WorldWideScience

Sample records for juvenile paget disease

  1. Genetics Home Reference: juvenile Paget disease

    Science.gov (United States)

    ... Information & Resources MedlinePlus (1 link) Health Topic: Bone Diseases Genetic and Rare Diseases Information Center (1 link) Juvenile ... on PubMed Daroszewska A, Ralston SH. Mechanisms of disease: genetics of Paget's disease of bone and related disorders. ...

  2. Acantholytic anaplastic Paget's disease.

    Science.gov (United States)

    Mobini, Narciss

    2009-03-01

    Classic Paget's disease (PD) can be diagnosed relatively easily by histopathologic examination. 'Anaplastic' variant of this disease is a less-recognized subset that may pose as a diagnostic challenge and pitfall. We describe two cases who presented with scaly erythematous plaques on their nipple/areola. In the first patient, there was no palpable mass and imaging studies were negative. The second case presented with a lesion 5 years after a lumpectomy. Initial shave biopsies revealed histopathologic changes indistinguishable from Bowen's disease with no readily identifiable classic Paget's cells, associated with prominent superficial acantholysis. The neoplastic cells were negative for mucin, GCDFP-15, negative/minimally positive for CEA and strongly positive for CK7 markers. A high-grade ductal carcinoma in situ in the underlying breast was ultimately found in both cases. Anaplastic PD is a rare variant of this disease that histologically mimics Bowen's disease with an associated prominent superficial acantholysis. There is mucin, CEA and GCDFP-15 negativity with positive CK7 reaction. A high index of suspicion along with a complete immunohistochemical panel should be considered in evaluating any Bowenoid neoplasm of the breast skin, particularly in superficial skin shave biopsies along with negative imaging studies and no palpable mass clinically.

  3. PAGET'S DISEASE: CURRENT TREATMENT MODALITIES

    Directory of Open Access Journals (Sweden)

    Yulia Leonidovna Korsakova

    2010-01-01

    Full Text Available Paget's disease is a chronic local bone disease included into a group of metabolic osteopathies in which rearrangement foci emerge in one or several bones. The disease is characterized by the appearance of ostealgia, skeletal deformity, or, for example, hearing loss occurring with skull lesion or hip or knee arthrosis and, less frequently, sarcoma or giant cell tumor. There is evidence that bisphosphonates may control the activity of Paget's disease as they inhibit the function of osteoclasts. The use of these drugs reduces the intensity of osteoalgia and the level of biochemical markers for bone resorption and osteogenesis and can decelerate or reverse the early osteolytic phase of the disease. It is promising to use of zolendronic acid (Aclasta, 5 mg, a new heterocyclic amino-containing bisphosphonate that has a significantly higher efficacy than previously used antiresorptive agents.

  4. Management of Paget's Disease of the Calcaneum.

    Science.gov (United States)

    Humphrey, Joel; Pervez, Anum; Walker, Roland; Abbasian, Ali; Singh, Sam

    The calcaneum is not the most common site for Paget's disease of bone, with only a few reports of monostotic involvement. We present 2 cases of Paget's disease of bone affecting the calcaneus, present an overview of the published data, and describe our management of these interesting cases.

  5. Paget's disease of bone (osteitis deformans).

    Science.gov (United States)

    Ankrom, M A; Shapiro, J R

    1998-08-01

    Paget's disease of bone is important in geriatric populations because it is the second most common bone disorder after osteoporosis. In older people, it may be responsible for chronic back pain and joint pain, skeletal deformities, hearing loss, and cranial nerve compression. Paget's disease can reduce both function and mobility in the older people. In addition to newer tests for assessing the activity of Paget's disease, effective therapy is available in the form of salmon calcitonin for nasal administration and new third generation bisphosphonates. Frequently, treatment can reverse the course of the disease. For these reasons, it is feasible for the physician to adopt an aggressive approach to diagnosis and treatment. The objective should be to relieve pain, improve mobility, and forestall debilitating complications. This review will focus on the manifestations and clinical management of Paget's disease. Two cases are presented that illustrate common management problems in older patients.

  6. Paget disease of the male nipple

    Directory of Open Access Journals (Sweden)

    El Harroudi T

    2010-01-01

    Full Text Available Breast cancer occurring in the mammary gland of men is infrequent. It accounts for 0.8% of all breast cancers, which is less than one per cent of all newly diagnosed male cancers and 0.2% of male cancer deaths. However, Paget disease of the male nipple is extremely rare. We report a single case of Paget disease with infiltrative ductal carcinoma of the breast in a 61-year-old man.

  7. What Is Paget's Disease of Bone?

    Science.gov (United States)

    ... Size | S S M M L L Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics News Glossary ... focus(); */ } //--> Print-Friendly Page Home Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics About Us ...

  8. How Is Paget's Disease of Bone Diagnosed?

    Science.gov (United States)

    ... Size | S S M M L L Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics News Glossary ... focus(); */ } //--> Print-Friendly Page Home Bone Basics Osteoporosis Osteogenesis Imperfecta Paget’s Disease of Bone Related Topics About Us ...

  9. Genetics Home Reference: Paget disease of bone

    Science.gov (United States)

    ... Clin Pathol. 2010 Mar;63(3):199-203. doi: 10.1136/jcp.2009.064428. Epub 2009 Oct 26. Review. Citation on PubMed Ralston SH, Albagha OM. Genetics of Paget's disease of bone. Curr Osteoporos Rep. 2014 Sep;12(3):263-71. doi: 10.1007/s11914-014-0219-y. Review. Citation ...

  10. Paget's disease of the nipple. A continuing enigma

    DEFF Research Database (Denmark)

    Osther, P J; Balslev, Erik; Blichert-Toft, M

    1990-01-01

    Paget's disease of the nipple, although recognized since 1874, remains in several respects enigmatic. The two main theories of its origin are 1) epidermotropic, i.e. ductal cancer cells migrating to the epidermis of the nipple, and 2) in situ appearance of malignant keratinocytes expressing......-conserving management of Paget's disease of the nipple are in progress....

  11. Giant cell tumor complicating Paget disease of long bone

    Energy Technology Data Exchange (ETDEWEB)

    Hoch, Benjamin [Mount Sinai Medical Center, Department of Pathology, New York, NY (United States); Hermann, George [Mount Sinai Medical Center, Department of Radiology, New York, NY (United States); Klein, Michael J. [University of Alabama School of Medicine, Department of Pathology, Birmingham, AL (United States); Abdelwahab, Ibrahim F. [Coney Island Hospital affiliated with CUNY Downstate School of Medicine, Department of Radiology, New York, NY (United States); Springfield, Dempsey [Massachusetts General Hospital, Department of Orthopaedic Surgery, Boston, MA (United States)

    2007-10-15

    Giant cell tumor (GCT) is a rare complication of Paget disease of bone. It usually occurs in the skull or pelvic bones of patients with long-standing polyostotic disease. This report describes a 62-year-old patient who presented with monostotic Paget disease of the distal femur complicated by GCT. He had a 2-year history of discomfort and pain in his left knee. Conventional plain films and MRI demonstrated the characteristic bone changes of Paget disease and an associated lytic lesion involving the epiphyseal and metaphyseal regions of the distal femur. A diagnostic curettage showed the characteristic histopathologic features of Paget disease and GCT. There was no evidence of malignancy. The clinicopathologic features of this rare lesion are described and correlated with a review of the literature. (orig.)

