and have primary tumors of the oral tongue. Only 4% of tumors (7/171) were positive for HPV by ISH. Comparisons of patients with p16-positive and p16-negative tumors, patients with HPV-positive and HPV-negative tumors by PCR, and patients with HPV-positive and HPV-negative tumors by ISH showed no significant differences in disease-specific or disease-free survival by p16/HPV status. When we applied a more stringent definition of HPV positivity based on a combination of assay results, only 10 of 166 tumors were HPV positive, and there were no significant differences in demographic, exposure, clinical, or survival characteristics between these patients and the 156 HPV-negative patients. Conclusions Very few patients with SCCOC have HPV-driven tumors. SCCOC that overexpresses p16 may be a unique subset deserving of further study. PMID:27086486

  3. Disparities in cervical cancer survival among Asian-American women.

    Science.gov (United States)

    Nghiem, Van T; Davies, Kalatu R; Chan, Wenyaw; Mulla, Zuber D; Cantor, Scott B

    2016-01-01

    We compared overall survival and influencing factors between Asian-American women as a whole and by subgroup with white women with cervical cancer. Cervical cancer data were from the Surveillance, Epidemiology, and End Results registry; socioeconomic information was from the Area Health Resource File. We used standard tests to compare characteristics between groups; the Kaplan-Meier method with log-rank test to assess overall survival and compare it between groups; and Cox proportional hazards models to determine the effect of race and other covariates on overall survival (with and/or without age stratification). Being 3.3 years older than white women at diagnosis (P Asian-American women were more likely to be in a spousal relationship, had more progressive disease, and were better off socioeconomically. Women of Filipino, Japanese, and Korean origin had similar clinical characteristics compared to white women. Asian-American women had higher 36- and 60-month survival rates (P = .004 and P = .013, respectively), higher overall survival rates (P = .049), and longer overall survival durations after adjusting for age and other covariates (hazard ratio = 0.77, 95% confidence interval: 0.68-0.86). Overall survival differed across age strata between the two racial groups. With the exception of women of Japanese or Korean origin, Asian-American women grouped by geographic origin had better overall survival than white women. Although Asian-American women, except those of Japanese or Korean origin, had better overall survival than white women, their older age at cervical cancer diagnosis suggests that they have less access to screening programs. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. The role of {sup 18}F-FDG PET/CT as a prognostic factor in patients with synovial sarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Kyoung Jin; Lim, Il Han; Park, Joon Yeun [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2015-03-15

    This research aims to investigate the potential of 18F-fluorodeoxyglucose positron emission tomography/computed tomography (FDG PET) to predict pathologic response after neoadjuvant chemotherapy (NAC) and overall survival (OS) of patients with synovial sarcoma in Korea. Twenty patients with synovial sarcoma from January 2001 to December 2011 were reviewed retrospectively. All patients underwent pre-treatment FDG PET and tumor removal. Patients were classified with the maximum SUV (SUVmax), metabolic tumor volume (MTV), total lesion glycolysis (TLG), age, sex, histologic subtype, tumor size, NAC, resection margin, and metastasis at diagnosis. Pathologic response was assessed using the French Federation of Cancer Centers system. Statistical analyses were analyzed using the Kaplan-Meier method, log-rank test, Cox proportional hazards regression model, and Mann-Whitney test. Nine patients (45 %) showed pathologic response, and ten patients survived. Higher SUVmax, higher MTV, higher TLG, monophasic epithelial type, and metastasis at diagnosis were significantly related to poorer OS (p = 0.047, 0.016, 0.016, 0.045, and 0.018, respectively). By multivariate analysis, metastasis at diagnosis was significantly related to poorer OS (p = 0.012/HR = 5.9, 95 % CI 1.47 to 24.1). The SUVmax, MTV, and TLG of the non-responder group were significantly higher than those of the responder group (p = 0.020, 0.020, and 0.020, respectively). There was no significant difference in size between the two groups (p = 0.062). A higher SUVmax on the pre-treatment scan, monophasic epithelial type, and metastasis at diagnosis were significantly associated with a poorer OS, and pathologic responders showed a higher SUVmax before NAC. The PET parameters can be used to predict OS and pathologic response in patients with synovial sarcomas before NAC.

  5. Efeito de Extratos Aquosos de Azadirachta indica na Sobrevivência de Diatraea saccharalis e do Parasitóide Cotesia flavipes

    Directory of Open Access Journals (Sweden)

    Fábio Mazzonetto

    2013-09-01

    Full Text Available O objetivo do presente trabalho foi avaliar o efeito de extratos aquosos de Azadirachta indica na sobrevivência de Diatraea saccharalis e do parasitóide Cotesia flavipes. Para a obtenção do extrato vegetal de A. indica, as folhas secas em estufa de circulação forçada de ar (40oC durante 48h, posteriormente trituradas em moinho de facas até obtenção do pó. Os extratos foram obtidos a partir da adição de 0,5; 1,0; 2,0; 3,0 e 5,0g do pó vegetal em 100ml de água destilada formando respectivamente as concentrações. O delineamento experimental foi inteiramente casualizado, com seis tratamentos (testemunha, 0,5%, 1%, 2%, 3% e 5% de extrato aquoso de A. indica e 40 repetições. Para a análise estatística utilizou-se o método de Kaplan-Meier e o teste de Log-Rank na obtenção e comparação das curvas de sobrevivência. Já para a análise dos dados de emergência de adultos do parasitóide C. flavipes foi utilizado o teste de Scott-Knott ao nível de 5% de probabilidade.  As lagartas D. saccharalis apresentaram um menor tempo de sobrevivência quando expostas as dietas artificiais contendo as diferentes concentrações do extrato aquoso de A. indica.  A utilização de extrato aquoso de A. indica afetou negativamente a emergência de adultos de C. flavipes, importante parasitóide de D. saccharalis, quando submetidos ao parasitismo de lagartas tratadas com extrato aquoso de folhas deste vegetal.

  6. Impact of UCSF criteria according to pre- and post-OLT tumor features: analysis of 479 patients listed for HCC with a short waiting time.

    Science.gov (United States)

    Decaens, Thomas; Roudot-Thoraval, Françoise; Hadni-Bresson, Solange; Meyer, Carole; Gugenheim, Jean; Durand, Francois; Bernard, Pierre-Henri; Boillot, Olivier; Sulpice, Laurent; Calmus, Yvon; Hardwigsen, Jean; Ducerf, Christian; Pageaux, Georges-Philippe; Dharancy, Sebastien; Chazouilleres, Olivier; Cherqui, Daniel; Duvoux, Christophe

    2006-12-01

    Orthotopic liver transplantation (OLT) indication for hepatocellular carcinoma (HCC) is currently based on the Milan criteria. The University of California, San Francisco (UCSF) recently proposed an expansion of the selection criteria according to tumors characteristics on the explanted liver. This study: 1) assessed the validity of these criteria in an independent large series and 2) tested for the usefulness of these criteria when applied to pre-OLT tumor evaluation. Between 1985 and 1998, 479 patients were listed for liver transplantation (LT) for HCC and 467 were transplanted. According to pre-OLT (imaging at date of listing) or post-OLT (explanted liver) tumor characteristics, patients were retrospectively classified according to both the Milan and UCSF criteria. The 5-yr survival statistics were assessed by the Kaplan-Meier method and compared by the log-rank test. Pre-OLT UCSF criteria were analyzed according to an intention-to-treat principle. Based on the pre-OLT evaluation, 279 patients were Milan+, 44 patients were UCSF+ but Milan- (subgroup of patients that might benefit from the expansion), and 145 patients were UCSF- and Milan-. With a short median waiting time of 4 months, 5-yr survival was 60.1 +/- 3.0%, 45.6 +/- 7.8%, and 34.7 +/- 4.0%, respectively (P OLT evaluation, the UCSF criteria are associated with a 5-yr survival below 50%. Their applicability is therefore limited, despite similar survival rates compared to the Milan criteria, when the explanted liver is taken into account.

  7. Polysialic Acid Neural Cell Adhesion Molecule (PSA-NCAM) is an adverse prognosis factor in glioblastoma, and regulates olig2 expression in glioma cell lines

    International Nuclear Information System (INIS)

    Amoureux, Marie-Claude; Coulibaly, Béma; Chinot, Olivier; Loundou, Anderson; Metellus, Philippe; Rougon, Geneviève; Figarella-Branger, Dominique

    2010-01-01

    Glioblastoma multiforme (GBM) is the most aggressive and frequent brain tumor, albeit without cure. Although patient survival is limited to one year on average, significant variability in outcome is observed. The assessment of biomarkers is needed to gain better knowledge of this type of tumor, help prognosis, design and evaluate therapies. The neurodevelopmental polysialic acid neural cell adhesion molecule (PSA-NCAM) protein is overexpressed in various cancers. Here, we studied its expression in GBM and evaluated its prognosis value for overall survival (OS) and disease free survival (DFS). We set up a specific and sensitive enzyme linked immunosorbent assay (ELISA) test for PSA-NCAM quantification, which correlated well with PSA-NCAM semi quantitative analysis by immunohistochemistry, and thus provides an accurate quantitative measurement of PSA-NCAM content for the 56 GBM biopsies analyzed. For statistics, the Spearman correlation coefficient was used to evaluate the consistency between the immunohistochemistry and ELISA data. Patients' survival was estimated by using the Kaplan-Meier method, and curves were compared using the log-rank test. On multivariate analysis, the effect of potential risk factors on the DFS and OS were evaluated using the cox regression proportional hazard models. The threshold for statistical significance was p = 0.05. We showed that PSA-NCAM was expressed by approximately two thirds of the GBM at variable levels. On univariate analysis, PSA-NCAM content was an adverse prognosis factor for both OS (p = 0.04) and DFS (p = 0.0017). On multivariate analysis, PSA-NCAM expression was an independent negative predictor of OS (p = 0.046) and DFS (p = 0.007). Furthermore, in glioma cell lines, PSA-NCAM level expression was correlated to the one of olig2, a transcription factor required for gliomagenesis. PSA-NCAM represents a valuable biomarker for the prognosis of GBM patients

  8. Local Recurrence of Hepatocellular Carcinoma after Segmental Transarterial Chemoembolization: Risk Estimates Based on Multiple Prognostic Factors

    International Nuclear Information System (INIS)

    Park, Seung Hyun; Cho, Yun Ku; Ahn, Yong Sik; Park, Yoon Ok; Kim, Jae Kyun; Chung, Jin Wook

    2007-01-01

    To determine the prognostic factors for local recurrence of nodular hepatocellular carcinoma after segmental transarterial chemoembolization. Seventy-four nodular hepatocellular carcinoma tumors ≤5 cm were retrospectively analyzed for local recurrence after segmental transarterial chemoembolization using follow-up CT images (median follow-up of 17 months, 4 77 months in range). The tumors were divided into four groups (IA, IB, IIA, and IIB) according to whether the one-month follow-up CT imaging, after segmental transarterial chemoembolization, showed homogeneous (Group I) or inhomogeneous (Group II) iodized oil accumulation, or whether the tumors were located within the liver segment (Group A) or in a segmental border zone (Group B). Comparison of tumor characteristics between Group IA and the other three groups was performed using the chi-square test. Local recurrence rates were compared among the groups using the Kaplan-Meier estimation and log rank test. Local tumor recurrence occurred in 19 hepatocellular carcinoma tumors (25.7%). There were: 28, 18, 17, and 11 tumors in Group IA, IB, IIA, and IIB, respectively. One of 28 (3.6%) tumors in Group IA, and 18 of 46 (39.1%) tumors in the other three groups showed local recurrence. Comparisons between Group IA and the other three groups showed that the tumor characteristics were similar. One-, two-, and three-year estimated local recurrence rates in Group IA were 0%, 11.1%, and 11.1%, respectively. The difference between Group IA and the other three groups was statistically significant (p 0.000). An acceptably low rate of local recurrence was observed for small or intermediate nodular tumors located within the liver segment with homogeneous iodized oil accumulation

  9. Relationship between HPV infection/p16 expression and radiotherapy prognosis in oropharyngeal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Qu Yuan; Gao Li; Yi Junlin; Huang Xiaodong; Luo Jingwei; Zhang Shiping; Wang Kai; Xu Guozhen

    2014-01-01

    Objective: To investigate the relationship between human papillomavirus (HPV) infection/p16 expression and radiotherapy prognosis in oropharyngeal squamous cell carcinoma (OSCC) and the prognostic value of p16 in OSCC patients treated with radiotherapy. Methods: Tissue samples were collected from 42 patients newly diagnosed with OSCC in our hospital from January 1999 to December 2008. PCR was performed to detect HPV DNA, and p16 expression was measured by immunohistochemistry. The chi-square test was used to compare the local/regional control rate (CR) between HPV (+)/p16 (+) patients and HPV (-)/p16 (-) patients after radical radiotherapy and evaluate the association between HPV infection and p16 expression; the Kaplan-Meier method was used to calculate overall survival (OS), and the log-rank test was used for survival difference analysis. Results: The follow-up rate was 100%.The HPV infection rate was 19%, and the positive rate of p16 was 43%. In patients who received radical radiotherapy, the local CR for HPV (+) patients was 100%, versus 54% for HPV (-) patients (P =0.026); the local CR for p16 (+) patients was 92%, versus 44% for p16 (-) patients (P=0.006); the locoregional CR for p16(-) patients was 69%, versus 22% for p16 (-) patients (P=0.009). For high-risk patients, HPV infection was significantly associated with p16 expression (P=0.000). The 3-year OS rates for p16 (+) and p16 (-) patients were 91% and 2 6 %, respectively (P=0.001). Conclusions: The p16 expression is closely associated with HPV infection in OSCC patients, and it is expected to become one of the prognostic markers in OSCC patients treated with radiotherapy. (authors)

  10. Evaluation of Retention in Methadone Treatment in Patients Attending Baharan Hospital Clinic in Zahedan City

    Directory of Open Access Journals (Sweden)

    M.D. Mohebi

    2015-04-01

    Full Text Available Introduction & Objectives: Substance abuse and opioid dependency refers to hazardous use of psychoactive substance .Prevention and treatment of opiate dependence has not been success-ful. Most effective drug in agonist treatment of opiates is methadone maintenance therapy (MMT.But the lack of cooperation of addicts in methadone maintenance therapy has always been a big problem to continue. The purpose of this study is to investigate the retention in the MMT. Materials & Methods: This historical cohort study analyzed the medical records of patients of Baharan hospital in Zahedan. All 912 cases of methadone maintenance clinic of Baharan hos-pital in Zahedan 2011-2012 were studied and the data were analyzed using SPSS. Tables and indexes were analyzed by the Chi-square test and survival curves were plotted using Kaplan–Meier method and analyzed by Log-Rank test. Results: This study reviewed records from 912 patients with a mean age of 34.67% and stan-dard deviation of 10.88 and the range of 15-86 years. 735 were male and 177 ware female. 1-moth retention rate was 71%, 3 months was 59%, 6 months was 47%, 1 year was 30% and 2 years was 17%. Kaplan-Meier median survival time of 8 months was estimated by relation-ship. Doses higher than 60 mg/d of methadone was associated with increased survival on MMT. Conclusion: Age increase, increase of employment time, increasing of the duration of drug abuse, increasing the daily dose of methadone, oral substance abuse increased retention rate and heroin abuse and smoking were associated with decrease retention rate of methadone maintenance therapy. So, with an emphasis on each of these factors effective steps can be taken to improve the cooperation of patients in MMT. (Sci J Hamadan Univ Med Sci 2015; 22 (1:30-36

  11. Long-term prognosis in patients continuing taking antithrombotics after peptic ulcer bleeding.

    Science.gov (United States)

    Wang, Xi-Xu; Dong, Bo; Hong, Biao; Gong, Yi-Qun; Wang, Wei; Wang, Jue; Zhou, Zhen-Yu; Jiang, Wei-Jun

    2017-01-28

    To investigate the long-term prognosis in peptic ulcer patients continuing taking antithrombotics after ulcer bleeding, and to determine the risk factors that influence the prognosis. All clinical data of peptic ulcer patients treated from January 1, 2009 to January 1, 2014 were retrospectively collected and analyzed. Patients were divided into either a continuing group to continue taking antithrombotic drugs after ulcer bleeding or a discontinuing group to discontinue antithrombotic drugs. The primary outcome of follow-up in peptic ulcer bleeding patients was recurrent bleeding, and secondary outcome was death or acute cardiovascular disease occurrence. The final date of follow-up was December 31, 2014. Basic demographic data, complications, and disease classifications were analyzed and compared by t - or χ 2 -test. The number of patients that achieved various outcomes was counted and analyzed statistically. A survival curve was drawn using the Kaplan-Meier method, and the difference was compared using the log-rank test. COX regression multivariate analysis was applied to analyze risk factors for the prognosis of peptic ulcer patients. A total of 167 patients were enrolled into this study. As for the baseline information, differences in age, smoking, alcohol abuse, and acute cardiovascular diseases were statistically significant between the continuing and discontinuing groups (70.8 ± 11.4 vs 62.4 ± 12.0, P peptic ulcer bleeding, continuing antithrombotics increases the risk of recurrent bleeding events, while discontinuing antithrombotics would increase the risk of death and developing cardiovascular disease. This suggests that clinicians should comprehensively consider the use of antithrombotics after peptic ulcer bleeding.

  12. Glioblastoma treated with postoperative radio-chemotherapy: Prognostic value of apparent diffusion coefficient at MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Yamasaki, Fumiyuki; Sugiyama, Kazuhiko [Department of Neurosurgery, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551 (Japan); Ohtaki, Megu [Department of Environmetrics and Biometrics, Research Institute for Radiation Biology and Medicine, Hiroshima University, Hiroshima (Japan); Takeshima, Yukio [Department of Pathology, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima (Japan); Abe, Nobukazu; Akiyama, Yuji; Takaba, Junko [Department of Radiology, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima (Japan); Amatya, Vishwa Jeet [Department of Pathology, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima (Japan); Saito, Taiichi; Kajiwara, Yoshinori; Hanaya, Ryosuke [Department of Neurosurgery, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551 (Japan); Kurisu, Kaoru [Department of Neurosurgery, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551 (Japan)], E-mail: kuka422@hiroshima-u.ac.jp

    2010-03-15

    Purpose: To retrospectively evaluate whether the mean, minimum, and maximum apparent diffusion coefficient (ADC) of glioblastomas obtained from pretreatment MR images is of prognostic value in patients with glioblastoma. Materials and methods: The institutional review board approved our study and waived the requirement for informed patient consent. Between February 1998 and January 2006, 33 patients (24 males, 9 females; age range 10-76 years) with supratentorial glioblastoma underwent pretreatment magnetic resonance (MR) imaging. The values of the mean, minimum, and maximum ADC (ADC{sub mean}, ADC{sub MIN}, and ADC{sub MAX}, respectively) of each tumor were preoperatively determined from several regions of interest defined in the tumors. After surgical intervention, all patients underwent irradiation and chemotherapy performed according to our hospital protocol. The patient age, symptom duration, Karnofsky performance scale score, extent of surgery, and ADC were assessed using factor analysis of overall survival. Prognostic factors were evaluated using Kaplan-Meier survival curves, the log-rank test, and multiple regression analysis with the Cox proportional hazards model. Results: Likelihood ratio tests confirmed that ADC{sub MIN} was the strongest among the three prognostic factors. Total surgical removal was the most important predictive factor for overall survival (P < 0.01). ADC{sub MIN} was also statistically correlated with overall survival (P < 0.05) and could be used to classify patients into different prognostic groups. Interestingly, ADC{sub MIN} was also the strongest prognostic factor (P < 0.01) in the group of patients in whom total tumor removal was not possible. Conclusion: The ADC{sub MIN} value obtained from pretreatment MR images is a useful clinical prognostic biomarker in patients with glioblastoma.

  13. The tumour suppressor SOX11 is associated with improved survival among high grade epithelial ovarian cancers and is regulated by reversible promoter methylation

    International Nuclear Information System (INIS)

    Sernbo, Sandra; Gustavsson, Elin; Brennan, Donal J; Gallagher, William M; Rexhepaj, Elton; Rydnert, Frida; Jirström, Karin; Borrebaeck, Carl AK; Ek, Sara

    2011-01-01

    The neural transcription factor SOX11 has been described as a prognostic marker in epithelial ovarian cancers (EOC), however its role in individual histological subtypes and tumour grade requires further clarification. Furthermore, methylation-dependent silencing of SOX11 has been reported for B cell lymphomas and indicates that epigenetic drugs may be used to re-express this tumour suppressor, but information on SOX11 promoter methylation in EOC is still lacking. SOX11 expression and clinicopathological data was compared using χ 2 test in a cohort of 154 cases of primary invasive EOC. Kaplan-Meier analysis and the log rank test were applied to evaluate ovarian cancer-specific survival (OCSS) and overall survival (OS) in strata, according to SOX11 expression. Also, the methylation status of the SOX11 promoter was determined by sodium bisulfite sequencing and methylation specific PCR (MSP). Furthermore, the effect of ectopic overexpression of SOX11 on proliferation was studied through [3H]-thymidine incorporation. SOX11 expression was associated with an improved survival of patients with high grade EOC, although not independent of stage. Further analyses of EOC cell lines showed that SOX11 mRNA and protein were expressed in two of five cell lines, correlating with promoter methylation status. Demethylation was successfully performed using 5'-Aza-2'deoxycytidine (5-Aza-dC) resulting in SOX11 mRNA and protein expression in a previously negative EOC cell line. Furthermore, overexpression of SOX11 in EOC cell lines confirmed the growth regulatory role of SOX11. SOX11 is a functionally associated protein in EOC with prognostic value for high-grade tumours. Re-expression of SOX11 in EOC indicates a potential use of epigenetic drugs to affect cellular growth in SOX11-negative tumours

  14. Metformin Use and Endometrial Cancer Survival

    Science.gov (United States)

    Nevadunsky, Nicole S.; Van Arsdale, Anne; Strickler, Howard D.; Moadel, Alyson; Kaur, Gurpreet; Frimer, Marina; Conroy, Erin; Goldberg, Gary L.; Einstein, Mark H.

