WorldWideScience

Sample records for k-20 diesel powered

  1. Diesel-powered Passenger Cars and Light Trucks

    Science.gov (United States)

    2015-10-01

    Diesel-powered automobiles are in the news following emission concerns raised by the U.S. Environmental Protection Agency. This fact sheet contains background information on diesel-powered motor vehicles and diesel fuel.

  2. Power Quality Improvements in Wind Diesel Power Generation System

    Directory of Open Access Journals (Sweden)

    Omar Feddaoui

    2015-08-01

    Full Text Available Generation of electricity using diesel is costly for small remote isolated communities. At remote location electricity generation from renewable energy such as wind can help reduce the overall operating costs by reducing the fuel costs. However, the penetration of wind power into small diesel-based grids is limited because of its effect on power quality and reliability. This paper focuses on the combination of Wind Turbine and Diesel Generator systems for sustained power generation, to improve the power quality of wind generation system. The performances of the optimal control structure are assessed and discussed by means of a set of simulations.

  3. Photovoltaic / Diesel / Battery Hybrid Power Supply System

    CSIR Research Space (South Africa)

    Tazvinga, Henerica

    2010-10-01

    Full Text Available (SOPAC Miscellaneous Report 406, 2005). The battery bank is cycled frequently, shortening its lifetime. If the inverter fails there is complete loss of power to the load, unless the load can be supplied directly from the diesel generator for emergency purposes....5 Sizing the inverter ............................................................................................... 67 5.6 Sizing the charge Controller ............................................................................... 68 5.7 Sizing...

  4. Combustion, performance and emissions of a diesel power generator fueled with biodiesel-kerosene and biodiesel-kerosene-diesel blends

    International Nuclear Information System (INIS)

    Bayındır, Hasan; Işık, Mehmet Zerrakki; Argunhan, Zeki; Yücel, Halit Lütfü; Aydın, Hüseyin

    2017-01-01

    High percentages of biodiesel blends or neat biodiesel cannot be used in diesel engines due to high density and viscosity, and poor atomization properties that lead to some engine operational problems. Biodiesel was produced from canola oil by transesterification process. Test fuels were prepared by blending 80% of the biodiesel with 20% of kerosene (B80&K20) and 80% of the biodiesel with 10% of kerosene and 10% diesel fuel (B80&K10&D10). Fuels were used in a 4 cylinders diesel engine that was loaded with a generator. Combustion, performance and emission characteristics of the blend fuels and D2 in the diesel engine for certain loads of 3.6, 7.2 and 10.8 kW output power and 1500 rpm constant engine speed were experimented and deeply analyzed. It was found that kerosene contained blends had quite similar combustion characteristics with those of D2. Mass fuel consumption and Bscf were slightly increased for blend fuels. HC emissions slightly increased while NOx emissions considerably reduced for blends. It was resulted that high percentages of biodiesel can be a potential substitute for diesel fuel provided that it is used as blending fuel with certain amounts of kerosene. - Highlights: • Effects of kerosene and diesel addition to biodiesel in a diesel engine were investigated. • B80&K10 and B80&K10&D10 were tested and comparisons have been made with D2. • Similar fuel properties and combustion parameters have been found for all fuels. • Heat release initiated earlier for B80&K10 and B80&K10&D10. • CO and NOx emissions are lowered for B80&K10 and B80&K10&D10.

  5. Effect of Magnetic Field on Diesel Engine Power Fuelled with Jatropha-Diesel Oil

    Directory of Open Access Journals (Sweden)

    Sukarni Sukarni

    2017-08-01

    Full Text Available Jatropha oil has characteristics very close to the diesel fuel, so it has good prospects as a substitute or as a mixture of diesel fuel. Previous research showed that jatropha oil usage in diesel engines caused power to decrease. It was probably owing to the higher viscosity of the Jatropha oil compared to that of diesel oil. Installing the magnetic field in the fuel line of a diesel engine fueled with jatropha-diesel oil is expected to reduce the viscosity of jatropha-diesel oil mixture, hence improve the combustion reaction process. This research aims to know the influence of the magnetic field strength in the fuel lines to the power of diesel engines fueled with a mixture of jatropha-diesel oil. The composition of Jatropha oil-diesel was 20% jatropha oil and 80% diesel oil. Magnetic field variations were 0.122, 0.245 and 0.368 Tesla. The results showed that the higher the strength of the magnetic field was, the higher the average diesel engine’s power would be.

  6. Power Balancing of Inline Multicylinder Diesel Engine

    Directory of Open Access Journals (Sweden)

    S. H. Gawande

    2012-01-01

    Full Text Available In this work, a simplified methodology is presented for power balancing by reducing the amplitude of engine speed variation, which result in excessive torsional vibrations of the crankshaft of inline six-cylinder diesel engine. In modern fuel injection systems for reciprocating engines, nonuniform cylinder-wise torque contribution is a common problem due to nonuniform fuel supply due to a defect in fuel injection system, causing increased torsional vibration levels of the crankshaft and stress of mechanical parts. In this paper, a mathematical model for the required fuel adjustment by using amplitude of engine speed variation applied on the flywheel based on engine dynamics is suggested. From the found empirical relations and FFT analysis, the amplitude of engine speed variation (i.e., torsional vibration levels of the crankshaft of inline six-cylinder diesel engine genset can be reduced up to 55%. This proposed methodology is simulated by developing MATALB code for uniform and nonuniform working of direct injection diesel engine of SL90 type manufactured by Kirloskar Oil Engine Ltd., Pune, India.

  7. PV-diesel hybrid powers island nature reserve

    Energy Technology Data Exchange (ETDEWEB)

    Corkish, R. [University of New South Wales (Australia). Centre for Photovoltaic Engineering

    2001-03-01

    A short paper reports how by replacing a diesel-electric power supply with a PV-diesel-battery hybrid system, the diesel generator running time has been cut by 87%. The system provides all the power needs (including for the lighthouse, the lighthouse keeper's family, and a few visitors) on Montague Island nature reserve off Australia. The old system consisted of a pair of diesel-fuelled generator sets rated at 10 and 20 kVA. The main purposes for the changes were environmental, safety (in terms of transporting diesel fuel), and financial. Liquefied petroleum gas is now used for water heating and cooking. The reasons for not going for wind power are given. A diagram shows load and array power profiles for a May day in 1999.

  8. Diesel engines for independent power producers

    International Nuclear Information System (INIS)

    Berc, Dj.

    1999-01-01

    During recent years an increasing demand has been experienced in the stationary diesel engine market for 10-70 MW diesel units. For larger units this demand is being met by two-stroke low-speed crosshead uniflow scavenged diesel engines, capable of burning almost any fuel available on the market, both liquid of gaseous. The paper deals with service experience gained from such engines and their fuel capability. Examples of actual installations for IPPs and captive plants, together with an example of a typical feasibility study of such plants, is presented in the Appendix. (author)

  9. New local diesel power stations: an economic assessment

    International Nuclear Information System (INIS)

    Wills, R.J.; Reuben, B.G.

    1992-01-01

    A recent investigation examined the economic potential for electricity generation in the U.K. using large slow-speed two-stroke diesel engines of around 40MW unit output. Large diesels are a high efficiency technology, resilient to fuel quality, and with high reliability. Economic analysis compared diesels with other generating options for a range of fuel scenarios and discount rates. Merit order potential and total costs were also assessed. The diesels show superior economic qualities, both in terms of investment criteria and high merit position. They are economically comparable with combined cycle gas turbines, but combined cycle plant is essentially large-scale, whereas diesels in 40 MW units sizes can provide small-scale, high-efficiency local generation. Slow-speed diesels represent a sound investment for electricity supply. Diesels in local power stations in southern England would increase supply security and diversity. They are compatible with a cautious investment approach and are appropriate for the new market conditions in electricity supply. (author)

  10. Diesel fuel to dc power: Navy & Marine Corps Applications

    Energy Technology Data Exchange (ETDEWEB)

    Bloomfield, D.P. [Analytic Power Corp., Boston, MA (United States)

    1996-12-31

    During the past year Analytic Power has tested fuel cell stacks and diesel fuel processors for US Navy and Marine Corps applications. The units are 10 kW demonstration power plants. The USN power plant was built to demonstrate the feasibility of diesel fueled PEM fuel cell power plants for 250 kW and 2.5 MW shipboard power systems. We designed and tested a ten cell, 1 kW USMC substack and fuel processor. The complete 10 kW prototype power plant, which has application to both power and hydrogen generation, is now under construction. The USN and USMC fuel cell stacks have been tested on both actual and simulated reformate. Analytic Power has accumulated operating experience with autothermal reforming based fuel processors operating on sulfur bearing diesel fuel, jet fuel, propane and natural gas. We have also completed the design and fabrication of an advanced regenerative ATR for the USMC. One of the significant problems with small fuel processors is heat loss which limits its ability to operate with the high steam to carbon ratios required for coke free high efficiency operation. The new USMC unit specifically addresses these heat transfer issues. The advances in the mill programs have been incorporated into Analytic Power`s commercial units which are now under test.

  11. 76 FR 45741 - Approval and Promulgation of Air Quality Implementation Plans; Pennsylvania; Diesel-Powered Motor...

    Science.gov (United States)

    2011-08-01

    ... Promulgation of Air Quality Implementation Plans; Pennsylvania; Diesel-Powered Motor Vehicle Idling Act AGENCY... the Commonwealth's Diesel-Powered Motor Vehicle Idling Act (Act 124 of 2008, or simply Act 124) into... allowable time that heavy-duty, commercial highway diesel vehicles of over 10,000 pounds gross vehicle...

  12. 77 FR 17099 - Proposed Extension of Existing Information Collection; Diesel-Powered Equipment for Underground...

    Science.gov (United States)

    2012-03-23

    ... to underground coal miners who work in mines that use diesel-powered equipment. Diesel equipment can... provide important safety protections to underground coal miners who work in mines that use diesel-powered... maintenance of fire suppression systems on the equipment and at fueling stations; exhaust gas sampling...

  13. Bio-oil fueled diesel power plant; Biooeljyllae toimiva dieselvoimala

    Energy Technology Data Exchange (ETDEWEB)

    Vuorinen, A [Modigen Oy, Helsinki (Finland)

    1996-12-31

    The project mission is to develop a diesel power plant which is capable of using liquid bio-oils as the main fuel of the power plant. The applicable bio-oils are rape seed oils and pyrolysis oils. The project was started in 1994 by installing a 1.5 MW Vasa 4L32 engine in VTT Energy laboratory in Otaniemi. During 1995 the first tests with the rape seed oils were made. The tests show that the rape seed oil can be used in Vasa 32 engines without difficulties. In the second phase of the project during 1996 and 1997 pyrolysis oil made of wood will be tested. Finally a diesel power plant concept with integrated pyrolysis oil, electricity and heat production will be developed

  14. Bio-oil fueled diesel power plant; Biooeljyllae toimiva dieselvoimala

    Energy Technology Data Exchange (ETDEWEB)

    Vuorinen, A. [Modigen Oy, Helsinki (Finland)

    1995-12-31

    The project mission is to develop a diesel power plant which is capable of using liquid bio-oils as the main fuel of the power plant. The applicable bio-oils are rape seed oils and pyrolysis oils. The project was started in 1994 by installing a 1.5 MW Vasa 4L32 engine in VTT Energy laboratory in Otaniemi. During 1995 the first tests with the rape seed oils were made. The tests show that the rape seed oil can be used in Vasa 32 engines without difficulties. In the second phase of the project during 1996 and 1997 pyrolysis oil made of wood will be tested. Finally a diesel power plant concept with integrated pyrolysis oil, electricity and heat production will be developed

  15. Bio-oil fuelled diesel power plant; Biooeljyllae toimiva dieselvoimala

    Energy Technology Data Exchange (ETDEWEB)

    Vuorinen, A [Modigen Oy, Helsinki (Finland)

    1997-12-01

    The project mission is to develop a diesel power plant which is capable of using liquid bio-oils as the main fuel of the power plant. The applicable bio-oils are rape seed oils and pyrolysis oils. The project was started in 1994 by installing a 1.5 MW Vasa 4L32 engine in VTT Energy laboratory in Otaniemi. During 1995 the first tests with the rape seed oils were made. The tests show that the rape seed oil can be used in Vasa 32 engines without difficulties. In the second phase of the project during 1996 pyrolysis oil made of wood was tested. Finally a diesel power plant concept with integrated pyrolysis oil, electricity and heat production will be developed

  16. Implementasi Power Turbin pada Diesel Generator di Sistem Pembangkit Listrik Tenaga Diesel (PLTD dalam meningkatkan produksi energi listrik

    Directory of Open Access Journals (Sweden)

    Aditya Wahyu Saputra

    2017-01-01

    Full Text Available Aplikasi Power Turbine merupakan salah satu aplikasi PTO (Power Take-Off yang mampu meningkatkan produksi energi listrik dengan memanfaatkan aliran gas buang dari motor bakar (diesel maupun bensin yang mengandung energi kalor (panas yang digunakan untuk memutar turbin dan generator. Penelitian ini bertujuan mencari besar potensi daya listik yang bisa dihasilkan power turbine. Hal ini dicapai dengan cara menganalisa pengaruh pembebanan power turbine terhadap kinerja motor diesel sehingga kita dapat melihat seberapa jauh power turbine tersebut dapat diaplikasikan pada motor bakar. Dari hasil analisa dan perhitungan, didapat bahwa power turbine tersebut dapat menghasilkan energi listrik sebesar 250 kW pada continuous rating (93,23%.

  17. 30 CFR 75.1710 - Canopies or cabs; diesel-powered and electric face equipment.

    Science.gov (United States)

    2010-07-01

    ...-powered and electric face equipment, including shuttle cars, be provided with substantially constructed... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Canopies or cabs; diesel-powered and electric... Miscellaneous § 75.1710 Canopies or cabs; diesel-powered and electric face equipment. In any coal mine where the...

  18. Operating experience with diesel generators in Belgian nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Merny, R. [Association Vincotte, Avenue du Roi 157, B-1060 Bruxelles/Brussels (Belgium)

    1986-02-15

    Various problems have occurred on the diesel generators in the Belgian nuclear power plants, independently of the D.G. manufacturer or from the operating crew. Furthermore no individual part of the D.G. can be incriminated as being the main cause of the incidents. The incidents reported in this paper are chosen because of the importance for the safety or for the long repair period. The unavailability of a D.G. can only be detected by periodic tests and controls. Combined with a good preventive maintenance, the risks of incidents can be reduced. (author)

  19. Operating experience with diesel generators in Belgian nuclear power plants

    International Nuclear Information System (INIS)

    Merny, R.

    1986-01-01

    Various problems have occurred on the diesel generators in the Belgian nuclear power plants, independently of the D.G. manufacturer or from the operating crew. Furthermore no individual part of the D.G. can be incriminated as being the main cause of the incidents. The incidents reported in this paper are chosen because of the importance for the safety or for the long repair period. The unavailability of a D.G. can only be detected by periodic tests and controls. Combined with a good preventive maintenance, the risks of incidents can be reduced. (author)

  20. Solar-Diesel Hybrid Power System Optimization and Experimental Validation

    Science.gov (United States)

    Jacobus, Headley Stewart

    As of 2008 1.46 billion people, or 22 percent of the World's population, were without electricity. Many of these people live in remote areas where decentralized generation is the only method of electrification. Most mini-grids are powered by diesel generators, but new hybrid power systems are becoming a reliable method to incorporate renewable energy while also reducing total system cost. This thesis quantifies the measurable Operational Costs for an experimental hybrid power system in Sierra Leone. Two software programs, Hybrid2 and HOMER, are used during the system design and subsequent analysis. Experimental data from the installed system is used to validate the two programs and to quantify the savings created by each component within the hybrid system. This thesis bridges the gap between design optimization studies that frequently lack subsequent validation and experimental hybrid system performance studies.

  1. Dynamic multi-stage dispatch of isolated wind–diesel power systems

    DEFF Research Database (Denmark)

    Hu, Yu; Morales González, Juan Miguel; Pineda, Salvador

    2015-01-01

    -stage decision-making model is proposed to determine the diesel power output that minimizes the cost of running and maintaining the wind–diesel power system. Optimized operational decisions for each time period are generated dynamically considering the path-dependent nature of the optimal dispatch policy, given......An optimal dispatch strategy is crucial for an isolated wind–diesel power system to save diesel fuel and maintain the system stability. The uncertainty associated with the stochastic character of the wind is, though, a challenging problem for this optimization. In this paper, a dynamic multi...

  2. General design criteria for diesel-generator sets for nuclear power plants

    International Nuclear Information System (INIS)

    Rangarao, G.

    1975-01-01

    The design criteria for diesel-generators for nuclear power plants are examined. Applicable standards, loading, design performance, and characteristics to be considered in the selection of diesel-generator set and its auxiliary system are discussed. Also, engineered safety features loads together with loss of power safe shutdown loads and their starting sequence, analysis of voltage and frequency response and the diesel-generator ability to start various load blocks successfully to meet the reactor emergency core cooling requirements are discussed

  3. Reliability of diesel generators in the Finnish and Swedish nuclear power plants

    International Nuclear Information System (INIS)

    Pulkkinen, U.; Huovinen, T.; Norros, L.; Vanhala, J.

    1989-10-01

    Diesel generators are used as emergency AC-power sources in nuclear power plants and they produce electric power for other emergency systems during accidents in which offsite power is lost. The reliability of diesel generators is thus of major concern for overall safety of nuclear power plants. In this study we consider the reliability of diesel generators in the Swedish and Finnish nuclear power plants on the basis of collected operational experience. We classify the occurred failures according to their functional criticality, type and cause. The failures caused by human errors in maintenance and testing are analysed in detail. We analyse also the reliability of the diesel generator subsystems. Further, we study the effect of surveillance test and the type of test on the reliability. Finally we construct an unavailability model for single diesel generator unit and discuss the findings of the study giving some practical recommendations

  4. 30 CFR 75.1907 - Diesel-powered equipment intended for use in underground coal mines.

    Science.gov (United States)

    2010-07-01

    ... underground coal mines. 75.1907 Section 75.1907 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Diesel-Powered Equipment § 75.1907 Diesel-powered equipment intended for use in underground coal mines. (a) As of...

  5. Determination of reliability criteria for standby diesel generators at a nuclear power station

    International Nuclear Information System (INIS)

    Evans, M.G.K.

    1987-01-01

    The requirement for standby diesel generators at nuclear power stations is developed and a probabilistic approach used to define the reliability parameters. The present criteria used when ordering a diesel generator are compared with the testing required by the regulatory body and the most likely requirement following an accident. The impact of this on the diesels at a particular station and the root cause of failures are discussed. (orig.)

  6. 30 CFR 36.4 - Mobile diesel-powered transportation equipment for which certificates of approval may be granted.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Mobile diesel-powered transportation equipment... REQUIREMENTS FOR PERMISSIBLE MOBILE DIESEL-POWERED TRANSPORTATION EQUIPMENT General Provisions § 36.4 Mobile... of approval will be granted for completely assembled mobile diesel-powered transportation equipment...

  7. Standardized small diesel power plants for rural electrification in Tanzania

    International Nuclear Information System (INIS)

    Holmqvist, A.; Soerman, J.; Gullberg, M.; Kjellstroem, B.

    1993-01-01

    This study focuses on small townships where the forecasted power demand stays below 500 kW during the ten first years. Case study calculations were made where two hypothetical load centres form the base. Each load centre is assumed to be supplied by two alternative standardized diesel power plants. One option is a power plant consisting of two medium speed (750 rpm) generator sets, one always on stand-by. Alternatively, a power plant consisting of three high speed (1500 rpm) generator sets is evaluated for each hypothetical load centre. The calculations clearly show that the high speed, three unit option comes out cheaper than the two unit, medium speed option in all the considered cases. The fuel costs per kWh generated are almost the same in all the cases studied, i.e. between 6 and 7 US cents. The medium speed engine tends to consume more fuel per kWh generated than the high speed, as it runs more often on part load. Consequently, the fuel costs will be slightly higher for this option. It is also of interest to compare the plant failure rate of the two options. In this study no proper probability evaluation has been made, but some general reflections can be worth considering. The availability of spare parts in Tanzania is doubtful. Many small diesel power plants presently operating have to wait indefinitely, when a failure appears that requires spare parts. As long as the individual sets have the same, or nearly the same failure rate, a three unit plant has lower probability for total loss of generating capacity than a two unit plant. The main conclusion of this evaluation is that for electricity generation in rural Tanzanian villages, power plants with three small, high speed generator sets are preferable to plants with two, medium speed generator sets. A power plant made out of small sets requires less capital, consumes less fuel and is not as likely to loose its generating capacity totally. 16 refs, 10 figs, 21 tabs

  8. 500 Watt Diesel Fueled TPV Portable Power Supply

    Science.gov (United States)

    Horne, W. E.; Morgan, M. D.; Sundaram, V. S.; Butcher, T.

    2003-01-01

    A test-bed 500 watt diesel fueled thermophotovoltaic (TPV) portable power supply is described. The goal of the design is a compact, rugged field portable unit weighing less than 15 pounds without fuel. The conversion efficiency goal is set at 15% fuel energy to electric energy delivered to an external load at 24 volts. A burner/recuperator system has been developed to meet the objectives of high combustion air preheat temperatures with a compact heat exchanger, low excess air operation, and high convective heat transfer rates to the silicon carbide emitter surface. The burner incorporates a air blast atomizer with 100% of the combustion air passing through the nozzle. Designed firing rate of 2900 watts at 0.07 gallons of oil per hour. This incorporates a single air supply dc motor/fan set and avoids the need for a system air compressor. The recuperator consists of three annular, concentric laminar flow passages. Heat from the combustion of the diesel fuel is both radiantly and convectively coupled to the inside wall of a cylindrical silicon carbide emitter. The outer wall of the emitter then radiates blackbody energy at the design temperature of 1400°C. The cylindrical emitter is enclosed in a quartz envelope that separates it from the photovoltaic (PV) cells. Spectral control is accomplished by a resonant mesh IR band-pass filter placed between the emitter and the PV array. The narrow band of energy transmitted by the filter is intercepted and converted to electricity by an array of GaSb PV cells. The array consists of 216 1-cm × 1-cm GaSb cells arranged into series and parallel arrays. An array of heat pipes couple the PV cell arrays to a heat exchanger which is cooled by forced air convection. A brief status of the key TPV technologies is presented followed by data characterizing the performance of the 500 watt TPV system.

  9. Study of In-Cylinder Reactions of High Power-Density Direct Injection Diesel Engines

    National Research Council Canada - National Science Library

    Jansons, M

    2004-01-01

    Direct-injection (DI) Diesel or compression-ignition (CI) engine combustion process is investigated when new design and operational strategies are employed in order to achieve a high power-density (HPD) engine...

  10. Techno-economic Analysis of a Wind-Diesel Hybrid Power System in the South Algeria

    Directory of Open Access Journals (Sweden)

    Khaireddine Allali

    2015-07-01

    Full Text Available The electrical energy is often produced with the help of diesel generators in isolated areas in the Saharan region. While the latter requiring relatively little investment because is generally expensive to exploit due to the transportation to remote areas adds extra cost, significant fuel consumption and relatively high maintenance cost, etc. Moreover, the electricity production by the diesel is ineffective, presents significant environmental risks. But these isolated areas have significant wind energy potential; which is good position for the exploitation of clean and sustainable wind energy. The use of wind-diesel power system is widely recommended especially to reduce fuel consumption and in this way to reduce system operating costs and environmental impact. The subject of this paper is to present the techno-economic analysis of a wind-diesel hybrid power system. In this context, the contribution envisaged with this research is to collaborate on the optimal design of a hybrid power system including a wind turbine generator, a diesel generator and an energy storage system for powering a continuous way an isolated site in the South Algerian installed power of 120 kW.This system has a high control strategy for the management of different power sources (wind, diesel, battery that depending to weather conditions, especially wind speed values and the power demanded by the consumer load.

  11. Research on H2 speed governor for diesel engine of marine power station

    Science.gov (United States)

    Huang, Man-Lei

    2007-09-01

    The frequency stability of a marine power system is determined by the dynamic characteristic of the diesel engine speed regulation system in a marine power station. In order to reduce the effect of load disturbances and improve the dynamic precision of a diesel engine speed governor, a controller was designed for a diesel engine speed regulation system using H2 control theory. This transforms the specifications of the system into a standard H2 control problem. Firstly, the mathematical model of a diesel engine speed regulation system using an H2 speed governor is presented. To counter external disturbances and model uncertainty, the design of an H2 speed governor rests on the problem of mixed sensitivity. Computer simulation verified that the H2 speed governor improves the dynamic precision of a system and the ability to adapt to load disturbances, thus enhancing the frequency stability of marine power systems.

  12. Optimal construction and combined wind and diesel power production in a regional power purchase

    Energy Technology Data Exchange (ETDEWEB)

    Lautala, P.; Antila, H.; Raekkoelaeinen, J.; Heikkilae, H. [Tampere Univ. of Technology (Finland). Automation and Control Inst.

    1998-12-31

    A weak electricity transmission and distribution network and a wind generator were modelled by a non-linear dynamic model. Energy purchase of a small utility was modelled as a linear mixed integer optimisation problem. The dynamic model was used to simulate the effects of distance between the wind generator and a regional power grid and the effects of changes in the production of the wind generator. The optimisation model was used to investigate the effect of the combined diesel and wind production. In this case the results show that if the distance between the generator and the network grid is more than 70 km, then voltage fluctuations exceed acceptable levels. The optimisation provides the value of the combined diesel and wind production. (orig.)

  13. Modelling and automatic reactive power control of isolated wind-diesel hybrid power systems using ANN

    International Nuclear Information System (INIS)

    Bansal, R.C.

    2008-01-01

    This paper presents an artificial neural network (ANN) based approach to tune the parameters of the static var compensator (SVC) reactive power controller over a wide range of typical load model parameters. The gains of PI (proportional integral) based SVC are optimised for typical values of the load voltage characteristics (n q ) by conventional techniques. Using the generated data, the method of multi-layer feed forward ANN with error back propagation training is employed to tune the parameters of the SVC. An ANN tuned SVC controller has been applied to control the reactive power of a variable slip/speed isolated wind-diesel hybrid power system. It is observed that the maximum deviations of all parameters are more for larger values of n q . It has been shown that initially synchronous generator supplies the reactive power required by the induction generator and/or load, and the latter reactive power is purely supplied by the SVC

  14. Modelling and automatic reactive power control of isolated wind-diesel hybrid power systems using ANN

    Energy Technology Data Exchange (ETDEWEB)

    Bansal, R.C. [Electrical and Electronics Engineering Division, School of Engineering and Physics, The University of the South Pacific, Suva (Fiji)

    2008-02-15

    This paper presents an artificial neural network (ANN) based approach to tune the parameters of the static var compensator (SVC) reactive power controller over a wide range of typical load model parameters. The gains of PI (proportional integral) based SVC are optimised for typical values of the load voltage characteristics (n{sub q}) by conventional techniques. Using the generated data, the method of multi-layer feed forward ANN with error back propagation training is employed to tune the parameters of the SVC. An ANN tuned SVC controller has been applied to control the reactive power of a variable slip/speed isolated wind-diesel hybrid power system. It is observed that the maximum deviations of all parameters are more for larger values of n{sub q}. It has been shown that initially synchronous generator supplies the reactive power required by the induction generator and/or load, and the latter reactive power is purely supplied by the SVC. (author)

  15. Statistical inquiry on the reliability of emergency diesel stations in German nuclear power plants

    International Nuclear Information System (INIS)

    1983-01-01

    This statistic inquiry is based on 692 occurrances in 40 diesel stations of 10 German nuclear power plants. Various parameters influencing the failure behaviour of diesel stations were investigated on only significant plant-specific influences and the impact of diesel station circuitry on failure behaviour were established. According to the results of this inquiry, running time, start-up number and increasing operational experience do not apparently influence the failure behaviour of diesel stations. The expected failure probability of diesel stations varies with the different nuclear power plants. Taking into account both start-up and operational failures, (with monthly inspections and running times of up to 2 h), this value is in the range of 1.6 x 10 -2 to 1.7 x 10 -3 per application. Considering failure data of all diesel stations, the failure probability (start-up and operational failures) is 8.1 x 10 -3 per application. On account of the two common-mode failures registered, a common-mode failure probability of 10 -3 was established. The inquiry also showed that non-availability of diesel stations is essentially determined by maintenance intervals. (orig.) [de

  16. Power and Torque Characteristics of Diesel Engine Fuelled by Palm-Kernel Oil Biodiesel

    Directory of Open Access Journals (Sweden)

    Oguntola J. ALAMU

    2009-07-01

    Full Text Available Short-term engine performance tests were carried out on test diesel engine fuelled with Palm kernel oil (PKO biodiesel. The biodiesel fuel was produced through transesterification process using 100g PKO, 20.0% ethanol (wt%, 1.0% potassium hydroxide catalyst at 60°C reaction temperature and 90min. reaction time. The diesel engine was attached to a general electric dynamometer. Torque and power delivered by the engine were monitored throughout the 24-hour test duration at 1300, 1500, 1700, 2000, 2250 and 2500rpm. At all engine speeds tested, results showed that torque and power outputs for PKO biodiesel were generally lower than those for petroleum diesel. Also, Peak torque for PKO biodiesel occurred at a lower engine speed compared to diesel.

  17. Reliability of diesel generators at the Finnish and Swedish nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Pulkkinen, Urho [Technical Research Centre of Finland, Vuorimiehentie 5, SF-02150, Espoo (Finland)

    1986-02-15

    The operating experiences of 40 stand-by diesel generators at the Finnish and Swedish nuclear power plants have been analysed with special emphasis on the impact of the frequency of surveillance testing and of the test procedure on diesel generator reliability, the contribution of design, manufacturing, testing and maintenance errors and the potential and actual common cause failures, The results pf the analyses consisted both practical recommendations and mathematical reliability models and useful reliability data. (author)

  18. Dynamic multi-stage dispatch of isolated wind–diesel power systems

    International Nuclear Information System (INIS)

    Hu, Yu; Morales, Juan M.; Pineda, Salvador; Sánchez, María Jesús; Solana, Pablo

    2015-01-01

    Highlights: • Optimal decision-making model for isolated hybrid wind–diesel power system is proposed. • Wind power uncertainty and conditional operating cost are considered. • Battery wear cost of the energy storage system is included in the model. • The results are compared with deterministic dispatch strategies. - Abstract: An optimal dispatch strategy is crucial for an isolated wind–diesel power system to save diesel fuel and maintain the system stability. The uncertainty associated with the stochastic character of the wind is, though, a challenging problem for this optimization. In this paper, a dynamic multi-stage decision-making model is proposed to determine the diesel power output that minimizes the cost of running and maintaining the wind–diesel power system. Optimized operational decisions for each time period are generated dynamically considering the path-dependent nature of the optimal dispatch policy, given the plausible future realizations of the wind power production. A numerical case study is analyzed and it is demonstrated that the proposed stochastic dynamic optimization model significantly outperforms the traditional deterministic dispatch strategies

  19. A light-weight, yet powerful diesel locomotive from Vossloh

    Energy Technology Data Exchange (ETDEWEB)

    Marti, Mariano [Vossloh Rail Vehicles, Albuixech/Valencia (Spain)

    2013-05-15

    The EUROLIGHT is an eight-wheeled diesel-electric locomotive developed by Vossloh Rail Vehicles for interoperable rail traffic. With its low axle load of less than 20 tonnes, it can be deployed flexibly on both main lines and secondary ones.

  20. Economic Analysis of Diesel-Fuel Replacement by Crude Palm Oil in Indonesian Power Plants

    Directory of Open Access Journals (Sweden)

    Petr Procházka

    2018-02-01

    Full Text Available Indonesia needs to find an alternative fuel to substitute diesel in their power plants in order to reduce the use of nonrenewable energy sources. The Indonesian government has a target to reduce oil fuel consumption while improving the efficiency of energy utilization. Crude palm oil is proposed to be used for this substitution. In this paper, the authors conduct an economic analysis of the replacement of diesel by crude palm oil. To predict future prices, a time series analysis is conducted using AutoRegressive Integrated Moving-Average method. A financial analysis of a specific project (0.75-MW power plant is conducted using static financial indicators (payback period, return on investment. Results show that replacing diesel with crude palm oil may be profitable. This is especially true for the proposed prospects of diesel price evolution. Analysis shows that the price of crude oil, which is the main factor in the pricing of diesel, may go up. Also, recently Indonesian currency depreciated against the US dollar, which also implies a higher cost of diesel.

  1. Technical model for optimising PV/diesel/battery hybrid power systems

    CSIR Research Space (South Africa)

    Tazvinga, Henerica

    2010-08-31

    Full Text Available A solar-based power supply system, such as a photovoltaic (PV)-diesel-battery system, is a particularly attractive option for decentralised power supply in southern Africa where solar radiation is ubiquitous in most countries. Such systems can make...

  2. Study of a solar PV-diesel-battery hybrid power system for a remotely located population near Rafha, Saudi Arabia

    International Nuclear Information System (INIS)

    Rehman, Shafiqur; Al-Hadhrami, Luai M.

    2010-01-01

    This study presents a PV-diesel hybrid power system with battery backup for a village being fed with diesel generated electricity to displace part of the diesel by solar. The hourly solar radiation data measured at the site along with PV modules mounted on fixed foundations, four generators of different rated powers, diesel prices of 0.2-1.2US$/l, different sizes of batteries and converters were used to find an optimal power system for the village. It was found that a PV array of 2000 kW and four generators of 1250, 750, 2250 and 250 kW; operating at a load factor of 70% required to run for 3317 h/yr, 4242 h/yr, 2820 h/yr and 3150 h/yr, respectively; to produce a mix of 17,640 MWh of electricity annually and 48.33 MWh per day. The cost of energy (COE) of diesel only and PV/diesel/battery power system with 21% solar penetration was found to be 0.190$/kWh and 0.219$/kWh respectively for a diesel price of 0.2$/l. The sensitivity analysis showed that at a diesel price of 0.6$/l the COE from hybrid system become almost the same as that of the diesel only system and above it, the hybrid system become more economical than the diesel only system. (author)

  3. PM-10 emissions and power of a Diesel engine fueled with crude and refined Biodiesel from salmon oil

    Energy Technology Data Exchange (ETDEWEB)

    J.F. Reyes; M.A. Sepulveda [University of Concepcion (Chile). Department of Mechanization and Energy, Faculty of Agricultural Engineering

    2006-09-15

    Power response and level of particulate emissions were assessed for blends of Diesel-crude Biodiesel and Diesel-refined Biodiesel. Crude Biodiesel and refined Biodiesel or methyl ester, were made from salmon oil with high content of free fatty acids, throughout a process of acid esterification followed by alkaline transesterification. Blends of Diesel-crude Biodiesel and Diesel-refined Biodiesel were tested in a diesel engine to measure simultaneously the dynamometric response and the particulate material (PM-10) emission performance. The results indicate a maximum power loss of about 3.5% and also near 50% of PM-10 reduction with respect to diesel when a 100% of refined Biodiesel is used. For blends with less content of either crude Biodiesel or refined Biodiesel, the observed power losses are lower but at the same time lower reduction in PM-10 emissions are attained. 21 refs., 4 figs., 2 tabs.

  4. The feature of emergency diesel generator relaying protection in Tianwan nuclear power station

    International Nuclear Information System (INIS)

    Jiang Xiaopeng; Shi Yan; Li Cong

    2014-01-01

    This paper mainly introduces the function and feature of emergency diesel generator in nuclear power plant, which plays an important role in nuclear accident. It minutely tells about the feature and configuration of relay protection and discusses the rationality of protection scheme, which shows that it can be completely contented all kinds of operation states. It is an analysis and argument about the principle of relay protection in detail, that would operate correctly when emergency diesel generator be in abnormal operating and serious fault conditions, such as cut off emergency diesel generator in order to avoid more harm to emergency diesel generator. It analyzes how the relay responses quickly and locks up the protection action under perturbations in the external power, so it can avoid unnecessary resection of emergency diesel generator to emergency power supply loss and effect of nuclear safety. It also analyzes the flexible use of protection setting of the protective relay to meet various operating status. It elaborates the particularity of relay protection which is due to the particularity of nuclear safety. It analyses the possibility of relay protection which has to be applied to other equipment and the protection setting that was provided by design institute, and puts forward the author's viewpoints. (authors)

  5. Diesel-generator reliability at nuclear power plants: data and preliminary analysis. Interim report

    International Nuclear Information System (INIS)

    McClymont, A.; McLagan, G.

    1982-06-01

    This report summarizes work performed under RP1233-1 relating to the collection and analysis of data pertaining to diesel generator reliability in nuclear power plants. Drawing from data collected on-site at plants, data supplied by utilites, and data from Licensee Event Reports (LERs), the report describes methods of deriving reliability estimates from data for use in probabilistic risk assessment and presents results when these methods are applied to data collected from 14 plants. Specifically, data are used to estimate diesel failure probabilities for failures to start and failure rates for failures to continue to run. A sampling theory approach and a Bayesian approach to failure probability estimation are compared. The data are used to derive estimates of diesel repair time for some plants, maintenance outages, and multiple diesel failure rates. In addition, a section is included that presents suggestions for failure-rate estimation when an accurate count of diesel start attempts at a plant is not available. The final section presents an analysis of diesel failures based on data from LERs, including a breakdown of failure event by subsystem, failure mode, and failure cause. Appendixes include detailed summaries of the data used in the analysis of previous sections

  6. An analysis of the performance benefits of short-term energy storage in wind-diesel hybrid power systems

    International Nuclear Information System (INIS)

    Shirazi, M.; Drouilhet, S.

    1996-01-01

    A variety of prototype high penetration wind-diesel hybrid power systems have been implemented with different amounts of energy storage. They range from systems with no energy storage to those with many hours worth of energy storage. There has been little consensus among wind-diesel system developers as to the appropriate role and amount of energy storage in such systems. Some researchers advocate providing only enough storage capacity to supply power during the time it takes the diesel genset to start. Others install large battery banks to allow the diesel(s) to operate at full load and/or to time-shift the availability of wind-generated electricity to match the demand. Prior studies indicate that for high penetration wind-diesel systems, short-term energy storage provides the largest operational and economic benefit. This study uses data collected in Deering, Alaska, a small diesel-powered village, and the hybrid systems modeling software Hybrid2 to determine the optimum amount of short-term storage for a particular high penetration wind-diesel system. These findings were then generalized by determining how wind penetration, turbulence intensity, and load variability affect the value of short term energy storage as measured in terms of fuel savings, total diesel run time, and the number of diesel starts

  7. TRANSIENT ANALYSIS OF WIND DIESEL POWER SYSTEM WITH FLYWHEEL ENERGY STORAGE

    Directory of Open Access Journals (Sweden)

    S. SUJITH

    2017-10-01

    Full Text Available Wind-Diesel Hybrid power generation is a viable alternative for generating continuous power to isolated power system areas which have inconsistent but potential wind power. The unpredictable nature of variable power from Wind generator to the system is compensated by Diesel generator, which supplies the deficit in generated power from wind to meet the instantaneous system load. However, one of the major challenges for such a system is the higher probability of transients in the form of wind and load fluctuations. This paper analyses the application of Flywheel Energy storage system (FESS to meet the transients during wind-speed and load fluctuations around high wind operation. The power system architecture, the distributed control mechanism governing the flow of power transfer and the modelling of major system components has been discussed and the system performances have been validated using MATLAB /Simulink software. Two cases of transient stages around the high wind system operation are discussed. The simulation results highlight the effective usage of FESS in reducing the peak overshoot of active power transients, smoothes the active power curves and helps in reducing the diesel consumption during the flywheel discharge period, without affecting the continuous power supply for meeting the instantaneous load demand.

  8. Generation of electric power through wind-diesel hybrid system for a hospital; Geracao de energia eletrica atraves de sistema hibrido diesel-eolico para um hospital

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, Silvio Carlos Anibal de; Freire, Raphael Lopes [Universidade Federal do Rio de Janeiro (DEM/UFRJ), RJ (Brazil). Dept. de Engenharia Mecanica], e-mail: silvioa@gmail.com, e-mail: raphaellfreire@gmail.com

    2008-07-01

    This paper presents a wind-diesel hybrid power simulation using the software Homer. The model is applied to the case study of Hospital das Clinicas da UNICAMP Analysis of several alternative energy facilities like wind, photovoltaic (PV), and connection of the isolated system with the grid is done. The costs used in the simulation indicated that the best results were obtained with the wind-diesel system. The payback period for the investment in the system is 8 years. (author)

  9. A reliability program for emergency diesel generators at nuclear power plants: Maintenance, surveillance, and condition monitoring

    International Nuclear Information System (INIS)

    Lofgren, E.V.; Henderson, W.; Burghardt, D.; Kripps, L.; Rothleder, B.

    1988-12-01

    This report is a companion report on NUREG/CR-5078, Volume 1, ''A Reliability Program for Emergency Diesel Generators at Nuclear Power Plants: Program Structure.'' The purpose of this report is to provide technical findings and insights related to: failure evaluation, troubleshooting, maintenance, surveillance, and condition monitoring. Examples and recommendations are provided for each of these areas based on actual emergency diesel generator (EDG) operating experience and the opinions of diesel generator experts. This report expands the more general guidance provided in Volume 1. In addition, a discussion of EDG interactions with other plant systems (e.g., instrument, air, service water, dc power) is provided since experience has shown that these support systems and their operation can adversely affect EDG reliability. Portions of this report have been designed for use by onsite personnel for evaluating operational characteristics of EDGs. 5 refs., 8 figs., 7 tabs

  10. Worldwide wind/diesel hybrid power system study: Potential applications and technical issues

    Energy Technology Data Exchange (ETDEWEB)

    King, W.R.; Johnson, B.L. III (Science Applications International Corp., McLean, VA (USA))

    1991-04-01

    The world market potential for wind/diesel hybrid technology is a function of the need for electric power, the availability of sufficient wind resource to support wind/diesel power, and the existence of buyers with the financial means to invest in the technology. This study includes data related to each of these three factors. This study does not address market penetration, which would require analysis of application specific wind/diesel economics. Buyer purchase criteria, which are vital to assessing market penetration, are discussed only generally. Countries were screened for a country-specific market analysis based on indicators of need and wind resource. Both developed countries and less developed countries'' (LDCs) were screened for wind/diesel market potential. Based on the results of the screening, ten countries showing high market potential were selected for more extensive market analyses. These analyses provide country-specific market data to guide wind/diesel technology developers in making design decisions that will lead to a competitive product. Section 4 presents the country-specific data developed for these analyses, including more extensive wind resource characterization, application-specific market opportunities, business conditions, and energy market characterizations. An attempt was made to identify the potential buyers with ability to pay for wind/diesel technology required to meet the application-specific market opportunities identified for each country. Additionally, the country-specific data are extended to corollary opportunities in countries not covered by the study. Section 2 gives recommendations for wind/diesel research based on the findings of the study. 86 refs.

  11. Worldwide wind/diesel hybrid power system study: Potential applications and technical issues

    Science.gov (United States)

    King, W. R.; Johnson, B. L., III

    1991-04-01

    The world market potential for wind/diesel hybrid technology is a function of the need for electric power, the availability of sufficient wind resource to support wind/diesel power, and the existence of buyers with the financial means to invest in the technology. This study includes data related to each of these three factors. This study does not address market penetration, which would require analysis of application specific wind/diesel economics. Buyer purchase criteria, which are vital to assessing market penetration, are discussed only generally. Countries were screened for a country-specific market analysis based on indicators of need and wind resource. Both developed countries and less developed countries (LDCs) were screened for wind/diesel market potential. Based on the results of the screening, ten countries showing high market potential were selected for more extensive market analyses. These analyses provide country-specific market data to guide wind/diesel technology developers in making design decisions that will lead to a competitive product. Section 4 presents the country-specific data developed for these analyses, including more extensive wind resource characterization, application-specific market opportunities, business conditions, and energy market characterizations. An attempt was made to identify the potential buyers with ability to pay for wind/diesel technology required to meet the application-specific market opportunities identified for each country. Additionally, the country-specific data are extended to corollary opportunities in countries not covered by the study. Section 2 gives recommendations for wind/diesel research based on the findings of the study.

  12. Possible alternatives for diesel powered mobile equipment for the conditions of deep mines

    Energy Technology Data Exchange (ETDEWEB)

    Paraszczak, J.; Kotersi, O [Laval Univ., Quebec City, PQ (Canada). Dept. of Mining, Metallurgical and Materials Engineering

    2008-07-01

    The challenges associated with mining at considerable depths were discussed. Mines such as Kidd Creek, LaRonde and Creighton are deeper than 2500 m. High rock temperature is among the challenges that operators face in such conditions. Conventional diesel powered load-hauling equipment constitute an additional source of heat and noxious gases. As such, more intense ventilation is needed in order to keep ambient temperature and air quality at a level that is acceptable for human workers. This paper examined possible alternatives for diesel powered equipment, including those that are commercially available as well as those that are underdevelopment or in the prototype stage. The equipment was reviewed with reference to the required infrastructure, stage of technology development and progress. The flexibility, practicality and economic viability of the equipment was also investigated. The potential for its use in deep Canadian mines was discussed along with the most promising drive alternatives for vehicles designed for deep mine operations. Electric drives have proven to be effective in many mining applications since they have significant advantages over diesel drives. The characteristics of cable powered equipment, trolley-wire powered equipment, and battery powered equipment were described. The key advantages and disadvantages of hybrid diesel electric equipment were also reviewed along with the viability of power plants based on the use of hydrogen. The principle types of hydrogen power plants include hydrogen combustion engines; HY-Drive systems and fuel cells. It was concluded that although there is no viable alternative for diesel engines at present, Canadian mining companies operating at great depths have made significant progress in these fields and remain among the leaders in mining innovation. 17 refs.

  13. Volatile organic compounds emissions from gasoline and diesel powered vehicle

    Energy Technology Data Exchange (ETDEWEB)

    Mugica, V [Universidad Autonoma Metropolitana, Mexico, D.F. (Mexico); Vega, E; Sanchez, G; Reyes, E; Arriaga, J. L [Instituto Mexicano del Petroleo, Mexico, D.F. (Mexico); Chow, J; Watson, J; Egami, R [Desert Research Institute, Reno, NV (United States)

    2001-01-01

    In this research, volatile organic compound emissions were characterized from gasoline and diesel vehicles. Sampling campaigns in the Metropolitan Area of Mexico City were designed and carried out in tunnels, crossroads, and truck and bus terminals. The samples were analyzed with gas chromatography getting more than 250 different compounds, being more or less 60 of them the 80% of all the emissions. The most abundant are the two carbon compounds, as a result of the combustion, and compounds related to fuels compositions, like isopentane, xylenes, toluene among others. The profiles obtained in tunnels and crossroads were very similar with the exception of the 3 and 4 carbon compounds, which were found in bigger proportion in the profiles at crossroads. This may probably be due to the blend with the ambient air. The profiles corresponding to trucks and buses have a smaller content of two carbon compounds and a bigger content of xylenes, toluene and ethylbenzene. The variations in the proportions of the compounds allow differentiating the profiles of vehicles using gasoline and diesel. [Spanish] En este trabajo se caracterizaron las emisiones de compuestos organicos volatiles provenientes de vehiculos a gasolina y a diesel. Para ello, se disenaron diversas campanas de muestreo en la zona Metropolitana de la Ciudad de Mexico, en tuneles, cruceros y estaciones de camiones de carga y autobuses. Las muestras se analizaron con cromatografia, de gases obteniendose mas de 250 compuestos distintos, de los cuales aproximadamente 60 corresponden a mas del 80% de las emisiones. Los compuestos mas abundantes son los de dos carbonos, resultado de la combustion, y 4 carbonos que se encontraron en mayor proporcion en los perfiles de cruceros, lo cual se debe probablemente a la mezcla con el aire ambiente. Los perfiles correspondientes a camiones de carga y autobuses tienen un menor contenido de compuestos de dos carbonos y un mayor contenido de xilenos, tolueno y etilbenceno. Estas

  14. Common cause failure rate estimates for diesel generators in nuclear power plants

    International Nuclear Information System (INIS)

    Steverson, J.A.; Atwood, C.L.

    1982-01-01

    Common cause fault rates for diesel generators in nuclear power plants are estimated, using Licensee Event Reports for the years 1976 through 1978. The binomial failure rate method, used for obtaining the estimates, is briefly explained. Issues discussed include correct classification of common cause events, grouping of the events into homogeneous data subsets, and dealing with plant-to-plant variation

  15. Energy performance analysis for a photovoltaic, diesel, battery hybrid power supply system

    CSIR Research Space (South Africa)

    Tazvinga, Henerica

    2010-03-01

    Full Text Available This paper looks at an energy performance analysis for a photovoltaic, diesel, and battery hybrid power supply system. The procedure starts by the identification of the hourly load requirements for a typical target consumer and the concept of load...

  16. A simple, robust and reliable wind diesel concept for remote power supply

    DEFF Research Database (Denmark)

    Lundsager, P.; Bindner, H.

    1994-01-01

    The paper introduces a Wind Diesel concept suitable for remote communities, the 'Simple, Robust and Reliable Concept' developed at Riso. All components are standard components, the system is self regulating using the component controllers and there is no power electronics. The paper documents...

  17. IMPROVMENT OF EFFECTIVE POWER OF THE DIESEL, ENGINE OPERATING ON MIXED BIODIESEL FUEL

    Directory of Open Access Journals (Sweden)

    A. Levterov

    2014-02-01

    Full Text Available The results of calculation and experimental studies of ways to increase the effective power of the bіodiesel engine and determine the effect of this increase on the economic and environmental performance of the diesel engine are presented in the given paper.

  18. Verification of voltage/ frequency requirement for emergency diesel generator in nuclear power plant using dynamic modeling

    International Nuclear Information System (INIS)

    Hur, J.S.; Roh, M.S.

    2013-01-01

    Full-text: One major cause of the plant shutdown is the loss of electrical power. The study is to comprehend the coping action against station blackout including emergency diesel generator, sequential loading of safety system and to ensure that the emergency diesel generator should meet requirements, especially voltage and frequency criteria using modeling tool. This paper also considered the change of the sequencing time and load capacity only for finding electrical design margin. However, the revision of load list must be verified with safety analysis. From this study, it is discovered that new load calculation is a key factor in EDG localization and in-house capability increase. (author)

  19. Device on a diesel motor to supply power to emergency aggregates

    International Nuclear Information System (INIS)

    Koch, C.; Boekemeier, V.; Schilling, R.

    1977-01-01

    The invented arrangement of a diesel motor for the emergency supply of a nuclear power plant ensures that in the case of a fire in the environment of the emergency feeding building, no air with too much flue gas reaches the diesel motor via the suction pipe. The discharge pipe with a nozzle-shaped discharge opening and the suction pipe running above it pass horizontally through a wall of the building. There are vertical walls on both sides of the openings which prevent a sideways flowing of air to the exhaust gas flow in the vicinity of the building. (HGOE) [de

  20. Smoothing of Grid-connected Wind-Diesel Power Output Using Energy Capacitor System

    Directory of Open Access Journals (Sweden)

    Adel A. Elbaset

    2014-06-01

    Full Text Available This paper presents a small hybrid power system consists of two types of power generation; wind turbine and diesel generation, DG connected to power distribution system. The fluctuations like random nature of wind power, turbulent wind, and sudden changes in load demand create imbalances in power distribution that can affect the frequency and the voltage in the power system. So, addition of Energy capacitor System, ECS is useful for compensation of fluctuating power, since it is capable of controlling both active and reactive power simultaneously and can smooth the output power flow. Hence, this paper proposes herein a dynamic model and simulation of a grid connected wind/DG based-ECS with power flow controllers between load and generation. Moreover, the paper presents a study to analyze the leveling of output fluctuation of wind power with the installation of ECS. To control the power exchanged between the ECS system and the AC grid, a load Following Control, LFC based supervisor is proposed with the aim to minimize variations of the power generated by the diesel generator. The interesting performance of the proposed supervisor is shown with the help of simulations. The computer simulation program is confirmed on a realistic circuit model which implemented in the Simulink environment of Matlab and works as if on line.

  1. Remote power supply by wind/diesel/battery systems - operational experience and economy

    International Nuclear Information System (INIS)

    Kniehl, R.; Cramer, G.; Toenges, K.H.

    1995-01-01

    To continuously supply remote villages and settlements not connected to the public grid with electric power is an ambitious technical task considering ecological and economical points of view. The German company SMA has developed a modular supply system as a solution for this task in the range of 30 kW to 5 MW. Meanwhile more than 20 applications of these 'Intelligent Power Systems (IPS)' have proved their technical reliability and economical competitiveness worldwide under different, and also extreme environmental conditions. Actually it is the first commercially available advanced Wind/Diesel/Battery System for remote area electrification. The modular autonomous electric supply systems realized by SMA basically consist of two or more diesel power sets, battery storage with converter, a rotating phaseshifter, and an optional number of wind turbines. All modules are coupled on the 3-phase AC system grid and run in various parallel configurations depending on the wind speed and the consumer power demand. The control system operates fully automatical and offers a very user-friendly graphical interface. This advanced system control also contains a remote control and operating data output via modem and telephone line. SMA and CES have considerable experience with Wind/Diesel/Battery Systems for more than eight years. In many cases wind energy converters in the power range of 30 to 40 kW were used, but it is also possible to use larger wind turbines (e.g. 250 kW). In the following the system technology is described in detail, experience of different system sizes in several countries of application is presented, and economical analyses for power supply by IPS are given in comparison to a conventional fully diesel power supply. (author)

  2. Remote power supply by wind/diesel/battery systems - operational experience and economy

    Energy Technology Data Exchange (ETDEWEB)

    Kniehl, R [CES - Consulting and Engineering Services, Heidelberg (Germany); Cramer, G; Toenges, K H [SMA Regelsysteme GmbH, Niestetal (Germany)

    1996-12-31

    To continuously supply remote villages and settlements not connected to the public grid with electric power is an ambitious technical task considering ecological and economical points of view. The German company SMA has developed a modular supply system as a solution for this task in the range of 30 kW to 5 MW. Meanwhile more than 20 applications of these `Intelligent Power Systems (IPS)` have proved their technical reliability and economical competitiveness worldwide under different, and also extreme environmental conditions. Actually it is the first commercially available advanced Wind/Diesel/Battery System for remote area electrification. The modular autonomous electric supply systems realized by SMA basically consist of two or more diesel power sets, battery storage with converter, a rotating phaseshifter, and an optional number of wind turbines. All modules are coupled on the 3-phase AC system grid and run in various parallel configurations depending on the wind speed and the consumer power demand. The control system operates fully automatical and offers a very user-friendly graphical interface. This advanced system control also contains a remote control and operating data output via modem and telephone line. SMA and CES have considerable experience with Wind/Diesel/Battery Systems for more than eight years. In many cases wind energy converters in the power range of 30 to 40 kW were used, but it is also possible to use larger wind turbines (e.g. 250 kW). In the following the system technology is described in detail, experience of different system sizes in several countries of application is presented, and economical analyses for power supply by IPS are given in comparison to a conventional fully diesel power supply. (author)

  3. Remote power supply by wind/diesel/battery systems - operational experience and economy

    Energy Technology Data Exchange (ETDEWEB)

    Kniehl, R. [CES - Consulting and Engineering Services, Heidelberg (Germany); Cramer, G.; Toenges, K.H. [SMA Regelsysteme GmbH, Niestetal (Germany)

    1995-12-31

    To continuously supply remote villages and settlements not connected to the public grid with electric power is an ambitious technical task considering ecological and economical points of view. The German company SMA has developed a modular supply system as a solution for this task in the range of 30 kW to 5 MW. Meanwhile more than 20 applications of these `Intelligent Power Systems (IPS)` have proved their technical reliability and economical competitiveness worldwide under different, and also extreme environmental conditions. Actually it is the first commercially available advanced Wind/Diesel/Battery System for remote area electrification. The modular autonomous electric supply systems realized by SMA basically consist of two or more diesel power sets, battery storage with converter, a rotating phaseshifter, and an optional number of wind turbines. All modules are coupled on the 3-phase AC system grid and run in various parallel configurations depending on the wind speed and the consumer power demand. The control system operates fully automatical and offers a very user-friendly graphical interface. This advanced system control also contains a remote control and operating data output via modem and telephone line. SMA and CES have considerable experience with Wind/Diesel/Battery Systems for more than eight years. In many cases wind energy converters in the power range of 30 to 40 kW were used, but it is also possible to use larger wind turbines (e.g. 250 kW). In the following the system technology is described in detail, experience of different system sizes in several countries of application is presented, and economical analyses for power supply by IPS are given in comparison to a conventional fully diesel power supply. (author)

  4. Diesel Fueled SOFC for Class 7/Class 8 On-Highway Truck Auxiliary Power

    Energy Technology Data Exchange (ETDEWEB)

    Vesely, Charles John-Paul [Cummins Power Generation; Fuchs, Benjamin S. [Cummins Power Generation; Booten, Chuck W. [Protonex Technology, LLC

    2010-03-31

    The following report documents the progress of the Cummins Power Generation (CPG) Diesel Fueled SOFC for Class 7/Class 8 On-Highway Truck Auxiliary Power (SOFC APU) development and final testing under the U.S. Department of Energy (DOE) Energy Efficiency and Renewable Energy (EERE) contract DE-FC36-04GO14318. This report overviews and summarizes CPG and partner development leading to successful demonstration of the SOFC APU objectives and significant progress towards SOFC commercialization. Significant SOFC APU Milestones: Demonstrated: Operation meeting SOFC APU requirements on commercial Ultra Low Sulfur Diesel (ULSD) fuel. SOFC systems operating on dry CPOX reformate. Successful start-up and shut-down of SOFC APU system without inert gas purge. Developed: Low cost balance of plant concepts and compatible systems designs. Identified low cost, high volume components for balance of plant systems. Demonstrated efficient SOFC output power conditioning. Demonstrated SOFC control strategies and tuning methods.

  5. Application of diagnostic system for diesel engines in nuclear power plant

    International Nuclear Information System (INIS)

    Yoshinaga, Takeshi

    2004-01-01

    The diagnostic system for diesel engines makes a diagnosis of secular change and abnormal indications of diesel engines (DG) by combination of characteristic analysis of engine, lubricating oil, fuel oil, and cooling water. The principles of diagnostic system for DG, results of confirmation of the efficiency and the maintenance plan for DG in the Japan Atomic Power Company are described. DG in the company is classified to a safety device in order to supply the power source to the Emergency Core Cooling System etc., when the power source in the plant is lost, for example, at lightning struck. Characteristics of DG, outline of the diagnostic system for DG, diagnostic technologies such as engine signature analysis, chemical analysis of samples, temperature measurement, degradation mode of DG, and training in the company are stated. (S.Y.)

  6. Feasibility study of hybrid retrofits to an isolated off-grid diesel power plant

    International Nuclear Information System (INIS)

    Rehman, S.; Ahmad, F.; Shaahid, S.M.; Shash, A.; El-Amin, I.M.; Al-Shehri, A.M.; Bakhashwain, J.M.

    2007-01-01

    The green sources of energy are being encouraged to reduce the environmental pollution and combat the global warming of the planet. A target of 12% usage of wind energy only has been agreed by the UNO country members to achieve by 2020. So, the power of the wind is being used to generate electricity both as grid connected and isolated wind-diesel hybrid power plants. This paper performed a pre-feasibility of wind penetration into an existing diesel plant of a village in north eastern part of Saudi Arabia. For simulation purpose, wind speed data from a near by airport and the load data from the village have been used. The hybrid system design tool HOMER has been used to perform the feasibility study. In the present scenario, for wind speed less than 6.0m/s the, the existing diesel power plant is the only feasible solution over the range of fuel prices used in the simulation. The wind diesel hybrid system becomes feasible at a wind speed of 6.0m/s or more and a fuel price of 0.1$/L or more. If the carbon tax is taken into consideration and subsidy is abolished then it is expected that the hybrid system become feasible. The maximum annual capacity shortage did not have any effect on the cost of energy which may be accounted for larger sizes of wind machines and diesel generators. It is recommended that the wind data must be collected at the village at three different heights using a wind mast of 40m for a minimum of one complete year and then the hybrid system must be re-designed. (author)

  7. POWER PERFOMANCE UNDER CONSTANT SPEED TEST WITH PALM OIL BIODIESEL AND ITS BLENDS WITH DIESEL

    Directory of Open Access Journals (Sweden)

    E. U. U. Ituen

    2010-06-01

    Full Text Available The torque and power performance tests were carried out with a single cylinder techno four-stroke diesel engine under constant speeds of 2000, 1500 and 1100 rpm. Five fuels, the Dura Palm Oil biodiesel/diesel blend at 10/90 vol/vol, B210 and the diesel or Automotive gas oil (ago, the reference fuel, were involved. Brake torque and brake power data were plotted against brake mean effective pressure (Bmep since the latter is independent of engine speed and size and it is an indication of how power and torque are obtained per litre of fuel. The curves for the torque versus Bmep for the five fuels merged into single straight line curve which extended to the origin and with a gradient of 0.0719 m3 for all the three speed tests of 2000, 1500 and 1100 rpm. Similarly, the power versus Bmep curves for the five fuels merged into one straight curve which also extended to the origin but with different gradients of 0.0151, 0.0113, 0.0083 for 2000, 1500 and 1100 rpm respectively. Therefore, the five fuels had similar torque and power performance characteristics in the engine. The straight line curve which can be extrapolated to any value can be used for the engine designs, that is determining vd from the relation, T=V/4 or Bp=VdN/2

  8. New control approach for a PV-diesel autonomous power system

    Energy Technology Data Exchange (ETDEWEB)

    Rashed, Mohamed; Elmitwally, A.; Kaddah, Sahar [Electrical Engineering Department, Mansoura University, Mansoura 35516 (Egypt)

    2008-06-15

    A new control scheme for the hybrid photovoltaic-diesel single-phase autonomous power system is proposed. The main advantage of this scheme is that the voltage control is accomplished by the interface inverter without need to the automatic voltage regulator of the diesel-driven generator. Unlike three-phase systems, frequency and voltage control in single-phase autonomous power systems imposes additional complexity. This is due to the pulsating nature of the single-phase loads instantaneous power at twice the rated frequency that may degrade the control efficacy. This obstacle is addressed in this paper and a new scheme is presented. The approach includes three control loops for maximum power tracking, voltage control and frequency control. The generator field current is held constant at its nominal value avoiding the saturation in the field circuit. A robust fuzzy logic controller is adopted for the speed control loop of the diesel engine. The dynamic performance of the system is investigated under different operating conditions. (author)

  9. Exergic, economic and environmental impacts of natural gas and diesel in operation of combined cycle power plants

    International Nuclear Information System (INIS)

    Mohammadi Khoshkar Vandani, Amin; Joda, Fatemeh; Bozorgmehry Boozarjomehry, Ramin

    2016-01-01

    Highlights: • Investigating the effect of natural gas and diesel on the power plant performance. • Exergy, economic and environmental evaluation of a combined cycle power plant. • Using life cycle assessment (LCA) to perform the environmental evaluation. • Optimizing the power plant in terms of exergy and economic. • Better performance of natural gas with respect to diesel. - Abstract: Combined cycle power plants (CCPPs) play an important role in electricity production throughout the world. Their energy efficiency is relatively high and their production rates of greenhouse gases are considerably low. In a country like Iran with huge oil and gas resources, most CCPP’s use natural gas as primary fuel and diesel as secondary fuel. In this study, effect of using diesel instead of natural gas for a selected power plant will be investigated in terms of exergy, economic and environmental impacts. The environmental evaluation is performed using life cycle assessment (LCA). In the second step, the operation of the plant will be optimized using exergy and economic objective functions. The results show that the exergy efficiency of the plant with natural gas as fuel is equal to 43.11%, while this efficiency with diesel will be 42.03%. Furthermore, the annual cost of plant using diesel is twice as that of plant using natural gas. Finally, diesel utilization leads to more contaminants production. Thus, environmental effects of diesel are much higher than that of natural gas. The optimization results demonstrate that in case of natural gas, exergy efficiency and annual cost of the power plant improve 2.34% and 4.99%, respectively. While these improvements for diesel are 2.36% and 1.97%.

  10. Design and evaluation of hybrid wind/PV/diesel power systems for Brazilian applications

    Energy Technology Data Exchange (ETDEWEB)

    McGowan, J.G.; Manwell, J.F.; Avelar, C. [Univ. of Massachusetts, Amherst, MA (United States); Warner, C. [National Renewable Energy Lab., Golden, CO (United States)

    1996-12-31

    This paper presents a summary of a study centered on the design and evaluation of hybrid wind/PV/diesel systems for remote locations in Brazil. The objective of this work was to evaluate high reliability hybrid power systems that have been designed for the lowest life cycle costs. The technical and economic analysis of the hybrid wind/PV/diesel systems was carried out using HYBRID2, a computational code developed at the University of Massachusetts in conjunction with the National Renewable Energy Laboratory (NREL). After a summary of a generalized design procedure for such systems based on the use of this code, a systematic parametric evaluation of a representative design case for a village power system in Brazil is presented. As summarized in the paper, the performance and economic effects of key design parameters are illustrated. 8 refs., 10 figs.

  11. Long term trend analysis of emergency power diesel generator reliability in german nuclear power plants

    International Nuclear Information System (INIS)

    Kotthoff, K.; Maqua, M.