  12. Extramammary paget disease of scrotum with oncocytic changes.

    Science.gov (United States)

    Aneiros-Fernandez, J; Arias-Santiago, S; Husein-ElAhmed, H; Nicolae, Alina; Ravassa, F O'valle; Serrano-Ortega, S; Fernandez, F Nogales; Cachaza, J Aneiros

    2010-10-01

    We report an unusual case of primary scrotal extramammary Paget disease that infiltrated reticular dermis and lymph vessels, with metastasis in inguinal lymph node. The 67-year-old patient died at 14 months due to systemic metastases. The tumor, which was located in epidermis and infiltrated the dermis, comprised cells with wide, granular, and eosinophilic cytoplasm and intense positivity for antimitochondrial antibody. This seems to be the first report of oncocytic changes in extramammary Paget disease.

  13. A Case of Thoracic Spinal Stenosis Secondary to Paget's Disease

    Institute of Scientific and Technical Information of China (English)

    Yu Zhao; Yi-peng Wang; Gui-xing Qiu; Jian-xiong Shen; Xi-sheng Weng; Xiang Li; Nai-guo Wang

    2010-01-01

    PAGET'S disease, also called osteitis deformans, is a metabolic bone disorder. It is characterized by increased bone resorption and the compensatory formation of new bones. The increased bone conversion and remodeling lead to the incrustation of woven bones and lamellar bones and finally result in the expansion, loosening, and excessive vascularization of the affected bones, rendering them susceptible to deformity and fracture.1 Paget's disease occurs much more com-monly in Anglo-Saxons than in Asians and Africans.

  14. Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

    Science.gov (United States)

    ... myopathy with early-onset Paget disease and frontotemporal dementia Enable Javascript to view the expand/collapse boxes. ... myopathy with early-onset Paget disease and frontotemporal dementia ( IBMPFD ) is a condition that can affect the ...

  15. An electron microscopic study of clinical Paget's disease of the nipple

    DEFF Research Database (Denmark)

    Jahn, H; Osther, P J; Nielsen, E H

    1995-01-01

    An ultrastructural study of the epidermis from eight patients with clinical Paget's disease of the nipple supports the epidermotropic theory. There was no evidence that the Paget's cells originated from keratinocytes. We propose the hypothesis that Paget's cells represent transformed ductal cells...

  16. Asymptomatic Paget's disease of bone presenting with complete atrioventricular block

    Institute of Scientific and Technical Information of China (English)

    A.Rauoof Malik; Nazir A.Lone; Hilal A.Rather; Vicar M Jan; Javid A.Malik; Khursheed A.Khan; S.Jalal

    2008-01-01

    @@ Paget's disease of bone is a deforming bone disease (osteitis deformans) characterized by increased bone remodeling,bone hypertrophy,and abnormal bone structure,leading to bone expansion,deformities,easy fractures,and occasionally,neoplastic transformation.It is the second most common bone disorder after osteoporosis.1 The disease is relatively rare in Asia but is common in Europe and North America,affecting approximately 2% of the population over 50 years,although lately,a decline in the prevalence has been reported.2 Paget's disease commonly affects people in or past their middle age and is slightly more common in men than in women.1 The exact cause of Paget's disease is not known.Environmental agents,particularly paramyxoviral infections (measles and canine distemper viruses) have been postulated as potential etiological factors.3 Recently,a strong genetic component has been described,with candidate loci suggested at 18q,5q35-QTER,and particularly,the squestosome 1/p62.2,3 The pathological process in Paget's disease consists of one or more areas of aggressive and relentless osteoclastic activity,coupled with deposition of structurally abnormal excessive bone and matrix tissues.1,4 Most of the cases involve only one (monostotic) or few bones,particularly skull,vertebrae,pelvis,femur,and tibia.

  17. Paget's disease of the skull causing hyperprolactinemia and erectile dysfunction: a case report

    Directory of Open Access Journals (Sweden)

    Hepherd Rachel

    2008-07-01

    Full Text Available Abstract Introduction Hyperprolactinemia is an uncommon cause of erectile dysfunction in men. Paget's disease of the skull is a relatively common disease. This case proposes a rare example of a causative link between the two and how treatment of the Paget's disease with bisphosphonates helped the patient regain erectile function. Case presentation A 67-year-old man with Paget's disease of the skull presented with prostatitis, erectile dysfunction, and hyperprolactinemia. Radio-isotope scanning showed increased vascularity around the sphenoid bone. Treatment with intravenous bisphosphonates improved the active Paget's disease as indicated by declining alkaline phosphatase levels and the patient's erectile function while serum prolactin levels became normal and serum testosterone levels remained unchanged. Conclusion It is possible that hyperprolactinemia is unrecognised in other patients with Paget's disease of the skull. Normalizing elevated prolactin levels by using bisphosphonates in treating Paget's disease appears to be more appropriate than traditional treatment for hyperprolactinemia.

  18. Ubiquitin-mediated signalling and Paget's disease of bone

    Directory of Open Access Journals (Sweden)

    Shaw Barry

    2007-11-01

    Full Text Available Abstract Multiple steps in the RANK-NF-κB signalling pathway are regulated by ubiquitylation. Mutations affecting different components of this pathway, including the ubiquitin binding p62 signalling adapter protein, are found in patients with Paget's disease of bone or related syndromes. Here, we review the molecular defects and potential disease mechanisms in these conditions and conclude that the mutations may confer a common increased sensitivity of osteoclasts to cytokines, resulting in disordered NF-κB-dependent osteoclast function. Modulation of the osteoclast RANK-NF-κB signalling axis may represent a viable therapeutic strategy for Paget's disease and other conditions where excessive bone resorption or remodelling is a feature. Publication history: Republished from Current BioData's Targeted Proteins database (TPdb; http://www.targetedproteinsdb.com.

  19. Imaging Paget's disease of bone--from head to toe.

    Science.gov (United States)

    Cortis, K; Micallef, K; Mizzi, A

    2011-07-01

    Paget's disease of the bone is a common, non-inflammatory, metabolic, skeletal disorder of unknown aetiology characterized by an increase in osteoclast-mediated bone resorption and compensatory excessive osteoblast activation. Prevalence increases with age, and a pronounced geographical variation is well documented. The disease is often an incidental finding on a radiological examination requested for an unrelated indication. The osteolytic, mixed osteolytic/osteoblastic, and osteosclerotic phases may occur in the same patient and same bone in a synchronous or metachronous fashion. Radiological features in each phase mirror the histopathological appearances, and are distinctive enough to establish a diagnosis with confidence. Using multi-technique imaging, this review illustrates the most common and the not so common radiological patterns of involvement in Paget's disease of bone observed at our centre during the past 20 years.