    2013-01-01

    Objective Impaired glucose tolerance and diabetes are risk factors for the development of uterine cancer. Although greater progression free survival among diabetic patients with ovarian and breast cancer using metformin have been reported, no studies have assessed the association of metformin use with survival in women with endometrial cancer (EC). Methods We conducted a single-institution retrospective cohort study of all patients treated for uterine cancer from January 1999 through December 2009. Demographic, medical, social, and survival data were abstracted from medical records and the national death registry. Overall survival (OS) was estimated using Kaplan-Meier methods. Cox models were utilized for multivariate analysis. All statistical tests were two-sided. Results Of 985 patients, 114 (12%) had diabetes and were treated with metformin, 136 (14%) were diabetic but did not use metformin, and 735 (74%) had not been diagnosed with diabetes. Greater OS was observed in diabetics with non-endometrioid EC who used metformin than in diabetic cases not using metformin and non-endometrioid EC cases without diabetes (log rank test (p=0.02)). This association remained significant (hazard ratio = 0.54, 95% CI: 0.30–0.97, p<0.04) after adjusting for age, clinical stage, grade, chemotherapy treatment, radiation treatment and presence of hyperlipidemia in multivariate analysis. No association between metformin use and OS in diabetics with endometrioid histology was observed. Conclusion Diabetic EC patients with non-endometrioid tumors who used metformin had lower risk of death than women with EC who did not use metformin. These data suggest that metformin might be useful as adjuvant therapy for non-endometrioid EC. PMID:24189334

  15. Surgical Treatment of Recurrent Endometrial Cancer: Time for a Paradigm Shift.

    Science.gov (United States)

    Papadia, Andrea; Bellati, Filippo; Ditto, Antonino; Bogani, Giorgio; Gasparri, Maria Luisa; Di Donato, Violante; Martinelli, Fabio; Lorusso, Domenica; Benedetti-Panici, Pierluigi; Raspagliesi, Francesco

    2015-12-01

    Although surgery represents the cornerstone treatment of endometrial cancer at initial diagnosis, scarce data are available in recurrent setting. The purpose of this study was to review the outcome of surgery in these patients. Medical records of all patients undergoing surgery for recurrent endometrial cancer at NCI Milano between January 2003 and January 2014 were reviewed. Survival was determined from the time of surgery for recurrence to last follow-up. Survival was estimated using Kaplan-Meier methods. Differences in survival were analyzed using the log-rank test. The Fisher's exact test was used to compare optimal versus suboptimal cytoreduction against possible predictive factors. Sixty-four patients were identified. Median age was 66 years. Recurrences were multiple in 38 % of the cases. Optimal cytoreduction was achieved in 65.6 %. Median OR time was 165 min, median postoperative hemoglobin drop was 2.4 g/dl, and median length hospital stay was 5.5 days. Eleven patients developed postoperative complications, but only four required surgical management. Estimated 5-year progression-free survival (PFS) was 42 and 19 % in optimally and suboptimally cytoreduced patients, respectively. At multivariate analysis, only residual disease was associated with PFS. Estimated 5-year overall survival (OS) was 60 and 30 % in optimally and suboptimally cytoreduced patients, respectively. At multivariate analysis, residual disease and histotype were associated with OS. At multivariate analysis, only performance status was associated with optimal cytoreduction. Secondary cytoreduction in endometrial cancer is associated with long PFS and OS. The only factors associated with improved long-term outcome are the absence of residual disease at the end of surgical resection and histotype.

  16. Time of progression to osteopenia/osteoporosis in chronically HIV-infected patients: screening DXA scan.

    Directory of Open Access Journals (Sweden)

    Eugenia Negredo

    Full Text Available BACKGROUND: Algorithms for bone mineral density (BMD management in HIV-infected patients are lacking. Our objective was to assess how often a dual-energy x-ray absorptiometry (DXA scan should be performed by assessing time of progression to osteopenia/osteoporosis. METHODS: All DXA scans performed between 2000 and 2009 from HIV-infected patients with at least two DXA were included. Time to an event (osteopenia and osteoporosis was assessed using the Kaplan-Meier method. Strata (tertiles were defined using baseline minimum T scores. Differences between strata in time to an event were compared with the log-rank test. RESULTS: Of 391 patients (1,639 DXAs, 49.6% had osteopenia and 21.7% osteoporosis at their first DXA scan. Of the 112 (28.6% with normal BMD, 35.7% progressed to osteopenia; median progression time was 6.7 years. These patients were stratified: "low-risk" (baseline minimum T score >-0.2 SD, "middle-risk" (between -0.2 and -0.6 SD, and "high-risk" (from -0.6 to -1 SD; median progression time to osteopenia was 8.7, >7.2, and 1.7 years, respectively (p8.5 years. Progression time was >8.2 years in "low-risk" tertile (T score between -1.1 and -1.6 SD, >8.5 years in "middle-risk" (between -1.6 and -2, and 3.2 years in "high-risk" (from -2 to -2.4 (p<0.0001. CONCLUSIONS: Our results may help to define the BMD testing interval. The lowest T score tertiles would suggest recommending a subsequent DXA in 1-2 years; in the highest tertiles, ≥6 years. Early intervention in patients with bone demineralization could reduce fracture-related morbidity/mortality.

  17. Preventive and curative effects of acupuncture on the common cold: a multicentre randomized controlled trial in Japan.

    Science.gov (United States)

    Kawakita, Kenji; Shichidou, Toshiyuki; Inoue, Etsuko; Nabeta, Tomoyuki; Kitakouji, Hiroshi; Aizawa, Shigekatsu; Nishida, Atsushi; Yamaguchi, Nobuo; Takahashi, Norihito; Yano, Tadashi; Tanzawa, Syouhachi

    2004-12-01

    To determine the preventive and curative effects of manual acupuncture on the symptoms of the common cold. Students and staff in five Japanese acupuncture schools (n=326) were randomly allocated to acupuncture and no-treatment control groups. A specific needling point (Y point) on the neck was used bilaterally. Fine acupuncture needles were gently manipulated for 15 s, evoking de qi sensation. Acupuncture treatments were performed four times during the 2-week experimental period with a 2-week follow-up period. A common cold diary was scored daily for 4 weeks, and a common cold questionnaire was scored before each acupuncture treatment and twice at weekly intervals. A reliability test for the questionnaire was performed on the last day of recording. Five of the 326 subjects who were recruited dropped out. The diary score in the acupuncture group tended to decrease after treatment, but the difference between groups was not significant (Kaplan-Meier survival analysis, log rank test P=0.53, Cox regression analysis, P>0.05). Statistically significantly fewer symptoms were reported in the questionnaire by the acupuncture group than control group (P=0.024, general linear model, repeated measure). Significant inter-centre (Pcold. A significantly positive effect of acupuncture was demonstrated in the summed questionnaire data, although a highly significant inter-centre difference was observed. Needling on the neck using the Japanese fine needle manipulating technique was shown to be effective and safe. The use of acupuncture for symptoms of the common cold symptoms should be considered, although further evidence from placebo controlled RCTs is required.

  18. Characteristics of Chinese herbal medicine usage and its effect on survival of lung cancer patients in Taiwan.

    Science.gov (United States)

    Li, Te-Mao; Yu, Yang-Hao; Tsai, Fuu-Jen; Cheng, Chi-Fung; Wu, Yang-Chang; Ho, Tsung-Jung; Liu, Xiang; Tsang, Hsinyi; Lin, Ting-Hsu; Liao, Chiu-Chu; Huang, Shao-Mei; Li, Ju-Pi; Lin, Jung-Chun; Lin, Chih-Chien; Liang, Wen-Miin; Lin, Ying-Ju

    2018-03-01

    In Taiwan, lung cancer remains one of the deadliest cancers. Survival of lung cancer patients remains low, ranging from 6% to 18%. Studies have shown that Chinese herbal medicine (CHM) can be used to induce cell apoptosis and exhibit anti-inflammatoryanti-inflammatory activities in cancer cells. This study aimed to investigate the frequencies and patterns of CHM treatment for lung cancer patients and the effect of CHM on their survival probability in Taiwan. We identified 6939 lung cancer patients (ICD-9-CM: 162). We allocated 264 CHM users and 528 CHM-non users, matched for age, gender, duration, and regular treatment. Chi-square test, conditional multivariable logistic regression, Kaplan-Meier method, and the log-rank test were used in this study. The CHM group was characterized by a longer follow up time and more cases of hyperlipidemia and liver cirrhosis. This group exhibited a lower mortality hazard ratio (0.48, 95% confidence interval [0.39-0.61], p herbs, respectively. Among them, BM was the core CHM of the major cluster, and Jie-Geng (JG) and Mai-Men-Dong-Tang (MMDT) were important CHMs by CHM network analysis. The use of CHM as an adjunctive therapy may reduce the mortality hazard ratio of lung cancer patients. The investigation of their comprehensive CHM prescription patterns might be useful in future large-scale, randomized clinical investigations of agent effectiveness, safety, and potential interactions with conventional treatments for lung cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Randomized intubation with polyurethane or conical cuffs to prevent pneumonia in ventilated patients.

    Science.gov (United States)

    Philippart, François; Gaudry, Stéphane; Quinquis, Laurent; Lau, Nicolas; Ouanes, Islem; Touati, Samia; Nguyen, Jean Claude; Branger, Catherine; Faibis, Frédéric; Mastouri, Maha; Forceville, Xavier; Abroug, Fekri; Ricard, Jean Damien; Grabar, Sophie; Misset, Benoît

    2015-03-15

    The occurrence of ventilator-associated pneumonia (VAP) is linked to the aspiration of contaminated pharyngeal secretions around the endotracheal tube. Tubes with cuffs made of polyurethane rather than polyvinyl chloride or with a conical rather than a cylindrical shape increase tracheal sealing. To test whether using polyurethane and/or conical cuffs reduces tracheal colonization and VAP in patients with acute respiratory failure. We conducted a multicenter, prospective, open-label, randomized study in four parallel groups in four intensive care units between 2010 and 2012. A cohort of 621 patients with expected ventilation longer than 2 days was included at intubation with a cuff composed of cylindrical polyvinyl chloride (n = 148), cylindrical polyurethane (n = 143), conical polyvinyl chloride (n = 150), or conical polyurethane (n = 162). We used Kaplan-Meier estimates and log-rank tests to compare times to events. After excluding 17 patients who secondarily refused participation or had met an exclusion criterion, 604 were included in the intention-to-treat analysis. Cumulative tracheal colonization greater than 10(3) cfu/ml at Day 2 was as follows (median [interquartile range]): cylindrical polyvinyl chloride, 0.66 (0.58-0.74); cylindrical polyurethane, 0.61 (0.53-0.70); conical polyvinyl chloride, 0.67 (0.60-0.76); and conical polyurethane, 0.62 (0.55-0.70) (P = 0.55). VAP developed in 77 patients (14.4%), and postextubational stridor developed in 28 patients (6.4%) (P = 0.20 and 0.28 between groups, respectively). Among patients requiring mechanical ventilation, polyurethane and/or conically shaped cuffs were not superior to conventional cuffs in preventing tracheal colonization and VAP. Clinical trial registered with clinicaltrials.gov (NCT01114022).

  20. Correlations of differentially expressed gap junction connexins Cx26, Cx30, Cx32, Cx43 and Cx46 with breast cancer progression and prognosis.

    Directory of Open Access Journals (Sweden)

    Ivett Teleki

    Full Text Available Connexins and their cell membrane channels contribute to the control of cell proliferation and compartmental functions in breast glands and their deregulation is linked to breast carcinogenesis. Our aim was to correlate connexin expression with tumor progression and prognosis in primary breast cancers.Meta-analysis of connexin isotype expression data of 1809 and 1899 breast cancers from the Affymetrix and Illumina array platforms, respectively, was performed. Expressed connexins were also monitored at the protein level in tissue microarrays of 127 patients equally representing all tumor grades, using immunofluorescence and multilayer, multichannel digital microscopy. Prognostic correlations were plotted in Kaplan-Meier curves and tested using the log-rank test and cox-regression analysis in univariate and multivariate models.The expression of GJA1/Cx43, GJA3/Cx46 and GJB2/Cx26 and, for the first time, GJA6/Cx30 and GJB1/Cx32 was revealed both in normal human mammary glands and breast carcinomas. Within their subfamilies these connexins can form homo- and heterocellular epithelial channels. In cancer, the array datasets cross-validated each other's prognostic results. In line with the significant correlations found at mRNA level, elevated Cx43 protein levels were linked with significantly improved breast cancer outcome, offering Cx43 protein detection as an independent prognostic marker stronger than vascular invasion or necrosis. As a contrary, elevated Cx30 mRNA and protein levels were associated with a reduced disease outcome offering Cx30 protein detection as an independent prognostic marker outperforming mitotic index and necrosis. Elevated versus low Cx43 protein levels allowed the stratification of grade 2 tumors into good and poor relapse free survival subgroups, respectively. Also, elevated versus low Cx30 levels stratified grade 3 patients into poor and good overall survival subgroups, respectively.Differential expression of Cx43 and Cx

  1. Accelerated Hyperfractionated Radiotherapy for Locally Advanced Uterine Cervix Cancers

    International Nuclear Information System (INIS)

    Seo, Young Seok; Cho, Chul Koo; Yoo, Seong Yul

    2008-01-01

    To assess the efficacy of the use of accelerated hyperfractionated radiotherapy (AHRT) for locally advanced uterine cervix cancers. Between May 2000 and September 2002, 179 patients were identified with FIGO stage IIB, IIIB, and IVA cancers. Of the 179 patients, 45 patients were treated with AHRT (AHRT group) and 134 patients were treated with conventional radiotherapy (CRT group), respectively. Patients undergoing the AHRT regimen received a dose of 30 Gy in 20 fractions (1.5 Gyx2 fractions/day) to the whole pelvis. Subsequently, with a midline block, we administered a parametrial boost with a dose of 20 Gy using 2 Gy fractions. Patients also received two courses of low-dose-rate brachytherapy, up to a total dose of 85∼90 Gy to point A. In the CRT group of patients, the total dose to point A was 85∼90 Gy. The overall treatment duration was a median of 37 and 66 days for patients that received AHRT and CRT, respectively. Statistical analysis was calculated by use of the Kaplan-Meier method, the log-rank test, and Chi-squared test. For patients that received cisplatin-based concurrent chemotherapy and radiotherapy, the local control rate at 5 years was 100% and 79.2% for the AHRT and CRT group of patients, respectively (p=0.028). The 5-year survival rate for patients with a stage IIB bulky tumor was 82.6% and 62.1% for the AHRT group and CRT group, respectively (p=0.040). There was no statistically significant difference for severe late toxicity between the two groups (p=0.561). In this study, we observed that treatment with AHRT with concurrent chemotherapy allows a significant advantage of local control and survival for locally advanced uterine cervix cancers

  2. Survival Rate of Dental Implants in Patients with History of Periodontal Disease: A Retrospective Cohort Study.

    Science.gov (United States)

    Correia, Francisco; Gouveia, Sónia; Felino, António Campos; Costa, Ana Lemos; Almeida, Ricardo Faria

    To evaluate the differences between the survival rates of implants placed in patients with no history of periodontal disease (NP) and in patients with a history of chronic periodontal disease (CP). A retrospective cohort study was conducted in which all consenting patients treated with dental implants in a private clinic in Oporto, Portugal, from November 2, 2002 through February 11, 2011 were included. All patients were treated consecutively by the same experimental operator. This study aimed to analyze how the primary outcomes (presence of disease, time of placement, and time of loading) and the secondary outcomes (severity-generalized periodontitis, brand, implant length, prosthesis type, prosthesis metal-ceramic extension) influence the survival rate of dental implants. The survival analysis was performed through the Kaplan-Meier method, and the equality of survival distributions for all groups was tested with the log-rank test with a significance level of .05 for all comparisons. The sample consisted of 202 patients (47% NP and 53% CP) and 689 implants (31% NP and 69% CP). The survival rate in the NP and CP groups showed no statistically significant differences (95.8% versus 93.1%; P ≥ .05). Implants were lost before loading in 54.9% of the cases. The majority of the implants were lost in the first year and stabilized after the second year. Survival rates in the NP and CP patients showed no statistically significant differences when comparing the following factors: subclassification of the disease, implant brands, implant length (short/standard), type of prosthesis, extension of the prosthesis metal-ceramic, and time of placement and loading (P ≥ .05). This work disclosed no statistically significant differences in terms of survival rates when compared with the control group. Placing implants in patients with a history of periodontal disease appears to be viable and safe.

  3. Systemic lupus erythematosus in a multiethnic US cohort LUMINA (XLI): factors predictive of self-reported work disability.

    Science.gov (United States)

    Bertoli, A M; Fernández, M; Alarcón, G S; Vilá, L M; Reveille, J D

    2007-01-01

    To examine the risk factors for self-reported work disability in patients from the LUpus in MInorities: NAture vs. Nurture cohort with systemic lupus erythematosus (SLE). Patients with SLE of Hispanic (Texas and Puerto Rico), African American and Caucasian ethnicity were studied. Work disability was defined by patients' self-report. Only patients known to be employed at the baseline visit were included. The probabilities of self-reporting work disability over time were examined by the Kaplan-Meier method; differences between ethnic groups were examined by the log-rank test. The relationship of baseline socioeconomic-demographic, clinical, behavioural and psychological features with work disability was examined by standard statistical tests. Variables with p

  4. Regional Lymph Node Uptake of [{sup 18}F]Fluorodeoxyglucose After Definitive Chemoradiation Therapy Predicts Local-Regional Failure of Locally Advanced Non-Small Cell Lung Cancer: Results of ACRIN 6668/RTOG 0235

    Energy Technology Data Exchange (ETDEWEB)

    Markovina, Stephanie [Mallinckrodt Institute of Radiology and Alvin J. Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri (United States); Duan, Fenghai [Department of Biostatistics and Center for Statistical Sciences, Brown University School of Public Health, Providence, Rhode Island (United States); Snyder, Bradley S. [Center for Statistical Sciences, Brown University School of Public Health, Providence, Rhode Island (United States); Siegel, Barry A. [Mallinckrodt Institute of Radiology and Alvin J. Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri (United States); Machtay, Mitchell [Department of Radiation Oncology, Case Western Reserve University, Cleveland, Ohio (United States); Bradley, Jeffrey D., E-mail: jbradley@radonc.wustl.edu [Mallinckrodt Institute of Radiology and Alvin J. Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri (United States)

    2015-11-01

    Purpose: The American College of Radiology Imaging Network (ACRIN) 6668/Radiation Therapy Oncology Group (RTOG) 0235 study demonstrated that standardized uptake values (SUV) on post-treatment [{sup 18}F]fluorodeoxyglucose-positron emission tomography (FDG-PET) correlated with survival in locally advanced non-small cell lung cancer (NSCLC). This secondary analysis determined whether SUV of regional lymph nodes (RLNs) on post-treatment FDG-PET correlated with patient outcomes. Methods and Materials: Included for analysis were patients treated with concurrent chemoradiation therapy, using radiation doses ≥60 Gy, with identifiable FDG-avid RLNs (distinct from primary tumor) on pretreatment FDG-PET, and post-treatment FDG-PET data. ACRIN core laboratory SUV measurements were used. Event time was calculated from the date of post-treatment FDG-PET. Local-regional failure was defined as failure within the treated RT volume and reported by the treating institution. Statistical analyses included Wilcoxon signed rank test, Kaplan-Meier curves (log rank test), and Cox proportional hazards regression modeling. Results: Of 234 trial-eligible patients, 139 (59%) had uptake in both primary tumor and RLNs on pretreatment FDG-PET and had SUV data from post-treatment FDG-PET. Maximum SUV was greater for primary tumor than for RLNs before treatment (P<.001) but not different post-treatment (P=.320). Post-treatment SUV of RLNs was not associated with overall survival. However, elevated post-treatment SUV of RLNs, both the absolute value and the percentage of residual activity compared to the pretreatment SUV were associated with inferior local-regional control (P<.001). Conclusions: High residual metabolic activity in RLNs on post-treatment FDG-PET is associated with worse local-regional control. Based on these data, future trials evaluating a radiation therapy boost should consider inclusion of both primary tumor and FDG-avid RLNs in the boost volume to maximize local

  5. Disparities in cervical cancer survival among Asian American women

    Science.gov (United States)

    Nghiem, Van T.; Davies, Kalatu R.; Chan, Wenyaw; Mulla, Zuber D.; Cantor, Scott B.

    2015-01-01

    Purpose We compared overall survival and influencing factors between Asian American women as a whole and by subgroup with white women with cervical cancer. Methods Cervical cancer data were from the Surveillance, Epidemiology, and End Results registry; socioeconomic information was from the Area Health Resource File. We used standard tests to compare characteristics between groups; the Kaplan-Meier method with log-rank test to assess overall survival and compare it between groups; and Cox proportional hazards models to determine the effect of race and other covariates on overall survival (with/without age-stratification). Results Being 3.3 years older than white women at diagnosis (pAsian American women were more likely to be in a spousal relationship, had more progressive disease, and were better off socioeconomically. Women of Filipino, Japanese, and Korean origin had similar clinical characteristics compared with white women. Asian American women had higher 36- and 60-month survival rates (p=0.004 and p=0.013, respectively), higher overall survival rates (p=0.049), and longer overall survival durations after adjusting for age and other covariates (hazard ratio=0.77, 95% confidence interval: 0.68–0.86). Overall survival differed across age strata between the two racial groups. With the exception of women of Japanese or Korean origin, Asian American women grouped by geographic origin had better overall survival than white women. Conclusions Although Asian American women, except those of Japanese or Korean origin, had better overall survival than white women, their older age at cervical cancer diagnosis suggests that they have less access to screening programs. PMID:26552330

  6. Unrelated hematopoietic stem cell transplantation in the pediatric population: single institution experience

    Directory of Open Access Journals (Sweden)

    Daniela Hespanha Marinho

    2015-08-01

    Full Text Available OBJECTIVE: Hematopoietic stem cell transplantation has been successfully used to treat the pediatric population with malignant and non-malignant hematological diseases. This paper reports the results up to 180 days after the procedure of all unrelated hematopoietic stem cell transplantations in pediatric patients that were performed in one institution.METHODS: A retrospective review was performed of all under 18-year-old patients who received unrelated transplantations between 1995 and 2009. Data were analyzed using the log-rank test, Cox stepwise model, Kaplan-Meier method, Fine and Gray model and Fisher's exact test.RESULTS: This study included 118 patients (46.8% who received bone marrow and 134 (53.2% who received umbilical cord blood transplants. Engraftment occurred in 89.47% of the patients that received bone marrow and 65.83% of those that received umbilical cord blood (p-value < 0.001. Both neutrophil and platelet engraftments were faster in the bone marrow group. Acute graft-versus-host disease occurred in 48.6% of the patients without statistically significant differences between the two groups (p-value = 0.653. Chronic graft-versus-host disease occurred in 9.2% of the patients with a higher incidence in the bone marrow group (p-value = 0.007. Relapse occurred in 24% of the 96 patients with malignant disease with 2-year cumulative incidences of 45% in the bone marrow group and 25% in the umbilical cord blood group (p-value = 0.117. Five-year overall survival was 47%, with an average survival time of 1207 days, and no significant differences between the groups (p-value = 0.4666.CONCLUSION: Despite delayed engraftment in the umbilical cord blood group, graft-versus-host disease, relapse and survival were similar in both groups.