    1990-01-01

    The paper deals with a long-term investigation on the availability of diesel generators. This investigation has been performed in two steps in 1980/81 and 1988/89. It is based on the operating experiences of a total of 110 diesel generators in 20 German NPP's. The overall probability of diesel failure during start and short-time operation amounts to about 5E-3/demand. Compared to the result of the first part of the investigation (8E-3/demand) there has been some further improvement of diesel generator performance in recent years. The upper limit calculated for the probability of common mode failures (about 6E-4/demand) is approximately one order of magnitude smaller. The influence of various parameters on the failure probability has been discussed. A statistically significant dependence could not be identified

  12. Development of a Cost-Effective Solar/Diesel Independent Power Plant for a Remote Station

    Directory of Open Access Journals (Sweden)

    Okeolu Samuel Omogoye

    2015-01-01

    Full Text Available The paper discusses the design, simulation, and optimization of a solar/diesel hybrid power supply system for a remote station. The design involves determination of the station total energy demand as well as obtaining the station solar radiation data. This information was used to size the components of the hybrid power supply system (HPSS and to determine its configuration. Specifically, an appropriate software package, HOMER, was used to determine the number of solar panels, deep-cycle batteries, and rating of the inverter that comprise the solar section of the HPSS. A suitable diesel generator was also selected for the HPSS after careful technical and cost analysis of those available in the market. The designed system was simulated using the HOMER software package and the simulation results were used to carry out the optimization of the system. The final design adequately meets the station energy requirement. Based on a life expectancy of twenty-five years, a cost-benefit analysis of the HPSS was carried out. This analysis shows that the HPSS has a lower cost as compared to a conventional diesel generator power supply, thus recommending the HPSS as a more cost-effective solution for this application.

  13. COMPARATIVE STUDY ON EXHAUST EMISSIONS FROM DIESEL- AND CNG-POWERED URBAN BUSES

    Energy Technology Data Exchange (ETDEWEB)

    COROLLER, P; PLASSAT, G

    2003-08-24

    Couple years ago, ADEME engaged programs dedicated to the urban buses exhaust emissions studies. The measures associated with the reduction of atmospheric and noise pollution has particular importance in the sector of urban buses. In many cases, they illustrate the city's environmental image and contribute to reinforcing the attractiveness of public transport. France's fleet in service, presently put at about 14,000 units, consumes about 2 per cent of the total energy of city transport. It causes about 2 per cent of the HC emissions and from 4 to 6 per cent of the NOx emissions and particles. These vehicles typically have a long life span (about 15 years) and are relatively expensive to buy, about 150.000 euros per unit. Several technical solutions were evaluated to quantify, on a real condition cycle for buses, on one hand pollutants emissions, fuel consumption and on the other hand reliability, cost in real existing fleet. This paper presents main preliminary results on urban buses exhaust emission on two different cases: - existing Diesel buses, with fuel modifications (Diesel with low sulphur content), Diesel with water emulsion and bio-Diesel (30% oil ester in standard Diesel fuel); renovating CNG powered Euro II buses fleet, over representative driving cycles, set up by ADEME and partners. On these cycles, pollutants (regulated and unregulated) were measured as well as fuel consumption, at the beginning of a program and one year after to quantify reliability and increase/decrease of pollutants emissions. At the same time, some after-treatment technologies were tested under real conditions and several vehicles. Information such as fuel consumption, lubricant analysis, problem on the technology were following during a one year program. On the overall level, it is the combination of various action, pollution-reduction and renewal that will make it possible to meet the technological challenge of reducing emissions and fuel consumption by urban bus

  14. Combined cycle versus one thousand diesel power plants: pollutant emissions, ecological efficiency and economic analysis

    International Nuclear Information System (INIS)

    Silveira, Jose Luz; de Carvalho, Joao Andrade; de Castro Villela, Iraides Aparecida

    2007-01-01

    The increase in the use of natural gas in Brazil has stimulated public and private sectors to analyse the possibility of using combined cycle systems for generation of electrical energy. Gas turbine combined cycle power plants are becoming increasingly common due to their high efficiency, short lead times, and ability to meet environmental standards. Power is produced in a generator linked directly to the gas turbine. The gas turbine exhaust gases are sent to a heat recovery steam generator to produce superheated steam that can be used in a steam turbine to produce additional power. In this paper a comparative study between a 1000 MW combined cycle power plant and 1000kW diesel power plant is presented. In first step, the energetic situation in Brazil, the needs of the electric sector modification and the needs of demand management and integrated means planning are clarified. In another step the characteristics of large and small thermoelectric power plants that use natural gas and diesel fuel, respectively, are presented. The ecological efficiency levels of each type of power plant is considered in the discussion, presenting the emissions of particulate material, sulphur dioxide (SO 2 ), carbon dioxide (CO 2 ) and nitrogen oxides (NO x ). (author)

  15. Generator gas as a fuel to power a diesel engine

    Directory of Open Access Journals (Sweden)

    Tutak Wojciech

    2014-01-01

    Full Text Available The results of gasification process of dried sewage sludge and use of generator gas as a fuel for dual fuel turbocharged compression ignition engine are presented. The results of gasifying showed that during gasification of sewage sludge is possible to obtain generator gas of a calorific value in the range of 2.15  2.59 MJ/m3. It turned out that the generator gas can be effectively used as a fuel to the compression ignition engine. Because of gas composition, it was possible to run engine with partload conditions. In dual fuel operation the high value of indicated efficiency was achieved equal to 35%, so better than the efficiency of 30% attainable when being fed with 100% liquid fuel. The dual fuel engine version developed within the project can be recommended to be used in practice in a dried sewage sludge gasification plant as a dual fuel engine driving the electric generator loaded with the active electric power limited to 40 kW (which accounts for approx. 50% of its rated power, because it is at this power that the optimal conditions of operation of an engine dual fuel powered by liquid fuel and generator gas are achieved. An additional advantage is the utilization of waste generated in the wastewater treatment plant.

  16. Feasibility of Hybrid Retrofits to Off-Grid Diesel Power Plants in the Philippines

    International Nuclear Information System (INIS)

    Abergas, R.L.; Barley, C.D.; Barruela, R.B.

    1999-01-01

    The Strategic Power Utilities Group (SPUG) of the National Power Corporation (NPC) in the Philippines owns and operates about 100 power plants, mostly fueled by diesel, ranging in energy production from about 15 kilowatt-hours (kWh)/day to 106,000 kWh/day. Reducing the consumption of diesel fuel in these plants, along with the associated financial losses, is a priority for SPUG. The purpose of this study is to estimate the potential fuel and cost savings that might be achieved by retrofitting hybrid power systems to these existing diesel plants. As used in this report, the term ''hybrid system'' refers to any combination of wind turbine generators (WTGs), photovoltaic (PV) modules, lead-acid batteries, and an AC/DC power converter (either an electronic inverter or a rotary converter), in addition to the existing diesel gensets. The resources available for this study did not permit a detailed design analysis for each of the plants. Instead, the following five-step process was used: 1.Tabulate some important characteristics of all the plants. 2.Group the plants into categories (six classes) with similar characteristics. 3.For each class of system, identify one plant that is representative of the class. 4.For each representative plant, perform a moderately detailed prefeasibility analysis of design options. 5.Summarize and interpret the results. The analysis of each representative plant involved the use of time-series computer simulation models to estimate the fuel usage, maintenance expenses, and cash flow resulting from various designs, and to search the domain of possible designs for the one leading to the lowest life-cycle cost. Cost items that would be unaffected by the retrofit, such as operator salaries and the capital cost of existing equipment, were not included in the analysis. Thus, the results are reported as levelized cost of energy (COE) savings: the difference between the cost of the existing diesel-only system and that of an optimized hybrid system

  17. Analysis of power tiller noise using diesel-biodiesel fuel blends

    Directory of Open Access Journals (Sweden)

    N Keramat Siavash

    2015-09-01

    Full Text Available Introduction: There are several sources of noise in an industrial and agriculture environment. Machines with rotating or reciprocating engines are sound-producing sources. Also, the audio signal can be analyzed to discover how well a machine operates. Diesel engines complex noise SPL and sound frequency content both strongly depend on fuel combustion, which produces the so-called combustion noise. Actually, the unpleasant sound signature of diesel engines is due to the harsh and irregular self-ignition of the fuel. Therefore, being able to extract combustion noise from the overall noise would be of prime interest. This would allow engineers to relate the sound quality back to the combustion parameters. The residual noise produced by various sources, is referred to as mechanical noise. Since diesel engine noise radiation is associated with the operators’ and pedestrians’ discomfort, more and more attention to being paid to it. The main sources of noise generation in a diesel engine are exhaust system, mechanical processes such as valve train and combustion that prevail over the other two. In the present work, experimental tests were conducted on a single cylinder diesel engine in order to investigate the combustion noise radiation during stationary state for various diesel and biodiesel fuel blends. Materials and Methods: The engine used in the current study is an ASHTAD DF120-RA70 that is a single cylinder 4 stroke water cooled diesel engine and its nominal power is 7.5 hp at 2200 rpm. The experiment has been done at three positions (Left ear of operator, 1.5 and 7.5 meter away from exhaust based on ISO-5131 and SAE-J1174 standards. For engine speed measurement the detector Lurton 2364 was utilized with a measurement accuracy of 0.001 rpm. To obtain the highest accuracy, contact mode of detector was used. The engine noise was measured by HT157 sound level meter and was digitalized and saved with Sound View software. HT157 uses alow impedance

  18. Fuel consumption and greenhouse gas calculator for diesel and biodiesel-powered vehicles

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2008-07-01

    Factors that influence fuel consumption include environmental conditions, maintenance, poor driving techniques, and driving speed. Developed by Natural Resources Canada, the SmartDriver training programs were designed to help fleet managers, drivers, and instructors to learn methods of improving fuel economy. This fuel consumption and greenhouse gas (GHG) calculator for diesel and biodiesel-powered vehicles provides drivers with a method of calculating fuel consumption rates when driving. It includes a log-book in which to record odometer readings and a slide-rule in which to determine the litres of fuel used during a trip. The scale showed the number of kg of GHGs produced by burning a particular amount of fuel for both biodiesel and diesel fuels. 1 fig.

  19. Improvement of diesel engine performance by hydraulically powered electronic control (mechatronics) system. Hakuyo diesel kikan no mechatronics system ni yoru seino kojo

    Energy Technology Data Exchange (ETDEWEB)

    Sonoda, K.; Nakamura, Y.; Kajima, T.; Sato, S.; Fujii, T.; Tobe, Y. (Kawasaki Heavy Industries, Ltd., Tokyo (Japan))

    1992-07-20

    This paper describes new hydraulically-actuated mechanisms for both fuel injection and inlet/exhaust valve operation of diesel engines through solenoid valves, which obviate the conventional cam-driven system. These mechanisms were integrated with an electronic control unit also developed in this study and they were mounted as a mechatronics system'' on a power-increased single-cylinder engine. This mechatronics system was mainly composed of an injection control. boost and accumulation component, an inlet and exhaust valve control component, a solenoid valve, an electronic control equipment, a hydraulic power unit, and a maneuvering unit. The verification test was carried out for the improvement of diesel engine performance by the hydraulically powered mechatronics system. As a result, it was proved not only that these mechanisms provide stable operating characteristics over a wide range of conditions, but also that the electronic control system allows accurate, smooth response. 3 refs., 23 figs., 2 tabs.

  20. Economic analysis of hybrid power systems (PV/diesel) in different climatic zones of Tamil Nadu

    International Nuclear Information System (INIS)

    Suresh Kumar, U.; Manoharan, P.S.

    2014-01-01

    Highlights: • Investigation on economic feasibility of PV/diesel system in various climatic zones. • HOMER is used to solve economic feasibility analysis. • By the sensitivity analysis, the net present cost is reduced. • Optimum climatic zone in Tamil Nadu, India is recommended. - Abstract: With the increasing threat to environment and the fast depleting fossil fuel resources, hybrid power systems consisting of two or more renewable energy sources such as solar PV, wind, biomass, ocean thermal-with or without the back up of diesel generator have come to the forefront. These hybrid systems are normally integrated with battery banks for total reliability; such systems have brought about better quality of life in remote areas of developing economics. The remote areas in the state of Tamil Nadu in India possess excellent renewable energy sources. These areas fall under different climatic zones, are sparsely populated and are in the process of development. Though these areas are connected to the grid, Tamil Nadu grid is not stable; it is currently experiencing 40% short fall in generation. Thus grid power is available to these remote areas only for 10 h a day and even when available, there are voltage frequency problems. This paper analyses the economic feasibility of installing and operating hybrid systems in these areas. The areas are divided into different climatic zones and the hybrid system economy is analyzed for each climatic zone on the basis of NPC (net present cost), consumption of diesel and renewable fraction for all climate zones. The analysis indicates that the interior climatic zone – the area would be the optimum climatic zone to install HPS PV/diesel. The sensitivity analysis proves that the NPC of such a system can be reduced. It is suggested that due to high initial cost, government subsidy is necessary to adopt the system on a large scale. Such a profit will encourage development of renewable energy utilization and bring about rapid

  1. Status of evaluations and modifications of diesel generator status annunciator systems at various US nuclear power plants

    International Nuclear Information System (INIS)

    Shindell, B.M.; Rumble, R.P.

    1979-10-01

    This report documents the current status of evaluations and modifications to the diesel generator status annunciators in a number of US nuclear power plants. These modifications may be required in order to: ensure that all conditions which might render the diesel generators incapable of automatic starting are annunciated in the control room; ensure that the wording on the control room annunciator clearly indicates to the operator that the diesel generator is unavailable if such is the case; and separate disabling and non-disabling annunciation

  2. Diesel power plants based on biomass gasification; Biomassan ja turpeen kaasutukseen perustuvien dieselvoimalaitosten toteutettavuustutkimus

    Energy Technology Data Exchange (ETDEWEB)

    Kurkela, E; Staahlberg, P; Solantausta, Y; Wilen, C

    1996-12-31

    Different power production systems have been developed for biomass feedstocks. However, only few of these systems can meet the following three requirements: (a) suitability to small scale electricity production (< 5-10 MWe), (b) reliable operation with realistically available biomass feedstocks, and (c) potential for economical competitiveness. The fluidized-bed boilers have been successfully operated with wood waste and peat down to outputs of the order of 5 MWe and the investment costs have been successfully lowered to a reasonable level. However, this concept is most suitable for combined heat and electricity production and smaller plant sizes are not considered feasible. One of the most promising alternative for this commercially proven technology is the diesel power plant based on gasification. This concept has a potential for higher power to heat ratios in cogeneration or higher efficiency in separate electricity production. The objectives of this project were (a) to evaluate the technical and economical feasibility of diesel power plants based on biomass gasification and (b) to study the effects of operating conditions (temperature, bed material and air staging) on the performance of a circulating fluidized-bed gasifier. The experimental part of the project was carried out on a new PDU-scale Circulating Fluidized-Bed Gasification test facility of VTT. Wood residues were used as the feedstocks and the experiments were mainly focused on tar formation and gasifier performance. The results will be compared to earlier VTT data obtained for bubbling-bed reactors. The techno-economic feasibility studies are carried out using existing process modelling tools of VTT and the gasification based diesel plants will be compared to conventional fluidized-bed boilers

  3. Diesel power plants based on biomass gasification; Biomassan ja turpeen kaasutukseen perustuvien dieselvoimalaitosten toteutettavuustutkimus

    Energy Technology Data Exchange (ETDEWEB)

    Kurkela, E.; Staahlberg, P.; Solantausta, Y.; Wilen, C.

    1995-12-31

    Different power production systems have been developed for biomass feedstocks. However, only few of these systems can meet the following three requirements: (a) suitability to small scale electricity production (< 5-10 MWe), (b) reliable operation with realistically available biomass feedstocks, and (c) potential for economical competitiveness. The fluidized-bed boilers have been successfully operated with wood waste and peat down to outputs of the order of 5 MWe and the investment costs have been successfully lowered to a reasonable level. However, this concept is most suitable for combined heat and electricity production and smaller plant sizes are not considered feasible. One of the most promising alternative for this commercially proven technology is the diesel power plant based on gasification. This concept has a potential for higher power to heat ratios in cogeneration or higher efficiency in separate electricity production. The objectives of this project were (a) to evaluate the technical and economical feasibility of diesel power plants based on biomass gasification and (b) to study the effects of operating conditions (temperature, bed material and air staging) on the performance of a circulating fluidized-bed gasifier. The experimental part of the project was carried out on a new PDU-scale Circulating Fluidized-Bed Gasification test facility of VTT. Wood residues were used as the feedstocks and the experiments were mainly focused on tar formation and gasifier performance. The results will be compared to earlier VTT data obtained for bubbling-bed reactors. The techno-economic feasibility studies are carried out using existing process modelling tools of VTT and the gasification based diesel plants will be compared to conventional fluidized-bed boilers

  4. Diesel power plants based on biomass gasification; Biomassan ja turpeen kaasutukseen perustuen dieselvoimalaitosten toteutettavuustutkimus

    Energy Technology Data Exchange (ETDEWEB)

    Kurkela, E.; Staahlberg, P.; Solantausta, Y. [VTT Energy, Espoo (Finland)

    1996-12-01

    Different power production systems have been developed for biomass feedstocks. However, only few of these systems can meet the following three requirements: (1) suitability to small scale electricity production (<5-10 MWe), (2) reliable operation with realistically available biomass feedstocks, and (3) potential for economical competitiveness. The fluidized-bed boilers have been successfully operated with wood waste and peat down to outputs of the order of 5 MWe and the investment costs have been successfully lowered to a reasonable level. However, this concept is most suitable for combined heat and electricity production and smaller plant sizes are not considered feasible. One of the most promising alternative for this commercially proven technology is the diesel power plant based on gasification. This concept has a potential for higher power to heat ratios in cogeneration or higher efficiency in separate electricity production. The objectives of this project were (1) to evaluate the technical and economical feasibility of diesel power plants based on biomass gasification and (2) to study the effects of operating conditions (temperature, bed material and air staging) on the performance of a circulating fluidized-bed gasifier. The experimental part of the project was carried out on a new PDU-scale Circulating Fluidized-Bed Gasification test facility of VTT. Wood residues were used as the feedstocks and the experiments were mainly focused on tar formation and gasifier performance. The results will be compared to earlier VTT data obtained for bubbling-bed reactors. The techno-economic feasibility studies are carried out using existing process modelling tools of VTT and the gasification based diesel plants will be compared to conventional fluidized-bed boilers. The studies are scheduled to be completed in March 1996. (author)

  5. The Influence of Diesel Fuel Subsidies and Taxes on the Potential for Solar-Powered Hybrid Systems in Africa

    Directory of Open Access Journals (Sweden)

    Paul Bertheau

    2015-08-01

    Full Text Available Many people in African countries lack access to sufficient electricity supply due to missing infrastructure of the centralized conventional power generation system. In order to provide electricity to a wider part of the population, it is necessary to exploit the vast renewable resources in African countries. Therefore, this paper scrutinizes the economic advantages of photovoltaic-based hybrid systems over fossil fuel-based power generation. A simulation model is applied in order to calculate the cost advantage of hybrid systems compared to diesel-only systems for the entire continent on a long term basis by applying two scenarios: one based on world market diesel prices and the other one based on national diesel prices. The results indicate that average power generation costs per country can be reduced by up to 0.11 €/kWh considering world market diesel prices and by up to 0.48 €/kWh considering national diesel prices. Furthermore, the effect of diesel fuel subsidies and taxes on the renewable energy potential and the respective savings are examined. These findings may ameliorate the policy development according to fossil fuel subsidies and taxes and demonstrate the advantages of decentralized renewable hybrid systems especially in rural areas of Africa.

  6. Cost-benefit analysis of remote hybrid wind-diesel power stations: Case study Aegean Sea islands

    International Nuclear Information System (INIS)

    Kaldellis, J.K.; Kavadias, K.A.

    2007-01-01

    More than one third of world population has no direct access to interconnected electrical networks. Hence, the electrification solution usually considered is based on expensive, though often unreliable, stand-alone systems, mainly small diesel-electric generators. Hybrid wind-diesel power systems are among the most interesting and environmental friendly technological alternatives for the electrification of remote consumers, presenting also increased reliability. More precisely, a hybrid wind-diesel installation, based on an appropriate combination of a small diesel-electric generator and a micro-wind converter, offsets the significant capital cost of the wind turbine and the high operational cost of the diesel-electric generator. In this context, the present study concentrates on a detailed energy production cost analysis in order to estimate the optimum configuration of a wind-diesel-battery stand-alone system used to guarantee the energy autonomy of a typical remote consumer. Accordingly, the influence of the governing parameters-such as wind potential, capital cost, oil price, battery price and first installation cost-on the corresponding electricity production cost is investigated using the developed model. Taking into account the results obtained, hybrid wind-diesel systems may be the most cost-effective electrification solution for numerous isolated consumers located in suitable (average wind speed higher than 6.0 m/s) wind potential regions

  7. Trial application of reliability technology to emergency diesel generators at the Trojan Nuclear Power Plant

    International Nuclear Information System (INIS)

    Wong, S.M.; Boccio, J.L.; Karimian, S.; Azarm, M.A.; Carbonaro, J.; DeMoss, G.

    1986-01-01

    In this paper, a trial application of reliability technology to the emergency diesel generator system at the Trojan Nuclear Power Plant is presented. An approach for formulating a reliability program plan for this system is being developed. The trial application has shown that a reliability program process, using risk- and reliability-based techniques, can be interwoven into current plant operational activities to help in controlling, analyzing, and predicting faults that can challenge safety systems. With the cooperation of the utility, Portland General Electric Co., this reliability program can eventually be implemented at Trojan to track its effectiveness

  8. An investigation of heat recovery of submarine diesel engines for combined cooling, heating and power systems

    International Nuclear Information System (INIS)

    Daghigh, Roonak; Shafieian, Abdellah

    2016-01-01

    Highlights: • The power output of the cycle is about 53 kW in the mass flow rate of 0.6 kg/s. • The output cooling water temperature of evaporator is 3.64 °C. • The absorption chiller has a coefficient of performance equal to 0.94. - Abstract: High temperature and mass flow rate of the exhaust gases of submarine diesel engines provide an appropriate potential for their thermal recovery. The current study introduces a combined cooling, heating and power system for thermal recovery of submarine diesel engines. The cooling system is composed of a mixed effect absorption chiller with two high and low pressure generators. The exhaust of the diesel engine is used in the high pressure generator, and the low pressure generator was divided into two parts. The required heat for the first and second compartments is supplied by the cooling water of the engine and condensation of the vapor generated in the high pressure generator, respectively. The power generation system is a Rankine cycle with an organic working fluid, which is considered a normal thermal system to supply hot water. The whole system is encoded based on mass stability, condensation and energy equations. The obtained findings showed that the maximum heat recovery for the power cycle occurs in exhaust gas mass ratio of 0.23–0.29 and working fluid mass flow rate of 0.45–0.57 kg/s. Further, for each specific mass ratio of exhaust gas, only a certain range of working fluid mass flow rate is used. In the refrigerant mass flow rate of 0.6 kg/s and exhaust gas mass ratio of 0.27, the power output of the cycle is 53 kW, which can also be achieved by simultaneous increase of refrigerant mass flow rate and exhaust gas mass ratio in a certain range of higher powers. In the next section, the overall distribution diagram of output water temperature of the thermal system is obtained according to the exhaust gas mass ratio in various mass flow rates, which can increase the potential of designing and controlling the

  9. The first of a new generation of diesel engines from General Motors - the efficient and powerful 1.6 liter Euro6 midsize diesel engine

    Energy Technology Data Exchange (ETDEWEB)

    Boretto, Gianmarco; Golisano, Roberto; Scotti, Michele; Antonioli, Pierpaolo; Frank, Richard M.; Rovatti, Giovanni [General Motors Powertrain Europe s.r.l., Turin (Italy); Wesslau, Markus [Adam Opel AG, Ruesselsheim (Germany)

    2013-08-01

    The major challenge the automotive industry will face in the next decade is undoubtedly the reduction of CO{sub 2} emissions. Conventional powertrains with internal combustion engines will still play a predominant role: in particular, the diesel engine will be a major contributor to the solution thanks to its intrinsic high thermodynamic efficiency and low-end torque which is a key enabler for downsizing engine displacement and downspeeding. In this context, General Motors has developed an entirely new 1.6 liter four-cylinder Midsize Diesel Engine (MDE), the first of a new generation of efficient and powerful diesel engines. Its development has been focused on the achievement of high power and torque density, superior fuel efficiency and state-of-the-art noise and vibration, while meeting the Euro6 emission standard in a wide range of B-, C- and D-segment vehicles, utilizing different exhaust aftertreatment solutions. The key technical features of the base engine, combustion system and emission reduction technologies, together with the innovative engine control unit, are described in this paper. (orig.)

  10. Antifungal amphiphilic aminoglycoside K20: bioactivities and mechanism of action

    Directory of Open Access Journals (Sweden)

    Sanjib K. Shrestha

    2014-12-01

    Full Text Available K20 is a novel amphiphilic antifungal aminoglycoside that is synthetically derived from the antibiotic kanamycin A. Reported here are investigations of K20’s antimicrobial activities, cytotoxicity, and fungicidal mechanism of action. In vitro growth inhibitory activities against a variety of human and plant pathogenic yeasts, filamentous fungi, and bacteria were determined using microbroth dilution assays and time-kill curve analyses, and hemolytic and animal cell cytotoxic activities were determined. Effects on Cryptococcus neoformans H-99 infectivity were determined with a preventive murine lung infection model. The antifungal mechanism of action was studied using intact fungal cells, yeast lipid mutants, and small unilamellar lipid vesicles. K20 exhibited broad-spectrum in vitro antifungal activities but not antibacterial activities. Pulmonary, single dose-administration of K20 reduced C. neoformans lung infection rates 4-fold compared to controls. Hemolysis and half-maximal cytotoxicities of mammalian cells occurred at concentrations that were 10 to 32-fold higher than fungicidal MICs. With fluorescein isothiocyanate, 20 to 25 mg/L K20 caused staining of >95% of C. neoformans and Fusarium graminearum cells and at 31.3 mg/L caused rapid leakage (30 to 80% in 15 min of calcein from preloaded small unilamellar lipid vesicles. K20 appears to be a broad-spectrum fungicide, capable of reducing the infectivity of C. neoformans, and exhibits low hemolytic activity and mammalian cell toxicity. It perturbs the plasma membrane by mechanisms that are lipid modulated. K20 is a novel amphiphilic aminoglycoside amenable to scalable production and a potential lead antifungal for therapeutic and crop protection applications.

  11. The impact of the type of operation on the parameters of a shunting diesel locomotive with hybrid power plant

    Directory of Open Access Journals (Sweden)

    Falendysh Anatoliy

    2017-01-01

    Full Text Available In designing a traction vehicle it is necessary to take into account the type of field operation it is meant for. It was found out that during shunting operation a ChME3 diesel locomotive is in idling mode for almost half of its general running time. That is why, the introduction of a less powerful engine along with an energy storage device for shunting operations at a shunting diesel locomotive is appropriate. The calculations were made using a modernized shunting diesel locomotive ChME3 with hybrid transmission of power as an example. The dependences of the general running time of a diesel locomotive on the position of the engine driver controller under performing shunting, transportation and hump operation were given in percentages. For every operation mode there was calculated the optimum power of a diesel-generator plant and the optimum energy capacity of an energy storage system taking into account the above-mentioned dependences. It was found out that due to the introduction of a hybrid drive for the section discussed above and the corresponding mass of a train the aggregate fuel consumption will be reduced by 25% and the efficiency of travel will increase by one third.

  12. Data Base for Light-Weight Automotive Diesel Power Plants. Volume 2: Discussion and Results.

    Science.gov (United States)

    1979-12-01

    The effects on fuel economy, emissions, passenger car safety and other variables due to the installation of light-weight Diesel powerplants were studied. Experimental data was obtained on naturally aspirated and turbocharged Diesel engines installed ...

  13. Data Base for Light-Weight Automotive Diesel Power Plants: Volume 1. Executive Summary.

    Science.gov (United States)

    1979-12-01

    The effects on fuel economy, emissions, passenger car safety and other variables due to the installation of light-weight Diesel powerplants were studied. Experimental data was obtained on naturally aspirated and turbocharged Diesel engines installed ...

  14. Data Base for Light-Weight Automotive Diesel Power Plants : Volume 3. Miscellaneous Data.

    Science.gov (United States)

    1979-12-01

    The effects of fuel economy, emissions, passenger car safety and other variables due to the installation of light-weight Diesel powerplants were studied. Experimental data was obtained on naturally aspirated and turbocharged Diesel engines installed ...

  15. Aging and service wear of diesel engines used for emergency power at nuclear power stations

    International Nuclear Information System (INIS)

    Dingee, P.A.; Johnson, A.B.

    1985-01-01

    Aging and wear problems associated with emergency standby diesel generators are under study as part of the US Nuclear Regulatory Commission Nuclear Plant Aging Research program. Aging/wear factors identified in this study to date include chemical, mechanical, electrochemical, and bacterial mechanisms. The study also examines the potential of excessive engine testing as a cause of premature wear. To date, the results of this effort are not conclusive. An assessment of current wear mitigation measures such as engine maintenance and surveillance procedures suggests the need for their further development within the nuclear industry

  16. The injection equipment of future high-speed DI diesel engines with respect to power and pollution requirements

    Energy Technology Data Exchange (ETDEWEB)

    Dolenc, A. (Monobloc Dieselmotoren GmbH, Vienna (AT))

    1990-01-01

    The development of high specific output DI diesel engines started at the low-speed end some 50 years ago primarily for marine and traction applications. Movement towards the high-speed end has been slow but steady with the majority of truck engines being very conservatively rated. There has been recent major effort on the automotive car and light commercial vehicle diesel application leading to lightweight DI diesel engines with an engine speed of 4000-5000 r/min and a rated power of 50 kW/litre displacement. These are expected to be on the market in a short period of time. The key point of this development has been the injection equipment including combustion control. In this area the use of modulated injection has the possibility of solving power and pollution requirements. (author).

  17. The design and performance of the first fully automatic non-grid 5 MW multi-diesel / mini hydro / battery converter power stations

    International Nuclear Information System (INIS)

    Ahmad Shadzli Abdul Wahab

    2000-01-01

    Electricity power supply in remote communities and towns are traditionally and hitherto supplied by diesel generator sets of varying capacities and sizes -from few kilowatt to few megawatts. Its proven to be versatile, robust, modular cheaper capital investment, reliable and easy to operate and maintain. These features are what make diesel generators most preferred choice for generating electric power to power hungry remote communities. The main draw back, though, is its increasingly high cost of operation and maintenance, largely due to upward trend in the cost of diesel fuel, high cost of engines spare parts plus the inflationary nature of salary and wages of operators. For these reasons, engineers and technologists have for years worked tirelessly to find ways and means to reduce the O and M costs. One of the novel ideas was to hybrid the conventional diesel generating system with renewable energy resources, such as mini hydro, solar photovoltaic or wind energy. Many prototypes involving several configurations of energy resources eg diesel/PV/ battery, diesel/wind/battery, diesel/mini hydro/battery have been tested but none has so far has been as successful as Sema/ Powercorp automated Intelligent Power System (IPS). Based on microprocessor hardware, powerful computer software programming and satellite communication technology, the IPS -equipped diesel power station can now now be operated fully automatic with capability of remote control and monitoring. The system is versatile in maximising the use of renewable energy energy resources such as wind, mini hydro or solar thereby reducing very significantly the use of diesel fuel. Operation and maintenance costs also are reduced due to the use of minimum manpower and and increase in fuel efficiency of the engines. The tested and proven IPS technology has been operating successfully for the last ten years in remote diesel stations in Northern Territory, Australia, Rathlin Island, Northern Ireland and its latest and

  18. Trend analyses of the emergency diesel generator problem events in Japanese and U.S. nuclear power plants

    International Nuclear Information System (INIS)

    Shimada, Yoshio

    2011-01-01

    Up to 2009, the author and a colleague conducted trend analyses of problem events related to main generators, emergency diesel generators, breakers, motors and transformers which are more likely to cause problems than other electric components in nuclear power plants. Among the electric components with high frequency of defect occurrence, i.e., emergency diesel generators, several years have passed since the last analyses. These are very important components needed to stop a nuclear reactor safely and to cool it down during external power supply loses. Then trend analyses were conducted for the second time. The trend analyses were performed on 80 problem events with emergency diesel generators which had occurred in U.S. nuclear power plants in the five years from 2005 through 2009 among events reported in the Licensee Event Reports (LERs: event reports submitted to NRC by U.S. nuclear power plants) which have been registered in the nuclear information database of the Institute of Nuclear Safety System, Inc. (INSS) , as well as 40 events registered in the Nuclear Information Archives (NUCIA), which occurred in Japanese nuclear power plants in the same time period. It was learned from the trend analyses of the problem events with emergency diesel generators that frequency of defect occurrence are high in both Japanese and US plants during plant operations and functional tests (that is, defects can be discovered effectively in advance), so that implementation of periodical functional tests under plant operation is an important task for the future. (author)

  19. 30 CFR 75.1710-1 - Canopies or cabs; self-propelled diesel-powered and electric face equipment; installation...

    Science.gov (United States)

    2010-07-01

    ... and electric face equipment; installation requirements. (a) Except as provided in paragraph (f) of this section, all self-propelled diesel-powered and electric face equipment, including shuttle cars... and electric face equipment; installation requirements. 75.1710-1 Section 75.1710-1 Mineral Resources...

  20. A comparative life cycle assessment of diesel and compressed natural gas powered refuse collection vehicles in a Canadian city

    International Nuclear Information System (INIS)

    Rose, Lars; Hussain, Mohammed; Ahmed, Syed; Malek, Kourosh; Costanzo, Robert; Kjeang, Erik

    2013-01-01

    Consumers and organizations worldwide are searching for low-carbon alternatives to conventional gasoline and diesel vehicles to reduce greenhouse gas (GHG) emissions and their impact on the environment. A comprehensive technique used to estimate overall cost and environmental impact of vehicles is known as life cycle assessment (LCA). In this article, a comparative LCA of diesel and compressed natural gas (CNG) powered heavy duty refuse collection vehicles (RCVs) is conducted. The analysis utilizes real-time operational data obtained from the City of Surrey in British Columbia, Canada. The impact of the two alternative vehicles is assessed from various points in their life. No net gain in energy use is found when a diesel powered RCV is replaced by a CNG powered RCV. However, significant reductions (approximately 24% CO 2 -equivalent) in GHG and criteria air contaminant (CAC) emissions are obtained. Moreover, fuel cost estimations based on 2011 price levels and a 5-year lifetime for both RCVs reveal that considerable cost savings may be achieved by switching to CNG vehicles. Thus, CNG RCVs are not only favorable in terms of reduced climate change impact but also cost effective compared to conventional diesel RCVs, and provide a viable and realistic near-term strategy for cities and municipalities to reduce GHG emissions. - Highlights: ► Life cycle analysis is performed on two alternative refuse collection vehicle technologies. ► Real-time operational data obtained by the City of Surrey in British Columbia are utilized. ► The life cycle energy use is similar for diesel and CNG RCVs. ► A 24% reduction of GHG emissions (CO 2 -equivalent) may be realized by switching from diesel to CNG. ► CNG RCVs are estimated to be cost effective and may lead to reduced fuel costs.

  1. Practical Applications and Experiences in K-20 Blended Learning Environments

    Science.gov (United States)

    Kyei-Blankson, Lydia, Ed.; Ntuli, Esther, Ed.

    2014-01-01

    Learning environments continue to change considerably and is no longer confined to the face-to-face classroom setting. As learning options have evolved, educators must adopt a variety of pedagogical strategies and innovative technologies to enable learning. "Practical Applications and Experiences in K-20 Blended Learning Environments"…

  2. Development of reliability program for emergency diesel generators in domestic nuclear power plants

    International Nuclear Information System (INIS)

    Kim, Young Ho; Jung, Hyun Jong; Choi, Kwang Hee; Hong, Seoung Yeul

    2001-01-01

    Surveillance tests of Emergency Diesel Generators (EDGs) in Nuclear Power Plants (NPPs) have been conducted periodically to verify the reliability and integrity of the EDGs, however, it was found that these surveillance methods were so conservative and severe as to accelerate the degradation of the EDGs. Hence, new regulatory guideline, Reg. Guide 1.9 Rev. 3, was established by the U.S. NRC to resolve these problems. But it requires the additional implementation of reliability program of the EDGs to improve the actual reliability of them. In Korea, the EDGs of Yonggwang nuclear units 3 and 4 were the first plant applying new Reg. guide 1.9 rev.3 and implementing EDG reliability program. Furthermore it is expected that new guideline for the EDGs will be applied to other EDGs of Korean NPPs. In this paper, this reliability program is described, and it can be used as a reference for other EDGs in Korean NPPs

  3. Parametric study of power turbine for diesel engine waste heat recovery

    International Nuclear Information System (INIS)

    Zhao, Rongchao; Zhuge, Weilin; Zhang, Yangjun; Yin, Yong; Chen, Zhen; Li, Zhigang

    2014-01-01

    Turbocompounding is a promising technology to recover waste heat from the exhaust and reduce fuel consumption for internal combustion engine. The design of a power turbine plays a key role in turbocompound engine performance. This paper presents a set of parametric studies of power turbine performed on a turbocompound diesel engine by means of turbine through-flow model developed by the authors. This simulation model was verified and validated using engine performance test data and achieved reasonable accuracy. The paper first analyzed the influence of three key geometrical parameters (blade height, blade radius and nozzle exit blade angle) on turbine expansion ratio and engine fuel consumptions. After that, the impacts of the geometrical parameters on power distribution, air mass flow rate and exhaust temperature were analyzed. Results showed that these parameters had significant effects on engine BSFC and power. At high engine speeds, there existed an optimum value of geometry parameter to obtain the lowest BSFC. At low engine speeds, the engine BSFC kept increasing or decreasing continuously as the geometry parameters changed. Research also found that the engine BSFC was most sensitive to the nozzle exit blade angle, which should be considered carefully during the design process. This paper provides a useful method for matching and designing of a power turbine for turbocompound engine. - Highlights: •Through-flow model of axial-flow power turbine for turbocompound engine was established. •Turbocompound engine performance test was carried out to validate the cycle simulation model. •Influences of power turbine geometry parameters on engine BSFC and power were presented

  4. Survey of modern power plants driven by diesel and gas engines

    Energy Technology Data Exchange (ETDEWEB)

    Niemi, S [Turku Polytechnic, Turku (Finland)

    1998-12-31

    This report surveys the latest technology of power plants driven by reciprocating internal combustion (IC) engines, from information collected from publications made mainly during the 1990`s. Diesel and gas engines are considered competitive prime movers in power production due mainly to their high full- and part-load brake thermal efficiency, ability to burn different fuels, short construction time and fast start-ups. The market for engine power plants has grown rapidly, with estimated total orders for reciprocating engines of 1 MW output and more reaching the 5000 unit level, (10 GW), between June 1995 and May 1996. Industrialized countries much prefer combined heat and power (CHP) production. Intense interest has been shown in recent years in alternative gas fuels; natural gas appears to be the most promising, but liquid petroleum gas, gas from sewage disposal plants, landfill gas and other biogases, as well as wood gas have also been recognized as other alternatives. Liquid alternatives such as fuels and pyrolysis oil have also been mentioned, in addition to information on coal burning engines. The percentage of gas engines used has increased and different ones are being developed, based on either the traditional spark ignition (SI), dual-fuel technology or the more recent high pressure gas injection system. In cold climates, energy production is largely based on CHP plants. Waste heat is utilized for local, regional or district heating or for industrial uses like drying, heating, cooling etc. Even radiative and convective heat from gen-set surfaces are employed, and boilers are used with exhaust outlet temperatures of below dew point. Combined cycle schemes, including turbo compound systems and steam turbines, are also incorporated into engine power plants in order to increase output and efficiency. Two-stroke, low-speed diesel engine plants show the highest electric efficiencies, with combined cycle plants reaching up to 54 %, while gas engine plants achieved

  5. Survey of modern power plants driven by diesel and gas engines

    Energy Technology Data Exchange (ETDEWEB)

    Niemi, S. [Turku Polytechnic, Turku (Finland)

    1997-12-31

    This report surveys the latest technology of power plants driven by reciprocating internal combustion (IC) engines, from information collected from publications made mainly during the 1990`s. Diesel and gas engines are considered competitive prime movers in power production due mainly to their high full- and part-load brake thermal efficiency, ability to burn different fuels, short construction time and fast start-ups. The market for engine power plants has grown rapidly, with estimated total orders for reciprocating engines of 1 MW output and more reaching the 5000 unit level, (10 GW), between June 1995 and May 1996. Industrialized countries much prefer combined heat and power (CHP) production. Intense interest has been shown in recent years in alternative gas fuels; natural gas appears to be the most promising, but liquid petroleum gas, gas from sewage disposal plants, landfill gas and other biogases, as well as wood gas have also been recognized as other alternatives. Liquid alternatives such as fuels and pyrolysis oil have also been mentioned, in addition to information on coal burning engines. The percentage of gas engines used has increased and different ones are being developed, based on either the traditional spark ignition (SI), dual-fuel technology or the more recent high pressure gas injection system. In cold climates, energy production is largely based on CHP plants. Waste heat is utilized for local, regional or district heating or for industrial uses like drying, heating, cooling etc. Even radiative and convective heat from gen-set surfaces are employed, and boilers are used with exhaust outlet temperatures of below dew point. Combined cycle schemes, including turbo compound systems and steam turbines, are also incorporated into engine power plants in order to increase output and efficiency. Two-stroke, low-speed diesel engine plants show the highest electric efficiencies, with combined cycle plants reaching up to 54 %, while gas engine plants achieved

  6. More safety for emergency diesel engines for the Belgium nuclear power plants

    International Nuclear Information System (INIS)

    Laire, Ch.; Scauflaire, O.; D'ans, G.; Moland, G. de; Bresseleers, J.

    2002-01-01

    Each nuclear plant in Belgium is equipped with a series of ultimate power supply (UPS) units, also called emergency power units. These consist of generators driven by multi-cylinder (typically 18) diesel engines, which are marine derivatives. Unlike marine applications, the steady-state load does not produce pulsating torques. However, these diesel engines are designed to start upon short notice following a blackout and reach full power within a few seconds to guarantee the availability or all safety valves and ventilators. Such sharp and quasi-cold starts, periodically performed to guarantee the UPS availability, may spell utter failures of the crank shaft, as demonstrated by a fatigue failure observed on the fillets connecting the crank pin to the web faces. The fillet cracks initiate in bending mode and then progress in torsion mode to excessive transient torques arising in the power train during successive starts. Aware of the potential risk and conforming to the Belgian nuclear safety rules, the plant operator of Doel sponsored the development of a nondestructive technique enabling the inspection of each fillet for cracks without first removing each piston rod from its crank pin. As a result, Laborelec developed a specific eddy-current probe which avoids fully dismantling the engine, as is done during ten-yearly overhauls with dye-checks for cracks. Inspecting crank shaft fillet integrity with this least obtrusive technique requires 24 hours per engine. It can thus be performed more frequently to prevent total crank shaft failures in time and monitor the engine fatigue caused following the mandatory monthly start-up tests. This promising technique may also find marine applications. Measuring the transient torque arising between the engine and the generator showed that this reached very high values shortly after starting the engine and injecting fuel at full throttle to reach full power within seconds. The pulsating torque of the 18-cylinders engine occurring 9

  7. Optimal Dispatch of Unreliable Electric Grid-Connected Diesel Generator-Battery Power Systems

    Science.gov (United States)

    Xu, D.; Kang, L.

    2015-06-01

    Diesel generator (DG)-battery power systems are often adopted by telecom operators, especially in semi-urban and rural areas of developing countries. Unreliable electric grids (UEG), which have frequent and lengthy outages, are peculiar to these regions. DG-UEG-battery power system is an important kind of hybrid power system. System dispatch is one of the key factors to hybrid power system integration. In this paper, the system dispatch of a DG-UEG-lead acid battery power system is studied with the UEG of relatively ample electricity in Central African Republic (CAR) and UEG of poor electricity in Congo Republic (CR). The mathematical models of the power system and the UEG are studied for completing the system operation simulation program. The net present cost (NPC) of the power system is the main evaluation index. The state of charge (SOC) set points and battery bank charging current are the optimization variables. For the UEG in CAR, the optimal dispatch solution is SOC start and stop points 0.4 and 0.5 that belong to the Micro-Cycling strategy and charging current 0.1 C. For the UEG in CR, the optimal dispatch solution is of 0.1 and 0.8 that belongs to the Cycle-Charging strategy and 0.1 C. Charging current 0.1 C is suitable for both grid scenarios compared to 0.2 C. It makes the dispatch strategy design easier in commercial practices that there are a few very good candidate dispatch solutions with system NPC values close to that of the optimal solution for both UEG scenarios in CAR and CR.

  8. Modeling and Control of a DC-grid Hybrid Power System with Battery and Variable Speed Diesel Generators

    OpenAIRE

    Syverud, Tron Hansen

    2016-01-01

    Hybrid electric power systems (HPS) have successfully been integrated in the road-traffic industry due to enhanced efficiency and environmental benefits. Recently this concept has been implemented in the marine sector. In this master thesis, the construction of a DC hybrid power system for a marine vessel is outlined in detail. The HPS is developed in Matlbat/Simulink and comprises two set of diesel generators with variable speed, six-pulse diode bridges, a battery bank, bidire...

  9. Decentralized/stand-alone hybrid Wind-Diesel power systems to meet residential loads of hot coastal regions

    International Nuclear Information System (INIS)

    Elhadidy, M.A.; Shaahid, S.M.

    2005-01-01

    In view of rising costs, pollution and fears of exhaustion of oil and coal, governments around the world are encouraging to seek energy from renewable/sustainable energy sources such as wind. The utilization of energy from wind (since the oil embargo of the 1970s) is being widely disseminated for displacement of fossil fuel produced energy and to reduce atmospheric degradation. A system that consists of a wind turbine and Diesel genset is called a Wind-Diesel power system.The literature indicates that the commercial/residential buildings in Saudi Arabia consume an estimated 10-40% of the total electric energy generated. In the present study, the hourly mean wind-speed data of the period 1986-1997 recorded at the solar radiation and meteorological station, Dhahran (26 deg. 32'N, 50 deg. 13'E in the Eastern Coastal Region of Saudi Arabia), has been analyzed to investigate the potential of utilizing hybrid (Wind-Diesel) energy conversion systems to meet the load requirements of a hundred typical two bedroom residential buildings (with annual electrical energy demand of 3512 MWh). The long term monthly average wind speeds for Dhahran range from 4.2 to 6.4 m/s. The hybrid systems considered in the present case study consist of different combinations/clusters of 150 kW commercial wind machines supplemented with battery storage and Diesel back-up. The deficit energy generated by the Diesel generator (for different battery capacities) and the number of operational hours of the Diesel system to meet a specific annual electrical energy demand of 3512 MWh have also been presented. The evaluation of the hybrid system shows that with seven 150 kW wind energy conversion system (WECS) and one day of battery storage, the Diesel back-up system has to provide 21.6% of the load demand. Furthermore, with three days of battery storage, the Diesel back-up system has to provide 17.5% of the load demand. However, in the absence of battery storage, about 37% of the load needs to be

  10. 30 CFR 75.1914 - Maintenance of diesel-powered equipment.

    Science.gov (United States)

    2010-07-01

    ...) Sampling and analytical methods (including calibration of instrumentation) that are capable of accurately... inspection by an authorized representative of the Secretary and by miners' representatives. (i) Diesel...

  11. Proposals for Enhancing Frequency Control in Weak and Isolated Power Systems: Application to the Wind-Diesel Power System of San Cristobal Island-Ecuador

    Directory of Open Access Journals (Sweden)

    Danny Ochoa

    2018-04-01

    Full Text Available Wind-diesel hybridization has been emerging as common practice for electricity generation in many isolated power systems due to its reliability and its contribution in mitigating environmental issues. However, the weakness of these kind of power systems (due to their small inertia makes the frequency regulation difficult, particularly under high wind conditions, since part of the synchronous generation has to be set offline for ensuring a suitable tracking of the power demand. This reduces the power system’s ability to absorb wind power variations, leading to pronounced grid frequency fluctuations under normal operating conditions. This paper proposes some corrective actions aimed at enhancing the frequency control capability in weak and isolated power systems: a procedure for evaluating the system stability margin intended for readjusting the diesel-generator control gains, a new wind power curtailment strategy, and an inertial control algorithm implemented in the wind turbines. These proposals are tested in the San Cristobal (Galapagos Islands-Ecuador hybrid wind-diesel power system, in which many power outages caused by frequency relays tripping were reported during the windiest season. The proposals benefits have been tested in a simulation environment by considering actual operating conditions based on measurement data recorded at the island.

  12. Research on the Power Recovery of Diesel Engines with Regulated Two-Stage Turbocharging System at Different Altitudes

    Directory of Open Access Journals (Sweden)

    Hualei Li

    2014-01-01

    Full Text Available Recovering the boost pressure is very important in improving the dynamic performance of diesel engines at high altitudes. A regulated two-stage turbocharging system is an adequate solution for power recovery of diesel engines. In the present study, the change of boost pressure and engine power at different altitudes was investigated, and a regulated two-stage turbocharging system was constructed with an original turbocharger and a matched low pressure turbocharger. The valve control strategies for boost pressure recovery, which formed the basis of the power recovery method, are presented here. The simulation results showed that this system was effective in recovering the boost pressure at different speeds and various altitudes. The turbine bypass valve and compressor bypass valve had different modes to adapt to changes in operating conditions. The boost pressure recovery could not ensure power recovery over the entire operating range of the diesel engine, because of variation in overall turbocharger efficiency. The fuel-injection compensation method along with the valve control strategies for boost pressure recovery was able to reach the power recovery target.

  13. Comparative evaluation of three alternative power cycles for waste heat recovery from the exhaust of adiabatic diesel engines

    Science.gov (United States)

    Bailey, M. M.

    1985-01-01

    Three alternative power cycles were compared in application as an exhaust-gas heat-recovery system for use with advanced adiabatic diesel engines. The power cycle alternatives considered were steam Rankine, organic Rankine with RC-1 as the working fluid, and variations of an air Brayton cycle. The comparison was made in terms of fuel economy and economic payback potential for heavy-duty trucks operating in line-haul service. The results indicate that, in terms of engine rated specific fuel consumption, a diesel/alternative-power-cycle engine offers a significant improvement over the turbocompound diesel used as the baseline for comparison. The maximum imporvement resulted from the use of a Rankine cycle heat-recovery system in series with turbocompounding. The air Brayton cycle alternatives studied, which included both simple-cycle and compression-intercooled configurations, were less effective and provided about half the fuel consumption improvement of the Rankine cycle alternatives under the same conditions. Capital and maintenance cost estimates were also developed for each of the heat-recovery power cycle systems. These costs were integrated with the fuel savings to identify the time required for net annual savings to pay back the initial capital investment. The sensitivity of capital payback time to arbitrary increases in fuel price, not accompanied by corresponding hardware cost inflation, was also examined. The results indicate that a fuel price increase is required for the alternative power cycles to pay back capital within an acceptable time period.

  14. Power quality control of an autonomous wind-diesel power system based on hybrid intelligent controller.

    Science.gov (United States)

    Ko, Hee-Sang; Lee, Kwang Y; Kang, Min-Jae; Kim, Ho-Chan

    2008-12-01

    Wind power generation is gaining popularity as the power industry in the world is moving toward more liberalized trade of energy along with public concerns of more environmentally friendly mode of electricity generation. The weakness of wind power generation is its dependence on nature-the power output varies in quite a wide range due to the change of wind speed, which is difficult to model and predict. The excess fluctuation of power output and voltages can influence negatively the quality of electricity in the distribution system connected to the wind power generation plant. In this paper, the authors propose an intelligent adaptive system to control the output of a wind power generation plant to maintain the quality of electricity in the distribution system. The target wind generator is a cost-effective induction generator, while the plant is equipped with a small capacity energy storage based on conventional batteries, heater load for co-generation and braking, and a voltage smoothing device such as a static Var compensator (SVC). Fuzzy logic controller provides a flexible controller covering a wide range of energy/voltage compensation. A neural network inverse model is designed to provide compensating control amount for a system. The system can be optimized to cope with the fluctuating market-based electricity price conditions to lower the cost of electricity consumption or to maximize the power sales opportunities from the wind generation plant.

  15. Experimental investigation on the availability, performance, combustion and emission distinctiveness of bael oil/ diesel/ diethyl ether blends powered in a variable compression ratio diesel engine

    Science.gov (United States)

    Krishnamoorthi, M.; Malayalamurthi, R.

    2018-02-01

    The present work aims at experimental investigation on the combined effect of injection timing (IT) and injection pressure (IP) on the performance and emissions characteristics, and exergy analysis of a compression-ignition (CI) engine powered with bael oil blends. The tests were conducted using ternary blends of bael oil, diethyl ether (DEE) and neat diesel (D) at various engine loads at a constant engine speed (1500 rpm). With B2 (60%D + 30%bael oil+10%DEE) fuel, the brake thermal efficiency (BTE) of the engine is augmented by 3.5%, reduction of 4.7% of oxides of nitrogen (NOx) emission has been observed at 100% engine load with 250 bar IP. B2 fuel exhibits 7% lower scale of HC emissions compared to that of diesel fuel at 100% engine load in 23 °bTDC IT. The increment in both cooling water and exhaust gas availabilities lead to increasing exergy efficiency with increasing load. The exergy efficiency of about 62.17% has been recorded by B2 fuel at an injection pressure of 230 IP bar with 100% load. On the whole, B2 fuel displays the best performance and combustion characteristics. It also exhibits better characteristics of emissions level in terms of lower HC, smoke opacity and NOx.

  16. STUDYING OF INFLUENCE OF BIOFUEL MOTOR QUALITIES ON POWER AND ECOLOGICAL CHARACTERISTICS OF THE DIESEL ENGINE

    Directory of Open Access Journals (Sweden)

    Levterov, A.

    2012-06-01

    Full Text Available The results of bench tests of D21A (2 Ч 10,5/12 diesel engine at its operation on mixed diesel fuel with improved qualities (Euro and the biofuel synthesized by the way of ethanol intereste-rification of rapeseed oil are offered.

  17. An assessment on performance, combustion and emission behavior of a diesel engine powered by ceria nanoparticle blended emulsified biofuel

    International Nuclear Information System (INIS)

    Annamalai, M.; Dhinesh, B.; Nanthagopal, K.; SivaramaKrishnan, P.; Isaac JoshuaRamesh Lalvani, J.; Parthasarathy, M.; Annamalai, K.

    2016-01-01

    smoke opacity emission could be achieved compared with the LGO emulsion and diesel fuel at various power outputs. Improvement in BTE was also observed for LGO nano emulsion test fuel compared to neat LGO and LGO emulsion fuels due to improved atomization and rapid evaporation rate of fuel owing to large surface area to volume ratio of CeO_2 nanoparticle.

  18. Estimation of CO2 reduction by parallel hard-type power hybridization for gasoline and diesel vehicles.

    Science.gov (United States)

    Oh, Yunjung; Park, Junhong; Lee, Jong Tae; Seo, Jigu; Park, Sungwook

    2017-10-01

    The purpose of this study is to investigate possible improvements in ICEVs by implementing fuzzy logic-based parallel hard-type power hybrid systems. Two types of conventional ICEVs (gasoline and diesel) and two types of HEVs (gasoline-electric, diesel electric) were generated using vehicle and powertrain simulation tools and a Matlab-Simulink application programming interface. For gasoline and gasoline-electric HEV vehicles, the prediction accuracy for four types of LDV models was validated by conducting comparative analysis with the chassis dynamometer and OBD test data. The predicted results show strong correlation with the test data. The operating points of internal combustion engines and electric motors are well controlled in the high efficiency region and battery SOC was well controlled within ±1.6%. However, for diesel vehicles, we generated virtual diesel-electric HEV vehicle because there is no available vehicles with similar engine and vehicle specifications with ICE vehicle. Using a fuzzy logic-based parallel hybrid system in conventional ICEVs demonstrated that HEVs showed superior performance in terms of fuel consumption and CO 2 emission in most driving modes. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. On-board measurement of emissions from liquefied petroleum gas, gasoline and diesel powered passenger cars in Algeria

    OpenAIRE

    Chikhi , Saâdane; Boughedaoui , Ménouèr; Kerbachi , Rabah; Joumard , Robert

    2014-01-01

    International audience; On-board measurements of unit emissions of CO, HC, NOx and CO 2 were conducted on 17 private cars powered by different types of fuels including gasoline, dual gasoline-LPG, gasoline, and diesel. The tests performed revealed the effect of LPG injection technology on unit emissions and made it possible to compare the measured emissions to the European Artemis emission model. A sequential multipoint injection LPG kit with no catalyst installed was found to be the most eff...

  20. First and second law analysis of diesel engine powered cogeneration systems

    International Nuclear Information System (INIS)

    Abusoglu, Aysegul; Kanoglu, Mehmet

    2008-01-01

    In this article, the thermodynamic analysis of the existing diesel engine cogeneration system is performed. All necessary data are obtained from the actual diesel engine cogeneration plant located at Gaziantep, Turkey. The exergy analysis is aimed to evaluate the exergy destruction in each component as well as the exergetic efficiencies. The thermodynamic performance of a 25.32 MW electricity and 8.1 tons/h steam capacity diesel engine cogeneration system at full load conditions is analyzed. The thermal efficiency of the overall plant is found to be 44.2% and the exergetic efficiency is 40.7%. The exergy balance equations developed in this paper may also be utilized in the exergoeconomic analysis to estimate the production costs depending on various input costs in a diesel cogeneration system

  1. Reliability analysis of Diesel Generator power supply system of Prototype Fast Breeder Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Pramod Kumar, E-mail: pramodks@igcar.gov.in; Bhuvana, V.; Ramakrishnan, M.

    2016-12-15

    Highlights: • The unavailability of DG success is 4.75E−3 for 2/4 and 1.47E−3 for 1/4. • Modeling includes sub systems like CB, SSWS, Fuel oil system & 220 V DC. • DG-FR, DG-FR-CCF and DG maintenance is major contributors of DG unavailability. • Uncertainty analysis has been carried out through Monte Carlo simulations. • Sensitivity analysis identifies DG mechanical FR as most sensitive part. - Abstract: The unavailability of Diesel Generator power supply system has been evaluated using Fault tree method with ISOGRAPH reliability software and is found to be 4.75E−3 for 2/4 (DG success) and 1.47E−3 for 1/4 (DG success). Common cause failures contribute significantly to the unavailability of the system. Statistical analysis indicates that the DG unavailability is uncertain by Error Factor 4.4 (90% confidence bound) for 2 out of 4 DG system (system success) and by Error Factor 4.1 (90% confidence bound) for 1 out of 4 DG system (system success). Support systems namely Safety related service water system, Fuel oil system and circuit breaker control power supply dependency have been modeled. Results of importance analysis and sensitivity study are used to identify significant contributors to unavailability. DG fails to run, DG fails to run due to CCF and DG maintenance out of service is identified as dominant and important contributors of DG unavailability. Uncertainty analysis has been carried out through Monte Carlo simulations.

  2. Coal fueled diesel system for stationary power applications-technology development

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-08-01

    The use of coal as a fuel for diesel engines dates back to the early days of the development of the engine. Dr. Diesel envisioned his concept as a multi-fuel engine, with coal a prime candidate due to the fact that it was Germany`s primary domestic energy resource. It is interesting that the focus on coal burning diesel engines appears to peak about every twenty years as shortages of other energy resources increase the economic attractiveness of using coal. This periodic interest in coal started in Germany with the work of Diesel in the timeframe 1898-1906. Pawlikowski carried on the work from 1916 to 1928. Two German companies commercialized the technology prior to and during World War II. The next flurry of activity occurred in the United States in the period from 1957-69, with work done at Southwest Research Institute, Virginia Polytechnical University, and Howard University. The current period of activity started in 1978 with work sponsored by the Conservation and Renewable Energy Branch of the US Department of Energy. This work was done at Southwest Research Institute and by ThermoElectron at Sulzer Engine in Switzerland. In 1982, the Fossil Energy Branch of the US Department of Energy, through the Morgantown Energy Technology Center (METC) initiated a concentrated effort to develop coal burning diesel and gas turbine engines. The diesel engine work in the METC sponsored program was performed at Arthur D. Little (Cooper-Bessemer as subcontractor), Bartlesville Energy Technology Center (now NIPER), Caterpillar, Detroit Diesel Corporation, General Motor Corporation (Electromotive Division), General Electric, Southwest Research Institute, and various universities and other research and development organizations. This DOE-METC coal engine RD & D initiative which spanned the 1982-1993 timeframe is the topic of this review document. The combustion of a coal-water fuel slurry in a diesel engine is described. The engine modifications necessary are discussed.

  3. Influence of driving style on fuel consumption and Emissions in diesel-powered passenger car

    OpenAIRE

    Fonseca González, Natalia Elizabeth; Casanova Kindelán, Jesús; Espinosa Zapata, Felipe

    2010-01-01

    This paper presents the main results of a study on the influence of driving style on fuel consumption and pollutant emissions of diesel passenger car in urban traffic. Driving styles (eco, normal or aggressive) patterns were based on the “eco-driving” criteria. The methodology is based on on-board emission measurements in real urban traffic in the city of Madrid. Five diesel passenger cars, have been tested. Through a statistical analysis, a Dynamic Performance Index was defined for die...

  4. Analysis of power tiller noise using diesel-biodiesel fuel blends

    OpenAIRE

    N Keramat Siavash; Gh Najafi; S. R Hassan Beigi Bidgoli; B Ghobadian

    2015-01-01

    Introduction: There are several sources of noise in an industrial and agriculture environment. Machines with rotating or reciprocating engines are sound-producing sources. Also, the audio signal can be analyzed to discover how well a machine operates. Diesel engines complex noise SPL and sound frequency content both strongly depend on fuel combustion, which produces the so-called combustion noise. Actually, the unpleasant sound signature of diesel engines is due to the harsh and irregular sel...

  5. Effects of injection timing, before and after top dead center on the propulsion and power in a diesel engine

    Directory of Open Access Journals (Sweden)

    Nader Raeie

    2014-06-01

    Full Text Available It is well known that injection strategies including the injection timing and pressure play the most important role in determining engine performance, especially in pollutant emissions. However, the injection timing and pressure quantitatively affect the performance of diesel engine with a turbo charger are not well understood. In this paper, the fire computational fluid dynamics (CFD code with an improved spray model has been used to simulate the spray and combustion processes of diesel with early and late injection timings and six different injection pressure (from 275 bar to 1000 bar. It has been concluded that the use of early injection provides lower soot and higher NOx emissions than the late injection. In this study, it has been tried using the change of fuel injection time at these two next steps: before top dead center (BTDC and after top dead center (ATDC in order to achieving optimum emission and power in a specific point.

  6. Thermal design of a natural gas - diesel dual fuel turbocharged V18 engine for ship propulsion and power plant applications

    Science.gov (United States)

    Douvartzides, S.; Karmalis, I.

    2016-11-01

    A detailed method is presented on the thermal design of a natural gas - diesel dual fuel internal combustion engine. An 18 cylinder four stroke turbocharged engine is considered to operate at a maximum speed of 500 rpm for marine and power plant applications. Thermodynamic, heat transfer and fluid flow phenomena are mathematically analyzed to provide a real cycle analysis together with a complete set of calculated operation conditions, power characteristics and engine efficiencies. The method is found to provide results in close agreement to published data for the actual performance of similar engines such as V18 MAN 51/60DF.

  7. Power supply for pumping systems in northern Chile: Photovoltaics as alternative to grid extension and diesel engines

    International Nuclear Information System (INIS)

    Chueco-Fernandez, Francisco J.; Bayod-Rujula, Angel A.

    2010-01-01

    This paper examines and compares the cost-effectiveness to energize pumping systems in remote areas on northern Chile by means of photovoltaic systems, diesel engines and grid extension. Variables such as the distance to the power grid, the voltage grid, the prices of electricity and fuel, and the required investments, are taken into account. The comparison is made for wide range of variable values, distances and pumping requirements. The results obtained are useful for choosing the best alternative for the power supply of pumping systems in wells in Northern Chile. (author)

  8. Ciclo combinado Diesel-Vapor como repotenciación de una central termoeléctrica: caso de estudio; Combined Cycle Diesel-Steam as Power Plant Repowering: study case

    Directory of Open Access Journals (Sweden)

    Alberto Eduardo Calvo González

    2015-04-01

    Full Text Available La necesidad imperiosa de cubrir el déficit de generación eléctrica ampliando el potencial de generación con motores diesel a fuel oíl, cuya instalación requiere de muy poco tiempo, es una solución adecuada. La idea de aprovechar los nodos del sistema electro energético, como son las subestaciones y las centrales eléctricas, para instalar los grupos electrógenos es una solución apropiada. Pero en el caso de una central termoeléctrica, al montar estas instalaciones de forma independiente, no se aprovechan las posibilidades que la combinación de procesos ofrece como la disminución del consumo de combustible, y de la contaminación ambiental por unidad de energía producida. El presente trabajo explora la posibilidad de instalar plantas eléctricas diesel a fuel oil como ciclo combinado diesel-vapor. Se demuestra la conveniencia de instalar plantas eléctricas diesel a fuel oil como ciclo combinado diesel-vapor, aprovechando la sinergia que se logra por la combinación de los procesos térmicos.  The pressing need of covering generation deficit to satisfy the demand in the shorter possible time, by enlarging the generation potential with fuel oil fueled diesel motors, it’s an appropriate solution. The idea of taking advantage of electric grid existent nodes facilities to place the generating electricity diesel motors is a non-unwise solution. But in the case of the node of steam power station place these motors in an independent way, don't take advantage of the possibilities that the processes combination offers, as the combined cycle diesel vapor for example. The work presented herein explored and showed the possibility of installing the electric diesel plants as a repowering the existing steam power plant by combined cycle diesel-steam taking advantage of the synergy achieved by thermal processes combination.