  20. Determinants of quality of life in Paget's disease of bone.

    Science.gov (United States)

    Castro, Gláucio Ricardo Werner de; Castro, Silvania Ana Fernandes de; Pereira, Ivanio Alves; Zimmermann, Adriana Fontes; Toscano, Maria Amazile; Neves, Fabricio Souza; Scottini, Maria Aparecida; Paupitz, Juliane; Rosa, Julia Salvan da; Buss, Ziliani; Fröde, Tânia Silvia

    2017-09-26

    To evaluate the parameters associated with quality of life in patients with Paget's disease of bone. Patients with Paget's disease of bone were evaluated with SF-36 and WHOQOL-bref questionnaires. Patients with other diseases that could cause significant impairment of their quality of life were excluded. We searched for correlations between the results and: age, time from diagnosis, type of involvement, pain related to Paget's disease of bone, limitation to daily activities, deformities, bone specific alkaline phosphatase, the extent of involvement and treatment. Fifty patients were included. Results of the SF-36 total score and its domains, physical and mental health, were significantly correlated with bone pain and deformities. Marital status was significantly correlated with the SF-36 total score and Mental Health Domain. BAP levels and disease extension were significantly correlated to SF-36 Physical Health Domain. After multivariate analysis, the only parameters that remained significantly associated with the SF-36 total score and to its Mental Health and Physical Health Domains were pain and marital status. The WHOQOL-bref total score was significantly associated with pain, physical impairment and deformities. WHOQOL-bref Domain 1 (physical) score was significantly associated with marital status, pain and deformities, while Domain 2 (psychological) score was associated with marital status, physical impairment and kind of involvement. After multivariate analysis, the presence of pain, deformities, and marital status were significantly associated with results of the WHOQOL-bref total score and its Domain 1. WHOQOL-bref domain 2 results were significantly predicted by pain and marital status. The main disease-related factor associated with SF-36 results in Paget's disease of bone patients was bone pain, while bone pain and deformities were associated with WHOQOL-bref. Copyright © 2017 Elsevier Editora Ltda. All rights reserved.

  1. Perianal Paget's disease: presentation of six cases and literature review.

    Science.gov (United States)

    Minicozzi, Annamaria; Borzellino, Giuseppe; Momo, Rostand; Steccanella, Francesca; Pitoni, Federica; de Manzoni, Giovanni

    2010-01-01

    Extramammary Paget's disease (EMPD) is frequently associated with adnexal or visceral synchronous or metachronous malignancies. Our purpose was to evaluate, retrospectively, the results obtained in six cases of EMPD and to review the literature. Six patients with the perianal Paget's disease had been treated in our division between March 1996 and December 2006. In three cases, the disease was confined in the epidermis; in one case, there was a microinvasion of the dermis, while in another one the dermis was infiltrated. The last case was associated to a low rectal adenocarcinoma. All patients underwent wide perianal excision and reconstruction with skin graft. We performed a transanal resection of the rectal adenocarcinoma. A review of the literature from 1990 to 2008 revealed 193 cases of perianal EMPD, 112 were intraepithelial/intradermal while 81 were associated with malignancies. Anorectal adenocarcinoma was already existing in two cases, synchronous in 48, and subsequent to diagnosis in 11. In three cases, the disease recurred locally, but no patient developed metastatic spread. Five patients survived and are free of disease. The review of the literature allows a clear identification of the primitive EMPD and the form associated to anorectal adenocarcinoma and little information about cases associated with synchronous adnexal adenocarcinoma. The Paget's disease can relapse after radical surgery and has a capacity of metastatic spread. Up to now, no clear guidelines have been established for the diagnosis of EMPD. The association with synchronous or metachronous carcinomas imposes a long-term follow-up with frequent clinical, radiological, and endoscopical controls.

  2. Angiogenesis in Paget's Disease of the Vulva and the Breast: Correlation with Microvessel Density

    Directory of Open Access Journals (Sweden)

    Patricia E. Ellis

    2012-01-01

    Full Text Available Our understanding of the pathogenesis of Paget's disease of the vulva and the breast remains limited. Current evidence supports the fact that angiogenesis plays an important role in the pathogenesis of several diseases. Therefore, we sought to define its role, as correlated with microvessel density, in Paget's disease of the vulva and the breast. Microvessels were analysed using anti-von Willebrand factor antibody in 105 cases of Paget's disease of the vulva and the breast comprising 71 cases of Paget's disease of the vulva, including 8 cases with invasive disease, and 34 cases of Paget's disease of the breast. The latter included 12 cases with DCIS, 5 cases with both DCIS and invasive carcinoma, and 6 with carcinoma alone. Eleven cases had no underlying tumour identified. Increased microvessel density was demonstrated in Paget's disease of the breast with DCIS and with carcinoma alone compared to Paget's disease of the breast alone, <0.08 and <0.013, respectively. There were no significant differences in microvessel density in the vulval cases. Neovascularisation is an important process in the development of Paget's disease of the breast. Other biological and molecular processes are more involved in the pathogenesis of Paget's disease of the vulva.

  3. Paget's disease of the vulva: A review of 89 cases

    Directory of Open Access Journals (Sweden)

    Cherry O. Onaiwu

    2017-02-01

    Full Text Available The purpose of this study was to retrospectively review the clinical characteristics and outcomes of a series of women with Paget's disease of the vulva. A retrospective review was performed of 89 women with Paget's disease of the vulva evaluated at a single institution between 1966 and 2010. Medical records were reviewed for demographic information, clinical data, pathologic findings, treatment modalities and outcomes. We found that the primary treatment was surgery for 74 (83.1% patients, with positive margins noted in 70.1% of cases. Five patients (5.6% underwent topical treatment with imiquimod and/or 5-fluorouracil, one patient (1.1% underwent laser ablation and treatment was unknown in 9 patients (10.1%. The majority of patients had multiple recurrences, with 18% having four or more recurrences. There were no significant differences in recurrence rates between patients who underwent surgery and those who did not. Furthermore, there was no association between positive margins following primary surgery and recurrence. Forty-one patients (46.1% were diagnosed with 53 synchronous or metachronous cancers. Seven patients (7.9% were found to have invasive vulvar cancer with 1 mm or more depth of invasion, but none of the patients died of Paget's disease or associated vulvar/vaginal cancer. Our findings suggest that the majority of patients with Paget's disease of the vulva develop multiple recurrences regardless of treatment modality or margin status. Alternatives to surgery are needed to better care for women with this disease.

  4. Photodynamic Therapy for Extramammary Paget's Disease:5 Cases Report

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective: To study the therapeutic effect of photodynamic therapy for extramammary Paget's disease.Methods: DIOMED 630 nm diode laser was used as light source and photofrin as photosensitizer. The patient's lesion was irradiated for 24-72 h after administrating of photofrin. The power density was 100-150 mW/cm2 and energy density was 150-300J/cm2. Dosage of photofrin was 2 mg/kg. Results: Lesion darkened 24 h after irradiation and formed a scar 96-120 h after irradiation. One patient's lesion disappeared, three patients' lesion diminished apparently and one patient's lesion was not controlled 3 months later. Conclusion: Photodynamic therapy is an effective modality for extramammary Paget's disease.