  7. Positron Emission Tomography (PET) Evaluation After Initial Chemotherapy and Radiation Therapy Predicts Local Control in Rhabdomyosarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Dharmarajan, Kavita V., E-mail: dharmark@mskcc.org [Departments of Radiation Oncology, Pediatric Oncology, and Nuclear Medicine, Memorial Sloan-Kettering, New York, New York (United States); Wexler, Leonard H.; Gavane, Somali; Fox, Josef J.; Schoder, Heiko; Tom, Ashlyn K.; Price, Alison N.; Meyers, Paul A.; Wolden, Suzanne L. [Departments of Radiation Oncology, Pediatric Oncology, and Nuclear Medicine, Memorial Sloan-Kettering, New York, New York (United States)

    2012-11-15

    Purpose: 18-fluorodeoxyglucose positron emission tomography (PET) is already an integral part of staging in rhabdomyosarcoma. We investigated whether primary-site treatment response characterized by serial PET imaging at specific time points can be correlated with local control. Patients and Methods: We retrospectively examined 94 patients with rhabdomyosarcoma who received initial chemotherapy 15 weeks (median) before radiotherapy and underwent baseline, preradiation, and postradiation PET. Baseline PET standardized uptake values (SUVmax) and the presence or absence of abnormal uptake (termed PET-positive or PET-negative) both before and after radiation were examined for the primary site. Local relapse-free survival (LRFS) was calculated according to baseline SUVmax, PET-positive status, and PET-negative status by the Kaplan-Meier method, and comparisons were tested with the log-rank test. Results: The median patient age was 11 years. With 3-year median follow-up, LRFS was improved among postradiation PET-negative vs PET-positive patients: 94% vs 75%, P=.02. By contrast, on baseline PET, LRFS was not significantly different for primary-site SUVmax {<=}7 vs >7 (median), although the findings suggested a trend toward improved LRFS: 96% for SUVmax {<=}7 vs 79% for SUVmax >7, P=.08. Preradiation PET also suggested a statistically insignificant trend toward improved LRFS for PET-negative (97%) vs PET-positive (81%) patients (P=.06). Conclusion: Negative postradiation PET predicted improved LRFS. Notably, 77% of patients with persistent postradiation uptake did not experience local failure, suggesting that these patients could be closely followed up rather than immediately referred for intervention. Negative baseline and preradiation PET findings suggested statistically insignificant trends toward improved LRFS. Additional study may further understanding of relationships between PET findings at these time points and outcome in rhabdomyosarcoma.

  8. The correlations between alteration of p16 gene and clinicopathological factors and prognosis in squamous cell carcinomas of the buccal mucosa.

    Science.gov (United States)

    Dong, Yuying; Wang, Jie; Dong, Fusheng; Wang, Xu; Zhang, Yinghuai

    2012-07-01

    To evaluate relationships between the alteration of p16 gene and the clinical status and prognosis of the patients with squamous cell carcinoma of the buccal mucosa. Thirty buccal cancers were included in the analysis. Deletion analysis was performed by PCR. Point mutation analysis was used by PCR-SSCP and direct sequencing. Methylation-specific PCR methods were adopted for the evaluation of p16 methylation. The correlation between alteration of p16 gene and clinicopathological factors buccal cancer was evaluated by Fisher's exact test. Kaplan-Meier and Cox regression were used to investigate the relationship between p16 alteration and survival time. The frequency of p16 alteration was 63.3% in buccal carcinomas. P16 deletion was associated significantly with tumor size (P = 0.01). P16 point mutation was associated significantly with differentiation (P = 0.006). P16 methylation was associated significantly with nodes metastasis (P = 0.027). The overall survival rate of 30 buccal carcinomas was 53.3%. The Log-rank test (P = 0.021) and univariate Cox regression analysis (P = 0.030) revealed that p16 methylation was significantly associated with the overall survival rate. Multivariate analysis showed that p16 deletion, p16 mutation, and p16 methylation were not statistically significant. The alterations of p16 gene may play a major role in malignancy and development and metastases of buccal carcinoma and may be an excellent marker of aggressive clinical behavior. P16 methylation has a prognostic value in buccal carcinoma but not an independent prognosis factor. P16 point mutation and p16 deletion have not prognostic significance in buccal carcinoma. © 2012 John Wiley & Sons A/S.

  9. THE WAY OF ASSESSING THE ADHERENCE TO MODERN DRUG THERAPY CLINICAL GUIDELINES AIMED AT REDUCING THE RISK OF RECURRENT STROKE (ACCORDING TO THE LIS-2 REGISTER

    Directory of Open Access Journals (Sweden)

    A. Yu. Suvorov

    2015-09-01

    Full Text Available Aim. To develop a method for the assessment of quality of medical prevention of recurrent stroke and its’ testing using the results of the LIS-2 register (Lyubertsy study of mortality in patients after stroke.Material and methods. The scale evaluation of the quality of therapy for the prevention of recurrent stroke developed in accordance with the modern clinical practice guidelines, as well as the recurrent stroke prevention index (RSPI for this assessment were elaborated. The analysis of the therapy was performed in patients after stroke in LIS-2 registers (n=219. The assessment of the quality of treatment was performed using RSPI, the influence of the index results on the in-hospital mortality was studied.Results. Two groups of patients [with RSPI=0 (n=137 and RSPI>0 (n=82] were formed on the basis of the results evaluation via RSPI. Significant differences between groups were not found. At the same time higher in-hospital mortality (p=0.014; χ2 Pearson was detected in patients with RSPI=0; relative risk of in-hospital death (after adjustment for sex and age was 2.04 [1.07-3.91] (p=0.031. Analysis of the length of survival and duration of hospital stay was performed in both groups using the Kaplan-Meier method. In-hospital mortality was significantly higher in patients with RSPI=0, which was confirmed by the log-rank test (p=0.032.Conclusion. The results of the quality of medical care assessment in accordance with the developed method are significantly related to the outcomes during the stay in a hospital. The developed method, based on current clinical recommendations, can serve as an example of the implementation of evidence-based medicine in actual practice.

  10. Postoperative radiotherapy in salivary ductal carcinoma: a single institution experience

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Tae Hyung; Kim, Mi Sun; Choi, Seo Hee; Suh, Yang Gun; Koh, Yoon Woo; Kim, Se Hun; Choi, Eun Chang; Keum, Ki Chang [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    2014-09-15

    We reviewed treatment outcomes and prognostic factors for patients with salivary ductal carcinoma (SDC) treated with surgery and postoperative radiotherapy from 2005 to 2012. A total of 16 patients were identified and 15 eligible patients were included in analysis. Median age was 61 years (range, 40 to 71 years) and 12 patients (80%) were men. Twelve patients (80%) had a tumor in the parotid gland, 9 (60%) had T3 or T4 disease, and 9 (60%) had positive nodal disease. All patients underwent surgery and postoperative radiotherapy. Postoperative radiotherapy was delivered using 3-dimensional conformal radiotherapy or intensity-modulated radiotherapy. Locoregional failure-free survival (LRFFS), distant failure-free survival (DFFS), progression-free survival (PFS), and overall survival (OS) were calculated using the Kaplan-Meier method. Differences in survival based on risk factors were tested using a log-rank test. Median total radiotherapy dose was 60 Gy (range, 52.5 to 63.6 Gy). Four patients received concurrent weekly chemotherapy with cisplatin. Among 10 patients who underwent surgery with neck dissection, 7 received modified radical neck dissection. With a median follow-up time of 38 months (range, 24 to 105 months), 4-year rates were 86% for LRFFS, 51% for DFFS, 46% for PFS, and 93% for OS. Local failure was observed in 2 patients (13%), and distant failure was observed in 7 (47%). The lung was the most common involved site of distant metastasis. Surgery and postoperative radiotherapy in SDC patients resulted in good local control, but high distant metastasis remained a major challenge.

  11. The tumour suppressor SOX11 is associated with improved survival among high grade epithelial ovarian cancers and is regulated by reversible promoter methylation

    LENUS (Irish Health Repository)

    Sernbo, Sandra

    2011-09-24

    Abstract Background The neural transcription factor SOX11 has been described as a prognostic marker in epithelial ovarian cancers (EOC), however its role in individual histological subtypes and tumour grade requires further clarification. Furthermore, methylation-dependent silencing of SOX11 has been reported for B cell lymphomas and indicates that epigenetic drugs may be used to re-express this tumour suppressor, but information on SOX11 promoter methylation in EOC is still lacking. Methods SOX11 expression and clinicopathological data was compared using χ2 test in a cohort of 154 cases of primary invasive EOC. Kaplan-Meier analysis and the log rank test were applied to evaluate ovarian cancer-specific survival (OCSS) and overall survival (OS) in strata, according to SOX11 expression. Also, the methylation status of the SOX11 promoter was determined by sodium bisulfite sequencing and methylation specific PCR (MSP). Furthermore, the effect of ectopic overexpression of SOX11 on proliferation was studied through [3H]-thymidine incorporation. Results SOX11 expression was associated with an improved survival of patients with high grade EOC, although not independent of stage. Further analyses of EOC cell lines showed that SOX11 mRNA and protein were expressed in two of five cell lines, correlating with promoter methylation status. Demethylation was successfully performed using 5\\'-Aza-2\\'deoxycytidine (5-Aza-dC) resulting in SOX11 mRNA and protein expression in a previously negative EOC cell line. Furthermore, overexpression of SOX11 in EOC cell lines confirmed the growth regulatory role of SOX11. Conclusions SOX11 is a functionally associated protein in EOC with prognostic value for high-grade tumours. Re-expression of SOX11 in EOC indicates a potential use of epigenetic drugs to affect cellular growth in SOX11-negative tumours.

  12. Basaloid squamous cell carcinoma of the esophagus.

    Science.gov (United States)

    Chen, Shao-Bin; Weng, Hong-Rui; Wang, Geng; Yang, Jie-Sheng; Yang, Wei-Ping; Li, Hua; Liu, Di-Tian; Chen, Yu-Ping

    2012-07-01

    Basaloid squamous cell carcinoma (BSCC) of the esophagus is a rare carcinoma with distinct characteristics. No standard treatment has been established. This retrospective study was designed to investigate the clinical and pathological characteristics, diagnosis, treatment, and prognosis of esophageal BSCC. Clinical data were retrospectively analyzed from 26 patients with pathologically confirmed esophageal BSCC who underwent transthoracic esophagectomy with lymphadenectomy between January 1995 and June 2010 at the Cancer Hospital of Shantou University Medical College. Clinicopathologic data between BSCC patients and different histologic grades of esophageal squamous cell carcinoma (ESCC) patients were statistically compared by means of the χ(2) test or Fisher's exact test. The Kaplan-Meier and log-rank methods were used to estimate and compare survival rates. Microscopically, BSCC was characterized by a nesting, lobular, or trabecular arrangement of small crowded cells with scant cytoplasm. None of the histologic specimens taken at preoperative esophagoscopy were diagnosed as BSCC. The median survival time (MST) of the 26 patients was 29.0 months (95% confidence interval, 9.0-49.0), and the 1-, 3-, and 5-year overall survival rates were 73.1, 42.7, and 36.6%, respectively. The MST for BSCC patients was significantly lower than that of well-differentiated SCC patients (P = 0.024), but there were no significant differences between the MST for BSCC patients and that of moderately or poorly differentiated SCC patients (P > 0.05). BSCC of the esophagus is a rare but distinctive disease and is prone to be misdiagnosed by endoscopic biopsy. The prognosis is poorer than well-differentiated SCC, but similar to moderately or poorly differentiated SCC.

  13. Identification of human papillomavirus (HPV) subtype in oral cancer patients through microarray technology.

    Science.gov (United States)

    Kim, Soung Min; Kwon, Ik Jae; Myoung, Hoon; Lee, Jong Ho; Lee, Suk Keun

    2018-02-01

    Human papilloma virus (HPV) is the main source of cervical cancer. Many recent studies have revealed the prevalence and prognosis of HPV associated with oropharyngeal squamous cell carcinoma, but fewer reports have evaluated HPV in oral squamous cell carcinoma (OSCC). The purpose of this study was to determine the prevalence and prognosis of HPV associated with OSCC according to HPV and tumor types. We used a DNA chip kit (MY-HPV chip kit ® , Mygene Co., Korea) to detect high-risk HPV subtypes (16, 18, 31, 33, 35, 39, 45, 51, 52, 54, 56, 58) and low-risk subtypes (6, 11, 34, 40, 42, 43, 44) among 187 patients. The prevalence was determined by Chi-square and Fisher's exact tests, and the prognosis was calculated by the Kaplan-Meier method and the log-rank test. The overall prevalence of HPV in OSCC was 7.0% for all HPV positives and 4.3% for high-risk HPV positives. The prevalence of HPV was significantly higher in individuals under 65 years old and in those with tumors in the tongue and gum regions. The prognosis did not differ between the HPV-positive and -negative groups. Although the prevalence of HPV-positive cases in OSCC was low (7.0, 4.3%) and the prognosis did not depend on HPV positivity, HPV-associated OSCC should be considered in the evaluation and treatment of oral cancer patients. In addition, separating high- and low-risk groups based on the HPV status of other body parts might not be appropriate. The DNA microarray method can accurately detect known HPV subtypes simultaneously, but has limitations in detecting new subtypes. Vaccines can also be used to prevent HPV-associated OSCC in patients, so further studies on the prognosis and efficacy of vaccines should be undertaken.

  14. Development of a whole-organism model to screen new compounds for sun protection.

    Science.gov (United States)

    Wang, Yun-Hsin; Wen, Chi-Chung; Yang, Zhi-Shiang; Cheng, Chien-Chung; Tsai, Jen-Ning; Ku, Chia-Chen; Wu, Hsin-Ju; Chen, Yau-Hung

    2009-01-01

    We used zebrafish as a whole-organism model to screen new compounds for sun protection activity. First of all, we designed a series of UVB exposure experiments and recorded the phenotypic changes of zebrafish embryos. Results showed that 100 mJ/cm(2) of UVB given six times separated by 30 min intervals is the best condition. Fin malformation (reduced and/or absent fin) phenotypes are the most evident consequences after exposure to UVB. Each fin was affected by UVB, including pelvic, ventral, caudal, and dorsal fin, but pelvic fin seemed to be the most sensitive target after UVB exposure. We furthermore carried out "prevention" and "treatment" experiments using green tea extract and/or (-)-epigallocatechin (EGCG) to test this whole-organism model by observing the morphological changes of all fins (especially pelvic fin) after UVB exposure. Effects of UVB, green tea extract and EGCG on fin development were assessed using the Kaplan-Meier analysis, log-rank test and Cox proportional hazards regression. Results showed that a zebrafish pelvic fin in the UVB + green tea (treatment) group is 5.51 (range from 2.39 to 14.90) times, one in the UVB + green tea (prevention) group is 7.04 (range from 3.11 to 18.92) times, and one in the 25 ppm of EGCG (prevention) group is 22.19 (range from 9.40 to 61.50) times more likely to return to normal fin than one in the UVB only group. On the basis of these observations, we believe this model is effective for screening the higher stability and lower toxicity of new compounds, such as small chemicals which are derivative from EGCG or other dietary agents for sun protection.

  15. [Renal transplantation program at the Centenario Hospital Miguel Hidalgo in Aguascalientes, Mexico].

    Science.gov (United States)

    Reyes-Acevedo, Rafael; Romo-Franco, Luis; Delgadillo-Castañeda, Rodolfo; Orozco-Lozano, Iraida; Melchor-Romo, Miriam; Gil-Guzmán, Enrique; Lupercio-Luévano, Salvador; Cervantes, Sandra; Dávila, Imelda; Chew-Wong, Alfredo

    2011-09-01

    Miguel Hidalgo Hospital in Aguascalientes is dependent from the Federal Secretary of Health and operates in integrity with State health system in Aguascalientes. It capacity is based on 132 censored beds and 71 no censored beds. Is considered a specialty hospital in the region of Bajío. Renal transplant program activity was initiated in 1990 and gives care for adult and pediatric population. Retrospective, comparative and longitudinal study to describe and analyze our experience. Data base and clinical charts of renal transplant recipients were reviewed. Age, gender, date of transplant, etiology of renal disease, type of donor, HLA compatibility and PRA, immunosuppressive therapy, acute rejection, serum creatinina, graft loss and mortality were registered. Statistical analysis included 2, unpaired Student T test and Kaplan-Meier survival analysis with Log Rank test. Cox Analysis was also done. 1050 renal transplants were done from November 1990 to June 2011. 50 were excluded because follow-up was not longer than 3 months. 1000 consecutive renal transplant patients from January 1995 to June 2011 were included for analysis. Patients were divided in 2 groups: group A transplanted January 1995 to December 2004; group B transplanted January 2005 to June 2011. Etiology for end stage renal disease is unknown in 61% of cases, 11% developed renal disease to diabetes mellitus. 93% patient survival was observed at median follow-up and 84.9% graft survival at median follow-up (6 years). Biopsy proven acute rejection in group A 19.9 vs. 10% in group B. Two haplotype matching shows 92% graft survival. Diabetic patients exhibit 73% graft survival vs. other as hypertension (87%). PRA >0 and serum creatinine > 2.0 mg/dL increase risk for graft loss according to Cox analysis. CONCLUSION. Results are comparable to international data. Importance of developing regional transplant centers is emphasized.

  16. The influence of polymorbidity, revascularization, and wound therapy on the healing of arterial ulceration

    Directory of Open Access Journals (Sweden)

    Joerg Tautenhahn

    2008-06-01

    Full Text Available Joerg Tautenhahn1, Ralf Lobmann2, Brigitte Koenig3, Zuhir Halloul1, Hans Lippert1, Thomas Buerger11Department of General, Visceral and Vascular Surgery; 2Department of Endocrinology and Metabolism; 3Institute for Medical Microbiology, Medical School, Otto-von-Guericke University, Magdeburg, GermanyObjective: An ulcer categorized as Fontaine’s stage IV represents a chronic wound, risk factor of arteriosclerosis, and co-morbidities which disturb wound healing. Our objective was to analyze wound healing and to assess potential factors affecting the healing process.Methods: 199 patients were included in this 5-year study. The significance levels were determined by chi-squared and log-rank tests. The calculation of patency rate followed the Kaplan-Meier method.Results: Mean age and co-morbidities did not differ from those in current epidemiological studies. Of the patients with ulcer latency of more than 13 weeks (up to one year, 40% required vascular surgery. Vascular surgery was not possible for 53 patients and they were treated conservatively. The amputation rate in the conservatively treated group was 37%, whereas in the revascularizated group it was only 16%. Ulcers in patients with revascularization healed in 92% of cases after 24 weeks. In contrast, we found a healing rate of only 40% in the conservatively treated group (p < 0.001. Revascularization appeared more often in diabetic patients (n = 110; p < 0.01 and the wound size and number of infections were elevated (p = 0.03. Among those treated conservatively, wound healing was decelerated (p = 0.01/0.02; χ² test.Conclusions: The success of revascularization, presence of diabetes mellitus, and wound treatment proved to be prognostic factors for wound healing in arterial ulcers.Keywords: arterial leg ulcer, wound management, risk factors, revascularization

  17. Evaluation of the efficacy and toxicity of protocol cisplatin, 5-fluorouracil, leucovorin compared to protocol fluorouracil, doxorubicin and mitomycin C in locally advanced and metastatic gastric cancer

    Directory of Open Access Journals (Sweden)

    Andrić Zoran

    2012-01-01

    Full Text Available Introduction. Still there is no consensus on the choice of the most efficient and the least toxic chemotherapy regimen in the treatment of advanced gastric cancer. Nowadays few therapy protocols are available for treating this disease. Objective. Study was conducted to compare the efficacy and toxicity of FAM (flurouracil, doxorubicin, mitomycin C with CDDP and FU/FA (cisplatin, 5-fluorouracil, leucovorin protocols in patients with locally advanced and metastatic gastric cancer. Methods. This randomized study involved a group of 50 patients with locally advanced or metastatic gastric cancer, who had not previously undergone chemotherapy treatment. Progression free survival, overall survival and drug toxicity were evaluated. For statistical analysis chi-square test, Kaplan-Meier curve and the log rank test were used. Results. The overall response rate was 20% in the group treated with FAM and 24% in the group treated with CDDP, FU/FA (4% of patients from each group had complete response, but without significant statistical difference. Median survival was 10.9 months in the FAM group and 11.8 months in CDDP, FU/FA group, with no statistically significant difference. Non-haematological and haematological toxicities of CDDP, FU/FA were considerably less frequent than of FAM, and there was no treatment related deaths in any of the groups. Conclusion. Both investigated regimens demonstrated moderate efficacy. The study shows in favour of justified application of both protocols, while in regard to toxicity CDDP and FU/FA can be recommended as preferable treatment for locally advanced and metastatic gastric cancer. New strategies should be considered for better efficacy in the treatment of advanced gastric cancer. New strategies are necessary with the goal to achieve a better therapeutic effect.