  9. Ciclo combinado Diesel-Vapor como repotenciación de una central termoeléctrica: caso de estudio; Combined Cycle Diesel-Steam as Power Plant Repowering: study case

    Directory of Open Access Journals (Sweden)

    Alberto Eduardo Calvo González

    2014-06-01

    Full Text Available La necesidad imperiosa de cubrir el déficit de generación eléctrica ampliando el potencial de generación con motores diesel a fuel oíl, cuya instalación requiere de muy poco tiempo, es una solución adecuada. La idea de aprovechar los nodos del sistema electro energético, como son las subestaciones y las centrales eléctricas, para instalar los grupos electrógenos es una solución apropiada. Pero en el caso de una central termoeléctrica, al montar estas instalaciones de forma independiente, no se aprovechan las posibilidades que la combinación de procesos ofrece como la disminución del consumo de combustible, y de la contaminación ambiental por unidad de energía producida. El presente trabajo explora la posibilidad de instalar plantas eléctricas diesel a fuel oil como ciclo combinado diesel-vapor. Se demuestra la conveniencia de instalar plantas eléctricas diesel a fuel oil como ciclo combinado diesel-vapor, aprovechando la sinergia que se logra por la combinación de los procesos térmicos. The pressing need of covering generation deficit to satisfy the demand in the shorter possible time, by enlarging the generation potential with fuel oil fueled diesel motors, it’s an appropriate solution. The idea of taking advantage of electric grid existent nodes facilities to place the generating electricity diesel motors is a non-unwise solution. But in the case of the node of steam power station place these motors in an independent way, don't take advantage of the possibilities that the processes combination offers, as the combined cycle diesel vapor for example. The work presented herein explored and showed the possibility of installing the electric diesel plants as a repowering the existing steam power plant by combined cycle diesel-steam taking advantage of the synergy achieved by thermal processes combination.

  10. Prediction of an optimum biodiesel-diesel blended fuel for compression ignition engine using GT-power

    International Nuclear Information System (INIS)

    Shah, A.N.; Shah, F.H.; Shahid, E.M.; Gardezi, S.A.R.

    2014-01-01

    This paper describes the development of a turbocharged direct-injection compression ignition (CI) engine model using fluid-dynamic engine simulation codes through a simulating tool known as GT Power. The model was first fueled with diesel, and then with various blends of biodiesel and diesel by allotting suitable parameters to predict an optimum blended fuel. During the optimization, main focus was on the engine performance, combustion, and one of the major regulated gaseous pollutants known as oxides of nitrogen (NOx). The combustion parameters such as Premix Duration (DP), Main Duration (DM), Premix Fraction (FP), Main Exponent (EM) and ignition delay (ID) affect the start of injection (SOI) angle, and thus played significant role in the prediction of optimum blended fuel. The SOI angle ranging from 5.2 to 5.7 degree crank angle (DCA) measured before top dead center (TDC) revealed an optimum biodiesel-diesel blend known as B20 (20% biodiesel and 80% diesel by volume). B20 exhibited the minimum possible NOx emissions, better combustion and acceptable engine performance. Moreover, experiments were performed to validate the simulated results by fueling the engine with B20 fuel and operating it on AC electrical dynamometer. Both the experimental and simulated results were in good agreement revealing maximum deviations of only 3%, 3.4%, 4.2%, and 5.1% for NOx, maximum combustion pressure (MCP), engine brake power (BP), and brake specific fuel consumption (BSFC), respectively. Meanwhile, a positive correlation was found between MCP and NOx showing that both the parameters are higher at lower speeds, relative to higher engine speeds. (author)

  11. Diesel engine power generating set efficiency for nuclear power plant electrical energy supply in case of emergency

    International Nuclear Information System (INIS)

    Popovic, I.; Aksamija, R.; Tumpa, M.

    1984-01-01

    Working ability of diesel engine set to starting and functioning reliability during operation is evaluated within study of efficiency. methods of calculation are applied: data compilation method and Markov method. The evaluation is that a diesel engine set has efficiency of 0.993285. It is a high efficiency which ensures a safe start, load take over and safe operation. This evaluation makes a basis for similar calculations which will be needed for national nuclear program. (author)

  12. Power generation using coir-pith and wood derived producer gas in diesel engines

    Energy Technology Data Exchange (ETDEWEB)

    Ramadhas, A.S.; Jayaraj, S.; Muraleedharan, C. [Department of Mechanical Engineering, National Institute of Technology Calicut, Calicut-673 601, Kerala State (India)

    2006-10-15

    Partial combustion of biomass in the gasifier generates producer gas that can be used for heating purposes and as supplementary or sole fuel in internal combustion engines. In this study, the potential of coir-pith and wood chips as the feedstock for gasifier is analyzed. The performance of the gasifier-engine system is analyzed by running the engine for various producer gas-air flow ratios and at different load conditions. The system is experimentally optimized with respect to maximum diesel savings and lower emissions in the dual fuel mode operation while using coir-pith and wood chips separately. The performance and emission characteristics of the dual fuel engine are compared with that of diesel engine at different load conditions. Specific energy consumption in the dual fuel mode of operation is found to be in the higher side at all load conditions. The brake thermal efficiency of the engine while using wood chips in the dual mode operation is higher than that of coir-pith. The CO emission is higher in the case of dual fuel mode of operation as compared to that of diesel mode. In the dual fuel mode of operation, the higher diesel savings is achieved while using wood chips as compared to that of coir-pith. The comparison of the performance and emission characteristics of the dual fuel engine with diesel engine is also described. (author)

  13. Use of high ash fuel in diesel power plants II; Korkean tuhkapitoisuuden omaavan polttoaineen kaeyttoe dieselvoimaloissa II

    Energy Technology Data Exchange (ETDEWEB)

    Vestergren, R; Normen, E; Hellen, G [Wartsila Diesel International Ltd Oy, Vaasa (Finland); and others

    1997-10-01

    Heavy fuel oils containing a large amount of ash are used in some geographically restricted areas. The ash components can cause problems with deposit formation and hot corrosion, leading to burned exhaust gas valves in some diesel engines. The LIEKKI 2 programs Use of high ash fuel in diesel power plants, Part I and II, have been initiated to clarify the mechanisms of deposit formation, and start and propagation of hot corrosion. The aim is to get enough knowledge to enable the development of the Waertsilae diesel engines to be able to handle heavy fuels with a very high ash content. The chemistry during combustion has been studied. The chemical and physical properties of the particles in the exhaust gas, of the deposits, and of exhaust valves have been investigated. Exhaust gas particle measurements have been performed when running on high ash fuel, both with and without deposit modifying fuel additive. Theories for the mechanisms mentioned above have been developed. On the practical side two long time field tests are going on, one with an ash/deposit modifying fuel additive (vanadium chemistry alteration), one with fuel water washing (sodium removal). Seven different reports have been written. (orig.)

  14. On-board measurement of emissions from liquefied petroleum gas, gasoline and diesel powered passenger cars in Algeria.

    Science.gov (United States)

    Chikhi, Saâdane; Boughedaoui, Ménouèr; Kerbachi, Rabah; Joumard, Robert

    2014-08-01

    On-board measurements of unit emissions of CO, HC, NOx and CO₂ were conducted on 17 private cars powered by different types of fuels including gasoline, dual gasoline-liquefied petroleum gas (LPG), gasoline, and diesel. The tests performed revealed the effect of LPG injection technology on unit emissions and made it possible to compare the measured emissions to the European Artemis emission model. A sequential multipoint injection LPG kit with no catalyst installed was found to be the most efficient pollutant reduction device for all of the pollutants, with the exception of the NOx. Specific test results for a sub-group of LPG vehicles revealed that LPG-fueled engines with no catalyst cannot compete with catalyzed gasoline and diesel engines. Vehicle age does not appear to be a determining parameter with regard to vehicle pollutant emissions. A fuel switch to LPG offers many advantages as far as pollutant emissions are concerned, due to LPG's intrinsic characteristics. However, these advantages are being rapidly offset by the strong development of both gasoline and diesel engine technologies and catalyst converters. The LPG's performance on a chassis dynamometer under real driving conditions was better than expected. The enforcement of pollutant emission standards in developing countries is an important step towards introducing clean technology and reducing vehicle emissions. Copyright © 2014. Published by Elsevier B.V.

  15. Diesel oil

    Science.gov (United States)

    Oil ... Diesel oil ... Diesel oil poisoning can cause symptoms in many parts of the body. EYES, EARS, NOSE, AND THROAT Loss of ... most dangerous effects of hydrocarbon (such as diesel oil) poisoning are due to inhaling the fumes. NERVOUS ...

  16. Optimal sizing study of hybrid wind/PV/diesel power generation unit

    Energy Technology Data Exchange (ETDEWEB)

    Belfkira, Rachid; Zhang, Lu; Barakat, Georges [Groupe de Recherche en Electrotechnique et Automatique du Havre, University of Le Havre, 25 rue Philippe Lebon, BP 1123, 76063 Le Havre (France)

    2011-01-15

    In this paper, a methodology of sizing optimization of a stand-alone hybrid wind/PV/diesel energy system is presented. This approach makes use of a deterministic algorithm to suggest, among a list of commercially available system devices, the optimal number and type of units ensuring that the total cost of the system is minimized while guaranteeing the availability of the energy. The collection of 6 months of data of wind speed, solar radiation and ambient temperature recorded for every hour of the day were used. The mathematical modeling of the main elements of the hybrid wind/PV/diesel system is exposed showing the more relevant sizing variables. A deterministic algorithm is used to minimize the total cost of the system while guaranteeing the satisfaction of the load demand. A comparison between the total cost of the hybrid wind/PV/diesel energy system with batteries and the hybrid wind/PV/diesel energy system without batteries is presented. The reached results demonstrate the practical utility of the used sizing methodology and show the influence of the battery storage on the total cost of the hybrid system. (author)

  17. Exposure to dust and particle-associated 1-nitropyrene of drivers of diesel-powered equipment in underground mining.

    Science.gov (United States)

    Scheepers, P T J; Micka, V; Muzyka, V; Anzion, R; Dahmann, D; Poole, J; Bos, R P

    2003-07-01

    A field study was conducted in two mines in order to determine the most suitable strategy for ambient exposure assessment in the framework of a European study aimed at validation of biological monitoring approaches for diesel exhaust (BIOMODEM). Exposure to dust and particle-associated 1-nitropyrene (1-NP) was studied in 20 miners of black coal by the long wall method (Czech Republic) and in 20 workers in oil shale mining by the room and pillar method (Estonia). The study in the oil shale mine was extended to include 100 workers in a second phase (main study). In each mine half of the study population worked underground as drivers of diesel-powered trains (black coal) and excavators (oil shale). The other half consisted of workers occupied in various non-diesel production assignments. Exposure to diesel exhaust was studied by measurement of inhalable and respirable dust at fixed locations and by personal air sampling of respirable dust. The ratio of geometric mean inhalable to respirable dust concentration was approximately two to one. The underground/surface ratio of respirable dust concentrations measured at fixed locations and in the breathing zones of the workers was 2-fold or greater. Respirable dust was 2- to 3-fold higher in the breathing zone than at fixed sampling locations. The 1-NP content in these dust fractions was determined by gas chromatography-mass spectrometry/mass spectrometry and ranged from 0.003 to 42.2 ng/m(3) in the breathing zones of the workers. In mine dust no 1-NP was detected. In both mines 1-NP was observed to be primarily associated with respirable particles. The 1-NP concentrations were also higher underground than on the surface (2- to 3-fold in the coal mine and 10-fold or more in the oil shale mine). Concentrations of 1-NP in the breathing zones were also higher than at fixed sites (2.5-fold in the coal mine and 10-fold in the oil shale mine). For individual exposure assessment personal air sampling is preferred over air sampling

  18. Alterations of global histone H4K20 methylation during prostate carcinogenesis

    Directory of Open Access Journals (Sweden)

    Behbahani Turang E

    2012-03-01

    Full Text Available Abstract Background Global histone modifications have been implicated in the progression of various tumour entities. Our study was designed to assess global methylation levels of histone 4 lysine 20 (H4K20me1-3 at different stages of prostate cancer (PCA carcinogenesis. Methods Global H4K20 methylation levels were evaluated using a tissue microarray in patients with clinically localized PCA (n = 113, non-malignant prostate disease (n = 27, metastatic hormone-naive PCA (mPCA, n = 30 and castration-resistant PCA (CRPC, n = 34. Immunohistochemistry was performed to assess global levels of H4K20 methylation levels. Results Similar proportions of the normal, PCA, and mPCA prostate tissues showed strong H4K20me3 staining. CRPC tissue analysis showed the weakest immunostaining levels of H4K20me1 and H4K20me2, compared to other prostate tissues. H4K20me2 methylation levels indicated significant differences in examined tissues except for normal prostate versus PCA tissue. H4K20me1 differentiates CRPC from other prostate tissues. H4K20me1 was significantly correlated with lymph node metastases, and H4K20me2 showed a significant correlation with the Gleason score. However, H4K20 methylation levels failed to predict PSA recurrence after radical prostatectomy. Conclusions H4K20 methylation levels constitute valuable markers for the dynamic process of prostate cancer carcinogenesis.

  19. Sixth international wind-diesel workshop

    International Nuclear Information System (INIS)

    1992-01-01

    At a workshop on hybrid wind/diesel power generation systems, papers were presented on international research programs, demonstration projects, wind/diesel deployment strategies and requirements, wind/diesel market development and economics, wind turbine design requirements, and wind/diesel models and analytical tools. Separate abstracts have been prepared for 11 papers from this workshop

  20. Sixth international wind-diesel workshop

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    At a workshop on hybrid wind/diesel power generation systems, papers were presented on international research programs, demonstration projects, wind/diesel deployment strategies and requirements, wind/diesel market development and economics, wind turbine design requirements, and wind/diesel models and analytical tools. Separate abstracts have been prepared for 11 papers from this workshop.

  1. A technical and environmental approach of the utilization of the Diesel instead of the natural gas in thermoelectric power plants in Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Villela, Iraides Aparecida de Castro [Universidade de Sao Paulo (USP), Lorena, SP (Brazil). College of Engineering]. E-mail: iraides@debas.eel.usp.br; Silveira, Jose Luz [UNESP, Guaratingueta, SP (Brazil). Energy Dept.]. E-mail: joseluz@feg.unesp.br; www.feg.unesp.br/gose

    2008-07-01

    This work analyses the Thermodynamic and Ecological Performance of a thermoelectric power plant with nominal power of 310 MW in combined cycle. In the worldwide scenery, combined cycle power plants have become more and more known, due to the stage of development of the technology as well as to its high efficiency and low levels of atmospherical emissions when compared with conventional thermodynamic cycles. In Brazil, unfortunately, the diesel oil has been utilized in thermoelectric power plants, for the natural gas has not met the demand, in face of the problems in the contract with Bolivia. The study of the operation of these thermoelectric power plants with a second combustible, as the diesel, for instance, becomes more necessary, seen that the levels of thermal efficiency and of emissions undergo considerable alterations. This work aims to analyze the thermal and ecological efficiency of this thermoelectric power plant, through a comparison between the natural gas and the diesel. And analysis of the First Law of Thermodynamics is made and the ecological efficiency of the plant being studied for the two combustibles is determined. From the results obtained, it is inferred that the utilization of the natural associated to the use of the technology of the combined cycle presents better energetic and ecological efficiency when compared to the diesel. (author)

  2. Techno Economical Study of PV-Diesel Power System for a Remote Island in Indonesia : A Case Study of Miangas Island

    Science.gov (United States)

    Rumbayan, M.; Nagasaka, K.

    2018-05-01

    The purpose of this study is to conduct the techno economical study of PC-Diesel power system based on renewable energy available locally in a remote island. This research is a case study for Miangas island which is the border island between Indonesia and Philipines. It is located in Talaud Island regency of North Sulawesi province of Indonesia. The monthly average daily radiation in Miangas island is 5.52 kWh/m2.The research methods used are data collection and data analysis using software HOMER. Based on the simulation result, the techno economic study of PV-Diesel power plant system based on energy demand in Miangas island can be obtained. The Cost of Energy (COE), Net Present Cost (NPC) and operating cost for proposed hybrid PV-Diesel power generation can be assessed for the design power systems uses Canadian solar Max Power C56x-325P of 150 KW PV, 18 string of Surette 6CS25P, Diesel Generator 50 kW and converter Magnum MS4448PAE 25 kW. The annual electricity production from the PV Diesel system for Miangas island is 309.589 kWh in which 80.7% electricity comes from PV, 19.3% electricity comes from diesel with the 109.063 kWh excess electricity. The cost of generating electrical energy in the term of cost of energy (COE), Net Present Cost (NPC) and operating cost are 0.318 US/kWh, 719.673 US and 36.857 US respectively.

  3. Simulation of a heavy-duty diesel engine with electrical turbocompounding system using operating charts for turbocharger components and power turbine

    International Nuclear Information System (INIS)

    Katsanos, C.O.; Hountalas, D.T.; Zannis, T.C.

    2013-01-01

    Highlights: • A diesel model was developed using charts for turbocharger and power turbine. • The maximum value of bsfc improvement is 4.1% at 100% engine load. • The generated electric power ranges from 23 kW to 62 kW. • Turbocharger turbine efficiency decreases slightly with the power turbine speed. • Turbocompounding increases the average pressure value in the exhaust manifold. - Abstract: In diesel engines, approximately 30–40% of the energy supplied by the fuel is rejected to the ambience through exhaust gases. Therefore, there is a potentiality for further considerable increase of diesel engine efficiency with the utilization of exhaust gas heat and its conversion to mechanical or electrical energy. In the present study, the operational behavior of a heavy-duty (HD) diesel truck engine equipped with an electric turbocompounding system is examined on a theoretical basis. The electrical turbocompounding configuration comprised of a power turbine coupled to an electric generator, which is installed downstream to the turbocharger (T/C) turbine. A diesel engine simulation model has been developed using operating charts for both turbocharger and power turbine. A method for introducing the operating charts into the engine model is described thoroughly. A parametric analysis is conducted with the developed simulation tool, where the varying parameter is the rotational speed of power turbine shaft. In this study, the interaction between the power turbine and the turbocharged diesel engine is examined in detail. The effect of power turbine speed on T/C components efficiencies, power turbine efficiency, exhaust pressure and temperature, engine boost pressure and air to fuel ratio is evaluated. In addition, theoretical results for the potential impact of electrical turbocompounding on the generated electric power, net engine power and relative improvement of brake specific fuel consumption (bsfc) are provided. The critical evaluation of the theoretical

  4. Allocation of ESS by interval optimization method considering impact of ship swinging on hybrid PV/diesel ship power system

    International Nuclear Information System (INIS)

    Wen, Shuli; Lan, Hai; Hong, Ying-Yi; Yu, David C.; Zhang, Lijun; Cheng, Peng

    2016-01-01

    Highlights: • An uncertainty model of PV generation on board is developed based on the experiments. • The moving and swinging of the ship are considered in the optimal ESS sizing problem. • Optimal sizing of ESS in a hybrid PV/diesel/ESS ship power system is gained by the interval optimization method. • Different cases were studied to show the significance of the proposed method considering the swinging effects on the cost. - Abstract: Owing to low efficiency of traditional ships and the serious environmental pollution that they cause, the use of solar energy and an energy storage system (ESS) in a ship’s power system is increasingly attracting attention. However, the swinging of a ship raises crucial challenges in designing an optimal system for a large oil tanker ship, which are associated with uncertainties in solar energy. In this study, a series of experiments are performed to investigate the characteristics of a photovoltaic (PV) system on a moving ship. Based on the experimental results, an interval uncertainty model of on-board PV generation is established, which considers the effect of the swinging of the ship. Due to the power balance equations, the outputs of the diesel generator and the ESS on a large oil tanker are also modeled using interval variables. An interval optimization method is developed to determine the optimal size of the ESS in this hybrid ship power system to reduce the fuel cost, capital cost of the ESS, and emissions of greenhouse gases. Variations of the ship load are analyzed using a new method, taking five operating conditions into account. Several cases are compared in detail to demonstrate the effectiveness of the proposed algorithm.

  5. Modelling the economics of combined wind/hydro/diesel power systems

    International Nuclear Information System (INIS)

    Sinha, A.

    1993-01-01

    A model that stimulates the performance and economics of a combined wind/hydro/diesel plant with pumped storage has been developed. It is applied to a hypothetical site to demonstrate how a subset of the cheapest configuration of plant sizes may be identified, illustrating in particular the trade-off between the hydro storage capacity and the wind turbine penetration. It seems that, with the wind and water regimes employed, pumped storage is unlikely to have significant benefits, but may be beneficial in areas without natural inflow, in which case the reservoir is used as a store for excess wind output. (author)

  6. Status and modeling improvements of hybrid wind/PV/diesel power systems for Brazilian applications

    Energy Technology Data Exchange (ETDEWEB)

    McGowan, J.G.; Manwell, J.F.; Avelar, C. [Univ. of Massachusetts, Amherst, MA (United States); Taylor, R. [National Renewable Energy Lab., Golden, CO (United States)

    1997-12-31

    This paper present a summary of the ongoing work on the modeling and system design of hybrid wind/PV/diesel systems for two different sites in the Amazonia region of Brazil. The work incorporates the latest resource data and is based on the use of the Hybrid2 simulation code developed by the University of Massachusetts and NREL. Details of the baseline operating hybrid systems are reviewed, and the results of the latest detailed hybrid system evaluation for each site are summarized. Based on the system modeling results, separate recommendations for system modification and improvements are made.

  7. Measurement of Exhaust Emissions from Diesel-Powered Forklifts during Operations in Ammunition Storage Magazines.

    Science.gov (United States)

    1984-05-01

    to CO over a work period can cause central nervous system depression , blackouts, coma, and eventual death at the concentrations that could be reached...Camel, Jr., Eds., National Cancer Institute Monograph No. 9, p. 225, 1962. 11.6 Sawicki, E., R. C. Corey, A. E. Dooley,J. B. Gisclard, J. L. Monkman, R...tum wmammmmm ~m mamas aB-mm7 B-27 1K PEDCO INVIRONMENTAL. INC ARMY DIESEL FORKLIFT STUDY Location THREE TOt Description TEST SI Date: DECEMIER 6. 1103

  8. Genotoxic potential of organic extracts from particle emissions of diesel and rapeseed oil powered engines

    Czech Academy of Sciences Publication Activity Database

    Topinka, Jan; Milcová, Alena; Schmuczerová, Jana; Mazac, M.; Pechout, M.; Vojtíšek-Lom, M.

    2012-01-01

    Roč. 212, č. 1 (2012), s. 11-17 ISSN 0378-4274 R&D Projects: GA ČR GAP503/11/0142; GA ČR(CZ) GBP503/12/G147 Grant - others:project MEDETOX(XE) LIFE10ENV/CZ/651 Institutional research plan: CEZ:AV0Z50390703 Institutional support: RVO:68378041 Keywords : biodiesel * diesel emissions * DNA adducts Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 3.145, year: 2012

  9. A reliability program for emergency diesel generators at nuclear power plants: Program structure

    International Nuclear Information System (INIS)

    Lofgren, E.V.; DeMoss, G.M.; Fragola, J.R.; Appignani, P.L.; Delarche, G.; Boccio, J.

    1988-04-01

    The purpose of this report is to provide technical guidelines for NRC staff use in the development of positions for evaluating emergency diesel generator (EDG) reliability programs. Such reviews will likely result following resolution of USI A-44 and GSI B-56. The diesel generator reliability program is a management system for achieving and maintaining a selected (or target) level of reliability. This can be achieved by: (1) understanding the factors that control the EDG reliability and (2) then applying reliability and maintenance techniques in the proper proportion to achieve selected performance goals. The concepts and guidelines discussed in this report are concepts and approaches that have been successful in applications where high levels of reliability must be maintained. Both an EDG reliability program process and a set of review items for NRC use are provided. The review items represent a checklist for reviewing EDG reliability programs. They do not, in themselves, constitute a reliability program. Rather, the review items are those distinctive features of a reliability program that must be present for the program to be effective

  10. A minimal order observer based frequency control strategy for an integrated wind-battery-diesel power system

    International Nuclear Information System (INIS)

    Howlader, Abdul Motin; Izumi, Yuya; Uehara, Akie; Urasaki, Naomitsu; Senjyu, Tomonobu; Yona, Atsushi; Saber, Ahmed Yousuf

    2012-01-01

    Wind energy is a fluctuating resource which can diverge quickly and causes the frequency deviation. To overcome this problem, the current paper deals with a frequency control scheme for a small power system by a coordinated control strategy of a wind turbine generator (WTG) and a battery energy storage system (BESS). The small power system composes of a wind turbine, a battery storage and a diesel generator. A minimal order observer is utilized as a disturbance observer to estimate the load of the power system. The load deviations are considered in a frequency domain. The low frequency component is reduced by the pitch angle control system of the WTG, while the high frequency component is reduced by the charge/discharge of the BESS, respectively. The output power command of the BESS is determined according to the state of charge, the high frequency component of the frequency deviation and the load variation. The proposed method is compared with the conventional method in different cases. By using the proposed method, the capacity of the battery is decreased by the charge/discharge of the BESS in long term. To enhance the control performance, the generalized predictive control (GPC) method is introduced to the pitch angle control system of the WTG. Effectiveness of the proposed method is verified by the numerical simulations. -- Highlights: ► A coordinated control method for a WTG and a BESS in the small power system. ► To achieve this objective, a minimal order observer is utilized. ► The output power command of the WTG is based on the wind speed and the estimated frequency deviations. ► The output power the WTG is controlled by the GPC based robust pitch angle control system. ► The output power command of the BESS is determined by the state of charge and the estimated frequency deviations.

  11. Aerosol particles generated by diesel-powered school buses at urban schools as a source of children’s exposure

    Science.gov (United States)

    Hochstetler, Heather A.; Yermakov, Mikhail; Reponen, Tiina; Ryan, Patrick H.; Grinshpun, Sergey A.

    2015-01-01

    Various heath effects in children have been associated with exposure to traffic-related particulate matter (PM), including emissions from school buses. In this study, the indoor and outdoor aerosol at four urban elementary schools serviced by diesel-powered school buses was characterized with respect to the particle number concentrations and size distributions as well as the PM2.5 mass concentrations and elemental compositions. It was determined that the presence of school buses significantly affected the outdoor particle size distribution, specifically in the ultrafine fraction. The time-weighted average of the total number concentration measured outside the schools was significantly associated with the bus and the car counts. The concentration increase was consistently observed during the morning drop-off hours and in most of the days during the afternoon pick-up period (although at a lower degree). Outdoor PM2.5 mass concentrations measured at schools ranged from 3.8 to 27.6 µg m−3. The school with the highest number of operating buses exhibited the highest average PM2.5 mass concentration. The outdoor mass concentrations of elemental carbon (EC) and organic carbon (OC) were also highest at the school with the greatest number of buses. Most (47/55) correlations between traffic-related elements identified in the outdoor PM2.5 were significant with elements identified in the indoor PM2.5. Significant associations were observed between indoor and outdoor aerosols for EC, EC/OC, and the total particle number concentration. Day-to-day and school-to-school variations in Indoor/Outdoor (I/O) ratios were related to the observed differences in opening windows and doors, which enhanced the particle penetration, as well as indoor activities at schools. Overall, the results on I/O ratio obtained in this study reflect the sizes of particles emitted by diesel-powered school bus engines (primarily, an ultrafine fraction capable of penetrating indoors). PMID:25904818

  12. Aerosol particles generated by diesel-powered school buses at urban schools as a source of children's exposure.

    Science.gov (United States)

    Hochstetler, Heather A; Yermakov, Mikhail; Reponen, Tiina; Ryan, Patrick H; Grinshpun, Sergey A

    2011-03-01

    Various heath effects in children have been associated with exposure to traffic-related particulate matter (PM), including emissions from school buses. In this study, the indoor and outdoor aerosol at four urban elementary schools serviced by diesel-powered school buses was characterized with respect to the particle number concentrations and size distributions as well as the PM2.5 mass concentrations and elemental compositions. It was determined that the presence of school buses significantly affected the outdoor particle size distribution, specifically in the ultrafine fraction. The time-weighted average of the total number concentration measured outside the schools was significantly associated with the bus and the car counts. The concentration increase was consistently observed during the morning drop-off hours and in most of the days during the afternoon pick-up period (although at a lower degree). Outdoor PM2.5 mass concentrations measured at schools ranged from 3.8 to 27.6 µg m -3 . The school with the highest number of operating buses exhibited the highest average PM2.5 mass concentration. The outdoor mass concentrations of elemental carbon (EC) and organic carbon (OC) were also highest at the school with the greatest number of buses. Most (47/55) correlations between traffic-related elements identified in the outdoor PM2.5 were significant with elements identified in the indoor PM2.5. Significant associations were observed between indoor and outdoor aerosols for EC, EC/OC, and the total particle number concentration. Day-to-day and school-to-school variations in Indoor/Outdoor (I/O) ratios were related to the observed differences in opening windows and doors, which enhanced the particle penetration, as well as indoor activities at schools. Overall, the results on I/O ratio obtained in this study reflect the sizes of particles emitted by diesel-powered school bus engines (primarily, an ultrafine fraction capable of penetrating indoors).

  13. Conceptual design of coal-fueled diesel system for stationary power applications

    Energy Technology Data Exchange (ETDEWEB)

    1989-05-01

    A preliminary conceptual design of a coal-fueled diesel system was prepared as part of a previous systems study. Since then, our team has accumulated extensive results from testing coal-water slurry on the 13-inch bore JS engine (400 rpm) in 1987 and 1988. These results provided new insights into preferred design concepts for engine components. One objective, therefore, was to revise the preliminary design to incorporate these preferred design concepts. In addition there were certain areas where additional, more detailed analysis was required as a result of the previous conceptual design. Another objective, therefore was to perform additional detailed design efforts, such as: (1) market applications and engine sizes, (2) coal-water slurry cleaning and grinding processes, (3) emission controls and hot gas contaminant controls, (4) component durability, (5) cost and performance assessments. (VC)

  14. Rudolph Diesel

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. Rudolph Diesel. Articles written in Resonance – Journal of Science Education. Volume 17 Issue 4 April 2012 pp 406-424 Classics. Diesel's Rational Heat Motor · Rudolph Diesel · More Details Fulltext PDF ...

  15. Free-Piston Diesel-Fueled Linear Alternator for Auxiliary Power Unit Applications

    National Research Council Canada - National Science Library

    Atkinson, Christopher

    1999-01-01

    .... Previous studies of free-piston engine designs have indicated that they would be useful where linear power delivery could be used, such as in fluid power delivery, or in electrical energy applications.

  16. Diesel fuel filtration system

    International Nuclear Information System (INIS)

    Schneider, D.

    1996-01-01

    The American nuclear utility industry is subject to tight regulations on the quality of diesel fuel that is stored at nuclear generating stations. This fuel is required to supply safety-related emergency diesel generators--the backup power systems associated with the safe shutdown of reactors. One important parameter being regulated is the level of particulate contamination in the diesel fuel. Carbon particulate is a natural byproduct of aging diesel fuel. Carbon particulate precipitates from the fuel's hydrocarbons, then remains suspended or settles to the bottom of fuel oil storage tanks. If the carbon particulate is not removed, unacceptable levels of particulate contamination will eventually occur. The oil must be discarded or filtered. Having an outside contractor come to the plant to filter the diesel fuel can be costly and time consuming. Time is an even more critical factor if a nuclear plant is in a Limiting Condition of Operation (LCO) situation. A most effective way to reduce both cost and risk is for a utility to build and install its own diesel fuel filtration system. The cost savings associated with designing, fabricating and operating the system inhouse can be significant, and the value of reducing the risk of reactor shutdown because of uncertified diesel fuel may be even higher. This article describes such a fuel filtering system

  17. Economic analysis and performance of a low power diesel engine using soybean oil refined; Analise economica e de desempenho de um motor diesel de baixa potencia utilizando oleo de soja refinado

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Guilherme Ladeira dos; Fernandes, Haroldo Carlos; Alvarenga, Cleyton Batista de; Leite, Daniel Mariano; Siqueira, Wagner da Cunha [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Engenharia Agricola], E-mails: glsantos@yahoo.com.br, haroldo@ufv.br, cleyton.alvarenga@ufv.br, daniel.mariano@ufv.br, wagner.siqueira@ufv.br

    2011-07-01

    Oil is the main source of energy available to power internal combustion engines, enabling its transformation into mechanical energy. To meet the production of vegetable oils, many cultures can be used, according to regional conditions, especially those that are already commercially exploited, such as peanuts, Soybeans, Corn, Palm oil, Sunflower and Canola, and other public regional and castor oil, Andiroba, Pequi, Buriti, Inaja, Carnauba, Jatropha, among others. The objective of this work make an economic analysis of replacing diesel fuel by mixing and compare performance on the engine and using B{sub 2} biodiesel fuel mixture of diesel with 2 % Refined Soybean Oil (SAB). The loads applied by the dynamometer in the engine were 7, 9, 11, 13, 15, 17, 19 and 21.5 lbs. The engine was coupled to the dynamometer with the aid of pulleys and belts of the type V with gear ratio of 1:1,9. Apparently, the best vegetable oil mixture was 30 %, both in terms of specific consumption and cost from R$ kW{sup -1} h{sup -1}. Providing the same cost of pure diesel. (author)

  18. Techno-economic analysis of an optimized photovoltaic and diesel generator hybrid power system for remote houses in a tropical climate

    International Nuclear Information System (INIS)

    Ismail, M.S.; Moghavvemi, M.; Mahlia, T.M.I.

    2013-01-01

    Highlights: ► We analyzed solar data in the location under consideration. ► We developed a program to simulate the operation of the PV-diesel generator hybrid system. ► We analyzed different scenarios to select and design the optimal system. ► It is cost effective to power houses in remote areas with such hybrid systems. ► The hybrid system had lower CO 2 emissions compared to a diesel generator only operation. - Abstract: A techno-economic analysis and the design of a complete hybrid system, consisting of photovoltaic (PV) panels, a battery system and a diesel generator as a backup power source for a typical Malaysian village household is presented in this paper. The specifications of the different components constructing the hybrid system were also determined. A scenario depending on a standalone PV and other scenario depending on a diesel generator only were also analyzed. A simulation program was developed to simulate the operation of these different scenarios. The scenario that achieves the minimum cost while meeting the load requirement was selected. The optimal tilt angle of the PV panels in order to increase the generated energy was obtained using genetic algorithm. In addition, sensitivity analysis was undertaken to evaluate the effect of change of some parameters on the cost of energy. The results indicated that the optimal scenario is the one that consists of a combination of the PV panels, battery bank and a diesel generator. Powering a rural house using this hybrid system is advantageous as it decreases operating cost, increases efficiencies, and reduces pollutant emissions

  19. Polycyclic aromatic hydrocarbons (PAHs) in exhaust emissions from diesel engines powered by rapeseed oil methylester and heated non-esterified rapeseed oil

    Science.gov (United States)

    Vojtisek-Lom, Michal; Czerwinski, Jan; Leníček, Jan; Sekyra, Milan; Topinka, Jan

    2012-12-01

    Polycyclic aromatic hydrocarbons (PAHs) of exhaust emissions were studied in four direct-injection turbocharged four-cylinder diesel engines, with power ratings of 90-136 kW. The engines were operated on biodiesel (B-100), a blend of 30% biodiesel in diesel fuel (B-30), and heated rapeseed oil (RO) in two independent laboratories. Diesel particle filters (DPF) and selective catalytic reduction (SCR) systems were used with B-30 and B-100. Concentrations of individual PAHs sampled in different substrates (quartz, borosilicate fiber and fluorocarbon membrane filters, polyurethane foam) were analyzed using different methods. Benzo[a]pyrene toxic equivalents (BaP TEQ) were calculated using different sets of toxic equivalency factors (TEF). Operation on B-100 without aftertreatment devices, compared to diesel fuel, yielded a mean reduction in PAHs of 73%, consistent across engines and among TEF used. A lower PAH reduction was obtained using B-30. The BaP TEQ reductions on DPF were 91-99% using B-100, for one non-catalyzed DPF, and over 99% in all other cases. The BaP TEQ for heated RO were higher than those for B-100 and one half lower to over twice as high as that of diesel fuel. B-100 and RO samples featured, compared to diesel fuel, a relatively high share of higher molecular weight PAH and a relatively low share of lighter PAHs. Using different sets of TEF or different detection methods did not consistently affect the observed effect of fuels on BaP TEQ. The compilation of multiple tests was helpful for discerning emerging patterns. The collection of milligrams of particulate matter per sample was generally needed for quantification of all individual PAHs.

  20. Oil drilling rig diesel power-plant fuel efficiency improvement potentials through rule-based generator scheduling and utilization of battery energy storage system

    International Nuclear Information System (INIS)

    Pavković, Danijel; Sedić, Almir; Guzović, Zvonimir

    2016-01-01

    Highlights: • Isolated oil drilling rig microgrid power flows are analyzed over 30 days. • Rule-based diesel generator scheduling is proposed to reduce fuel consumption. • A battery energy storage is parameterized and used for peak load leveling. • The effectiveness of proposed hybrid microgrid is verified by simulations. • Return-of-investment might be expected within 20% of battery system lifetime. - Abstract: This paper presents the development of a rule-based energy management control strategy suitable for isolated diesel power-plants equipped with a battery energy storage system for peak load shaving. The proposed control strategy includes the generator scheduling strategy and peak load leveling scheme based on current microgrid active and reactive power requirements. In order to investigate the potentials for fuel expenditure reduction, 30 days-worth of microgrid power flow data has been collected on an isolated land-based oil drilling rig powered by a diesel generator power-plant, characterized by highly-variable active and reactive load profiles due to intermittent engagements and disengagements of high-power electric machinery such as top-drive, draw-works and mud-pump motors. The analysis has indicated that by avoiding the low-power operation of individual generators and by providing the peak power requirements (peak shaving) from a dedicated energy storage system, the power-plant fuel efficiency may be notably improved. An averaged power flow simulation model has been built, comprising the proposed rule-based power flow control strategy and the averaged model of a suitably sized battery energy storage system equipped with grid-tied power converter and state-of-charge control system. The effectiveness of the proposed rule-based strategy has been evaluated by means of computer simulation analysis based on drilling rig microgrid active and reactive power data recorded during the 30 day period. The analysis has indicated that fuel consumption of

  1. Optimal Sizing Of An Off-Grid Small Hydro-Photovoltaic-Diesel Generator Hybrid Power System For A Distant Village

    Directory of Open Access Journals (Sweden)

    Adebanji B.

    2017-08-01

    Full Text Available This paper presented an optimal sizing technique for an off-grid hybrid system consisting of Small Hydro SHP system Photovoltaic PV modules Battery BATT banks and Diesel Generator DG. The objective cost function Annualized Cost System and the Loss of Power Supply Probability LPSP were minimized with application of Genetic Algorithm GA in order to reduce the Cost of Energy COE generation. GA compared to other convectional optimization methods has the ability to attain global optimum easily. The decision variables are the number of small hydro turbines NSHP number of solar panels NPV number of battery banks NBATT and the capacity of DG PDG. The proposed method was applied to a typical rural village Itapaji-Ekiti in Nigeria. The monthly average solar irradiance data were converted into hourly solar irradiance data for uniformity. Sensitivity analysis was also performed to identify the most important parameter influencing the optimized hybrid system. The optimal sizing result of the HPS is 954 kW of SHP 290 kW of PV panels 9500 sets of 600Ah battery strings and 350 kW of DG. The optimal Loss of Power Supply Probability LPSP is 0.0054 and the Renewable Fraction RF is 0.62 which is indeed a significant improvement on the environment and comparatively better than any other combinations in the system.

  2. A GUI Based Software for Sizing Stand Alone AC Coupled Hybrid PV-Diesel Power System under Malaysia Climate

    Science.gov (United States)

    Syafiqah Syahirah Mohamed, Nor; Amalina Banu Mohamat Adek, Noor; Hamid, Nurul Farhana Abd

    2018-03-01

    This paper presents the development of Graphical User Interface (GUI) software for sizing main component in AC coupled photovoltaic (PV) hybrid power system based on Malaysia climate. This software provides guideline for PV system integrator to design effectively the size of components and system configuration to match the system and load requirement with geographical condition. The concept of the proposed software is balancing the annual average renewable energy generation and load demand. In this study, the PV to diesel generator (DG) ratio is introduced by considering the hybrid system energy contribution. The GUI software is able to size the main components in the PV hybrid system to meet with the set target of energy contribution ratio. The rated powers of the components to be defined are PV array, grid-tie inverter, bi-directional inverter, battery storage and DG. GUI is used to perform all the system sizing procedures to make it user friendly interface as a sizing tool for AC coupled PV hybrid system. The GUI will be done by using Visual Studio 2015 based on the real data under Malaysia Climate.

  3. Using Extractive FTIR to Measure N2O from Medium Heavy Duty Vehicles Powered with Diesel and Biodiesel Fuels

    Science.gov (United States)

    A Fourier Transform Infrared (FTIR) spectrometer was used to measure N2O and other pollutant gases during an evaluation of two medium heavy-duty diesel trucks equipped with a Diesel Particulate Filter (DPF). The emissions of these trucks were characterized under a variety of oper...

  4. Hybrid PV/diesel solar power system design using multi-level factor analysis optimization

    Science.gov (United States)

    Drake, Joshua P.

    Solar power systems represent a large area of interest across a spectrum of organizations at a global level. It was determined that a clear understanding of current state of the art software and design methods, as well as optimization methods, could be used to improve the design methodology. Solar power design literature was researched for an in depth understanding of solar power system design methods and algorithms. Multiple software packages for the design and optimization of solar power systems were analyzed for a critical understanding of their design workflow. In addition, several methods of optimization were studied, including brute force, Pareto analysis, Monte Carlo, linear and nonlinear programming, and multi-way factor analysis. Factor analysis was selected as the most efficient optimization method for engineering design as it applied to solar power system design. The solar power design algorithms, software work flow analysis, and factor analysis optimization were combined to develop a solar power system design optimization software package called FireDrake. This software was used for the design of multiple solar power systems in conjunction with an energy audit case study performed in seven Tibetan refugee camps located in Mainpat, India. A report of solar system designs for the camps, as well as a proposed schedule for future installations was generated. It was determined that there were several improvements that could be made to the state of the art in modern solar power system design, though the complexity of current applications is significant.

  5. Diesel Engine Technician

    Science.gov (United States)

    Tech Directions, 2010

    2010-01-01

    Diesel engine technicians maintain and repair the engines that power transportation equipment such as heavy trucks, trains, buses, and locomotives. Some technicians work mainly on farm machines, ships, compressors, and pumps. Others work mostly on construction equipment such as cranes, power shovels, bulldozers, and paving machines. This article…

  6. Publication of the KTA 3702.1 safety rule of the Kerntechnischer Ausschuss from July 3, 1980. Stand-by units with diesel aggregates in nuclear power plants. Pt. 1

    International Nuclear Information System (INIS)

    1980-01-01

    The rule applies to stationary nuclear power plants. Depending on their application, one of the following diesel aggregates should be chosen: Stand-by aggregates, fast emergency aggregates, or no-delay emergency aggregates. (HP) [de

  7. Model of predicting proportion of diesel fuel and engine oil in diesel ...

    African Journals Online (AJOL)

    Viscosity of diesel adulterated SAE 40 engine oil at varying proportions of the mixture is presented. Regression, variation of intercept and the power parameters methods are used for developing polynomial and power law functions for predicting proportion of either diesel or engine oil in diesel adulterated SAE 40 engine oil ...

  8. Application of positive matrix factorization to on-road measurements for source apportionment of diesel- and gasoline-powered vehicle emissions in Mexico City

    Directory of Open Access Journals (Sweden)

    D. A. Thornhill

    2010-04-01

    Full Text Available The goal of this research is to quantify diesel- and gasoline-powered motor vehicle emissions within the Mexico City Metropolitan Area (MCMA using on-road measurements captured by a mobile laboratory combined with positive matrix factorization (PMF receptor modeling. During the MCMA-2006 ground-based component of the MILAGRO field campaign, the Aerodyne Mobile Laboratory (AML measured many gaseous and particulate pollutants, including carbon dioxide, carbon monoxide (CO, nitrogen oxides (NOx, benzene, toluene, alkylated aromatics, formaldehyde, acetaldehyde, acetone, ammonia, particle number, fine particulate mass (PM2.5, and black carbon (BC. These serve as inputs to the receptor model, which is able to resolve three factors corresponding to gasoline engine exhaust, diesel engine exhaust, and the urban background. Using the source profiles, we calculate fuel-based emission factors for each type of exhaust. The MCMA's gasoline-powered vehicles are considerably dirtier, on average, than those in the US with respect to CO and aldehydes. Its diesel-powered vehicles have similar emission factors of NOx and higher emission factors of aldehydes, particle number, and BC. In the fleet sampled during AML driving, gasoline-powered vehicles are found to be responsible for 97% of total vehicular emissions of CO, 22% of NOx, 95–97% of each aromatic species, 72–85% of each carbonyl species, 74% of ammonia, negligible amounts of particle number, 26% of PM2.5, and 2% of BC; diesel-powered vehicles account for the balance. Because the mobile lab spent 17% of its time waiting at stoplights, the results may overemphasize idling conditions, possibly resulting in an underestimate of NOx and overestimate of CO emissions. On the other hand, estimates of the inventory that do not correctly account for emissions during idling are likely to produce bias in the opposite direction.The resulting fuel

  9. Selection, design, qualification, testing, and reliability of emergency diesel generator units used as Class 1E onsite electric power systems at nuclear power plants

    International Nuclear Information System (INIS)

    1992-04-01

    This guide has been prepared for the resolution of Generic Safety Issue B-56, ''Diesel Generator Reliability,'' and is related to Unresolved Safety Issue (USI) A-44, ''Station Blackout.'' The resolution of USI A-44 established a need for an emergency diesel generator (EDG) reliability program that has the capability to achieve and maintain the emergency diesel generator reliability levels in the range of 0.95 per demand or better to cope with station blackout

  10. NOx, Soot, and Fuel Consumption Predictions under Transient Operating Cycle for Common Rail High Power Density Diesel Engines

    Directory of Open Access Journals (Sweden)

    N. H. Walke

    2016-01-01

    Full Text Available Diesel engine is presently facing the challenge of controlling NOx and soot emissions on transient cycles, to meet stricter emission norms and to control emissions during field operations. Development of a simulation tool for NOx and soot emissions prediction on transient operating cycles has become the most important objective, which can significantly reduce the experimentation time and cost required for tuning these emissions. Hence, in this work, a 0D comprehensive predictive model has been formulated with selection and coupling of appropriate combustion and emissions models to engine cycle models. Selected combustion and emissions models are further modified to improve their prediction accuracy in the full operating zone. Responses of the combustion and emissions models have been validated for load and “start of injection” changes. Model predicted transient fuel consumption, air handling system parameters, and NOx and soot emissions are in good agreement with measured data on a turbocharged high power density common rail engine for the “nonroad transient cycle” (NRTC. It can be concluded that 0D models can be used for prediction of transient emissions on modern engines. How the formulated approach can also be extended to transient emissions prediction for other applications and fuels is also discussed.

  11. Intensive use of diesels underground

    Energy Technology Data Exchange (ETDEWEB)

    Olsen, R W

    1980-07-01

    At a US mine, coal is extracted by room and pillar mining. Tyred diesel vehicles are used to transport men and materials, to spread gravel on the roadway, and to tow and provide hydraulic power to rock dusting machines. Hydraulic power take-offs from the vehicles are used to operate equipment such as drills and chain saws. A deisel ambulance is kept underground, and diesel lubrication units and maintenance tracks are used. A diesel generator provides electrical power when or where no permanent electricity supply is available e.g. for tramming continuous miners in to or out of the mine.

  12. Electrical Energy Forecasting and Optimal Allocation of ESS in a Hybrid Wind-Diesel Power System

    Directory of Open Access Journals (Sweden)

    Hai Lan

    2017-02-01

    Full Text Available Due to the increasingly serious energy crisis and environmental pollution problem, traditional fossil energy is gradually being replaced by renewable energy in recent years. However, the introduction of renewable energy into power systems will lead to large voltage fluctuations and high capital costs. To solve these problems, an energy storage system (ESS is employed into a power system to reduce total costs and greenhouse gas emissions. Hence, this paper proposes a two-stage method based on a back-propagation neural network (BPNN and hybrid multi-objective particle swarm optimization (HMOPSO to determine the optimal placements and sizes of ESSs in a transmission system. Owing to the uncertainties of renewable energy, a BPNN is utilized to forecast the outputs of the wind power and load demand based on historic data in the city of Madison, USA. Furthermore, power-voltage (P-V sensitivity analysis is conducted in this paper to improve the converge speed of the proposed algorithm, and continuous wind distribution is discretized by a three-point estimation method. The Institute of Electrical and Electronic Engineers (IEEE 30-bus system is adopted to perform case studies. The simulation results of each case clearly demonstrate the necessity for optimal storage allocation and the efficiency of the proposed method.

  13. Modular simulation of a hybrid power system with diesel, photovoltaic inverter and wind turbine generation

    Directory of Open Access Journals (Sweden)

    Klimis Ch. Karasavvas

    2008-05-01

    Full Text Available The dynamic behavior and stability of an isolated electric power system, fed by a conventional energy plant and a re-newable energy system, is presented in this paper. Matlab/Simulink is the used software for simulating the whole system.

  14. An assessment on performance, emission and combustion characteristics of single cylinder diesel engine powered by Cymbopogon flexuosus biofuel

    International Nuclear Information System (INIS)

    Dhinesh, B.; Isaac JoshuaRamesh Lalvani, J.; Parthasarathy, M.; Annamalai, K.

    2016-01-01

    Highlights: • Cymbopogon Flexuosus biofuel is used as an alternative energy source. • Cymbopogon flexuosus biofuel 20% + Diesel 80% blend profile stayed close to diesel. • Resulting in higher thermal efficiency and reduced fuel consumption. • Reduced hydrocarbon, carbon monoxide and smoke emission. • Oxides of nitrogen and carbon di-oxide emission was marginally higher. - Abstract: The novelty of this manuscript is that it discusses about the experimental analysis of a new biofuel feedstock as an alternative fuel that has not drawn much attention among the researchers. An exploration for a new biofuel feedstock resulted in Cymbopogon flexuosus as an alternative energy source. Raw oil of Cymbopogon flexuosus was obtained through steam distillation process. Cymbopogon flexuosus biofuel was blended with diesel fuel in various proportions on volume basis, namely 10, 20, 30, 40, and 100 percent and its properties were assessed according to American Society for Testing and Materials standards. The considered test fuel was experimentally analysed in a single cylinder diesel engine at 1500 rpm for its performance, emission and combustion characteristics. Among various blends, Fuel blend of Cymbopogon flexuosus biofuel 20% + diesel 80% fuel profile stayed close to diesel fuel resulting in higher thermal efficiency and lower hydrocarbon, carbon monoxide, and smoke emission. However, oxides of nitrogen and carbon dioxide emission was marginally higher for the test fuel considered. Cylinder pressure and heat release rate curves were lower at full load condition as compared with diesel fuel. Against the grim background of fossil fuel depletion, Fuel blend of Cymbopogon flexuosus biofuel 20% + diesel 80% fuel acts as a promising alternative fuel and brings hope to the nation as well as the research world.

  15. Small wind power plants : results of the Nordic wind diesel projects for large telecommunications companies; Implantation d'une centrale eolienne comme source d'energie d'appoint pour des stations de telecommunications

    Energy Technology Data Exchange (ETDEWEB)

    Ilinca, A.; Chaumel, J.L. [ATI Eolien, Rimouski, PQ (Canada); Thibault, G. [Entreprises MB, PQ (Canada)

    2005-07-01

    Two wind-diesel generating stations have been installed at telecommunication towers in the remote communities of Kuujjuarapik and Lac Julien in northern Quebec. The use of wind power contributes to the sustainable development in these remote areas by lowering the reliance on costly helicopter-transported diesel fuel and by reducing the release of greenhouse gases to the atmosphere. The technical characteristics of the Bergey 100 kW turbine with battery charger were presented along with the technical characteristics of the EolDie control panel that controls the supply of electricity from either the wind or diesel power generators. For the first time, the ATI-Wind technology system that was installed can supply the needs of the large telecommunication towers of Bell Canada and Telebec from either the wind or the diesel generators. The system is also capable of shutting down the diesel generators when wind energy is sufficient to take over. Early results from June 2005 showed that the diesel generators could be turned off for 55 per cent of the time. Preliminary results of these 2 projects were discussed by the firms in charge of the diesel and wind aspects and recommendations for improvements to the control systems were presented. 11 figs.

  16. Role of fuel additives on reduction of NOX emission from a diesel engine powered by camphor oil biofuel

    KAUST Repository

    Subramanian, Thiyagarajan

    2018-03-21

    The present study intends to explore the effect of the addition of fuel additives with camphor oil (CMO) on the characteristics of a twin-cylinder compression ignition (CI) engine. The lower viscosity and boiling point of CMO when compared to diesel could improve the fuel atomization, evaporation, and air/fuel mixing process. However, the lower cetane index of CMO limits its use as a drop in fuel for diesel in CI engine. In general, NO emission increases for less viscous and low cetane (LVLC) fuels due to pronounced premixed combustion phase. To improve the ignition characteristics and decrease NO emissions, fuel additives such as diglyme (DGE)—a cetane enhancer, cumene (CU)—an antioxidant, and eugenol (EU) and acetone (A)—bio-additives, are added 10% by volume with CMO. The engine used for the experimentation is a twin-cylinder tractor engine that runs at a constant speed of 1500 rpm. The engine was operated with diesel initially to attain warm-up condition, which facilitates the operation of neat CMO. At full load condition, brake thermal efficiency (BTE) for CMO is higher (29.6%) than that of diesel (28.1%), while NO emission is increased by 9.4%. With DGE10 (10% DGE + 90% CMO), the ignition characteristics of CMO are improved and BTE is increased to 31.7% at full load condition. With EU10 (10% EU + 90% CMO) and A10 (10% A + 90% CMO), NO emission is decreased by 24.6 and 17.8% when compared to diesel, while BTE is comparable to diesel. While HC and CO emission decreased for DGE10 and CU10, they increased for EU10 and A10 when compared to baseline diesel and CMO.

  17. Role of fuel additives on reduction of NOX emission from a diesel engine powered by camphor oil biofuel.

    Science.gov (United States)

    Subramanian, Thiyagarajan; Varuvel, Edwin Geo; Ganapathy, Saravanan; Vedharaj, S; Vallinayagam, R

    2018-06-01

    The present study intends to explore the effect of the addition of fuel additives with camphor oil (CMO) on the characteristics of a twin-cylinder compression ignition (CI) engine. The lower viscosity and boiling point of CMO when compared to diesel could improve the fuel atomization, evaporation, and air/fuel mixing process. However, the lower cetane index of CMO limits its use as a drop in fuel for diesel in CI engine. In general, NO X emission increases for less viscous and low cetane (LVLC) fuels due to pronounced premixed combustion phase. To improve the ignition characteristics and decrease NO X emissions, fuel additives such as diglyme (DGE)-a cetane enhancer, cumene (CU)-an antioxidant, and eugenol (EU) and acetone (A)-bio-additives, are added 10% by volume with CMO. The engine used for the experimentation is a twin-cylinder tractor engine that runs at a constant speed of 1500 rpm. The engine was operated with diesel initially to attain warm-up condition, which facilitates the operation of neat CMO. At full load condition, brake thermal efficiency (BTE) for CMO is higher (29.6%) than that of diesel (28.1%), while NO X emission is increased by 9.4%. With DGE10 (10% DGE + 90% CMO), the ignition characteristics of CMO are improved and BTE is increased to 31.7% at full load condition. With EU10 (10% EU + 90% CMO) and A10 (10% A + 90% CMO), NO X emission is decreased by 24.6 and 17.8% when compared to diesel, while BTE is comparable to diesel. While HC and CO emission decreased for DGE10 and CU10, they increased for EU10 and A10 when compared to baseline diesel and CMO.

  18. Role of fuel additives on reduction of NOX emission from a diesel engine powered by camphor oil biofuel

    KAUST Repository

    Subramanian, Thiyagarajan; Varuvel, Edwin Geo; Ganapathy, Saravanan; Vedharaj, S.; Vallinayagam, R.

    2018-01-01

    The present study intends to explore the effect of the addition of fuel additives with camphor oil (CMO) on the characteristics of a twin-cylinder compression ignition (CI) engine. The lower viscosity and boiling point of CMO when compared to diesel could improve the fuel atomization, evaporation, and air/fuel mixing process. However, the lower cetane index of CMO limits its use as a drop in fuel for diesel in CI engine. In general, NO emission increases for less viscous and low cetane (LVLC) fuels due to pronounced premixed combustion phase. To improve the ignition characteristics and decrease NO emissions, fuel additives such as diglyme (DGE)—a cetane enhancer, cumene (CU)—an antioxidant, and eugenol (EU) and acetone (A)—bio-additives, are added 10% by volume with CMO. The engine used for the experimentation is a twin-cylinder tractor engine that runs at a constant speed of 1500 rpm. The engine was operated with diesel initially to attain warm-up condition, which facilitates the operation of neat CMO. At full load condition, brake thermal efficiency (BTE) for CMO is higher (29.6%) than that of diesel (28.1%), while NO emission is increased by 9.4%. With DGE10 (10% DGE + 90% CMO), the ignition characteristics of CMO are improved and BTE is increased to 31.7% at full load condition. With EU10 (10% EU + 90% CMO) and A10 (10% A + 90% CMO), NO emission is decreased by 24.6 and 17.8% when compared to diesel, while BTE is comparable to diesel. While HC and CO emission decreased for DGE10 and CU10, they increased for EU10 and A10 when compared to baseline diesel and CMO.

  19. Smart power management algorithm in microgrid consisting of photovoltaic, diesel, and battery storage plants considering variations in sunlight, temperature, and load

    International Nuclear Information System (INIS)

    Koohi-Kamali, Sam; Rahim, N.A.; Mokhlis, H.

    2014-01-01

    Highlights: • A novel power management algorithm is developed. • An effective power smoothing index is derived. • Application of battery storage in smoothing the power fluctuations is investigated. • An applicable battery sizing and designing algorithm is proposed. • An efficient battery current control algorithm is designed. - Abstract: Integration of utility scaled solar electricity generator into power networks can negatively affect the performance of next generation smartgrid. Rapidly changing output power of this kind is unpredictable and thus one solution is to mitigate it by short-term to mid-term electrical storage systems like battery. The main objective of this paper is to propose a power management system (PMS) which is capable of suppressing these adverse impacts on the main supply. A smart microgrid (MG) including diesel, battery storage, and solar plants has been suggested for this purpose. MG is able to supply its local load based on operator decision and decline the power oscillations caused by solar system together with variable loads. A guideline algorithm is also proposed which helps to precisely design the battery plant. A novel application of time domain signal processing approach to filter oscillating output power of the solar plant is presented as well. In this case, a power smoothing index (PSI) is formulated, which considers both load and generation, and used to dispatch the battery plant. A droop reference estimator to schedule generation is also introduced where diesel plant can share the local load with grid. A current control algorithm is designed as well which adjusts for PSI to ensure battery current magnitude is allowable. MG along with its communication platform and PMS are simulated using PSCAD software. PMS is tested under different scenarios using real load profiles and environmental data in Malaysia to verify the operational abilities of proposed MG. The results indicate that PMS can effectively control the MG

  20. Sistema híbrido eólico-diesel para el abastecimiento de energía eléctrica de 20 cabañas turísticas en Cayo Caguamas. // Eolic-Diesel hybrid system for electric power supply of 20 tourist cabins in Caguamas Key.

    Directory of Open Access Journals (Sweden)

    R. Alarcón Fernández

    2001-10-01

    Full Text Available Se presentan los aspectos técnicos y económicos de la planificación de un sistema híbrido eólico-diesel para elabastecimiento de energía eléctrica de 20 cabañas turísticas en Cayo Caguamas. Se determina la demanda de energía y lacurva de carga de la instalación turística. Se dimensiona un sistema híbrido eólico-diesel formado por 6 aerogeneradores de10 kW y dos generadores Diesel de 75 kW cada uno. Finalmente se determina la influencia de la variación de algunosparámetros importantes sobre la rentabilidad del proyectoPalabras claves: Sistema eólico-diesel, generación eléctrica, aerogeneradores, planificación económica._____________________________________________________________________AbstractThe technical and economic aspects of the planning of an Eolic-Diesel hybrid system for the supply of electric power of 20tourist cabins in Caguamas Key are presented. The energy demand and the load curve of the tourist installation isdetermined. An Eolic-Diesel hybrid system formed by six 10 kW windmills and two Diesel generators of 75 kW each oneare dimensioned. Finally the influence of variation of some important parameters about the profitability of the project arestated.Key words:.Eolic-Diesel system, electic power generation, windmillgenerator, economic planning.

  1. Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

  2. A new hybrid pneumatic combustion engine to improve fuel consumption of wind–Diesel power system for non-interconnected areas

    International Nuclear Information System (INIS)

    Basbous, Tammam; Younes, Rafic; Ilinca, Adrian; Perron, Jean

    2012-01-01

    Highlights: ► We model thermodynamic ideal cycle of a new hybrid pneumaticcombustion engine. ► We optimize commands of all modes and calculate maps of fuel and air consumption. ► We evaluate fuel economy for Wind–Diesel system function of tank volume and wind penetration. ► We find up to 10% of fuel economy i.e. 80 t/year with 100% wind penetration. ► Fuel economy increases with wind penetration and with volume but has asymptotic value. -- Abstract: This paper presents an evaluation of an optimized Hybrid Pneumatic-Combustion Engine (HPCE) concept that permits reducing fuel consumption for electricity production in non-interconnected remote areas, originally equipped with hybrid Wind–Diesel System (WDS). Up to now, most of the studies on the pneumatic hybridization of Internal Combustion Engines (ICE) have dealt with two-stroke pure pneumatic mode. The few studies that have dealt with hybrid pneumatic-combustion four-stroke mode require adding a supplementary valve to charge compressed air in the combustion chamber. This modification means that a new cylinder head should be fabricated. Moreover, those studies focus on spark ignition engines and are not yet validated for Diesel engines. Present HPCE is capable of making a Diesel engine operate under two-stroke pneumatic motor mode, two-stroke pneumatic pump mode and four-stroke hybrid mode, without needing an additional valve in the combustion chamber. This fact constitutes this study’s strength and innovation. The evaluation of the concept is based on ideal thermodynamic cycle modeling. The optimized valve actuation timings for all modes lead to generic maps that are independent of the engine size. The fuel economy is calculated for a known site during a whole year, function of the air storage volume and the wind power penetration rate.

  3. Evaluation of Emissions Bio diesel

    International Nuclear Information System (INIS)

    Rodriguez Maroto, J. J.; Dorronsoro Arenal, J. L.; Rojas Garcia, E.; Perez Pastor, R.; Garcia Alonso, S.

    2007-01-01

    The generation of energy from vegetal products is one of the possibilities to our reach in order to reduce the atmospheric pollution. Particularly, the use of bio diesel in internal combustion engines can be one of the best options. The finest particles emitted by the combustion engines are easily breathable and on them different substances can be absorbed presumably toxic, between which it is possible to emphasize the polycyclic aromatic hydrocarbons (PAHs), by its demonstrated carcinogen character. In this work, it is studied on the one hand, the characteristics that can present the aerosol of emission in a diesel engine with a maximum power of 97 kW, working without load to 600 rpm, using as combustible mixtures of bio diesel and diesel in different proportions. On the other hand, the evolution that takes place in the concentration of PAHs in emission particles, according to the percentage of bio diesel used in the combustible mixture. (Author) 9 refs

  4. Evaluation of Emissions Bio diesel

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez Maroto, J J; Dorronsoro Arenal, J L; Rojas Garcia, E; Perez Pastor, R; Garcia Alonso, S

    2007-09-27

    The generation of energy from vegetal products is one of the possibilities to our reach in order to reduce the atmospheric pollution. Particularly, the use of bio diesel in internal combustion engines can be one of the best options. The finest particles emitted by the combustion engines are easily breathable and on them different substances can be absorbed presumably toxic, between which it is possible to emphasize the polycyclic aromatic hydrocarbons (PAHs), by its demonstrated carcinogen character. In this work, it is studied on the one hand, the characteristics that can present the aerosol of emission in a diesel engine with a maximum power of 97 kW, working without load to 600 rpm, using as combustible mixtures of bio diesel and diesel in different proportions. On the other hand, the evolution that takes place in the concentration of PAHs in emission particles, according to the percentage of bio diesel used in the combustible mixture. (Author) 9 refs.

  5. Techno-economy optimization of PV-diesel hybrid / stand-alone systems for remote area power supply based on empirical analysis for Indonesia

    Energy Technology Data Exchange (ETDEWEB)

    Budiono, Chayun [Komplek BPP Teknologi, Jl. Teknologi VII, Jakarta (Indonesia)

    2007-07-01

    The techno-economy assessment of photovoltaic (PV) system applications for remote area power supply (RAPS) in combination with operation of diesel generating set (DGS) in Indonesia based on an empirical model is formulated. This model has shown that it helps the project owner to easily optimise the sub-system size (i.e. PV array, auxiliary generator and battery sizes) based on the financial constraints needed for the investment and operation of the system. Two major markets of RAPS in Indonesia are currently for rural electrification and telecommunication systems (orig.)

  6. Pressurized diesel fuel processing using hydrogen peroxide for the fuel cell power unit in low-oxygen environments

    Science.gov (United States)

    Lee, Kwangho; Han, Gwangwoo; Cho, Sungbaek; Bae, Joongmyeon

    2018-03-01

    A novel concept for diesel fuel processing utilizing H2O2 is suggested to obtain the high-purity H2 required for air-independent propulsion using polymer electrolyte membrane fuel cells for use in submarines and unmanned underwater vehicles. The core components include 1) a diesel-H2O2 autothermal reforming (ATR) reactor to produce H2-rich gas, 2) a water-gas shift (WGS) reactor to convert CO to H2, and 3) a H2 separation membrane to separate only high-purity H2. Diesel and H2O2 can easily be pressurized as they are liquids. The application of the H2 separation membrane without a compressor in the middle of the process is thus advantageous. In this paper, the characteristics of pressurized ATR and WGS reactions are investigated according to the operating conditions. In both reactors, the methanation reaction is enhanced as the pressure increases. Then, permeation experiments with a H2 separation membrane are performed while varying the temperature, pressure difference, and inlet gas composition. In particular, approximately 90% of the H2 is recovered when the steam-separated rear gas of the WGS reactor is used in the H2 separation membrane. Finally, based on the experimental results, design points are suggested for maximizing the efficiency of the diesel-H2O2 fuel processor.