  5. Paget's disease of the breast in a male with lymphomatoid papulosis: a case report

    Directory of Open Access Journals (Sweden)

    Fouad Dina

    2011-01-01

    Full Text Available Abstract Introduction Paget's disease is an eczematous skin change of the nipple that is usually associated with an underlying breast malignancy. Male breast cancer represents only 1-3% of all breast malignancies and Paget's disease remains very rare. Case presentation We present the case of a 67-year-old Caucasian man with lymphomatoid papulosis who was diagnosed with Paget's disease of the nipple and who was treated successfully with surgery alone. We discuss the presentation, investigations, management and pathogenesis of Paget's disease of the nipple. Conclusion The case highlights the need to be vigilant when new skin lesions arise in the context of an underlying chronic skin disorder.

  6. An electron microscopic study of clinical Paget's disease of the nipple

    DEFF Research Database (Denmark)

    Jahn, H; Osther, P J; Nielsen, E H

    1995-01-01

    An ultrastructural study of the epidermis from eight patients with clinical Paget's disease of the nipple supports the epidermotropic theory. There was no evidence that the Paget's cells originated from keratinocytes. We propose the hypothesis that Paget's cells represent transformed ductal cells......, from the subjacent lactiferous ducts of the nipple, which have migrated into the epidermis, either as neoplastic cells or as normal ductal cells with secondary in situ transformation in the epidermis....

  7. Sarcomatous degeneration of Pagets disease in the calcaneus: a case report; Degeneracao sarcomatosa de doenca de Paget do calcaneo: relato de caso

    Energy Technology Data Exchange (ETDEWEB)

    Matiotti, Simone Berwig; Tramunt, Conrado Silva; Duarte, Rogerio Dias; Duarte, Rodrigo Dias; Duarte, Wolmir Lourenco [Clinica Serdil, Porto Alegre, RS (Brazil)]. E-mail: smat2@hotmail.com; Soder, Janine Bernardi [Fundacao Saint Pastous, Porto Alegre, RS (Brazil). Clinica Serdil

    2009-01-15

    Neoplastic degeneration in Paget's disease is a rare complication (approximately 1% of cases) and, despite the treatment, presents a poor prognosis. The authors report a case of a male, 82-year-old patient with long standing Paget's disease who presented imaging findings of malignant degeneration in the calcaneus histopathologically diagnosed as sarcomatous degeneration (author)

  8. CLINICAL ANALYSIS AND TREATMENT OF 14 CASESOF EXTRAMAMMARY PAGET'S DISEASE

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective To diffrentiate extramammary Paget' s disease ( EPD ) clinically and histologically from other skin diseases. Methods Clinical analysis and excisional treatment of 14 patients with EPD were reviewed from 1987 to 1997. Results Of 14 patients, 12 involved scrotum and penis, one in the groin and the other one in the perianal region. All were positive for cytokeratin and negative for S-100 protein. Follow-up showed 3 recurrences who had positive surgical margin biopsy. One died of other disease. Conclusion Surgery is the first choice for treatment of EPD. Negative margin must be achieved to prevent local recurrence.

  9. Doença de Paget com acometimento sacral: relato de caso Paget's disease with sacral involvement: a case report

    Directory of Open Access Journals (Sweden)

    Fernanda Nogueira Holanda Ferreira Braga

    2010-10-01

    Full Text Available Os autores relatam o caso de um paciente do sexo masculino, 71 anos de idade, com diagnóstico de doença de Paget óssea sacral. Foi realizado estudo com radiografia, cintilografia, tomografia computadorizada e ressonância magnética, e o diagnóstico foi confirmado por análise histopatológica. O paciente evoluiu com boa resposta ao uso de ibandronato 150 mg, mensalmente, com redução significativa dos marcadores bioquímicos da doença.The authors report a case of a 71-year-old male patient diagnosed with Paget's disease of sacrum. Imaging study was performed with radiography, scintigraphy, computed tomography and magnetic resonance imaging, and the diagnosis was confirmed by biopsy. The patient progressed with a good response to monthly treatment with ibandronate 150 mg, presenting a significant reduction in biochemical markers of disease.

  10. Mucinous breast carcinoma presenting as Paget's disease of the nipple in a man: A case report

    Directory of Open Access Journals (Sweden)

    Charalabopoulos Konstantinos

    2008-10-01

    Full Text Available Abstract Introduction Male breast cancer is rare compared to its female counterpart representing less than 1% of cancer in men. Moreover, mucinous carcinoma of the male breast is an extremely rare histological subtype of malignancy. Paget's disease of the nipple is rarely observed in males. Case report Herein, we describe a unique case of an 86 years old man with mucinous breast cancer presenting as Paget's disease of the nipple. According to the immunohistochemical evaluation the neoplastic cells were positive for estrogen (ER and progesterone receptors (PR. Conclusion To our best knowledge this is the first case of mucinous male breast cancer presenting as Paget's disease of the nipple.

  11. Pain and Paget's Disease of Bone

    Science.gov (United States)

    ... Your Doctor (NIA) Conversando con su médico (NIA) Sea miembro activo del equipo de cuidados de la Salud (FDA) '); docprint.document.close(); docprint.focus(); */ } //--> Print-Friendly Page May 2015 Types of Pain Paget’s disease can cause ...

  12. Paget's Disease is Associated with Eleven Cancerous Regions: a Case Report and Therapeutic Strategy

    Institute of Scientific and Technical Information of China (English)

    Yongxi SONG; Zhenning WANG; Huimian XU; Zhenyu YUE; Chengzhong XING

    2009-01-01

    Paget's disease of the breast is an uncommon disorder that accounts for 1% to 3% of all mammary tumors. The incidence of underlying carcinoma associated with Paget's disease has been re-ported in 82% to 100% of cases. The finding of underlying carcinoma reaches almost 100% when a palpable lump is also present. In this rare case, we described a patient presenting with Paget's disease but no palpable lump. However, we found 11 independent regions which were all invasive ductal carci-noma after the operation. Considering this patient, we should pay more attention to a multifocal and multicentric breast carcinoma associated with Paget's disease. Furthermore, we believe the mammog-raphy examination and a modified radical mastectomy are the most appropriate treatments for this population in clinical practice.

  13. Spinal Metastases of Extramammary Paget Disease with Radiologic-Pathologic Correlation

    Science.gov (United States)

    Little, Jason T; Lehman, Vance T; Morris, Jonathan M; Lehman, Julia S; Diehn, Felix E

    2016-01-01

    Extramammary Paget disease (EMPD) is an uncommon malignancy. It manifests either in the primary form in the skin as an intraepithelial neoplasm, or in secondary form as pagetoid (intraepithelial) spread of an underlying internal carcinoma to the skin. Although local invasion and recurrence of primary extramammary Paget disease are relatively frequent, widespread metastases are rare. As such, there are very few reports and little characterization of the radiologic features of widespread spinal metastases. To our knowledge, there are no prior reports of a metastatic extramammary Paget disease presenting as a painful pathologic vertebral body compression fracture. We report the radiological features of a case of primary extramammary Paget disease with subsequent spinal metastases presenting as a painful compression fracture. PMID:27761174

  14. The Nature of Expansion of Paget’s Disease of Bone

    Science.gov (United States)