  18. Preoperative Chemotherapy Versus Preoperative Chemoradiotherapy for Stage III (N2) Non-Small-Cell Lung Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Higgins, Kristin [Department of Radiation Oncology, Duke University of Medical Center, Durham, NC (United States); Chino, Junzo P [Department of Radiation Oncology, Duke University of Medical Center, Durham, NC (United States); Marks, Lawrence B [Department of Radiation Oncology, University of North Carolina, Chapel Hill, NC (United States); Ready, Neal [Department of Medicine, Division of Medical Oncology, Duke University of Medical Center, Durham, NC (United States); D' Amico, Thomas A [Department of Surgery, Division of Cardiovascular and Thoracic Surgery, Duke University of Medical Center, Durham, NC (United States); Clough, Robert W; Kelsey, Chris R [Department of Radiation Oncology, Duke University of Medical Center, Durham, NC (United States)

    2009-12-01

    Purpose: To compare preoperative chemotherapy (ChT) and preoperative chemoradiotherapy (ChT-RT) in operable Stage III non-small-cell lung cancer. Methods and Materials: This retrospective study analyzed all patients with pathologically confirmed Stage III (N2) non-small-cell lung cancer who initiated preoperative ChT or ChT-RT at Duke University between 1995 and 2006. Mediastinal pathologic complete response (pCR) rates were compared using a chi-square test. The actuarial overall survival, disease-free survival, and local control were estimated using the Kaplan-Meier method and compared using the log-rank test. Multivariate Cox regression analysis was also performed. Results: A total of 101 patients who initiated preoperative therapy with planned resection were identified. The median follow-up was 20 months for all patients and 38 months for survivors. The mediastinal lymph nodes were reassessed after preoperative therapy in 88 patients (87%). Within this group, a mediastinal pCR was achieved in 35% after preoperative ChT vs. 65% after preoperative ChT-RT (p = 0.01). Resection was performed in 69% after ChT and 84% after ChT-RT (p = 0.1). For all patients, the overall survival, disease-free survival, and local control rate at 3 years was 40%, 27%, and 66%, respectively. No statistically significant differences were found in the clinical endpoints between the ChT and ChT-RT subgroups. On multivariate analysis, a mediastinal pCR was associated with improved disease-free survival (p = 0.03) and local control (p = 0.03), but not overall survival (p = 0.86). Conclusion: Preoperative ChT-RT was associated with higher mediastinal pCR rates but not improved survival.

  19. Preoperative Chemotherapy Versus Preoperative Chemoradiotherapy for Stage III (N2) Non-Small-Cell Lung Cancer

    International Nuclear Information System (INIS)

    Higgins, Kristin; Chino, Junzo P.; Marks, Lawrence B.; Ready, Neal; D'Amico, Thomas A.; Clough, Robert W.; Kelsey, Chris R.

    2009-01-01

    Purpose: To compare preoperative chemotherapy (ChT) and preoperative chemoradiotherapy (ChT-RT) in operable Stage III non-small-cell lung cancer. Methods and Materials: This retrospective study analyzed all patients with pathologically confirmed Stage III (N2) non-small-cell lung cancer who initiated preoperative ChT or ChT-RT at Duke University between 1995 and 2006. Mediastinal pathologic complete response (pCR) rates were compared using a chi-square test. The actuarial overall survival, disease-free survival, and local control were estimated using the Kaplan-Meier method and compared using the log-rank test. Multivariate Cox regression analysis was also performed. Results: A total of 101 patients who initiated preoperative therapy with planned resection were identified. The median follow-up was 20 months for all patients and 38 months for survivors. The mediastinal lymph nodes were reassessed after preoperative therapy in 88 patients (87%). Within this group, a mediastinal pCR was achieved in 35% after preoperative ChT vs. 65% after preoperative ChT-RT (p = 0.01). Resection was performed in 69% after ChT and 84% after ChT-RT (p = 0.1). For all patients, the overall survival, disease-free survival, and local control rate at 3 years was 40%, 27%, and 66%, respectively. No statistically significant differences were found in the clinical endpoints between the ChT and ChT-RT subgroups. On multivariate analysis, a mediastinal pCR was associated with improved disease-free survival (p = 0.03) and local control (p = 0.03), but not overall survival (p = 0.86). Conclusion: Preoperative ChT-RT was associated with higher mediastinal pCR rates but not improved survival.

  20. Avaliação da continuidade de uso do preservativo feminino em usuárias do Sistema Único de Saúde em unidades da região metropolitana de São Paulo, Brasil Evaluation of continuity of use of female condoms among users of the Brazilian National Health System (SUS: longitudinal analysis in units in the metropolitan region of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Suzana Kalckmann

    2009-06-01

    Full Text Available O perfil da epidemia da Aids vem exigindo alternativas que, além de prevenir a entrada do HIV, facilitem a negociação de uso com o parceiro e possibilitem dupla proteção - contra as infecções transmitidas sexualmente, inclusive a Aids, e contra a gravidez não desejada - como o preservativo feminino. O objetivo do presente estudo foi verificar se a alta aceitabilidade inicial do preservativo feminino, descrita em outros estudos, é mantida na rotina de atendimento às diferentes populações vulneráveis. Foram monitorados durante 12 meses 16 serviços do Sistema Único de Saúde da Grande São Paulo (7 serviços especializados em atendimento às doenças sexualmente transmissíveis, 6 unidades básicas de saúde e 3 projetos comunitários. Foram incluídas no estudo 2.469 mulheres, das quais 713 em serviços de atenção especializada às DST/Aids, 1.417 em unidades básicas e 339 em projetos comunitários. A análise da continuidade de uso foi realizada por tábua de sobrevida Kaplan-Meier, teste log-rank e modelo de regressão de Cox, com intervalo de confiança de 95% (IC=95%. Observou-se que, ao final do seguimento, estavam em uso contínuo do preservativo feminino 14,4% das mulheres (355. O tempo médio de uso foi de 3,55 meses (IC 95%: 3,37- 3,73. Os resultados evidenciaram que o tipo de serviço de dispensação do insumo e a frequência mensal de relações sexuais interferiram na continuidade de uso de forma estatisticamente significante. O número de mulheres que iniciaram o uso do preservativo feminino nos diferentes tipos de serviços mostrou que há uma demanda para alternativas de prevenção, e que é fundamental a criação de espaços onde elas possam ter acesso adequado a orientações e aos insumos.The new profile of the AIDS epidemic necessarily includes the implementation of alternatives which go beyond HIV prevention, meaning sexual partner negotiation and double protection: against STD (including AIDS and unplanned

  1. Surgical Consideration for Adolescents and Young Adults With Cervical Chordoma.

    Science.gov (United States)

    Zhong, Nanzhe; Yang, Xinghai; Yang, Jian; Meng, Tong; Yang, Cheng; Yan, Wangjun; Xiao, Jianru

    2017-05-15

    Retrospective study. The aim of this study was to compare the clinical outcomes between adolescent and young adult (AYA) patients and old adult patients with cervical chordoma who were treated surgically and present the surgical consideration for adolescents and young adults with cervical chordoma. With predominance in senior patients, chordoma is distinctively rare in AYAs. Because of the rarity of AYA chordoma, individual case report represents most of the literature on this disease entity on mobile spine and lack of long-term follow up, which leads to the paucity of clinical evidence for treatment planning and prognosis prediction. A retrospective study was conducted to investigate the prognosis of AYA patients with cervical chordoma who were treated surgically. We collected the clinical data of these patients and their older counterparts, and further compared the prognosis of the patients in different age groups. To estimate survival curves, Kaplan-Meier method was used, and significance was assessed using a log-rank test. Forty consecutive patients with chordoma of the cervical spine treated in our institution were included in the study. Two groups were identified according to age. Group 1 comprised children and adolescents (age ≤ 25 yrs; n = 9) and Group 2 comprised adults (age > 25 years; n = 31). In comparison, Group 1 was featured by significantly higher rate of recurrence and shorter overall survival, although no difference found in the surgical modality between two groups. There is a dismal prognosis in young patients with chordoma, and thus support the notion that as radical a total en bloc spondylectomy (TES) of the lesions as possible may benefit the overall survival of these young patients. Although the ensuing neurological deficits may be devastating, it will be worth sacrificing if the life expectancy of these young patients is prolonged. 4.

  2. ERBB-2 overexpression as a risk factor for malignant phaeochromocytomas and paraganglinomas.

    Science.gov (United States)

    Wang, Weiqing; Zhong, Xu; Ye, Lei; Qi, Yan; Su, TingWei; Wei, Qing; Xie, Jing; Jiang, Lei; Jiang, Yiran; Zhou, Weiwei; Cui, Bin; Ning, Guang

    2016-06-01

    There are currently no good histological or molecular markers to differentiate benign from malignant phaeochromocytomas and paraganglinomas (PPGLs). Our previous cross-sectional study observed that ERBB-2 overexpression was associated with malignant PPGLs. This study aimed to evaluate the predictive value of ERBB-2 overexpression for metastasis in PPGLs in a large population. A total of 262 patients diagnosed as PPGLs in our institution between 2002 and 2012 were included. We analysed ERBB-2 protein expression in the primary PPGL tumours by immunohistochemistry (IHC) and ERBB-2 amplification by fluorescence in situ hybridization (FISH). Direct Sanger sequencing was performed to examine ERBB-2 exon 20 mutations. The occurrence of malignant PPGLs was documented in the follow-up period. Kaplan-Meier analysis and Cox proportional hazard models were used to evaluate the association between ERBB-2 overexpression and metastasis of PPGLs. Twenty-six (9·9%) patients had ERBB-2 overexpression in their primary PPGL tumours, which was significantly associated with ERBB-2 amplification (17/25, 68%). No ERBB-2 mutation was found. At a median follow-up of 4·5 years, a total of 23 malignant PPGLs were documented, including eight (30·8%) patients in the ERBB-2 overexpression group and 15 (6·4%) patients in the ERBB-2-negative group. The incidence rate of metastasis was 5·3 per 100 person-years vs 1·4 per 100 person-years in the ERBB-2 overexpression and ERBB-2-negative groups (P overexpression was associated with decreased metastasis-free survival (P = 0·001, log-rank test). After adjusting for primary tumour size and location, Cox regression analysis revealed that ERBB-2 overexpression was independently associated with risk of malignant PPGLs (HR = 2·78; 95% CI, 1·12-6·90; P = 0·028). Patients harbouring tumours with ERBB-2 overexpression have a significantly higher risk of developing malignant PPGLs. © 2016 John Wiley & Sons Ltd.

  3. HIF1-alpha overexpression indicates a good prognosis in early stage squamous cell carcinomas of the oral floor

    International Nuclear Information System (INIS)

    Fillies, Thomas; Werkmeister, Richard; Diest, Paul J van; Brandt, Burkhard; Joos, Ulrich; Buerger, Horst

    2005-01-01

    Hypoxia-inducible factor 1 (HIF-1) is a transcription factor, which plays a central role in biologic processes under hypoxic conditions, especially concerning tumour angiogenesis. HIF-1α is the relevant, oxygen-dependent subunit and its overexpression has been associated with a poor prognosis in a variety of malignant tumours. Therefore, HIF-1α expression in early stage oral carcinomas was evaluated in relation to established clinico-pathological features in order to determine its value as a prognostic marker. 85 patients with histologically proven surgically treated T1/2 squamous cell carcinoma (SCC) of the oral floor were eligible for the study. Tumor specimens were investigated by means of tissue micro arrays (TMAs) and immunohistochemistry for the expression of HIF-1. Correlations between clinical features and the expression of HIF-1 were evaluated by Kaplan-Meier curves, log-rank tests and multivariate Cox regression analysis. HIF-1α was frequently overexpressed in a probably non-hypoxia related fashion. The expression of HIF-1α was related with a significantly improved 5-year survival rate (p < 0.01) and a significantly increased disease free period (p = 0.01) independent from nodal status and tumour size. In primary node negative T1/T2 SCC of the oral floor, absence of HIF-1α expression specified a subgroup of high-risk patients (p < 0.05). HIF-1α overexpression is an indicator of favourable prognosis in T1 and T2 SCC of the oral floor. Node negative patients lacking HIF-1α expression may therefore be considered for adjuvant radiotherapy

  4. Oligometastatic state predicts a favorable outcome for renal cell carcinoma patients with bone metastasis under the treatment of sunitinib.

    Science.gov (United States)

    Lu, Xiaolin; Gu, Weijie; Zhang, Hailiang; Zhu, Yao; Shi, Guohai; Ye, Dingwei

    2016-05-03

    The aim of the study was to investigate whether RCC patients with oligometastatic state of bone metastasis treated with sunitinib had a favorable clinical outcome. 22 patients were classified into oligometastatic state of bone metastasis with a median OS of 30.1 months (95%CI: 26.3 to 33.8 months). The 45 patients with non-oligometastatic state had a median OS of 12.7 months (95%CI: 9.43 to 16.0 months). Kaplan-Meier analysis showed significant difference between them (Log Rank test p<0.001). When we set patients with only multiple bone (at least 5 sites) metastases as a single group, there was still significant difference between oligometastatic state group and non-oligometastatic state groups. In multivariate Cox proportion hazard ratio analysis, metastatic states (p=0.012), MSKCC score (p=0.002), ECOG (p=0.001) and lymph nodes metastasis (p=0.000) were significantly associated with prognosis. The integration of metastatic state into the MSKCC risk model improved the c-index from 0.651 to 0.752. 67 patients from Fudan University Shanghai Cancer Center with bone metastatic RCC were divided into 2 metastatic states. One included those with oligometastatic state of bone metastasis with less than 5 sites of bone metastasis. The other involved those patients with multiple bone metastases (at least 5 sites) or together with other sites of metastasis. Then patients with only multiple bone (at least 5 sites) metastases were set into a single group. RCC patients with oligometastatic state of bone metastasis treated with sunitinib had a favorable clinical outcome.

  5. [Analysis of the therapeutic effects of different treatment modalities on the outcomes of 87 patients with lung oligometastasis from nasopharyngeal carcinoma after radiotherapy].

    Science.gov (United States)

    Tang, Q; Hu, Q Y; Piao, Y F; Hua, Y H; Chen, X Z

    2016-03-23

    The aim of the present study was to evaluate the efficacy of three different modalities in treatment of lung oligometastases from nasopharyngeal carcinoma (NPC) after radiotherapy and to identify a more appropriate treatment modality. The clinical data of 87 cases of lung oligometastases from NPC were analyzed retrospectively. Among them, 33 patients underwent local small-field irradiation+ /- chemotherapy, 28 underwent whole-lung irradiation+ chemotherapy, and 26 underwent simple chemotherapy. The survival rates were calculated using Kaplan-Meier analysis. The differences among the modalities were evaluated using the log-rank test. Cox univariate and multivariate analyses were performed to determine the influencing factors. The 3-year lung metastasis survival (LMS) rates of patients with lung metastasis undergoing the three treatment modalities (local small-field irradiation+ /-chemotherapy, whole-lung irradiation+ chemotherapy and chemotherapy alone) were 89.3%, 72.7%, and 72.4%, respectively, showing a significant difference between the groups (P=0.003). Further subgroup analysis showed that the 5-year LMS rate was significantly higher in the local small-field irradiation+ /-chemotherapy group than that in the whole-lung irradiation+ chemotherapy group and chemotherapy alone group (P=0.001). The 2-year progression-free survival (PFS) rates of the three groups were 57.1%, 25.8% and 3.8%, respectively, showing significant intergroup differences (P=0.002 and P<0.001). Multivariate analysis indicated that compared with the whole lung irradiation group and the chemotherapy alone group, the local irradiation+ /- chemotherapy is an independent favorable prognostic factor for LMS and PFS (P<0.05). Local radiotherapy combined with systemic chemotherapy is the best therapeutic modality for lung oligometastases derived from NPC after radiotherapy, improving the LMS and prolonging the PFS.

  6. Elevated Serum Neopterin is Associated with Increased Risk of Cardiovascular Events in Acute Coronary Syndromes

    Directory of Open Access Journals (Sweden)

    Anwar Santoso

    2009-04-01

    Full Text Available BACKGROUND: Neopterin is a soluble biomarker of monocyte activation and its increased concentration might be expressed in atherosclerosis. Until recently, there has been lacking of information on the prognostic role of neopterin in acute coronary syndromes (ACS. The study was aimed at measuring the associations between elevated serum neopterin and increased risk of cardiovascular (CV events in ACS. METHODS: This was a prospective cohort study, recruited 71 ACS patients from January 31 through August 31, 2007 in Sanglah Hospital of Udayana School of Medicine, Denpasar, Bali. Cardiovascular events, such as: CV death, recurrent myocardial infarction, stroke and recurrent myocardial ischemia were previously defined. Relative risk and survival rate were measured successively by Cox proportional model and Kaplan-Meier curve. RESULTS: Of 71 ACS patients aged 56.8±9.5 years, 21 (29.5% subjects underwent CV events. Overall mean followup was 151.6 (95% CI: 129.7-173.5 days. Baseline characteristic were similarly distributed between groups with the highest quartile neopterin level (≥14.7 nmol/L than those with lowest quartile (≤6.2 nmol/L. Patients with the highest quartile had the worst survival curve than those with the lowest quartile (log-rank test; p=0.047. On Cox proportional model, relative risk of highest quartile group was 5.84 (95% CI: 1.19-28.47; p=0.029 compared to lowest quartile, after being adjusted with other predictors. CONCLUSIONS: Elevated serum neopterin is associated with increased risk of CV events in acute coronary syndromes. KEYWORDS: neopterin, cardiovascular events, acute coronary syndromes.

  7. Renin-angiotensin system blockade therapy after transcatheter aortic valve implantation.

    Science.gov (United States)

    Ochiai, Tomoki; Saito, Shigeru; Yamanaka, Futoshi; Shishido, Koki; Tanaka, Yutaka; Yamabe, Tsuyoshi; Shirai, Shinichi; Tada, Norio; Araki, Motoharu; Naganuma, Toru; Watanabe, Yusuke; Yamamoto, Masanori; Hayashida, Kentaro

    2018-04-01

    The persistence of left ventricular (LV) hypertrophy is associated with poor clinical outcomes after transcatheter aortic valve implantation (TAVI) for aortic stenosis. However, the optimal medical therapy after TAVI remains unknown. We investigated the effect of renin-angiotensin system (RAS) blockade therapy on LV hypertrophy and mortality in patients undergoing TAVI. Between October 2013 and April 2016, 1215 patients undergoing TAVI were prospectively enrolled in the Optimized CathEter vAlvular iNtervention (OCEAN)-TAVI registry. This cohort was stratified according to the postoperative usage of RAS blockade therapy with angiotensin-converting enzyme (ACE) inhibitors or angiotensin-receptor blockers (ARBs). Patients with at least two prescriptions dispensed 180 days apart after TAVI and at least a 6-month follow-up constituted the RAS blockade group (n=371), while those not prescribed any ACE inhibitors or ARBs after TAVI were included in the no RAS blockade group (n=189). At 6 months postoperatively, the RAS blockade group had significantly greater LV mass index regression than the no RAS blockade group (-9±24% vs -2±25%, p=0.024). Kaplan-Meier analysis revealed a significantly lower cumulative 2-year mortality in the RAS blockade than that in the no RAS blockade group (7.5% vs 12.5%; log-rank test, p=0.031). After adjusting for confounding factors, RAS blockade therapy was associated with significantly lower all-cause mortality (HR, 0.45; 95% CI 0.22 to 0.91; p=0.025). Postoperative RAS blockade therapy is associated with greater LV mass index regression and reduced all-cause mortality. These data need to be confirmed by a prospective randomised controlled outcome trial. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  8. Primary mediastinal large B-cell lymphoma: Clinical features, prognostic factors and survival with RCHOP in Arab patients in the PET scan era

    Directory of Open Access Journals (Sweden)

    Salem Al Shemmari

    2014-01-01

    Full Text Available Objective: PMBCL is a distinct type of nonhodgkins lymphoma with specific clinicopathological features. To clarify clinical features, treatment alternatives and outcomes, we evaluated 28 Arab patients treated with chemotherapy or radiotherapy between 2006 and 2011. Patients and Methods: PMBCL lymphoma patients identified according to WHO classification and treated at KCCC between 2006 and 2011 were included in this study. Demographic and clinical data are presented as means or medians. Overall survival was estimated using the Kaplan-Meier method. Survival rates were compared using the log-rank test. A P < 0.05 was considered significant. Results: The median age of the patients was 31 years and the male to female ratio was 2:1. Majority of the patients (75% presented with stage I/II disease. Most had features of local extension like pleural effusion (18% and SVCO (39%. Only 11% of the patients had bone marrow involvement at presentation. 96% of the patients required biopsy from the mediastinal mass either by image guided core biopsy (75% or by surgical biopsy. Most patients were treated by RCHOP and involved field radiotherapy. Patients with positive PET scan after RCHOP chemotherapy received salvage chemotherapy and BEAM autologous marrow transplant. The five year OS for the entire group was 85% while the PFS was 73%. Patients who had PET scan for response evaluation had better OS [P = 0.013] and PFS [P = 0.039] when compared with those patients who received only radiotherapy based on CT scan evaluation. Conclusion: PMBCL is a specific lymphoma entity seen in the young with good survival. The role of PET scan for response evaluation and the type of consolidation therapy needs to be further clarified

  9. The Combination of Platelet Count and Neutrophil Lymphocyte Ratio Is a Predictive Factor in Patients with Esophageal Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Ji-Feng Feng

    2014-10-01

    Full Text Available OBJECTIVE: The prognostic value of inflammation indexes in esophageal cancer was not established. In this study, therefore, both prognostic values of Glasgow prognostic score (GPS and combination of platelet count and neutrophil lymphocyte ratio (COP-NLR in patients with esophageal squamous cell carcinoma (ESCC were investigated and compared. METHODS: This retrospective study included 375 patients who underwent esophagectomy for ESCC. The cancer-specific survival (CSS was calculated by the Kaplan-Meier method, and the difference was assessed by the log-rank test. The GPS was calculated as follows: patients with elevated C-reactive protein (>10 mg/l and hypoalbuminemia (300 × 109/l and neutrophil lymphocyte ratio (>3 were assigned to COP-NLR2. Patients with one or no abnormal value were assigned to COP-NLR1 or COP-NLR0, respectively. RESULTS: The 5-year CSS in patients with GPS0, 1, and 2 was 50.0%, 27.0%, and 12.5%, respectively (P < .001. The 5-year CSS in patients with COP-NLR0, 1, and 2 was 51.8%, 27.0%, and 11.6%, respectively (P < .001. Multivariate analysis showed that both GPS (P = .003 and COP-NLR (P = .003 were significant predictors in such patients. In addition, our study demonstrated a similar hazard ratio (HR between COP-NLR and GPS (HR = 1.394 vs HR = 1.367. CONCLUSIONS: COP-NLR is an independent predictive factor in patients with ESCC. We conclude that COP-NLR predicts survival in ESCC similar to GPS.