  7. Design of a Reliable Hybrid (PV/Diesel Power System with Energy Storage in Batteries for Remote Residential Home

    Directory of Open Access Journals (Sweden)

    Vincent Anayochukwu Ani

    2016-01-01

    Full Text Available This paper reports the experience acquired with a photovoltaic (PV hybrid system simulated as an alternative to diesel system for a residential home located in Southern Nigeria. The hybrid system was designed to overcome the problem of climate change, to ensure a reliable supply without interruption, and to improve the overall system efficiency (by the integration of the battery bank. The system design philosophy was to maximize simplicity; hence, the system was sized using conventional simulation tool and representative insolation data. The system includes a 15 kW PV array, 21.6 kWh (3600 Ah worth of battery storage, and a 5.4 kW (6.8 kVA generator. The paper features a detailed analysis of the energy flows through the system and quantifies all losses caused by PV charge controller, battery storage round-trip, rectifier, and inverter conversions. In addition, simulation was run to compare PV/diesel/battery with diesel/battery and the results show that the capital cost of a PV/diesel hybrid solution with batteries is nearly three times higher than that of a generator and battery combination, but the net present cost, representing cost over the lifetime of the system, is less than one-half of the generator and battery combination.

  8. energy characteristics of ethanol-diesel mix for automotive use

    African Journals Online (AJOL)

    This research work investigates the power output obtained from ethanol- diesel mix from a diesel engine. A 1% to 5% by volume of 99.6% ethanol was mixed with diesel fuel. A 500ml of each mix was used to power a 9.545kW diesel engine and the engine speed, torque, power and specific fuel consumption (sfc) were ...

  9. Scrutinizing the combustion, performance and emissions of safflower biodiesel–kerosene fueled diesel engine used as power source for a generator

    International Nuclear Information System (INIS)

    Aydın, Hüseyin

    2016-01-01

    Highlights: • Effects of kerosene addition to biodiesel in a diesel engine were investigated. • S90&K10, S75&K25 and S50&K50 were tested and comparisons have been made with D2. • Patterns of combustion parameters have found be quite similar for blend fuels and D2. • The highest efficiency value is obtained for S50&K50 blend. • HC emissions a bit increased and NOx emissions were decreased. - Abstract: When neat biodiesel or its blends with diesel fuel that contain high amounts of biodiesel are used in diesel engines some operational problems such as poor injection, bad atomization and incomplete combustion occur mainly due to higher viscosity and surface tension. Engine problems with the use of biodiesel–fuel blends that contain higher percentages of biodiesel need to be solved in order to utilize the advantages of biodiesel in environmental and economical ways. The mentioned problems can also be solved by blending biodiesel with another low density or viscosity fuel such as kerosene. In present study biodiesel was produced from safflower oil. S90&K10, S75&K25 and S50&K50 were prepared by blending biodiesel with kerosene. A 4 cylinder diesel engine that was used to drive an electric generator was used to deeply investigate the similarity of combustion, performance and emission characteristics of the blend fuels to D2. All experiments were carried out at constant loads of 3.6, 7.2 and 10.8 kW generated powers. Patterns of combustion parameters found to be quite similar for blends and D2 fuel. NO_x emissions were considerably decreased with percentages of 68.2%, 56.9% and 55.1% for S50&K50, S75&K25 and S90&K10, respectively while unburned HC emissions were a bit increased. Mass fuel consumption and BSFC were slightly increased for S75&K25 and S90&K10, but they were decreased with an average increase in BTE by 3.84% for S50&K50 fuel when compared to D2. Eventually, it was concluded that high percentages of safflower oil biodiesel can be a potential

  10. Practical testing of diesel generators

    International Nuclear Information System (INIS)

    Angle, C.W.; Meyer, S.P.

    1985-01-01

    The testing of diesel generators is a very important facet of the safe operation of nuclear power plants. Improper testing can lead to increased failures and unavailability of the engines resulting in a reduced safety factor for a nuclear plant. For a testing program to be successful it must be well planned and effectively implemented. In addition, inspections and maintenance activities also impact diesel generator availability. This paper describes elements of a suggested diesel generator testing program as well as some of the pitfalls to be avoided

  11. Performance of bio fuels in diesel engines

    International Nuclear Information System (INIS)

    Nunez I, Manuel L; Prada V, Laura P

    2007-01-01

    This paper shows the preliminary results of pilot plant tests developed in oil catalytic hydrotreating process, where the crude palm oil or a mixture of crude palm oil and mineral diesel is treated with an injection of 99% pure hydrogen flux, in a fixed bed reactor at high pressures and temperatures, in a presence of Nickel Molybdenum catalyst supported on alumina bed. The main product of this process is a fuel (bio diesel) which has the same or better properties than the diesel obtained by petroleum refining. It has been made some performance fuel tests in diesel engine? with good results in terms of power, torque and fuel consumption, without any changes in engine configuration. Considering the characteristics of the Catalytic hydrotreated bio diesel compare to conventional diesel, both fuels have similar distillation range? however, bio diesel has better flash point, cetane index and thermal stability. Gas fuels (methane, ethane, and propane) CO 2 and water are the secondary products of the process.

  12. Displacing the dinosaurs. [Diesel engine electric generators

    Energy Technology Data Exchange (ETDEWEB)

    Anon,

    1992-05-01

    This article describes how giant power stations are being replaced by smaller, cleaner units. These include plants using combined-cycle gas turbines and diesel engines of low, medium and high speeds. The use of these diesel engines in power generation is discussed. (UK).

  13. 30 CFR 75.1905-1 - Diesel fuel piping systems.

    Science.gov (United States)

    2010-07-01

    ... facility. (g) Diesel fuel piping systems from the surface shall only be used to transport diesel fuel... storage facility. (h) The diesel fuel piping system must not be located in a borehole with electric power... entry as electric cables or power lines. Where it is necessary for piping systems to cross electric...

  14. Emission Characterization of Diesel Engine Run on Coconut Oil ...

    African Journals Online (AJOL)

    PROF HORSFALL

    KEYWORDS: Diesel engine, diesel, coconut oil biodiesel, blends, emissions. Introduction ... Automobile exhaust ... power loss, the increase in fuel consumption and the increase in ... diesel fuel in terms of power and torque and none or ... gas analyzer (Motorscan 8050) made in Italy which .... different injection pressures.

  15. 150 years of Rudolf Diesel; 150 Jahre Rudolf Diesel

    Energy Technology Data Exchange (ETDEWEB)

    Basshuysen, R. van; Siebenpfeiffer, W. (eds.)

    2008-03-15

    'My engine is still making great progress', Rudolf Diesel wrote in a letter to his wife on 3 July 1895. The fact that Diesel's statement still holds true can be seen every day on our roads and at sea. But it is equally true that the idea of this eccentric and doubter who wanted to dedicate himself with an over-inflated self-belief to the welfare of humanity, needed a certain time to take a form that others could recognise in order to continuously refine this life's work. Diesel himself did not live to see most of the milestones that were repeatedly set thanks to his engine. It was not until 23 years after his unexplained death in 1913 that people were able to buy the first passenger car to be equipped with a diesel engine - with a top speed of 90 km/h. Today, diesel cars can easily reach speeds of up to 300 km/h, and even if there is little point in such excessive speeds outside racetracks like Le Mans, they are nevertheless clear evidence of the incredible evolution of the noisy, smoky truck engine to a high-tech racing power unit, from the ear-splitting rattle of the pre-chamber diesel to the highly refined, soot-free, common-rail diesel engine of today. The Publisher hopes you enjoy reading this unique progress report. (orig.)

  16. Modelling and Simulation of Packed Bed Catalytic Converter for Oxidation of Soot in Diesel Powered Vehicles Flue Gas

    Directory of Open Access Journals (Sweden)

    Mohammad Nasikin

    2010-10-01

    Full Text Available Diesel vehicle is used in Indonesia in very big number. This vehicle exhausts pollutants especially diesel soot that can be reduces by using a catalytic converter to convert the soot to CO2. To obtain the optimal dimension of catalytic converter it is needed a model that can represent the profile of soot weight, temperature and pressure along the catalytic converter. In this study, a model is developed for packed bed catalytic converter in an adiabatic condition based on a kinetic study that has been  reported previously. Calculation of developed equations in this model uses Polymath 5.X solver with Range Kutta Method. The simulation result shows that temperature profile along catalytic converter increases with the decrease of soot weight,  while pressure profile decreases. The increase of soot weight in entering gas increases the needed converter length. On the other hand, the increase of catalyst diameter does not affect to soot weight along converter and temperature profile, but results a less pressure drop. For 2.500 c diesel engine, packed bed catalytic converter with ellipse's cross sectional of 14,5X7,5 cm diagonal and 0,8 cm catalyst particle diameter, needs 4,1 cm length.

  17. Analysis of the ecological parameters of the diesel engine powered with biodiesel fuel containing methyl esters from Camelina sativa oil

    Directory of Open Access Journals (Sweden)

    S. Lebedevas

    2010-03-01

    Full Text Available The article explores the possibilities of using fatty acid methyl esters derived from the oil of a new species of oily plant Camelina sativa not demanding on soil. The performed research on the physical and chemical properties of pure methyl esters from Camelina sativa show that biofuels do not meet requirements for the biodiesel fuel standard (LST EN 14214:2009 of a high iodine value and high content of linoleic acid methyl ester, so they must be mixed with methyl esters produced from pork lard the content of which in the mixture must be not less than 32%. This article presents the results of tests on combustion emission obtained when three-cylinder diesel engine VALMET 320 DMG was fuelled with a mixture containing 30% of this new kind of fuel with fossil diesel fuel comparing with emissions obtained when the engine was fuelled with a fuel mixture containing 30% of conventional biodiesel fuel (rapeseed oil methyl esters with fossil diesel fuel. The obtained results show that using both types of fuel, no significant differences in CO and NOx concentrations were observed throughout the tested load range. When operating on fuels containing methyl esters from Camelina sativa, HC emissions decreased by 10 to 12% and the smokeness of exhaust gas by 12 to 25%.

  18. moteur diesel

    African Journals Online (AJOL)

    A board diagnostic system based on the use of fuzzy pattern recognition techniques was ... with model - Classification. ... ensemble de modèles du moteur diesel avec et .... classes). Nous nous plaçons dans le cas d'un apprentissage non supervisé car on ne connait ..... of noise in clustering, Pattern Recognition Letters,.

  19. Rudolf Diesel

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 17; Issue 4. Rudolf Diesel - The Rational Inventor of a Heat Engine. Tilottama Shrinivasa. Article-in-a-Box Volume 17 Issue 4 April 2012 pp 319-320. Fulltext. Click here to view fulltext PDF. Permanent link:

  20. Experimental Investigation of Embedded Controlled Diesel Engine

    OpenAIRE

    R.Govindaraju; M.Bharathiraja; Dr. K.Ramani; Dr.K.R.Govindan

    2012-01-01

    Diesel engines are widely used in Automobiles, Agriculture and Power generation sectors in a large scale. The modern techniques have contributed a lot in the saving of fuel in these diesel engines. However, from 1970 onwards the fuel consumption becomes a serious concern because of a manifold increase of automobiles and fast depletion of non renewable sources of energy. Since the fuel injection system plays a major role in the consumption of fuel in diesel engines, various control measures we...

  1. Analysis of the backpressure effect of an Organic Rankine Cycle (ORC) evaporator on the exhaust line of a turbocharged heavy duty diesel power generator for marine applications

    International Nuclear Information System (INIS)

    Michos, Constantine N.; Lion, Simone; Vlaskos, Ioannis; Taccani, Rodolfo

    2017-01-01

    Highlights: • Waste heat recovery on internal combustion engines is studied. • The backpressure effect of the Organic Rankine Cycle boiler has been evaluated. • Three different state-of-the art turbocharging technologies have been assessed. • Six different fluids for medium-high temperature recovery have been considered. • A reduction up to 10% in fuel consumption can be achieved. - Abstract: In marine and power generation sectors, waste heat recovery technologies are attracting growing attention in order to increase heavy duty diesel engines efficiency and decrease fuel consumption, with the purpose of respecting stringent emissions legislations. In this work, the backpressure effect of an Organic Rankine Cycle (ORC) evaporator on the exhaust line of a turbocharged, V12 heavy duty diesel engine, for typical marine and power generation applications has been investigated using the commercial software Ricardo WAVE. Three different state-of-the art turbocharging strategies are assessed in order to counterbalance the increased pumping losses of the engine due to the boiler installation: fixed turbine, Waste-Gate (WG) and Variable Geometry Turbine (VGT). At the same time, the steady-state thermodynamic performance of two different ORC configurations, simple tail-pipe evaporator and recuperated simple tail-pipe evaporator layouts, are assessed, with the scope of further increasing the engine power output, recovering unutilized exhaust gas heat. Several different working fluids, suitable for medium-high temperature waste heat recovery, are evaluated and screened, considering, as well, health and safety issues. Thermodynamic cycle parameters such as, for example, evaporation and condensing pressures, working fluid mass flow and cycle temperatures, are optimized in order to obtain the maximum improvement in Brake Specific Fuel Consumption (bsfc). From the engine side point of view, a VGT turbocharger is the most favorable solution to withstand increased

  2. A quantitative analysis of a risk impact due to a starting time extension of the emergency diesel generator in optimized power reactor-1000

    International Nuclear Information System (INIS)

    Lim, Ho-Gon; Yang, Joon-Eon; Hwang, Mee-Jeong

    2007-01-01

    An emergency diesel generator (EDG) is the ultimate electric power supply source for the operation of emergency engineered safety features when a nuclear power plant experiences a loss of off-site power (LOOP). If a loss of coolant accident (LOCA) with a simultaneous LOOP occurs, the EDG should be in the state of a full power within 10 s, which is a prescribed regulatory requirement in the technical specifications (TS) of the Optimized Power Reactor-1000 (OPR-1000). Recently, the US nuclear regulatory commission (NRC) has been preparing a new risk-informed emergency core cooling system (ECCS) rule called 10 CFR 50.46. The new rule redefines the size for the design basis LOCA and it relaxes some of the requirements such as the single failure criteria, simultaneous LOOP, and the methods of analysis. The revision of the ECCS rule will provide flexibility for plant changes if the plant risks are checked and balanced with the specified criteria. The present study performed a quantitative analysis of the plant risk impact due to the EDG starting time extension given that the new rule will be applied to OPR-1000. The thermal-hydraulic analysis and OPR-1000 probabilistic safety assessment (PSA) model were combined to estimate the whole plant risk impact. Also, sensitivity analyses were implemented for the important uncertainty parameters

  3. Using of cotton oil soapstock biodiesel-diesel fuel blends as an alternative diesel fuel

    Energy Technology Data Exchange (ETDEWEB)

    Keskin, Ali [Technical Education Faculty, Mersin University, 33500 Mersin (Turkey); Guerue, Metin [Engineering and Architectural Faculty, Gazi University, 06570 Maltepe, Ankara (Turkey); Altiparmak, Duran [Technical Education Faculty, Gazi University, 06500 Ankara (Turkey); Aydin, Kadir [Engineering and Architectural Faculty, Cukurova University, 01330 Adana (Turkey)

    2008-04-15

    In this study, usability of cotton oil soapstock biodiesel-diesel fuel blends as an alternative fuel for diesel engines were studied. Biodiesel was produced by reacting cotton oil soapstock with methyl alcohol at determined optimum condition. The cotton oil biodiesel-diesel fuel blends were tested in a single cylinder direct injection diesel engine. Engine performances and smoke value were measured at full load condition. Torque and power output of the engine with cotton oil soapstock biodiesel-diesel fuel blends decreased by 5.8% and 6.2%, respectively. Specific fuel consumption of engine with cotton oil soapstock-diesel fuel blends increased up to 10.5%. At maximum torque speeds, smoke level of engine with blend fuels decreased up to 46.6%, depending on the amount of biodiesel. These results were compared with diesel fuel values. (author)

  4. Using of cotton oil soapstock biodiesel-diesel fuel blends as an alternative diesel fuel

    International Nuclear Information System (INIS)

    Keskin, Ali; Guerue, Metin; Altiparmak, Duran; Aydin, Kadir

    2008-01-01

    In this study, usability of cotton oil soapstock biodiesel-diesel fuel blends as an alternative fuel for diesel engines were studied. Biodiesel was produced by reacting cotton oil soapstock with methyl alcohol at determined optimum condition. The cotton oil biodiesel-diesel fuel blends were tested in a single cylinder direct injection diesel engine. Engine performances and smoke value were measured at full load condition. Torque and power output of the engine with cotton oil soapstock biodiesel-diesel fuel blends decreased by 5.8% and 6.2%, respectively. Specific fuel consumption of engine with cotton oil soapstock-diesel fuel blends increased up to 10.5%. At maximum torque speeds, smoke level of engine with blend fuels decreased up to 46.6%, depending on the amount of biodiesel. These results were compared with diesel fuel values. (author)

  5. Clean Coal Diesel Demonstration Project

    Energy Technology Data Exchange (ETDEWEB)

    Robert Wilson

    2006-10-31

    A Clean Coal Diesel project was undertaken to demonstrate a new Clean Coal Technology that offers technical, economic and environmental advantages over conventional power generating methods. This innovative technology (developed to the prototype stage in an earlier DOE project completed in 1992) enables utilization of pre-processed clean coal fuel in large-bore, medium-speed, diesel engines. The diesel engines are conventional modern engines in many respects, except they are specially fitted with hardened parts to be compatible with the traces of abrasive ash in the coal-slurry fuel. Industrial and Municipal power generating applications in the 10 to 100 megawatt size range are the target applications. There are hundreds of such reciprocating engine power-plants operating throughout the world today on natural gas and/or heavy fuel oil.

  6. Revalidation program for nuclear standby diesel generators

    International Nuclear Information System (INIS)

    Muschick, R.P.

    1985-01-01

    This paper describes the program which Duke Power Company carried out to revalidate the diesel engines used in diesel generators for nuclear standby service at Unit 1 of the Catawba Nuclear Station. The diesels operated satisfactorily during the tests, and only relatively minor conditions were noted during the test and inspections, with one exception. This exception was that cracks were detected in the piston skirts. The piston skirts have been replaced with improved design skirts. The diesels have been fully revalidated for their intended service, and have been declared operable

  7. Performance of Diesel Engine Using Diesel B3 Mixed with Crude Palm Oil

    Science.gov (United States)

    Namliwan, Nattapong; Wongwuttanasatian, Tanakorn

    2014-01-01

    The objective of this study was to test the performance of diesel engine using diesel B3 mixed with crude palm oil in ratios of 95 : 5, 90 : 10, and 85 : 15, respectively, and to compare the results with diesel B3. According to the tests, they showed that the physical properties of the mixed fuel in the ratio of 95 : 5 were closest to those of diesel B3. The performance of the diesel engine that used mixed fuels had 5–17% lower torque and power than that of diesel B3. The specific fuel consumption of mixed fuels was 7–33% higher than using diesel B3. The components of gas emissions by using mixed fuel had 1.6–52% fewer amount of carbon monoxide (CO), carbon dioxide (CO2), sulfur dioxide (SO2), and oxygen (O2) than those of diesel B3. On the other hand, nitric oxide (NO) and nitrogen oxides (NOX) emissions when using mixed fuels were 10–39% higher than diesel B3. By comparing the physical properties, the performance of the engine, and the amount of gas emissions of mixed fuel, we found out that the 95 : 5 ratio by volume was a suitable ratio for agricultural diesel engine (low-speed diesel engine). PMID:24688402

  8. Performance of diesel engine using diesel B3 mixed with crude palm oil.

    Science.gov (United States)

    Namliwan, Nattapong; Wongwuttanasatian, Tanakorn

    2014-01-01

    The objective of this study was to test the performance of diesel engine using diesel B3 mixed with crude palm oil in ratios of 95 : 5, 90 : 10, and 85 : 15, respectively, and to compare the results with diesel B3. According to the tests, they showed that the physical properties of the mixed fuel in the ratio of 95 : 5 were closest to those of diesel B3. The performance of the diesel engine that used mixed fuels had 5-17% lower torque and power than that of diesel B3. The specific fuel consumption of mixed fuels was 7-33% higher than using diesel B3. The components of gas emissions by using mixed fuel had 1.6-52% fewer amount of carbon monoxide (CO), carbon dioxide (CO2), sulfur dioxide (SO2), and oxygen (O2) than those of diesel B3. On the other hand, nitric oxide (NO) and nitrogen oxides (NO X ) emissions when using mixed fuels were 10-39% higher than diesel B3. By comparing the physical properties, the performance of the engine, and the amount of gas emissions of mixed fuel, we found out that the 95 : 5 ratio by volume was a suitable ratio for agricultural diesel engine (low-speed diesel engine).

  9. Toxicological properties of emission particles from heavy duty engines powered by conventional and bio-based diesel fuels and compressed natural gas.

    Science.gov (United States)

    Jalava, Pasi I; Aakko-Saksa, Päivi; Murtonen, Timo; Happo, Mikko S; Markkanen, Ari; Yli-Pirilä, Pasi; Hakulinen, Pasi; Hillamo, Risto; Mäki-Paakkanen, Jorma; Salonen, Raimo O; Jokiniemi, Jorma; Hirvonen, Maija-Riitta

    2012-09-29

    One of the major areas for increasing the use of renewable energy is in traffic fuels e.g. bio-based fuels in diesel engines especially in commuter traffic. Exhaust emissions from fossil diesel fuelled engines are known to cause adverse effects on human health, but there is very limited information available on how the new renewable fuels may change the harmfulness of the emissions, especially particles (PM). We evaluated the PM emissions from a heavy-duty EURO IV diesel engine powered by three different fuels; the toxicological properties of the emitted PM were investigated. Conventional diesel fuel (EN590) and two biodiesels were used - rapeseed methyl ester (RME, EN14214) and hydrotreated vegetable oil (HVO) either as such or as 30% blends with EN590. EN590 and 100% HVO were also operated with or without an oxidative catalyst (DOC + POC). A bus powered by compressed natural gas (CNG) was included for comparison with the liquid fuels. However, the results from CNG powered bus cannot be directly compared to the other situations in this study. High volume PM samples were collected on PTFE filters from a constant volume dilution tunnel. The PM mass emission with HVO was smaller and with RME larger than that with EN590, but both biofuels produced lower PAH contents in emission PM. The DOC + POC catalyst greatly reduced the PM emission and PAH content in PM with both HVO and EN590. Dose-dependent TNFα and MIP-2 responses to all PM samples were mostly at the low or moderate level after 24-hour exposure in a mouse macrophage cell line RAW 264.7. Emission PM from situations with the smallest mass emissions (HVO + cat and CNG) displayed the strongest potency in MIP-2 production. The catalyst slightly decreased the PM-induced TNFα responses and somewhat increased the MIP-2 responses with HVO fuel. Emission PM with EN590 and with 30% HVO blended in EN590 induced the strongest genotoxic responses, which were significantly greater than those with EN590

  10. Experience with emergency diesels at the Swiss NPP Goesgen (KKG)

    Energy Technology Data Exchange (ETDEWEB)

    Steffen, W. [Federal Office of Energy, Swiss Federal Nuclear Safety Inspectorate, CH-5303 Wuerenlingen (Switzerland)

    1986-02-15

    The Goesgen nuclear power plant, a 970 MWe KWU pressurized water reactor, is fitted with 4 x 50 X emergency diesels and 2 x 100 % special emergency (Notstand) diesel units. Since the start-up tests of the diesels in 1977 several severe incidents occurred. As a consequence, different back-fitting actions were taken on the diesels and the emergency electrical System. The presentation will treat the following subjects: - lay-out of the onsite electrical power sources, - experiences and problems, - back-fitting measures, - periodic testing of the diesels. (author)

  11. Experience with emergency diesels at the Swiss NPP Goesgen (KKG)

    International Nuclear Information System (INIS)

    Steffen, W.

    1986-01-01

    The Goesgen nuclear power plant, a 970 MWe KWU pressurized water reactor, is fitted with 4 x 50 X emergency diesels and 2 x 100 % special emergency (Notstand) diesel units. Since the start-up tests of the diesels in 1977 several severe incidents occurred. As a consequence, different back-fitting actions were taken on the diesels and the emergency electrical System. The presentation will treat the following subjects: - lay-out of the onsite electrical power sources, - experiences and problems, - back-fitting measures, - periodic testing of the diesels. (author)

  12. Solar and tank. Down under, a power plant is producing electric power from diesel fuel and from solar energy; Sonne und Tank. Am Ende der Welt produziert ein Kraftwerk Strom aus Diesel - und aus Sonnenenergie

    Energy Technology Data Exchange (ETDEWEB)

    Podewils, Christoph

    2011-12-15

    Most Australians live in the big city, but some live in remote areas without infrastructure but with an existing power supply grid. One of these places is the former prospector town of Marble Bar, eight hours from Sydney by plane and by car. The town has an interesting power plant that could be exemplary for many regions of the world.

  13. ALTERNATIVE FUELS FOR DIESEL ENGINES

    Directory of Open Access Journals (Sweden)

    Jacek Caban

    2013-12-01

    Full Text Available This paper presents the development and genesis of the use of alternative fuels in internal combustion ignition engines. Based on the analysis of the literature, this article shows various alternative fuels used in Poland and all over the world. Furthermore, this article describes the research directions for alternative fuels use in road transport powered by diesel engines.

  14. Dual mode linguistic hedge fuzzy logic controller for an isolated wind-diesel hybrid power system with superconducting magnetic energy storage unit

    International Nuclear Information System (INIS)

    Thameem Ansari, M.Md.; Velusami, S.

    2010-01-01

    A design of dual mode linguistic hedge fuzzy logic controller for an isolated wind-diesel hybrid power system with superconducting magnetic energy storage unit is proposed in this paper. The design methodology of dual mode linguistic hedge fuzzy logic controller is a hybrid model based on the concepts of linguistic hedges and hybrid genetic algorithm-simulated annealing algorithms. The linguistic hedge operators are used to adjust the shape of the system membership functions dynamically and can speed up the control result to fit the system demand. The hybrid genetic algorithm-simulated annealing algorithm is adopted to search the optimal linguistic hedge combination in the linguistic hedge module. Dual mode concept is also incorporated in the proposed controller because it can improve the system performance. The system with the proposed controller was simulated and the frequency deviation resulting from a step load disturbance is presented. The comparison of the proportional plus integral controller, fuzzy logic controller and the proposed dual mode linguistic hedge fuzzy logic controller shows that, with the application of the proposed controller, the system performance is improved significantly. The proposed controller is also found to be less sensitive to the changes in the parameters of the system and also robust under different operating modes of the hybrid power system.

  15. The Performance Evaluation of Overall Heat Transfer and Pumping Power of γ-Al2O3/water Nanofluid as Coolant in Automotive Diesel Engine Radiator

    Directory of Open Access Journals (Sweden)

    Navid Bozorgan

    2013-05-01

    Full Text Available The efficiency of γ-Al2O3/water nanofluid as coolant is investigated in the present study. γ-Al2O3 nanoparticles with diameters of 20 nm dispersed in water with volume concentrations up 2% are selected and their performance in a radiator of Chevrolet Suburban diesel engine under turbulent flow conditions are numerically studied. The performance of an automobile radiator is a function of overall heat transfer coefficient and total heat transfer area. The heat transfer relations between nanofluid and airflow have been investigated to evaluate the overall heat transfer and the pumping power of γ-Al2O3/water nanofluid in the radiator with a given heat exchange capacity. In the present paper, the effects of the automotive speed and Reynolds number of the nanofluid in the different volume concentrations on the radiator performance are also investigated. As an example, the results show that for 2% γ-Al2O3 nanoparticles in water with Renf=6000 in the radiator while the automotive speed is 50 mph, the overall heat transfer coefficient and pumping power are approximately 11.11% and 29.17% more than that of water for given conditions, respectively. These results confirm that γ-Al2O3/water nanofluid offers higher overall heat transfer performance than water and can be reduced the total heat transfer area of the radiator.

  16. EFFECTS OF ETHANOL BLENDED DIESEL FUEL ON EXHAUST EMISSIONS FROM A DIESEL ENGINE

    Directory of Open Access Journals (Sweden)

    Özer CAN

    2005-02-01

    Full Text Available Diesel engine emissions can be improved by adding organic oxygenated compounds to the No. 2 diesel fuel. In this study, effects of 10 % and 15 % (in volume ethanol addition to Diesel No. 2 on exhaust emissions from an indirect injection turbocharged diesel engine running at different engine speeds and loads were investigated. Experimental results showed that the ethanol addition reduced CO, soot and SO2 emissions, although it caused some increase in NOx emission and some power reductions due to lower heating value of ethanol. Improvements on emissions were more significant at full load rather than at partial loads.

  17. A practical multi-objective design approach for optimum exhaust heat recovery from hybrid stand-alone PV-diesel power systems

    International Nuclear Information System (INIS)

    Yousefi, Moslem; Kim, Joong Hoon; Hooshyar, Danial; Yousefi, Milad; Sahari, Khairul Salleh Mohamed; Ahmad, Rodina Binti

    2017-01-01

    Highlights: • Heat recovery exchanger is designed based on practical conditions of a hybrid power system. • Off-the-grid electricity system modeling and analysis using micro-grid analysis software HOMER. • NSGA-II is used for the multi-objective design optimization task. • A new local search is proposed to incorporate the engineering knowledge in NSGA-II. • The proposed approach outperforms the existing ones. - Abstract: Integration of solar power and diesel generators (DGs) together with battery storage has proven to be an efficient choice for stand-alone power systems (SAPS). For higher energy efficiency, heat recovery from exhaust gas of the DG can also be employed to supply all or a portion of the thermal energy demand. Although the design of such heat recovery systems (HRSs) has been studied, the effect of solar power integration has not been taken into account. In this paper, a new approach for practical design of these systems based on varying engine loads is presented. Fast and elitist non-dominated sorting genetic algorithm (NSGA-II) equipped with a novel local search was used for the design process, considering conflicting objectives of annual energy recovery and total cost of the system, and six design variables. An integrated power system, designed for a remote SAPS, was used to evaluate the design approach. The optimum power supply system was first designed using the commercial software Hybrid Optimization of Multiple Energy Resources (HOMER), based on power demand and global solar energy in the region. Heat recovery design was based on the outcome of HOMER for DG hourly load, considering different power scenarios. The proposed approach improves the annual heat recovery of the PV/DG/battery system by 4%, PV/battery by 1.7%, and stand-alone DG by 1.8% when compared with a conventional design based on nominal DG load. The results prove that the proposed approach is effective and that load calculations should be taken into account prior to

  18. Engine performance and emissions characteristics of a diesel engine fueled with diesel-biodiesel-bioethanol emulsions

    International Nuclear Information System (INIS)

    Tan, Yie Hua; Abdullah, Mohammad Omar; Nolasco-Hipolito, Cirilo; Zauzi, Nur Syuhada Ahmad; Abdullah, Georgie Wong

    2017-01-01

    Highlights: • Different composition of diesel fuel, biodiesel and bioethanol emulsions were examined. • The fuels were tested in a direct injection diesel engine and parameters were evaluated. • Engine power, torque, exhaust gas temperature & fuel consumptions were compared. • Emulsions fuels emitted lower CO and CO_2 than fossil diesel. • Lower NOx emission was observed at medium engine speeds and loads for emulsion fuels. - Abstract: In this research work, the experimental investigation of the effect of diesel-biodiesel-bioethanol emulsion fuels on combustion, performance and emission of a direct injection (DI) diesel engine are reported. Four kind of emulsion fuels were employed: B (diesel-80%, biodiesel-20% by volume), C (diesel-80%, biodiesel-15%, bioethanol-5%), D (diesel-80%, biodiesel-10%, bioethanol-10%) and E (diesel-80%, biodiesel-5%, bioethanol-15%) to compare its’ performance with the conventional diesel, A. These emulsion fuels were prepared by mechanical homogenizer machine with the help of Tween 80 (1% v/v) and Span 80 (0.5% v/v) as surfactants. The emulsion characteristics were determined by optical electron microscope, emulsification stability test, FTIR, and the physiochemical properties of the emulsion fuels which were all done by following ASTM test methods. The prepared emulsion fuels were then tested in diesel engine test bed to obtain engine performance and exhaust emissions. All the engine experiments were conducted with engine speeds varying from 1600 to 2400 rpm. The results showed the heating value and density of the emulsion fuels decrease as the bioethanol content in the blend increases. The total heating value of the diesel-biodiesel-bioethanol fuels were averagely 21% higher than the total heating value of the pure biodiesel and slightly lower (2%) than diesel fuel. The engine power, torque and exhaust gas temperature were reduced when using emulsion fuels. The brake specific fuel consumption (BSFC) for the emulsion fuels

  19. Dependent failures of diesel generators

    International Nuclear Information System (INIS)

    Mankamo, T.; Pulkkinen, U.

    1982-01-01

    This survey of dependent failures (common-cause failures) is based on the data of diesel generator failures in U. S. nuclear power plants as reported in Licensee Event Reports. Failures were classified into random and potentially dependent failures. All failures due to design errors, manufacturing or installation errors, maintenance errors, or deviations in the operational environment were classified as potentially dependent failures.The statistical dependence between failures was estimated from the relative portion of multiple failures. Results confirm the earlier view of the significance of statistical dependence, a strong dependence on the age of the diesel generator was found in each failure class excluding random failures and maintenance errors, which had a nearly constant frequency independent of diesel generator age

  20. Hydrodesulfurization device for diesel fuel

    International Nuclear Information System (INIS)

    Al Asadi, Nadija

    2004-01-01

    New gas oil hydrodesulfurization unit was erected in OKTA Refinery. This unit is meant to produce low sulfur diesel. Capacity of the unit s 363.000 tons. Actually unit is producing diesel fuel with sulfur content of 0.035% wt, with possibility of decreasing sulfur content up to 0.005% wt. With this possibility OKTA reaches the target to supply market with diesel fuel satisfying local, and European fuel specifications. Feedstock for this unit are two gas oil fractions from the Crude oil atmospheric distillation column. As a result of new generation of CoMo and NiMo catalysts performance, high degree of desulfurization is reached at lower temperatures. Milder conditions enables longer operating period between two regenerations, savings of fuel, power etc. With further investments, and practically without changes, the unit will be able of producing diesel with sulfur content of 50 ppm and later with upgrading, 10 ppm. This means that OKTA has solved diesel quality problem for longer period. (Author)

  1. A cycle simulation model for predicting the performance of a diesel engine fuelled by diesel and biodiesel blends

    International Nuclear Information System (INIS)

    Gogoi, T.K.; Baruah, D.C.

    2010-01-01

    Among the alternative fuels, biodiesel and its blends are considered suitable and the most promising fuel for diesel engine. The properties of biodiesel are found similar to that of diesel. Many researchers have experimentally evaluated the performance characteristics of conventional diesel engines fuelled by biodiesel and its blends. However, experiments require enormous effort, money and time. Hence, a cycle simulation model incorporating a thermodynamic based single zone combustion model is developed to predict the performance of diesel engine. The effect of engine speed and compression ratio on brake power and brake thermal efficiency is analysed through the model. The fuel considered for the analysis are diesel, 20%, 40%, 60% blending of diesel and biodiesel derived from Karanja oil (Pongamia Glabra). The model predicts similar performance with diesel, 20% and 40% blending. However, with 60% blending, it reveals better performance in terms of brake power and brake thermal efficiency.

  2. Long term reliability analysis of standby diesel generators

    International Nuclear Information System (INIS)

    Winfield, D.J.

    1988-01-01

    The long term reliability of 11 diesel generators of 125 to 250 kV A size has been analysed from 26 years of data base information on individual diesel service as standby power supplies for the Chalk River research reactor facilities. Failure to start on demand and failure to run data is presented and failure by diesel subsystem and multiple failures are also analysed. A brief comparison is made with reliability studies of larger diesel generator units used for standby power service in nuclear power plants. (author)

  3. Performance diagnostic system for emergency diesel generators

    International Nuclear Information System (INIS)

    Logan, K.P.

    1991-01-01

    Diesel generators are commonly used for emergency backup power at nuclear stations. Emergency diesel generators (EDGs) are subject to both start-up and operating failures, due to infrequent and fast-start use. EDG reliability can be critical to plant safety, particularly when station blackout occurs. This paper describes an expert diagnostic system designed to consistently evaluate the operating performance of diesel generators. The prototype system is comprised of a suite of sensor monitoring, cylinder combustion analyzing, and diagnostic workstation computers. On-demand assessments of generator and auxiliary equipment performance are provided along with color trend displays comparing measured performance to reference-normal conditions

  4. Status of Wind-Diesel Applications in Arctic Climates: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Baring-Gould, I.; Corbus, D.

    2007-12-01

    The rising cost of diesel fuel and the environmental regulation for its transportation, use, and storage, combined with the clear impacts of increased arctic temperatures, is driving remote communities to examine alternative methods of providing power. Over the past few years, wind energy has been increasingly used to reduce diesel fuel consumption, providing economic, environmental, and security benefits to the energy supply of communities from Alaska to Antarctica. This summary paper describes the current state of wind-diesel systems, reviews the operation of wind-diesel plants in cold climates, discusses current research activities pertaining to these systems, and addresses their technical and commercial challenges. System architectures, dispatch strategies, and operating experience from a variety of wind-diesel systems in Alaska will be reviewed. Specific focus will also be given to the control of power systems with large amounts of wind generation and the complexities of replacing diesel engine waste heat with excess wind energy, a key factor in assessing power plants for retrofit. A brief overview of steps for assessing the viability of retrofitting diesel power systems with wind technologies will also be provided. Because of the large number of isolated diesel minigrids, the market for adding wind to these systems is substantial, specifically in arctic climates and on islands that rely on diesel-only power generation.

  5. 26 CFR 48.4082-4 - Diesel fuel and kerosene; back-up tax.

    Science.gov (United States)

    2010-04-01

    ...)(I) and 4041(d)(1) (the bus rate) if the bus is used to furnish (for compensation) passenger land... section 6427(b)(2)(D)) while the bus is engaged in furnishing (for compensation) intracity passenger land... propulsion engine of a diesel-powered highway vehicle (other than a diesel-powered bus) of— (i) Any diesel...

  6. Application of diagnostic system for diesel engine

    International Nuclear Information System (INIS)

    Yoshinaga, Takeshi; Hayashi, Haruji; Usui, Hiromi; Tsuruzono, Atsuya; Matsuda, Takafumi

    2008-01-01

    The Japan Atomic Power Company (JAPC) began to implement Condition Based Maintenance (CBM) for rotating components (pumps, fans and electric motors) from 1999 and, also has begun to apply diesel engine diagnostic techniques at our three nuclear power plants since 2004. This paper provides a description of the CBM methods used for diesel engines in nuclear standby service, a summary of the procedures to introduce these diagnostic techniques to our nuclear power plants, and experience with the application of these methods to JAPC nuclear power plants. (author)

  7. The Energy Cost Analysis of Hybrid Systems and Diesel Generators in Powering Selected Base Transceiver Station Locations in Nigeria

    Directory of Open Access Journals (Sweden)

    Peter Ozaveshe Oviroh

    2018-03-01

    Full Text Available As more locations gain access to telecommunication, there is a growing demand to provide energy in a reliable, efficient and environmentally friendly manner while effectively addressing growing energy needs. Erratic power supply and rising operation costs (OPEX in Nigeria have increased the need to harness local renewable energy sources. Thus, identifying the right generator schedule with the renewable system to reduce OPEX is a priority for operators and vendors. This study evaluates the energy costs of hybrid systems with different generator schedules in powering base transceiver stations in Nigeria using the Hybrid Optimization Model for Electric Renewable (HOMER. A load range of 4 kW to 8 kW was considered using: (i an optimised generator schedule; (ii forced-on generator schedule and (iii the generator-only schedule. The results showed an optimal LCOE range between averages of USD 0.156/kWh to 0.172/kWh for the 8 kW load. The percent energy contribution by generator ranges from 52.80% to 60.90%, and by the solar PV system, 39.10% to 47.20%. Excess energy ranges from 0.03% to 14.98%. The optimised generator schedule has the highest solar PV penetration of 56.8%. The OPEX savings on fuel ranges from 41.68% to 47% for the different load schedules and carbon emission savings of 4222 kg to 31,428.36 kg. The simulation results shows that powering base stations using the optimised hybrid system schedule would be a better option for the telecom industry.

  8. The economics of a variable speed wind-diesel

    International Nuclear Information System (INIS)

    Moll, W.

    1992-01-01

    A remote community power supply system generating over 1,000 kWH/d will have at least one diesel generator running all the time. If one or more wind turbine generators are added to such a system, the diesel generator will produce less power when wind speeds are adequate, but its fuel efficiency will gradually decrease as load decreases. In the variable speed wind/diesel concept, the diesel rpm is reduced with decreasing load and a high fuel efficiency is maintained over virtually the full power range. The outputs of the diesel and wind turbine generators are fed into an inverter which synthesizes a desired voltage wave-shape with controlled magnitude and frequency. The variable speed wind/diesel concept may make vertical axis wind turbines suitable for remote community power supply because the inverter effectively isolates the power ripple of the wind turbine. A possible wind/diesel system configuration using the variable speed concept is illustrated. The economics of a 50-kW variable speed diesel and a 80-kW variable speed wind turbine generator was analyzed. Going from a constant speed diesel generator to a variable speed generator operating at 55% capacity factor, a 6% fuel saving was achieved. Adding one 80-kW wind turbine increased fuel savings to 32% at 5 m/s wind speed, but the unit energy cost rose 8.5%. At 7 m/s wind speed, fuel savings were 59% and energy savings were 7.8%. Economics are better for a peaking variable speed 50-kW wind/diesel system added to an existing diesel system to extend the installed capacity. At 7 m/s wind speed the fuel savings translate into ca $40,000 over 10 y and purchase of a $150,000 diesel generator is postponed. 7 figs., 1 tab

  9. Performance of Diesel Engine Using Blended Crude Jatropha Oil

    Science.gov (United States)

    Kamarudin, Kamarul Azhar; Mohd Sazali, Nor Shahida Akma; Mohd Ali, Mas Fauzi; Alimin, Ahmad Jais; Khir, Saffiah Abdullah

    2010-06-01

    Vegetable oil presents a very promising alternative to diesel oil since it is renewable and has similar properties to the diesel. In view of this, crude jatropha oil is selected and its viscosity is reduced by blending it with diesel. Since jatropha oil has properties which are similar to mineral diesel, it can be used in compression ignition engines without any engine modification. This paper presents the results of investigation carried out on a four-cylinder, four strokes and indirect-injection diesel engine. The engine, operated using composition blends of crude jatropha oil and diesel, were compared with mineral diesel. An experimental investigation has been carried out to analyze the performance characteristics of a compression ignition engine from the blended fuel (5%, 10%, 20% and 30%). A naturally aspirated four-stroke indirect injection diesel engine was tested at full load conditions, speeds between 1000 and 3500 rpm with intervals of 500 rpm. Results obtained from the measures of torque, power, specific fuel consumptions, thermal efficiency and brake mean effective pressure are nearly the same between blended and diesel fuel. An overall graph shows that the performance of relevant parameters from blended fuel is most likely similar to the performance produced from diesel. The experimental results proved that the use of crude jatropha oil in compression ignition engines is a viable alternative to diesel.

  10. Sound engineering for diesel engines; Sound Engineering an Dieselmotoren

    Energy Technology Data Exchange (ETDEWEB)

    Enderich, A.; Fischer, R. [MAHLE Filtersysteme GmbH, Stuttgart (Germany)

    2006-07-01

    The strong acceptance for vehicles powered by turbo-charged diesel engines encourages several manufacturers to think about sportive diesel concepts. The approach of suppressing unpleasant noise by the application of distinctive insulation steps is not adequate to satisfy sportive needs. The acoustics cannot follow the engine's performance. This report documents, that it is possible to give diesel-powered vehicles a sportive sound characteristic by using an advanced MAHLE motor-sound-system with a pressure-resistant membrane and an integrated load controlled flap. With this the specific acoustic disadvantages of the diesel engine, like the ''diesel knock'' or a rough engine running can be masked. However, by the application of a motor-sound-system you must not negate the original character of the diesel engine concept, but accentuate its strong torque characteristic in the middle engine speed range. (orig.)

  11. Fuel oil systems for standby diesel-generators

    International Nuclear Information System (INIS)

    Anon.

    1976-01-01

    This Standard provides the design requirements for fuel oil system for diesel-generators that provide standby power for a nuclear power generating station. The system includes all essential equipment from and including fuel oil storage tanks up to the terminal connection on the diesel-engine. It does not include that portion of the fuel oil system supplied by the diesel-generator manufacturer which is in accordance with Trial-Use Criteria for Diesel-Generator Units Applied as Standby Power Supplies for Nuclear Power Generating Stations, IEEE-387-1972. This definition of scope is intended to exclude only those factory-assembled, engine-mounted appurtances supplied with a diesel-generator unit. Integral tanks are, however, within the scope of this Standard. It also excludes motors, motor control centers, switchgear, cables, and other electrical equipment which is used in operation of the fuel oil system, except to define interface requirements

  12. Polycyclic aromatic hydrocarbons (PAH) in exhaust emissions from diesel engines powered by rapeseed oil methylester and heated non-esterified rapeseed oil

    Czech Academy of Sciences Publication Activity Database

    Vojtíšek-Lom, M.; Czerwinski, J.; Leníček, J.; Sekyra, M.; Topinka, Jan

    2012-01-01

    Roč. 60, 14 JUNE (2012), s. 253-261 ISSN 1352-2310 R&D Projects: GA ČR GAP503/11/0142 Grant - others:GA ČR(CZ) GA101/08/1717; GA MŠk(CZ) 1M0568; project MEDETOX(XE) LIFE10ENV/CZ/651 Institutional research plan: CEZ:AV0Z50390703 Institutional support: RVO:68378041 Keywords : diesel engine * diesel emissions * particulate matter Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 3.110, year: 2012

  13. Dieselization in Sweden

    International Nuclear Information System (INIS)

    Kågeson, Per

    2013-01-01

    In Sweden the market share of diesel cars grew from below 10 per cent in 2005 to 62 per cent in 2011 despite a closing gap between pump prices on diesel oil and gasoline, and diesel cars being less favored than ethanol and biogas cars in terms of tax cuts and other subsidies offered to “environment cars”. The most important factor behind the dieselization was probably the market entrance of a number of low-consuming models. Towards the end of the period a growing number of diesel models were able to meet the 120 g CO 2 threshold applicable to “environment cars” that cannot use ethanol or biogas. This helped such models increase their share of the diesel car market from zero to 41 per cent. Dieselization appears to have had only a minor effect on annual distances driven. The higher average annual mileage of diesel cars is probably to a large extent a result of a self-selection bias. However, the Swedish diesel car fleet is young, and the direct rebound effect stemming from a lower variable driving cost may show up more clearly as the fleet gets older based on the assumption that second owners are more fuel price sensitive than first owners. - Highlights: ► This paper tries to explain the fast dieselization of the new Swedish car fleet. ► It identifies changes in supply and the impact of tax benefits. ► Finally it studies the impact on the annual average mileage

  14. Support vector machine to predict diesel engine performance and emission parameters fueled with nano-particles additive to diesel fuel

    Science.gov (United States)

    Ghanbari, M.; Najafi, G.; Ghobadian, B.; Mamat, R.; Noor, M. M.; Moosavian, A.

    2015-12-01

    This paper studies the use of adaptive Support Vector Machine (SVM) to predict the performance parameters and exhaust emissions of a diesel engine operating on nanodiesel blended fuels. In order to predict the engine parameters, the whole experimental data were randomly divided into training and testing data. For SVM modelling, different values for radial basis function (RBF) kernel width and penalty parameters (C) were considered and the optimum values were then found. The results demonstrate that SVM is capable of predicting the diesel engine performance and emissions. In the experimental step, Carbon nano tubes (CNT) (40, 80 and 120 ppm) and nano silver particles (40, 80 and 120 ppm) with nanostructure were prepared and added as additive to the diesel fuel. Six cylinders, four-stroke diesel engine was fuelled with these new blended fuels and operated at different engine speeds. Experimental test results indicated the fact that adding nano particles to diesel fuel, increased diesel engine power and torque output. For nano-diesel it was found that the brake specific fuel consumption (bsfc) was decreased compared to the net diesel fuel. The results proved that with increase of nano particles concentrations (from 40 ppm to 120 ppm) in diesel fuel, CO2 emission increased. CO emission in diesel fuel with nano-particles was lower significantly compared to pure diesel fuel. UHC emission with silver nano-diesel blended fuel decreased while with fuels that contains CNT nano particles increased. The trend of NOx emission was inverse compared to the UHC emission. With adding nano particles to the blended fuels, NOx increased compared to the net diesel fuel. The tests revealed that silver & CNT nano particles can be used as additive in diesel fuel to improve complete combustion of the fuel and reduce the exhaust emissions significantly.

  15. Desempenho de motor ciclo Diesel em bancada dinamométrica utilizando misturas diesel/biodiesel Performance of cycle Diesel engine in dynamometer using diesel/biodiesel mixtures

    Directory of Open Access Journals (Sweden)

    Marcio Castellanelli

    2008-03-01

    Full Text Available Diante da previsão de escassez do petróleo, o éster etílico (biodiesel tem-se apresentado como excelente opção de combustível alternativo para motores ciclo Diesel. As características do biodiesel são semelhantes às do diesel em termos de viscosidade e poder calorífico, podendo ser utilizado sem adaptações nos motores. Para a realização deste trabalho, utilizou-se de motor ciclo Diesel, de injeção direta, com quatro cilindros, sem adaptações. O motor foi acoplado a um dinamômetro e sistemas de aquisição de dados auxiliares. Avaliaram-se os desempenhos de torque, de potência e de consumo específico de combustível para as seguintes misturas diesel/éster etílico de soja: B2, B5, B10, B20, B50, B75 e B100. O melhor desempenho registrado deu-se com a mistura B20.Given the prediction of the scarcity of oil, the ethyl ester (biodiesel has presented as an excellent alternative fuel option for cycle diesel engine. The characteristics of biodiesel are similar of diesel in terms of viscosity and the calorific power, being able to be used without adaptations in the engines. For the accomplishment of this work it was used a cycle diesel engine, of direct injection with four cylinders, without adaptations. The engine was connected to a dynamometer and acquisition systems of auxiliary data. The performances of torque, power and specific fuel consumption for the following mixtures diesel/soy ethyl ester had been evaluated: B2, B5, B10, B20, B50, B75 and B100. The best registered performance was given with the B20 mixture.

  16. Experimental investigation on performance characteristics of a diesel engine using diesel-water emulsion with oxygen enriched air

    Directory of Open Access Journals (Sweden)

    P. Baskar

    2017-03-01

    Full Text Available Diesel engines occupy a crucial position in automobile industry due to their high thermal efficiency and high power to weight ratio. However, they lag behind in controlling air polluting components coming out of the engine exhaust. Therefore, diesel consumption should be analyzed for future energy consumption and this can be primarily controlled by the petroleum fuel substitution techniques for existing diesel engines, which include biodiesel, alcohol-diesel emulsions and diesel water emulsions. Among them the diesel water emulsion is found to be most suitable fuel due to reduction in particulate matter and NOx emission, besides that it also improves the brake thermal efficiency. But the major problem associated with emulsions is the ignition delay, since this is responsible for the power and torque loss. A reduction in NOx emission was observed due to reduction in combustion chamber temperature as the water concentration increases. However the side effect of emulsified diesel is a reduction in power which can be compensated by oxygen enrichment. The present study investigates the effects of oxygen concentration on the performance characteristics of a diesel engine when the intake air is enriched to 27% of oxygen and fueled by 10% of water diesel emulsion. It was found that the brake thermal efficiency was enhanced, combustion characteristics improved and there is also a reduction in HC emissions.

  17. Analysis of Oxygenated Component (butyl Ether) and Egr Effect on a Diesel Engine

    Science.gov (United States)

    Choi, Seung-Hun; Oh, Young-Taig

    Potential possibility of the butyl ether (BE, oxygenates of di-ether group) was analyzed as an additives for a naturally aspirated direct injection diesel engine fuel. Engine performance and exhaust emission characteristics were analyzed by applying the commercial diesel fuel and oxygenates additives blended diesel fuels. Smoke emission decreased approximately 26% by applying the blended fuel (diesel fuel 80 vol-% + BE 20vol-%) at the engine speed of 25,000 rpm and with full engine load compared to the diesel fuel. There was none significant difference between the blended fuel and the diesel fuel on the power, torque, and brake specific energy consumption rate of the diesel engine. But, NOx emission from the blended fuel was higher than the commercial diesel fuel. As a counter plan, the EGR method was employed to reduce the NOx. Simultaneous reduction of the smoke and the NOx emission from the diesel engine was achieved by applying the BE blended fuel and the cooled EGR method.

  18. Evaluating photovoltaic/energy storage/diesel hybrid power systems for remote area power supplies in the Amazon region of Peru

    International Nuclear Information System (INIS)

    Hurwitch, J.W.; Danley, D.R.

    1998-01-01

    In June 1997, an international memorandum of understanding was signed between the Ministry of Energy and Mines (MEM) in Peru, the Solar Energy Industries Association (SEIA) and the International Lead Zinc Research Organization (ILZRO). This agreement seeks to evaluate the potential for remote area power supplies (RAPS) for electrification of rural villages in the Amazon region. This study, funded by ILZRO, was the first major activity conducted under the aegis of this agreement. The objective of this study was to conduct a preliminary engineering design and feasibility study to assess the potential for Remote Area Power Supplies (RAPS) in the Amazon Region of Peru. This paper presents the results of this preliminary engineering study. (author)

  19. Diesel Engine Exhaust: Basis for Occupational Exposure Limit Value.

    Science.gov (United States)

    Taxell, Piia; Santonen, Tiina

    2017-08-01

    Diesel engines are widely used in transport and power supply, making occupational exposure to diesel exhaust common. Both human and animal studies associate exposure to diesel exhaust with inflammatory lung effects, cardiovascular effects, and an increased risk of lung cancer. The International Agency for Research on Cancer has evaluated diesel exhaust as carcinogenic to humans. Yet national or regional limit values for controlling occupational exposure to diesel exhaust are rare. In recent decades, stricter emission regulations have led to diesel technologies evolving significantly, resulting in changes in exhaust emissions and composition. These changes are also expected to influence the health effects of diesel exhaust. This review provides an overview of the current knowledge on the health effects of diesel exhaust and the influence of new diesel technologies on the health risk. It discusses the relevant exposure indicators and perspectives for setting occupational exposure limit values for diesel exhaust, and outlines directions for future research. The review is based on a collaborative evaluation report by the Nordic Expert Group for Criteria Documentation of Health Risks from Chemicals and the Dutch Expert Committee on Occupational Safety. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Experimental evaluation of a diesel-biogas dual fuel engine operated on micro-trigeneration system for power, drying and cooling

    International Nuclear Information System (INIS)

    Cacua, Karen; Olmos-Villalba, Luis; Herrera, Bernardo; Gallego, Anderson

    2016-01-01

    Highlights: • A micro-trigeneration system based in a diesel-biogas dual fuel engine was obtained. • Heat from engine exhaust gases was used for drying and refrigeration applications. • Energy efficiency of the microtrigeneration system in dual mode was 40%. • Peppermint was dried in the microtrigeneration system. - Abstract: A micro-trigeneration system based on a diesel-biogas dual fuel engine was evaluated experimentally. In this system, waste heat from the engine exhaust was used for heating air using a heat pipe exchanger and for driving an absorption unit freezer. The air heated was used in a convective trays dryer designed to dry peppermint. The global energy efficiency of this system at the engine full load was 40% and 31% in diesel and dual mode, respectively, while the same efficiencies of the engine at the original single generation were 23% and 18%, respectively. On the other hand, a maximum diesel substitution level of 50% was achieved in dual mode.

  1. Diesel engine emissions and performance from blends of karanja methyl ester and diesel

    International Nuclear Information System (INIS)

    Raheman, H.; Phadatare, A.G.

    2004-01-01

    This paper presents the results of investigations carried out in studying the fuel properties of karanja methyl ester (KME) and its blend with diesel from 20% to 80% by volume and in running a diesel engine with these fuels. Engine tests have been carried out with the aim of obtaining comparative measures of torque, power, specific fuel consumption and emissions such as CO, smoke density and NO x to evaluate and compute the behaviour of the diesel engine running on the above-mentioned fuels. The reduction in exhaust emissions together with increase in torque, brake power, brake thermal efficiency and reduction in brake-specific fuel consumption made the blends of karanja esterified oil (B20 and B40) a suitable alternative fuel for diesel and could help in controlling air pollution. (author)

  2. Panorama 2016 - Diesel

    International Nuclear Information System (INIS)

    Monnier, Gaetan; Ivanic, Tanja; Alazard-Toux, Nathalie

    2016-01-01

    Diesel vehicles have been the focus of recent national and world news coverage. This solution, with greater overall efficiency than spark emission engines (gasoline, LPG and natural gas), remains an essential aspect of road freight transport. Diesel has even gained a significant share of the light vehicle market in certain regions of the world. However, diesel is currently the focus of numerous controversies and has been condemned for its negative impact on air quality. (authors)

  3. Diesel particles - a health hazard

    Energy Technology Data Exchange (ETDEWEB)

    Ege, C.

    2004-08-15

    To all appearances, small particles belong to the pollutants presenting the biggest health hazards. Particles come especially from diesel-powered vehicles. According to researchers, particles cause thousands of early deaths each year in the big cities in Denmark alone, and up to 1,250 of these deaths could be prevented by fitting particle filters on diesel-powered vehicles. That is more than deaths caused by traffic accidents. Especially the elderly are affected. In addition, the small particles seem to aggravate asthma incidences, including the many children with asthma. What makes the small particles so very dangerous is that they can enter the smallest of vessels of the lungs. There is a solution within sight to this grave health hazard. The solution is called particle filters, but they will not come automatically. It requires initiatives in the form of legislation, green taxes and subsidies. The EU is introducing stricter regulations regarding particle emission from heavy vehicles from 2006, though only for new vehicles. It will therefore take many years to abate the problem this way. In the present pamphlet, the Danish Ecological Council offers a number of specific proposals on how to further the introduction of filters on diesel vehicles. The Danish government has taken a small step in the right direction by establishing a subsidy scheme for particle filters. Yet the amount allocated is too small and, because it is not followed up by setting taxes on polluting vehicles, it will have little effect. (au)

  4. Crude palm oil as fuel extender for diesel engines

    International Nuclear Information System (INIS)

    Mohamed M El-Awad; Fuad Abas; Mak Kian Sin

    2000-01-01

    In this work an investigation has been conducted into the use of Crude Palm Oil (CPO) as an extender fuel for diesel engines. Mixtures of CPO with normal diesel fuel (with a percentage of 25%, 50% and 75% CPO by volume) were used to fuel a stationary diesel engine and the engine performance variables, i.e., power output, fuel consumption, and exhaust-gas emission, were compared to those of normal diesel fuel. The results obtained, for a fixed throttle opening and variable speed, indicate that at high engine speeds, the engine performance with CP0/diesel mixtures with up to 50% CPO is comparable to that of diesel fuel. However, the results of the 75% CPO mixture showed a higher temperature and emission of CO and NO compared to the diesel fuel. At low engine speeds, the engine performance with CPO mixtures gave higher power output and lower emission of NO compared to that with diesel fuel, but showed higher specific fuel consumption and higher emission of CO. Based on these results, the study recommends that CPO can be used to extend diesel fuel in a mixture of up to 50% CPO by volume for an unmodified engine. (Author)

  5. 46 CFR 182.465 - Ventilation of spaces containing diesel machinery.

    Science.gov (United States)

    2010-10-01

    ... furnish natural or powered supply and exhaust ventilation. The total inlet area and the total outlet area... 46 Shipping 7 2010-10-01 2010-10-01 false Ventilation of spaces containing diesel machinery. 182... Ventilation of spaces containing diesel machinery. (a) A space containing diesel machinery must be fitted with...

  6. Stationary engine test of diesel cycle using diesel oil and biodiesel (B100); Ensaio de motores estacionarios do ciclo diesel utilizando oleo diesel e biodiesel (B100)

    Energy Technology Data Exchange (ETDEWEB)

    Torres, Ednildo Andrade [Universidade Federal da Bahia (DEQ/DEM/EP/UFBA), Salvador, BA (Brazil). Escola Politecnica. Dept. de Engenharia Quimica], Email: ednildo@ufba.br; Santos, Danilo Cardoso [Universidade Federal da Bahia (PPEQ/UFBA), Salvador, BA (Brazil). Programa de Pos-Graduacao em Engenharia Quimica; Souza, Daniel Vidigal D.; Peixoto, Leonardo Barbosa; Franca, Tiago [Universidade Federal da Bahia (DEM/UFBA), Salvador, BA (Brazil). Dept. de Engenharia Mecanica

    2006-07-01

    This work objectified to test an engine stationary of the cycle diesel, having as combustible diesel fossil and bio diesel. The characteristic curves of power, torque and emissions versus rotation of the engine was elaborated. The survey of these curves was carried through in the Laboratorio de Energia e Gas da Escola Politecnica da UFBA, which makes use of two stationary dynamometers and the one of chassis and necessary instrumentation for you analyze of the exhaustion gases. The tested engine was of the mark AGRALE, M-85 model stationary type, mono cylinder, with power NF (NBRISO 1585) Cv/kw/rpm 10/7,4/2500. The assays had been carried through in a hydraulically dynamometer mark Schenck, D-210 model. The fuel consumption was measured in a scale marks Filizola model BP-6, and too much ground handling equipment such as: water reservoir, tubings, valves controllers of volumetric outflow, sensors and measurers of rotation, torque, mass, connected to a system of acquisition of data on line. The emissions of the gases (CO, CO{sub 2}, and NOx), were measured by the analytical Tempest mark, model 100. The engine operated with oil diesel and bio diesel of oils and residual fats (OGR). In the tests, the use of the fuel derived from oil and the gotten ones from OGR was not detected significant differences how much. In this phase already it can show to the immediate possibility of the substitution of the oil diesel for bio diesel as combustible in the stationary engines of low power (author)

  7. The tumor suppressor SirT2 regulates cell cycle progression and genome stability by modulating the mitotic deposition of H4K20 methylation

    Science.gov (United States)

    The establishment of the epigenetic mark H4K20me1 (monomethylation of H4K20) by PR-Set7 during G2/M directly impacts S-phase progression and genome stability. However, the mechanisms involved in the regulation of this event are not well understood. Here we show that SirT2 regulates H4K20me1 depositi...

  8. Diesel Consumption of Agriculture in China

    Directory of Open Access Journals (Sweden)

    Shusen Gui

    2012-12-01

    Full Text Available As agricultural mechanization accelerates the development of agriculture in China, to control the growth of the resulting energy consumption of mechanized agriculture without negatively affecting economic development has become a major challenge. A systematic analysis of the factors (total power, unit diesel consumption, etc. influencing diesel consumption using the SECA model, combined with simulations on agricultural diesel flows in China between 1996 and 2010 is performed in this work. Seven agricultural subsectors, fifteen categories of agricultural machinery and five farm operations are considered. The results show that farming and transportation are the two largest diesel consumers, accounting for 86.23% of the total diesel consumption in agriculture in 2010. Technological progress has led to a decrease in the unit diesel consumption and an increase in the unit productivity of all machinery, and there is still much potential for future progress. Additionally, the annual average working hours have decreased rapidly for most agricultural machinery, thereby influencing the development of mechanized agriculture.

  9. Evaluation of the Use of Ultra Low Sulfur Diesel Oil for an Emergency Diesel Generator

    International Nuclear Information System (INIS)

    Yun, Young-Chul; Chung, Woo-Geun

    2016-01-01

    The aim of this study is to assess the compatibility and effect on driving an emergency diesel generator using ULSD examining the specific gravity and lubricity of the oil. Because generators at NPPs use ULSD which is not mostly used for medium-large diesel generator engines, this study seeks to provide effective precautions for the driving stability of emergency diesel generators. One of the major fuel oils used in medium-large diesel engines for the normal driving of vessels and the generation of emergency power at power plants is heavy fuel oil. There are no vessels and power generation engines known to use high-quality diesel oil which is widely used in cars. The findings of this study suggest that when driving a diesel generator, there will be increased fuel consumption by 3.6% [m 3 /hr.]. Furthermore, the mechanical fuel limiter on the engine needs an upward adjustment because the system is set for 110% load operations for the former LSD fuel. Both LSD and ULSD retain lubricity with a WSD around 330~350μm. These results clearly show that bad lubricity problems are not expected to occur. We had presumed an increased amount of foreign particulates because of the increased additives for high lubricity and oxidative stability

  10. Evaluation of the Use of Ultra Low Sulfur Diesel Oil for an Emergency Diesel Generator

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Young-Chul; Chung, Woo-Geun [KHNP CRI, Daejeon (Korea, Republic of)

    2016-10-15

    The aim of this study is to assess the compatibility and effect on driving an emergency diesel generator using ULSD examining the specific gravity and lubricity of the oil. Because generators at NPPs use ULSD which is not mostly used for medium-large diesel generator engines, this study seeks to provide effective precautions for the driving stability of emergency diesel generators. One of the major fuel oils used in medium-large diesel engines for the normal driving of vessels and the generation of emergency power at power plants is heavy fuel oil. There are no vessels and power generation engines known to use high-quality diesel oil which is widely used in cars. The findings of this study suggest that when driving a diesel generator, there will be increased fuel consumption by 3.6% [m{sup 3}/hr.]. Furthermore, the mechanical fuel limiter on the engine needs an upward adjustment because the system is set for 110% load operations for the former LSD fuel. Both LSD and ULSD retain lubricity with a WSD around 330~350μm. These results clearly show that bad lubricity problems are not expected to occur. We had presumed an increased amount of foreign particulates because of the increased additives for high lubricity and oxidative stability.

  11. Fundamentals of Diesel Engines.

    Science.gov (United States)

    Marine Corps Inst., Washington, DC.

    This student guide, one of a series of correspondence training courses designed to improve the job performance of members of the Marine Corps, deals with the fundamentals of diesel engine mechanics. Addressed in the three individual units of the course are the following topics: basic principles of diesel mechanics; principles, mechanics, and…

  12. Using simple wind-diesel systems without energy storage to obtain high penetration and market acceptance in the near future

    International Nuclear Information System (INIS)

    Lundsager, P.; Sherwin, R.W. Jr.