    2013-04-01

    cell line or normal marrow from uninvolved bones from PDB (5). We obtained the PSV10 cell line from Dr. G. David Roodman (Indiana University...H, Boykin CS, Zhang H, Ishizuka S, Dempster DW, Roodman GD, Windle JJ. A SQSTM1/p62 mutation linked to Paget’s disease increases the...Singer FR, Bruder JM, Roodman GD. Enhanced RANK ligand expression and responsivity of bone marrow cells in Paget’s disease of bone. J Clin Invest

  15. Long-term trends in the incidence of Paget's disease of bone.

    Science.gov (United States)

    Tiegs, R D; Lohse, C M; Wollan, P C; Melton, L J

    2000-09-01

    Existing data on the epidemiology of Paget's disease of bone are limited by the lack of directly determined secular trends in clinically diagnosed Paget's disease. In the current study, we examine trends in Paget's disease incidence in Olmsted County, MN, using data from the Rochester Epidemiology Project medical records linkage system. During the period 1950 through 1994, 236 Olmsted County, MN residents were diagnosed for the first time with Paget's disease of bone at a mean age of 69.6 years. Overall, there were 129 (54.7%) men and 107 women, and the age-adjusted incidence of Paget's disease was 12.7 per 100,000 person-years (95% CI 10.4-14.9) among the men compared with 7.0 per 100,000 person-years (95% CI 5.6-8.3) among Olmsted County women (male/female ratio of 1.8:1). The higher incidence in males compared with females and the increase in incidence with older age were statistically significant. The incidence of Paget's disease in Olmsted County seems to have increased over the first part of the study period and then declined. This may have resulted from ascertainment bias: the introduction of a 12-test automated serum chemistry panel in 1974 might have led to a sudden increase in the apparent incidence of Paget's disease followed by a compensatory decrease. In addition, there was a decrease in the proportion of patients who were symptomatic at diagnosis, from 36% in 1950-1959 to 27% in 1980-1994. This finding also suggests that routine measurement of alkaline phosphatase may have led to more diagnosis of asymptomatic individuals. The subsequent fall in the incidence of Paget's disease is consistent with previous reports, although this apparent decline could be artifactual to the extent that the reservoir of undiagnosed cases in the population was exhausted by earlier testing.

  16. Disease: H00437 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available H00437 Paget's disease of bone and related disorders, including: ; Paget's disease ...eletal hyperphosphatasia (ESH); Juvenile Paget's disease (JPD) Paget's disease of bone and related disorders... are rare inherited osteolytic disorders that show phenotypic overlap. Patients w...MP Paget's disease of bone and genetic disorders of RANKL/OPG/RANK/NF-kappaB signaling. Ann N Y Acad Sci 106...47:175-84 (2002) PMID:18328984 Ralston SH Juvenile Paget's disease, familial expansile osteolysis and other genetic osteolytic disord

  17. Paget disease of bone: A classic case report

    Directory of Open Access Journals (Sweden)

    Y Uday Shankar

    2013-01-01

    Full Text Available Paget disease of bone (PDB is a chronic progressive disease of the bone of uncertain etiology, characterized initially by an increase in bone resorption, followed by a disorganized and excessive formation of bone, leading to pain, fractures, and deformities. It can manifest as a monostotic or polyostotic disease. The prevalence of PDB is common in the Anglo-Saxon population, but relatively rare in India. The disease is often asymptomatic and commonly seen in an aging population. The diagnosis of the disease is mostly based on radiological examination and on biochemical markers of bone turnover. Markedly elevated serum alkaline phosphatase (SAP is a constant feature while calcium and phosphate levels are typically within normal limits. It is being successfully treated by biphosphonates, a group of anti-resorptive drugs, thereby decreasing the morbidity and mortality associated with the disease. We report a classic case of PDB with craniofacial involvement resulting in Leontiasis Ossea (lion like face, cotton wool appearance of the skull and elevated SAP.

  18. On the Nature of Expansion of Paget’s Disease of Bone

    Science.gov (United States)

    2012-10-01

    PDB patients (7). We obtained the PSV10 cell line from Dr. G. David Roodman (Indiana University School of Medicine) and tested the cells for a SQSTM1...Zhou H, Boykin CS, Zhang H, Ishizuka S, Dempster DW, Roodman GD, Windle JJ. A SQSTM1/p62 mutation linked to Paget’s disease increases the...JM, Roodman GD. Enhanced RANK ligand expression and responsivity of bone marrow cells in Paget’s disease of bone. J Clin Invest. 2000;105(12):1833

  19. Pathological fracture of the femur in a patient with Paget's disease of bone: a case report.

    Science.gov (United States)

    Petrescu, Pompiliu HoraŢiu; Izvernariu, Dragoş Andrei; Iancu, Cătălina; Dinu, Gabriel Ovidiu; Berceanu-Văduva, Marcel Mihai; Crişan, Dan; Iacob, Mihaela; Bucur, Venera Margareta; RăuŢia, Ion Călin; Prejbeanu, Ion Radu; Dema, Sorin; DuŢă, Ciprian Constantin

    2016-01-01

    Paget's disease of bone is a benign disease characterized by exaggerated remodeling of the bone matrix after osteoclast-mediated bone destruction. Its etiology is still unknown, despite the fact that it was discovered and described in 1877, but genetic factors and environmental triggers were shown to play their part in the pathogenesis of the disease. The main clinical presentations of the disease are related to bone pain and deformities. Radiological diagnosis is the main detection tool, though many monostotic Paget's disease cases may remain undiagnosed. We present the case of an 81-year-old male patient admitted to the Clinic of Orthopedics, Emergency County Hospital, Timisoara, Romania, with intense pain and deformity of the upper left thigh. Radiological examination performed shows a complete fracture of the upper third diaphysis of the left femur with suggestive signs for Paget's disease of the bone therefore a biopsy was taken and the patient was treated by surgical realignment with favorable evolution. He was discharged 13 days after surgery. The biopsy of the bone revealed extensive bone remodeling with numerous osteoclasts and extensive bone matrix deposition, unevenly stained and unevenly mineralized and reverse cement lines, which are consistent with the diagnosis of Paget's disease of the bone. Histomorphometric analysis show intense matrix deposition with a highly active remodeling process. Computed tomography (CT) scans were performed three years later and show the extension of the disease into the lower half of the left femur.

  20. Photon-deficient bone scan lesion as a precursor of active Paget's disease

    Energy Technology Data Exchange (ETDEWEB)

    Jaspers, M.M.J.R.; Pauwels, E.K.J.; Blom, J. (Department of Diagnostic Radiology, Division of Nuclear Medicine, University Hospital Leiden (Netherlands)); Harinck, H.I.J. (Clinical Investigation Unit, Department of Endocrinology, University Hospital Leiden, Netherands)

    1984-05-15

    A case is presented in which a Pagetoid lesion was demonstrated as a photon-deficient area (cold spot) on the bone scan. This area changed into a hot spot 3 years after its discovery. Clinical and radiological observations provide evidence that a scintigraphically photon-deficient area may represent a precursor of active Paget's disease.

  1. [Was Beethoven's deafness caused by Paget's disease? Report of findings and study of skull fragments of Ludwig van Beethoven].