  10. Outcome in Advanced Ovarian Cancer following an Appropriate and Comprehensive Effort at Upfront Cytoreduction: A Twenty-Year Experience in a Single Cancer Institute

    Directory of Open Access Journals (Sweden)

    Anne Marszalek

    2010-01-01

    Full Text Available Objectives. The purpose of this retrospective evaluation of advanced-stage ovarian cancer patients was to compare outcome with published findings from other centers and to discuss future options for the management of advanced ovarian carcinoma patients. Methods. A retrospective series of 340 patients with a mean age of 58 years (range: 17–88 treated for FIGO stage III and IV ovarian cancer between January 1985 and January 2005 was reviewed. All patients had primary cytoreductive surgery, without extensive bowel, peritoneal, or systematic lymph node resection, thereby allowing initiation of chemotherapy without delay. Chemotherapy consisted of cisplatin-based chemotherapy in combination with alkylating agents before 2000, whereas carboplatin and paclitaxel regimes were generally used after 1999-2000. Overall survival and disease-free survival were analyzed by the Kaplan-Meier method and the log-rank test. Results. With a mean followup of 101 months (range: 5 to 203, 280 events (recurrence or death were observed and 245 patients (72% had died. The mortality and morbidity related to surgery were low. The main prognostic factor for overall survival was postoperative residual disease (P<.0002, while the main prognostic factor for disease-free survival was histological tumor type (P<.0007. Multivariate analysis identified three significant risk factors: optimal surgery (RR=2.2 for suboptimal surgery, menopausal status (RR=1.47 for postmenopausal women, and presence of a taxane in the chemotherapy combination (RR=0.72. Conclusion. These results confirm that optimal surgery defined by an appropriate and comprehensive effort at upfront cytoreduction limits morbidity related to the surgical procedure and allows initiation of chemotherapy without any negative impact on survival. The impact of neoadjuvant chemotherapy to improve resectability while lowering the morbidity of the surgical procedure is discussed.

  11. Development, acceptability and efficacy of a standardized healthy lifestyle intervention in recurrent depression.

    Science.gov (United States)

    Goracci, A; Rucci, P; Forgione, R N; Campinoti, G; Valdagno, M; Casolaro, I; Carretta, E; Bolognesi, S; Fagiolini, A

    2016-05-15

    Research evidence on the effects of integrated multifaceted lifestyle interventions for depression is scanty. The aim of the present study is to report on the development, acceptability and efficacy of a standardized healthy lifestyle intervention, including exercise, eating habits, sleep hygiene and smoking cessation in preventing relapses. One hundred-sixty outpatients with recurrent unipolar depression or bipolar disorder were recruited after achieving full remission or recovery from the most recent depressive episode. Patients were randomized to 3-months of usual care or to an intervention aimed at promoting a healthy lifestyle (HLI), as an augmentation of pharmacological maintenance treatment. Usual care consisted of clinical management visits. At the end of the intervention, follow-up visits were scheduled at 3,6,9 and 12 months. During the intervention phase, 1 relapse occurred in the HLI group and 4 in the control group. Over the 12 months of follow-up, relapses were 5 in the HLI group and 16 in control group. Using an intent-to-treat approach, the overall percentage of relapses was 6/81 (7.4%) in the HLI group vs. 20/79 (25.3%) in the control group.. In a Kaplan-Meier survival analysis the risk of relapse was significantly lower in patients receiving the HLI intervention (log-rank test, p=0.003) over the 60 weeks of observation. The majority of patients assigned to HLI adhered to the program, and were highly motivated throughout the intervention. The retention rate was low because patients were recruited during the maintenance phase and the 1-year follow-up was relatively short to detect a long-term effect of HLI. The HLI program proved to be efficacious in preventing relapses. Given the absence of contraindications and its cost-effectiveness in routine practice, the use of HLI should be encouraged to promote the well-being of patients with recurrent depression. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Single nucleotide polymorphisms in the D-loop region of mitochondrial DNA is associated with the kidney survival time in chronic kidney disease patients.

    Science.gov (United States)

    Xu, Jinsheng; Guo, Zhanjun; Bai, Yaling; Zhang, Junxia; Cui, Liwen; Zhang, Huiran; Zhang, Shenglei; Ai, Xiaolu

    2015-02-01

    The mitochondrial displacement loop (D-loop) is known to accumulate mutations and SNPs at a higher frequency than other regions of mitochondrial DNA (mtDNA). We had identified chronic kidney disease (CKD) risk-associated SNPs in the D-loop of CKD patients previously. In this study, we investigated the association of SNPs in the D-loop of mtDNA with the kidney survival of CKD. The D-loop region of mtDNA was sequenced for 119 CKD patients from the inpatient of the Fourth Hospital of Hebei Medical University. The Kaplan-Meier method was used to identify disease outcome-associated SNPs in the D-loop of CKD patients. The Cox proportional hazards model was used to identify risk factors for the kidney survival of CKD. In the present study, we identified 20 SNPs with a frequency higher than 5% and assessed the relationship of these SNPs with kidney survival time in CKD patients, a SNP of 146 was identified by log-rank test for statistically significant prediction of the kidney survival time. In an overall multivariate analysis, allele 146 was identified as an independent predictor of kidney survival time in CKD patients. The survival time of kidney in the CKD patients with 146C was significantly shorter than that of kidney in CKD patients with 146T (relative risk, 2.336; 95% CI, 1.319-3.923; p = 0.001). SNPs in the D-loop can predict the kidney survival of CKD patients. Analysis of genetic polymorphisms in the mitochondrial D-loop can help to identify CKD patient subgroup at high risk of a poor disease outcome.

  13. Mortality and morbidity hazards associated with cognitive status in seniors: a Canadian population prospective cohort study.

    Science.gov (United States)

    Meng, Xiangfei; D'Arcy, Carl

    2013-09-01

    Although cognitive impairment is widely accepted as a leading indicator of dementia, influences of cognitive status on incident dementia and mortality remain unclear. The present study investigated the morbidity hazard associated with cognitive impairment and the mortality hazard associated with dementia in comparison to cognitively intact seniors. A population-based sample of 2914 seniors with clinically diagnosed cognitive status at Wave I (1991-1992) of the Canadian Study of Health and Aging (CSHA) were followed-up 5 years later (1996-1997). At Wave I, there were 921 cognitively intact, 861 cognitively impaired but not demented (CIND), and 1132 seniors with dementia, respectively. The primary outcome measures 5 years later were being cognitively intact, CIND, dementia and death. Kaplan-Meier estimates, log-rank tests, and Cox's proportional models were used in the analyses. Respondents with CIND at Wave I were 2.191 times (95%CI 1.706-2.814) more likely to have dementia 5 years later than cognitively intact seniors. After adjusting for confounding socio-demographic and health status factors, the odds ratio was reduced to 2.147 times (95%CI 1.662-2.774), but remained significant. Respondents with CIND had a mortality rate 1.869 times (95%CI 1.602-2.179) and seniors with dementia 3.362 times greater (95%CI 2.929-3.860) than that of seniors who were cognitively intact. After controlling the confounders, the odds remained significant at 1.576 (95%CI 1.348-1.843) for CIND respondents and 2.415 (95%CI 2.083-2.800) for seniors with dementia. CIND increases both the risk of dementia and mortality. Early intervention with CIND is warranted to reduce both dementia incidence and mortality. Copyright © 2012 Wiley Publishing Asia Pty Ltd.

  14. Analysis of elemental concentration censored distributions in breast malignant and breast benign neoplasm tissues

    International Nuclear Information System (INIS)

    Kubala-Kukus, A.; Banas, D.; Braziewicz, J.; Gozdz, S.; Majewska, U.; Pajek, M.

    2007-01-01

    The total reflection X-ray fluorescence method was applied to study the trace element concentrations in human breast malignant and breast benign neoplasm tissues taken from the women who were patients of Holycross Cancer Centre in Kielce (Poland). These investigations were mainly focused on the development of new possibilities of cancer diagnosis and therapy monitoring. This systematic comparative study was based on relatively large (∼ 100) population studied, namely 26 samples of breast malignant and 68 samples of breast benign neoplasm tissues. The concentrations, being in the range from a few ppb to 0.1%, were determined for thirteen elements (from P to Pb). The results were carefully analysed to investigate the concentration distribution of trace elements in the studied samples. The measurements of concentration of trace elements by total reflection X-ray fluorescence were limited, however, by the detection limit of the method. It was observed that for more than 50% of elements determined, the concentrations were not measured in all samples. These incomplete measurements were treated within the statistical concept called left-random censoring and for the estimation of the mean value and median of censored concentration distributions, the Kaplan-Meier estimator was used. For comparison of concentrations in two populations, the log-rank test was applied, which allows to compare the censored total reflection X-ray fluorescence data. Found statistically significant differences are discussed in more details. It is noted that described data analysis procedures should be the standard tool to analyze the censored concentrations of trace elements analysed by X-ray fluorescence methods

  15. [Efficacy of icotinib for advanced non-small cell lung cancer patients with EGFR status identified].

    Science.gov (United States)

    Song, Zhengbo; Yu, Xinmin; Cai, Jufen; Shao, Lan; Lin, Baochai; He, Chunxiao; Zhang, Beibei; Zhang, Yiping

    2013-03-01

    As the first epidermal growth factor receptor tyrosine kinase inhibitor (EGFR-TKI) in China, icotinib shows promising anticancer activity in vitro and vivo. The phase III clinical study (ICOGEN) showed that icotinib has a good efficacy and tolerability in Chinese patients with advanced non-small cell lung cancer (NSCLC) compared with gefitinib. This retrospective study aims to evaluate the efficacy and tolerability of icotinib monotherapy for advanced NSCLC patients with EGFR mutation and wild-type patients in our hospital. Patients with advanced NSCLC who were treated with icotinib in Zhejiang Cancer Hospital were retrospectively analyzed from August, 2011 to August, 2012. Survival was estimated using Kaplan-Meier analysis and Log-rank tests. The clinical data of 49 patients (13 with wild-type and 36 with EGFR mutation) with NSCLC were enrolled in the current study. The patients' overall objective response rate (ORR) was 58.3% and the disease control rate (DCR) in 36 EGFR mutation patients was 88.9%. The ORR was 7.7% and DCR was 53.8% in the wild-type patients. Median progression-free survival (PFS) with icotinib treatment in EGFR mutation patients was 9.5 months and 2.2 months in wild-type patients (Picotinib as first-line and 17 in further-line treatment. The PFS was 9.5 months in the first-line and 8.5 months for second-line or further-line patients (P=0.41). Median overall survival (OS) in EGFR mutation patients was not reached, but was 12.6 months in wild-type patients. Most of the drug-related adverse events were mild (grade I or II) and reversible with no grade IV toxicity. Icotinib monotherapy showed significant antitumor activity in advanced NSCLC EGFR mutation patients. The toxicity was well tolerated and acceptable.

  16. Disclosure of HIV status and its impact on the loss in the follow-up of HIV-infected patients on potent anti-retroviral therapy programs in a (post- conflict setting: A retrospective cohort study from Goma, Democratic Republic of Congo.

    Directory of Open Access Journals (Sweden)

    Pierre Zalagile Akilimali

    Full Text Available The study aimed to identify the impact of non-disclosure of HIV status on the loss to follow-up (LTFU of patients receiving anti-retroviral therapy.A historic cohort of HIV patients from 2 major hospitals in Goma, Democratic Republic of Congo was followed from 2004 to 2012. LTFU was defined as not taking an ART refill for a period of 3 months or longer since the last attendance, and had not yet been classified as 'dead' or 'transferred-out'. Kaplan-Meier plots were used to determine the probability of LTFU as a function of time as inclusive of the cohort. The log-rank test was used to compare survival curves based on determinants. Cox proportional hazard modeling was used to measure predictors of LTFU from the time of treatment induction until December 15th, 2012 (the end-point.The median follow-up time was 3.99 years (IQR = 2.33 to 5.59. Seventy percent of patients had shared their HIV status with others (95% CI: 66.3-73.1. The proportion of LTFU was 12% (95%CI: 9.6-14.4. Patients who did not share their HIV status (Adjusted HR 2.28, 95% CI 1.46-2.29, patients who did not live in the city of Goma (Adjusted HR 1.97, 95% CI 1.02-3.77, and those who attained secondary or higher education level (Adjusted HR 1.60, 95% CI 1.02-2.53 had a higher hazard of being LTFU.This study shows the relationship between the non-disclosure HIV status and LTFU. Healthcare workers in similar settings should pay more attention to clients who have not disclosed their HIV status, and to those living far from health settings where they receive medication.

  17. A retrospective cohort study to investigate fatigue, psychological or cognitive impairment after TIA: protocol paper.

    Science.gov (United States)

    Moran, Grace M; Calvert, Melanie; Feltham, Max G; Ryan, Ronan; Marshall, Tom

    2015-05-03

    Transient ischaemic attack (TIA) is defined by short-lasting, stroke-like symptoms, and is recognised as a medical emergency. Symptoms are assumed to completely resolve, and treatment is focused on secondary stroke/TIA prevention. However, evidence suggests that patients with TIA may experience ongoing residual impairments, which they do not receive therapy for as standard practice. TIA-induced sequelae could impact on patients' quality of life and ability to return to work or social activities. We aim to investigate whether TIA is associated with subsequent consultation for fatigue, psychological or cognitive impairment in primary care. A retrospective open cohort study of patients with first-ever TIA and matched controls. Relevant data will be extracted from The Health Improvement Network (THIN) database, an anonymised primary care database which includes data for over 12 million patients and covers approximately 6% of the UK population. Outcomes will be the first consultation for fatigue, anxiety, depression, post-traumatic stress disorder or cognitive impairment. Principal analysis will use Kaplan-Meier survivor functions to estimate time to first consultation, with log-rank tests to compare TIA and control patients. Cox proportional hazard models will predict the effect of demographic and patient characteristics on time to first consultation. Approval was granted by a THIN Scientific Review Committee (ref: 14-008). The study's findings will be published in a peer-reviewed journal and disseminated at national and international conferences and through social media. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  18. [Treatment outcome, survival and their risk factors among new tuberculosis patients co-infected with HIV during the Ebola outbreak in Conakry].

    Science.gov (United States)

    Camara, A; Sow, M S; Touré, A; Diallo, O H; Kaba, I; Bah, B; Diallo, T H; Diallo, M S; Guilavogui, T; Sow, O Y

    2017-11-01

    Mortality among TB/HIV co-infected patients remains high in Africa. The study aimed to estimate survival and associated factors in a cohort of TB/HIV co-infected patients who started tuberculosis treatment during the Ebola outbreak in Conakry, Guinea. A prospective cohort study was conducted from April 2014 to December 2015. TB patients with HIV co-infection were enrolled at the University Hospital of Conakry. Survival and risk factors were analyzed according to Kaplan-Meier's method, log-rank test and Cox's regression. Data from 573 patients were analyzed. From these, 86 (15.0%) died before the end of treatment, 52% occurring within eight weeks of treatment onset. Survival at 4, 12 and 24 weeks after the beginning of the TB treatment was 92%, 86% and 83%, respectively. Independent risk factors associated with death were in the cell CD4 <200 cells/mm 3 [adjusted hazard ratio (AHR): 2.25; 95% CI (confidence intervals): 1.16-4.37], opportunistic infections other than TB [AHR: 2.89; 95% CI: 1.39-6.02], and comorbidities [AHR: 4.12; 95% CI: 2.10-8.10]. An increase of one unit in hemoglobin [AHR: 0.81; 95% CI: 0.75-0.91] was protective of death. TB/HIV co-infected patients had a higher fatality rate during treatment of tuberculosis. Prevention of opportunistic infections, anemia and proper management of tuberculosis treatment in early comorbidities may improve survival for TB/HIV co-infected patients in restoring immune function. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Serum prognostic biomarkers in head and neck cancer patients.

    Science.gov (United States)

    Lin, Ho-Sheng; Siddiq, Fauzia; Talwar, Harvinder S; Chen, Wei; Voichita, Calin; Draghici, Sorin; Jeyapalan, Gerald; Chatterjee, Madhumita; Fribley, Andrew; Yoo, George H; Sethi, Seema; Kim, Harold; Sukari, Ammar; Folbe, Adam J; Tainsky, Michael A

    2014-08-01

    A reliable estimate of survival is important as it may impact treatment choice. The objective of this study is to identify serum autoantibody biomarkers that can be used to improve prognostication for patients affected with head and neck squamous cell carcinoma (HNSCC). Prospective cohort study. A panel of 130 serum biomarkers, previously selected for cancer detection using microarray-based serological profiling and specialized bioinformatics, were evaluated for their potential as prognostic biomarkers in a cohort of 119 HNSCC patients followed for up to 12.7 years. A biomarker was considered positive if its reactivity to the particular patient's serum was greater than one standard deviation above the mean reactivity to sera from the other 118 patients, using a leave-one-out cross-validation model. Survival curves were estimated according to the Kaplan-Meier method, and statistically significant differences in survival were examined using the log rank test. Independent prognostic biomarkers were identified following analysis using multivariate Cox proportional hazards models. Poor overall survival was associated with African Americans (hazard ratio [HR] for death = 2.61; 95% confidence interval [CI]: 1.58-4.33; P = .000), advanced stage (HR = 2.79; 95% CI: 1.40-5.57; P = .004), and recurrent disease (HR = 6.66; 95% CI: 2.54-17.44; P = .000). On multivariable Cox analysis adjusted for covariates (race and stage), six of the 130 markers evaluated were found to be independent prognosticators of overall survival. The results shown here are promising and demonstrate the potential use of serum biomarkers for prognostication in HNSCC patients. Further clinical trials to include larger samples of patients across multiple centers may be warranted. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

  20. Molecular profiles of screen detected vs. symptomatic breast cancer and their impact on survival: results from a clinical series

    International Nuclear Information System (INIS)

    Crispo, Anna; Esposito, Emanuela; Amore, Alfonso; Di Bonito, Maurizio; Botti, Gerardo; Montella, Maurizio; Barba, Maddalena; D’Aiuto, Giuseppe; De Laurentiis, Michelino; Grimaldi, Maria; Rinaldo, Massimo; Caolo, Giuseppina; D’Aiuto, Massimiliano; Capasso, Immacolata

    2013-01-01

    Stage shift is widely considered a major determinant of the survival benefit conferred by breast cancer screening. However, factors and mechanisms underlying such a prognostic advantage need further clarification. We sought to compare the molecular characteristics of screen detected vs. symptomatic breast cancers and assess whether differences in tumour biology might translate into survival benefit. In a clinical series of 448 women with operable breast cancer, the Kaplan-Meier method and the log-rank test were used to estimate the likelihood of cancer recurrence and death. The Cox proportional hazard model was used for the multivariate analyses including mode of detection, age at diagnosis, tumour size, and lymph node status. These same models were applied to subgroups defined by molecular subtypes. Screen detected breast cancers tended to show more favourable clinicopathological features and survival outcomes compared to symptomatic cancers. The luminal A subtype was more common in women with mammography detected tumours than in symptomatic patients (68.5 vs. 59.0%, p=0.04). Data analysis across categories of molecular subtypes revealed significantly longer disease free and overall survival for screen detected cancers with a luminal A subtype only (p=0.01 and 0.02, respectively). For women with a luminal A subtype, the independent prognostic role of mode of detection on recurrence was confirmed in Cox proportional hazard models (p=0.03). An independent role of modality of detection on survival was also suggested (p=0.05). Molecular subtypes did not substantially explain the differences in survival outcomes between screened and symptomatic patients. However, our results suggest that molecular profiles might play a role in interpreting such differences at least partially. Further studies are warranted to reinterpret the efficacy of screening programmes in the light of tumour biology

  1. Intensity-modulated radiotherapy vs. parotid-sparing 3D conformal radiotherapy. Effect on outcome and toxicity in locally advanced head and neck cancer

    Energy Technology Data Exchange (ETDEWEB)

    Lambrecht, M.; Nevens, D.; Nuyts, S. [University Hospitals Leuven (Belgium). Dept. of Radiation Oncology

    2013-03-15

    Background and purpose: Intensity-modulated radiotherapy (IMRT) has rapidly become standard of care in the management of locally advanced head and neck squamous cell carcinoma (HNSCC). In this study, our aim was to retrospectively investigate the effect of the introducing IMRT on outcome and treatment-related toxicity compared to parotid-sparing 3D conformal radiotherapy (3DCRT). Material and methods: A total of 245 patients with stage III and IV HNSCC treated with primary radiotherapy between January 2003 and December 2010 were included in this analysis: 135 patients were treated with 3DCRT, 110 patients with IMRT. Groups were compared for acute and late toxicity, locoregional control (LRC), and overall survival (OS). Oncologic outcomes were estimated using Kaplan-Meier analysis and compared using a log-rank test. Acute toxicity was analyzed according to the Common Terminology Criteria for Adverse Events v3.0 and late toxicity was scored using the RTOG/EORTC late toxicity scoring system. Results: Median follow-up was 35 months in the IMRT group and 68 months in the 3DCRT group. No significant differences were found in 3-year LRC and OS rates between the IMRT group and 3DCRT group. Significantly less acute mucositis {>=} grade 3 was observed in the IMRT group (32% vs. 44%, p = 0.03). There was significantly less late xerostomia {>=} grade 2 in the IMRT group than in the 3DCRT group (23% vs. 68%, p < 0.001). After 24 months, there was less dysphagia {>=} grade 2 in the IMRT group although differences failed to reach statistical significance. Conclusion: The introduction of IMRT in the radiotherapeutic management of locally advanced head and neck cancer significantly improved late toxicity without compromising tumor control compared to a parotid-sparing 3D conformal radiotherapy technique. (orig.)