    1991-01-01

    A wind/diesel hybrid power system combines wind energy technology with diesel generation to provide continous AC electrical power with reduced fuel consumption. The objectives of this paper are to summarize the reasoning behind the simple Wind-Diesel system concept using low or negative load operation of the diesels, including the diesel backdrive technique proposed by Atlantic Orient, and to outline a strategy within an international framework to make simple Wind-Diesel systems with standard induction generator wind turbines commercially available and accepted by the market. (au) (11 refs.)

  13. Pyrolysis oil as diesel fuel

    Energy Technology Data Exchange (ETDEWEB)

    Gros, S [Wartsila Diesel International Ltd., Vaasa (Finland). Diesel Technology

    1997-12-31

    Wood waste pyrolysis oil is an attractive fuel alternative for diesel engine operation. The main benefit is the sustainability of the fuel. No fossil reserves are consumed. The fact that wood waste pyrolysis oil does not contribute to CO{sub 2} emissions is of utmost importance. This means that power plants utilising pyrolysis oil do not cause additional global warming. Equally important is the reduced sulphur emissions that this fuel alternative implies. The sulphur content of pyrolysis oil is extremely low. The high water content and low heating value are also expected to result in very low NO{sub x} emissions. Utilisation of wood waste pyrolysis oil in diesel engines, however, involves a lot of challenges and problems to be solved. The low heating value requires a new injection system with high capacity. The corrosive characteristics of the fluid also underline the need for new injection equipment materials. Wood waste pyrolysis oil contains solid particles which can clog filters and cause abrasive wear. Wood waste pyrolysis oil has proven to have extremely bad ignition properties. The development of a reliable injection system which is able to cope with such a fuel involves a lot of optimisation tests, redesign and innovative solutions. Successful single-cylinder tests have already been performed and they have verified that diesel operation on wood pyrolysis oil is technically possible. (orig.)

  14. Pyrolysis oil as diesel fuel

    Energy Technology Data Exchange (ETDEWEB)

    Gros, S. [Wartsila Diesel International Ltd., Vaasa (Finland). Diesel Technology

    1996-12-31

    Wood waste pyrolysis oil is an attractive fuel alternative for diesel engine operation. The main benefit is the sustainability of the fuel. No fossil reserves are consumed. The fact that wood waste pyrolysis oil does not contribute to CO{sub 2} emissions is of utmost importance. This means that power plants utilising pyrolysis oil do not cause additional global warming. Equally important is the reduced sulphur emissions that this fuel alternative implies. The sulphur content of pyrolysis oil is extremely low. The high water content and low heating value are also expected to result in very low NO{sub x} emissions. Utilisation of wood waste pyrolysis oil in diesel engines, however, involves a lot of challenges and problems to be solved. The low heating value requires a new injection system with high capacity. The corrosive characteristics of the fluid also underline the need for new injection equipment materials. Wood waste pyrolysis oil contains solid particles which can clog filters and cause abrasive wear. Wood waste pyrolysis oil has proven to have extremely bad ignition properties. The development of a reliable injection system which is able to cope with such a fuel involves a lot of optimisation tests, redesign and innovative solutions. Successful single-cylinder tests have already been performed and they have verified that diesel operation on wood pyrolysis oil is technically possible. (orig.)

  15. Improving the reliability of emergency diesel generators through sustained maintenance

    International Nuclear Information System (INIS)

    Reddy, R.

    2000-01-01

    In Nuclear Power Stations Emergency Diesel Generators are vital safety related equipment which ensures power supply to essential equipment during loss of power. In view of their importance Reliability of Diesel generators should be very high. Since these Diesel generators are standby equipment and operate only during demand or during surveillance checks, their demand failure probability should be very low and once they operate their operational availability should be very high. Madras Atomic Power Station at Kalpakkam, India consists two pressurised heavy water Reactors each rated at 220 MWe. To supply standby power each unit has two Diesel Generators of I 500 kW capacity each. The Diesel Engine is 16 cylinder 'V' type engine and is cranked by Air starting motor and is connected to generator whose rating at 100% load is 1500 KW. During commissioning and in the initial years of operation these Diesel Generators have encountered many problems. Major problem was Diesel Engine failing to start on demand. This was due to non engagement of air motor pinion with ring gear or continued engagement air motor even after the engine had picked up speed and failure of timer to initiate multiple starts after initial incomplete starts Apart from these there were problems like fuel oil leaks, high jacket water temperatures, low fuel oil pressure trips. Another major problem was with excitation system. How these problems were dealt with thereby reducing the demand failure probability and increasing the operational availability are discussed in this paper. (author)

  16. Bio diesel- the Clean, Green Fuel for Diesel Engines

    International Nuclear Information System (INIS)

    Elkareish, S.M.M.

    2004-01-01

    Natural, renewable resources such as vegetable oils, animal fats and recycled restaurant greases can be chemically transformed into clean burning bio diesel fuels (1). Just like petroleum diesel, bio diesel operates in combustion-ignition engines. Blends of up to 20% bio diesel (mixed with petroleum diesel fuels) can be used in nearly all diesel equipment and are compatible with most storage and distribution equipment. Using bio diesel in a conventional diesel engine substantially reduces emissions of unburned hydrocarbons, carbon monoxide, sulphates, polycyclic aromatic hydrocarbons, nitrated polycyclic aromatic hydrocarbons, and particulate matter. The use of bio diesel has grown dramatically during the last few years. Egypt has a promising experiment in promoting forestation by cultivation of Jatropha plant especially in luxor and many other sites of the country. The first production of the Egyptian Jatropha seeds oil is now under evaluation to produce a cost-competitive bio diesel fuel

  17. Dazzled by diesel? The impact on carbon dioxide emissions of the shift to diesels in Europe through 2009

    International Nuclear Information System (INIS)

    Schipper, Lee; Fulton, Lew

    2013-01-01

    This paper identifies trends in new gasoline and diesel passenger car characteristics in the European Union between 1995 and 2009. By 2009 diesels had captured over 55% of the new vehicle market. While the diesel version of a given car model may have as much as 35% lower fuel use/km and 25% lower CO 2 emissions than its gasoline equivalent, diesel buyers have chosen increasingly large and more powerful cars than the gasoline market. As a result, new diesels bought in 2009 had only 2% lower average CO 2 emissions than new gasoline cars, a smaller advantage than in 1995. A Laspeyres decomposition investigates which factors were important contributors to the observed emission reductions and which factors offset savings in other areas. More than 95% of the reduction in CO 2 emissions per km from new vehicles arose because both diesel and gasoline new vehicle emissions/km fell, and only 5% arose because of the shift from gasoline to diesel technology. Increases in vehicle mass and power for both gasoline and diesel absorbed much of the technological efficiency improvements offered by both technologies. We also observe changes in the gasoline and diesel fleets in eight EU countries and find changes in fuel and emissions intensities consistent with the changes in new vehicles reported. While diesel cars continue to be driven far farther than gasoline cars, we attribute only some of this difference to a “rebound effect”. We conclude that while diesel technology has permitted significant fuel savings, the switch from gasoline to diesel in the new vehicle market contributed little itself to the observed reductions in CO 2 emissions from new vehicles. - Highlights: ► By 2009 diesels had captured over 55% of the new car market in the EU. ► New diesels in 2009 emitted only 2% lower average CO 2 than new gasoline cars. ► Diesel cars continue to be driven farther than gasoline cars. ► Overall there has been little net CO 2 reduction from the switch to diesels in

  18. Dual-fuelling of a direct-injection automotive diesel engine by diesel and compressed natural gas

    International Nuclear Information System (INIS)

    Pirouzpanah, V.; Mohammadi Kosha, A.; Mosseibi, A.; Moshirabadi, J.; Gangi, A.; Moghadaspour, M.

    2000-01-01

    Application of Compressed Natural Gas in diesel engines has always been important, especially in the field of automotive engineering. This is due to easy accessibility, better mixing quality and good combustion characteristics of the Compressed Natural Gas fuel. In this study the application of Compressed Natural Gas fuel along with diesel oil in a heavy duty direct-injection automotive diesel engine is experimentally investigated. In order to convert a diesel engine into a diesel-gas one, the so called m ixed diesel-gas a pproach has been used and for this purpose a carbureted Compressed Natural Gas fuel system has been designed and manufactured. For controlling quantity of Compressed Natural Gas, the gas valve is linked to the diesel fuel injection system by means of a set of rods. Then, the dual-fuel system is adjusted so that, at full load conditions, the quantity of diesel fuel is reduced to 20% and 80% of its equivalent energy is substituted by Compressed Natural Gas fuel. Also injection pressure of pilot jet is increased by 11.4%. Performance and emission tests are conducted under variation of load and speed on both diesel and diesel-gas engines. Results show that, with equal power and torque, the diesel-gas engine has the potential to improve overall engine performance and emission. For example, at rated power and speed, fuel economy increases by 5.48%, the amount of smoke decreases by 78%, amount of CO decreases by 64.3% and mean exhaust gas temperature decreases by 6.4%

  19. Predicting emergency diesel starting performance

    International Nuclear Information System (INIS)

    DeBey, T.M.

    1989-01-01

    The US Department of Energy effort to extend the operational lives of commercial nuclear power plants has examined methods for predicting the performance of specific equipment. This effort focuses on performance prediction as a means for reducing equipment surveillance, maintenance, and outages. Realizing these goals will result in nuclear plants that are more reliable, have lower maintenance costs, and have longer lives. This paper describes a monitoring system that has been developed to predict starting performance in emergency diesels. A prototype system has been built and tested on an engine at Sandia National Laboratories. 2 refs

  20. Analysis of the market for diesel PEM fuel cell auxiliary power units onboard long-haul trucks and of its implications for the large-scale adoption of PEM FCs

    International Nuclear Information System (INIS)

    Contestabile, Marcello

    2010-01-01

    Proton exchange membrane fuel cells (PEM FCs) offer a promising alternative to internal combustion engines in road transport. During the last decade PEM FC research, development and demonstration (RD and D) activities have been steadily increasing worldwide, and targets have been set to begin their commercialisation in road transport by 2015-2020. However, there still is considerable uncertainty on whether these targets will actually be met. The picture is complex and market and technology issues are closely interlinked; investment in RD and D projects is essential but not sufficient; the development of suitable early markets is also necessary and policy is set to play an important role. Auxiliary power units (APUs) are generally regarded as one important early market for FCs in transport. This paper analyses the possible future market for diesel PEM FC APUs onboard long-haul trucks and its implications for the development of PEM FCs in general. The analysis, part of the project HyTRAN (EC Contract no. 502577), is aided by the use of a dynamic simulation model of technology and markets developed by the author. Results suggest that an interesting window of opportunity for diesel PEM FC APUs exists but this is subject to additional research particularly targeted at the rapid development of fuel processors.

  1. Performance of jatropha oil blends in a diesel engine

    Energy Technology Data Exchange (ETDEWEB)

    Forson, F.K.; Oduro, E.K.; Hammond-Donkoh, E. [Kwame Nkrumah University of Science and Technology, Kumasi (Ghana). Dept. of Mechanical Engineering

    2004-06-01

    Results are presented on tests on a single-cylinder direct-injection engine operating on diesel fuel, jatropha oil, and blends of diesel and jatropha oil in proportions of 97.4%/2.6%; 80%120%; and 50%150% by volume. The results covered a range of operating loads on the engine. Values are given for the chemical and physical properties of the fuels, brake specific fuel consumption, brake power, brake thermal efficiency, engine torque, and the concentrations of carbon monoxide, carbon dioxide and oxygen in the exhaust gases. Carbon dioxide emissions were similar for all fuels, the 97.4% diesel/2.6% jatropha fuel blend was observed to be the lower net contributor to the atmospheric level. The trend of carbon monoxide emissions was similar for the fuels but diesel fuel showed slightly lower emissions to the atmosphere. The test showed that jatropha oil could be conveniently used as a diesel substitute in a diesel engine. The test further showed increases in brake thermal efficiency, brake power and reduction of specific fuel consumption for jatropha oil and its blends with diesel generally, but the most significant conclusion from the study is that the 97.4% diesel/2.6% jatropha fuel blend produced maximum values of the brake power and brake thermal efficiency as well as minimum values of the specific fuel consumption. The 97.4%12.6% fuel blend yielded the highest cetane number and even better engine performance than the diesel fuel suggesting that jatropha oil can be used as an ignition- accelerator additive for diesel fuel. (author)

  2. Acoustic Emission Sensing for Maritime Diesel Engine Performance and Health

    Science.gov (United States)

    2016-05-01

    system does not provide direct current power to the preamplifier, equivalent pre-amplifiers with external power inputs were purchased , but the... behaviour of piston ring/cylinder liner interaction in diesel engines using acoustic emission. Tribology International 39 (12) 12 / 01 / 1634-1642...diesel engine using in-cylinder pressure and acoustic emission techniques. Dyanmics for Sustainable Engineering 1 454-463 26. Lowe, D. P., et al

  3. Soft start technique for diesel generator sets

    Energy Technology Data Exchange (ETDEWEB)

    Fredlund, Lars [Swedish State Power Board, Ringhals Nuclear Power Plant, S-430 22, Vaeroebacka (Sweden)

    1986-02-15

    A diesel motor in a nuclear power plant should be of a well-proven design. It is designed for long periods of trouble-free duty, but not for the frequent and rapid test starts called for by the technical specifications. In order to decrease the dynamic forces and thermal stresses, a soft-start scheme has been implemented. By limiting the fuel injection the diesel generator will reach full speed in appr. 30 seconds. The fuel limiter is a pneumatic cylinder which mechanically limits the travel of the terminal shaft of the governor. (author)

  4. Soft start technique for diesel generator sets

    International Nuclear Information System (INIS)

    Fredlund, Lars

    1986-01-01

    A diesel motor in a nuclear power plant should be of a well-proven design. It is designed for long periods of trouble-free duty, but not for the frequent and rapid test starts called for by the technical specifications. In order to decrease the dynamic forces and thermal stresses, a soft-start scheme has been implemented. By limiting the fuel injection the diesel generator will reach full speed in appr. 30 seconds. The fuel limiter is a pneumatic cylinder which mechanically limits the travel of the terminal shaft of the governor. (author)

  5. Diesel engine cogeneration plants in the context of integration of renewable energy sources in power supply; Dieselmotor-Kraft-Waerme-Kopplungsanlagen im Kontext der Integration Erneuerbarer Energien in die Energieversorgung

    Energy Technology Data Exchange (ETDEWEB)

    Sievers, John

    2010-10-29

    The aim of this thesis is to investigate and assess future options, potentials, strengths and weaknesses of cogeneration of heat and power. This is carried out against the background of global climate change and the integration of an increasing share of fluctuating renewable energies in power generation considering the necessity of guaranteeing a reliable, efficient, sustainable and cost effective power supply. It is assumed that the transition process to an entirely renewable energy-based electricity generation in Germany will considerably depend on the integration of wind energy because of its economic competitiveness, environmental friendliness and potential. However, power generation using wind energy fluctuates quite considerably. Diesel motors are here investigated as a decentralized integration instrument. Thanks to their great flexibility, high efficiency and relatively low nominal capacity, they perfectly meet the requirements for the simultaneous decentralized use of heat. Boundary conditions of Diesel motor combined heat and power plants (CHP) are analyzed and described in this work, different models for wind energy integration are elaborated, and these models are used for several variations to simulate the balance of wind energy by cogeneration. In this context, environmental impacts are discussed. Common assessment methods on environmental impacts of CHP distort the results. The so-called output method is developed and described, by which the final assessment of environmental impacts is not implicitly mixed - as is commonly the case - with the calculation of environmental impacts. This output method is used to compare CHP generation with other energy conversion processes within the context of power generation including insulation of buildings, the use of different fuels and different applications for cogeneration. This work clearly demonstrates that while bio fuel resources can be optimally used for power generation, cogenerated electricity could also

  6. The all new BMW top diesel engines; Die neuen Diesel Spitzenmotorisierungen von BMW

    Energy Technology Data Exchange (ETDEWEB)

    Ardey, N.; Wichtl, R.; Steinmayr, T.; Kaufmann, M.; Hiemesch, D.; Stuetz, W. [BMW Motoren GmbH, Steyr (Austria)

    2012-11-01

    From the very beginning, diesel drivetrains have been important components of the BMW EfficientDynamics strategy. High levels of driving dynamics in combination with attractive fuel consumption have become features of a wide range of models. With the introduction of 2-stage turbocharging for passenger car diesel engines in 2004, BMW was able to significantly enhance the power density without increasing the number of cylinders or the cylinder capacity. In the meantime, the BMW TwinPower Turbo diesel engine variants achieve a rated power of up to 160 kW on the 2.0-litre 4-cylinder engine and 230 kW on the 3.0-litre 6-cylinder engine. In order to extend the leading position in the premium segment, a new BMW TwinPower Turbo variant has been developed. The major objectives were to achieve a range of power output, torque and comfort at least at the level of 8-cylinder competitors, but at the same time equal the lower fuel consumption and power/weight ratio that is typical for existing BMW 6-cylinder diesel engines. The new engine will be used for the first time in the emphatically sports-oriented BMW M Performance Automobiles (MPA) of the X5/X6 and 5 Series. The charging and injection technology as well as capability of high cylinder pressures in the core engine are key technologies for the enhancement of performance. The new BMW TwinPower Turbo diesel drivetrain is based on the main dimensions of the existing 3.0-litre 6-cylinder inline diesel engines. The core element of the new engine is a 2-stage turbocharging system, consisting of 3 exhaust turbochargers. A common rail injection system with a system pressure up to 2200 bar is deployed for the first time. The drive unit has been configured for a maximum cylinder pressure of 200 bar, an innovative feature is the aluminium crankcase with its screwed tension anchor connection. The cooling system contains an indirect 2-stage intercooler. The exhaust system of the new BMW diesel engine in the 5 Series is equipped as

  7. Feasibility study for power generation using off- grid energy system from micro hydro-PV-diesel generator-battery for rural area of Ethiopia: The case of Melkey Hera village, Western Ethiopia

    Directory of Open Access Journals (Sweden)

    Tilahun Nigussie

    2017-07-01

    Full Text Available Electricity supply in Ethiopia is extremely antiquated. Most of the remote rural areas of Ethiopia are not yet electrified. Electrifying these remote areas by extending grid system is difficult and costly. Melkey Hera village is one of a rural community situated in western Ethiopia. In this village, extension of the grid is not yet practical. As the current international trend in rural electrification is to utilize renewable energy resources; solar, wind, biomass, and micro hydro power systems can be seen as alternatives. Therefore, the target of this paper is to investigate the viability of a micro hydro, Photo Voltaic (PV and Diesel Generator-battery hybrid power system options to come up with the best techno-economic and optimum configuration for supplying electricity to this village. The study was performed by an assessment of the predicted village energy demand, the available renewable energy resources, and then using the software called HOMER. The best hybrid system type was described and the optimization of the system configuration was also done. Furthermore, through the simulation of different configuration of the supply system, the optimal mini-grid hybrid system design was established to combine hydro, solar PV, battery energy storage and diesel generator. This system demonstrated to be more reliable in operation, and the most cost-effective for the required level of service. The role of energy storage in system operation also demonstrated to offer additional operational advantages in-terms of reliability and cost savings. Overall, the design results show that the majority of energy obtained from hydropower, which accounts 79%, the PV module covers 20%, and diesel generator is only 1% of the total load consumption. The obtained hybrid system is cost competitive with $\\$$0.133/kWh, which is somewhat good to satisfy the community needs. However, this is more than current energy price in Ethiopia which $\\$$0.06/kWh. If due-merit given

  8. Radium in diesel oil

    International Nuclear Information System (INIS)

    Kulich, J.

    1977-05-01

    In order to determine the addition of radon and radium to the air in mines, originatiny from the combustion of petroleum, measurements of the content of radium in diesel oil have been performed. Knowing the radium content theradon content can easily be calculated. The procedures used for the chemical analysis of radium is desribed. The ash remaining after combustion of the diesel oil is soluted in water and radium is precipiated as sulphate. The radium is detected by a ZnS (Ag) detector. The diesel oils from different petroleum companies contained between o.019-0.5pCi radium - 226. The conclution is that the consumption of diesel oils in motors used in mines does not contribute to the radium - 226 content at the air move than permissible according to norms.(K.K.)

  9. Screw expander for light duty diesel engines

    Science.gov (United States)

    1983-01-01

    Preliminary selection and sizing of a positive displacement screw compressor-expander subsystem for a light-duty adiabatic diesel engine; development of a mathematical model to describe overall efficiencies for the screw compressor and expander; simulation of operation to establish overall efficiency for a range of design parameters and at given engine operating points; simulation to establish potential net power output at light-duty diesel operating points; analytical determination of mass moments of inertia for the rotors and inertia of the compressor-expander subsystem; and preparation of engineering layout drawings of the compressor and expander are discussed. As a result of this work, it was concluded that the screw compressor and expander designed for light-duty diesel engine applications are viable alternatives to turbo-compound systems, with acceptable efficiencies for both units, and only a moderate effect on the transient response.

  10. An Experimental Investigation of Ethanol-Diesel Blends on Performance and Exhaust Emissions of Diesel Engines

    Directory of Open Access Journals (Sweden)

    Tarkan Sandalcı

    2014-08-01

    Full Text Available Ethanol is a promising alternative fuel, due to its renewable biobased origin. Also, it has lower carbon content than diesel fuel and it is oxygenated. For this reason, ethanol is providing remarkable potential to reduce particulate emulsions in compression-ignition engines. In this study, performance of ethanol-diesel blends has been investigated experimentally. Tested fuels were mineral diesel fuel (E0D100, 15% (v/v ethanol/diesel fuel blend (E15D85, and 30% (v/v ethanol/diesel fuel blend (E30D70. Firstly, the solubility of ethanol and diesel was experienced. Engine tests were carried out to reveal the performance and emissions of the engine fuelled with the blends. Full load operating conditions at various engine speeds were investigated. Engine brake torque, brake power, brake specific fuel consumption, brake thermal efficiency, exhaust gas temperature, and finally exhaust emissions were measured. Performance of the tested engine decreased substantially while improvement on smoke and gaseous emissions makes ethanol blend favorable.

  11. Utilization of diesel fuel, anhydrous ethanol and additives blend of a stationary diesel engine with rotatory pump; Utilizacao de mistura ternaria alcool, diesel e aditivo em motores do ciclo diesel com bomba de injecao rotativa

    Energy Technology Data Exchange (ETDEWEB)

    Reyes Cruz, Yordanka; Cavado Osorio, Alberto [Centro de Pesquisas de Petroleo (CEINPET), Havana (Cuba); Belchior, Carlos Rodrigues Pereira; Pereira, Pedro P.; Pinto, Nauberto Rodrigues [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Centro de Tecnologia. Dept. de Engenharia Naval e Mecanica; Aranda, Donato A. Gomes [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Escola de Quimica

    2008-07-01

    In this paper is analyzed the performance and fuel consumption of a stationary Diesel engine, with rotary diesel fuel injection pump, using (diesel fuel + anhydrous ethanol + 0.5% additive) blend. The engine performance parameters and fuel consumption tests were performed at the Termic Machine Laboratory, located in Federal University of Rio de Janeiro, and evaluated using a MWM Series 10 model 4.10 TCA. Two test cycles were used for this test program: the tests were carried out starting from the base diesel S-500, used as a reference; the engine operated with (diesel fuel S-500 - 8% anhydrous ethanol - DIOLEFECT additive (0,5% SPAN80 + 0,1% Biomix-D)) blend. The results indicate that: the reduction levels in power and torque of engine are approximately the same which is (2,55{+-}2%), the brake specific fuel consumption increased in 1,8%. (author)

  12. The diesel challenge

    International Nuclear Information System (INIS)

    Tobin, Geoff

    1997-01-01

    This article is focused on the challenges being faced by the diesel producer and these include a number of interesting developments which illustrate the highly competitive world of the European refiner. These include: The tightening quality requirements being legislated coupled with the availability of the ''city diesel'' from Scandinavia and elsewhere which is already being sold into the market. For a time there will be a clear means of product differentiation. One of the key questions is whether the consumer will value the quality difference; a growing demand for diesel which is outstripping the growth in gasoline demand and causing refiners headaches when it comes to balancing their supply/demand barrels; the emergence of alternative fuels which are challenging the traditional markets of the refiner and in particular, the niche markets for the higher quality diesel fuels. All of this at a time of poor margins and over-capacity in the industry with further major challenges ahead such as fuel oil disposal, tighter environmental standards and the likelihood of heavier, higher sulphur crude oils in the future. Clearly, in such a difficult and highly-competitive business environment it will be important to find low-cost solutions to the challenges of the diesel quality changes. An innovative approach will be required to identify the cheapest and best route to enable the manufacture of the new quality diesel. (Author)

  13. A techno-economic evaluation of two non-edible vegetable oil based bio diesel in Pakistan

    International Nuclear Information System (INIS)

    Chakrabarti, M.H.; Ali, M.

    2010-01-01

    Technical evaluation of Bio diesel, produced from various non-edible oils, was carried out on the basis of emission profile, torque, engine brake power and exhaust temperatures at 10% blend ratio (by volume) with mineral diesel. The performance of engine parameters showed that the castor oil based bio diesel gave the best results. Economic feasibility for bio diesel production was carried out based on available data on cultivation of necessary plants on marginal lands. This economic analysis also included the value of by-products which would be available during the chemical process for the production of bio diesel. It was found that jatropha bio diesel could be produced at a comparable cost to mineral diesel, however, castor bio diesel required substantial subsidies or mass cultivation of plants on marginal lands to enable it to compete economically with mineral diesel. (author)

  14. An example of a diesel generator model with fluctuating engine torque for transient analysis using XTAP

    Directory of Open Access Journals (Sweden)

    Orie Sakamoto

    2016-01-01

    Full Text Available In remote site power systems with small diesel generators, weak distribution feeders with diesel generators may suffer from voltage and power fluctuations due to misfiring of the engine cylinder. An electromagnetic transient (EMT program named XTAP is considered to be useful to analyze these phenomena. In this study, a new diesel generator model with example fluctuating engine torque has been developed using XTAP for analyses of small power systems with those diesel engines. The configuration and verification results of the developed model are presented in the paper.

  15. Diesel fuel stability; Estabilidade de oleo diesel

    Energy Technology Data Exchange (ETDEWEB)

    Alves, Marcelo V.; Pinto, Ricardo R.C. [PETROBRAS S.A., Rio de Janeiro, RJ (Brazil); Zotin, Fatima M.Z. [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil)

    2008-07-01

    The demand for the reduction of the pollutants emissions by diesel engines has led to the adoption of more advanced injection systems and concern about fuel stability. The degradation of the diesel fuel can happen during storage and distribution, according to the acid-catalysed condensation of aromatic compounds such phenalenones and indolic nitrogenated heterocyclic compounds. These precursors appear in several streams used in diesel fuel formulation. In this study the sediment formation in model and real, aromatic and paraffinic fuels, containing such precursors naturally or by addition was analysed. The fuels were submitted to accelerated (16 hours at 90 deg C) and long term (13 weeks at 43 deg C) storage stability tests. The model fuels responded positively to the storage stability tests with formation of sediments, concluding that these methods can be considered adequate to verify the occurrence of the studied degradation process. The real fuels response was even more due to their chemical complexity, composition and impurities. The formation of sediments showed to be affected by the hydrocarbon distribution of the fuels. (author)

  16. K20E, an oxidative-coupling compound of methyl caffeate, exhibits anti-angiogenic activities through down-regulations of VEGF and VEGF receptor-2

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Chun-Hsu [Department of Pharmacy, Taipei Medical University, Taipei 11031, Taiwan (China); Lin, Wen-Hsin; Chien, Yi-Chung; Liu, Fon-Chang; Sheu, Ming-Jyh [School of Pharmacy, China Medical University, Taichung 40402, Taiwan (China); Kuo, Yueh-Hsiung, E-mail: kuoyh@mail.cmu.edu.tw [Tsuzuki Institute for Traditional Medicine, China Medical University, Taichung 40402, Taiwan (China); Department of Chinese Pharmaceutical Sciences and Chinese Medicine Resources, China Medical University, Taichung 40402, Taiwan (China); Department of Biotechnology, Asia University, Taichung 41354, Taiwan (China); Wu, Chieh-Hsi, E-mail: chhswu@tmu.edu.tw [Department of Pharmacy, Taipei Medical University, Taipei 11031, Taiwan (China); School of Pharmacy, China Medical University, Taichung 40402, Taiwan (China); Department of Biological Science and Technology, China Medical University, Taichung 40402, Taiwan (China)

    2015-01-15

    Anti-angiogenesis is one of the most popular clinical interventions for cancer chemotherapy. A series of synthesized derivative of methyl caffeate were used to evaluate the anti-angiogenic activity and to investigate possible pharmacological mechanisms in the present study. The most potent anti-angiogenic compound was evaluated in the experiments of murine allograft tumor model and Matrigel plug assay as well as cell models in the human umbilical vascular endothelial cells (HUVECs) and the LLC1 lung cancer cells. Our results suggested that K20E suppressed the tumor growth in the allograft tumor model and exhibited anti-angiogenic activity in Matrigel plug assay. Besides, HUVEC viability was found to be significantly reduced by arresting cell cycle at G{sub 2}/M phase and apoptosis. Cell migration, invasion, and tube formation of the HUVECs were also markedly suppressed by K20E treatment. K20E largely down-regulated the intracellular and secreted vascular endothelial growth factor (VEGF) in the LLC1 cancer cells. Besides, VEGF receptor-2 (VEGFR-2) and its downstream signaling cascades (AKT-mTOR and MEK1/2-ERK1/2) as well as gelatinases were all evidently reduced in the HUVECs treated with K20E. Inversely, K20E can up-regulate the expression levels of p53 and p21 proteins in the HUVECs. Based on these results, our study suggested that K20E possessed inhibiting angiogenesis through regulation of VEGF/VEGFR-2 and its downstream signaling cascades in the vascular endothelial cells (VECs). - Highlights: • K20E is an oxidative-coupling compound of methyl caffeate. • K20E exhibits anti-tumor and anti-angiogenesis effects. • K20E suppresses the expressions of VEGF and VEGF receptor-2 (VEGFR-2) proteins. • K20E deactivates VEGFR-2-mediated downstream signaling pathways to inhibit angiogenesis. • K20E up-regulates p53-p21 pathway to induce apoptosis and cell arrest at G2/M phase.

  17. CNG/diesel buses for Texas school districts

    International Nuclear Information System (INIS)

    Armstrong, J.H.

    1993-01-01

    At the present time, the preponderance of trucks, buses and other heavy duty vehicles are powered by diesel engines. The reasons for the change from gasoline to diesel engines are all basically economic, due to the longer life and lower operating costs of diesel engines, as compared to gasoline engines. This provides a compelling reason to continue to use these engines, even if powered by fuel other than diesel. A major strategy within the industry has been the various attempts to adapt diesel engines to alternative fuels. These conversions have been largely to either methanol or natural gas, with propane joining the race just recently. This strategy takes advantage of the remaining life of existing vehicles by converting engines rather than purchasing a new engine (and/or vehicle) designed for and dedicated to an alternate fuel. Although diesel engines have been converted to run on natural gas, there are substantial challenges that must be met. The following describes some of the technical approaches being used for diesel engine conversions

  18. Identification of the Genes Involved in the Biofilm-like Structures on Actinomyces oris K20, a Clinical Isolate from an Apical Lesion

    Science.gov (United States)

    2013-01-01

    bacteria in clinically asymptomatic periapical pathosis. J Endod 1990;16:534–8. 5. Nair PNR. On the causes of persistent apical periodontitis : a review...Identification of the Genes Involved in the Biofilm-like Structures on Actinomyces oris K20, a Clinical Isolate from an Apical Lesion Chiho Mashimo...Actinomyces oris K20. (J Endod 2013;39:44–48) Key Words Actinomyces oris, apical abscess, biofilm, polysac- charide deacetylase, transposon mutagenesis

  19. Both H4K20 mono-methylation and H3K56 acetylation mark transcription-dependent histone turnover in fission yeast

    International Nuclear Information System (INIS)

    Yang, Hanna; Kwon, Chang Seob; Choi, Yoonjung; Lee, Daeyoup

    2016-01-01

    Nucleosome dynamics facilitated by histone turnover is required for transcription as well as DNA replication and repair. Histone turnover is often associated with various histone modifications such as H3K56 acetylation (H3K56Ac), H3K36 methylation (H3K36me), and H4K20 methylation (H4K20me). In order to correlate histone modifications and transcription-dependent histone turnover, we performed genome wide analyses for euchromatic regions in G2/M-arrested fission yeast. The results show that transcription-dependent histone turnover at 5′ promoter and 3′ termination regions is directly correlated with the occurrence of H3K56Ac and H4K20 mono-methylation (H4K20me1) in actively transcribed genes. Furthermore, the increase of H3K56Ac and H4K20me1 and antisense RNA production was observed in the absence of the histone H3K36 methyltransferase Set2 and histone deacetylase complex (HDAC) that are involved in the suppression of histone turnover within the coding regions. These results together indicate that H4K20me1 as well as H3K56Ac are bona fide marks for transcription-dependent histone turnover in fission yeast.

  20. PR-Set7 and H4K20me1: at the crossroads of genome integrity, cell cycle, chromosome condensation, and transcription

    Science.gov (United States)

    Beck, David B.; Oda, Hisanobu; Shen, Steven S.; Reinberg, Danny

    2012-01-01

    Histone post-translational modifications impact many aspects of chromatin and nuclear function. Histone H4 Lys 20 methylation (H4K20me) has been implicated in regulating diverse processes ranging from the DNA damage response, mitotic condensation, and DNA replication to gene regulation. PR-Set7/Set8/KMT5a is the sole enzyme that catalyzes monomethylation of H4K20 (H4K20me1). It is required for maintenance of all levels of H4K20me, and, importantly, loss of PR-Set7 is catastrophic for the earliest stages of mouse embryonic development. These findings have placed PR-Set7, H4K20me, and proteins that recognize this modification as central nodes of many important pathways. In this review, we discuss the mechanisms required for regulation of PR-Set7 and H4K20me1 levels and attempt to unravel the many functions attributed to these proteins. PMID:22345514

  1. Both H4K20 mono-methylation and H3K56 acetylation mark transcription-dependent histone turnover in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Hanna [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Kwon, Chang Seob [Department of Chemistry and Biology, Korea Science Academy of KAIST, Busan, 614-822 (Korea, Republic of); Choi, Yoonjung, E-mail: jjungii@kaist.ac.kr [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Lee, Daeyoup, E-mail: daeyoup@kaist.ac.kr [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of)

    2016-08-05

    Nucleosome dynamics facilitated by histone turnover is required for transcription as well as DNA replication and repair. Histone turnover is often associated with various histone modifications such as H3K56 acetylation (H3K56Ac), H3K36 methylation (H3K36me), and H4K20 methylation (H4K20me). In order to correlate histone modifications and transcription-dependent histone turnover, we performed genome wide analyses for euchromatic regions in G2/M-arrested fission yeast. The results show that transcription-dependent histone turnover at 5′ promoter and 3′ termination regions is directly correlated with the occurrence of H3K56Ac and H4K20 mono-methylation (H4K20me1) in actively transcribed genes. Furthermore, the increase of H3K56Ac and H4K20me1 and antisense RNA production was observed in the absence of the histone H3K36 methyltransferase Set2 and histone deacetylase complex (HDAC) that are involved in the suppression of histone turnover within the coding regions. These results together indicate that H4K20me1 as well as H3K56Ac are bona fide marks for transcription-dependent histone turnover in fission yeast.

  2. CRL research reactor diesel generator reliability study 1960 - 1992

    International Nuclear Information System (INIS)

    Winfield, D.J.; McCauley, G.M.

    1994-07-01

    A data base has been provided for the Chalk River Laboratories (CRL) research reactor diesel generator reliability, for use in risk assessment studies of CRL research reactors. Data from 1960 to end of 1992 have been collected, representing 358 diesel generator years of experience. The data is used to provide failure-to-start probabilities and failure-to-run rates. Data is also classified according to subsystem failures, multiple failures and common cause failures. Comparisons with other recent studies of nuclear power plant diesel generator reliability have been made. This revision updates the 1989 September report. (author). 14 refs., 13 tabs., 10 figs

  3. CRNL research reactor diesel generator reliability study 1960-1985

    International Nuclear Information System (INIS)

    Winfield, D.J.

    1989-09-01

    A data base has been provided for the CRNL research reactor diesel generator reliability, for use in risk assessment studies of CRNL research reactors. Data from 1960 to the present have been collected, representing 281 diesel generator years of experience. The data is used to provide failure-to-start probabilities and failure-to-run rates. Data is also classified according to subsystem failures, multiple failures and common cause failures. Comparisons with other recent studies of nuclear power plant diesel generator reliability have been made

  4. Ground tests of 120 kW(heat) biomass fired gasifier diesel installation

    Energy Technology Data Exchange (ETDEWEB)

    Zyssin, L.V.; Maronet, I.J.; Morshin, V.N. [Energotechnology Ltd., St. Petersburg (Russian Federation)

    1996-12-31

    For the 1 MW and less power range diesel gasifier power plants could be considered as one of the main energy sources. The brief information about works carried out in Russia according to this direction is presented. Data of preliminary tests for gas diesel installations are presented. (orig.)

  5. Ground tests of 120 kW(heat) biomass fired gasifier diesel installation

    Energy Technology Data Exchange (ETDEWEB)

    Zyssin, L V; Maronet, I J; Morshin, V N [Energotechnology Ltd., St. Petersburg (Russian Federation)

    1997-12-31

    For the 1 MW and less power range diesel gasifier power plants could be considered as one of the main energy sources. The brief information about works carried out in Russia according to this direction is presented. Data of preliminary tests for gas diesel installations are presented. (orig.)

  6. Fueling diesel engines with methyl-ester soybean oil

    International Nuclear Information System (INIS)

    Schumacher, L.G.; Hires, W.G.; Borgelt, S.C.

    1993-01-01

    Two 5.9 liter Cummins engines were fueled for a combined total of more than 80,467 km (50,000 miles). One truck, a 1991 Dodge, has been driven approximately 48,280 km (30,000 miles). The other, a 1992 Dodge, has been driven approximately 32,187 km (20,000 miles). Fueling these engines with soydiesel increase engine power by 3 percent (1991 engine) and reduced power by 6 percent (1992 engine). The pickups averaged more than 7.1 km/L (16.7 mpg). Analysis of used engine oil samples indicated that the engines were wearing at normal rate. The black exhaust smoke normally observed when a diesel engine accelerates was reduced as much as 86 percent when the diesel engine was fueled with 100% soydiesel. Increased EPA exhaust emissions requirements for diesel engines have created much interest in the use of soydiesel as fuel for diesel engines

  7. Design and approval of EPS diesel systems in German NPP

    Energy Technology Data Exchange (ETDEWEB)

    Kollmer, A.A., E-mail: anton.kollmer@tuev-sued.de [TUV SUD Industrie Service GmbH, Munich (Germany)

    2014-07-01

    Not at least because of 'Fukushima accident', Emergency power supply (EPS) systems with diesel engines are regarded as higher safety-important as 20 years ago. This presentation shows the design and approval of the emergency power facilities of the German nuclear power plants. It deals with the essential details e. g.: EPS Diesel integration to main power grid of the German BWR and PWR; Procedure for 'Loss of off-site power (LOOP)-Design'; Design robustness of AC Power Supply (Design requirements: independent redundancies, airplane crash, explosion pressure wave, earth-quake); Cooling systems (chilled by river water, air, well water, stored water volume); Layout of the stationary emergency Diesel generator (fuel supply, starting system); Layout of the bunkered EDG with directly driven emergency feed water pump; Robustness of AC power supply beyond design; Layout of mobile chilling equipment for diesel engines; Layout of mobile Diesel gen-sets (200 kVA and 1250 kVA); German Requirements of KTA 3702 versus US-IEE 323; Construction, Materials and Testing of EDG; Maintenance (in-service inspections, operation, Repair); Lessons learned (e. g. crank house cracks, start failure due to too much oil in the combustion chamber) (author)

  8. Pneumatic hybridization of a diesel engine using compressed air storage for wind-diesel energy generation

    International Nuclear Information System (INIS)

    Basbous, Tammam; Younes, Rafic; Ilinca, Adrian; Perron, Jean

    2012-01-01

    In this paper, we are studying an innovative solution to reduce fuel consumption and production cost for electricity production by Diesel generators. The solution is particularly suitable for remote areas where the cost of energy is very high not only because of inherent cost of technology but also due to transportation costs. It has significant environmental benefits as the use of fossil fuels for electricity generation is a significant source of GHG (Greenhouse Gas) emissions. The use of hybrid systems that combine renewable sources, especially wind, and Diesel generators, reduces fuel consumption and operation cost and has environmental benefits. Adding a storage element to the hybrid system increases the penetration level of the renewable sources, that is the percentage of renewable energy in the overall production, and further improves fuel savings. In a previous work, we demonstrated that CAES (Compressed Air Energy Storage) has numerous advantages for hybrid wind-diesel systems due to its low cost, high power density and reliability. The pneumatic hybridization of the Diesel engine consists to introduce the CAES through the admission valve. We have proven that we can improve the combustion efficiency and therefore the fuel consumption by optimizing Air/Fuel ratio thanks to the CAES assistance. As a continuation of these previous analyses, we studied the effect of the intake pressure and temperature and the exhaust pressure on the thermodynamic cycle of the diesel engine and determined the values of these parameters that will optimize fuel consumption. -- Highlights: ► Fuel economy analysis of a simple pneumatic hybridization of the Diesel engine using stored compressed air. ► Thermodynamic analysis of the pneumatic hybridization of diesel engines for hybrid wind-diesel energy systems. ► Analysis of intake pressure and temperature of compressed air and exhaust pressure on pressure/temperature during Diesel thermodynamic cycle. ► Direct admission of

  9. Diesel generator fire protection: getting the balance right

    International Nuclear Information System (INIS)

    Enzmann, Hans; Swiss Reinsurance Co., Zurich)

    1986-01-01

    A wide range of different approaches to the fire protection of diesel generators can be found in nuclear power plants around the world. In some cases there is too little protection. In others there is far too much, such that fire prevention has been overemphasised at the expense of diesel generator operability and overall nuclear safety. A risk assessment check list developed in Switzerland could help to achieve the right balance. (author)

  10. Analysis of a diesel-electric hybrid urban bus system

    Science.gov (United States)

    Marr, W. W.; Sekar, R. R.; Ahlheim, M. C.

    A hybrid bus powered by a diesel engine and a battery pack was analyzed over an idealized bus-driving cycle in Chicago. Three hybrid configurations, two parallel and one series, were evaluated. The results indicate that the fuel economy of a hybrid bus, taking into account the regenerative braking, is comparable with that of a conventional diesel bus. Life-cycle costs are slightly higher because of the added weight and cost of the battery.

  11. Diesel reformulation using bio-derived propanol to control toxic emissions from a light-duty agricultural diesel engine.

    Science.gov (United States)

    Thillainayagam, Muthukkumar; Venkatesan, Krishnamoorthy; Dipak, Rana; Subramani, Saravanan; Sethuramasamyraja, Balaji; Babu, Rajesh Kumar

    2017-07-01

    In the Indian agricultural sector, millions of diesel-driven pump-sets were used for irrigation purposes. These engines produce carcinogenic diesel particulates, toxic nitrogen oxides (NOx), and carbon monoxide (CO) emissions which threaten the livelihood of large population of farmers in India. The present study investigates the use of n-propanol, a less-explored high carbon bio-alcohol that can be produced by sustainable pathways from industrial and crop wastes that has an attractive opportunity for powering stationary diesel engines meant for irrigation and rural electrification. This study evaluates the use of n-propanol addition in fossil diesel by up to 30% by vol. and concurrently reports the effects of exhaust gas recirculation (EGR) on emissions of an agricultural DI diesel engine. Three blends PR10, PR20, and PR30 were prepared by mixing 10, 20, and 30% by vol. of n-propanol with fossil diesel. Results when compared to baseline diesel case indicated that smoke density reduced with increasing n-propanol fraction in the blends. PR10, PR20, and PR30 reduced smoke density by 13.33, 33.33, and 60%, respectively. NOx emissions increased with increasing n-propanol fraction in the blends. Later, three EGR rates (10, 20, and 30%) were employed. At any particular EGR rate, smoke density remained lower with increasing n-propanol content in the blends under increasing EGR rates. NOx reduced gradually with EGR. At 30% EGR, the blends PR10, PR20, and PR30 reduced NOx emissions by 43.04, 37.98, and 34.86%, respectively when compared to baseline diesel. CO emissions remained low but hydrocarbon (HC) emissions were high for n-propanol/diesel blends under EGR. Study confirmed that n-propanol could be used by up to 30% by vol. with diesel and the blends delivered lower soot density, NOx, and CO emissions under EGR.

  12. Diesel conservation: GSRTC'S experience

    Energy Technology Data Exchange (ETDEWEB)

    Ramesh Kumar, I V

    1980-01-01

    The Gujarat State Road Transport Corporation (GSRTC) in India has a fleet of about 6000 buses. The increasing cost of fuel and lubricants added to uncertainty in supplies, has necessitated the need for conserving High Speed Diesel Oil (HSD). GSRTC had achieved an overall average Kilometre Per Litre (kmpl) of 4.44 in the year 1976-1977 due to a variety of measures. In the year 1978-1979 the average kmpl was 4.52 and it is expected to be 4.60 for 1979-1980. The case study outlined describes the measures taken by GSRTC in conserving high speed diesel oil by various methods.

  13. Reducing emissions from diesel combustion

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper contains information dealing with engine design to reduce emissions and improve or maintain fuel economy. Topics include: Observation of High Pressure Fuel Spray with Laser Light Sheet Method; Determination of Engine Cylinder Pressures from Crankshaft Speed Fluctuations; Combustion Similarity for Different Size Diesel Engines: Theoretical Prediction and Experimental Results; Prediction of Diesel Engine Particulate Emission During Transient Cycles; Characteristics and Combustibility of Particulate Matter; Dual-Fuel Diesel Engine Using Butane; Measurement of Flame Temperature Distribution in D.I. Diesel Engine with High Pressure Fuel Injection: and Combustion in a Small DI Diesel Engine at Starting

  14. Diesel exhaust controls and aftertreatment

    Energy Technology Data Exchange (ETDEWEB)

    Rubeli, B. [Natural Resources Canada, Sudbury, ON (Canada). CANMET Mining and Mineral Sciences Laboratories

    2009-07-01

    This presentation discussed the safe use of diesel fuels in underground mines, with particular reference to advanced technology engines and system technology options for mines. The use of diesel fuels underground requires well designed diesel engines with an effective preventive maintenance programs utilizing diesel emissions testing. The mines must have a well-engineered ventilation system and an adequate air quality monitoring system. An outline of diesel pollutant formation was included in the presentation. Diesel emission control technologies can address localized air quality problems and control emissions at the source. This presentation summarized the best available diesel emission control technologies for underground mines, namely diesel oxidation catalysts (DOC); diesel particulate filters (DPF); active diesel particulate filters (A-DPF); selective catalytic reduction (SCR); water scrubbers; and fume diluters. An emissions control plan using aftertreatment technology should target the vehicles that are the biggest contributors to diesel exhaust. Low sulphur fuel is a prerequisite for most emission control technologies. The successful control of emissions requires knowledge of the high emitting vehicle groups; an integrated ventilation and emission control technology application plan; ambient and tailpipe emissions testing; and training of operators and mechanics. tabs., figs.

  15. Development of condition monitoring and diagnosis system for standby diesel generator

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kwang Hee; Park, Jong Hyuck; Park, Jong Eun [Korea Electric Power Research Institute, Daejeon (Korea, Republic of)

    2009-05-15

    The emergency diesel generator (EDG) of the nuclear power plant is designed to supply the power to the nuclear on Station Black Out (SBO) condition. The operation reliability of onsite emergency diesel generator should be ensured by a condition monitoring system designed to monitor and analysis the condition of diesel generator. For this purpose, we have developed the online condition monitoring and diagnosis system for the wolsong unit 3 and 4 standby diesel generator including diesel engine performance. In this paper, technologies of condition monitoring and diagnosis system (SDG MDS) for the wolsong standby diesel generator are described. By using the condition monitoring module of the SDG MDS, performance monitoring function for major operating parameters of EDG reliability program required by Reg. guide 1.155 can be operated as on line monitoring system.

  16. Development of condition monitoring and diagnosis system for standby diesel generator

    International Nuclear Information System (INIS)

    Choi, Kwang Hee; Park, Jong Hyuck; Park, Jong Eun

    2009-01-01

    The emergency diesel generator (EDG) of the nuclear power plant is designed to supply the power to the nuclear on Station Black Out (SBO) condition. The operation reliability of onsite emergency diesel generator should be ensured by a condition monitoring system designed to monitor and analysis the condition of diesel generator. For this purpose, we have developed the online condition monitoring and diagnosis system for the wolsong unit 3 and 4 standby diesel generator including diesel engine performance. In this paper, technologies of condition monitoring and diagnosis system (SDG MDS) for the wolsong standby diesel generator are described. By using the condition monitoring module of the SDG MDS, performance monitoring function for major operating parameters of EDG reliability program required by Reg. guide 1.155 can be operated as on line monitoring system

  17. Market penetration of large wind/diesel systems

    International Nuclear Information System (INIS)

    Kronborg, T.

    1992-01-01

    Burmeister ampersand Wain is developing a large size wind/diesel package in collaboration with Micon, the Danish wind turbine manufacturer, and the Danish utility NESA. The package comprises an initial calculation of the technical feasibility and the economic viability of an actual project, installing the optimum number of large wind turbines, and service, operation, and maintenance as needed. The concept should be seen as an addition to existing diesel-based power stations. Wind turbines are especially advantageous in smaller diesel-based electrical systems in the 1-20 MW range because such systems can have high fuel costs and expensive maintenance. Analysis of the market for the wind/diesel concept indicates islands and remote areas with limited population are likely candidates for implementation of wind/diesel systems. An example of an economic analysis of a wind/diesel application on an isolated island is presented, showing the cost savings possible. To obtain practical experience and to demonstrate the wind/diesel concept, a MW-size demonstration plant is being constructed in Denmark

  18. LPG diesel dual fuel engine – A critical review

    Directory of Open Access Journals (Sweden)

    B. Ashok

    2015-06-01

    Full Text Available The engine, which uses both conventional diesel fuel and LPG fuel, is referred to as ‘LPG–diesel dual fuel engines’. LPG dual fuel engines are modified diesel engines which use primary fuel as LPG and secondary fuel as diesel. LPG dual fuel engines have a good thermal efficiency at high output but the performance is less during part load conditions due to the poor utilization of charges. This problem can be overcome by varying factors such as pilot fuel quantity, injection timing, composition of the gaseous fuel and intake charge conditions, for improving the performance, combustion and emissions of dual fuel engines. This article reviews about the research work done by the researchers in order to improve the performance, combustion and emission parameters of a LPG–diesel dual fuel engines. From the studies it is shown that the use of LPG in diesel engine is one of the capable methods to reduce the PM and NOx emissions but at same time at part load condition there is a drop in efficiency and power output with respect to diesel operation.

  19. Occupational exposure to diesel exhaust fumes

    International Nuclear Information System (INIS)

    Wheatley, A. D.; Sadhra, S.

    2004-01-01

    There is currently no OEL for diesel fumes in the UK. This study reports parallel measurements of airborne levels of diesel fume pollutants in nine distribution depots where diesel powered fork-lift trucks (FLTs) were in use. Correlations between individual pollutants are assessed as well as their spatial distribution. Samples were collected on board FLTs and at background positions at nine distribution depots. Substances measured and the range of exposures by site were: respirable dust (n = 76) GM ≤ 80-179 μg/m 3 ; elemental carbon (n = 79) GM = 7-55 μg/m 3 ; organic carbon (n = 79) GM 11-69 μg/m 3 ; ultrafine particles (n = 17) range = 58-231 x 10 3 particles/cm 3 ; selected particulate phase polycyclic aromatic hydrocarbons (PAHs) (n - 14) range = 6-37 ng/m 3 . In addition, a tracer method based on ultrafine particle measurements was used to estimate the spatial distribution of total carbon and PAHs at the sites monitored. The spatial distribution was found to be reasonably uniform. Major diesel fume aerosol components were, in general, well correlated (r = 0.62-0.97). CO 2 measurements were also made and found to be below the HSE guideline of 1000 p.p.m., with most levels below 600 p.p.m. (Author)

  20. Understanding the spectrum of diesel injector deposits

    Energy Technology Data Exchange (ETDEWEB)

    Quigley, Robert; Barbour, Robert [Lubrizol Limited, Derby (United Kingdom); Arters, David; Bush, Jim [Lubrizol Corporation, Wickliffe, OH (United States)

    2013-06-01

    Understanding the origin of diesel fuel injector deposits used to be relatively simple; for the most part they were caused by the decomposition of fuel during the combustion process, were generally organic in nature and typically only affected the nozzle orifices. However, modem fuel injector designs appear to be both more severe in terms of generating conditions conducive to creating new and different types of deposits and more likely to have their operation affected by those deposits. Changes to fuel composition and type have in some cases increased the potential pool of reactive species or provided new potential deposit precursors. As a result, the universe of diesel injector deposits now range from the traditional organic to partially or fully inorganic in nature and from nozzle coking deposits to deposits which can seize the internal components of the injector; so called internal diesel injector deposits. Frequently, combinations of inorganic and organic deposits are found. While power loss is one well known issue associated with nozzle deposits, other field problems resulting from these new deposits include severe issues with drivability, emissions, fuel consumption and even engine failure. Conventional deposit control additive chemistries were developed to be effective against organic nozzle coking deposits. These conventional additives in many cases may prove ineffective against this wide range of deposit types. This paper discusses the range of deposits that have been found to adversely impact modem diesel fuel injectors and compares the performance of conventional and new, advanced deposit control additives against these various challenges to proper fuel injector functioning. (orig.)

  1. AUTOMOTIVE DIESEL MAINTENANCE 1. UNIT XXII, I--MAINTAINING THE FUEL SYSTEM (PART I)--CUMMINS DIESEL ENGINE, II--UNDERSTANDING THE DIFFERENTIAL.

    Science.gov (United States)

    Minnesota State Dept. of Education, St. Paul. Div. of Vocational and Technical Education.

    THIS MODULE OF A 30-MODULE COURSE IS DESIGNED TO DEVELOP AN UNDERSTANDING OF THE FUNCTION AND MAINTENANCE OF THE DIESEL ENGINE FUEL SYSTEM AND DIFFERENTIAL DRIVE UNITS USED IN DIESEL POWERED VEHICLES. TOPICS ARE (1) FUEL SYSTEM COMPARISONS, (2) FUEL SYSTEM SUPPLY COMPONENTS, (3) FUEL SUPPLY SECTION MAINTENANCE, (4) FUNCTION OF THE DIFFERENTIAL,…

  2. AUTOMOTIVE DIESEL MAINTENANCE 1. UNIT XVII, I--MAINTAINING THE LUBRICATION SYSTEM--CUMMINS DIESEL ENGINE, II--UNIT INSTALLATION AND REMOVAL--DRIVE LINES.

    Science.gov (United States)

    Minnesota State Dept. of Education, St. Paul. Div. of Vocational and Technical Education.

    THIS MODULE OF A 30-MODULE COURSE IS DESIGNED TO DEVELOP AN UNDERSTANDING OF THE DIESEL ENGINE LUBRICATION SYSTEM AND THE PROCEDURES FOR REMOVAL AND INSTALLATION OF THE DRIVE LINE USED IN DIESEL ENGINE POWER DISTRIBUTION. TOPICS ARE (1) PROLONGING ENGINE LIFE, (2) FUNCTIONS OF THE LUBRICATING SYSTEM, (3) TRACING THE LUBRICANT FLOW, (4) DETERMINING…

  3. AUTOMOTIVE DIESEL MAINTENANCE 1. UNIT XXI, I--MAINTAINING THE AIR SYSTEM--CATERPILLAR DIESEL ENGINE, II--UNDERSTANDING REAR END SUSPENSION.

    Science.gov (United States)

    Minnesota State Dept. of Education, St. Paul. Div. of Vocational and Technical Education.

    THIS MODULE OF A 30-MODULE COURSE IS DESIGNED TO DEVELOP AN UNDERSTANDING OF THE OPERATION AND MAINTENANCE OF THE DIESEL ENGINE AIR SYSTEM AND REAR AXLE SUSPENSION USED ON DIESEL POWERED VEHICLES. TOPICS ARE (1) AIR INDUCTION AND EXHAUST SYSTEM, (2) VALVE MECHANISM, (3) TROUBLESHOOTING THE AIR SYSTEM, (4) PURPOSE OF VEHICLE SUSPENSION, (5) TANDEM…

  4. AUTOMOTIVE DIESEL MAINTENANCE 1. UNIT XXIII, I--MAINTAINING THE FUEL SYSTEM, PART II--CATERPILLAR DIESEL ENGINE, II--UNDERSTANDING STEERING SYSTEMS.

    Science.gov (United States)

    Minnesota State Dept. of Education, St. Paul. Div. of Vocational and Technical Education.

    THIS MODULE OF A 30-MODULE COURSE IS DESIGNED TO DEVELOP AN UNDERSTANDING OF THE OPERATION AND MAINTENANCE OF THE DIESEL ENGINE FUEL INJECTION SYSTEM AND THE STEERING SYSTEM OF DIESEL POWERED VEHICLES. TOPICS ARE FUEL INJECTION SECTION, AND DESCRIPTION OF THE STEERING SYSTEM. THE MODULE CONSISTS OF A SELF-INSTRUCTIONAL BRANCH PROGRAMED TRAINING…

  5. AUTOMOTIVE DIESEL MAINTENANCE 1. UNIT XXV, I--CATERPILLAR DIESEL ENGINE COOLING SYSTEM D-8 AND 824 MODELS, II--TIRES AND TIRE HARDWARE.

    Science.gov (United States)

    Minnesota State Dept. of Education, St. Paul. Div. of Vocational and Technical Education.

    THIS MODULE OF A 30-MODULE COURSE IS DESIGNED TO DEVELOP AN UNDERSTANDING OF THE OPERATION AND MAINTENANCE OF THE DIESEL ENGINE COOLING SYSTEM AND TO PROVIDE A DESCRIPTION OF HEAVY TIRES AND WHEELS USED ON DIESEL POWERED VEHICLES. TOPICS ARE (1) THEORY OF THE COOLING SYSTEM, (2) COOLING SYSTEM COMPONENTS, (3) MAINTENANCE TIPS (COOLING SYSTEM), (4)…

  6. Diesel Engine Mechanics.

    Science.gov (United States)

    Foutes, William A.

    Written in student performance terms, this curriculum guide on diesel engine repair is divided into the following eight sections: an orientation to the occupational field and instructional program; instruction in operating principles; instruction in engine components; instruction in auxiliary systems; instruction in fuel systems; instruction in…

  7. Diesel sisustab / Jenni Juurinen

    Index Scriptorium Estoniae

    Juurinen, Jenni

    2007-01-01

    Renzo Rosso poolt 1978. a. Itaalias asutatud rõivafirma Diesel sisustas 2007. a. kevadel Stay Inn-projekti raames katusekorteri Helsingi kesklinnas. Diesili kujundaja Vesa Kemppainen. Sisustuses on kasutatud peamiselt soome mööblit ja seintel eksponeeritud soome noorte kunstnike taieseid. Autoreid: Harri Koskinen (voodi), Thomas Pedersen (Stingrey kiiktool), Jenni Hiltunen (maalid)

  8. Hydrogen, nitrogen and syngas enriched diesel combustion

    OpenAIRE

    Christodoulou, Fanos

    2014-01-01

    This thesis was submitted for the degree of Doctor of Philosophy and awarded by Brunel University On-board hydrogen and syngas production is considered as a transition solution from fossil fuel to hydrogen powered vehicles until problems associated with hydrogen infrastructure, distribution and storage are resolved. A hydrogen- or syngas-rich stream, which substitutes part of the main hydrocarbon fuel, can be produced by supplying diesel fuel in a fuel-reforming reactor, integrated within ...

  9. Maintenance Practices for Emergency Diesel Generator Engines Onboard United States Navy Los Angeles Class Nuclear Submarines

    National Research Council Canada - National Science Library

    Hawks, Matthew A

    2006-01-01

    .... All underway Navy nuclear reactors are operated with diesel generators as a backup power system, able to provide emergency electric power for reactor decay heat removal as well as enough electric...

  10. Diesel from home-grown biomass - Just a vision or near reality?

    International Nuclear Information System (INIS)

    Werder, M. J.

    2003-01-01

    This short article discusses how diesel fuel can be produced from indigenous biomass and describes a high-temperature process that converts carbon-based materials to carbon monoxide and hydrogen that can be further processed to provide petrol and diesel oil. The prospects of producing diesel oil from Swiss biomass using a catalytic process that can also provide gas for use in a combined heat and power unit is also examined. Ecological and economical considerations are discussed

  11. Research on the Common Rail Pressure Overshoot of Opposed-Piston Two-Stroke Diesel Engines

    OpenAIRE

    Yi Lu; Changlu Zhao; Zhe Zuo; Fujun Zhang; Shuanlu Zhang

    2017-01-01

    The common rail pressure has a direct influence on the working stability of Opposed-Piston Two-Stroke (OP2S) diesel engines, especially on performance indexes such as power, economy and emissions. Meanwhile, the rail pressure overshoot phenomenon occurs frequently due to the operating characteristics of OP2S diesel engines, which could lead to serious consequences. In order to solve the rail pressure overshoot problem of OP2S diesel engines, a nonlinear concerted algorithm adding a speed stat...

  12. Design and evaluation of fluidized bed heat recovery for diesel engine systems

    Science.gov (United States)

    Hamm, J. R.; Newby, R. A.; Vidt, E. J.; Lippert, T. E.

    1985-01-01

    The potential of utilizing fluidized bed heat exchangers in place of conventional counter-flow heat exchangers for heat recovery from adiabatic diesel engine exhaust gas streams was studied. Fluidized bed heat recovery systems were evaluated in three different heavy duty transport applications: (1) heavy duty diesel truck; (2) diesel locomotives; and (3) diesel marine pushboat. The three applications are characterized by differences in overall power output and annual utilization. For each application, the exhaust gas source is a turbocharged-adiabatic diesel core. Representative subposed exhaust gas heat utilization power cycles were selected for conceptual design efforts including design layouts and performance estimates for the fluidized bed heat recovery heat exchangers. The selected power cycles were: organic rankine with RC-1 working fluid, turbocompound power turbine with steam injection, and stirling engine. Fuel economy improvement predictions are used in conjunction with capital cost estimates and fuel price data to determine payback times for the various cases.

  13. Unmanned Surface Sea Vehicle Power System Design and Modeling

    National Research Council Canada - National Science Library

    Pritpal, Singh

    2005-01-01

    .... The power system of the USV is chosen to be a hybrid power source comprising a diesel generator and a lithium-ion battery pack Optimal sizing of the diesel generator and battery pack is important...

  14. Bio Diesel An Alternative Vehicles Fuel; Analytical View

    International Nuclear Information System (INIS)

    El Banna, S.; El Deen, O.N.

    2004-01-01

    Transesterification of a vegetable oil was conducted as early as 1853, by scientists E. Duffy and J. Patrick, many years before the first diesel engine became functional(1). Rudolf Diesel's prime model, a single 10 ft (3 m) iron cylinder with a flywheel at its base, ran on its own power for the first time in Augsburg, Germany on August 10, 1893(2). Diesel later demonstrated his engine at the World Fair in Paris, France in 1898. This engine stood as an example of Diesel's vision because it was powered by peanut oil-a bio fuel. He believed that the utilization of a biomass fuel was the real future of his engine. In a 1912 speech, Rudolf Diesel said, (I) t he use of vegetable oils for engine fuels may seem insignificant today, but such oils may become, in the course of time, as important as petroleum and the coal-tar products of the present time. Rudolf Diesel was not the only inventor to believe that biomass fuels would be the mainstay of the transportation industry. Henry Ford designed his automobiles, beginning with the 1908 Model T(1), to use ethanol. Ford was so convinced that renewable resources were the key to the success of his automobiles that he built a plant to make ethanol in the Midwest and formed a partnership with Standard Oil to sell it in their distributing stations

  15. Hydrogen assisted diesel combustion

    Energy Technology Data Exchange (ETDEWEB)

    Lilik, Gregory K.; Boehman, Andre L. [The EMS Energy Institute, The Pennsylvania State University, University Park, PA 16802 (United States); Zhang, Hedan; Haworth, Daniel C. [Department of Mechanical and Nuclear Engineering, The Pennsylvania State University, University Park, PA 16802 (United States); Herreros, Jose Martin [Escuela Tecnica Superior de Ingenieros Industriales, Universidad de Castilla La-Mancha, Avda. Camilo Jose Cela s/n, 13071 Ciudad Real (Spain)

    2010-05-15

    Hydrogen assisted diesel combustion was investigated on a DDC/VM Motori 2.5L, 4-cylinder, turbocharged, common rail, direct injection light-duty diesel engine, with a focus on exhaust emissions. Hydrogen was substituted for diesel fuel on an energy basis of 0%, 2.5%, 5%, 7.5%, 10% and 15% by aspiration of hydrogen into the engine's intake air. Four speed and load conditions were investigated (1800 rpm at 25% and 75% of maximum output and 3600 rpm at 25% and 75% of maximum output). A significant retarding of injection timing by the engine's electronic control unit (ECU) was observed during the increased aspiration of hydrogen. The retarding of injection timing resulted in significant NO{sub X} emission reductions, however, the same emission reductions were achieved without aspirated hydrogen by manually retarding the injection timing. Subsequently, hydrogen assisted diesel combustion was examined, with the pilot and main injection timings locked, to study the effects caused directly by hydrogen addition. Hydrogen assisted diesel combustion resulted in a modest increase of NO{sub X} emissions and a shift in NO/NO{sub 2} ratio in which NO emissions decreased and NO{sub 2} emissions increased, with NO{sub 2} becoming the dominant NO{sub X} component in some combustion modes. Computational fluid dynamics analysis (CFD) of the hydrogen assisted diesel combustion process captured this trend and reproduced the experimentally observed trends of hydrogen's effect on the composition of NO{sub X} for some operating conditions. A model that explicitly accounts for turbulence-chemistry interactions using a transported probability density function (PDF) method was better able to reproduce the experimental trends, compared to a model that ignores the influence of turbulent fluctuations on mean chemical production rates, although the importance of the fluctuations is not as strong as has been reported in some other recent modeling studies. The CFD results confirm

  16. The BAH domain of ORC1 links H4K20me2 to DNA replication licensing and Meier-Gorlin syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Alex J; Song, Jikui; Cheung, Peggie; Ishibe-Murakami, Satoko; Yamazoe, Sayumi; Chen, James K; Patel, Dinshaw J; Gozani, Or [Stanford; (MSKCC); (Stanford-MED)

    2012-07-11

    The recognition of distinctly modified histones by specialized 'effector' proteins constitutes a key mechanism for transducing molecular events at chromatin to biological outcomes. Effector proteins influence DNA-templated processes, including transcription, DNA recombination and DNA repair; however, no effector functions have yet been identified within the mammalian machinery that regulate DNA replication. Here we show that ORC1 - a component of ORC (origin of replication complex), which mediates pre-DNA replication licensing - contains a bromo adjacent homology (BAH) domain that specifically recognizes histone H4 dimethylated at lysine 20 (H4K20me2). Recognition of H4K20me2 is a property common to BAH domains present within diverse metazoan ORC1 proteins. Structural studies reveal that the specificity of the BAH domain for H4K20me2 is mediated by a dynamic aromatic dimethyl-lysine-binding cage and multiple intermolecular contacts involving the bound peptide. H4K20me2 is enriched at replication origins, and abrogating ORC1 recognition of H4K20me2 in cells impairs ORC1 occupancy at replication origins, ORC chromatin loading and cell-cycle progression. Mutation of the ORC1 BAH domain has been implicated in the aetiology of Meier-Gorlin syndrome (MGS), a form of primordial dwarfism, and ORC1 depletion in zebrafish results in an MGS-like phenotype. We find that wild-type human ORC1, but not ORC1-H4K20me2-binding mutants, rescues the growth retardation of orc1 morphants. Moreover, zebrafish depleted of H4K20me2 have diminished body size, mirroring the phenotype of orc1 morphants. Together, our results identify the BAH domain as a novel methyl-lysine-binding module, thereby establishing the first direct link between histone methylation and the metazoan DNA replication machinery, and defining a pivotal aetiological role for the canonical H4K20me2 mark, via ORC1, in primordial dwarfism.