    Science.gov (United States)

    Jesserer, H; Bankl, H

    1986-10-01

    Paget's disease of bone (osteitis deformans) has been repeatedly named as a possible cause for Ludwig van Beethoven's deafness. In 1985 a descendent of Franz Romeo Seligmann (a Viennese medical historian who in 1863 had studied Beethoven's mortal remains on the occasion of their relocation) presented to us three bone fragments allegedly from Beethoven's cranium. They represented fragments of the left parietal bone and the occiputum. It was possible to prove nearly with certainty that these bone fragments actually are Beethoven's. They did not show signs of Paget's disease of bone. It must therefore be concluded that Beethoven's deafness was not caused by Paget's osteitis deformans.

  2. Understanding the Delay in Onset of Pagets Disease of Bone

    Science.gov (United States)

    2015-09-01

    change from last funding period) Contribution to Project Ms Alander performed routine cell culture and RNA preparation as well as stock maintenance...the measles virus nucleocapsid gene display a pagetic phenotype. J Clin Invest . 2000;105(5):607-14. PubMed PMID: 10712432.http://www.ncbi.nlm.nih.gov...alpha/ beta and IL-6 in the human lung epithelial cell line A549. Virology. 2001;290(1):1-10. PubMed PMID: 11882993.http://www.ncbi.nlm.nih.gov/pubmed

  3. Extensive Invasive Extramammary Paget Disease Evaluated by F-18 FDG PET/CT

    OpenAIRE

    Li, Zu-Gui; Qin, Xiao-Jing

    2015-01-01

    Abstract Extramammary Paget disease (EMPD) is a rare cutaneous, intraepithelial adenocarcinoma. Because of its rarity, little is known about the value of fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) in evaluating this disease. Our case report aims to increase current knowledge of FDG PET/CT in EMPD as a noninvasive imaging tool for assessing the extension of the disease and detecting distant metastases. We reported a 64-year-old Chinese man who presented ...

  4. Case report 438: Osteolytic phase of Paget disease affecting the ulna in case 1 and the humerus in case 2

    Energy Technology Data Exchange (ETDEWEB)

    Mitchell, M.L.; Ackermann, L.V.; Tsutsumi, Akira

    1987-08-01

    The two cases reported here are examples of monostotic Paget disease occurring in the unusual sites of the humerus and ulna. Sinse biopsy of osteolytic Paget disease may increase the likelihood of fracture, expecially in a weight-bearing long bone, an accurate radiographic diagnosis is important. Observation of a flame-shaped front of osteolysis or other radiographic features of Paget disease may be helpful. Exacerbation of radiographic osteopenia with immobilization, and remineralization with mobilization of the affected extremity, are findings which would also support the diagnosis of Paget disease. If the patient presents with a pathological fracture, as occurred in the two cases described here, a biopsy is appropriate to help establish the diagnosis, and to exclude sarcomatous transformation. A similar histological appearance might be found in patients with hyperparathyroidism, but the absence of the appropriate serological abnormalities and the characteristic radiographic findings in other bones, should exclude that diagnosis. (orig./SHA).

  5. Paget's disease of the breast: Clinical, mammographic, sonographic and pathologic findings in 52 cases

    Energy Technology Data Exchange (ETDEWEB)

    Guenhan-Bilgen, Isil [Ege University Hospital, Department of Radiology, Bornova 35100, Izmir (Turkey)]. E-mail: isilbilgen@hotmail.com; Oktay, Aysenur [Ege University Hospital, Department of Radiology, Bornova 35100, Izmir (Turkey)

    2006-11-15

    Purpose: To determine and quantitate radiologic characteristics of Paget's disease of the breast and to report clinical and pathologic findings. Materials and methods: A retrospective review of records of 2872 women who received a diagnosis of breast carcinoma between January 1988 and January 2006 revealed 52 histologicallly proved Paget's disease of the breast. Analysis included history, findings at physical examination, mammography and sonography (US) and histologic type of Paget's disease. Results: At physical examination, palpable mass (n = 33, 63%), nipple erythema-eczema-ulceration (n = 17, 33%) and blood-stained nipple discharge (n = 5, 10%) were noted. Among 17 patients who had clinically evident Paget's disease, the mammographic findings were isolated microcalcifications in 3 (18%), mass associated with microcalcifications in 5 (29%), mass in 2 (12%) and negative in 7 (41%) patients. In the 35 patients with clinically inevident Paget's disease, these mammographic findings were 43% (n = 15), 34% (n = 12), 20% (n = 7) and 3% (n = 1), respectively. US depicted 43 masses in 35 patients, all of which were lobulated or irregularly contoured, mostly (n = 41, 95%) without posterior acoustic shadowing. The cancer was clinically occult in 10% (n = 5), mammographically occult in 15% (n = 8) and radiologically occult in 13% (n = 7) of the 52 patients. Histologically, the tumor was multifocal and/or multicentric in 11 (21%) patients. Conclusion: The clinical features of Paget's disease are characteristic and should alert the clinician to the likelihood of an underlying carcinoma, which should be evaluated radiologically. However, as Paget's disease is primarily a clinical diagnosis and mammograms may be negative, screening programs without clinical examination may result with delay in diagnosis. As a result, both clinical and imaging findings are complementary and should be correlated to confirm or exclude a diagnosis of Paget

  6. Paget's Disease of the Breast in a Man. A Case Report

    Directory of Open Access Journals (Sweden)

    Lidia Torres Aja

    2014-01-01

    Full Text Available Paget’s disease of the breast is rare, accounting for only 1 to 1.5 % of all reported breast cancers cases. It frequently occurs in females in a 99:1 ratio compared to male, during the fourth or fifth decades of life in pre- or postmenopausal women. A case of Paget's disease of the breast clinically manifested by an eczematous lesion in a 76-year-old male patient is presented. This is the first case of Paget's disease of the breast in men diagnosed in the province of Cienfuegos. Due to the unusual presentation of this disease in males, the present case report is considered important for health professionals.

  7. Mapping biopsy with punch biopsies to determine surgical margin in extramammary Paget's disease.

    Science.gov (United States)

    Kato, Takeshi; Fujimoto, Noriki; Fujii, Norikazu; Tanaka, Toshihiro

    2013-12-01

    It is difficult to determine the appropriate resection margin of extramammary Paget's disease (EMPD). A high recurrence rate is reported in spite of using Mohs micrographic surgery (MMS), which is performed commonly. Preoperative mapping biopsy is easier to perform than MMS. In Japan, the following method is recommended instead of MMS: well-defined border and margins histologically confirmed by mapping biopsy should be resected with 1-cm margin and ill-defined border with 3-cm margin. This study aimed to evaluate the accuracy of the Japanese guideline and to assess our mapping biopsy method compared with MMS. Preoperative mapping biopsy specimens were obtained beyond the clinical border for at least four directions in each patient. To confirm the presence of residual Paget's cells postoperatively, narrow specimens were obtained along the surgical margin. Retrospective evaluation of 17 EMPD patients was conducted concerning histological spread of Paget's cells and recurrence ratio. There were 86 directions showing a well-defined border, and in 9.3% (8/86), Paget's cells were still observed at 1-cm resection line. On the other hand, there were 21 directions showing an ill-defined border, and unnecessary radical resection was performed in 90% (19/21) of directions with 3-cm resection line. Although postoperative histological examination showed residual Paget's cells in 47% (8/17) of patients and additional resections were not performed, recurrence rate was only 5.9% (1/17). The resection line of EMPD should be based not on clinical features, but on mapping biopsy. Mapping biopsy is equivalent to MMS concerning recurrence rate and, though conventional, is useful method to treat EMPD.