  2. Parathyroid carcinoma survival: improvements in the era of intact parathyroid hormone monitoring?

    Directory of Open Access Journals (Sweden)

    Steve R. Martinez

    2013-02-01

    Full Text Available The intact parathyroid hormone (iPTH assay is a critical test in the diagnosis and management of PTH-mediated hypercalcemia, including parathyroid carcinoma (PCa. We hypothesized that the survival of patients diagnosed with PCa has improved since adoption of the iPTH assay into clinical practice. We identified all confirmed cases of PCa within the Surveillance, Epidemiology and End Results database from 1973 to 2006. Patients were categorized into two eras based upon introduction of the iPTH assay: 1973 to 1997 (era I and 1997 to 2006 (era II, when the iPTH assay was in standard use. We estimated overall survival (OS and disease-specific survival (DSS using the Kaplan-Meier method, with differences among survival curves assessed via log rank. Multivariate Cox proportional hazards models compared the survival rates between treatment eras while controlling for patient age, sex, race/ethnicity, tumor size, nodal status, extent of disease, and type of surgery. Multivariate models included patients undergoing potentially curative surgery and excluded those with dis- tant metastases. Risks of overall and disease-specific mortality were reported as hazard ratios with 95% confidence intervals. Study criteria were met by 370 patients. Median survival was 15.6 years. Five-year rates of OS and DSS were 78% and 88% for era I and 82% and 96% for era II. On multivariate analysis, age, black race, and unknown extent of disease predicted an increased risk of death from any cause. Treatment era did not predict OS. No factor predicted PCa-specific mortality. In multivariate analysis, neither OS nor DSS have improved in the current era that utilizes iPTH for the detection and management of PCa.

  3. Choline kinase alpha and hexokinase-2 protein expression in hepatocellular carcinoma: association with survival.

    Directory of Open Access Journals (Sweden)

    Sandi A Kwee

    Full Text Available PURPOSE: Hexokinase-2 (HK2 and more recently choline kinase alpha (CKA expression has been correlated with clinical outcomes in several major cancers. This study examines the protein expression of HK2 and CKA in hepatocellular carcinoma (HCC in association with patient survival and other clinicopathologic parameters. METHODS: Immunohistochemical analysis for HK2 and CKA expression was performed on a tissue microarray of 157 HCC tumor samples. Results were analyzed in relation to clinicopathologic data from Surveillance, Epidemiology, and End-Results Program registries. Mortality rates were assessed by Kaplan-Meier estimates and compared using log-rank tests. Predictors of overall survival were assessed using proportional hazards regression. RESULTS: Immunohistochemical expression of HK2 and CKA was detected in 71 (45% and 55 (35% tumor samples, respectively. Differences in tumor HK2 expression were associated with tumor grade (p = 0.008 and cancer stage (p = 0.001, while CKA expression differed significantly only across cancer stage (p = 0.048. Increased mortality was associated with tumor HK2 expression (p = 0.003 as well as CKA expression (p = 0.03 with hazard ratios of 1.86 (95% confidence interval (CI 1.23-2.83 and 1.59 (95% CI 1.04-2.41, respectively. Similar effects on overall survival were noted in a subset analysis of early stage (I and II HCC. Tumor HK2 expression, but not CKA expression, remained a significant predictor of survival in multivariable analyses. CONCLUSION: HK2 and CKA expression may have biologic and prognostic significance in HCC, with tumor HK2 expression being a potential independent predictor of survival.

  4. Safe Reentry for False Aneurysm Operations in High-Risk Patients.

    Science.gov (United States)

    Martinelli, Gian Luca; Cotroneo, Attilio; Caimmi, Philippe Primo; Musica, Gabriele; Barillà, David; Stelian, Edmond; Romano, Angelo; Novelli, Eugenio; Renzi, Luca; Diena, Marco

    2017-06-01

    In the absence of a standardized safe surgical reentry strategy for high-risk patients with large or anterior postoperative aortic false aneurysm (PAFA), we aimed to describe an effective and safe approach for such patients. We prospectively analyzed patients treated for PAFA between 2006 and 2015. According to the preoperative computed tomography scan examination, patients were divided into two groups according to the anatomy and extension of PAFA: in group A, high-risk PAFA (diameter ≥3 cm) developed in the anterior mediastinum; in group B, low-risk PAFA (diameter <3 cm) was situated posteriorly. For group A, a safe surgical strategy, including continuous cerebral, visceral, and coronary perfusion was adopted before resternotomy; group B patients underwent conventional surgery. We treated 27 patients (safe reentry, n = 13; standard approach, n = 14). Mean age was 60 years (range, 29 to 80); 17 patients were male. Mean interval between the first operation and the last procedure was 4.3 years. Overall 30-day mortality rate was 7.4% (1 patient in each group). No aorta-related mortality was observed at 1 and 5 years in either group. The Kaplan-Meier overall survival estimates at 1 and 5 years were, respectively, 92.3% ± 7.4% and 73.4% ± 13.4% in group A, and 92.9% ± 6.9% and 72.2% ± 13.9% in group B (log rank test, p = 0.830). Freedom from reoperation for recurrent aortic disease was 100% at 1 year and 88% at 5 years. The safe reentry technique with continuous cerebral, visceral, and coronary perfusion for high-risk patients resulted in early and midterm outcomes similar to those observed for low-risk patients undergoing conventional surgery. Copyright © 2017 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  5. Impact of Symptomatic Metastatic Spinal Cord Compression on Survival of Patients with Non-Small-Cell Lung Cancer.

    Science.gov (United States)

    da Silva, Gustavo Telles; Bergmann, Anke; Thuler, Luiz Claudio Santos

    2017-12-01

    Non-small-cell lung cancer (NSCLC) is one of the most common primary tumor sites among patients with metastatic spinal cord compression (MSCC). This disorder is related to neurologic dysfunction and can reduce the quality of life, but the association between MSCC and death is unclear. The aim of this study was to analyze the impact of the occurrence of symptomatic MSCC on overall survival of patients with NSCLC. A cohort study was carried out involving 1112 patients with NSCLC who were enrolled between 2006 and 2014 in a single cancer center. Clinical and sociodemographic data were extracted from the physical and electronic records. Survival analysis of patients with NSCLC was conducted using the Kaplan-Meier method. A log-rank test was used to assess differences between survival curves. Cox proportional hazards regression analyses were carried out to quantify the relationship between the independent variable (MSCC) and the outcome (overall survival). During the study period, the incidence of MSCC was 4.1%. Patients who presented with MSCC were 1.43 times more likely to die than were those with no history of MSCC (hazard ratio, 1.43; 95% confidence interval [CI], 1.03-2.00; P = 0.031). The median survival time was 8.04 months (95% CI, 6.13-9.96) for those who presented MSCC and 11.95 months (95% CI, 10.80-13.11) for those who did not presented MSCC during the course of disease (P = 0.002). MSCC is an important and independent predictor of NSCLC worse survival. This effect was not influenced by sociodemographic and clinical factors. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Prognostic significance of an early decline in serum alpha-fetoprotein during chemotherapy for ovarian yolk sac tumors.

    Science.gov (United States)

    de la Motte Rouge, Thibault; Pautier, Patricia; Genestie, Catherine; Rey, Annie; Gouy, Sébastien; Leary, Alexandra; Haie-Meder, Christine; Kerbrat, Pierre; Culine, Stéphane; Fizazi, Karim; Lhommé, Catherine

    2016-09-01

    The ovarian yolk sac tumor (OYST) is a very rare malignancy arising in young women. Our objective was to determine whether an early decline in serum alpha-fetoprotein (AFP) during chemotherapy has a prognostic impact. This retrospective study is based on prospectively recorded OYST cases at Gustave Roussy (Cancer Treatment Center). Survival curves were estimated using the Kaplan-Meier method. The serum AFP decline was calculated with the formula previously developed and validated in male patients with poor prognosis non-seminomatous germ cell tumors. Univariate and multivariate analyses were performed using the log-rank test and logistic regression, respectively. Data on AFP were available to calculate an early AFP decline in 57 patients. All patients had undergone surgery followed by chemotherapy. The 5-year overall survival (OS) and event-free survival (EFS) rates were 86% (95% CI: 74%-93%) and 84% (95% CI: 73%-91%), respectively. The disease stage, presence of ascites at presentation, use of the BEP regimen, serum AFP half-life and an early AFP decline were significantly predictive factors for OS and EFS in the univariate analysis. The OS rate was 100% and 49% (95% CI: 26%-72%) in patients with a favorable AFP decline and in those with an unfavorable decline, respectively (p<0.001). In the multivariate analysis, only the presence of ascites at diagnosis (RR=7.3, p=0.03) and an unfavorable early AFP decline (RR=16.9, p<0.01) were significant negative predictive factors for OS. An early AFP decline during chemotherapy is an independent prognostic factor in patients with OYSTs. No conflict of interest. Copyright © 2016. Published by Elsevier Inc.

  7. Analysis of prognostic factors in patients with hepatocellular carcinoma after transcatheter hepatic arterial chemoembolization(TAE)

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Tae Gwon; Byun, Kyung Hwan; Oh, Hyun Han; Ryeom, Hun Kyu; Kim, Yong Joo [Kyungpook National Univ. Hospital, Taegu (Korea, Republic of)

    1996-07-01

    To evaluate long-term survival rates and prognostic factors of patients with hepatocellular carcinoma after TAE. 225 patients with hepatocellular carcinoma treated with TAE between January 1988 and December 1994 were studied. Hepatocellular carcinoma was diagnosed either histologically(n=13) or clinically on the basis of findings characteristic for hepatocellular carcinoma obtained using such as diagnostic imaging methods such as ultrasonography, CT, MRI, and angiography as well as on the basis of high serum alpha-fetoprotein level(n=212). TAE was carried out between one and six times(mean, 1.4 time) using a mixture of lipiodol and Adriamycin, together with Gelfoam. Cumulative survival rates from the day of the first TAE were obtained by the Kaplan-Meier method. Parameters likely to influence the prognosis were subjected to univariate analysis using the log-rank test Cumulative survival rates at the end of the first, second, third, fourth, and fifth year were 55.9%, 32.6%, 21.9%, 17.9%, and 15.0%, respectively. The mean survival time was 727{+-}76 days. Several factors, including Child-Pugh classification, Okuda's stage, tumor size, presence of portal vein invasion by tumor, of arterio-portal shunt, and of extrahepatic metastases, catheter selection level, and number of TAE showed significant correlation with the outcome. Degrees of Lipiodol accumulation in a tumor on follow up CT were also correlated with survival rates. TAE is an effective measure for prolonging the patient's life expectancy and evaluation of prognostic factor is helpful for prognosis and in deciding on the optimal therapeutic modality.

  8. Evaluation of the AJCC 8th Edition Staging System for Pathologically Versus Clinically Staged Intrahepatic Cholangiocarcinoma (iCCA): a Time to Revisit a Dogma? A Surveillance, Epidemiology, and End Results (SEER) Analysis.

    Science.gov (United States)

    Kamarajah, Sivesh K

    2018-03-07

    Recently, the AJCC has released its 8th edition changes to the staging system for intrahepatic cholangiocarcinoma (iCCA). This study sought to validate the proposed changes to the 8th edition of AJCC system for T and N classification of iCCA using a population-based data set. Using the Surveillance, Epidemiology, and End Results (SEER) database (1998-2013), patients undergoing resection or non-surgical management for non-metastatic iCCA were identified. Overall survival was estimated using the Kaplan-Meier method and compared using log-rank tests. Concordance indices (c-indices) calculated from Cox proportional hazards models were calculated to evaluate discriminatory power. The study included 2630 patients resected (37%) or non-surgically managed (63%) for iCCA. Nodal staging was performed in 56%, of whom 31% had positive nodes. For all patients with iCCA, the median 5-year survival by AJCC T classification for T1a, T1b, T2, T3, and T4 was 32, 21, 14, 10, and 10 months, respectively (p < 0.001). The concordance index for the staging system was 0.57 for all patients, 0.62 for those who underwent resection, and 0.54 for patients who did not undergo resection. In summary, the new AJCC 8th edition staging system is comparable to the 7th edition and valid in stratifying patients with iCCA. However, the performance of the staging system is better in patients undergoing surgical resection than those undergoing non-surgical management. These findings further highlight the need for improved accuracy of radiological imaging in clinically staging patients to guide prognosis.

  9. The association of ABO blood type with disease recurrence and mortality among patients with urothelial carcinoma of the bladder undergoing radical cystectomy.

    Science.gov (United States)

    Gershman, Boris; Moreira, Daniel M; Tollefson, Matthew K; Frank, Igor; Cheville, John C; Thapa, Prabin; Tarrell, Robert F; Thompson, Robert Houston; Boorjian, Stephen A

    2016-01-01

    To evaluate the association of ABO blood type with clinicopathologic outcomes and mortality among patients with urothelial carcinoma of the bladder treated with radical cystectomy (RC). We identified 2,086 consecutive patients who underwent RC between 1980 and 2008. Postoperative recurrence-free survival (RFS) and cancer-specific survival (CSS) were estimated using the Kaplan Meier method and compared with the log-rank test. Cox proportional hazards regression models were used to evaluate the association of ABO blood type with outcomes. A total of 913 (44%), 881 (42%), 216 (10%), and 76 (4%) patients had blood type O, A, B, and AB, respectively. Median postoperative follow-up among survivors was 11.0 years (interquartile range: 7.7-15.9y). Overall, 1,561 patients died, with 770 deaths attributable to bladder cancer. Non-O blood type was associated with significantly worse 5-year RFS (65% vs. 69%; P = 0.04) and/or CSS (64% vs. 70%; P = 0.02). In particular, among patients with≤pT2N0 disease, the 5-year RFS for those with non-O vs. O blood type was 75% vs. 82%, respectively (P = 0.002), whereas the 5-year CSS was 77% vs. 85%, respectively (P = 0.001). Moreover, on multivariable analysis, blood type A remained independently associated with an increased risk of cancer-specific mortality (hazard ratio = 1.22; P = 0.01). Non-O blood type, particularly blood type A, is associated with a significantly increased risk of death from bladder cancer among patients undergoing RC. If validated, the utility of a multimodal therapy approach, including perioperative chemotherapy, or more frequent postoperative surveillance in this cohort warrants further study. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Prevalence of molecular subtypes and prognosis of invasive breast cancer in north-east of Morocco: retrospective study

    Directory of Open Access Journals (Sweden)

    Bennis Sanae

    2012-08-01

    Full Text Available Abstract Background Breast carcinoma is known as a heterogeneous disease because gene expression analyses identify several subtypes and the molecular profiles are prognostic and predictive for patients. Our aim, in this study, is to estimate the prevalence of breast cancer subtypes and to determine the relationship between clinico-pathological characteristics, overall survival (OS and disease free survival (DFS for patients coming from north-east of Morocco. Methods We reviewed 366 cases of breast cancer diagnosed between January 2007 to June 2010 at the Department of pathology. Age, size tumor, metastatic profile, node involvement profile, OS and DFS were analyzed on 181 patients. These last parameters were estimated by Kaplan-Meier analysis and log-rank test to estimate outcome differences among subgroups. Results The average age was 45 years, our patients were diagnosed late (57% stage III, 17.5% stage IV with a high average tumor size. Luminal A subtype was more prevalent (53.6% associated with favorable clinic-pathological characteristics, followed by luminal B (16.4%, Her2-overexpressing (12.6%, basal-like (12.6% and unclassified subtype (4.9%. Survival analysis showed a significant difference between subtypes. The triple negative tumors were associated with poor prognosis (49% OS, 39% DFS, whereas the luminal A were associated with a better prognosis (88% OS, 59% DFS. The luminal B and the Her2-overexpressing subtypes were associated with an intermediate prognosis (77% and 75% OS, and 41% and 38% DFS respectively. Conclusion This study showed that molecular classification by immunohistochemistry was necessary for therapeutic decision and prognosis of breast carcinoma. The luminal A subtype was associated with favorable biological characteristics and a better prognosis than triple negative tumors that were associated with a poor prognosis and unfavorable clinic-pathological characteristics.

  11. Prognostic analysis of uterine cervical cancer treated with postoperative radiotherapy: importance of positive or close parametrial resection margin

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Yi Jun; Lee, Kyung Ja; Park, Kyung Ran [Dept. of Radiation Oncology, (Korea, Republic of); and others

    2015-06-15

    To analyze prognostic factors for locoregional recurrence (LRR), distant metastasis (DM), and overall survival (OS) in cervical cancer patients who underwent radical hysterectomy followed by postoperative radiotherapy (PORT) in a single institute. Clinicopathologic data of 135 patients with clinical stage IA2 to IIA2 cervical cancer treated with PORT from 2001 to 2012 were reviewed, retrospectively. Postoperative parametrial resection margin (PRM) and vaginal resection margin (VRM) were investigated separately. The median treatment dosage of external beam radiotherapy (EBRT) to the whole pelvis was 50.4 Gy in 1.8 Gy/fraction. High-dose-rate vaginal brachytherapy after EBRT was given to patients with positive or close VRMs. Concurrent platinum-based chemoradiotherapy (CCRT) was administered to 73 patients with positive resection margin, lymph node (LN) metastasis, or direct extension of parametrium. Kaplan-Meier method and log-rank test were used for analyzing LRR, DM, and OS; Cox regression was applied to analyze prognostic factors. The 5-year disease-free survival was 79% and 5-year OS was 91%. In univariate analysis, positive or close PRM, LN metastasis, direct extension of parametrium, lymphovascular invasion, histology of adenocarcinoma, and chemotherapy were related with more DM and poor OS. In multivariate analysis, PRM and LN metastasis remained independent prognostic factors for OS. PORT after radical hysterectomy in uterine cervical cancer showed excellent OS in this study. Positive or close PRM after radical hysterectomy in uterine cervical cancer correlates with poor prognosis even with CCRT. Therefore, additional treatments to improve local control such as radiation boosting need to be considered.

  12. Prognostic significance of snail expression in hilar cholangiocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Kong, Dalu [Department of Hepatobiliary Surgery, Tianjin Medical University Cancer Institute and Hospital, Hexi District, Tianjin (China); Liang, Jun [Department of Oncology, Affiliated Hospital of Medical College, Qingdao University, Qingdao, Shandong Province (China); Li, Rong [Department of Hepatobiliary Surgery, Tianjin Medical University Cancer Institute and Hospital, Hexi District, Tianjin (China); Liu, Shihai [Department of Laboratory Center, Affiliated Hospital of Medical College, Qingdao University, Qingdao, Shandong Province (China); Wang, Jigang [Department of Oncology, Affiliated Hospital of Medical College, Qingdao University, Qingdao, Shandong Province (China); Zhang, Kejun; Chen, Dong [Department of General Surgery, Affiliated Hospital of Medical College, Qingdao University, Qingdao, Shandong Province (China)

    2012-05-11

    Many patients with hilar cholangiocarcinoma (HC) have a poor prognosis. Snail, a transcription factor and E-cadherin repressor, is a novel prognostic factor in many cancers. The aim of this study was to evaluate the relationship between snail and E-cadherin protein expression and the prognostic significance of snail expression in HC. We examined the protein expression of snail and E-cadherin in HC tissues from 47 patients (22 males and 25 females, mean age 61.2 years) using immunohistochemistry and RT-PCR. Proliferation rate was also evaluated in the same cases by the MIB1 index. High, low and negative snail protein expression was recorded in 18 (38%), 17 (36%), and 12 (26%) cases, respectively, and 40.4% (19/47) cases showed reduced E-cadherin protein expression in HC samples. No significant correlation was found between snail and E-cadherin protein expression levels (P = 0.056). No significant correlation was found between snail protein expression levels and gender, age, tumor grade, vascular or perineural invasion, nodal metastasis and invasion, or proliferative index. Cancer samples with positive snail protein expression were associated with poor survival compared with the negative expresser groups. Kaplan-Meier curves comparing different snail protein expression levels to survival showed highly significant separation (P < 0.0001, log-rank test). With multivariate analysis, only snail protein expression among all parameters was found to influence survival (P = 0.0003). We suggest that snail expression levels can predict poor survival regardless of pathological features and tumor proliferation. Immunohistochemical detection of snail protein expression levels in routine sections may provide the first biological prognostic marker.

  13. High bone sialoprotein (BSP expression correlates with increased tumor grade and predicts a poorer prognosis of high-grade glioma patients.

    Directory of Open Access Journals (Sweden)

    Tao Xu

    Full Text Available OBJECTIVES: To investigate the expression and prognostic value of bone sialoprotein (BSP in glioma patients. METHODS: We determined the expression of BSP using real-time RT-PCR and immunohistochemistry in tissue microarrays containing 15 normal brain and 270 glioma samples. Cumulative survival was calculated by the Kaplan-Meier method and analyzed by the log-rank test. Univariate and multivariate analyses were performed by the stepwise forward Cox regression model. RESULTS: Both BSP mRNA and protein levels were significantly elevated in high-grade glioma tissues compared with those of normal brain and low-grade glioma tissues, and BSP expression positively correlated with tumor grade (P<0.001. Univariate and multivariate analysis showed high BSP expression was an independent prognostic factor for a shorter progression-free survival (PFS and overall survival (OS in both grade III and grade IV glioma patients [hazard ratio (HR = 2.549 and 3.154 for grade III glioma, and HR = 1.637 and 1.574 for grade IV glioma, respectively]. Patients with low BSP expression had a significantly longer median OS and PFS than those with high BSP expression. Small extent of resection and lineage of astrocyte served as independent risk factors of both shorter PFS and OS in grade III glioma patients; GBM patients without O(6-methylguanine (O(6-meG DNA methyltransferase (MGMT methylation and Karnofsky performance score (KPS less than 70 points were related to poor prognosis. Lack of radiotherapy related to shorter OS but not affect PFS in both grade III and grade IV glioma patients. CONCLUSION: High BSP expression occurs in a significant subset of high-grade glioma patients and predicts a poorer outcome. The study identifies a potentially useful molecular marker for the categorization and targeted therapy of gliomas.

  14. MR Imaging Analysis of Non-Measurable Enhancing Lesions Newly Appearing after Concomitant Chemoradiotherapy in Glioblastoma Patients for Prognosis Prediction.