  17. AUTOMOTIVE DIESEL MAINTENANCE 2. UNIT XIV, UNDERSTANDING DC GENERATOR PRINCIPLES.

    Science.gov (United States)

    Human Engineering Inst., Cleveland, OH.

    THIS MODULE OF A 25-MODULE COURSE IS DESIGNED TO DEVELOP AN UNDERSTANDING OF THE OPERATING PRINCIPLES OF DIRECT CURRENT GENERATORS USED ON DIESEL POWERED EQUIPMENT. TOPICS ARE (1) WHAT IS A GENERATOR AND ITS USE, (2) SHUNT GENERATOR PRINCIPLES, (3) POWER AND RATINGS OF A GENERATOR, (4) ARMATURE REACTION, (5) WHAT IS POLARITY, (6) TWO GENERATOR…

  18. AUTOMOTIVE DIESEL MAINTENANCE 2. UNIT II, MECHANICAL TRANSMISSIONS.

    Science.gov (United States)

    Human Engineering Inst., Cleveland, OH.

    THIS MODULE OF A 25-MODULE COURSE IS DESIGNED TO DEVELOP AN UNDERSTANDING OF THE OPERATION AND MAINTENANCE OF MECHANICAL TRANSMISSIONS USED ON DIESEL POWERED VEHICLES. TOPICS ARE (1) PURPOSE OF TRANSMISSIONS, (2) RATIO DIFFERENCE, (3) CONSTANT MESH TRANSMISSIONS, (4) FOUR-SPEED TRUCK TRANSMISSION POWER FLOW, AND (5) TRANSMISSION TROUBLESHOOTING.…

  19. IMPLEMENTATION OF DIOXANE AND DIESEL FUEL BLENDS TO REDUCE EMISSION AND TO IMPROVE PERFORMANCE OF THE COMPRESSION IGNITION ENGINE

    OpenAIRE

    SENDILVELAN S.; SUNDAR RAJ C.

    2017-01-01

    Performance of a compression ignition engine fuelled with 1, 4 Dioxane- diesel blends is evaluated. A single-cylinder, air-cooled, direct injection diesel engine developing a power output of 5.2 kW at 1500 rev/min is used. Base data is generated with standard diesel fuel subsequently; five fuel blends namely 90:10, 80:20, 70:30, 60:40 and 50:50 percentages by volume of diesel and dioxane were prepared and tested in the diesel engine. Engine performance and emission data were used to optimize ...

  20. Instalation of two emergency diesel groups in Angra-1

    International Nuclear Information System (INIS)

    Spitalnik, J.; Doria, L.

    1990-01-01

    As any technology that evolves, nuclear technology is no exception, mainly when new safety conditions of operation, more limited and restricted than previous ones, are introduced to assure increased protection to the public and the environment. NUCLEN has been actively involved in this type of activity in relation with the Angra-1 nuclear power plant. An important example is the Emergency Diesel Project to install in the power plant, two Diesel sets in addition to the existing ones. Experience gathered in this Project has also shown the way local firms, respectively in the fields of design engineering and power plant operation, were able to structure their teams to fulfill successfully a nuclear project both complex and pioneering. This report shows relevant aspects of the Diesel sets project design and erection, with special emphasis on the solution of problems related to the construction of a nuclear facility of the class-1 type, built under both German and US standards. (author) [pt

  1. Experimental Investigation of the Effects of Some Operating Diesel Engine Variables on Emitted Particulate Matters (PM

    Directory of Open Access Journals (Sweden)

    Adel M. Saleh

    2012-03-01

    Full Text Available The diesel engine is the most efficient prime mover commonly available today. Diesel engines move a large portion of the world’s goods, power much of the world’s equipment, and generate electricity more economically than any other device in their size range. But the diesel is one of the largest contributors to environmental pollution problems worldwide, and will remain so, with large increases expected in vehicle population. This experimental study has been conducted with direct injection diesel engine and particulate matters (PM concentrations were measured at variable operating variables. The results show that PM concentrations influence by changing equivalence ratio, load, engine speed and injection timing

  2. Vale nails down reduction of diesel particulate

    Energy Technology Data Exchange (ETDEWEB)

    Larmour, A.

    2010-09-01

    This article discussed innovations for reducing emissions of diesel particulate matter (DPM) from light-duty underground vehicles. DPM is a byproduct of diesel-powered equipment. Controlling these emissions at the source of generation is necessary for a healthy work environment and more cost effective than fresh air ventilation to reduce contaminant concentrations. Previous diesel particulate filter (DPF) systems required extensive human intervention, but this was deemed too inefficient. A DPF system that does not require human intervention was developed and proved successful in filter regeneration, longevity, and reliability. This DPF system uses a sintered metal filter element, a base metal, fuel-borne catalyst with an on-board dosing system, an electric heater that uses on-board power, and a sensor-based control unit. Software in the control unit adjusts fuel dosing rates and heater timing to ensure filter regeneration for different engines and operating scenarios. The new filter system is robust, and it has a compact design and long service-intervals. The product is still being tested to determine the costs and service life of the filter. More testing on fuel additives was deemed to be warranted, as was designing filter elements for larger engines used in heavy-duty vehicles.

  3. Prediction of major pollutants emission in direct injection dual-fuel diesel and natural-gas engines

    International Nuclear Information System (INIS)

    Pirouzpanah, V.; Kashani, B.O.

    2000-01-01

    The dual-fuel diesel engine is a conventional diesel engine in which much of the energy released, hence power, comes from the combustion of gaseous fuel such as natural gas. The exhaust emission characteristics of the dual-fuel diesel engine needs further refinements, particularly in terms of reduction of Unburnt Hydrocarbons and Carbon Monoxide (CO) emission, because the concentration of these pollutants are higher than that of the baseline diesel engine. Furthermore, the combustion process in a typical dual-fuel diesel engine tends to be complex, showing combination of the problems encountered both in diesel and spark ignition engines. In this work, a computer code has been modified for simulation of dual-fuel diesel engine combustion process. This model simulates dual-fuel diesel engine combustion by using a Multi-Zone Combustion Model for diesel pilot jet combustion and a conventional spark ignition combustion model for modelling of combustion of premixed gas/air charge. Also, in this model, there are four submodels for prediction of major emission pollutants such as: Unburnt Hydrocarbons, No, Co and soot which are emitted from dual-fuel diesel engine. For prediction of formation and oxidation rates of pollutants, relevant s conventional kinetically-controlled mechanisms and mass balances are used. the model has been verified by experimental data obtained from a heavy-duty truck and bus diesel engines. The comparison shows that, there exist good agreements between the experimental and predicted results from the dual-fuel diesel engine

  4. Performance of single cylinder, direct injection Diesel engine using water fuel emulsions

    International Nuclear Information System (INIS)

    Abu-Zaid, M.

    2004-01-01

    A single cylinder Diesel engine study of water-in-Diesel emulsions was conducted to investigate the effect of water emulsification on the engine performance and gases exhaust temperature. Emulsified Diesel fuels of 0, 5, 10, 15 and 20 water/Diesel ratios by volume, were used in a single cylinder, direct injection Diesel engine, operating at 1200-3300 rpm. The results indicate that the addition of water in the form of emulsion improves combustion efficiency. The engine torque, power and brake thermal efficiency increase as the water percentage in the emulsion increases. The average increase in the brake thermal efficiency for 20% water emulsion is approximately 3.5% over the use of Diesel for the engine speed range studied. The proper brake specific fuel consumption and gases exhaust temperature decrease as the percentage of water in the emulsion increases

  5. Lignocellulosic Biobutanol as Fuel for Diesel Engines

    Directory of Open Access Journals (Sweden)

    Martin Pexa

    2016-05-01

    Full Text Available Energy recovery of lignocellulosic waste material in the form of liquid fractions can yield alcohol-based fuels such as bioethanol or biobutanol. This study examined biobutanol derived from lignocellulosic material that was then used as an additive for diesel engines. Biobutanol was used in fuel mixtures with fatty acid methyl ester (FAME obtained by esterification of animal fat (also a waste material in the amounts of 10%, 30%, and 50% butanol. 100% diesel and 100% FAME were used as reference fuels. The evaluation concerned the fuel’s effect on the external speed characteristics, harmful exhaust emissions, and fuel consumption while using the Non-Road Steady Cycle test. When the percentage of butanol was increased, the torque and the power decreased and the brake specific fuel consumption increased. The main advantage of using biobutanol in fuel was its positive effect on reducing the fuel’s viscosity.

  6. An expert system for diesel generator diagnostics

    International Nuclear Information System (INIS)

    Bley, D.C.; Read, J.W.; Kaplan, S.; Liming, J.K.; Brosee, N.M.; Hanley, D.W.

    1987-01-01

    The idea of developing artificial intelligence (AI) systems to capture the knowledge of human experts is receiving much attention these days. The idea is even more attractive when important expertise resides within a single individual, especially one who is nearing retirement and who has not otherwise recorded or passed along his important knowledge and thought processes. The diesel generators at Pilgrim Nuclear Power Station have performed exceptionally well, primarily due to the care and attention of one man. Therefore, the authors are constructing an expert system for the diagnosis of diesel generator problems at Pilgrim. This paper includes a description of the expert system design and operation, examples from the knowledge base, and sample diagnoses, so the reader can observe the process in action

  7. Study of Exhaust Emissions Reduction of a Diesel Fuel Operated Heater During Transient Mode of Operation

    Directory of Open Access Journals (Sweden)

    Miklánek Ľubomír

    2014-10-01

    Full Text Available Diesel fuel operated heaters (FOHs are generally used as an independent heat source for any system in which a diesel fuel and battery power is available. Based on the fact that future engines will become even more efficient and thus less waste heat will be available to heat the passenger compartment, independent heat sources will be even more necessary.

  8. Risk analysis due to the extension of STI for CANDU diesel generators

    Energy Technology Data Exchange (ETDEWEB)

    Jee, Moon Hak; Choi, Kwang Hee; Jung, Hyun Jong; Choi, Seong Soo [Korea electric Power Research Institute, Taejon (Korea, Republic of); Lim, Jae Won [Atomic Creative Technology Company, Taejon (Korea, Republic of); Song, Jin Bae [KHNP, Kyungju (Korea, Republic of)

    2005-07-01

    The purpose of this study is to provide technical rationale for the extension of the Surveillance Test Interval (STI) of the Standby Diesel Generator (SDG) and the Emergency Power Supply Diesel Generator (EPSDG) of CANDU plants in Korea in a reliability aspect. The current STI of 2 weeks aims to be extended to 4 weeks through this study.

  9. 30 CFR 75.1912 - Fire suppression systems for permanent underground diesel fuel storage facilities.

    Science.gov (United States)

    2010-07-01

    ... Diesel-Powered Equipment § 75.1912 Fire suppression systems for permanent underground diesel fuel storage... system by a nationally recognized independent testing laboratory and appropriate for installation at a... recommended inspection and maintenance program and as required by the nationally recognized independent...

  10. 26 CFR 48.4041-5 - Sales of diesel and special motor fuels and fuel for use in aircraft; rules of general application.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 16 2010-04-01 2010-04-01 true Sales of diesel and special motor fuels and fuel... AND RETAILERS EXCISE TAXES Special Fuels § 48.4041-5 Sales of diesel and special motor fuels and fuel... of a diesel-powered highway vehicle, or of special motor fuel to an owner, lessee, or other operator...

  11. STRATEGY DETERMINATION FOR DIESEL INJECTION USING AVL ESE DIESEL

    Directory of Open Access Journals (Sweden)

    Vrublevskiy, A.

    2012-06-01

    Full Text Available Based on the design of research AVL FIRE ESE DIESEL environment they proposed to reduce noise and NOx emissions in the exhaust gases of the automobile diesel engine using two-stage injection. The parameters of the fuel for idling are determined.

  12. Differences in rheological profile of regular diesel and bio-diesel fuel

    Directory of Open Access Journals (Sweden)

    Jiří Čupera

    2010-01-01

    Full Text Available Biodiesel represents a promising alternative to regular fossil diesel. Fuel viscosity markedly influences injection, spraying and combustion, viscosity is thus critical factor to be evaluated and monitored. This work is focused on quantifying the differences in temperature dependent kinematic viscosity regular diesel fuel and B30 biodiesel fuel. The samples were assumed to be Newtonian fluids. Vis­co­si­ty was measured on a digital rotary viscometer in a range of 0 to 80 °C. More significant difference between minimum and maximum values was found in case of diesel fuel in comparison with biodiesel fuel. Temperature dependence of both fuels was modeled using several mathematical models – polynomial, power and Gaussian equation. The Gaussian fit offers the best match between experimental and computed data. Description of viscosity behavior of fuels is critically important, e.g. when considering or calculating running efficiency and performance of combustion engines. The models proposed in this work may be used as a tool for precise prediction of rheological behavior of diesel-type fuels.

  13. Replacing diesel by solar in the Amazon: short-term economic feasibility of PV-diesel hybrid systems

    International Nuclear Information System (INIS)

    Schmid, A.L.; Hoffmann, C.A.A.

    2004-01-01

    Energy planning in the Brazilian Amazon faces two major challenges. One is that of helping the off-grid population improve a situation of discomfort, environmental risks and high lighting costs. Another is that of cutting fuel subsidies in the local utility grids supplied by diesel generators. Simulation shows that PV systems with energy storage connected to existing diesel generators, allowing them to be turned of during the day, provide the lowest energy costs. Implementation potential of that choice is evaluated for local grids up to 100 kW, where transportation costs cause maximal wholesale diesel prices for Northern Brazil to be increased of 15% and more, it is economical to convert diesel systems up to 50 kW peak power into hybrid systems. In locations where the costs increase is of 45% and more, systems up to 100 kW turn economical. A new legal mechanism for subrogation of diesel subsidies to renewable energy projects changes those limits to 0% and 21%, respectively. Therefore, the actors in power generation are motivated to consider solar energy. A program with the scope described should give the Brazilian photovoltaic industry a relevant push and launch a transition towards a sustainable power supply for the region

  14. FTIR analysis of surface functionalities on particulate matter produced by off-road diesel engines operating on diesel and biofuel.

    Science.gov (United States)

    Popovicheva, Olga B; Kireeva, Elena D; Shonija, Natalia K; Vojtisek-Lom, Michal; Schwarz, Jaroslav

    2015-03-01

    Fourier transform infrared spectroscopy is applied as a powerful analytic technique for the evaluation of the chemical composition of combustion aerosols emitted by off-road engines fuelled by diesel and biofuels. Particles produced by burning diesel, heated rapeseed oil (RO), RO with ethylhexylnitrate, and heated palm oil were sampled from exhausts of representative in-use diesel engines. Multicomponent composition of diesel and biofuel particles reveal the chemistry related to a variety of functional groups containing carbon, hydrogen, oxygen, sulfur, and nitrogen. The most intensive functionalities of diesel particles are saturated C-C-H and unsaturated C=C-H aliphatic groups in alkanes and alkenes, aromatic C=C and C=C-H groups in polyaromatics, as well as sulfates and nitrated ions. The distinguished features of biofuel particles were carbonyl C=O groups in carboxylic acids, ketones, aldehydes, esters, and lactones. NO2, C-N and -NH groups in nitrocompounds and amines are found to dominate biofuel particles. Group identification is confirmed by complementary measurements of organic carbon (OC), elemental carbon, and water-soluble ion species. The relationship between infrared bands of polar oxygenated and non-polar aliphatic functionalities indicates the higher extent of the surface oxidation of biofuel particles. Findings provide functional markers of organic surface structure of off-road diesel emission, allowing for a better evaluation of relation between engine, fuel, operation condition, and particle composition, thus improving the quantification of environmental impacts of alternative energy source emissions.

  15. Effects of ethanol-diesel fuel blends on the performance and exhaust emissions of heavy duty DI diesel engine

    International Nuclear Information System (INIS)

    Rakopoulos, D.C.; Rakopoulos, C.D.; Kakaras, E.C.; Giakoumis, E.G.

    2008-01-01

    An experimental investigation is conducted to evaluate the effects of using blends of ethanol with conventional diesel fuel, with 5% and 10% (by vol.) ethanol, on the performance and exhaust emissions of a fully instrumented, six-cylinder, turbocharged and after-cooled, heavy duty, direct injection (DI), Mercedes-Benz engine, installed at the authors' laboratory, which is used to power the mini-bus diesel engines of the Athens Urban Transport Organization sub-fleet with a view to using bio-ethanol produced from Greek feedstock. The tests are conducted using each of the above fuel blends, with the engine working at two speeds and three loads. Fuel consumption, exhaust smokiness and exhaust regulated gas emissions such as nitrogen oxides, carbon monoxide and total unburned hydrocarbons are measured. The differences in the measured performance and exhaust emissions of the two ethanol-diesel fuel blends from the baseline operation of the engine, i.e. when working with neat diesel fuel, are determined and compared. Theoretical aspects of diesel engine combustion combined with the widely differing physical and chemical properties of the ethanol against those for the diesel fuel, are used to aid the correct interpretation of the observed engine behavior

  16. Sistema híbrido eólico-diesel para el abastecimiento de energía eléctrica de 20 cabañas turísticas en Cayo Caguamas. // Eolic-Diesel hybrid system for electric power supply of 20 tourist cabins in Caguamas Key.

    OpenAIRE

    R. Alarcón Fernández

    2001-01-01

    Se presentan los aspectos técnicos y económicos de la planificación de un sistema híbrido eólico-diesel para elabastecimiento de energía eléctrica de 20 cabañas turísticas en Cayo Caguamas. Se determina la demanda de energía y lacurva de carga de la instalación turística. Se dimensiona un sistema híbrido eólico-diesel formado por 6 aerogeneradores de10 kW y dos generadores Diesel de 75 kW cada uno. Finalmente se determina la influencia de la variación de algunosparámetros importantes sobre la...

  17. Study and design of a hybrid wind-diesel-compressed air energy storage system for remote areas

    International Nuclear Information System (INIS)

    Ibrahim, H.; Younes, R.; Ilinca, A.; Dimitrova, M.; Perron, J.

    2010-01-01

    Remote areas around the world predominantly rely on diesel-powered generators for their electricity supply, a relatively expensive and inefficient technology that is responsible for the emission of 1.2 million tons of greenhouse gas (GHG) annually, only in Canada . Wind-diesel hybrid systems (WDS) with various penetration rates have been experimented to reduce diesel consumption of the generators. After having experimented wind-diesel hybrid systems (WDS) that used various penetration rates, we turned our focus to that the re-engineering of existing diesel power plants can be achieved most efficiently, in terms of cost and diesel consumption, through the introduction of high penetration wind systems combined with compressed air energy storage (CAES). This article compares the available technical alternatives to supercharge the diesel that was used in this high penetration wind-diesel system with compressed air storage (WDCAS), in order to identify the one that optimizes its cost and performances. The technical characteristics and performances of the best candidate technology are subsequently assessed at different working regimes in order to evaluate the varying effects on the system. Finally, a specific WDCAS system with diesel engine downsizing is explored. This proposed design, that requires the repowering of existing facilities, leads to heightened diesel power output, increased engine lifetime and efficiency and to the reduction of fuel consumption and GHG emissions, in addition to savings on maintenance and replacement cost.

  18. Emergency diesel generator reliability program

    International Nuclear Information System (INIS)

    Serkiz, A.W.

    1989-01-01

    The need for an emergency diesel generator (EDG) reliability program has been established by 10 CFR Part 50, Section 50.63, Loss of All Alternating Current Power, which requires that utilities assess their station blackout duration and recovery capability. EDGs are the principal emergency ac power sources for coping with a station blackout. Regulatory Guide 1.155, Station Blackout, identifies a need for (1) an EDG reliability equal to or greater than 0.95, and (2) an EDG reliability program to monitor and maintain the required levels. The resolution of Generic Safety Issue (GSI) B-56 embodies the identification of a suitable EDG reliability program structure, revision of pertinent regulatory guides and Tech Specs, and development of an Inspection Module. Resolution of B-56 is coupled to the resolution of Unresolved Safety Issue (USI) A-44, Station Blackout, which resulted in the station blackout rule, 10 CFR 50.63 and Regulatory Guide 1.155, Station Blackout. This paper discusses the principal elements of an EDG reliability program developed for resolving GSI B-56 and related matters

  19. Displacement of diesel fuel with wind energy in rural Alaskan villages. Final progress and project closeout report

    Energy Technology Data Exchange (ETDEWEB)

    Meiners, Dennis [Alaska Industrial Development and Export Authority, Anchorage, AK (United States); Drouhilet, Steve [National Renewable Energy Lab. (NREL), Golden, CO (United States); Reeve, Brad [Alaska Industrial Development and Export Authority, Anchorage, AK (United States); Bergen, Matt [Kotzebue Electric Association, Kotzebue, AK (United States)

    2002-03-11

    The basic concept behind this project was to construct a wind diesel hybrid power system which combines and maximizes the intermittent and variable energy output of wind turbine(s) with diesel generator(s) to provide continuous high quality electric power to weak isolated mini-grids.

  20. Effect of partial replacement of diesel or biodiesel with gas from biomass gasification in a diesel engine

    International Nuclear Information System (INIS)

    Hernández, J.J.; Lapuerta, M.; Barba, J.

    2015-01-01

    The injected diesel fuel used in a diesel engine was partially replaced with biomass-derived gas through the intake port, and the effect on performance and pollutant emissions was studied. The experimental work was carried out in a supercharged, common-rail injection, single-cylinder diesel engine by replacing diesel fuel up to 20% (by energy), keeping constant the engine power. Three engine loads (60, 90, 105 Nm), three different EGR (exhaust gas recirculation) ratios (0, 7.5, 15%) and two intake temperatures (45, 60 °C) were tested. Finally, some of the tested conditions were selected to replace diesel injection fuel with biodiesel injection. Although the brake thermal efficiency was decreased and hydrocarbons and carbon monoxide emissions increased with increasing fuel replacement, particulate emissions decreased significantly and NO x emissions decreased slightly at all loads and EGR ratios. Thermodynamic diagnostic results showed higher premixed ratio and lower combustion duration for increasing diesel fuel replacement. High EGR ratios improved both engine performance and emissions, especially when intake temperature was increased, which suggest removing EGR cooling when diesel fuel is replaced. Finally, when biodiesel was used instead of diesel fuel, the gas replacement improved the efficiency and reduced the hydrocarbon, carbon monoxide and particulate emissions. - Highlights: • Replacing injected fuel with gas permits an efficient valorization of waste biomass. • Inlet gas was inefficiently burned after the end of liquid fuel injection. • Engine parameters were combined to simultaneously reduce particle and NO x emissions. • Hot EGR (exhaust gas recirculation) and biodiesel injection are proposed to improve efficiency and emissions

  1. Combined effects of thermal barrier coating and blending with diesel fuel on usability of vegetable oils in diesel engines

    International Nuclear Information System (INIS)

    Aydin, Hüseyin

    2013-01-01

    The possibility of using pure vegetable oils in a thermally insulated diesel engine has been experimentally investigated. Initially, the standard diesel fuel was tested in the engine, as base experiment for comparison. Then the engine was thermally insulated by coating some parts of it, such as piston, exhaust and intake valves surfaces with zirconium oxide (ZrO 2 ). The main purpose of engine coating was to reduce heat rejection from the walls of combustion chamber and to increase thermal efficiency and thus to increase performance of the engine that using vegetable oil blends. Another aim of the study was to improve the usability of pure vegetable oils in diesel engines without performing any fuel treatments such as pyrolysis, emulsification and transesterification. Pure inedible cottonseed oil and sunflower oil were blended with diesel fuel. Blends and diesel fuel were then tested in the coated diesel engine. Experimental results proved that the main purpose of this study was achieved as the engine performance parameters such as power and torque were increased with simultaneous decrease in fuel consumption (bsfc). Furthermore, exhaust emission parameters such as CO, HC, and Smoke opacity were decreased. Also, sunflower oil blends presented better performance and emission parameters than cottonseed oil blends. -- Highlights: ► Usability of two different vegetable oils in a coated diesel engine was experimentally investigated. ► A diesel engine was coated with ZrO 2 layer to make the combustion chamber insulated. ► Test results showed significant improvements in performance parameters. ► While only minor reductions were observed in emissions with coated engine operation

  2. Capture of Heat Energy from Diesel Engine Exhaust

    Energy Technology Data Exchange (ETDEWEB)

    Chuen-Sen Lin

    2008-12-31

    Diesel generators produce waste heat as well as electrical power. About one-third of the fuel energy is released from the exhaust manifolds of the diesel engines and normally is not captured for useful applications. This project studied different waste heat applications that may effectively use the heat released from exhaust of Alaskan village diesel generators, selected the most desirable application, designed and fabricated a prototype for performance measurements, and evaluated the feasibility and economic impact of the selected application. Exhaust flow rate, composition, and temperature may affect the heat recovery system design and the amount of heat that is recoverable. In comparison with the other two parameters, the effect of exhaust composition may be less important due to the large air/fuel ratio for diesel engines. This project also compared heat content and qualities (i.e., temperatures) of exhaust for three types of fuel: conventional diesel, a synthetic diesel, and conventional diesel with a small amount of hydrogen. Another task of this project was the development of a computer-aided design tool for the economic analysis of selected exhaust heat recovery applications to any Alaskan village diesel generator set. The exhaust heat recovery application selected from this study was for heating. An exhaust heat recovery system was fabricated, and 350 hours of testing was conducted. Based on testing data, the exhaust heat recovery heating system showed insignificant effects on engine performance and maintenance requirements. From measurements, it was determined that the amount of heat recovered from the system was about 50% of the heat energy contained in the exhaust (heat contained in exhaust was evaluated based on environment temperature). The estimated payback time for 100% use of recovered heat would be less than 3 years at a fuel price of $3.50 per gallon, an interest rate of 10%, and an engine operation of 8 hours per day. Based on experimental data

  3. Alternative Diesel from Waste Plastics

    Directory of Open Access Journals (Sweden)

    Stella Bezergianni

    2017-10-01

    Full Text Available The long term ambition of energy security and solidarity, coupled with the environmental concerns of problematic waste accumulation, is addressed via the proposed waste-to-fuel technology. Plastic waste is converted into automotive diesel fuel via a two-step thermochemical process based on pyrolysis and hydrotreatment. Plastic waste was pyrolyzed in a South East Asia plant rendering pyrolysis oil, which mostly consisted of middle-distillate (naphtha and diesel hydrocarbons. The diesel fraction (170–370 °C was fractionated, and its further upgrade was assessed in a hydroprocessing pilot plant at the Centre for Research and Technology Hellas (CERTH in Greece. The final fuel was evaluated with respect to the diesel fuel quality specifications EN 590, which characterized it as a promising alternative diesel pool component with excellent ignition quality characteristics and low back end volatility.

  4. Diesel Engine Tribology

    DEFF Research Database (Denmark)

    Christiansen, Christian Kim

    Recent years have seen an increase in the wear rate of engine bearings, subsequently followed by bearing failure, for the large two-stroke diesel engines used for ship propulsion. Here, the engine bearings include main, big end and crosshead bearings, with the bearing type used being the journal...... bearing, belonging to the class of ‘hydrodynamic bearings’. This implies that the load carrying capacity is generated by a relative movement of the involved components, i.e. avelocity-driven operation. For the engine application, the velocity stems from the engine RPM. However, to comply with the latest...

  5. TRNSYS HYBRID wind diesel PV simulator

    Energy Technology Data Exchange (ETDEWEB)

    Quinlan, P.J.A.; Mitchell, J.W.; Klein, S.A.; Beckman, W.A.; Blair, N.J. [Univ. of Wisconsin, Madison, WI (United States)

    1996-12-31

    The Solar Energy Laboratory (SEL) has developed a wind diesel PV hybrid systems simulator, UW-HYBRID 1.0, an application of the TRNSYS 14.2 time-series simulation environment. An AC/DC bus links up to five diesels and wind turbine models, along with PV modules, a battery bank, and an AC/DC converter. Multiple units can be selected. PV system simulations include solar angle and peak power tracking options. Weather data are Typical Meteorological Year data, parametrically generated synthesized data, or external data files. PV performance simulations rely on long-standing SEL-developed algorithms. Loads data are read as scalable time series. Diesel simulations include estimated fuel-use and waste heat output, and are dispatched using a least-cost of fuel strategy. Wind system simulations include varying air density, wind shear and wake effects. Time step duration is user-selectable. UW-HYBRID 1.0 runs in Windows{reg_sign}, with TRNSED providing a customizable user interface. 12 refs., 6 figs.

  6. Exposure Assessment of Diesel Bus Emissions

    Directory of Open Access Journals (Sweden)

    Werner Hofmann

    2006-12-01

    Full Text Available The goal of this study was to measure ultrafine particle concentrations with diameters less than 1 μm emitted by diesel buses and to assess resulting human exposure levels. The study was conducted at the Woolloongabba Busway station in Brisbane, Australia in the winter months of 2002 during which temperature inversions frequently occurred. Most buses that utilize the station are fuelled by diesel, the exhaust of which contains a significant quantity of particle matter. Passengers waiting at the station are exposed to these particles emitted from the buses. During the course of this study, passenger census was conducted, based on video surveillance, yielding person-by-person waiting time data. Furthermore, a bus census revealed accurate information about the total number of diesel versus Compressed Natural Gas (CNG powered buses. Background (outside of the bus station and platform measurements of ultrafine particulate number size distributions were made to determine ambient aerosol concentrations. Particle number exposure concentration ranges from 10 and 40 to 60% of bus related exhaust fumes. This changes dramatically when considering the particle mass exposure concentration, where most passengers are exposed to about 50 to 80% of exhaust fumes. The obtained data can be very significant for comparison with similar work of this type because it is shown in previous studies that exhaust emissions causes cancer in laboratory animals. It was assumed that significant differences between platform and background distributions were due to bus emissions which, combined with passenger waiting times, yielded an estimate of passenger exposure to ultrafine particles from diesel buses. From an exposure point of view, the Busway station analyzed resembles a street canyon. Although the detected exhaust particle concentration at the outbound platform is found to be in the picogram range, exposure increases with the time passengers spend on the platform

  7. Fuel Saving on Diesel Genset using PV/Battery Spike Cutting in Remote Area Microgrid

    Directory of Open Access Journals (Sweden)

    Dwi Atmaja Tinton

    2018-01-01

    Full Text Available Diesel Generator set was found to be a favorite power generator in a remote area. In this area, diesel genset usually consumes a significant amount of diesel fuel with higher fuel price than an urban area. Diesel Generator capacity conventionally prepared twice bigger or more than the existing load to prevent any load spike from designated equipment. This work implements an Energy Management System to cut the spike with the support from battery storage unit and photovoltaic module. Once the Energy Management System cut the load spike using battery/photovoltaics, Diesel Generator loads no longer need to be irrelevantly bigger than the existing load. The current experiment in the remote island at Raja Ampat archipelago indicates that the using of 80 kVA Diesel Generator can be reduced to 42 kVA Diesel Generator. This Diesel Generator replacement induces fuel consumption up to 50 %. With this designed work, a smart microgrid with PV-Battery-Diesel can be installed in a designated remote area with lower fuel consumption.

  8. Performance, Emission, Energy, and Exergy Analysis of a C.I. Engine Using Mahua Biodiesel Blends with Diesel.

    Science.gov (United States)

    Panigrahi, Nabnit; Mohanty, Mahendra Kumar; Mishra, Sruti Ranjan; Mohanty, Ramesh Chandra

    2014-01-01

    This paper presents an experimental investigation on a four-stroke single cylinder diesel engine fuelled with the blends of Mahua oil methyl ester (MOME) and diesel. The performance emission, energy, and exergy analysis has been carried out in B20 (mixture of 80% diesel by volume with 20% MOME). From energy analysis, it was observed that the fuel energy input as well as energy carried away by exhaust gases was 6.25% and 11.86% more in case of diesel than that of B20. The unaccounted losses were 10.21% more in case of diesel than B20. The energy efficiency was 28%, while the total losses were 72% for diesel. In case of B20, the efficiency was 65.74 % higher than that of diesel. The exergy analysis shows that the input availability of diesel fuel is 1.46% more than that of B20. For availability in brake power as well as exhaust gases of diesel were 5.66 and 32% more than that of B20. Destructed availability of B20 was 0.97% more than diesel. Thus, as per as performance, emission, energy, and exergy part were concerned; B20 is found to be very close with that of diesel.

  9. Experimental investigation of performance and emissions of a VCR diesel engine fuelled with n-butanol diesel blends under varying engine parameters.

    Science.gov (United States)

    Nayyar, Ashish; Sharma, Dilip; Soni, Shyam Lal; Mathur, Alok

    2017-09-01

    The continuous rise in the cost of fossil fuels as well as in environmental pollution has attracted research in the area of clean alternative fuels for improving the performance and emissions of internal combustion (IC) engines. In the present work, n-butanol is treated as a bio-fuel and investigations have been made to evaluate the feasibility of replacing diesel with a suitable n-butanol-diesel blend. In the current research, an experimental investigation was carried out on a variable compression ratio CI engine with n-butanol-diesel blends (10-25% by volume) to determine the optimum blending ratio and optimum operating parameters of the engine for reduced emissions. The best results of performance and emissions were observed for 20% n-butanol-diesel blend (B20) at a higher compression ratio as compared to diesel while keeping the other parameters unchanged. The observed deterioration in engine performance was within tolerable limits. The reductions in smoke, nitrogen oxides (NO x ), and carbon monoxide (CO) were observed up to 56.52, 17.19, and 30.43%, respectively, for B20 in comparison to diesel at rated power. However, carbon dioxide (CO 2 ) and hydrocarbons (HC) were found to be higher by 17.58 and 15.78%, respectively, for B20. It is concluded that n-butanol-diesel blend would be a potential fuel to control emissions from diesel engines. Graphical abstract ᅟ.

  10. Performance and emission parameters of single cylinder diesel engine using castor oil bio-diesel blended fuels

    Science.gov (United States)

    Rahimi, A.; Ghobadian, B.; Najafi, G.; Jaliliantabar, F.; Mamat, R.

    2015-12-01

    The purpose of this study is to investigate the performance and emission parameters of a CI single cylinder diesel engine operating on biodiesel-diesel blends (B0, B5, B10, B15 and E20: 20% biodiesel and 80% diesel by volume). A reactor was designed, fabricated and evaluated for biodiesel production. The results showed that increasing the biodiesel content in the blend fuel will increase the performance parameters and decrease the emission parameters. Maximum power was detected for B0 at 2650 rpm and maximum torque was belonged to B20 at 1600 rpm. The experimental results revealed that using biodiesel-diesel blended fuels increased the power and torque output of the engine. For biodiesel blends it was found that the specific fuel consumption (sfc) was decreased. B10 had the minimum amount for sfc. The concentration of CO2 and HC emissions in the exhaust pipe were measured and found to be decreased when biodiesel blends were introduced. This was due to the high oxygen percentage in the biodiesel compared to the net diesel fuel. In contrast, the concentration of CO and NOx was found to be increased when biodiesel is introduced.

  11. Evaluation of the BRV 10 diesel engine disruption of the multi purpose reactor G.A Siwabessy reactor

    International Nuclear Information System (INIS)

    Asep Saepuloh; Kiswanto; Muh Taufiq; Yuyut, S.

    2014-01-01

    Diesel generator is one of the important components of emergency electrical power supply when the main power supply is disrupted. Unable to operation of diesel engines will have a serious impact to the operation of the reactor. This paper aims to evaluate the cause of disruption of the diesel generator BRV10 at the Multi Purpose Reactor GA Siwabessy occurred in 2014. This event makes enough attention because its cause is deemed unusual. Evaluation is done by investigating the causes of the disorder, do the repair, test functions and anticipate that similar events do not recur in the future. From the results of the evaluation of the causes of disorders known that diesel is a diesel mixing with water and mud that had buried long estimated in the diesel engine fuel tank. Is believed to cause the fuel tank care is less than optimal. (author)

  12. Successful testing of an emergency diesel generator engine at very low load

    International Nuclear Information System (INIS)

    Killinger, A.; Loeper, St.

    2001-01-01

    For more than 30 years, the nuclear power industry has been concerned about the ability of emergency diesel generator sets (EDGs) to operate for extended periods of time at low loads (typically less than 33% of design rating) and still be capable of meeting their design safety requirement. Most diesel engine manufacturers today still caution owners and operators to avoid running their diesel engines for extended periods of time at low loads. At one nuclear power plant, the emergency electrical bus arrangement only required approximately 25% of the EDG's design rating, which necessitated that the plant operators monitor EDG operating hours and periodically increase electrical load. In order to eliminate the plant operations burden of periodically loading the EDGs, the nuclear power plant decided to conduct a low-load test of a ''spare'' diesel engine. A SACM Model UD45V16S5D diesel engine was returned to the factory in Mulhouse, France where the week long testing at rated speed and 3% of design rating was completed. The test demonstrated that the engine was capable of operating for seven days (168 hours) at very low loads, with no loss of performance and no unusual internal wear or degradation. The planning and inspections associated with preparing the diesel engine for the test, the engine monitoring performed during the test, the final test results, and the results and material condition of the engine following the test are described. The successful diesel engine low-load test resulted in the elimination of unnecessary nuclear power plant operation restrictions that were based on old concerns about long-term, low-load operation of diesel engines. The paper describes the significance of this diesel engine test to the nuclear power plant and the entire nuclear power industry. (author)

  13. H4K20me0 marks post-replicative chromatin and recruits the TONSL₋MMS22L DNA repair complex

    Energy Technology Data Exchange (ETDEWEB)

    Saredi, Giulia; Huang, Hongda; Hammond, Colin M.; Alabert, Constance; Bekker-Jensen, Simon; Forne, Ignasi; Reverón-Gómez, Nazaret; Foster, Benjamin M.; Mlejnkova, Lucie; Bartke, Till; Cejka, Petr; Mailand, Niels; Imhof, Axel; Patel, Dinshaw J.; Groth, Anja [UCopenhagen; (MSKCC); (ICL); (LMU); (Zurich)

    2016-06-22

    Here, we report that after DNA replication, chromosomal processes including DNA repair and transcription take place in the context of sister chromatids. While cell cycle regulation can guide these processes globally, mechanisms to distinguish pre- and post-replicative states locally remain unknown. In this paper we reveal that new histones incorporated during DNA replication provide a signature of post-replicative chromatin, read by the human TONSL–MMS22L1, 2, 3, 4 homologous recombination complex. We identify the TONSL ankyrin repeat domain (ARD) as a reader of histone H4 tails unmethylated at K20 (H4K20me0), which are specific to new histones incorporated during DNA replication and mark post-replicative chromatin until the G2/M phase of the cell cycle. Accordingly, TONSL–MMS22L binds new histones H3–H4 both before and after incorporation into nucleosomes, remaining on replicated chromatin until late G2/M. H4K20me0 recognition is required for TONSL–MMS22L binding to chromatin and accumulation at challenged replication forks and DNA lesions. Consequently, TONSL ARD mutants are toxic, compromising genome stability, cell viability and resistance to replication stress. Finally, together, these data reveal a histone-reader-based mechanism for recognizing the post-replicative state, offering a new angle to understand DNA repair with the potential for targeted cancer therapy.

  14. Bio diesel production from algae

    International Nuclear Information System (INIS)

    Khola, G.; Ghazala, B.

    2011-01-01

    Algae appear to be an emerging source of biomass for bio diesel that has the potential to completely displace fossil fuel. Two thirds of earth's surface is covered with water, thus alga e would truly be renewable option of great potential for global energy needs. This study discusses specific and comparative bio diesel quantitative potential of Cladophora sp., also highlighting its biomass (after oil extraction), pH and sediments (glycerine, water and pigments) quantitative properties. Comparison of Cladophora sp., with Oedogonium sp., and Spirogyra sp., (Hossain et al., 2008) shows that Cladophora sp., produce higher quantity of bio diesel than Spirogyra sp., whereas biomass and sediments were higher than the both algal specimens in comparison to the results obtained by earlier workers. No prominent difference in pH of bio diesel was found. In Pakistan this is a first step towards bio diesel production from algae. Results indicate that Cladophora sp., provide a reasonable quantity of bio diesel, its greater biomass after oil extraction and sediments make it a better option for bio diesel production than the comparing species. (author)

  15. ENVIRONMENTAL TECHNOLOGY VERIFICATION REPORT: NEW CONDENSATOR, INC.--THE CONDENSATOR DIESEL ENGINE RETROFIT CRANKCASE VENTILATION SYSTEM

    Science.gov (United States)

    EPA's Environmental Technology Verification Program has tested New Condensator Inc.'s Condensator Diesel Engine Retrofit Crankcase Ventilation System. Brake specific fuel consumption (BSFC), the ratio of engine fuel consumption to the engine power output, was evaluated for engine...

  16. Diesel spray characterization; Dieselmoottorin polttoainesuihkujen ominaisuudet

    Energy Technology Data Exchange (ETDEWEB)

    Pitkaenen, J.; Turunen, R.; Paloposki, T.; Rantanen, P.; Virolainen, T. [Helsinki Univ. of Technology, Otaniemi (Finland). Internal Combustion Engine Lab.

    1997-10-01

    Fuel injection of diesel engines will be studied using large-scale models of fuel injectors. The advantage of large-scale models is that the measurement of large-scale diesel sprays will be easier than the measurement of actual sprays. The objective is to study the break-up mechanism of diesel sprays and to measure drop size distributions in the inner part of the spray. The results will be used in the development of diesel engines and diesel fuels. (orig.)

  17. Life Cycle Assessment of Diesel and Electric Public Transportation Buses

    Science.gov (United States)

    The Clean Air Act identifies diesel powered motor vehicles, including transit buses, as significant sources of several criteria pollutants which contribute to ground level ozone formation or smog. The effects of air pollution in urban areas are often more significant due to con...

  18. Selection of Fuel System for Modern Heavy Duty Diesel Engines

    Directory of Open Access Journals (Sweden)

    G. M. Kukharonok

    2004-01-01

    Full Text Available Fuel systems of diesel engines have been analyzed. The paper shows components of the systems, peculiarities of their manufacturing process. Difference in efficiency of the systems, their application and market prospects are considered in the paper. While solving problems to design a power installation the essence of fuel system selection is given on the basis of an internal combustion engine.

  19. Optimization of diesel engine performance by the Bees Algorithm

    Science.gov (United States)

    Azfanizam Ahmad, Siti; Sunthiram, Devaraj

    2018-03-01

    Biodiesel recently has been receiving a great attention in the world market due to the depletion of the existing fossil fuels. Biodiesel also becomes an alternative for diesel No. 2 fuel which possesses characteristics such as biodegradable and oxygenated. However, there are facts suggested that biodiesel does not have the equivalent features as diesel No. 2 fuel as it has been claimed that the usage of biodiesel giving increment in the brake specific fuel consumption (BSFC). The objective of this study is to find the maximum brake power and brake torque as well as the minimum BSFC to optimize the condition of diesel engine when using the biodiesel fuel. This optimization was conducted using the Bees Algorithm (BA) under specific biodiesel percentage in fuel mixture, engine speed and engine load. The result showed that 58.33kW of brake power, 310.33 N.m of brake torque and 200.29/(kW.h) of BSFC were the optimum value. Comparing to the ones obtained by other algorithm, the BA produced a fine brake power and a better brake torque and BSFC. This finding proved that the BA can be used to optimize the performance of diesel engine based on the optimum value of the brake power, brake torque and BSFC.

  20. Particulate filter behaviour of a Diesel engine fueled with biodiesel

    International Nuclear Information System (INIS)

    Buono, D.; Senatore, A.; Prati, M.V.

    2012-01-01

    Biodiesel is an alternative and renewable fuel made from plant and animal fat or cooked oil through a transesterification process to produce a short chain ester (generally methyl ester). Biodiesel fuels have been worldwide studied in Diesel engines and they were found to be compatible in blends with Diesel fuel to well operate in modern Common Rail engines. Also throughout the world the diffusion of biofuels is being promoted in order to reduce greenhouse gas emissions and the environmental impact of transport, and to increase security of supply. To meet the current exhaust emission regulations, after-treatment devices are necessary; in particular Diesel Particulate Filters (DPFs) are essential to reduce particulate emissions of Diesel engines. A critical requirement for the implementation of DPF on a modern Biodiesel powered engine is the determination of Break-even Temperature (BET) which is defined as the temperature at which particulate deposition on the filter is balanced by particulate oxidation on the filter. To fit within the exhaust temperature range of the exhaust line and to require a minimum of active regeneration during the engine running, the BET needs to occur at sufficiently low temperatures. In this paper, the results of an experimental campaign on a modern, electronic controlled fuel injection Diesel engine are shown. The engine was fuelled either with petroleum ultralow sulphur fuel or with Biodiesel: BET was evaluated for both fuels. Results show that on average, the BET is lower for biodiesel than for diesel fuel. The final goal was to characterize the regeneration process of the DPF device depending on the adopted fuel, taking into account the different combustion process and the different nature of the particulate matter. Overall the results suggest significant benefits for the use of biodiesel in engines equipped with DPFs. - Highlights: ► We compare Diesel Particulate Trap (DPF) performance with Biodiesel and Diesel fuel. ► The Break

  1. Cleaning the Diesel Engine Emissions

    DEFF Research Database (Denmark)

    Christensen, Thomas Budde

    This paper examines how technologies for cleaning of diesel emission from road vehicles can be supported by facilitating a technology push in the Danish automotive emission control industry. The European commission is at present preparing legislation for the euro 5 emission standard (to be enforced...... in 2010). The standard is expected to include an 80% reduction of the maximum particulate emissions from diesel cars. The fulfillment of this requirement entails development and production of particulate filters for diesel cars and trucks. Theoretically the paper suggests a rethinking of public industry...

  2. Investigation of palm methyl-ester bio-diesel with additive on performance and emission characteristics of a diesel engine under 8-mode testing cycle

    Directory of Open Access Journals (Sweden)

    S. Senthilkumar

    2015-09-01

    Full Text Available Biodiesel is receiving increasing attention each passing day because of its same diesel-like fuel properties and compatibility with petroleum-based diesel fueled engines. Therefore, in this paper the prospects and opportunities of using various blends of methyl esters of palm oil as fuel in an engine with and without the effect of multi-functional fuel additive (MFA, Multi DM 32 are studied to arrive at an optimum blend of bio-diesel best suited for low emissions and minimal power drop. Experimental tests were conducted on a four stroke, three cylinder and naturally aspirated D.I. Diesel engine with diesel and various blend percentages of 20%, 40%, 45%, and 50% under the 8 mode testing cycle. The effect of fuel additive was tested out on the optimum blend ratio of the bio-diesel so as to achieve further reduced emissions. Comparison of results shows that, 73% reduction in hydrocarbon emission, 46% reduction in carbon monoxide emission, and around 1% reduction in carbon dioxide emission characteristics. So it is observed that the blend ratio of 40% bio-diesel with MFA fuel additive creates reduced emission and minimal power drop due to effective combustion even when the calorific value is comparatively lower due to its higher cetane number.

  3. Emission potentials of future diesel fuel injection systems; Emissionspotentiale zukuenftiger Diesel-Einspritzsysteme

    Energy Technology Data Exchange (ETDEWEB)

    Schommers, J.; Breitbach, H.; Stotz, M.; Schnabel, M. [DaimlerChrysler AG (Germany)

    2007-07-01

    The historical evolution of the diesel engine correlates strongly with fuel injection system developments. Mercedes-Benz contributed significantly to the recent success of the diesel engine, being one of the first car manufacturers to introduce a modern common rail diesel engine in the Mercedes C220 CDI in 1997. The excellent characteristics of modern diesel engines resulted in a 50% market share in newly registered cars in Germany. These characteristics have to be further improved in the next years to keep the diesel engine attractive. Emissions and at the same time fuel consumption and noise need to be further reduced, while engine power has to go up. For Mercedes-Benz key steps to reach these goals are lower compression ratio, higher boost pressures, higher exhaust gas recirculation rates and better EGR cooling, multiple injection patterns and components with stable application parameters over lifetime. Important requirements for future fuel injection systems are high spray momentum, good stability over lifetime, good robustness of injected quantities for varying injection patterns and a low shot-to-shot variation of injected quantities. The high spray momentum has to be achieved especially for small injections and for part load operating points with low pressures. Therefore, the needle opening and closing velocities are of special importance. With special focus on the above requirements, different injector concepts were hydraulically evaluated. Both concepts in serial production and under development from system suppliers, as well as Mercedes-Benz developed prototype injector concepts were chosen. The concepts analysed are a servo-hydraulically driven injector with control piston, two servo-hydraulically driven injectors without control piston with differently adjusted hydraulics, and a direct driven injector, where the needle is driven directly from an actuator without servo-hydraulic amplification. The hydraulic investigations show an excellent performance of

  4. Reducing Diesel Engine Emission Using Reactivity Controlled Approach

    Directory of Open Access Journals (Sweden)

    Osama Hasib Ghazal

    2018-01-01

    Full Text Available Several automobile manufacturers are interested in investigating of dual fuel internal combustion engines, due to high efficiencand low emissions. Many alternative fuels have been used in dual fuel mode for IC engine, such as methane, hydrogen, and natural gas. In the present study, a reactivity controlled compression ignition (RCCI engine using gasoline/diesel (G/D dual fuel has been investigated. The effectof mixing gasoline with diesel fuel on combustion characteristic, engine performance and emissions has been studied. The gasoline was injected in the engine intake port, to produce a homogeneous mixture with air. The diesel fuel was injected directly to the combustion chamber during compression stroke to initiate the combustion process. A direct injection compression ignition engine has been built and simulated using ANSYS Forte professional code. The gasoline amount in the simulation varied from (50%-80% by volume. The diesel fuel was injected to the cylinder in two stages. The model has been validated and calibrated for neat diesel fuel using available data from the literature. The results show that the heat release rate and the cylinder pressure increased when the amount of added gasoline is between 50%-60% volume of the total injected fuels, compared to the neat diesel fuel. Further addition of gasoline will have a contrary effect. In addition, the combustion duration is extended drastically when the gasoline ratio is higher than 60% which results in an incomplete combustion. The NO emission decreased drastically as the gasoline ratio increased. Moreover, addition of gasoline to the mixture increased the engine power, thermal efficienc and combustion efficienc compared to neat diesel fuel.

  5. LPG as a Fuel for Diesel Engines-Experimental Investigations

    Science.gov (United States)

    Cristian Nutu, Nikolaos; Pana, Constantin; Negurescu, Niculae; Cernat, Alexandru; Mirica, Ionel

    2017-10-01

    The main objective of the paper is to reduce the pollutant emissions of a compression ignition engine, fuelling the engine with liquefied petroleum gas (LPG), aiming to maintain the energetic performances of the engine. To optimise the engine operation a corelation between the substitute ratio of the diesel fuel with LPG and the adjustments for the investigated regimens must be made in order to limit the maximum pressure and smoke level, knock and rough engine functioning, fuel consumption and the level of the pollutant emissions. The test bed situated in the Thermotechnics, Engines, Thermal Equipments and Refrigeration Instalations Department was adapted to be fuelled with liquefied petroleum gas. A conventional LPG fuelling instalation was adopted, consisting of a LPG tank, a vaporiser, conections between the tank and the vaporiser and a valve to adjust the gaseous fuel flow. Using the diesel-gas methode, in the intake manifold of the engine is injected LPG in gaseous aggregation state and the airr-LPG homogeneous mixture is ignited from the flame appeared in the diesel fuel sprays. To maintain the engine power at the same level like in the standard case of fuelling only with diesel fuel, for each investigated operate regimen the diesel fuel dose was reduced, being energetically substituted with LPG. The engine used for experimental investigations is a turbocharged truck diesel engine with a 10.34 dm3 displacement. The investigated working regimen was 40% load and 1750 rpm and the energetic substitute ratios of the diesel fuel with LPG was situated between [0-25%].

  6. Laser-induced-fluorescence imaging of NO in a eta-heptane- and diesel-fuel-driven diesel engine

    NARCIS (Netherlands)

    Brugman, T.M.; Klein-Douwel, R.J.H.; Huigen, G.; Walwijk, van E.; Meulen, ter J.J.

    1993-01-01

    Continuous on-line imaging by 2D-LIF techniques of in-cylinder NO distributions in a running Diesel engine is explored using an ArF-excimer laser at 193 nm operating at low power. For the first time NO excitation spectra could be measured as a result of high optical transparencies during

  7. TECHNICAL AND ENERGY PARAMETERS IMPROVEMENT OF DIESEL LOCOMOTIVES THROUGH THE INTRODUCTION OF AUTOMATED CONTROL SYSTEMS OF A DIESEL

    Directory of Open Access Journals (Sweden)

    M. I. Kapitsa

    2015-04-01

    Full Text Available Purpose. Today the issue, connected with diesel traction remains relevant for the majority of industrial enterprises and Ukrainian railways and diesel engine continues to be the subject of extensive research and improvements. Despite the intensive process of electrification, which accompanies Railway Transport of Ukraine the last few years, diesel traction continues to play an important role both in the main and in the industrial railway traction rolling stock. Anyway, all kinds of maneuvering and chores are for locomotives, they are improved and upgraded relentlessly and hourly. This paper is focused on finding the opportunities to improve technical and energy parameters of diesels due to the development of modern control method of the fuel equipment in the diesel engine. Methodology. The proposed method increases the power of locomotives diesel engines in the range of crankshaft rotation (from idle running to maximum one. It was based on approach of mixture ignition timing up to the top «dead» center of piston position. Findings. The paper provides a brief historical background of research in the area of operating cycle in the internal combustion engine (ICE. The factors affecting the process of mixing and its quality were analyzed. The requirements for fuel feed system in to the cylinder and the «weak points» of the process were presented. A variant of the modification the fuel pump drive, which allows approaching to the regulation of fuel feed system from the other hand and to improve it was proposed. Represents a variant of embodiment of the complex system with specification of mechanical features and control circuits. The algorithm of the system operation was presented and its impact on the performance of diesel was made. Originality. The angle regulating system of fuel supply allows automating the process of fuel injection advance angle into the cylinder. Practical value. At implementation the angle regulating system of fuel supply

  8. Ecological Diesel Now

    International Nuclear Information System (INIS)

    Carta Petrolera

    1999-01-01

    An ACPM (Diesel) lighter and of low contained of sulfur it will begin to elaborate the refinery of Ecopetrol in Barrancabermeja (Colombia); it will be the next product of the refinery that it receives the international certification of insurance of quality ISO-9002. The new ecological product will be dedicated initially to assist the demand in Bogota. Their characteristics understand 340 degrade Celsius of final point of boil and 0, 1% in weight of sulfur, what will contribute to reduce the levels of contamination of the air in the capital. It is the result of several years of the technical personnel's of the refinery investigation, where the distillation units adapted and the advantages that they offer took advantage raw light, of low contained of sulfur and paraffin

  9. Optimization of diesel engine performances for a hybrid wind-diesel system with compressed air energy storage

    International Nuclear Information System (INIS)

    Ibrahim, H.; Younes, R.; Basbous, T.; Ilinca, A.; Dimitrova, M.

    2011-01-01

    Electricity supply in remote areas around the world is mostly guaranteed by diesel generators. This relatively inefficient and expensive method is responsible for 1.2 million tons of greenhouse gas (GHG) emission in Canada annually. Some low- and high-penetration wind-diesel hybrid systems (WDS) have been experimented in order to reduce the diesel consumption. We explore the re-engineering of current diesel power plants with the introduction of high-penetration wind systems together with compressed air energy storage (CAES). This is a viable alternative to major the overall percentage of renewable energy and reduce the cost of electricity. In this paper, we present the operative principle of this hybrid system, its economic benefits and advantages and we finally propose a numerical model of each of its components. Moreover, we are demonstrating the energy efficiency of the system, particularly in terms of the increase of the engine performance and the reduction of its fuel consumption illustrated and supported by a village in northern Quebec. -- Highlights: → The Wind-Diesel-Compressed Air Storage System (WDCAS) has a very important commercial potential for remote areas. → The WDCAS is conceived like the adaptation of the existing engines at the level of the intake system. → A wind turbine and an air compression and storage system are added on the diesel plant. → This study demonstrates the potential of WDCAS to reduce fuel consumption and increase the efficiency of the diesel engine. → This study demonstrates that we can expect savings which can reach 50%.

  10. Diesel Engine Valve Clearance Detection Using Acoustic Emission

    Directory of Open Access Journals (Sweden)

    Fathi Elamin

    2010-01-01

    Full Text Available This paper investigated, using experimental method, the suitability of acoustic emission (AE technique for the condition monitoring of diesel engine valve faults. The clearance fault was adjusted experimentally in an exhaust valve and successfully detected and diagnosed in a Ford FSD 425 four-cylinder, four-stroke, in-line OHV, direct injection diesel engine. The effect of faulty exhaust valve clearance on engine performance was monitored and the difference between the healthy and faulty engine was observed from the recorded AE signals. The measured results from this technique show that using only time domain and frequency domain analysis of acoustic emission signals can give a superior measure of engine condition. This concludes that acoustic emission is a powerful and reliable method of detection and diagnosis of the faults in diesel engines and this is considered to be a unique approach to condition monitoring of valve performance.

  11. Diesel fueled ship propulsion fuel cell demonstration project

    Energy Technology Data Exchange (ETDEWEB)

    Kumm, W.H. [Arctic Energies Ltd., Severna Park, MD (United States)

    1996-12-31

    The paper describes the work underway to adapt a former US Navy diesel electric drive ship as a 2.4 Megawatt fuel cell powered, US Coast Guard operated, demonstrator. The Project will design the new configuration, and then remove the four 600 kW diesel electric generators and auxiliaries. It will design, build and install fourteen or more nominal 180 kW diesel fueled molten carbonate internal reforming direct fuel cells (DFCs). The USCG cutter VINDICATOR has been chosen. The adaptation will be carried out at the USCG shipyard at Curtis Bay, MD. A multi-agency (state and federal) cooperative project is now underway. The USCG prime contractor, AEL, is performing the work under a Phase III Small Business Innovation Research (SBIR) award. This follows their successful completion of Phases I and II under contract to the US Naval Sea Systems (NAVSEA) from 1989 through 1993 which successfully demonstrated the feasibility of diesel fueled DFCs. The demonstrated marine propulsion of a USCG cutter will lead to commercial, naval ship and submarine applications as well as on-land applications such as diesel fueled locomotives.

  12. Combustion of Microalgae Oil and Ethanol Blended with Diesel Fuel

    Directory of Open Access Journals (Sweden)

    Saddam H. Al-lwayzy

    2015-12-01

    Full Text Available Using renewable oxygenated fuels such as ethanol is a proposed method to reduce diesel engine emission. Ethanol has lower density, viscosity, cetane number and calorific value than petroleum diesel (PD. Microalgae oil is renewable, environmentally friendly and has the potential to replace PD. In this paper, microalgae oil (10% and ethanol (10% have been mixed and added to (80% diesel fuel as a renewable source of oxygenated fuel. The mixture of microalgae oil, ethanol and petroleum diesel (MOE20% has been found to be homogenous and stable without using surfactant. The presence of microalgae oil improved the ethanol fuel demerits such as low density and viscosity. The transesterification process was not required for oil viscosity reduction due to the presence of ethanol. The MOE20% fuel has been tested in a variable compression ratio diesel engine at different speed. The engine test results with MOE20% showed a very comparable engine performance of in-cylinder pressure, brake power, torque and brake specific fuel consumption (BSFC to that of PD. The NOx emission and HC have been improved while CO and CO2 were found to be lower than those from PD at low engine speed.

  13. Noise Optimization in Diesel Engines

    Directory of Open Access Journals (Sweden)

    S. Narayan

    2014-04-01

    Full Text Available Euro 6 norms emphasize on reduction of emissions from the engines. New injection methods are being adopted for homogenous mixture formation in diesel engines. During steady state conditions homogenous combustion gave noise levels in lower frequencies. In this work noise produced in a 440 cc diesel engine has been investigated. The engine was run under various operating conditions varying various injection parameters.

  14. Research on application of mobile diesel equipment in underground mines 2

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Bok Youn; Kang, Chang Hee; Jo, Young Do; Lim, Sang Taek [Korea Inst. of Geology Mining and Materials, Taejon (Korea, Republic of)

    1995-12-01

    It is 2 nd year of the research project on application of mobile diesel equipment in underground mines for providing appropriate measures to improve underground working environment contaminated by the diesel exhaust pollutants. Studies on Diesel Particulate Matter(DPM), which is regarded as a carcinogenic substances, was carried out intensively to figure out which substance is the most critical one among the diesel exhaust pollutants. The production mechanism and health effects of DPM, and evaluation of hazard level of underground workings was conducted. For development of exhaust treatment devices and recommendation of the best concept suitable for local conditions has been done. And the basic guidelines for good engine maintenance to provide the safe and healthful use of diesel-powered mine equipment were suggested so that field engineers can use it as a reference in daily operations. (author). 19 refs., 31 figs., 41 tabs.

  15. Alternative fuel properties of tall oil fatty acid methyl ester-diesel fuel blends

    Energy Technology Data Exchange (ETDEWEB)

    Altiparmak, D.; Keskin, A.; Koca, A. [Gazi University, Ankara (Turkey). Technical Education Faculty; Guru, M. [Gazi University, Ankara (Turkey). Engineering and Architectural Faculty

    2007-01-15

    In this experimental work, tall oil methyl ester-diesel fuel blends as alternative fuels for diesel engines were studied. Tall oil methyl ester was produced by reacting tall oil fatty acids with methyl alcohol under optimum conditions. The blends of tall oil methyl ester-diesel fuel were tested in a direct injection diesel engine at full load conditions. The effects of the new fuel blends on the engine performance and exhaust emission were tested. It was observed that the engine torque and power output with tall oil methyl ester-diesel fuel blends increased up to 6.1% and 5.9%, respectively. It was also seen that CO emissions decreased to 38.9% and NO{sub x} emissions increased up to 30% with the new fuel blends. The smoke capacity did not vary significantly. (author)

  16. Alternative fuel properties of tall oil fatty acid methyl ester-diesel fuel blends.

    Science.gov (United States)

    Altiparmak, Duran; Keskin, Ali; Koca, Atilla; Gürü, Metin

    2007-01-01

    In this experimental work, tall oil methyl ester-diesel fuel blends as alternative fuels for diesel engines were studied. Tall oil methyl ester was produced by reacting tall oil fatty acids with methyl alcohol under optimum conditions. The blends of tall oil methyl ester-diesel fuel were tested in a direct injection diesel engine at full load condition. The effects of the new fuel blends on the engine performance and exhaust emission were tested. It was observed that the engine torque and power output with tall oil methyl ester-diesel fuel blends increased up to 6.1% and 5.9%, respectively. It was also seen that CO emissions decreased to 38.9% and NO(x) emissions increased up to 30% with the new fuel blends. The smoke opacity did not vary significantly.

  17. Diesel engine management systems and components

    CERN Document Server

    2014-01-01

    This reference book provides a comprehensive insight into todays diesel injection systems and electronic control. It focusses on minimizing emissions and exhaust-gas treatment. Innovations by Bosch in the field of diesel-injection technology have made a significant contribution to the diesel boom. Calls for lower fuel consumption, reduced exhaust-gas emissions and quiet engines are making greater demands on the engine and fuel-injection systems. Contents History of the diesel engine.- Areas of use for diesel engines.- Basic principles of the diesel engine.- Fuels: Diesel fuel.- Fuels: Alternative fuels.- Cylinder-charge control systems.- Basic principles of diesel fuel-injection.- Overview of diesel fuel-injection systems.- Fuel supply to the low pressure stage.- Overview of discrete cylinder systems.- Unit injector system.- Unit pump system.- Overview of common-rail systems.- High pressure components of the common-rail system.- Injection nozzles.- Nozzle holders.- High pressure lines.- Start assist systems.-...