  8. Imaging Paget's disease of bone-from head to toe

    Energy Technology Data Exchange (ETDEWEB)

    Cortis, K.; Micallef, K. [Medical Imaging Department, Mater Dei Hospital, Msida (Malta); Mizzi, A., E-mail: adrian.mizzi@gov.mt [Medical Imaging Department, Mater Dei Hospital, Msida (Malta)

    2011-07-15

    Paget's disease of the bone is a common, non-inflammatory, metabolic, skeletal disorder of unknown aetiology characterized by an increase in osteoclast-mediated bone resorption and compensatory excessive osteoblast activation. Prevalence increases with age, and a pronounced geographical variation is well documented. The disease is often an incidental finding on a radiological examination requested for an unrelated indication. The osteolytic, mixed osteolytic/osteoblastic, and osteosclerotic phases may occur in the same patient and same bone in a synchronous or metachronous fashion. Radiological features in each phase mirror the histopathological appearances, and are distinctive enough to establish a diagnosis with confidence. Using multi-technique imaging, this review illustrates the most common and the not so common radiological patterns of involvement in Paget's disease of bone observed at our centre during the past 20 years.

  9. Diagnostic scope of computer tomography in hip disease - Paget's disease, femoral head necrosis, coxarthrosis, coxarthritis

    Energy Technology Data Exchange (ETDEWEB)

    Nebel, G.; Lingg, G.; Reid, W.

    1982-10-01

    The value of computer tomography was investigated in Paget's disease of the hip, femoral head necrosis (adult avascular and osteoradionecrosis), coxarthrosis and coxarthritis (bacterial and rheumatoid). The greatest value of CT is in the diagnosis of adult avascular necrosis of the femoral head and is valuable for localising the necrotic area in the axial plane. This is of value in planning surgical treatment (displacement osteotomy or endoprosthesis). In Paget's disease, coxarthrosis and coxarthritis, CT provides only additional or more precise information.

  10. Periprosthetic fracture of the acetabulum during total hip arthroplasty in a patient with Paget's disease.

    Science.gov (United States)

    McGrory, B J

    1999-04-01

    The case of a patient with Paget's disease of the pelvis (acetabulum) who had an intraoperative posterior wall fracture during the insertion of a noncemented acetabular component into an under-reamed acetabular bed of sclerotic Pagetoid bone is reported. This unusual complication has not, to my knowledge, been previously reported. Patients with sclerotic bone, like those with osteoporotic bone, may also be at risk for periprosthetic acetabular fractures when an under-reaming technique is used.

  11. Unilateral Pigmented Extramammary Paget's Disease of the Axilla Associated with a Benign Mole: A Case Study and a Review of Literature

    OpenAIRE

    Ladak, Aleem; Bramley, Maria; Titi, Sami

    2014-01-01

    Pigmented extramammary Paget's disease (PEMPD) is an uncommon intraepithelial adenocarcinoma and a rare variant of Paget's disease affecting skin that is rich in apocrine sweat glands such as the axilla, perianal region and vulva. It most commonly occurs in postmenopausal women and presents as a superficial pigmented scaly macule, mimicking a melanocytic lesion. The histological presentation is adenocarcinoma in situ with an increased number of melanocytes scattered between the Paget's cells....

  12. Contributions of the Measles Virus Nucleocapsid Gene and the SQSTM1/p62P392L Mutation to Paget's Disease

    Science.gov (United States)

    Kurihara, Noriyoshi; Hiruma, Yuko; Yamana, Kei; Michou, Laëtitia; Rousseau, Côme; Morissette, Jean; Galson, Deborah L.; Teramachi, Jumpei; Zhou, Hua; Dempster, David W.; Windle, Jolene J.; Brown, Jacques P.; Roodman, G. David

    2011-01-01

    Summary Paget's Disease (PD) is characterized by abnormal osteoclasts (OCL) that secrete high IL-6 levels and induce exuberant bone formation. Because measles virus nucleocapsid gene (MVNP) and the p62P392L mutation are implicated in PD, marrows from 12 PD patients harboring p62P392L and 8 normals were tested for MVNP expression and pagetic OCL formation. 8/12 patients expressed MVNP and formed pagetic OCL in vitro, which were inhibited by antisense-MVNP. 4/12 patients lacked MVNP and formed normal OCL that were hyper-responsive to RANKL but unaffected by antisense-MVNP. Similarly, mice expressing only p62P394L formed normal OCL, while mice expressing MVNP in OCL, with or without p62P394L, developed pagetic OCL and expressed high IL-6 levels dependent on p38MAPK activation. IL-6 deficiency in MVNP mice abrogated pagetic OCL development in vitro. Mice co-expressing MVNP and p62P394L developed dramatic Paget's-like bone lesions. These results suggest that p62P394L and IL-6 induction by MVNP play key roles in PD. PMID:21195346

  13. Contributions of the measles virus nucleocapsid gene and the SQSTM1/p62(P392L) mutation to Paget's disease.

    Science.gov (United States)

    Kurihara, Noriyoshi; Hiruma, Yuko; Yamana, Kei; Michou, Laëtitia; Rousseau, Côme; Morissette, Jean; Galson, Deborah L; Teramachi, Jumpei; Zhou, Hua; Dempster, David W; Windle, Jolene J; Brown, Jacques P; Roodman, G David

    2011-01-05

    Paget's disease (PD) is characterized by abnormal osteoclasts (OCL) that secrete high IL-6 levels and induce exuberant bone formation. Because measles virus nucleocapsid gene (MVNP) and the p62(P392L) mutation are implicated in PD, marrows from 12 PD patients harboring p62(P392L) and eight normals were tested for MVNP expression and pagetic OCL formation. Eight out of twelve patients expressed MVNP and formed pagetic OCL in vitro, which were inhibited by antisense-MVNP. Four out of twelve patients lacked MVNP and formed normal OCL that were hyperresponsive to RANKL but unaffected by antisense-MVNP. Similarly, mice expressing only p62(P394L) formed normal OCL, while mice expressing MVNP in OCL, with or without p62(P394L), developed pagetic OCL and expressed high IL-6 levels dependent on p38MAPK activation. IL-6 deficiency in MVNP mice abrogated pagetic OCL development in vitro. Mice coexpressing MVNP and p62(P394L) developed dramatic Paget's-like bone lesions. These results suggest that p62(P394L) and IL-6 induction by MVNP play key roles in PD.