    Directory of Open Access Journals (Sweden)

    Bo Ram Kim

    Full Text Available To analyze the enhancement patterns and apparent diffusion coefficient (ADC values of non-measurable surgical cavity wall enhancement pattern, newly appearing after completion of standard concurrent chemoradiotherapy (CCRT with temozolomide in glioblastoma patients for the prognosis prediction.From January 2010 to April 2014, among 190 patients with histopathologically confirmed glioblastoma, a total of 33 patients with non-measurable wall enhancement on post-CCRT MR imaging were enrolled and divided into two subgroups: non-progression (n = 18 and progression groups (n = 15. We analyzed the wall enhancement patterns, which were categorized into three patterns: thin, thick and nodular enhancement. ADC values were measured in the enhancing portions of the walls. The progression-free survival (PFS related to the wall enhancement was analyzed by Kaplan-Meier analysis, and survival curves were compared using the log-rank test.Statistically significant differences in the surgical cavity wall enhancement patterns was shown between the progression and non-progression groups (P = 0.0032. Thin wall enhancement was more frequently observed in the non-progression group, and thick or nodular wall enhancement were observed in the progression group (P = 0.0016. There was no statistically significant difference in the mean ADC values between the progression and non-progression groups. The mean PFS was longer in patients with thin wall enhancement than in those with nodular or thick wall enhancement (35.5 months vs. 15.8 months, P = 0.008.Pattern analysis of non-measurable surgical cavity wall enhancement on post-CCRT MR imaging might be useful tool for predicting prognosis of GBM patient before clear progression of non-measurable disease.

  15. Prognostic and survival analysis of 837 Chinese colorectal cancer patients.

    Science.gov (United States)

    Yuan, Ying; Li, Mo-Dan; Hu, Han-Guang; Dong, Cai-Xia; Chen, Jia-Qi; Li, Xiao-Fen; Li, Jing-Jing; Shen, Hong

    2013-05-07

    To develop a prognostic model to predict survival of patients with colorectal cancer (CRC). Survival data of 837 CRC patients undergoing surgery between 1996 and 2006 were collected and analyzed by univariate analysis and Cox proportional hazard regression model to reveal the prognostic factors for CRC. All data were recorded using a standard data form and analyzed using SPSS version 18.0 (SPSS, Chicago, IL, United States). Survival curves were calculated by the Kaplan-Meier method. The log rank test was used to assess differences in survival. Univariate hazard ratios and significant and independent predictors of disease-specific survival and were identified by Cox proportional hazard analysis. The stepwise procedure was set to a threshold of 0.05. Statistical significance was defined as P analysis suggested age, preoperative obstruction, serum carcinoembryonic antigen level at diagnosis, status of resection, tumor size, histological grade, pathological type, lymphovascular invasion, invasion of adjacent organs, and tumor node metastasis (TNM) staging were positive prognostic factors (P analysis showed a significant statistical difference in 3-year survival among these groups: LNR1, 73%; LNR2, 55%; and LNR3, 42% (P analysis results showed that histological grade, depth of bowel wall invasion, and number of metastatic lymph nodes were the most important prognostic factors for CRC if we did not consider the interaction of the TNM staging system (P < 0.05). When the TNM staging was taken into account, histological grade lost its statistical significance, while the specific TNM staging system showed a statistically significant difference (P < 0.0001). The overall survival of CRC patients has improved between 1996 and 2006. LNR is a powerful factor for estimating the survival of stage III CRC patients.

  16. Outcome predictors in the management of intramedullary classic ependymoma: An integrative survival analysis.

    Science.gov (United States)

    Wang, Yinqing; Cai, Ranze; Wang, Rui; Wang, Chunhua; Chen, Chunmei

    2018-06-01

    This is a retrospective study.The aim of this study was to illustrate the survival outcomes of patients with classic ependymoma (CE) and identify potential prognostic factors.CE is the most common category of spinal ependymomas, but few published studies have discussed predictors of the survival outcome.A Boolean search of the PubMed, Embase, and OVID databases was conducted by 2 investigators independently. The objects were intramedullary grade II ependymoma according to 2007 WHO classification. Univariate Kaplan-Meier analysis and Log-Rank tests were performed to identify variables associated with progression-free survival (PFS) or overall survival (OS). Multivariate Cox regression was performed to assess hazard ratios (HRs) with 95% confidence intervals (95% CIs). Statistical analysis was performed by SPSS version 23.0 (IBM Corp.) with statistical significance defined as P analysis showed that patients who had undergone total resection (TR) had better PFS and OS than those with subtotal resection (STR) and biopsy (P = .002, P = .004, respectively). Within either univariate or multivariate analysis (P = .000, P = .07, respectively), histological type was an independent prognostic factor for PFS of CE [papillary type: HR 0.002, 95% CI (0.000-0.073), P = .001, tanycytic type: HR 0.010, 95% CI (0.000-0.218), P = .003].It was the first integrative analysis of CE to elucidate the correlation between kinds of factors and prognostic outcomes. Definite histological type and safely TR were foundation of CE's management. 4.

  17. Evaluation of Tumor Markers and Their Impact on Prognosis in Gallbladder, Bile Duct and Cholangiocellular Carcinomas - A Pilot Study.

    Science.gov (United States)

    Liska, Vaclav; Treska, Vladislav; Skalicky, Tomas; Fichtl, Jakub; Bruha, Jan; Vycital, Ondrej; Topolcan, Ondrej; Palek, Richard; Rosendorf, Jachym; Polivka, Jiri; Holubec, Lubos

    2017-04-01

    The behavior of tumor markers in biliary tract malignancies is not well-known and has been scarcely studied. Such markers could play important roles in diagnostic and prognostic schemes as well as in decision-making about the best treatment strategies. This study analyzed the preoperative serum levels of conventional tumor markers (AFP, CEA, CA 19-9, CA 72-4), proliferative marker thymidine kinase (TK) and cytokeratins (TPA, TPS and CYFRA 21.1) in patients with gallbladder carcinoma, bile duct carcinoma (Klatskin) and cholangiocellular carcinoma, in relation to the patient prognosis. The study aimed in finding the role of tumor markers in not properly investigated diseases, where their importance is often marginalized. The study included 43 patients, who underwent either radical surgical procedure (n=21) or explorative laparotomy without any surgical treatment (n=22) for gallbladder carcinoma, bile duct carcinoma (Klatskin tumor) and cholangiocellular carcinoma (24, 8 and 11 patients, respectively) between 2003 and 2010 at our Department. The association of serum tumor markers and patients' prognosis were assessed for the entire cohort and for each cancer type and also with regard to treatment (radical surgery versus explorative laparotomy). Overall survival (OS) and disease-free interval (DFI) were estimated by the Kaplan-Meier method and statistically evaluated using the LogRank test. DFI was computed only in the subgroup of patients treated by radical surgery. The statistical analysis of tumor markers revealed TK as a poor prognostic factor for shorter DFI (HR=3.5, 95%CI=0.6-21.3, ptumor markers for assessment of prognosis (OS or DFI) in patients with gallbladder carcinoma, bile duct carcinoma, and cholangiocellular carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  18. Safety, Efficacy, and Persistence of Long-Term Mirabegron Treatment for Overactive Bladder in the Daily Clinical Setting: Interim (1-Year) Report from a Japanese Post-Marketing Surveillance Study.

    Science.gov (United States)

    Kato, Daisuke; Tabuchi, Hiromi; Uno, Satoshi

    2017-08-01

    To report interim 1-year results from a 3-year surveillance study evaluating safety, efficacy, and persistence of long-term mirabegron for overactive bladder (OAB). Patients starting treatment with mirabegron for urinary urgency, daytime frequency, and urgency incontinence associated with OAB were registered and followed up for 3 years. Data were collected on adverse drug reactions (ADR), changes in OAB symptoms, changes in Overactive Bladder Symptom Score (OABSS), and treatment discontinuations. Treatment persistence rates were calculated by Kaplan-Meier analysis. Eighty-one ADR were observed in 72/1139 patients (6.3%) through 1 year of mirabegron treatment, with the incidence highest during the first month. No significant change in residual urine volume was observed at any observation point up to 1 year of mirabegron treatment. Mirabegron was deemed "effective" in 883/1091 patients (80.9%) at 1 year/discontinuation. Total OABSS was decreased with statistical significance at 3 months, 6 months, and 1 year, or at discontinuation (P similar for male and female patients but significantly higher for patients aged ≥65 years (67.3%; n = 908) compared with those aged <65 years (59.8%; n = 231; log-rank test: P = 0.032). Long-term OAB treatment with mirabegron was well-tolerated, with effectiveness maintained through 1 year. Mirabegron treatment persistence was higher than has been previously reported, and was greater in patients aged ≥65 years compared with those aged <65 years. © 2017 John Wiley & Sons Australia, Ltd.

  19. Clinical and biochemical outcomes of men undergoing radical prostatectomy or radiation therapy for localized prostate cancer

    Energy Technology Data Exchange (ETDEWEB)

    Schreiber, David; Weiss, Jeffrey P.; Safdieh, Joseph; Weiner, Joseph; Rotman, Marvin; Schwartz, David [Veterans Affairs, New York Harbor Healthcare System, Brooklyn (United States); Rineer, Justin [University of Florida Health Cancer Center at Orlando Health, Orlando (United States)

    2015-03-15

    We analyzed outcomes of patients with prostate cancer undergoing either radical retropubic prostatectomy (RRP) +/- salvage radiation or definitive radiation therapy (RT) +/- androgen deprivation. From 2003-2010 there were 251 patients who underwent RRP and 469 patients who received RT (> or =7,560 cGy) for prostate cancer. Kaplan-Meier analysis was performed with the log-rank test to compare biochemical control (bCR), distant metastatic-free survival (DMPFS), and prostate cancer-specific survival (PCSS) between the two groups. The median follow-up was 70 months and 61.3% of the men were African American. For low risk disease the 6-year bCR were 90.3% for RT and 85.6% for RRP (p = 0.23) and the 6-year post-salvage bCR were 90.3% vs. 90.9%, respectively (p = 0.84). For intermediate risk disease the 6-year bCR were 82.6% for RT and 59.7% for RRP (p < 0.001) and 82.6% vs. 74.0%, respectively, after including those salvaged with RT (p = 0.06). For high risk disease, the 6-year bCR were 67.4% for RT and 41.3% for RRP (p < 0.001) and after including those salvaged with RT was 67.4% vs. 43.1%, respectively (p < 0.001). However, there were no significant differences between the two groups in regards to DMPFS or PCSS. Treatment approaches utilizing RRP +/- salvage radiation or RT +/- androgen deprivation yielded equivalent DMPFS and PCSS outcomes. Biochemical control rates, using their respective definitions, appeared equivalent or better in those who received treatment with RT.

  20. Malignant transformation of oral leukoplakia: a retrospective cohort study of 218 Chinese patients

    International Nuclear Information System (INIS)

    Liu, Wei; Wang, Yu-Feng; Zhou, Hai-Wei; Shi, Peng; Zhou, Zeng-Tong; Tang, Guo-Yao

    2010-01-01

    Oral leukoplakia (OL) is the best-known potentially malignant disorder. A new binary system to grade dysplasia was proposed by WHO, but the biological significance in predicting malignant transformation risk is unknown. The objective of this study is to estimate the rate of malignant transformation in a long-term follow-up cohort, explore the usefulness of the new binary system of grading dysplasia and identify significant risk factors of OL malignant transformation in China. A total of 218 patients with clinical and histopathologic diagnosis of OL were retrospectively reviewed. They were selected among all archived files at the Department of Oral Mucosal Diseases, Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine. The mean follow-up period was 5.3 years. Among 218 cases, 39 (17.9%) OL patients developed oral cancer, with a mean duration of 5.2 years. Cox regression analysis revealed that dysplasia was an independent risk factor for OL malignant transformation, but age, gender, lesion site, diet habit, smoking and ethanol intake were not risk factors. High-risk dysplastic OL was associated with a 4.57-fold (95% confidence interval, 2.36-8.84; P < 0.001) increased risk of malignant transformation, compared with low-risk dysplasia. Consistent with this result, high-risk dysplastic OL had signicantly higher malignant incidence than low-risk dysplasia, particularly during the first 2-3 years of follow-up, by Kaplan-Meier analysis (Log-rank test, P < 0.001). The new binary system's function in predicting OL malignant transformation risk was investigated in this survey. The utilization of high-risk dysplasia as a significant indicator for evaluating malignant transformation risk in patients with OL was suggested, which may be helpful to guide treatment selection in clinical practice

  1. Impact of VEGF and VEGF receptor 1 (FLT1) expression on the prognosis of stage III esophageal cancer patients after radiochemotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Rades, D. [Dept. of Radiation Oncology, Univ. Medical Center Hamburg-Eppendorf (Germany); Dept. of Radiation Oncology, Univ. Hospital Schleswig-Holstein, Luebeck (Germany); Golke, H. [Dept. of Radiation Oncology, Univ. Medical Center Hamburg-Eppendorf (Germany); Inst. of Pathology, Univ. Medical Center Hamburg-Eppendorf (Germany); Schild, S.E. [Dept. of Radiation Oncology, Mayo Clinic, Scottsdale, AZ (United States); Kilic, E. [Inst. of Pathology, Univ. Medical Center Hamburg-Eppendorf (Germany); Inst. of Pathology, Univ. Hospital Basel-Stadt (Switzerland)

    2008-08-15

    Background and purpose: high expression of vascular endothelial growth factor (VEGF) is negatively associated with clinical outcome. The prognostic value of VEGF receptor 1 (FLT1) is unclear. This retrospective study investigated the impact of tumor expression of VEGF and FLT1 on outcome in 68 stage III esophageal cancer patients. Material and methods: the impact of tumor VEGF and FLT expression (< 10% vs. > 10%) and five additional potential prognostic factors on overall survival (OS) and locoregional control (LC) was retrospectively evaluated. These factors included T-stage (T3 vs. T4), N-stage (NO vs. N1), treatment (radiochemotherapy plus resection vs. radiochemotherapy alone), erythropoietin (ERYPO {sup registered} 10000, Janssen-Cilag, Neuss, Germany) administration during radiotherapy, and majority of hemoglobin levels during radiotherapy (< 12 vs. {>=} 12 g/dl). Subgroup analyses were performed for patients receiving resection (R0 vs. R1/2 resection). The factors found to be significant on univariate analyses (Kaplan-Meier method, log-rank test) were included in multivariate analyses performed with the Cox proportional hazard model. Results: on univariate analysis, improved OS was associated with T3 stage (p = 0.011), surgery (p = 0.019), and hemoglobin {>=} 12 g/dl (p < 0.001). Improved LC was associated with T3 stage (p = 0.025), hemoglobin {>=} 12 g/dl (p < 0.001), and VEGF negativity (p = 0.045). On multivariate analyses, only hemoglobin maintained significance. In patients having surgery, R0 resection was significantly better than R1/2 resection for OS (p < 0.001) and LC (p < 0.001). Conclusion: preradiotherapy tumor VEGF expression appears negatively correlated with outcomes, whereas FLT1 expression appears to have no significant impact on OS and LC. (orig.)

  2. Enteral Feeding During Chemoradiotherapy for Advanced Head-and-Neck Cancer: A Single-Institution Experience Using a Reactive Approach

    International Nuclear Information System (INIS)

    Clavel, Sebastien; Fortin, Bernard; Despres, Philippe; Donath, David; Soulieres, Denis; Khaouam, Nader; Charpentier, Danielle; Belair, Manon; Guertin, Louis; Nguyen-Tan, Phuc Felix

    2011-01-01

    Purpose: The optimal method for providing enteral nutrition to patients with head-and-neck cancer is unclear. The purpose of the present study was to evaluate the safety and efficacy of our reactive policy, which consists of the installation of a nasogastric (NG) feeding tube only when required by the patient's nutritional status. Methods and Materials: The records of all patients with Stage III and IV head-and-neck cancer treated with concomitant chemotherapy and radiotherapy between January 2003 and December 2006 were reviewed. The overall and disease-free survival rates were estimated using the Kaplan-Meier method and compared with the log-rank test. Results: The present study included 253 patients, and the median follow-up was 33 months. At 3 years, the estimated overall survival and disease-free survival rate was 82.8% and 77.8%, respectively, for the whole population. No survival difference was observed when the patients were compared according to the presence and absence of a NG tube or stratified by weight loss quartile. The mean weight loss during treatment for all patients was 10.4%. The proportion of patients requiring a NG tube was 49.8%, and the NG tube remained in place for a median duration of 40 days. No major complications were associated with NG tube installation. Only 3% of the patients were still dependent on enteral feeding at 6 months. Conclusion: These results suggest that the use of a reactive NG tube with an interdisciplinary team approach is a safe and effective method to manage malnutrition in patients treated with concomitant chemotherapy and radiotherapy for head-and-neck cancer.

  3. Prediction of Mortality after Emergent Transjugular Intrahepatic Portosystemic Shunt Placement: Use of APACHE II, Child-Pugh and MELD Scores in Asian Patients with Refractory Variceal Hemorrhage

    Energy Technology Data Exchange (ETDEWEB)

    Tzeng, Wen Sheng; Wu, Reng Hong; Lin, Ching Yih; Chen, Jyh Jou; Sheu, Ming Juen; Koay, Lok Beng; Lee, Chuan [Chi-Mei Foundation Medical Center, Tainan (China)

    2009-10-15

    This study was designed to determine if existing methods of grading liver function that have been developed in non-Asian patients with cirrhosis can be used to predict mortality in Asian patients treated for refractory variceal hemorrhage by the use of the transjugular intrahepatic portosystemic shunt (TIPS) procedure. Data for 107 consecutive patients who underwent an emergency TIPS procedure were retrospectively analyzed. Acute physiology and chronic health evaluation (APACHE II), Child-Pugh and model for end-stage liver disease (MELD) scores were calculated. Survival analyses were performed to evaluate the ability of the various models to predict 30-day, 60-day and 360-day mortality. The ability of stratified APACHE II, Child-Pugh, and MELD scores to predict survival was assessed by the use of Kaplan-Meier analysis with the log-rank test. No patient died during the TIPS procedure, but 82 patients died during the follow-up period. Thirty patients died within 30 days after the TIPS procedure; 37 patients died within 60 days and 53 patients died within 360 days. Univariate analysis indicated that hepatorenal syndrome, use of inotropic agents and mechanical ventilation were associated with elevated 30-day mortality (p < 0.05). Multivariate analysis showed that a Child-Pugh score > 11 or an MELD score > 20 predicted increased risk of death at 30, 60 and 360 days (p < 0.05). APACHE II scores could only predict mortality at 360 days (p < 0.05). A Child-Pugh score > 11 or an MELD score > 20 are predictive of mortality in Asian patients with refractory variceal hemorrhage treated with the TIPS procedure. An APACHE II score is not predictive of early mortality in this patient population.

  4. Prevalence of and risk factors for symptomatic urinary tract infection after endoscopic incision for the treatment of ureterocele in children.

    Science.gov (United States)

    Moriya, Kimihiko; Nakamura, Michiko; Nishimura, Yoko; Kanno, Yukiko; Kitta, Takeya; Kon, Masafumi; Shinohara, Nobuo

    2017-09-01

    To clarify the impact of endoscopic incision (EI) for ureterocele as an initial procedure, by performing a retrospective chart review, focusing on the prevalence of and risk factors for symptomatic urinary tract infection (UTI) after EI. In the present study we included children with ureterocele, managed between September 1994 and April 2016, who were observed conservatively without additional surgical management after EI. Ureterocele was categorized as intravesical or ectopic. Symptomatic UTI was defined as either recurrent non-febrile or febrile UTI. The prevalence of and risk factors for symptomatic UTI were analysed using Cox proportional hazard models or Kaplan-Meier curves, and the log-rank test. A total of 36 children met the inclusion criteria. The median age of the participants at EI was 8.9 months. Eleven children had symptomatic UTIs (febrile, n = 9; recurrent non-febrile, n = 2) during the median follow-up of 75.5 months. Initial symptomatic UTI in each child occurred UTI-free rate after EI was 65.6%. The risk factors for symptomatic UTI were female gender, duplex system, ectopic ureterocele, and unchanged hydronephrosis after EI. The present study determined the critical period and risk factors for symptomatic UTI after EI for the treatment of ureterocele. The results suggest that when conservative management is indicated after EI, patients, especially those with risk factors, should be followed carefully at least for 25 months after EI for symptomatic UTI. © 2017 The Authors BJU International © 2017 BJU International Published by John Wiley & Sons Ltd.

  5. Impact of VEGF and VEGF receptor 1 (FLT1) expression on the prognosis of stage III esophageal cancer patients after radiochemotherapy

    International Nuclear Information System (INIS)

    Rades, D.; Golke, H.; Schild, S.E.; Kilic, E.

    2008-01-01

    Background and purpose: high expression of vascular endothelial growth factor (VEGF) is negatively associated with clinical outcome. The prognostic value of VEGF receptor 1 (FLT1) is unclear. This retrospective study investigated the impact of tumor expression of VEGF and FLT1 on outcome in 68 stage III esophageal cancer patients. Material and methods: the impact of tumor VEGF and FLT expression ( 10%) and five additional potential prognostic factors on overall survival (OS) and locoregional control (LC) was retrospectively evaluated. These factors included T-stage (T3 vs. T4), N-stage (NO vs. N1), treatment (radiochemotherapy plus resection vs. radiochemotherapy alone), erythropoietin (ERYPO registered 10000, Janssen-Cilag, Neuss, Germany) administration during radiotherapy, and majority of hemoglobin levels during radiotherapy (< 12 vs. ≥ 12 g/dl). Subgroup analyses were performed for patients receiving resection (R0 vs. R1/2 resection). The factors found to be significant on univariate analyses (Kaplan-Meier method, log-rank test) were included in multivariate analyses performed with the Cox proportional hazard model. Results: on univariate analysis, improved OS was associated with T3 stage (p = 0.011), surgery (p = 0.019), and hemoglobin ≥ 12 g/dl (p < 0.001). Improved LC was associated with T3 stage (p = 0.025), hemoglobin ≥ 12 g/dl (p < 0.001), and VEGF negativity (p = 0.045). On multivariate analyses, only hemoglobin maintained significance. In patients having surgery, R0 resection was significantly better than R1/2 resection for OS (p < 0.001) and LC (p < 0.001). Conclusion: preradiotherapy tumor VEGF expression appears negatively correlated with outcomes, whereas FLT1 expression appears to have no significant impact on OS and LC. (orig.)

  6. Treatment and survival outcomes of small cell carcinoma of the esophagus: an analysis of the National Cancer Data Base.