  18. One dimensional modeling of a diesel-CNG dual fuel engine

    Science.gov (United States)

    Azman, Putera Adam; Fawzi, Mas; Ismail, Muammar Mukhsin; Osman, Shahrul Azmir

    2017-04-01

    Some of the previous studies have shown that the use of compressed natural gas (CNG) in diesel engines potentially produce engine performance improvement and exhaust gas emission reduction, especially nitrogen oxides, unburned hydrocarbons, and carbon dioxide. On the other hand, there are other researchers who claimed that the use of CNG increases exhaust gas emissions, particularly nitrogen oxides. In this study, a one-dimensional model of a diesel-CNG dual fuel engine was made based on a 4-cylinder 2.5L common rail direct injection diesel engine. The software used is GT-Power, and it was used to analyze the engine performance and exhaust gas emissions of several diesel-CNG dual fuel blend ratios, i.e. 100:0, 90:10, 80:20, 70:30, 60:40 and 50:50. The effect of 100%, 75%, 50% engine loads on the exhaust gas emissions were also studied. The result shows that all diesel-CNG fuel blends produces higher brake torque and brake power at engine speed of 2000-3000 rpm compared with 100% diesel. The 50:50 diesel-CNG blend produces the highest brake torque and brake power, but also has the highest brake specific fuel consumption. As a higher percentage of CNG added to the dual fuel blend, unburned hydrocarbons and carbon monoxide emission increased while carbon dioxide emission decreased. The nitrogen oxides emission concentration is generally unaffected by any change of the dual fuel ratio.

  19. Energy Analysis of a Diesel Engine Using Diesel and Biodiesel from Waste Cooking Oil

    Directory of Open Access Journals (Sweden)

    S Abbasi

    2018-03-01

    University. The engine is connected to a dynamometer and after reaching steady state conditions data were obtained (Fig. 1. In thermal balance study, combustion process merely as a process intended to free up energy fuel and the first law of thermodynamics is used (Koochak et al., 2000. The energy contained in fuel converted to useful and losses energies by combustion. Useful energy measured by dynamometer as brake power and losses energy including exhaust emission, cooling system losses and uncontrollable energy losses. Variance analysis of all engine energy balance done by split plot design based on a completely randomized design and the means were compared with each other using Duncan test at 5% probability. Results and Discussion Results showed that, in general, biodiesel use has a significant impact on all components of energy balance. Of total energy from fuel combustion, the share of energy losses to form of exhaust emissions the maximum value in all percentages allocated to biodiesel (Average 51.715 percent with the maximum and minimum amount of B42 (55.982 percent and B0 (46.481 percent, respectively (Fig. 2. Also, fuel blend with 12% biodiesel was diagnosed the best blend because of having the most useful power, having the lowest energy losses through the exhaust and cooling system. Conclusions Using biodiesel produced from waste cooking oil by transesterification process, lead to increase the useful power. The addition of biodiesel to pure diesel cause to significant reduction in the waste energy due to friction. In higher amounts of biodiesel increase energy losses especially through the exhaust and cooling system due to higher viscosity.

  20. Trend and future of diesel engine: Development of high efficiency and low emission low temperature combustion diesel engine

    International Nuclear Information System (INIS)

    Ho, R J; Yusoff, M Z; Palanisamy, K

    2013-01-01

    Stringent emission policy has put automotive research and development on developing high efficiency and low pollutant power train. Conventional direct injection diesel engine with diffused flame has reached its limitation and has driven R and D to explore other field of combustion. Low temperature combustion (LTC) and homogeneous charge combustion ignition has been proven to be effective methods in decreasing combustion pollutant emission. Nitrogen Oxide (NO x ) and Particulate Matter (PM) formation from combustion can be greatly suppressed. A review on each of method is covered to identify the condition and processes that result in these reductions. The critical parameters that allow such combustion to take place will be highlighted and serves as emphasis to the direction of developing future diesel engine system. This paper is written to explore potential of present numerical and experimental methods in optimizing diesel engine design through adoption of the new combustion technology.

  1. Trend and future of diesel engine: Development of high efficiency and low emission low temperature combustion diesel engine

    Science.gov (United States)

    Ho, R. J.; Yusoff, M. Z.; Palanisamy, K.

    2013-06-01

    Stringent emission policy has put automotive research & development on developing high efficiency and low pollutant power train. Conventional direct injection diesel engine with diffused flame has reached its limitation and has driven R&D to explore other field of combustion. Low temperature combustion (LTC) and homogeneous charge combustion ignition has been proven to be effective methods in decreasing combustion pollutant emission. Nitrogen Oxide (NOx) and Particulate Matter (PM) formation from combustion can be greatly suppressed. A review on each of method is covered to identify the condition and processes that result in these reductions. The critical parameters that allow such combustion to take place will be highlighted and serves as emphasis to the direction of developing future diesel engine system. This paper is written to explore potential of present numerical and experimental methods in optimizing diesel engine design through adoption of the new combustion technology.

  2. Properties and use of Moringa oleifera biodiesel and diesel fuel blends in a multi-cylinder diesel engine

    International Nuclear Information System (INIS)

    Mofijur, M.; Masjuki, H.H.; Kalam, M.A.; Atabani, A.E.; Arbab, M.I.; Cheng, S.F.; Gouk, S.W.

    2014-01-01

    Highlights: • Potential of biodiesel production from crude Moringa oleifera oil. • Characterization of M. oleifera biodiesel and its blend with diesel fuel. • Evaluation of M. oleifera biodiesel blend in a diesel engine. - Abstract: Researchers have recently attempted to discover alternative energy sources that are accessible, technically viable, economically feasible, and environmentally acceptable. This study aims to evaluate the physico-chemical properties of Moringa oleifera biodiesel and its 10% and 20% by-volume blends (B10 and B20) in comparison with diesel fuel (B0). The performance and emission of M. oleifera biodiesel and its blends in a multi-cylinder diesel engine were determined at various speeds and full load conditions. The properties of M. oleifera biodiesel and its blends complied with ASTM D6751 standards. Over the entire range of speeds, B10 and B20 fuels reduced brake power and increased brake specific fuel consumption compared with B0. In engine emissions, B10 and B20 fuels reduced carbon monoxide emission by 10.60% and 22.93% as well as hydrocarbon emission by 9.21% and 23.68%, but slightly increased nitric oxide emission by 8.46% and 18.56%, respectively, compared with B0. Therefore, M. oleifera is a potential feedstock for biodiesel production, and its blends B10 and B20 can be used as diesel fuel substitutes

  3. Uso de etanol carburado en motores Diesel

    Directory of Open Access Journals (Sweden)

    Rodríguez Luis Arnoby

    1990-06-01

    Full Text Available Este trabajo se ejecutó en el Taller de Maquinaria Agrícola de la Facultad de Ciencias Agropecuarias de la Universidad Nacional de Colombia, Seccional Palmira. Un motor diesel de 2 cilindros, 1260 cm3 y relación de comprensión 23:1, fue alimentado mediante un sistema dual formado por el sistema de inyección para ACPM y un sistema de carburación para etanol y mezclas etanol-agua. En primer término se varió el avance de la inyección entre 18 y 26° APMS(Antes de Punto Muerto Superior con el fin de determinar el avance óptimo de inyección en el motor original y el motor alimentado con el sistema dual. Con base en el punto de máxima potencia, se seleccionaron 20 y 22" como avances óptimos. En la segunda prueba, al operar el motor con carga y velocidad variables y alimentarlo con cuatro combustibles (ACPM, etanol y mezclas etanol- agua con 20 y 40 % agua, se incrementaron la velocidad en 10% la potencia máxima en 6.5% ; y el torque máximo en 3.73%, desde el motor original al sistema dual alimentado con la mezcla carburada de 40% agua. La mayor sustitución de combustible se presentó a alta velocidad donde se reemplazó hasta el 32 % de ACPM por etanol. Solo a alta velocidad se justifica la sobrealimentación con etanol carburado. En este rango se presentaron aumentos de potencia, velocidad, par torsor y sustitución de combustible.This work was performed in the Agricultural Mechanics Shop of the Universidad Nacional of Colombia in Palmira. A two-cylinder, 1260 cm3 diesel engine with a compression ratio of 23:1 was fueled by a dual system formed by its injection system for diesel oil and a carburation system for ethanol and ethanol-water blends. In a first test, m e injection advance was varied between 18 and 26 o BTDC (Before Top Dead Center to determine the optimum injection advance in the original engine and the engine fueled with the dual system. According to the maximum power point, 20 and 22° BTDC were selected as the optimum

  4. THE EFFECT OF KARANJA OIL METHYL ESTER ON KIRLOSKAR HA394DI DIESEL ENGINE PERFORMANCE AND EXHAUST EMISSIONS

    Directory of Open Access Journals (Sweden)

    Sharanappa K Godiganur

    2010-01-01

    Full Text Available Biofuels are being investigated as potential substitutes for current high pollutant fuels obtained from the conventional sources. The primary problem associated with using straight vegetable oil as fuel in a compression ignition engine is caused by viscosity. The process of transesterifiction of vegetable oil with methyl alcohol provides a significant reduction in viscosity, thereby enhancing the physical properties of vegetable oil. The Kirloskar HA394 compression ignition, multi cylinder diesel engine does not require any modification to replace diesel by karanja methyl ester. Biodiesel can be used in its pure form or can be blended with diesel to form different blends. The purpose of this research was to evaluate the potential of karanja oil methyl ester and its blend with diesel from 20% to 80% by volume. Engine performance and exhaust emissions were investigated and compared with the ordinary diesel fuel in a diesel engine. The experimental results show that the engine power of the mixture is closed to the values obtained from diesel fuel and the amounts of exhaust emissions are lower than those of diesel fuel. Hence, it is seen that the blend of karanja ester and diesel fuel can be used as an alternative successfully in a diesel engine without any modification and in terms of emission parameters; it is an environmental friendly fuel

  5. A probabilistic evaluation of temporarily extending the diesel generator limiting condition for operation

    International Nuclear Information System (INIS)

    Kukielka, C.A.; Detamore, M.B.

    1986-01-01

    Pennsylvania Power and Light Company is installing a fifth diesel generator at its Susquehanna Steam Electric Station. This new diesel generator will serve as a ''swing'' diesel generator, i.e., perform the function of any of the existing diesel generators. The addition of this diesel generator avoids a dual unit shutdown should a diesel generator outage for maintenance or repair exceed the three day Technical Specification Limiting Condition for Operation (LCO). It is estimated that up to fifteen days per diesel generator will be required to complete the tie-in. In accordance with the existing three day LCO, a dual unit shutdown would then result. To preclude such a shutdown, a one time temporary extension to the three day LCO was requested of the Nuclear Regulatory Commission (NRC). This paper presents a probabilistic evaluation that was used to estimate the increased risk due to extending the LCO to a cumulative sixty days to allow the tie-in of the fifth diesel generator

  6. Combustion Performance and Exhaust Emission of DI Diesel Engine Using Various Sources of Waste Cooking Oil

    Science.gov (United States)

    Afiq, Mohd; Azuhairi, Mohd; Jazair, Wira

    2010-06-01

    In Malaysia, more than 200-tone of cooking oil are used by domestic users everyday. After frying process, about a quarter of these cooking oil was remained and drained into sewage system. This will pollutes waterways and affects the ecosystem. The use of waste cooking oil (WCO) for producing bio-diesel was considered in economical factor which current production cost of bio-diesel production is higher in Malaysia due to higher price of palm oil. Thus, the aim of this study is to investigate the most suitable source of WCO to become a main source of bio-diesel for bio-diesel production in this country. To perform this research, three type of WCO were obtained from house's kitchen, cafeteria and mamak's restaurant. In this study, prospect of these bio-diesel source was evaluated based on its combustion performance and exhaust emissions operated in diesel engine in the form of waste cooking oil methyl ester (WCOME) and have been compared with pure diesel fuel. A 0.6 liter, single-cylinder, air-cooled direct injection diesel engine was used to perform this experiment. Experiment was done at variable engine loads and constant engine speed. As the result, among three stated WCOMEs, the one collected from house's kitchen gives the best performance in term of brake specific fuel consumption (bsfc) and brake power (BP) with lowest soot emission.

  7. Trends in Asian diesel fuel quality

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2000-01-01

    An overview of the Asia-Pacific petrol and diesel markets is presented covering the diesel demand and quality in the sub regions of Australia/New Zealand, East Asia (Japan, China), South Asia, and Southeast Asia (Malaysia, Indonesia, Thailand, Philippines, Singapore) and the trend towards lower sulphur diesels in Asia. Plots are presented illustrating Asia-Pacific diesel demand by regional submarket (1985-2005), the steady reductions in Asia-Pacific diesel sulphur levels (1990-2000), and the average sulphur content and tpd sulphur in Asian diesel

  8. Theoretical modeling of combustion characteristics and performance parameters of biodiesel in DI diesel engine with variable compression ratio

    Energy Technology Data Exchange (ETDEWEB)

    Al-Dawody, Mohamed F.; Bhatti, S.K. [Department of Mechanical Engineering, Andhra University (India)

    2013-07-01

    Increasing of costly and depleting fossil fuels are prompting researchers to use edible as well as non-edible vegetable oils as a promising alternative to petro-diesel fuels. A comprehensive computer code using ''Quick basic'' language was developed for the diesel engine cycle to study the combustion and performance characteristics of a single cylinder, four stroke, direct injection diesel engine with variable compression ratio. The engine operates on diesel fuel and 20% (mass basis) of biodiesel (derived from soybean oil) blended with diesel. Combustion characteristics such as cylinder pressure, heat release fraction, heat transfer and performance characteristics such as brake power; and brake specific fuel consumption (BSFC) were analyzed. On the basis of the first law of thermodynamics the properties at each degree crank angle was calculated. Wiebe function is used to calculate the instantaneous heat release rate. The computed results are validated through the results obtained in the simulation Diesel-rk software.

  9. An experimental study on the effect of using gas-to-liquid (GTL fuel on diesel engine performance and emissions

    Directory of Open Access Journals (Sweden)

    M.A. Bassiony

    2016-09-01

    Full Text Available Gas to Liquid (GTL fuel is considered one of the most propitious clean alternative fuels for the diesel engines. The aim of this study was to experimentally compare the performance and emissions of a diesel engine fueled by GTL fuel, diesel, and a blend of GTL and diesel fuels with a mixing ratio of 1:1 by volume (G50 at various engine load and speed conditions. Although using the GTL and G50 fuels decreased slightly the engine maximum power compared to the diesel fuel, both the engine brake thermal efficiency and engine brake specific fuel consumption were improved. In addition, using the GTL and G50 fuels as alternatives to the diesel resulted in a significant decrease in engine CO, NOx, and SO2 emissions.

  10. AUTOMOTIVE DIESEL MAINTENANCE 1. UNIT XXVI, I--CATERPILLAR LUBRICATION SYSTEMS AND COMPONENTS, II--LEARNING ABOUT BRAKES (PART I).

    Science.gov (United States)

    Minnesota State Dept. of Education, St. Paul. Div. of Vocational and Technical Education.

    THIS MODULE OF A 30-MODULE COURSE IS DESIGNED TO DEVELOP AN UNDERSTANDING OF THE FUNCTIONS OF DIESEL ENGINE LUBRICATION SYSTEMS AND COMPONENTS AND THE PRINCIPLES OF OPERATION OF BRAKE SYSTEMS USED ON DIESEL POWERED VEHICLES. TOPICS ARE (1) THE NEED FOR OIL, (2) SERVICE CLASSIFICATION OF OILS, (3) CATERPILLAR LUBRICATION SYSTEM COMPONENTS (4)…

  11. Effect of vegetable de-oiled cake-diesel blends on diesel engine

    Energy Technology Data Exchange (ETDEWEB)

    Raj, C.S. [Bharathiyar College of Engineering and Technology, Karaikal (India). MGR Educational and Research Inst.; Arivalagar, A.; Sendilvelan, S. [MGR Univ., Chennai (India). MGR Educational and Research Inst.; Arul, S. [Panimalar College of Engineering, Channai (India)

    2009-07-01

    This study evaluated the use of coconut oil methyl ester (COME) as a blending agent with the vegetable de-oiled cakes used in biodiesel production. Different proportions of the de-oiled cake were combined with diesel in order to investigate performance, emissions, and combustion characteristics. The experiments were conducted on a 4-stroke single cylinder, air-cooled diesel engine. Fuel flow rates were measured and a thermocouple was used to measure exhaust gas temperatures. A combustion analyzer was used to measure cylinder pressure and heat release rates. Brake thermal efficiency, brake power, and specific fuel consumption performance was monitored. Results of the study showed that rates of heat release were reduced for the de-oiled cake blended fuels as a result of the change in fuel molecular weight. The variation of NOx with load for neat diesel blends was examined. There was no variation of NOx emission up to 50 per cent of load for all blended oils, and it increased with load. Smoke density was reduced for all blends. Soot production was decreased by the oxygen present in the de-oiled cake. The study showed that fossil fuel oil consumption decreased by 14 to 15 per cent when the de-oiled biodiesel was used at low loads, and 4 to 5 per cent at peak loads. 10 refs., 4 tabs., 9 figs.

  12. Experimental evaluation of Diesel engine performance and emission using blends of jojoba oil and Diesel fuel

    International Nuclear Information System (INIS)

    Huzayyin, A.S.; Bawady, A.H.; Rady, M.A.; Dawood, A.

    2004-01-01

    An experimental evaluation of using jojoba oil as an alternate Diesel engine fuel has been conducted in the present work. Measurements of jojoba oil chemical and physical properties have indicated a good potential of using jojoba oil as an alternative Diesel engine fuel. Blending of jojoba oil with gas oil has been shown to be an effective method to reduce engine problems associated with the high viscosity of jojoba oil. Experimental measurements of different performance parameters of a single cylinder, naturally aspirated, direct injection, Diesel engine have been performed using gas oil and blends of gas oil with jojoba oil. Measurements of engine performance parameters at different load conditions over the engine speed range have generally indicated a negligible loss of engine power, a slight increase in brake specific fuel consumption and a reduction in engine NO x and soot emission using blends of jojoba oil with gas oil as compared to gas oil. The reduction in engine soot emission has been observed to increase with the increase of jojoba oil percentage in the fuel blend

  13. Experimental evaluation of diesel engine performance and emission using blends of jojoba oil and diesel fuel

    Energy Technology Data Exchange (ETDEWEB)

    Huzayyin, A.S.; Rady, M.A.; Dawood, A. [Benha High Inst. of Technology (Egypt). Dept. of Mechanical Engineering Technology; Bawady, A.H. [University of Ain Shams, Cairo (Egypt). Faculty of Engineering

    2004-08-01

    An experimental evaluation of using jojoba oil as an alternate diesel engine fuel has been conducted in the present work. Measurements of jojoba oil chemical and physical properties have indicated a good potential of using jojoba oil as an alternative diesel engine fuel. Blending of jojoba oil with gas oil has been shown to be an effective method to reduce engine problems associated with the high viscosity of jojoba oil. Experimental measurements of different performance parameters of a single cylinder, naturally aspirated, direct injection, diesel engine have been performed using gas oil and blends of gas oil with jojoba oil. Measurements of engine performance parameters at different load conditions over the engine speed range have generally indicated a negligible loss of engine power, a slight increase in brake specific fuel consumption and a reduction in engine NO{sub x} and soot emission using blends of jojoba oil with gas oil as compared to gas oil. The reduction in engine soot emission has been observed to increase with the increase of jojoba oil percentage in the fuel blend. (Author)

  14. Epigenetic regulation of facultative heterochromatinisation in Planococcus citri via the Me(3)K9H3-HP1-Me(3)K20H4 pathway.

    Science.gov (United States)

    Bongiorni, Silvia; Pasqualini, Barbara; Taranta, Monia; Singh, Prim B; Prantera, Giorgio

    2007-03-15

    Using RNA interference (RNAi) we have conducted a functional analysis of the HP1-like chromobox gene pchet2 during embryogenesis of the mealybug Planococcus citri. Knocking down pchet2 expression results in decondensation of the male-specific chromocenter that normally arises from the developmentally-regulated facultative heterochromatinisation of the paternal chromosome complement. Together with the disappearance of the chromocenter the staining levels of two associated histone modifications, tri-methylated lysine 9 of histone H3 [Me(3)K9H3] and tri-methylated lysine 20 of histone H4 [Me(3)K20H4], are reduced to undetectable levels. Embryos treated with double-stranded RNA (dsRNA) targeting pchet2 also exhibit chromosome abnormalities, such as aberrant chromosome condensation, and also the presence of metaphases that contain 'lagging' chromosomes. We conclude that PCHET2 regulates chromosome behavior during metaphase and is a crucial component of a Me(3)K9H3-HP1-Me(3)K20H4 pathway involved in the facultative heterochromatinisation of the (imprinted) paternal chromosome set.

  15. Diesel fuel long term storage and treatment- recommended tests and practices (U)

    Energy Technology Data Exchange (ETDEWEB)

    Gross, R. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2009-06-05

    The Clean Air Act (1970) is the comprehensive federal law that regulates air emissions from stationary and mobile sources. Among other things, this law authorized the Environmental Protection Agency (EPA) to establish National Ambient Air Quality Standards to protect public health and public welfare and to regulate emissions of hazardous air pollutants. In recent years, EPA regulations have forced oil refineries into producing a very low sulfur diesel fuel and incentives for adding up to 5% bio-diesel. These changes to the fuel oil formulation are beneficial to air quality and to energy conservation, but adversely impact heat content, long term storage stability, engine power, and injection system reliability. Diesel engines typically have a high incidence of injector failure resulting from poor diesel fuel quality. Since standby diesel engines do not run continuously it is necessary to implement periodic surveillance's to ensure the quality of diesel fuel is acceptable for reliable operation when a loss of power occurs. The information contained in this document is a compilation of best practices to be used as a guide for maintenance of a reliable diesel fuel system.

  16. STUDY ON THE NITROGEN OXIDES EMISSIONS GENERATED BY THE DIRECT INJECTION DIESEL ENGINES RUNNING WITH BIODIESEL

    Directory of Open Access Journals (Sweden)

    Doru Cosofret

    2016-05-01

    Full Text Available Currently, research results on the use of mixtures of biofuels with fossil fuels to power diesel engines are controversial in terms of reducing emissions of NO in the exhaust gases of diesel engines. This diversity on the results is due to possibly different type of biodiesel used, the type of engine on which the tests were carried out and the methods and conditions for obtaining these results. Therefore research on biodiesel mixed with diesel is still a matter of study. In this regard, we conducted a laboratory study on a 4-stroke diesel engine naturally aspirated, using different mixtures (10, 15, 20, 25, 30, 40 and 50% of diesel with biodiesel made from rapeseed oil. The study results revealed that the NO emissions of the mixtures used are lower than the same emissions produced when the engine is powered with diesel. Also, the emissions of NO do not have a significant drop in the case of mixtures compared with the diesel fuel.

  17. Evaluation of a diesel engine running with stationary mixtures of soybean oil and reused oil diesel; Avaliacao de um motor diesel estacionario funcionando com misturas de oleo de soja reutilizado e oleo diesel

    Energy Technology Data Exchange (ETDEWEB)

    Maronhas, Maite E.S.; Fernandes, Haroldo C.; Siqueira, Wagner C.; Figueiredo, Augusto C. [Universidade Federal de Vicosa (UFV), MG (Brazil)], Emails: maronhas@gmail.com, haroldo@ufv.br, augusto.figueiredo@ufv.br

    2009-07-01

    The tests were conducted at the Laboratory of Agricultural Mechanization Department of Agricultural Engineering, Federal University of Vicosa using a stationary diesel engine Yanmar brand NS{sub B} 75, with nominal power of 5.8 kw at 2400 rpm, direct injection, and water cooled. This work aimed to examine the reuse of soybean oil to drive the engine stationary. Were used as fuel five mixtures of diesel oil (DO) and soybean oil (OS) re-used in the kitchen of the restaurant of the university in the proportions of 0-100%, 25-75%, 50-50%, 75-25 % and 100-0% respectively. The power and torque of the engine is higher for the mixture showed a 75% OD and 25% OS and 25% lower for DO and 75% OS. The lowest hourly consumption was with a mixture of 25% and 75% OD and OS was 15% lower than for the pure diesel. The values found justifying the use of mixtures of diesel and soybean oil reused, but the technical aspects, especially regarding the wear of the engine, must be evaluated to indicate the use after a long period of engine operation. (author)

  18. OXIDATIVE DNA DAMAGE IN DIESEL BUS MECHANICS

    Science.gov (United States)

    Rationale: Diesel exposure has been associated with adverse health effects, including susceptibility to asthma, allergy and cancer. Previous epidemiological studies demonstrated increased cancer incidence among workers exposed to diesel. This is likely due to oxid...

  19. Village power in Thailand

    Energy Technology Data Exchange (ETDEWEB)

    Bergey, M.

    1997-12-01

    This paper presents an overview of the electric power system in Thailand. 99% of the country is electrified, but much of this is with diesel generators which leaves high costs but a high level of service. The paper discusses renewable energy projects which have been sited in the country, and examples of hybrid systems which have been retrofit into existing diesel generator systems. Photovoltaic and hydroelectric power projects are described. Dedicated systems have been installed for water pumping and battery charging applications.

  20. How to design your stand-by diesel generator unit for maximum reliability

    International Nuclear Information System (INIS)

    Kauffmann, W.M.

    1979-01-01

    Critical stand-by power applications, such as in a nuclear plant, or radio support stations, demand exacting guidelines for positive start, rapid acceleration, load acceptance with minimum voltage drop, and quick recovery to rated voltage. The design of medium-speed turbocharged and intercooled diesel-engine-generator for this purpose is considered. Selection of the diesel engine, size, and number of units, from the standpoint of cost, favors minimum number of units with maximum horsepower capability. Four-cycle diesels are available in 16 to 20 cyinders V-configurations, with 200 BMEP (brake mean-effective pressure) continuous and 250 BMEP peaking

  1. A probabilistic maintenance model for diesel engines

    Science.gov (United States)

    Pathirana, Shan; Abeygunawardane, Saranga Kumudu

    2018-02-01

    In this paper, a probabilistic maintenance model is developed for inspection based preventive maintenance of diesel engines based on the practical model concepts discussed in the literature. Developed model is solved using real data obtained from inspection and maintenance histories of diesel engines and experts' views. Reliability indices and costs were calculated for the present maintenance policy of diesel engines. A sensitivity analysis is conducted to observe the effect of inspection based preventive maintenance on the life cycle cost of diesel engines.

  2. The performance and emissions of diesel engines with biodiesel of sunan pecan seed and diesel oil blends

    Science.gov (United States)

    Ariani, F.; Sitorus, T. B.; Ginting, E.

    2017-12-01

    An observation was performed to evaluate the performance of direct injection stationary diesel engine which used a blends of biodiesel of Sunan pecan seed. The experiments were done with diesel oil, B5, B10, B15 and B20 in the engine speed variety. Results showed that the values of torque, power and thermal efficiency tend to decrease when the engine is using B5, B10, B15 and B20, compared to diesel oil. It also shown that the specific fuel consumption is increased when using B5, B10, B15 and B20. From the results of experiments and calculations, the maximum power of 3.08 kW, minimum specific fuel consumption of 189.93 g/kWh and maximum thermal efficiency of 45.53% when engine using diesel oil. However, exhaust gases were measured include opacity, carbon monoxide and hydrocarbon when the engine using biodiesel B5, B10, B15 and B20 decreased.

  3. Operational experience and maintenance programs of Transamerica Delaval, Inc., diesel generators

    International Nuclear Information System (INIS)

    Rajan, J.R.

    1994-05-01

    Concerns regarding the reliability of large-bore, medium-speed diesel generators manufactured by Transamerica Delaval, Inc. (TDI) for application at domestic nuclear plants were first prompted by a crankshaft failure at Shoreham Nuclear Power Station in August 1983. A number of diesel generator components were identified which had potential deficiencies from a manufacturing and operational standpoint. In response to these problems, 11 (now 8) U.S. nuclear utility owners formed a TDI Diesel Generator Owners Group (Owners Group) to address operational and regulatory issues relative to diesel generator sets used for standby emergency power. The Owners' Group performed extensive design reviews of all key engine components and developed recommendations to be implemented by the individual owners concerning needed component replacements and modifications, component inspections to validate the open-quotes as-manufacturedclose quotes and open-quotes as-assembledclose quotes quality of key engine components, engine testing, and an enhanced maintenance and surveillance program

  4. Costa de Cocos 11-kW wind-diesel hybrid system

    Energy Technology Data Exchange (ETDEWEB)

    Corbus, D. [National Renewable Energy Lab., Golden, CO (United States); Bergey, M. [Bergey Windpower Company, Norman, OK (United States)

    1997-12-31

    Costa de Cocos is a small resort located in the state of Quintana Roo, Mexico. Using the existing diesel generator, the resort`s power system was retrofitted to a wind-hybrid diesel system. The reason for this retrofit was to supply 24-hour power, to reduce diesel fuel by using wind energy, and to reduce diesel air and noise emissions in order to promote ecotourism. The wind system was installed in October 1996 with cost-shared funding from the U.S. Department of Energy/U.S. Agency for International Development renewable energy program in Mexico. The National Renewable Energy Laboratory (NREL) supplied technical assistance to the project. Discussed in this paper are the system design, installation, and initial performance.

  5. Costa de Cocos 11-kW wind-diesel hybrid system

    Energy Technology Data Exchange (ETDEWEB)

    Corbus, D [National Renewable Energy Lab., Golden, CO (United States); Bergey, M [Bergey Windpower Co., Norman, OK (United States)

    1997-09-01

    Costa de Cocos is a small resort located in the state of Quintana Roo, Mexico. Using the existing diesel generator, the resort`s power system was retrofitted to a wind-hybrid diesel system. The reason for this retrofit was to supply 24-hour power, to reduce diesel fuel by using wind energy, and to reduce diesel air and noise emissions in order to promote ecotourism. The wind system was installed in October 1996 with cost-shared funding from the U.S. Department of Energy/U.S. Agency for International Development renewable energy program in Mexico. The National Renewable Energy Laboratory (NREL) supplied technical assistance to the project. Discussed in this paper are the system design, installation, and initial performance.

  6. Heavy-Duty Diesel Fuel Analysis

    Science.gov (United States)

    EPA's heavy-duty diesel fuel analysis program sought to quantify the hydrocarbon, NOx, and PM emission effects of diesel fuel parameters (such as cetane number, aromatics content, and fuel density) on various nonroad and highway heavy-duty diesel engines.

  7. Theoretical investigation of heat balance in direct injection (DI) diesel engines for neat diesel fuel and gasoline fumigation

    International Nuclear Information System (INIS)

    Durgun, O.; Sahin, Z.

    2009-01-01

    The main purpose of the presented study is to evaluate energy balance theoretically in direct injection (DI) diesel engines at different conditions. To analyze energy balance, a zero-dimensional multi-zone thermodynamic model has been developed and used. In this thermodynamic model, zero-dimensional intake and exhaust approximations given by Durgun, zero-dimensional compression and expansion model given by Heywood and quasi-dimensional phenomenological combustion model developed by Shahed and then improved Ottikkutti have been used and developed with new approximations and assumptions. By using the developed model, complete diesel engine cycle, engine performance parameters and exhaust emissions can be determined easily. Also, by using this model energy balance can be analyzed for neat diesel fuel and for light fuel fumigation easily. In the presented study, heat balance has been investigated theoretically for three different engines and various numerical applications have been conducted. In the numerical applications two different turbocharged DI diesel engines and a naturally aspirated DI diesel engine have been used. From these numerical applications, it is determined that, what portion of available fuel energy is converted to useful work, what amount of fuel energy is lost by exhaust gases or lost by heat transfer. In addition, heat balance has been analyzed for gasoline fumigation and some numerical results have been given. Brake effective power and brake specific fuel consumption increase and brake effective efficiency decreases for gasoline fumigation for turbocharged diesel engines used in numerical applications. Combustion duration increases with increasing fumigation ratio and thus heat transfer to the walls increases. Because exhaust temperature increases, exhaust losses also increases for fumigation case

  8. Preparation of diesel emulsion using auxiliary emulsifier mono ethylene glycol and utilization in a turbocharged diesel engine

    International Nuclear Information System (INIS)

    Yilmaz, Emre; Solmaz, Hamit; Polat, Seyfi; Uyumaz, Ahmet; Şahin, Fatih; Salman, M. Sahir

    2014-01-01

    Highlights: • Mono-ethylene glycol was used as an auxiliary emulsifier. • Using mono ethylene glycol prolonged precipitation duration of emulsions. • With using E5 and E10 fuels engine torque averagely increased by 0.35% and 1.73% respectively. • It was found that specific fuel consumption of emulsions is lower than diesel. • Using E10 fuel reduced CO, NO x and soot emissions 44%, 47% and 5% respectively. - Abstract: Diesel engines are used widely as they have lower fuel consumption and higher thermal efficiency in transportation sector. However, the emitted high NO x , CO and soot emissions have led researchers to search different alternative fuels. At this point, diesel fuels emulsions help to reduce exhaust emissions. In this study, the effects of diesel fuel emulsions containing 5% (E5) and 10% (E10) water on engine performance an exhaust emissions has been investigated. Mono ethylene glycol was used as an auxiliary emulsifier in the preparation of the emulsion. Use of the mono ethylene glycol reduced the subsidence rate of the E5 and E10 about 34.5% and 47.1% respectively. The experiments were conducted at full load condition and at 2500, 3250 and 4000 rpm engine speeds. Engine torque and power increased according to diesel fuel between 2400 and 3600 engine speed range when emulsified fuels were used. But significant reductions were observed after that engine speed range. It was observed that the nitrogenoxide (NO x ) emission reduced 5.42% and 11.01% with using E5 and E10 fuel respectively according to diesel fuel at 2500 rpm. Also the soot emissions reduced 12.39% and 22.97% with using E5 and E10

  9. Sampling for diesel particulate matter in mines : Diesel Emissions Evaluation Program (DEEP), technology transfer initiative, October 2001

    International Nuclear Information System (INIS)

    Grenier, M.; Gangal, M.; Goyer, N.; McGinn, S.; Penney, J.; Vergunst, J.

    2001-10-01

    The physical and chemical characteristics of diesel particulate matter (DPM) from exhaust gases from diesel powered mining equipment were presented along with guidelines and regulation for exposure monitoring in the workplace. The report addresses issues related to personal and direct exhaust sampling in mines and presents evidence about potential carcinogenicity of the solid fraction of diesel exhaust. The incomplete combustion of diesel fuel results in the formation of solid and liquid particles in the exhaust. DPM is defined as being the portion of diesel exhaust which is made up of solid carbon particles and the attached chemicals such as polycyclic aromatic hydrocarbons and inorganics such as sulphate compounds. DPM is a submicron aerosol and as such, it is a respirable dust which penetrates deep into the lungs. In addition, DPMs are not easily removed from the air stream because of their small size. Control of DPM is crucial because once they are airborne, they are likely to remain that way and will affect the workplace where they are produced as well as workplaces downwind. In January 2001, the Mine Safety and Health Administration issued a ruling for U.S. metal and non-metal mines requiring that mines meet a limit of exposure of 0.40 mg/m 3 . Mines are expected to reduce exposure to meet a 0.16 mg/m 3 limit of exposure by January 2006. European mines and tunnel construction projects must also meet DPM exposure limits. DPM sampling in Canada has been regulated for nearly one decade. Sampling protocols in Canada and the United States were described with reference to equipment and procedures testing DPM filtration efficiency of after-treatment modules and to evaluate the impact of diesel equipment maintenance on gaseous particulate emissions. 23 refs., 1 tab., 7 figs

  10. Diesel engine performance and exhaust emission analysis using diesel-organic germanium fuel blend

    Directory of Open Access Journals (Sweden)

    Syafiq Zulkifli

    2017-01-01

    Full Text Available Alternative fuels such as biodiesel, bio-alcohol and other biomass sources have been extensively research to find its potential as an alternative sources to fossil fuels. This experiment compared the performance of diesel (D, biodiesel (BD and diesel-organic germanium blend (BG5 at five different speeds ranging from 1200-2400 rpm. BG5 shows significant combustion performance compared to BD. No significant changes of power observed between BG5 and BD at a low speed (1200 rpm. On the contrary, at higher speeds (1800 rpm and 2400 rpm, BG5 blend fuel shows increased engine power of 12.2 % and 9.2 %, respectively. Similarly, torque shows similar findings as engine power, whereby the improvement could be seen at higher speeds (1800 rpm and 2400 rpm when torque increased by 7.3 % and 2.3 %, respectively. In addition, the emission results indicated that for all speeds, CO2, and NO had reduced at an average of 2.1 % and 177 %, respectively. Meanwhile, CO emission had slightly increased compared to BD at low speeds by 0.04 %. However, the amount of CO released had decreased at an average of 0.03 % as the engine speed increased. Finally, measurement of O2 shows an increment at 16.4 % at all speed range.

  11. BIOMarkers for occupational diesel exhaust exposure monitoring (BIOMODEM) - a study in underground mining

    DEFF Research Database (Denmark)

    Scheepers, P.T.J.; Coggon, D.; Knudsen, Lisbeth E.

    2002-01-01

    Methods for the assessment of exposures to diesel exhaust were evaluated, including various biomarkers of internal exposure and early biological effects. The impact of possible biomarkers of susceptibility was also explored. Underground workers (drivers of diesel-powered excavators) at an oil sha...... bulky DNA adducts determined by 32P-postlabelling, or in DNA damage. The study indicated that smoking, diet and residential indoor air pollution are important non-occupational factors to consider when interpreting biomonitoring results....

  12. BİR DIESEL MOTORUNDA SIKIŞTIRMA ORANI ARTIŞININ PERFORMANSA ETKİSİ

    OpenAIRE

    PARLAK, Adnan

    2003-01-01

    An optimisation of the Diesel cycle has been performed for power output and thermal efficiency with respect to compression ratio for various extreme temperature ratio. The relation between compression ratio and extreme temperature ratio, which gives optimum performance is derived. As the compression ratio of the diesel engine is increased in comparison to the optimum value of the engine, it is shown that the performance of the engine is decreased. The experimental study agrees with these ...

  13. Reeds diesel engine troubleshooting handbook

    CERN Document Server

    Pickthall, Barry

    2013-01-01

    Most diesel engines will develop a problem at some point in their lives, but armed with the right knowledge a skipper needn't worry. The Reeds Diesel Engine Troubleshooting Handbook is a compact, pocket-sized guide to finding solutions to all of the most common engine problems, and many of the less common ones too. The perfect format for quick reference on board, this book will help skippers fix troublesome engines themselves, avoiding costly engineer fees if the problem is simple to sort out, or enabling an emergency patch-up for a more serious problem until they can get back to port. Each to

  14. Dual fuel operation of used transformer oil with acetylene in a DI diesel engine

    International Nuclear Information System (INIS)

    Behera, Pritinika; Murugan, S.; Nagarajan, G.

    2014-01-01

    Highlights: • Utilisation of Used transformer oil (UTO) as a fuel in a diesel engine. • UTO with acetylene in a diesel engine, on a dual fuel mode technique. • Analysis of combustion characteristics of the diesel engine. • Analysis of performance and emission characteristics of the diesel engine. - Abstract: Used transformer oil (UTO) is a waste oil obtained from power transformers and welding transformers. It possesses considerable heating value and properties similar to diesel fuel. A preliminary investigation on the utilization of the UTO in a single cylinder, four stroke small powered direct injection (DI) diesel engine revealed that at an optimum injection timing of 20°CA the engine exhibited lower nitric oxide (NO) and higher smoke emissions, compared to that of diesel operation. In order to improve the performance and reduce the smoke emission, a dual fuel operation was attempted in the present investigation. Acetylene was inducted as a primary fuel at four different flow rates viz 132 g/h, 198 g/h, 264 g/h and 330 g/h along with the air, to study the combustion, performance and emission behavior of a four-stroke, 4.4 kW diesel engine, while the UTO was injected as pilot fuel with the optimized injection timing. The experimental results were compared with diesel-acetylene dual fuel operation in the same engine. Acetylene aspiration reduced the ignition delay and maximum cylinder pressure by about 3°CA, and 25% respectively at full load in comparison with the sole UTO operation. Higher thermal efficiency and lower exhaust gas were also observed at full load. Smoke was reduced by about 13.7%, in comparison with the UTO operation at full load

  15. Study on performance of blended fuel PPO - Diesel at generator

    Science.gov (United States)

    Prasetyo, Joni; Prasetyo, Dwi Husodo; Murti, S. D. Sumbogo; Adiarso, Priyanto, Unggul

    2018-02-01

    Bio-energy is renewable energy made from plant. Biomass-based energy sources are potentially CO2 neutral and recycle the same carbon atoms. In order to reduce pollution caused by fossil fuel combustion either for mechanical or electrical energy generation, the performance characteristic of purified palm oil blends are analyzed at various ratios. Bio-energy, Pure Plant Oil, represent a sustainable solution.A generator has been modified due to adapt the viscosity ofblended fuel, PPO - diesel, by pre-heating. Several PPO - diesel composition and injection timing were tested in order to investigate the characteristic of mixed fuel with and without pre-heating. The term biofuel refers to liquid or gaseous fuels for the internal combustion engines that are predominantly produced fro m biomass. Surprising result showed that BSFC of blended PPO - diesel was more efficient when injection timing set more than 15° BTDC. The mixed fuel produced power with less mixed fuel even though the calorie content of diesel is higher than PPO. The most efficient was 20% PPO in diesel with BSFC 296 gr fuel / kwh rather than 100% diesel with BSFC 309 gr fuel / kwh at the same injection timing 18° BTDC with pre-heating. The improvement of BSFC is caused by heating up of mixed fuel which it added calorie in the mixed fuel. Therefore, the heating up of blended PPO - diesel is not only to adapt the viscosity but also improving the efficiency of fuel usage representing by lower BSFC. In addition, torque of the 20% PPO was also as smooth as 100% diesel representing by almost the same torqueat injection timing 15° BTDC. The AIP Proceedings article template has many predefined paragraph styles for you to use/apply as you write your paper. To format your abstract, use the Microsoft Word template style: Abstract. Each paper must include an abstract. Begin the abstract with the word "Abstract" followed by a period in bold font, and then continue with a normal 9 point font.

  16. Sustainable electricity generation by solar pv/diesel hybrid system without storage for off grids areas

    International Nuclear Information System (INIS)

    Azoumah, Y; Yamegueu, D; Py, X

    2012-01-01

    Access to energy is known as a key issue for poverty reduction. The electrification rate of sub Saharan countries is one of the lowest among the developing countries. However this part of the world has natural energy resources that could help raising its access to energy, then its economic development. An original 'flexy energy' concept of hybrid solar pv/diesel/biofuel power plant, without battery storage, is developed in order to not only make access to energy possible for rural and peri-urban populations in Africa (by reducing the electricity generation cost) but also to make the electricity production sustainable in these areas. Some experimental results conducted on this concept prototype show that the sizing of a pv/diesel hybrid system by taking into account the solar radiation and the load/demand profile of a typical area may lead the diesel generator to operate near its optimal point (70-90 % of its nominal power). Results also show that for a reliability of a PV/diesel hybrid system, the rated power of the diesel generator should be equal to the peak load. By the way, it has been verified through this study that the functioning of a pv/Diesel hybrid system is efficient for higher load and higher solar radiation.

  17. Sustainable electricity generation by solar pv/diesel hybrid system without storage for off grids areas

    Science.gov (United States)

    Azoumah, Y.; Yamegueu, D.; Py, X.

    2012-02-01

    Access to energy is known as a key issue for poverty reduction. The electrification rate of sub Saharan countries is one of the lowest among the developing countries. However this part of the world has natural energy resources that could help raising its access to energy, then its economic development. An original "flexy energy" concept of hybrid solar pv/diesel/biofuel power plant, without battery storage, is developed in order to not only make access to energy possible for rural and peri-urban populations in Africa (by reducing the electricity generation cost) but also to make the electricity production sustainable in these areas. Some experimental results conducted on this concept prototype show that the sizing of a pv/diesel hybrid system by taking into account the solar radiation and the load/demand profile of a typical area may lead the diesel generator to operate near its optimal point (70-90 % of its nominal power). Results also show that for a reliability of a PV/diesel hybrid system, the rated power of the diesel generator should be equal to the peak load. By the way, it has been verified through this study that the functioning of a pv/Diesel hybrid system is efficient for higher load and higher solar radiation.

  18. Bio diesel energy potential in the Republic of Macedonia, v. 14(55)

    International Nuclear Information System (INIS)

    Armenski, Slave; Davkova, Katitsa

    2006-01-01

    Bio diesel ia a liquid fuel produced from raw vegetable oil, animal fats and cooking oils and can be used like substitute or addition of petroleum diesel. Bio diesel is alternative fuel and can be use in diesel engines, to obtain power similar lake petroleum diesel. During his combustion it realises small quantities of carbon dioxide and sulfur oxides. In this paper is carrying out an investigation of the sources of raw vegetables oils on the quantities which are produced from agriculture and livestock in the R. of Macedonia, in the term of their quantities estimation, bio diesel quantity estimation and energy value estimation. For this reason it is analyzed used arable area, as well as available free pasture area with: soybean, rapes sed, sun-flower and other vegetable oil plants. By defined areas and average quantities production in the past five years (1997-2001), it is determined the whole raw vegetable oil quantities from source of row material. In the area of livestock in this paper is defined the number of animal and poultry slaughtered and the quantity of waste fats. In the base of determined quantities from row vegetable oils, used cooking oils and restaurant frying oils and waste animal fats, it is determined mass and energy quantities of bio diesel which can be produced in the R. of Macedonia. (Author)

  19. Bio diesel energy potential in the Republic of Macedonia, v. 15(56)

    International Nuclear Information System (INIS)

    Armenski, Slave; Davkova, Katitsa

    2007-01-01

    Bio diesel ia a liquid fuel produced from raw vegetable oil, animal fats and cooking oils and can be used like substitute or addition of petroleum diesel. Bio diesel is alternative fuel and can be use in diesel engines, to obtain power similar lake petroleum diesel. During his combustion it realises small quantities of carbon dioxide and sulfur oxides. In this paper is carrying out an investigation of the sources of raw vegetables oils on the quantities which are produced from agriculture and livestock in the R. of Macedonia, in the term of their quantities estimation, bio diesel quantity estimation and energy value estimation. For this reason it is analyzed used arable area, as well as available free pasture area with: soybean, rapes sed, sun-flower and other vegetable oil plants. By defined areas and average quantities production in the past five years (1997-2001), it is determined the whole raw vegetable oil quantities from source of row material. In the area of livestock in this paper is defined the number of animal and poultry slaughtered and the quantity of waste fats. In the base of determined quantities from row vegetable oils, used cooking oils and restaurant frying oils and waste animal fats, it is determined mass and energy quantities of bio diesel which can be produced in the R. of Macedonia. (Author)

  20. Performance of compression ignition engine with indigenous castor oil bio diesel in Pakistan

    International Nuclear Information System (INIS)

    Chakrabarti, M.H.

    2009-01-01

    Castor oil available indigenously in Pakistan was converted successfully to bio diesel and blended to 10% quantity (by volume) with high speed mineral diesel (HSD) fuel. This fuel was tested in a compression-ignition engine in order to assess its environmental emissions as well as engine performance parameters. The blended fuel was found to give lower environmental emissions in most accounts except for higher CO/sub 2/ and higher NOx. In addition, three engine performance parameters were assessed; which were engine brake power, engine torque and exhaust temperature. In the first two cases, blended bio diesel fuel gave lower figures than pure mineral diesel due to lower calorific value. However, its higher flash point resulted in higher engine exhaust temperatures than pure mineral diesel. Overall, in terms of engine performance, castor oil bio diesel (from non edible oil of castor bean -growing on marginal lands of Pakistan) fared better in comparison to canola oil bio diesel (from expensive edible oil) and can be recommended for further tests at higher blend ratios. (author)

  1. Jatropha oil methyl ester and its blends used as an alternative fuel in diesel engine

    Directory of Open Access Journals (Sweden)

    Yarrapathruni Rao Hanumantha Venkata

    2009-01-01

    Full Text Available Biomass derived vegetable oils are quite promising alternative fuels for agricultural diesel engines. Use of vegetable oils in diesel engines leads to slightly inferior performance and higher smoke emissions due to their high viscosity. The performance of vegetable oils can be improved by modifying them through the transesterification process. In this present work, the performance of single cylinder water-cooled diesel engine using methyl ester of jatropha oil as the fuel was evaluated for its performance and exhaust emissions. The fuel properties of biodiesel such as kinematic viscosity, calorific value, flash point, carbon residue, and specific gravity were found. Results indicate that B25 has closer performance to diesel and B100 has lower brake thermal efficiency mainly due to its high viscosity compared to diesel. The brake thermal efficiency for biodiesel and its blends was found to be slightly higher than that of diesel fuel at tested load conditions and there was no difference of efficiency between the biodiesel and its blended fuels. For jatropha biodiesel and its blended fuels, the exhaust gas temperature increased with the increase of power and amount of biodiesel. However, its diesel blends showed reasonable efficiency, lower smoke, and CO2 and CO emissions.

  2. Aspen Simulation of Diesel-Biodiesel Blends Combustion

    Directory of Open Access Journals (Sweden)

    Pérez-Sánchez Armando

    2015-01-01

    Full Text Available Biodiesel is a fuel produced by transesterification of vegetable oils or animal fats, which currently is gaining attention as a diesel substitute. It represents an opportunity to reduce CO2, SO2, CO, HC, PAH and PM emissions and contributes to the diversification of fuels in Mexico's energetic matrix. The results of the simulation of the combustion process are presented in this paper with reference to an engine specification KUBOTA D600-B, operated with diesel-biodiesel blends. The physicochemical properties of the compounds and the operating conditions of equipment were developed using the simulator Aspen® and supplementary information. The main aspects of the engine working conditions were considered such as diesel-biodiesel ratio, air/fuel mixture, temperature of the combustion gases and heat load. Diesel physicochemical specifications were taken from reports of PEMEX and SENER. Methyl esters corresponding to the transesterification of fatty acids that comprise castor oil were regarded as representative molecules of biodiesel obtained from chromatographic analysis. The results include CO2, water vapor, combustion efficiency, power and lower calorific value of fuels.

  3. Super Turbocharging the Direct Injection Diesel engine

    Science.gov (United States)

    Boretti, Albert

    2018-03-01

    The steady operation of a turbocharged diesel direct injection (TDI) engine featuring a variable speed ratio mechanism linking the turbocharger shaft to the crankshaft is modelled in the present study. Key parameters of the variable speed ratio mechanism are range of speed ratios, efficiency and inertia, in addition to the ability to control relative speed and flow of power. The device receives energy from, or delivers energy to, the crankshaft or the turbocharger. In addition to the pistons of the internal combustion engine (ICE), also the turbocharger thus contributes to the total mechanical power output of the engine. The energy supply from the crankshaft is mostly needed during sharp accelerations to avoid turbo-lag, and to boost torque at low speeds. At low speeds, the maximum torque is drastically improved, radically expanding the load range. Additionally, moving closer to the points of operation of a balanced turbocharger, it is also possible to improve both the efficiency η, defined as the ratio of the piston crankshaft power to the fuel flow power, and the total efficiency η*, defined as the ratio of piston crankshaft power augmented of the power from the turbocharger shaft to the fuel flow power, even if of a minimal extent. The energy supply to the crankshaft is possible mostly at high speeds and high loads, where otherwise the turbine could have been waste gated, and during decelerations. The use of the energy at the turbine otherwise waste gated translates in improvements of the total fuel conversion efficiency η* more than the efficiency η. Much smaller improvements are obtained for the maximum torque, yet again moving closer to the points of operation of a balanced turbocharger. Adopting a much larger turbocharger (target displacement x speed 30% larger than a conventional turbocharger), better torque outputs and fuel conversion efficiencies η* and η are possible at every speed vs. the engine with a smaller, balanced turbocharger. This result

  4. Diesel engine performance as influenced by fuel temperature

    Energy Technology Data Exchange (ETDEWEB)

    Sumner, H.R.; Best, W.D.; Monroe, G.E.

    1986-11-01

    The effects of diesel fuel temperature on the efficiency of a 4.4-L diesel engine were studied. Fuel temperatures of 41, 67, and 81 C were used with engine loads of 0 to 100% of full load at three engine frequencies. Regression equations were developed that predicted fuel economy as a function of PTO power at three engine frequencies. An increase in engine fuel temperature did not improve fuel economy, but did result in reduced fuel mass flow through the injector pump and reduced maximum PTO power. Reducing engine frequency improved fuel economy and supported the 'throttle back shift up' technique for saving fuel. 4 figs., 1 tab., 11 refs.

  5. EFFECT OF COMPRESSION RATIO ON ENERGY AND EMISSION OF VCR DIESEL ENGINE FUELLED WITH DUAL BLENDS OF BIODIESEL

    Directory of Open Access Journals (Sweden)

    R. D. EKNATH

    2014-10-01

    Full Text Available In recent 10 years biodiesel fuel was studied extensively as an alternative fuel. Most of researchers reported performance and emission of biodiesel and their blends with constant compression ratio. Also all the research was conducted with use of single biodiesel and its blend. Few reports are observed with the use of variable compression ratio and blends of more than one biodiesel. Main aim of the present study is to analyse the effect of compression ratio on the performance and emission of dual blends of biodiesel. In the present study Blends of Jatropha and Karanja with Diesel fuel was tested on single cylinder VCR DI diesel engine for compression ratio 16 and 18. High density of biodiesel fuel causes longer delay period for Jatropha fuel was observed compare with Karanja fuel. However blending of two biodiesel K20J40D results in to low mean gas temperature which is the main reason for low NOx emission.

  6. Experimental investigation on a Common Rail Diesel engine partially fuelled by syngas

    International Nuclear Information System (INIS)

    Rinaldini, Carlo Alberto; Allesina, Giulio; Pedrazzi, Simone; Mattarelli, Enrico; Savioli, Tommaso; Morselli, Nicolò; Puglia, Marco; Tartarini, Paolo

    2017-01-01

    Highlights: • A current automotive Diesel engine is tested running on both Diesel fuel and syngas. • The syngas HHV is about 5 MJ/Nm"3, allowing a 60% of Diesel substitution. • The engine brake efficiency is slightly increased running on syngas at high load. • In-cylinder pressure do not change very much even if Diesel fuel is strongly reduced. - Abstract: The high efficiency, reliability and flexibility of modern passenger car Diesel engines makes these power units quite attractive for steady power plants totally or partially running on fuels derived from biomass, in particular on syngas. The engine cost, which is obviously higher than that of current industrial engines, may not be a big obstacle, provided that the re-engineering work is limited and that performance and efficiency are enhanced. The goal of this work is to explore the potential of a current automotive turbocharged Diesel engine running on both Diesel fuel and syngas, by means of a comprehensive experimental investigation focused on the combustion process. The engine is operated at the most typical speed employed in steady power plants (3000 rpm), considering three different loads (50–100–300 Nm/16–31–94 kW). For each operating condition, the syngas rate is progressively increased until it provides a maximum heating power of 85 kW, while contemporarily reducing the amount of injected Diesel oil. Maximum care is applied to guarantee a constant quality of the syngas flow throughout the tests, as well as to maintain the same engine control parameters, in particular the boost pressure. It is found that in-cylinder pressure traces do not change very much, even when drastically reducing the amount of Diesel fuel: this is a very encouraging result, because it demonstrates that there is no need to radically modify the standard stock engine design. Another promising outcome is the slight but consistent enhancement of the engine brake efficiency: the use of syngas not only reduces the

  7. DIESEL ENGINE RETROFIT TECHNOLOGY VERIFICATION

    Science.gov (United States)

    This presentation wil be given at the EPA Science Forum 2005 in Washington, DC. According to recent estimates, there are approximately 7.9 million heavy-duty diesel trucks and buses in use in the United States. Emissions from these vehicles account for substantial portions of t...

  8. Experimental Investigations on Conventional and Semi-Adiabatic Diesel Engine Using Simarouba Biodiesel as Fuel

    Science.gov (United States)

    Ravi, M. U.; Reddy, C. P.; Ravindranath, K.

    2013-04-01

    parameters including power output, fuel consumption, brake thermal efficiency, brake specific fuel consumption etc. Exhaust emissions were also measured. The results obtained confirmed that the blends of SBD with petro-diesel can be successfully employed as an alternate fuel in diesel engines. Also engine with coated piston crown gave better break thermal efficiency for blends of Simarouba and diesel compared with diesel fuel. Significant improvements in engine performance characteristics were observed for a blend containing 20 % SBD. The emissions for 20 % biodiesel blend for the standard engine were less when compared with diesel fuel emissions. Contrary to expectations the injection pressure of 180 bar proved to be better than 190 and 200 bar.

  9. Monitoring of large diesel engines through asphaltene content

    Energy Technology Data Exchange (ETDEWEB)

    Declerck, R [Texaco Technology Ghent (Belgium)

    1998-12-31

    Lubricants in large diesel engines, for marine and power plant application, are open contaminated with heavy fuel. This type of contamination results in blackening of the engines and deposit formation because of the coagulation of asphaltene particles. Monitoring of the asphaltene content presents the operator with important information on the condition of the engine and the lubricant. This technique was an important asset in developing a new range of lubricants highly capable of tackling the presence of asphaltenes. (orig.)

  10. Monitoring of large diesel engines through asphaltene content

    Energy Technology Data Exchange (ETDEWEB)

    Declerck, R. [Texaco Technology Ghent (Belgium)

    1997-12-31

    Lubricants in large diesel engines, for marine and power plant application, are open contaminated with heavy fuel. This type of contamination results in blackening of the engines and deposit formation because of the coagulation of asphaltene particles. Monitoring of the asphaltene content presents the operator with important information on the condition of the engine and the lubricant. This technique was an important asset in developing a new range of lubricants highly capable of tackling the presence of asphaltenes. (orig.)

  11. Advanced diesel electronic fuel injection and turbocharging

    Science.gov (United States)

    Beck, N. J.; Barkhimer, R. L.; Steinmeyer, D. C.; Kelly, J. E.

    1993-12-01

    The program investigated advanced diesel air charging and fuel injection systems to improve specific power, fuel economy, noise, exhaust emissions, and cold startability. The techniques explored included variable fuel injection rate shaping, variable injection timing, full-authority electronic engine control, turbo-compound cooling, regenerative air circulation as a cold start aid, and variable geometry turbocharging. A Servojet electronic fuel injection system was designed and manufactured for the Cummins VTA-903 engine. A special Servojet twin turbocharger exhaust system was also installed. A series of high speed combustion flame photos was taken using the single cylinder optical engine at Michigan Technological University. Various fuel injection rate shapes and nozzle configurations were evaluated. Single-cylinder bench tests were performed to evaluate regenerative inlet air heating techniques as an aid to cold starting. An exhaust-driven axial cooling air fan was manufactured and tested on the VTA-903 engine.

  12. Diesel exhaust emissions : health effects

    Energy Technology Data Exchange (ETDEWEB)

    Grenier, M. [Natural Resources Canada, Sudbury, ON (Canada). CANMET Mining and Mineral Sciences Laboratories

    2009-07-01

    Despite modern day ventilation, underground miners are exposed to diesel particulate matter (DPM) composed of elemental carbon, organic carbon, sulphates, metals and ashes. Diesel exhaust contains over 40 air contaminants that have been recognized as toxic, carcinogenic or reproductive and developmental hazards. Nearly all components of diesel exhaust interact with the human body at the bloodstream or tissue level. This presentation discussed the following 4 potential levels of threat posed by the physical and chemical nature of diesel exhaust: (1) cancer of the lungs and bladder, (2) toxins that affect the nervous, endocrine, reproductive and immune system as well as the liver and kidneys, (3) fine particulate matter that can cause premature death and an increase in respiratory illness, and (4) nitrogen oxides that contribute to increased ozone and smog. Non-cancer health effects from short-term exposure include acute irritation and respiratory symptoms. This presentation also referred to cancer risk assessments of diesel exhaust by national, state, and world health organizations. Particulate exposure standards for Canada, Quebec, Ontario and the United States were listed along with the percentage of DPM samples in excess of various exposure limits in 2008 according to Canadian underground mine data. DPM concentration levels in mines are in the range that environmental agencies would consider high for general population exposure. Solutions for underground mines include pollution control at the source; use of modern engines with certification for underground mining; emissions based maintenance; exhaust treatment; use of clean or alternative fuels such as hydrogen; regular sampling and monitoring; ventilation; training and technology transfer; and regulations. tabs., figs.

  13. Challenges and solutions of implementing and supporting wind diesel applications in remote (AK) locations

    Energy Technology Data Exchange (ETDEWEB)

    Pingree, B. [Northern Power Systems, Barre, VT (United States)

    2010-07-01

    This PowerPoint presentation discussed the methods used by Northern Power Systems to install and support wind-diesel applications in remote locations in Alaska. Over 90 wind turbines have been installed in the state over the last 5 years. Drivers behind the increase in wind turbine installations include the recent energy crisis as well as the introduction of several financial incentives for renewable energy. The correct equipment is needed to overcome the technical challenges associated with wind-diesel systems in remote cold temperature areas. Multiple projects are synchronized within regions, and remote energy management software is used. Centralized power production is promoted where possible, and technicians are trained locally. The wind-diesel market has become successful in Alaska as a result of leadership, a streamline grant and permitting process, and a program that supports First Nations empowerment. Photographs of various Northern Power Systems projects in Alaska were included. tabs., figs.

  14. EXPERIMENTAL COMBUSTION ANALYSIS OF A HSDI DIESEL ENGINE FUELLED WITH PALM OIL BIODIESEL-DIESEL FUEL BLENDS

    Directory of Open Access Journals (Sweden)

    JOHN AGUDELO

    2009-01-01

    Full Text Available Differences in the chemical nature between petroleum diesel fuels and vegetable oils-based fuels lead to differences in their physical properties affecting the combustion process inside the engine. In this work a detailed combustion diagnosis was applied to a turbocharged automotive diesel engine operating with neat palm oil biodiesel (POB, No. 2 diesel fuel and their blends at 20 and 50% POB by volume (B20 and B50 respectively. To isolate the fuel effect, tests were executed at constant power output without carrying out any modification of the engine or its fuel injection system. As the POB content in the blend increased, there was a slight reduction in the fuel/air equivalence ratio from 0.39 (B0 to 0.37 (B100, an advance of injection timing and of start of combustion. Additionally, brake thermal efficiency, combustion duration, maximum mean temperature, temperature at exhaust valve opening and exhaust gas efficiency decreased; while the peak pressure, exergy destruction rate and specific fuel consumption increased. With diesel fuel and the blends B20 and B50 the same combustion stages were noticed. However, as a consequence of the differences pointed out, the thermal history of the process was affected. The diffusion combustion stage became larger with POB content. For B100 no premixed stage was observed.

  15. Design and implementation of reliability data system of emergency diesel generator for YGN 3,4

    International Nuclear Information System (INIS)

    Kim, S. H.; Jang, S. D.; Kim, G. Y.; Kim, T. W.; Kim, Y. H.; Jeong, H. J.; Choi, G. H.

    1998-01-01

    This paper describes the design and implementation of D 2 REAMS that supports management and monitoring of the reliability data of emergency diesel generator of YGN 3,4 nuclear power plant. D2REAMS is the computerized reliability database management system to control the reliability of the emergency diesel generator of nuclear power plant and consists of seven sub-modules. Also, it was developed with intranet technology to eliminate the common problems of conventional client-server architecture. As the result of this implementation, the reliability and unavailability can be automatically computed by D2REAMS with the stored test and operation data of YGN 3,4 nuclear power plant

  16. Resolution of GSI B-56 - Emergency diesel generator reliability

    International Nuclear Information System (INIS)

    Serkiz, A.W.

    1989-01-01

    The need for an emergency diesel generator (EDG) reliability program has been established by 10 CFR Part 50, Section 50.63, Loss of All Alternating Current Power, which requires that licensees assess their station blackout coping and recovery capability. EDGs are the principal emergency ac power sources for avoiding a station blackout. Regulatory Guide 1.155, Station Blackout, identifies a need for (1) a nuclear unit EDG reliability level of at least 0.95, and (2) an EDG reliability program to monitor and maintain the required EDG reliability levels. NUMARC-8700, Guidelines and Technical Bases for NUMARC Initiatives Addressing Station Blackout at Light Water Reactors, also provides guidance on such needs. The resolution of GSI B-56, Diesel Reliability will be accomplished by issuing Regulatory Guide 1.9, Rev. 3, Selection, Design, Qualification, Testing, and Reliability of Diesel Generator Units Used as Onsite Electric Power Systems at Nuclear Plants. This revision will integrate into a single regulatory guide pertinent guidance previously addressed in R.G. 1.9, Rev. 2, R.G. 1.108, and Generic Letter 84-15. R.G. 1.9 has been expanded to define the principal elements of an EDG reliability program for monitoring and maintaining EDG reliability levels selected for SBO. In addition, alert levels and corrective actions have been defined to detect a deteriorating situation for all EDGs assigned to a particular nuclear unit, as well as an individual problem EDG

  17. Alternatives to Diesel Fuel in California - Fuel Cycle Energy and Emission Effects of Possible Replacements Due to the TAC Diesel Particulate Decision; FINAL

    International Nuclear Information System (INIS)

    Christopher L. Saraicks; Donald M. Rote; Frank Stodolsky; James J. Eberhardt

    2000-01-01

    Limitations on petroleum-based diesel fuel in California could occur pursuant to the 1998 declaration by California's Air Resources Board (CARB) that the particulate matter component of diesel exhaust is a carcinogen, therefore a toxic air contaminant (TAC) subject to the state's Proposition 65. It is the declared intention of CARB not to ban or restrict diesel fuel, per se, at this time. Assuming no total ban, Argonne National Laboratory (ANL) explored two feasible ''mid-course'' strategies, each of which results in some degree of (conventional) diesel displacement. In the first case, with substantial displacement of compression ignition by spark ignition engines, diesel fuel is assumed admissible for ignition assistance as a pilot fuel in natural gas (NG)-powered heavy-duty vehicles. Gasoline demand in California increases by 32.2 million liters (8.5 million gallons) per day overall, about 21 percent above projected 2010 baseline demand. Natural gas demand increases by 13.6 million diesel liter (3.6 million gallon) equivalents per day, about 7 percent above projected (total) consumption level. In the second case, ressionignition engines utilize substitutes for petroleum-based diesel having similar ignition and performance properties. For each case we estimated localized air emission plus generalized greenhouse gas and energy changes. Fuel replacement by di-methyl ether yields the greatest overall reduction in NOx emissions, though all scenarios bring about PM10 reductions relative to the 2010 baseline, with greatest reductions from the first case described above and the least from fuel replacement by Fischer-Tropsch synthetic diesel. Economic implications of vehicle and engine replacement were not formally evaluated

  18. Adaptive neuro-fuzzy inference system (ANFIS) to predict CI engine parameters fueled with nano-particles additive to diesel fuel

    Science.gov (United States)

    Ghanbari, M.; Najafi, G.; Ghobadian, B.; Mamat, R.; Noor, M. M.; Moosavian, A.

    2015-12-01

    This paper studies the use of adaptive neuro-fuzzy inference system (ANFIS) to predict the performance parameters and exhaust emissions of a diesel engine operating on nanodiesel blended fuels. In order to predict the engine parameters, the whole experimental data were randomly divided into training and testing data. For ANFIS modelling, Gaussian curve membership function (gaussmf) and 200 training epochs (iteration) were found to be optimum choices for training process. The results demonstrate that ANFIS is capable of predicting the diesel engine performance and emissions. In the experimental step, Carbon nano tubes (CNT) (40, 80 and 120 ppm) and nano silver particles (40, 80 and 120 ppm) with nanostructure were prepared and added as additive to the diesel fuel. Six cylinders, four-stroke diesel engine was fuelled with these new blended fuels and operated at different engine speeds. Experimental test results indicated the fact that adding nano particles to diesel fuel, increased diesel engine power and torque output. For nano-diesel it was found that the brake specific fuel consumption (bsfc) was decreased compared to the net diesel fuel. The results proved that with increase of nano particles concentrations (from 40 ppm to 120 ppm) in diesel fuel, CO2 emission increased. CO emission in diesel fuel with nano-particles was lower significantly compared to pure diesel fuel. UHC emission with silver nano-diesel blended fuel decreased while with fuels that contains CNT nano particles increased. The trend of NOx emission was inverse compared to the UHC emission. With adding nano particles to the blended fuels, NOx increased compared to the net diesel fuel. The tests revealed that silver & CNT nano particles can be used as additive in diesel fuel to improve combustion of the fuel and reduce the exhaust emissions significantly.

  19. 40 CFR 79.33 - Motor vehicle diesel fuel.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Motor vehicle diesel fuel. 79.33... diesel fuel. (a) The following fuels commonly or commercially known or sold as motor vehicle diesel fuel are hereby individually designated: (1) Motor vehicle diesel fuel, grade 1-D; (2) Motor vehicle diesel...

  20. Optimal Design of Wind-PV-Diesel-Battery System using Genetic Algorithm

    Science.gov (United States)

    Suryoatmojo, Heri; Hiyama, Takashi; Elbaset, Adel A.; Ashari, Mochamad

    Application of diesel generators to supply the load demand on isolated islands in Indonesia has widely spread. With increases in oil price and the concerns about global warming, the integration of diesel generators with renewable energy systems have become an attractive energy sources for supplying the load demand. This paper performs an optimal design of integrated system involving Wind-PV-Diesel-Battery system for isolated island with CO2 emission evaluation by using genetic algorithm. The proposed system has been designed for the hybrid power generation in East Nusa Tenggara, Indonesia-latitude 09.30S, longitude 122.0E. From simulation results, the proposed system is able to minimize the total annual cost of the system under study and reduce CO2 emission generated by diesel generators.

  1. Review and evaluation of TDI diesel generator owner's group program plan

    International Nuclear Information System (INIS)

    1984-06-01

    This report documents a review, performed by the Pacific Northwest Laboratory (PNL), of the Transamerica Delaval, Inc. (TDI) Diesel Generator Owner's Group Program Plan. This report was prepared as part of the technical support PNL is providing to the US Nuclear Regulatory Commission (NRC), Division of Licensing, on matters pertaining to the reliability of TDI diesel generators as emergency power sources for safety-related nuclear systems. The report presents the comments and conclusions reached by PNL, with the advice and counsel of five diesel engine consultants, on the principal elements of the Owners' Group Plan: Generic Problem Resolution, Design Review/Quality Revalidation, and Engine Testing and Inspection. Also included are PNL's comments on the related issues of Surveillance and Maintenance, and Administrative Controls. The conclusions drawn from PNL's evaluation of these issues form the basis for two additional topics addressed in the report: Critical Elements Required to Establish Diesel Engine Operability and Reliability, and Considerations for Interim Licensing

  2. The study of stability, combustion characteristics and performance of water in diesel emulsion fuel

    Directory of Open Access Journals (Sweden)

    Syafiq Zulkifli

    2017-01-01

    Full Text Available A single cylinder diesel engine study of water in diesel emulsions was conducted to investigate the stability effect of emulsion fuel on three different fuel blends and the water emulsification effect on the engine performance. Emulsified fuels contained 2% of surfactant including Span 80 Tween 80 and tested 10 HLB number. The blends also varied of 5%, 10% and 15% of water in diesel ratios namely as BSW5, BSW10 and BSW15. The fuel blends performance was tested using a single cylinder, direct injection diesel engine, operating at 1860 rpm. The results on stability reveal that high shear homogenizer yields more stability on emulsion fuel than mechanical stirrer and ultrasonic water bath. The engine performance results show that the ignition delay and peak pressure increase with the increment of water percentage up to 15%. However, the results indicate the increment of water percentage is also shows a significant decrease in engine power.

  3. DETERMINATION OF CO2 MASSES IN THE EXHAUST GASES OF THE MARINE DIESEL ENGINES

    Directory of Open Access Journals (Sweden)

    Doru COSOFRET

    2016-05-01

    Full Text Available Currently, reducing CO2 emissions that contribute to the greenhouse effect is currently under attention of the relevant international bodies. In the field of maritime transport, in 2011 International Maritime Organization (IMO has taken steps to reduce emissions of CO2 from the exhaust gases of marine diesel engines on ships, by imposing their energy efficiency standards. In this regard, we conducted a laboratory study on a 4-stroke diesel engine naturally aspirated by using to power it diesel and different blends of biodiesel with diesel fuel. The purpose of the study was to determine the formulas for calculating the mass flow rates of CO2 from exhaust gases’ concentrations experimentally determined. Determining the mass flow of CO2 is necessary to calculate the energy efficiency coefficient of the ship to assess the energy efficiency of the board of the limits imposed by the IMO.

  4. 40 CFR 80.522 - May used motor oil be dispensed into diesel motor vehicles or nonroad diesel engines?

    Science.gov (United States)

    2010-07-01

    ... diesel motor vehicles or nonroad diesel engines? 80.522 Section 80.522 Protection of Environment... vehicles or nonroad diesel engines? No person may introduce used motor oil, or used motor oil blended with... later nonroad diesel engines (not including locomotive or marine diesel engines), unless both of the...

  5. STUDY ON THE CARBON MONOXYDE AND HC EMISSIONS GENERATED BY THE DIRECT INJECTION DIESEL ENGINES, RUNNING WITH BIODIESEL

    Directory of Open Access Journals (Sweden)

    DORU COSOFRET

    2016-06-01

    Full Text Available Currently, the research results on the use of mixtures of biofuels with fossil fuels to power diesel engines are controversial in terms of reducing emissions of CO and HC which are contained in the exhaust gases of diesel engines. The diversity of the results is due to possibly different type of biodiesel used, the type of engine on which the tests were carried out and the methods and conditions for obtaining these results. Therefore, researches on regular diesel - biodiesel mixtures in various ratio is still a matter of study. In this regard, we conducted a laboratory study on a 4-stroke diesel engine, by using different mixtures (10, 15, 20, 25, 30, 40 and 50% of diesel with biodiesel made from rapeseed oil. The study results reveals that the CO and HC emissions will decrease within creasing load.

  6. Knockdown of long non-coding RNA MAP3K20 antisense RNA 1 inhibits gastric cancer growth through epigenetically regulating miR-375.

    Science.gov (United States)

    Quan, Yongsheng; Zhang, Yan; Lin, Wei; Shen, Zhaohua; Wu, Shuai; Zhu, Changxin; Wang, Xiaoyan

    2018-03-04

    Emerging evidence has demonstrated that long noncoding RNAs (lncRNAs) play a critical role in tumorigenesis of gastric cancer. LncRNA MAP3K20 antisense RNA 1 (MLK7-AS1) has been identified as one of gastric cancer-specific lncRNAs. However, its precise role in gastric cancer remains unknown. In this study, we found that lncRNA MLK7-AS1 was significantly increased in gastric cancer tissues compared with in adjacent tissues. Gastric cancer patients with high MLK7-AS1 expression had a shorter survival and poorer prognosis. By loss-function assay, we demonstrated that knockdown of MLK7-AS1 inhibited cell proliferation and induced apoptosis in HGC27and MKN-45 cells. Furthermore, we identified miR-375 as a target of MLK7-AS1. MLK7-AS1 interacted with Dnmt1 and recruited it to miR-375 promotor, hyper-methylating miR-375 promotor and repressing miR-375 expression. Taken together, our findings demonstrate that knockdown of MLK7-AS1 by siRNA inhibits gastric cancer growth by epigenetically regulating miR-375. Thus, MLK7-AS1 may be a useful prognostic marker and therapeutic target for gastric cancer patients. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Reliability of the emergency diesel generator

    Energy Technology Data Exchange (ETDEWEB)

    Verstegen, C.; Kotthoff, K. [Gesellschaft fuer Reaktorsicherheit - GRS mbH, Schwertnergasse 1, D-5000 Koeln 1, Cologne (Germany)

    1986-02-15

    The paper deals with a statistical investigation on the availability of diesel generators, which has been performed recently The investigation is based on the operating experiences of a total of 40-diesel generators in 10 German NPP's. Both unavailability of the diesel generators due to failures and due to maintenance and repair have been considered.The probability of diesel failure during start and short-time operation amounts?o about 8 x 10{sup -3}/demand. The probability of common mode failures is approximately one order of magnitude smaller. The influence of various parameters on the failure probability has been discussed. A statistically significant dependence could not be identified In addition the investigation shows that the unavailability of the diesel generators due to maintenance and repair is about of the same order magnitude as the probability of diesel failures. (authors)

  8. The Effect of Ethanol-Diesel Blends on The Performance of A Direct Injection Diesel Engine

    OpenAIRE

    Arifin Nur; Yanuandri Putrasari; Iman Kartolaksono Reksowardojo

    2012-01-01

    The experiment was conducted on a conventional direct injection diesel engine. Performance test was carried out to evaluate the performance and emission characteristics of a conventional diesel engine that operates on ethanol-diesel blends. The test procedure was performed by coupling the diesel engine on the eddy current dynamometer. Fuel consumption was measured using the AVL Fuel Balance, and a hotwire anemometer was used to measure the air consumption. Some of the emission test devices we...

  9. Ion currents in diesel engines

    OpenAIRE

    Rao, Rahul

    2017-01-01

    This thesis documents an experimental and modelling investigation into ion formation in diesel engines, its uses in the field of engine performance and emissions prediction and the mechanisms by which these uses are made possible. Ion sensors have been employed in engines for a variety of purposes, including estimation of air-fuel ratio, start of combustion and in-cylinder pressure, detection of knock, misfire and combustion resonance, prediction of soot formation, and control of spark ...

  10. Ultrasound-Assisted Oxidative Desulfurization of Diesel

    OpenAIRE

    Niran K. Ibrahim; Walla A. Noori; Jaffar M. Khasbag

    2016-01-01

    Due to the dramatic environmental impact of sulfur emissions associated with the exhaust of diesel engines, last environmental regulations for ultra-low-sulfur diesel require a very deep desulfurization (up to 15 ppm), which cannot be met by the conventional hydrodesulfurization units alone. The proposed method involves a batch ultrasound-assisted oxidative desulfurization (UAODS) of a previously hydrotreated diesel (containing 480 ppm sulfur) so as to convert the residual sulfur-bearing comp...

  11. Diesel Engine Light Truck Application

    Energy Technology Data Exchange (ETDEWEB)

    None

    2007-12-31

    The Diesel Engine Light Truck Application (DELTA) program consists of two major contracts with the Department of Energy (DOE). The first one under DE-FC05-97-OR22606, starting from 1997, was completed in 2001, and consequently, a final report was submitted to DOE in 2003. The second part of the contract was under DE-FC05-02OR22909, covering the program progress from 2002 to 2007. This report is the final report of the second part of the program under contract DE-FC05-02OR22909. During the course of this contract, the program work scope and objectives were significantly changed. From 2002 to 2004, the DELTA program continued working on light-duty engine development with the 4.0L V6 DELTA engine, following the accomplishments made from the first part of the program under DE-FC05-97-OR22606. The program work scope in 2005-2007 was changed to the Diesel Particulate Filter (DPF) soot layer characterization and substrate material assessment. This final report will cover two major technical tasks. (1) Continuation of the DELTA engine development to demonstrate production-viable diesel engine technologies and to demonstrate emissions compliance with significant fuel economy advantages, covering progress made from 2002 to 2004. (2) DPF soot layer characterization and substrate material assessment from 2005-2007.

  12. Experimental investigation of the performance and emissions of diesel engines by a novel emulsified diesel fuel

    International Nuclear Information System (INIS)

    Chen, Zhenbin; Wang, Xiaochen; Pei, Yiqiang; Zhang, Chengliang; Xiao, Mingwei; He, Jinge

    2015-01-01

    Highlights: • A novel bio-fuel, glucose solution emulsified diesel fuel, is evaluated. • Emulsified diesel has comparable brake thermal efficiency. • NO X emissions decrease with emulsified fuel at all loads. • Soot emissions decrease with emulsified fuel except at a few operating points. - Abstract: The subject of this paper was to study the performance and emissions of two typical diesel engines using glucose solution emulsified diesel fuel. Emulsified diesel with a 15% glucose solution by mass fraction was used in diesel engines and compared with pure diesel. For the agricultural diesel engine, performance and emission characteristics were measured under various engine loads. The results showed that the brake thermal efficiencies were improved using emulsified diesel fuel. Emulsified fuel decreased NO x and soot emissions except at a few specific operating conditions. HydroCarbon (HC) and CO emissions were increased. For the automotive diesel engine, performance and emissions were measured using the 13-mode European Stationary Cycle (ESC). It was found that brake thermal efficiencies of emulsified diesel and pure diesel were comparable at 75% and 100% load. Soot emissions decreased significantly while NO x emissions decreased slightly. HC emissions increased while CO emissions decreased at some operating conditions

  13. Optimizing the efficiency of a diesel engine for a hybrid wind-diesel experimental validation; Optimisation de l'efficacite du moteur diesel pour un systeme hybride eolien-diesel-validation experimentale

    Energy Technology Data Exchange (ETDEWEB)

    Ibrahim, H.; Dimitrova, M. [TechnoCentre Eolien, Murdochville, PQ (Canada); Ilinca, A. [Quebec Univ., Rimouski, PQ (Canada); Perron, J. [Quebec Univ., Chicoutimi, PQ (Canada)

    2010-07-01

    This study examined the feasibility of using a wind-diesel compressed air storage system in large-scale gas turbines at remote sites where a good wind resource is available. Studies have shown that the system can increase the wind energy penetration rate, particularly when combined with a turbo diesel engine. The system increases the power and performance of the diesel engine and reduces fuel consumption and emissions of greenhouse gases greenhouse gases (GHG). This study included a comparison of different technical solutions for the compressed air energy storage system, and described the one that optimized the performance and cost of the overall system. The optimal solution allowed the turbocharger to operate independently of the engine due to the energy provided by the compressed air in the air turbine. Optimization required maximizing the compressor power as an objective function. The energy balance of the engine itself had to be taken into account, along with the turbo charging system. 12 refs., 2 tabs., 16 figs.

  14. Decomposition of diesel oil by various microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Suess, A; Netzsch-Lehner, A

    1969-01-01

    Previous experiments demonstrated the decomposition of diesel oil in different soils. In this experiment the decomposition of /sup 14/C-n-Hexadecane labelled diesel oil by special microorganisms was studied. The results were as follows: (1) In the experimental soils the microorganisms Mycoccus ruber, Mycobacterium luteum and Trichoderma hamatum are responsible for the diesel oil decomposition. (2) By adding microorganisms to the soil an increase of the decomposition rate was found only in the beginning of the experiments. (3) Maximum decomposition of diesel oil was reached 2-3 weeks after incubation.

  15. AUTOMOTIVE DIESEL MAINTENANCE 1. UNIT XXVII, I--CATERPILLAR STARTING (PONEY) ENGINE (PART I), II--LEARNING ABOUT BRAKES (PART II).

    Science.gov (United States)

    Minnesota State Dept. of Education, St. Paul. Div. of Vocational and Technical Education.

    THIS MODULE OF A 30-MODULE COURSE IS DESIGNED TO DEVELOP AN UNDERSTANDING OF THE CONSTRUCTION AND OPERATION OF DIESEL ENGINE STARTING ENGINES AND BRAKE SYSTEMS USED ON DIESEL POWERED VEHICLES. TOPICS ARE (1) GENERAL DESCRIPTION, (2) OPERATION, (3) COMBUSTION SPACE AND VALVE ARRANGEMENT (STARTING ENGINES), (4) TYPES OF BRAKES, AND (5) DOUBLE…

  16. Electricity generating system. [Wind/diesel/flywheel system

    Energy Technology Data Exchange (ETDEWEB)

    Moody, R.L.

    1992-02-05

    An electricity generating system is described which includes a water tank with electric heating elements connected to the water cooling system of a diesel engine which is heated by excess output of the system. Power in excess of that required by a load which is generated by a wind turbine driven generator runs up a flywheel and further excess is absorbed in the tank. A fan associated with a radiator connected to the tank may be operated to dissipate further excess power. When the load requirements exceed the output of the generators linked to the wind turbine and the flywheel the engine operates a synchronous alternator. (author).

  17. Castor Seed from Melkasa Agricultural Research Centre, East Showa, Ethiopia and it’s biodiesel performance in Four Stroke Diesel Engine

    Directory of Open Access Journals (Sweden)

    Tesfahun Tegegne Akanawa

    2014-05-01

    Full Text Available This study focused in investigating the fuel properties of Castor oil Methyl Ester (CME and its blend with diesel fuel in running a diesel engine. Engine tests have been carried out with the aim of obtaining comparative measures of torque, power, and specific fuel consumption. Castor oil was extracted by using a mechanical pressing machine and trans-esterification was made by methyl alcohol and potassium hydroxide as a catalyst.  So that its viscosity and density were reduced and by increasing its volatility.  By following the procedures given in American Society for Testing and Materials (ASTM book the fuel characteristics were identified whether it fulfil the requirements needed to be used as a fuel in internal combustion engines or not. From the characterization result, it was proved that trans-esterified castor oil was found to be a promising alternative fuel for compression ignition (diesel engines. But the viscosity of CME was still higher and the energy content was a little bit less as compared to petro diesel. To solve these problems CME was blended with petro diesel in some proportion (B5, B10, B20, B40, B80. The torque, power and brake specific fuel consumption performances of CME and its blends with petro diesel were tested in a four stroke diesel engine. The analyzed results were compared with that of petro diesel and found to be very nearly similar, making CME a suiTable alternative fuel for petro diesel.

  18. Power

    DEFF Research Database (Denmark)

    Elmholdt, Claus Westergård; Fogsgaard, Morten

    2016-01-01

    and creativity suggests that when managers give people the opportunity to gain power and explicate that there is reason to be more creative, people will show a boost in creative behaviour. Moreover, this process works best in unstable power hierarchies, which implies that power is treated as a negotiable....... It is thus a central point that power is not necessarily something that breaks down and represses. On the contrary, an explicit focus on the dynamics of power in relation to creativity can be productive for the organisation. Our main focus is to elaborate the implications of this for practice and theory...

  19. Study of the technical specifications for the diesels generator of Juragua NPP

    International Nuclear Information System (INIS)

    Vilaragut Llanes, J.J.

    1996-01-01

    The Technical Specifications of a nuclear power plant specify the limits for plant operation from the safety point of view. These operational safety rules were originally defined on the basis of deterministic analysis and engineering judgement. The Probabilistic safety Assessment, constitutes a tool to analyze of the risk effect in the Technical Specifications Rules, and makes possible a relative comparison of the rules from the risk point of view. This paper studies the technical specifications for the diesels generators of Juragua Nuclear Power Plant and for that was used the probabilistic methodology . It is presented the evaluation of the some parameters as surveillance testing, test interval, repairs time, diesel degradation and AOT

  20. Thermodynamic analysis of diesel engine coupled with ORC and absorption refrigeration cycle

    International Nuclear Information System (INIS)

    Salek, Farhad; Moghaddam, Alireza Naghavi; Naserian, Mohammad Mahdi

    2017-01-01

    Highlights: • Coupling ORC and Ammonia absorption cycles with diesel engine to recover energy. • By using designed bottoming system, recovered diesel engine energy is about 10%. • By using designed bottoming system, engine efficiency will grow about 4.65%. - Abstract: In this paper, Rankine cycle and Ammonia absorption cycle are coupled with Diesel engine to recover the energy of exhaust gases. The novelty of this paper is the use of ammonia absorption refrigeration cycle bottoming Rankine cycle which coupled with diesel engine to produce more power. Bottoming system converts engine exhaust thermal energy to cooling and mechanical energy. Energy transfer process has been done by two shell and tube heat exchangers. Simulation processes have been done by programming mathematic models of cycles in EES Program. Based on results, recovered energy varies with diesel engine load. For the particular load case of current research, the use of two heat exchangers causes 0.5% decrement of engine mechanical power. However, the recovered energy is about 10% of engine mechanical power.

  1. Economic Efficiency Assessment of Autonomous Wind/Diesel/Hydrogen Systems in Russia

    Directory of Open Access Journals (Sweden)

    O. V. Marchenko

    2013-01-01

    Full Text Available The economic efficiency of harnessing wind energy in the autonomous power systems of Russia is analyzed. Wind turbines are shown to be competitive for many considered variants (groups of consumers, placement areas, and climatic and meteorological conditions. The authors study the possibility of storing energy in the form of hydrogen in the autonomous wind/diesel/hydrogen power systems that include wind turbines, diesel generator, electrolyzer, hydrogen tank, and fuel cells. The paper presents the zones of economic efficiency of the system (set of parameters that provide its competitiveness depending on load, fuel price, and long-term average annual wind speed. At low wind speed and low price of fuel, it is reasonable to use only diesel generator to supply power to consumers. When the fuel price and wind speed increase, first it becomes more economical to use a wind-diesel system and then wind turbines with a hydrogen system. In the latter case, according to the optimization results, diesel generator is excluded from the system.

  2. Utilizing Philippine Calatrava coal-diesel oil mixture (CDOM) as alternative fuel for industrial steam generator

    Energy Technology Data Exchange (ETDEWEB)

    Archie B. Maglaya [De La Salle University, Manila (Philippines). Department of Mechanical Engineering

    2005-01-01

    The fast depletion of fuel oil and the continuous increase in the demand for power is a global issue. In the Philippines, the demand for diesel oil is expected to increase significantly in a 20-year period as projected by the Department of Energy. In line with the Philippine Government's thrust to lessen the dependence on imported energy, the agenda for the search for alternative fuel is highly prioritized. Thus, this paper presents the results of the study on performance analysis and efficiency test of a diesel oil fired industrial steam generator using Philippine Calatrava coal-diesel oil mixture (CDOM) as alternative fuel. A computer program was developed in HyperText Markup Language (HTML{copyright}) and JavaScript{copyright} to aid the computation of the adiabatic flame temperature from the governing system of equations based on the heat interaction between CDOM fuel, combustion air and products of combustion to determine the most desirable alternative fuel. Actual experimentation for the determination of CDOM fuel properties was also conducted to verify the alternative fuel selected through theoretical calculations. Results showed that the CDOM fuel with a particle size passing 75 {mu}m (-200 mesh) sieve having a proportion of 5% pulverized coal-95% diesel oil and 10% pulverized coal-90% diesel oil could be handled throughout the test with no degradation of the industrial steam generator. The steam generator efficiency using diesel oil is close to the steam generator efficiency using both CDOM fuels. 20 refs., 5 figs., 4 tabs.

  3. Effect of beadles from soybean on the exhaust emission of a turbocharged diesel engine

    International Nuclear Information System (INIS)

    Shan, G.E.; Jian, T.; Shah, A.N.

    2009-01-01

    This paper presents the regulated emissions in the light of cylinder pressure and heat release rate (HRR) from a 4-stroke direct injection (DI) diesel engine fuelled with neat soybean oil-based biodiesel, commercial diesel and 20% biodiesel-diesel blend. The engine was run using electrical dynamometer at four different engine conditions. The experimental results revealed that brake power (BP) of the engine decreased but brake specific fuel consumption (BSFC) increased with biodiesel as compared to diesel. Relative to diesel, the maximum combustion pressure (MCP) was higher; however, HRR curves were not much deeper in the ignition delay (ID) periods and the premixed combustion peaks were lower with biodiesel. Carbon monoxide (CO), total hydrocarbons (HC), smoke opacity, and particulate matter (PM) emissions decreased by 3% to 14%, 32.6% to 46%, 56.5% to 83%, and 71% to 87.8%, respectively; however, oxides of nitrogen (NOx) increased by 2% to 10% with biodiesel, compared to the commercial diesel. Both smoke and NOx pollutants were greatly influenced by the MCP, CO, HC, and PM emissions were higher at lower load conditions compared to higher load conditions, but NO/sub x/ and smoke pollutants were higher at higher load conditions relative to lower load conditions. (author)

  4. Membrane-Based Air Composition Control for Light-Duty Diesel Vehicles: A Benefit and Cost Assessment; FINAL

    International Nuclear Information System (INIS)

    K. Stork; R. Poola

    1998-01-01

    This report presents the methodologies and results of a study conducted by Argonne National Laboratory (Argonne) to assess the benefits and costs of several membrane-based technologies. The technologies evaluated will be used in automotive emissions-control and performance-enhancement systems incorporated into light-duty diesel vehicle engines. Such engines are among the technologies that are being considered to power vehicles developed under the government-industry Partnership for a New Generation of Vehicles (PNGV). Emissions of nitrogen oxides (NO(sub x)) from diesel engines have long been considered a barrier to use of diesels in urban areas. Recently, particulate matter (PM) emissions have also become an area of increased concern because of new regulations regarding emissions of particulate matter measuring 2.5 micrometers or less (PM(sub 2.5)). Particulates are of special concern for diesel engines in the PNGV program; the program has a research goal of 0.01 gram per mile (g/mi) of particulate matter emissions under the Federal Test Procedure (FTP) cycle. This extremely low level (one-fourth the level of the Tier II standard) could threaten the viability of using diesel engines as stand-alone powerplants or in hybrid-electric vehicles. The techniques analyzed in this study can reduce NO(sub x) and particulate emissions and even increase the power density of the diesel engines used in light-duty diesel vehicles

  5. Main results from Risoe's wind-diesel programme 1984-1990

    International Nuclear Information System (INIS)

    Lundsager, P.; Christensen, C.J.

    1991-12-01

    The report presents the results of the wind-diesel work done in projects at Risoe National Laboratory during the years 1984-90, including important earlier publications as appendices. The partners in the original joint project were Risoe National Laboratory, Denmark, and Chalmers University of Technology, Sweden. Chalmers has constructed and laboratory tested an advanced wind-diesel-battery system with variable speed operation of the wind turbine, while Risoe has established a flexible and versatile wind-diesel test facility and field tested Chalmers system. As part of the subsequent EFP projects Risoe designed and constructed a simple wind-diesel system without storage, characterized by several innovative features. This concept was part of a ''simple wind-diesel systems strategy'', in which immediate cost-effectiveness is ensured by the simplicity and reliability of the design. Dynamic computer models were developed for system design and analysis purposes, and a general logistic computer model was developed for the determination of fuel savings and power supply capabilities for a number of system configurations. In addition to a considerable body of experience the main results of activities are: A versatile wind-diesel test facility and a proposed standard wind-diesel test procedure. Two wind-diesel systems at each end of the spectrum of configurations. Computer models for logistic and dynamic modelling. The two systems represent the very simple system concept, believed to be a presently economically optimal configuration, and the very sophisticated concept believed to be a future optimal configuration. (au) (6 tabs., 67 ills., 25 refs.)

  6. METHOD OF CONVERSION OF HIGH- AND MIDDLE-SPEED DIESEL ENGINES INTO GAS DIESEL ENGINES

    Directory of Open Access Journals (Sweden)

    Mikhail G. Shatrov

    2017-12-01

    Full Text Available The paper aims at the development of fuel supply and electronic control systems for boosted high- and middle-speed transport engines. A detailed analysis of different ways of converting diesel engine to operate on natural gas was carried out. The gas diesel process with minimized ignition portion of diesel fuel injected by the Common Rail (CR system was selected. Electronic engine control and modular gas feed systems which can be used both on high- and middle-speed gas diesel engines were developed. Also diesel CR fuel supply systems were developed in cooperation with the industrial partner, namely, those that can be mounted on middle-speed diesel and gas diesel engines. Electronic control and gas feed systems were perfected using modeling and engine tests. The high-speed diesel engine was converted into a gas diesel one. After perfection of the gas feed and electronic control systems, bench tests of the high-speed gas diesel engine were carried out showing a high share of diesel fuel substitution with gas, high fuel efficiency and significant decrease of NOх and СО2 emissions.

  7. Mathematical model of combined parametrical analysis of indicator process and thermal loading on the Diesel engine piston

    Directory of Open Access Journals (Sweden)

    G. Lebedeva

    2004-06-01

    Full Text Available In the publication the methodical aspects of a mathematical model of the combined parametrical analysis of an indicator process and thermal loading on the diesel engine piston have been considered. A thermodynamic model of a diesel engine cycle is developed. The executed development is intended for use during researches and on the initial stages of design work. Its realization for high revolution diesel engines of perspective type CHN15/15 allowed to choose rational variants for the organization of an indicator process and to prove power ranges of application for not cooled and created cooled oil welded pistons.

  8. Study on Waste Heat Utilization Device of High-Temperature Freshwater in the Modern Marine Diesel Engine

    Science.gov (United States)

    Wang, Shuaijun; Liu, Chentao; Zhou, Yao

    2018-01-01

    Based on using the waste heat recycling from high temperature freshwater in marine diesel engine to heat fuel oil tank, lubrication oil tank and settling tank and so on to achieve energy saving, improve fuel efficiency as the goal, study on waste heat utilization device of high-temperature freshwater in the modern marine diesel engine to make the combustion chamber effectively cooled by high-temperature freshwater and the inner liner freshwater temperature heat is effectively utilized and so on to improve the overall efficiency of the power plant of the ship and the diesel optimum working condition.

  9. Diesel Catalytic Converters As Emission Control Devices

    International Nuclear Information System (INIS)

    El Banna, S.; El Deen, O.N.

    2004-01-01

    Internal combustion engines are devices that generate work from combustion reactions. Combustion products under high pressure produce work by expansion through a turbine or piston. The combustion reactions inside these engines are not necessarily neutralizing or complete and air pollutants are produced. There are three major types of internal combustion engine(l) in use today: I) the spark ignition engine, which is used primarily in automobiles; 2) the diesel engine, which is used in large vehicles and industrial systems where cycle efficiency offers advantages over the more compact and lighter-weight spark ignition engine and; 3) the gas turbine, which is used in aircraft due to its high power/weight ratio and is also used for stationary power generation. Each of these types of engine is an important source of atmospheric pollutants. Automobiles are the one of the major source of carbon monoxide, unburned hydrocarbons, and nitrogen oxides. Probably more than any other combustion system, the design of automobile engines is now being guided by requirements to reduce emissions of these pollutants. While substantial progress has been made in emission reduction, automobiles remain important sources of air pollutants

  10. Experimental study on performance and exhaust emissions of a diesel engine fuelled with Ceiba pentandra biodiesel blends

    International Nuclear Information System (INIS)

    Silitonga, A.S.; Masjuki, H.H.; Mahlia, T.M.I.; Ong, Hwai Chyuan; Chong, W.T.

    2013-01-01

    Highlights: • Ceiba pentandra biodiesel was prepared by two-step transesterification. • The main FAC of C. pentandra is 18.54% of malvalic acid. • Engine performance and emission are conducted for CPME and its blends. • The CPB10 gives the best engine performance at 1900 rpm. • The CO, HC and smoke opacity were lower for all biodiesel blends. - Abstract: Nowadays, production of biodiesel from non-edible feedstock is gaining more attention than edible oil to replace diesel fuel. Thus, Ceiba pentandra is chosen as a potential biodiesel feedstock for the present investigations based on the availability in Indonesia and Malaysia. C. pentandra methyl ester was prepared by two-step acid esterification (H 2 SO 4 ) and base transesterification (NaOH) process. The purpose of this study is to examine the engine performance and emission characteristic of C. pentandra biodiesel diesel blends in internal combustion. Besides, the detailed properties of C. pentandra biodiesel, biodiesel diesel blends and diesel were measured and evaluated. After that, the biodiesel diesel blends (10%, 20%, 30% and 50%) were used to conduct engine performance and exhaust emission characteristic at different engine speeds. The experimental results showed that CPB10 blend give the best results on engine performance such as engine torque and power at 1900 rpm with full throttle condition. Besides, the brake specific fuel consumption at maximum torque (161 g/kW h) for CPB10 is higher about 22.98% relative to diesel fuel (198 g/kW h). This is shown that the lower biodiesel diesel blends ratio will increase the performance and reduce the fuel consumption. Moreover, the exhaust emissions showed that CO, HC and smoke opacity were reduced for all biodiesel diesel blends. However, NO x and CO 2 were increased compared to petrol diesel. Overall, the results proved that C. pentandra biodiesel is a suitable alternative and substitute fuel to diesel

  11. The Diesel as a Vehicle Engine

    Science.gov (United States)

    Neumann, Kurt

    1928-01-01

    The thorough investigation of a Dorner four-cylinder, four-stroke-cycle Diesel engine with mechanical injection led me to investigate more thoroughly the operation of the Diesel as a vehicle engine. Aside from the obvious need of reliability of functioning, a high rotative speed, light weight and economy in heat consumption per horsepower are also indispensable requirements.

  12. One step processing for future diesel specifications

    International Nuclear Information System (INIS)

    Brierley, G.R.

    1997-01-01

    The trend in diesel fuel specifications is to limit the sulfur level to less than 0.05 wt- per cent. Many regions have also specified that diesel fuels must have lower aromatic levels, higher cetane numbers, and lower distillation end points. These changes will require significant refinery investment to meet the new diesel fuel specifications. The changes may also significantly affect the value of synthetic crude stocks. UOP has developed a new hydroprocessing catalyst which makes it possible to meet the new diesel specifications in one single processing step and at minimal cost. The catalyst saturates aromatics while opening ring structures at the same time. By selectively cracking heavy components into the diesel range with minimal cracking to gas or naphtha, heavier feedstocks can be upgraded to diesel, and refinery diesel yield can be augmented. Synthetic crude distillate is often high in aromatics and low in cetane number. This new UOP hydroprocessing system will allow synthetic crude producers and refiners to produce diesel fuels with higher cetane numbers, high-quality distillate blendstocks and distillate fuels. 26 figs

  13. Diesel engine emission deterioration - a preliminary study

    CSIR Research Space (South Africa)

    Pretorius, Cecilia J

    2016-04-01

    Full Text Available The objective of this study was to find a parameter in diesel and oil analysis of underground mining vehicles that can be correlated with personal diesel particulate matter (DPM) exposure and used as part of an engine maintenance programme. A number...

  14. Diesel Technology: Engines. [Teacher and Student Editions.

    Science.gov (United States)

    Barbieri, Dave; Miller, Roger; Kellum, Mary

    Competency-based teacher and student materials on diesel engines are provided for a diesel technology curriculum. Seventeen units of instruction cover the following topics: introduction to engine principles and procedures; engine systems and components; fuel systems; engine diagnosis and maintenance. The materials are based on the…

  15. Standardized Curriculum for Diesel Engine Mechanics.

    Science.gov (United States)

    Mississippi State Dept. of Education, Jackson. Office of Vocational, Technical and Adult Education.

    Standardized curricula are provided for two courses for the secondary vocational education program in Mississippi: diesel engine mechanics I and II. The eight units in diesel engine mechanics I are as follows: orientation; shop safety; basic shop tools; fasteners; measurement; engine operating principles; engine components; and basic auxiliary…

  16. Main problems experienced on diesel generators of French 900 MWe operating units

    Energy Technology Data Exchange (ETDEWEB)

    Dredemis, Geoffroy; Jude, Francois [Commissariat a l' Energie Atomique, centre d' Etudes Nucleaires de Fontenay-aux-Roses, Institut de Protection et Surete Nucleaire, Departement d' Analyse de Surete, B.P. No. 6, 92260 Fontenay-aux-Roses (France)

    1986-02-15

    Each unit of all the French nuclear power plant is equipped with two diesel emergency generator sets., For the totality of standards PWRs of 900 MWe, they are identical. We present in this communication the most significative failures met with diesel engines on operating units, such as rupture of fuel injection pipes, breaking of the connecting rods, and cylinder lubrication failures. All these incidents, which affected the emergency power sources of concerned units, had generic characteristics. In view of their potential consequences, it was proceeded in each case to an immediate control of the components concerned of all PWR 900 MWe diesel engines. At the same time, studies were started as to what modifications would permit to solve rapidly each one of the problems met with. (authors)

  17. Performance Analysis of an Evaporator for a Diesel Engine–Organic Rankine Cycle (ORC Combined System and Influence of Pressure Drop on the Diesel Engine Operating Characteristics

    Directory of Open Access Journals (Sweden)

    Chen Bei

    2015-06-01

    Full Text Available The main purpose of this research is to analyze the performance of an evaporator for the organic Rankine cycle (ORC system and discuss the influence of the evaporator on the operating characteristics of diesel engine. A simulation model of fin-and-tube evaporator of the ORC system is established by using Fluent software. Then, the flow and heat transfer characteristics of the exhaust at the evaporator shell side are obtained, and then the performance of the fin-and-tube evaporator of the ORC system is analyzed based on the field synergy principle. The field synergy angle (β is the intersection angle between the velocity vector and the temperature gradient. When the absolute values of velocity and temperature gradient are constant and β < 90°, heat transfer enhancement can be achieved with the decrease of the β. When the absolute values of velocity and temperature gradient are constant and β >90°, heat transfer enhancement can be achieved with the increase of the β. Subsequently, the influence of the evaporator of the ORC system on diesel engine performance is studied. A simulation model of the diesel engine is built by using GT–Power software under various operating conditions, and the variation tendency of engine power, torque, and brake specific fuel consumption (BSFC are obtained. The variation tendency of the power output and BSFC of diesel engine–ORC combined system are obtained when the evaporation pressure ranges from 1.0 MPa to 3.5 MPa. Results show that the field synergy effect for the areas among the tube bundles of the evaporator main body and the field synergy effect for the areas among the fins on the windward side are satisfactory. However, the field synergy effect in the areas among the fins on the leeward side is weak. As a result of the pressure drop caused by the evaporator of the ORC system, the diesel engine power and torque decreases slightly, whereas the BSFC increases slightly with the increase of exhaust back

  18. Life cycle assessment of climate impact of Fischer-Tropsch diesel based on peat and biomass

    Energy Technology Data Exchange (ETDEWEB)

    Holmgren, Kristina; Hagberg, Linus

    2009-02-15

    By combining biomass gasification and Fischer-Tropsch synthesis it is possible to produce biodiesel. Vapo is investigating the possibilities for a plant where a mixture of different biomass fractions and peat would be used as raw material. In this study the climate impact of such synthetic diesel is calculated in terms of radiative forcing. The calculations show that the following parameters have large impact on the results: the emission factors associated with external power demand (purchased electricity) the use of carbon capture and storage the time perspective used in the analysis the raw material mix (amount of peat vs. amount of forest residues) the reference scenario for the peat production (type of peatland) All the FT-diesel scenarios with a peat input of 90% will have higher climate impact than fossil diesel after 100 years, except when CCS is applied and Swedish electricity mix is assumed for the external power demand. In order to have lower climate impact than conventional diesel after 100 years, the peat input must be significantly lower than the biomass input. Substantial reductions of the climate impact can be achieved by applying CCS. With CCS, all peat based FT-diesel scenarios (except the ones based on 90% peat) result in lower climate impact than fossil diesel after both 100 and 300 years. For scenarios with marginal electricity, the reductions are 50-84% after 100 years compared to conventional diesel. For scenarios with Swedish electricity mix the reductions are 100-135% (i.e. zero or negative radiative forcing). The scenarios in this study are based on the assumption that the biodiesel refinery is located close to a harbour so that transportation of captured CO{sub 2} to a storage site can be made by ship. An inland location would require truck transport or pipelines and the cost, infrastructure and logistics for this might not be feasible

  19. FORMALIZATION OF DIESEL ENGINE OPERATION CONSIDERING THE EVALUATION OF VELOCITY DURING THE COMBUSTION PROCESSES

    Directory of Open Access Journals (Sweden)

    V. P. Litvinenko

    2015-10-01

    Full Text Available Purpose. Under modern conditions the applying methods and design models as well as the evaluation of the operational characteristics of diesel engines do not completely take into consideration the specifics of the combustion processes. In part, such situation is characterized by the complexity of considering of varied by its nature processes that haven’t been completely investigated. In this context it is necessary to find the new methods and models which would provide relatively simple solutions through the use of integrated factors based on the analysis of parameters of diesel engines. Methodology. The proposed algorithms for the estimating of the combustion process in the form of volumetric and linear velocities is based on the well-known parameters of power and mean effective pressure and allows to compare the efficiency of their behavior in various versions of diesel engines. Findings. The author specified that the volumetric / linear velocity ratio is characterized by some strength and depends on the geometric dimensions of the cylinder-piston group. Due to the assumptions it has become possible to consider the operation of a diesel engine as a system comprising: 1 the subsystem that provides the possibility of obtaining the thermal energy; 2 the subsystem providing the thermal energy transformation; 3 the subsystem that provides the necessary diesel engine power depending on terms of combustion of air-fuel mixture. Originality. The author of the paper proposed the indices of volumetric and linear combustion velocity of air-fuel mixture in the engine cylinder, that allow to obtain the comparative value in different modifications taking into account the possible choice of optimum ratio. Practical value. The usage of indices of volumetric and linear velocities of the combustion processes in the engine cylinder combined with a mathematical model will simplify the method of diesels calculating. Parametric indices of the mentioned velocities

  20. Electron beam treatment of simulated marine diesel exhaust gases

    Directory of Open Access Journals (Sweden)

    Licki Janusz

    2015-09-01

    Full Text Available The exhaust gases from marine diesel engines contain high SO2 and NOx concentration. The applicability of the electron beam flue gas treatment technology for purification of marine diesel exhaust gases containing high SO2 and NOx concentration gases was the main goal of this paper. The study was performed in the laboratory plant with NOx concentration up to 1700 ppmv and SO2 concentration up to 1000 ppmv. Such high NOx and SO2 concentrations were observed in the exhaust gases from marine high-power diesel engines fuelled with different heavy fuel oils. In the first part of study the simulated exhaust gases were irradiated by the electron beam from accelerator. The simultaneous removal of SO2 and NOx were obtained and their removal efficiencies strongly depend on irradiation dose and inlet NOx concentration. For NOx concentrations above 800 ppmv low removal efficiencies were obtained even if applied high doses. In the second part of study the irradiated gases were directed to the seawater scrubber for further purification. The scrubbing process enhances removal efficiencies of both pollutants. The SO2 removal efficiencies above 98.5% were obtained with irradiation dose greater than 5.3 kGy. For inlet NOx concentrations of 1700 ppmv the NOx removal efficiency about 51% was obtained with dose greater than 8.8 kGy. Methods for further increase of NOx removal efficiency are presented in the paper.

  1. Acoustical monitoring of diesel engines in reverberant environment

    International Nuclear Information System (INIS)

    Mein, M.

    1995-10-01

    The feed-back knowledge of emergency diesel generators in nuclear power plants shows that some malfunctions, mainly affecting fuel-injection or distribution system of the engine can be heard and detected by experienced maintenance agents. This study consists in the feasibility,v of acoustical monitoring of those diesel engines, taking into account the reverberant environment of the machine. The operating cycle of the diesel is composed of transient events (injection, combustion, valve closure...) which generate highly non stationary acoustical signals. The detection of a malfunction appearing on such transients requires the use of adapted signal processing techniques. Visual analysis of the phenomena is first proceeded using time-frequency and time-scale representations. The second step will be parametric modeling of acoustical signatures for the extraction of characteristic parameters, in order to characterize the fault and to use an automatic classification system. The lest part of the study will concern the evaluation of the robustness of the detection methods in regard to acoustical reverberation. (author). 10 refs., 6 figs

  2. Effect of biodiesel fuels on diesel engine emissions

    Energy Technology Data Exchange (ETDEWEB)

    Lapuerta, Magin; Armas, Octavio; Rodriguez-Fernandez, Jose [Escuela Tecnica Superior de Ingenieros Industriales, University of Castilla-La Mancha, Avda. Camilo Jose Cela, s/n. 13071 Ciudad Real (Spain)

    2008-04-15

    The call for the use of biofuels which is being made by most governments following international energy policies is presently finding some resistance from car and components manufacturing companies, private users and local administrations. This opposition makes it more difficult to reach the targets of increased shares of use of biofuels in internal combustion engines. One of the reasons for this resistance is a certain lack of knowledge about the effect of biofuels on engine emissions. This paper collects and analyzes the body of work written mainly in scientific journals about diesel engine emissions when using biodiesel fuels as opposed to conventional diesel fuels. Since the basis for comparison is to maintain engine performance, the first section is dedicated to the effect of biodiesel fuel on engine power, fuel consumption and thermal efficiency. The highest consensus lies in an increase in fuel consumption in approximate proportion to the loss of heating value. In the subsequent sections, the engine emissions from biodiesel and diesel fuels are compared, paying special attention to the most concerning emissions: nitric oxides and particulate matter, the latter not only in mass and composition but also in size distributions. In this case the highest consensus was found in the sharp reduction in particulate emissions. (author)

  3. Evaluation of Hydroprocessed Renewable Diesel (HRD) Fuel in a Caterpillar Engine Using the 210 Hour TWV Cycle

    Science.gov (United States)

    2014-05-01

    TERMS Hydroprocessed Renewable Diesel , Reference Diesel Fuel, C7, emissions, power, performance, deposition, ambient, desert, synthetic fuel injector ...the engine run-in, the engine was disassembled to determine injector nozzle tip deposits, and the piston crowns and engine combustion chamber deposits...removed from the test cell and disassembled to determine injector nozzle tip and piston crown and engine combustion chamber deposits. Post- test

  4. Final report : Alberta renewable diesel demonstration

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-02-15

    The Alberta renewable diesel demonstration (ARDD) was a demonstration project aimed at providing information and operating experience to stakeholders in the diesel fuel industry. The demonstration took renewable diesel from the lab to the road, providing hands-on experience at 2 and 5 per cent blends (B2 in winter and B5 in shoulder and summer seasons). The ARDD fleet consisted of 59 vehicles running on two types of renewable diesel, notably fatty acid methyl ester (FAME) and hydrogenated-derived renewable diesel (HDRD). This report was a summary of the observations of the ARDD. The report provided a general account of the project scope, methods and observations employed in a multi-stakeholder, real-world demonstration of low-level renewable diesel fuels in challenging winter conditions. The purpose of the report was to provide feedback to stakeholders regarding the use of renewable diesel fuels in Canada's on-road diesel fuel market and to confirm the operability of low level renewable diesel blends under the specific conditions tested ensuring full and continuous compliance with CAN/CGSB 3.520. The report discussed Canada's fuel distribution system in western Canada; the blending facility; blending techniques; fuel retail locations; fuel properties; fuel handling; fuel selection; and fuel testing. It was concluded that the ARDD demonstrated that B2 blends of canola methyl ester and 2 per cent blends of hydrogenation derived renewable diesel were fully operable in winter conditions in the study area when cloud points were adjusted to meet CAN/CGSB requirements. 4 refs., 15 tabs., 20 figs., 2 appendices.

  5. Annual Report: DOE Advanced Combustion Systems & Fuels R&D; Light-Duty Diesel Combustion

    Energy Technology Data Exchange (ETDEWEB)

    Busch, Stephen [Sandia National Lab. (SNL-CA), Livermore, CA (United States)

    2017-11-01

    Despite compliance issues in previous years, automakers have demonstrated that the newest generation of diesel power trains are capable of meeting all federal and state regulations (EPA, 2016). Diesels continue to be a cost-effective, efficient, powerful propulsion source for many light- and medium-duty vehicle applications (Martec, 2016). Even modest reductions in the fuel consumption of light- and medium duty diesel vehicles in the U.S. will eliminate millions of tons of CO2 emissions per year. Continued improvement of diesel combustion systems will play an important role in reducing fleet fuel consumption, but these improvements will require an unprecedented scientific understanding of how changes in engine design and calibration affect the mixture preparation, combustion, and pollutant formation processes that take place inside the cylinder. The focus of this year’s research is to provide insight into the physical mechanisms responsible for improved thermal efficiency observed with a stepped-lip piston. Understanding how piston design can influence efficiency will help engineers develop and optimize new diesel combustion systems.

  6. Finite element analysis of a crankshaft of diesel engine

    International Nuclear Information System (INIS)

    Bannikiv, M.G.

    2005-01-01

    This research was a part of the project aimed at the increase in power of the direct injection turbocharged twelve- cylinder V-type diesel engine. Crankshaft of a high power high speed diesel engine is subjected to complex loading conditions and undergoes high cyclic loads of the order of 107 to 108 cycles. Therefore, durability of this component is of critical importance. Strength analysis was based on the assessment of factor of safety (FOS) of the engine augmented by brake mean effective pressure (bmep) and/or engine speed. In the first part of the study, mechanical loads due to gas pressure and inertia forces were obtained from engine cycle simulation. Relationships for displacement, velocity and acceleration of an articulated connecting rod piston as a function of engine geometry and crank angle were derived. In the second part, the range of bmep and engine speed was determined over which engine performance is satisfactory on the basis of fatigue. It was shown that with limitations imposed (unchanged design and material of the crankshaft) the crankshaft of the given engine can withstand increase in power up to 15%. It was recommended, that required increase in engine power should be realized by the increase in bmep, since the increase in engine speed would deteriorate combustion efficiency. Finite Element Analysis was used to verify stresses calculations. New features of procedure used and relationships obtained in this research apply to strength analysis of other types of internal combustion engines. (author)

  7. Effect of Alcohol on Diesel Engine Combustion Operating with Biodiesel-Diesel Blend at Idling Conditions

    Science.gov (United States)

    Mahmudul, H. M.; Hagos, Ftwi. Y.; A, M. Mukhtar N.; Mamat, Rizalman; Abdullah, A. Adam

    2018-03-01

    Biodiesel is a promising alternative fuel to run the automotive engine. However, its blends have not been properly investigated during idling as it is the main problem to run the vehicles in a big city. The purpose of this study is to evaluate the impact of alcohol additives such as butanol and ethanol on combustion parameters under idling conditions when a single cylinder diesel engine operates with diesel, diesel-biodiesel blends, and diesel biodiesel-alcohol blends. The engine combustion parameters such as peak pressure, heat release rate and ignition delay were computed. This investigation has revealed that alcohol blends with diesel and biodiesel, BU20 blend yield higher maximum peak cylinder pressure than diesel. B5 blend was found with the lowest energy release among all. B20 was slightly lower than diesel. BU20 blend was seen with the highest peak energy release where E20 blend was found advance than diesel. Among all, the blends alcohol component revealed shorter ignition delay. B5 and B20 blends were influenced by biodiesel interference and the burning fraction were found slightly slower than conventional diesel where BU20 and E20 blends was found slightly faster than diesel So, based on the result, it can be said that among the alcohol blends butanol and ethanol can be promising alternative at idling conditions and can be used without any engine modifications.

  8. 30 CFR 72.520 - Diesel equipment inventory.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Diesel equipment inventory. 72.520 Section 72... Mines § 72.520 Diesel equipment inventory. (a) The operator of each mine that utilizes diesel equipment underground, shall prepare and submit in writing to the District Manager, an inventory of diesel equipment...

  9. 30 CFR 250.510 - Diesel engine air intakes.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Diesel engine air intakes. 250.510 Section 250... engine air intakes. Diesel engine air intakes must be equipped with a device to shut down the diesel engine in the event of runaway. Diesel engines that are continuously attended must be equipped with...

  10. 30 CFR 250.610 - Diesel engine air intakes.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Diesel engine air intakes. 250.610 Section 250... engine air intakes. No later than May 31, 1989, diesel engine air intakes shall be equipped with a device to shut down the diesel engine in the event of runaway. Diesel engines which are continuously...

  11. 40 CFR 1065.703 - Distillate diesel fuel.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Distillate diesel fuel. 1065.703... Standards § 1065.703 Distillate diesel fuel. (a) Distillate diesel fuels for testing must be clean and... distillate diesel fuels: (1) Cetane improver. (2) Metal deactivator. (3) Antioxidant, dehazer. (4) Rust...

  12. Acoustical monitoring of diesel engines in reverberant environment; Methodes de surveillance acoustique des diesels en milieu reverberant

    Energy Technology Data Exchange (ETDEWEB)

    Mein, M.

    1995-10-01

    The feed-back knowledge of emergency diesel generators in nuclear power plants shows that some malfunctions, mainly affecting fuel-injection or distribution system of the engine can be heard and detected by experienced maintenance agents. This study consists in the feasibility,v of acoustical monitoring of those diesel engines, taking into account the reverberant environment of the machine. The operating cycle of the diesel is composed of transient events (injection, combustion, valve closure...) which generate highly non stationary acoustical signals. The detection of a malfunction appearing on such transients requires the use of adapted signal processing techniques. Visual analysis of the phenomena is first proceeded using time-frequency and time-scale representations. The second step will be parametric modeling of acoustical signatures for the extraction of characteristic parameters, in order to characterize the fault and to use an automatic classification system. The lest part of the study will concern the evaluation of the robustness of the detection methods in regard to acoustical reverberation. (author). 10 refs., 6 figs.

  13. Assessment of energy performance and air pollutant emissions in a diesel engine generator fueled with water-containing ethanol-biodiesel-diesel blend of fuels

    International Nuclear Information System (INIS)

    Lee, Wen-Jhy; Liu, Yi-Cheng; Mwangi, Francis Kimani; Chen, Wei-Hsin; Lin, Sheng-Lun; Fukushima, Yasuhiro; Liao, Chao-Ning; Wang, Lin-Chi

    2011-01-01

    Biomass based oxygenated fuels have been identified as possible replacement of fossil fuel due to pollutant emission reduction and decrease in over-reliance on fossil fuel energy. In this study, 4 v% water-containing ethanol was mixed with (65-90%) diesel using (5-30%) biodiesel (BD) and 1 v% butanol as stabilizer and co-solvent respectively. The fuels were tested against those of biodiesel-diesel fuel blends to investigate the effect of addition of water-containing ethanol for their energy efficiencies and pollutant emissions in a diesel-fueled engine generator. Experimental results indicated that the fuel blend mix containing 4 v% of water-containing ethanol, 1 v% butanol and 5-30 v% of biodiesel yielded stable blends after 30 days standing. BD1041 blend of fuel, which composed of 10 v% biodiesel, 4 v% of water-containing ethanol and 1 v% butanol demonstrated -0.45 to 1.6% increase in brake-specific fuel consumption (BSFC, mL kW -1 h -1 ) as compared to conventional diesel. The better engine performance of BD1041 was as a result of complete combustion, and lower reaction temperature based on the water cooling effect, which reduced emissions to 2.8-6.0% for NO x , 12.6-23.7% particulate matter (PM), 20.4-23.8% total polycyclic aromatic hydrocarbons (PAHs), and 30.8-42.9% total BaPeq between idle mode and 3.2 kW power output of the diesel engine generator. The study indicated that blending diesel with water-containing ethanol could achieve the goal of more green sustainability. -- Highlights: → Water-containing ethanol was mixed with diesel using biodiesel and butanol as stabilizer and co-solvent, respectively. → Fuel blends with 4 v% water-containing ethanol, 1 v% butanol, 5-30 v% biodiesel and conventional diesel yielded a stable blended fuel after more than 30 days. → Due to more complete combustion and water quench effect, target fuel BD1041 was gave good energy performance and significant reduction of PM, NO x , total PAH and total BaPeq emissions.

  14. Investigation of diesel-ethanol blended fuel properties with palm methyl ester as co-solvent and blends enhancer

    Directory of Open Access Journals (Sweden)

    Mat Taib Norhidayah

    2017-01-01

    Full Text Available Diesel engine is known as the most efficient engine with high efficiency and power but always reported as high fuel emission. Malaysia National Automotive Policy (NAP was targeting to improve competitive regional focusing on green technology development in reducing the emission of the engine. Therefore, ethanol was introduced to reduce the emission of the engine and while increasing its performance, Palm methyl ester was introduced as blend enhancer to improve engine performance and improve diesel-ethanol blends stability. This paper aimed to study the characteristics of the blends and to prove the ability of palm-methyl-ester as co-solvent in ethanol-diesel blends. Stability and thermophysical test were carried out for different fuel compositions. The stability of diesel-ethanol blended was proved to be improved with the addition of PME at the longer period and the stability of the blends changed depending on temperature and ethanol content. Density and viscosity of diesel-ethanol-PME blends also give higher result than diesel-ethanol blends and it's proved that PME is able to increase density and viscosity of blends. Besides, heating value of the blends also increases with the increasing PME in diesel-ethanol blends.

  15. Cross-species analyses unravel the complexity of H3K27me3 and H4K20me3 in the context of neural stem progenitor cells

    Directory of Open Access Journals (Sweden)

    Christopher T. Rhodes

    2016-06-01

    Full Text Available Neural stem progenitor cells (NSPCs in the human subventricular zone (SVZ potentially contribute to lifelong neurogenesis, yet subtypes of glioblastoma multiforme (GBM contain NSPC signatures that highlight the importance of cell fate regulation. Among numerous regulatory mechanisms, the posttranslational methylations onto histone tails are crucial regulator of cell fate. The work presented here focuses on the role of 2 repressive chromatin marks trimethylations on histone H3 lysine 27 (H3K27me3 and histone H4 lysine 20 (H4K20me3 in the adult NSPC within the SVZ. To best model healthy human NSPCs as they exist in vivo for epigenetic profiling of H3K27me3 and H4K20me3, we used NSPCs isolated from the adult SVZ of baboon brain (Papio anubis with brain structure and genomic level similar to human. The putative role of H3K27me3 in normal NSPCs predominantly falls into the regulation of gene expression, cell cycle, and differentiation, whereas H4K20me3 is involved in DNA replication/repair, metabolism, and cell cycle. Using conditional knockout mouse models to diminish Ezh2 and Suv4-20h responsible for H3K27me3 and H4K20me3, respectively, we found that both repressive marks have irrefutable function for cell cycle regulation in the NSPC population. Although both EZH2/H3K27me3 and Suv4-20h/H4K20me3 have implication in cancers, our comparative genomics approach between healthy NSPCs and human GBM specimens revealed that substantial sets of genes enriched with H3K27me3 and H4K20me3 in the NSPCs are altered in the human GBM. In sum, our integrated analyses across species highlight important roles of H3K27me3 and H4K20me3 in normal and disease conditions in the context of NSPC.

  16. Cross-species Analyses Unravel the Complexity of H3K27me3 and H4K20me3 in the Context of Neural Stem Progenitor Cells.

    Science.gov (United States)

    Rhodes, Christopher T; Sandstrom, Richard S; Huang, Shu-Wei Angela; Wang, Yufeng; Schotta, Gunnar; Berger, Mitchel S; Lin, Chin-Hsing Annie

    2016-06-01

    Neural stem progenitor cells (NSPCs) in the human subventricular zone (SVZ) potentially contribute to life-long neurogenesis, yet subtypes of glioblastoma multiforme (GBM) contain NSPC signatures that highlight the importance of cell fate regulation. Among numerous regulatory mechanisms, the post-translational methylations onto histone tails are crucial regulator of cell fate. The work presented here focuses on the role of two repressive chromatin marks tri-methylations on histone H3 lysine 27 (H3K27me3) and histone H4 lysine 20 (H4K20me3) in the adult NSPC within the SVZ. To best model healthy human NSPCs as they exist in vivo for epigenetic profiling of H3K27me3 and H4K20me3, we utilized NSPCs isolated from the adult SVZ of baboon brain ( Papio anubis ) with brain structure and genomic level similar to human. The putative role of H3K27me3 in normal NSPCs predominantly falls into the regulation of gene expression, cell cycle, and differentiation, whereas H4K20me3 is involved in DNA replication/repair, metabolism, and cell cycle. Using conditional knock-out mouse models to diminish Ezh2 and Suv4-20h responsible for H3K27me3 and H4K20me3, respectively, we found that both repressive marks have irrefutable function for cell cycle regulation in the NSPC population. While both EZH2/H3K27me3 and Suv4-20h/H4K20me3 have implication in cancers, our comparative genomics approach between healthy NSPCs and human GBM specimens revealed that substantial sets of genes enriched with H3K27me3 and H4K20me3 in the NSPCs are altered in the human GBM. In sum, our integrated analyses across species highlight important roles of H3K27me3 and H4K20me3 in normal and disease conditions in the context of NSPC.

  17. Comparative Life-Cycle Cost Analysis Of Solar Photovoltaic Power ...

    African Journals Online (AJOL)

    Comparative Life-Cycle Cost Analysis Of Solar Photovoltaic Power System And Diesel Generator System For Remote Residential Application In Nigeria. ... like capital cost, and diesel fuel costs are varied. The results show the photovoltaic system to be more cost-effective at low-power ranges of electrical energy supply.

  18. 40 CFR 80.592 - What records must be kept by entities in the motor vehicle diesel fuel and diesel fuel additive...

    Science.gov (United States)

    2010-07-01

    ... in the motor vehicle diesel fuel and diesel fuel additive distribution systems? 80.592 Section 80.592... FUELS AND FUEL ADDITIVES Motor Vehicle Diesel Fuel; Nonroad, Locomotive, and Marine Diesel Fuel; and ECA... the motor vehicle diesel fuel and diesel fuel additive distribution systems? (a) Records that must be...

  19. Motor gerador ciclo diesel sob cinco proporções de biodiesel com óleo diesel Engine-generator diesel cycle under five proportions of biodiesel and diesel

    Directory of Open Access Journals (Sweden)

    Marcelo J. da Silva

    2012-01-01

    Full Text Available O estudo de fontes alternativas de energia ao óleo diesel mineral, como o biodiesel, com origem renovável, é importante para o meio-ambiente e diversificação da matriz energética. Neste estudo foram levantados o consumo específico de combustível, o valor calórico do combustível e a eficiência do conjunto motor gerador da marca BRANCO em função de cargas resistivas, sob as seguintes proporções volumétricas entre o óleo diesel mineral com biodiesel: 0% (B0, 20% (B20, 40% (B40, 60% (B60 e 100% de biodiesel (B100. Para o ensaio utilizou-se motor de 7,36 kW, com gerador elétrico acoplado de 5,5 kW. As cargas utilizadas, 0,5 kW; 1,0 kW; 1,5 kW e 2,0 kW foram elevadas até 5,0 kW, oriundas de um dinamômetro de cargas resistentes. Assim, o desempenho do conjunto para cargas abaixo de 1,5 kW mostrou-se menor, pelo maior consumo específico de combustível (CEC, e redução na eficiência do conjunto motor gerador para a faixa de potência. Para as proporções de biodiesel B40, B60 e B100 os resultados descreveram redução no valor calórico e aumento do CEC. Portanto, realizando comparação das proporções de biodiesel com o óleo diesel, a proporção B20 substitui parcialmente o óleo diesel, sem perdas significativas do desempenho do motor gerador.The study of mineral diesel alternatives, such as biodiesel, a renewable fuel, is important for the environment and to diversify energy sources. This study evaluated an engine-generator BRANCO brand. Specific fuel consumption, calorific value and the overall efficiency as a function of the system load was measured, using diesel oil and biodiesel blends. The biodiesel proportions in the composition were 0% (B0, 20% (B20, 40% (B40, 60% (B60, and 100% (B100. The engine that was used during the test has a power of 7.36 kW, and the electric generator was 5.5 kW. The group was submitted to resistive loading, in the range: 0.5 kW, 1.0 kW, 1.5 kW; growing up to 5.0 kW. The results have shown

  20. Energy and Exergy Analysis of a Diesel Engine Fuelled with Diesel and Simarouba Biodiesel Blends

    Science.gov (United States)

    Panigrahi, Nabnit; Mohanty, Mahendra Kumar; Mishra, Sruti Ranjan; Mohanty, Ramesh Chandra

    2018-02-01

    This article intends to determine the available work and various losses of a diesel engine fuelled with diesel and SB20 (20 % Simarouba biodiesel by volume blended with 80 % diesel by volume). The energy and exergy analysis were carried out by using first law and second law of thermodynamics respectively. The experiments were carried out on a 3.5 kW compression ignition engine. The analysis was conducted on per mole of fuel basis. The energy analysis indicates that about 37.23 and 37.79 % of input energy is converted into the capacity to do work for diesel and SB20 respectively. The exergetic efficiency was 34.8 and 35 % for diesel and Simarouba respectively. Comparative study indicates that the energetic and exergetic performance of SB20 resembles with that of diesel fuel.