    Science.gov (United States)

    Wong, Andrew T; Shao, Meng; Rineer, Justin; Osborn, Virginia; Schwartz, David; Schreiber, David

    2017-02-01

    Given the paucity of esophageal small cell carcinoma (SCC) cases, there are few large studies evaluating this disease. In this study, the National Cancer Data Base (NCDB) was utilized to analyze the clinical features, treatment, and survival of patients with esophageal SCC in a large, population-based dataset. We selected patients diagnosed with esophageal SCC from 1998 to 2011. Patients were identified as having no treatment, chemotherapy alone, radiation ± sequential chemotherapy, concurrent chemoradiation, and esophagectomy ± chemotherapy and/or radiation. Overall survival (OS) was analyzed using the Kaplan-Meier method and compared using the log-rank test. Multivariate Cox regression analysis was conducted to identify factors associated with OS. A total of 583 patients were identified. Most patients had stage IV disease (41.7%). Regarding treatment selection, chemoradiation was the most commonly utilized for patients with nonmetasatic disease, whereas chemotherapy alone was most common for metastatic patients. Esophagectomy (median survival 44.9 months with 3 year OS 50.5%) was associated with the best OS for patients with localized (node-negative) disease compared with chemotherapy alone (p < 0.001) or chemoradiation (p = 0.01). For locoregional (node-positive) disease, treatment with chemoradiation resulted in a median survival of 17.8 months and a 3 year OS 31.6%. On multivariate analysis, treatment with chemotherapy alone (p = 0.003) was associated with worse OS while esophagectomy (p = 0.04) was associated with improved OS compared to chemoradiation. Esophageal SCC is an aggressive malignancy with most patients presenting with metastatic disease. Either esophagectomy or chemoradiation as part of multimodality treatment appear to improve OS for selected patients with nonmetastatic disease. © 2016 International Society for Diseases of the Esophagus.

  7. Local Recurrence After Uveal Melanoma Proton Beam Therapy: Recurrence Types and Prognostic Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Caujolle, Jean-Pierre, E-mail: ncaujolle@aol.com [Department of Ophthalmology, Saint Roch Hospital, Nice Teaching Hospital, Nice (France); Paoli, Vincent [Department of Ophthalmology, Saint Roch Hospital, Nice Teaching Hospital, Nice (France); Chamorey, Emmanuel [Department of Radiation Oncology, Protontherapy Center, Centre Antoine Lacassagne, Nice (France); Department of Biostatistics and Epidemiology, Centre Antoine Lacassagne, Nice (France); Maschi, Celia; Baillif, Stéphanie [Department of Ophthalmology, Saint Roch Hospital, Nice Teaching Hospital, Nice (France); Herault, Joël [Department of Radiation Oncology, Protontherapy Center, Centre Antoine Lacassagne, Nice (France); Gastaud, Pierre [Department of Ophthalmology, Saint Roch Hospital, Nice Teaching Hospital, Nice (France); Hannoun-Levi, Jean Michel [Department of Radiation Oncology, Protontherapy Center, Centre Antoine Lacassagne, Nice (France)

    2013-04-01

    Purpose: To study the prognosis of the different types of uveal melanoma recurrences treated by proton beam therapy (PBT). Methods and Materials: This retrospective study analyzed 61 cases of uveal melanoma local recurrences on a total of 1102 patients treated by PBT between June 1991 and December 2010. Survival rates have been determined by using Kaplan-Meier curves. Prognostic factors have been evaluated by using log-rank test or Cox model. Results: Our local recurrence rate was 6.1% at 5 years. These recurrences were divided into 25 patients with marginal recurrences, 18 global recurrences, 12 distant recurrences, and 6 extrascleral extensions. Five factors have been identified as statistically significant risk factors of local recurrence in the univariate analysis: large tumoral diameter, small tumoral volume, low ratio of tumoral volume over eyeball volume, iris root involvement, and safety margin inferior to 1 mm. In the local recurrence-free population, the overall survival rate was 68.7% at 10 years and the specific survival rate was 83.6% at 10 years. In the local recurrence population, the overall survival rate was 43.1% at 10 years and the specific survival rate was 55% at 10 years. The multivariate analysis of death risk factors has shown a better prognosis for marginal recurrences. Conclusion: Survival rate of marginal recurrences is superior to that of the other recurrences. The type of recurrence is a clinical prognostic value to take into account. The influence of local recurrence retreatment by proton beam therapy should be evaluated by novel studies.

  8. IgV H mutations in blastoid mantle cell lymphoma characterize a subgroup with a tendency to more favourable clinical outcome.

    Science.gov (United States)

    Cogliatti, Sergio B; Bertoni, Francesco; Zimmermann, Dieter R; Henz, Samuel; Diss, Tim C; Ghielmini, Michele; Schmid, Ulrico

    2005-07-01

    Mantle cell lymphoma (MCL) is associated with a very unfavourable clinical course. This is particularly true for mantle cell lymphoma of the blastoid subtype (MCL-b). In order to define prognostic factors, we analysed the impact of immunoglobulin heavy chain variable (IgV H) gene somatic hypermutations on clinical outcome in a series of 21 cases of morphologically, phenotypically, and genotypically well-characterized MCL-b. Testing and estimation were performed using log-rank statistics and displayed on Kaplan-Meier graphs. Thirteen of 21 cases of MCL-b revealed a homology rate of > or = 99% compared to IgV H germ-line sequences in the databases and were scored as non-mutated. Eight of 21 cases (38%) of MCL-b were mutated. In MCL-b the mutation frequency was usually low and the mutation pattern was only rarely antigen-selected, in contrast to a control group of 11 cases with morphologically almost identical, but phenotypically and genotypically clearly distinguishable, diffuse large B cell lymphoma, derived, most likely, from germinal centre B cells. In our series of 21 MCL-b, positive IgV H mutational status, irrespective of varying homology thresholds, had no statistically significant prognostic impact on event-free or overall survival. However, mutated MCL-b tended to present more frequently at an earlier stage and without bone marrow involvement and to show lower rates of relapse and death, resulting in a more favourable clinical outcome. Copyright 2005 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  9. Gender and socioeconomic status as determinants of waiting time for inpatient surgery in a system with implicit queue management.

    Science.gov (United States)

    Arnesen, Kjell E; Erikssen, Jan; Stavem, Knut

    2002-12-01

    In a system with implicit queue management, to examine gender and socioeconomic status as determinants of waiting time for inpatient surgery, after adjusting for other potential predictors. A cohort of 452 subjects was examined in outpatient clinics of a general hospital and referred to inpatient surgery. They were followed until scheduled hospital admission (n=396) or until the requested procedure no longer was relevant (n=56). We compared waiting time between groups from referral date until hospital admission, using Kaplan-Meier estimates of waiting times and log rank test. A Cox proportional hazards model was used for assessing the risk ratio (RR) of hospital admission for scheduled surgery. Gender and socioeconomic status could not explain variations in waiting time. However, patients with suspected/verified neoplastic disease or a risk of serious deterioration without treatment had markedly shorter waiting times than the reference groups, with adjusted RR (95% confidence intervals (95%CI)) of time to receiving in-patient surgery of 2.3 (1.7-3.0) and 2.0 (1.3-3.0), respectively. Being on sick leave was associated with shorter waiting time, adjusted RR of 1.7 (1.2-2.5). Referrals from within the hospital or other hospitals had also shorter waiting times than referrals from primary health care physicians, adjusted RR=1.4 (1.1-1.8). There was no evidence of bias against women or people in lower socioeconomic classes in this implicit queue management system. However, patients' access to inpatient surgery was associated with malignancy, prognosis, sick leave status, physician experience, referral pattern and the major diagnosis category.

  10. Survival in patients with oral and maxillofacial diffuse large B-cell lymphoma

    Directory of Open Access Journals (Sweden)

    Janet Ofelia Guevara-Canales

    2013-11-01

    Full Text Available The purpose of this study was to determine the survival and prognostic factors of patients with diffuse large B-cell lymphoma (DLBCL of the oral cavity and maxillofacial region. Retrospectively, the clinical records of patients with a primary diagnosis of DLBCL of the oral cavity and maxillofacial region treated at the A.C. Camargo Hospital for Cancer, São Paulo, Brazil, between January 1980 and December 2005 were evaluated to determine (A overall survival (OS at 2 and 5 years and the individual survival percentage for each possible prognostic factor by means of the actuarial technique (also known as mortality tables, and the Kaplan Meier product limit method (which provided the survival value curves for each possible prognostic factor; (B prognostic factors subject to univariate evaluation with the log-rank test (also known as Mantel-Cox, and multivariate analysis with Cox's regression model (all the variables together. The data were considered significant at p ≤ 0.05. From 1980 to 2005, 3513 new cases of lymphomas were treated, of which 151 (4.3% occurred in the oral cavity and maxillofacial region. Of these 151 lesions, 48 were diffuse large B-cell lymphoma, with 64% for OS at 2 years and 45% for OS at 5 years. Of the variables studied as possible prognostic factors, multivariate analysis found the following variables have statistically significant values: age (p = 0.042, clinical stage (p = 0.007 and performance status (p = 0.031. These data suggest that patients have a higher risk of mortality if they are older, at a later clinical stage, and have a higher performance status.

  11. The Association of Visual Impairment With Clinical Outcomes in Hemodialysis Patients.

    Science.gov (United States)

    Hong, Yu Ah; Kim, Suk Young; Kim, Su-Hyun; Kim, Young Ok; Jin, Dong Chan; Song, Ho Chul; Choi, Euy Jin; Kim, Yong-Lim; Kim, Yon-Su; Kang, Shin-Wook; Kim, Nam-Ho; Yang, Chul Woo; Kim, Yong Kyun

    2016-05-01

    Visual impairment limits people's ability to perform daily tasks and affects their quality of life. We evaluated the impact of visual impairment on clinical outcomes in hemodialysis (HD) patients.HD patients were selected from the Clinical Research Center registry a prospective cohort study on dialysis patients in Korea. Visual impairment was defined as difficulty in daily life due to decreased visual acuity or blindness. The primary outcome was all-cause mortality and the secondary outcomes were cardiovascular and infection-related hospitalization.A total of 3250 patients were included. Seven hundred thirty (22.5%) of the enrolled patients had visual impairment. The median follow-up period was 30 months. The Kaplan-Meier curve and log-rank test showed that all-cause mortality rates (P visual impairment than in patients without visual impairment. In the multivariable analysis, visual impairment had significant predictive power for all-cause mortality (Hazard ratio [HR], 1.77, 95% confidence interval [CI], 1.21-2.61, P = 0.004) and cardiovascular hospitalization (HR 1.45 [1.00-1.90], P = 0.008) after adjusting for confounding variables. Of these 3250 patients, 634 patients from each group were matched by propensity scores. In the propensity score matched analysis, patients with visual impairment had independently significant associations with increased all-cause mortality (HR 1.69 [1.12-2.54], P = 0.01) and cardiovascular hospitalization (HR 1.48 [1.08-2.02], P = 0.01) compared with patients without visual impairment after adjustment for confounding variables.Our data demonstrated that visual impairment was an independent risk factor for clinical adverse outcomes in HD patients.

  12. Survival and Predictive Factors of Lethality in Hemodyalisis: D/I Polymorphism of The Angiotensin I-Converting Enzyme and of the Angiotensinogen M235T Genes

    Energy Technology Data Exchange (ETDEWEB)

    Alves, Mauro, E-mail: malves@cardiol.br; Silva, Nelson Albuquerque de Souza e; Salis, Lucia Helena Alvares; Pereira, Basilio de Bragança; Godoy, Paulo Henrique; Nascimento, Emília Matos do [Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ (Brazil); Oliveira, Jose Mario Franco [Universidade Federal Fluminense, Niterói, RJ (Brazil)

    2014-09-15

    End-stage kidney disease patients continue to have markedly increased cardiovascular disease morbidity and mortality. Analysis of genetic factors connected with the renin-angiotensin system that influences the survival of the patients with end-stage kidney disease supports the ongoing search for improved outcomes. To assess survival and its association with the polymorphism of renin-angiotensin system genes: angiotensin I-converting enzyme insertion/deletion and angiotensinogen M235T in patients undergoing hemodialysis. Our study was designed to examine the role of renin-angiotensin system genes. It was an observational study. We analyzed 473 chronic hemodialysis patients in four dialysis units in the state of Rio de Janeiro. Survival rates were calculated by the Kaplan-Meier method and the differences between the curves were evaluated by Tarone-Ware, Peto-Prentice, and log rank tests. We also used logistic regression analysis and the multinomial model. A p value ≤ 0.05 was considered to be statistically significant. The local medical ethics committee gave their approval to this study. The mean age of patients was 45.8 years old. The overall survival rate was 48% at 11 years. The major causes of death were cardiovascular diseases (34%) and infections (15%). Logistic regression analysis found statistical significance for the following variables: age (p = 0.000038), TT angiotensinogen (p = 0.08261), and family income greater than five times the minimum wage (p = 0.03089), the latter being a protective factor. The survival of hemodialysis patients is likely to be influenced by the TT of the angiotensinogen M235T gene.

  13. Comparative evaluation of fracture and defect in reciproc and rotary files in severe curved root canals

    Directory of Open Access Journals (Sweden)

    Mahdis Bagherian

    2015-03-01

    Full Text Available Introduction: Root canal instrumentation is an important phase in root canal therapy. Since success in endodontic treatment depends on file defect and fracture, the aim of this study was to compare the evaluation of defect and fracture in rotary and reciproc files in severe curved root canals. Materials & Methods: In this experimental study, 60 mesial canals of human closed apex molars with more than 30° canal curvature were randomly divided into two groups. In first group M-two rotary files number# 15, 20, and 25 and in second group R25 reciproc file were used for filing, respectively. A ×8 magnifier was applied to evaluate the defect or fracture presence in each side and if it were observed, a new file would be replaced. Therefore, the number of prepared canals with each file and fractured or defective files and the place of fracture in root canal were recorded. Kaplan Meier curve and log rank test were done by using SPSS v.22. Results: In rotary group, seven and two files were fractured and defected, respectively and four files were fractured and no defect was observed in reciproc group. Although the mean of the number of prepared canals until fracture or defect in rotary and reciproc groups was 3.3 and 7.06, respectively, there were no significant differences between two systems. All file’s fractures occurred in apical regions . Conclusion: The results showed that there was no significant difference in defects or fractures of rotary and reciproc systems. Reciproc instruments can be more effective than rotary ones because the root canal preparation in rotary instruments is longer than in reciproc system.

  14. Impact of viral E2-gene status on outcome after radiotherapy for patients with human papillomavirus 16-positive cancer of the uterine cervix

    International Nuclear Information System (INIS)

    Lindel, Katja; Villiers, Ethel-Michele de; Burri, Philipp; Studer, Ueli; Altermatt, Hans J.; Greiner, Richard H.; Gruber, Guenther

    2006-01-01

    Purpose: Integration of high-risk papillomavirus DNA has been considered an important step in oncogenic progression to cervical carcinoma. Disruption of the human papillomavirus (HPV) genome within the E2 gene is frequently a consequence. This study investigated the influence of episomal viral DNA on outcome in patients with advanced cervical cancer treated with primary radiotherapy. Methods and Materials: Paraffin-embedded biopsies of 82 women with locally advanced cervical cancer could be analyzed for HPV infection by multiplex polymerase chain reaction (PCR) by use of SPF1/2 primers. E2-gene intactness of HPV-16-positive samples was analyzed in 3 separate amplification reactions by use of the E2A, E2B, E2C primers. Statistical analyses (Kaplan-Meier method; log-rank test) were performed for overall survival (OS), disease-free survival (DFS), local progression-free survival (LPFS), and distant metastases-free survival (DMFS). Results: Sixty-one (75%) of 82 carcinomas were HPV positive, 44 of them for HPV-16 (72%). Seventeen of the 44 HPV-16-positive tumors (39%) had an intact E2 gene. Patients with a HPV-16-positive tumor and an intact E2 gene showed a trend for a better DFS (58% vs. 38%, p = 0.06) compared with those with a disrupted E2 gene. A nonsignificant difference occurred regarding OS (87% vs. 66%, p = 0.16) and DMFS (57% vs. 48%, p = 0.15). Conclusion: E2-gene status may be a promising new target, but more studies are required to elucidate the effect of the viral E2 gene on outcome after radiotherapy in HPV-positive tumors

  15. Comparison of treatment outcomes of endoscope-guided pneumatic dilation and laparoscopic Heller myotomy.

    Science.gov (United States)

    Wang, Hsin-Ming; Tai, Wei-Chen; Chuah, Seng-Kee; Lu, Hung-I; Lu, Lung-Sheng; Liang, Chih-Ming; Kuo, Chung-Huang; Chiu, Yi-Chun; Wu, Keng-Liang; Changchien, Chi-Sin

    2015-12-01

    The debate on which is the better choice between laparoscopic Heller myotomy (LHM) and endoscopic pneumatic dilation (PD) for esophageal achalasia has been ongoing for decades. This study aims to compare the results of endoscope-guided PD and LHM in 42 patients with achalasia between May 1996 and August 2011. Twenty-one patients who had received PD and 21 who had received LHM were enrolled. The cumulative remission rate was analyzed using the Kaplan-Meier method with the assessment of symptom scores between grades before and after PD or LHM done at 6 weeks, 6 months, 1 year, and then every year thereafter. Possible confounding factors related to the remissions were analyzed by Cox's proportional hazard model. For PD, the cumulative remission rates were 81.0% (1 year), 76.2% (2), 66.7% (3), 61.9% (4), and 47.6% (5). For LHM, the cumulative remission rates were 90.5% every year from the 1(st) to the 5(th). The LHM patients had significantly better remission rates than the PD patients (p = 0.033, by log-rank test). The LHM group had a longer hospital stay than the PD group [median (interquartile range): 8 (6.5-10) days vs. 3 (2-3) days, p < 0.001) and had more reflux complications (52.4% vs. 19.0%, p = 0.024). No perforation occurred in either group. In conclusion, the 5-year cumulative effectiveness of LHM is better than that of PD despite the association of LHM with more reflux events (52.4%). Copyright © 2015. Published by Elsevier Taiwan.

  16. Local Recurrence After Uveal Melanoma Proton Beam Therapy: Recurrence Types and Prognostic Consequences

    International Nuclear Information System (INIS)

    Caujolle, Jean-Pierre; Paoli, Vincent; Chamorey, Emmanuel; Maschi, Celia; Baillif, Stéphanie; Herault, Joël; Gastaud, Pierre; Hannoun-Levi, Jean Michel

    2013-01-01

    Purpose: To study the prognosis of the different types of uveal melanoma recurrences treated by proton beam therapy (PBT). Methods and Materials: This retrospective study analyzed 61 cases of uveal melanoma local recurrences on a total of 1102 patients treated by PBT between June 1991 and December 2010. Survival rates have been determined by using Kaplan-Meier curves. Prognostic factors have been evaluated by using log-rank test or Cox model. Results: Our local recurrence rate was 6.1% at 5 years. These recurrences were divided into 25 patients with marginal recurrences, 18 global recurrences, 12 distant recurrences, and 6 extrascleral extensions. Five factors have been identified as statistically significant risk factors of local recurrence in the univariate analysis: large tumoral diameter, small tumoral volume, low ratio of tumoral volume over eyeball volume, iris root involvement, and safety margin inferior to 1 mm. In the local recurrence-free population, the overall survival rate was 68.7% at 10 years and the specific survival rate was 83.6% at 10 years. In the local recurrence population, the overall survival rate was 43.1% at 10 years and the specific survival rate was 55% at 10 years. The multivariate analysis of death risk factors has shown a better prognosis for marginal recurrences. Conclusion: Survival rate of marginal recurrences is superior to that of the other recurrences. The type of recurrence is a clinical prognostic value to take into account. The influence of local recurrence retreatment by proton beam therapy should be evaluated by novel studies

  17. Oropharyngeal squamous cell carcinoma with known human papillomavirus status treated with definitive chemoradiotherapy: patterns of failure and toxicity outcomes

    International Nuclear Information System (INIS)

    Bledsoe, Trevor J; Koyfman, Shlomo A; Noble, Anisha R; Hunter, Grant K; Rybicki, Lisa A; Hoschar, Aaron; Chute, Deborah J; Saxton, Jerrold P; Greskovich, John F; Adelstein, David J

    2013-01-01

    Tumor human papillomavirus (HPV) status has emerged as one of the most powerful prognostic factors for disease control and survival in patients with oropharyngeal squamous cell carcinoma (OPSCC). We reviewed our experience in patients with OPSCC and known tumor HPV status treated with definitive chemoradiotherapy (CRT). Patients with stage III-IVb OPSCC and known tumor HPV status treated with CRT between 2006 and 2011 were identified from an IRB approved registry for this retrospective review. Outcomes were estimated using the Kaplan-Meier method and compared between HPV-positive and negative patients using the log-rank test. Of the 121 pts (89% male, 93% Caucasian) included in this study, median age was 57 (range: 40–73) and median follow-up was 21 months (range: 6–63). Ninety-seven (80%) patients were HPV-positive and 24 (20%) were HPV-negative. Primary site was base of tongue (55%), tonsil (44%), and oropharyngeal wall (2%). Two year rates of locoregional recurrence (3% vs. 26%; p = 0.002), disease free survival (93% vs. 64%; p = 0.001) and overall survival (94% vs 73%; p = 0.002) were superior in HPV-positive patients, while rates of distant recurrence were similar (3% vs. 5%; p = 0.98). While acute toxicities were similar between both groups, patients with HPV-positive disease were more likely to resume a normal diet (90% vs. 65%; p = 0.017) at last follow up. Also, no HPV-positive patient required a feeding tube beyond 6 months after treatment, compared with 24% of HPV-negative patients. Definitive CRT produces excellent rates of disease control with minimal late toxicity for patients with HPV-positive OPSCC. Studies of OPSCC should account for tumor HPV status when identifying factors prognostic for outcome

  18. The relationship between HPV status and chemoradiotherapy in the locoregional control of penile cancer.

    Science.gov (United States)

    Yuan, Zhigang; Naghavi, Arash O; Tang, Dominic; Kim, Youngchul; Ahmed, Kamran A; Dhillon, Jasreman; Giuliano, Anna R; Spiess, Philippe E; Johnstone, Peter A

    2018-03-27