  14. ZNF687 Mutations in Severe Paget Disease of Bone Associated with Giant Cell Tumor.

    Science.gov (United States)

    Divisato, Giuseppina; Formicola, Daniela; Esposito, Teresa; Merlotti, Daniela; Pazzaglia, Laura; Del Fattore, Andrea; Siris, Ethel; Orcel, Philippe; Brown, Jacques P; Nuti, Ranuccio; Strazzullo, Pasquale; Benassi, Maria Serena; Cancela, M Leonor; Michou, Laetitia; Rendina, Domenico; Gennari, Luigi; Gianfrancesco, Fernando

    2016-02-04

    Paget disease of bone (PDB) is a skeletal disorder characterized by focal abnormalities of bone remodeling, which result in enlarged and deformed bones in one or more regions of the skeleton. In some cases, the pagetic tissue undergoes neoplastic transformation, resulting in osteosarcoma and, less frequently, in giant cell tumor of bone (GCT). We performed whole-exome sequencing in a large family with 14 PDB-affected members, four of whom developed GCT at multiple pagetic skeletal sites, and we identified the c.2810C>G (p.Pro937Arg) missense mutation in the zinc finger protein 687 gene (ZNF687). The mutation precisely co-segregated with the clinical phenotype in all affected family members. The sequencing of seven unrelated individuals with GCT associated with PDB (GCT/PDB) identified the same mutation in all individuals, unravelling a founder effect. ZNF687 is highly expressed during osteoclastogenesis and osteoblastogenesis and is dramatically upregulated in the tumor tissue of individuals with GCT/PDB. Interestingly, our preliminary findings showed that ZNF687, indicated as a target gene of the NFkB transcription factor by ChIP-seq analysis, is also upregulated in the peripheral blood of PDB-affected individuals with (n = 5) or without (n = 6) mutations in SQSTM1, encouraging additional studies to investigate its potential role as a biomarker of PDB risk.

  15. Juvenile Battens Disease.

    Science.gov (United States)

    Gayton, Romayne

    1987-01-01

    Ten children diagnosed with juvenile Battens disease were tested over a three-year period in general intelligence, memory, listening and speech, motor skills, and general learning. Results showed that the patients followed a predetermined pattern but that the time span for development of memory, communication, and behavior problems varied greatly.…

  16. Juvenile Battens Disease.

    Science.gov (United States)

    Gayton, Romayne

    1987-01-01

    Ten children diagnosed with juvenile Battens disease were tested over a three-year period in general intelligence, memory, listening and speech, motor skills, and general learning. Results showed that the patients followed a predetermined pattern but that the time span for development of memory, communication, and behavior problems varied greatly.…

  17. Ultrasonography in Paget's disease of the breast: Comparison with Mammographic findings

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Sang Hee; Chung, Soo Young; Lee, Kyung Won; Yang, Ik; Kim, Hong Dae; Shin, Sang June; Chung, Bong Wha; Shin, Jung Weon [Hallym University College of Medicine, Chuncheon (Korea, Republic of); Kim, Hak Hee; Kim, Hyeon Sook [Catholic University College of Medicine, Seoul (Korea, Republic of)

    2001-06-15

    To evaluate sonographic and mammographic findings in Paget's disease of the breast and to assess the usefulness of sonography. Sonographic (n=13) and mammographic findings (n=12) of thirteen patients (age ranged from 25 and 86 years with the mean age of 56) with pathologically proven Paget's disease of the breast were retrospectively reviewed and compared. Clinical manifestations of the subjects were reviewed using patients' medical records. On sonography, any change in subareolar, the presence of mass, the configuration of the mass if present, the changes of the main lactiferous ducts and the presence of calcification were analyzed. On mammography, the subareolar density, parenchymal distortion, the presence of mass and the presence and type of calcifications were analyzed. The frequent clinical manifestations of Paget's disease were nipple retraction (7/13), bloody nipple discharge (7/13), nipple eczema (4/13) and subareolar mass (4/13). On sonography, mass was the most common (12/13) feature, and the mass was seen as an irregular hypoechoic mass. The irregularly dilated major lactiferous duct associated with a mass (3/13), calcification (2/13), subareolar low echogenicity (1/13) and parenchymal distortion (1/13) were also observed. The most frequent mammographic findings was increased subareolar density(9/12), followed by parenchymal distortion (8/12), microcalcification (6/12) and the presence of mass (3/12). The types of microcalcification seen on mammography were branching (4/6) and granular (2/6) shapes. Mass in the breast was more frequent detected on sonography (12/13) than on mammography (4/12). The irregularly dilated major lactiferous duct (3/12) associated with the mass could not be demonstrated on mammography. On the other hand, breast sonography was inferior to mammography in the detection rate of microcalcification. In diagnosis of Paget's disease in the breast, sonography was more useful than mammography in the detection of

  18. Paget's Disease of Bone and Osteoarthritis: Different Yet Related

    Science.gov (United States)

    ... and Other Conditions Paget’s Disease of Bone and Osteoarthritis: Different Yet Related Publication available in: PDF (59 ... for sure what causes Paget’s disease. What Is Osteoarthritis? Osteoarthritis is a condition that causes changes in ...

  19. Increased IL-6 expression in osteoclasts is necessary but not sufficient for the development of Paget's disease of bone.

    Science.gov (United States)

    Teramachi, Jumpei; Zhou, Hua; Subler, Mark A; Kitagawa, Yukiko; Galson, Deborah L; Dempster, David W; Windle, Jolene J; Kurihara, Noriyoshi; Roodman, G David

    2014-06-01

    Measles virus nucleocapsid protein (MVNP) expression in osteoclasts (OCLs) and mutation of the SQSTM1 (p62) gene contribute to the increased OCL activity in Paget's disease (PD). OCLs expressing MVNP display many of the features of PD OCLs. Interleukin-6 (IL-6) production is essential for the pagetic phenotype, because transgenic mice with MVNP targeted to OCLs develop pagetic OCLs and lesions, but this phenotype is absent when MVNP mice are bred to IL-6(-/-) mice. In contrast, mutant p62 expression in OCL precursors promotes receptor activator of NF-κB ligand (RANKL) hyperresponsivity and increased OCL production, but OCLs that form have normal morphology, are not hyperresponsive to 1,25-dihydroxyvitamin D3 (1,25-(OH)2 D3 ), nor produce elevated levels of IL-6. We previously generated p62(P394L) knock-in mice (p62KI) and found that although OCL numbers were increased, the mice did not develop pagetic lesions. However, mice expressing both MVNP and p62KI developed more exuberant pagetic lesions than mice expressing MVNP alone. To examine the role of elevated IL-6 in PD and determine if MVNP mediates its effects primarily through elevation of IL-6, we generated transgenic mice that overexpress IL-6 driven by the tartrate-resistant acid phosphatase (TRAP) promoter (TIL-6 mice) and produce IL-6 at levels comparable to MVNP mice. These were crossed with p62KI mice to determine whether IL-6 overexpression cooperates with mutant p62 to produce pagetic lesions. OCL precursors from p62KI/TIL-6 mice formed greater numbers of OCLs than either p62KI or TIL-6 OCL precursors in response to 1,25-(OH)2 D3 . Histomorphometric analysis of bones from p62KI/TIL-6 mice revealed increased OCL numbers per bone surface area compared to wild-type (WT) mice. However, micro-quantitative CT (µQCT) analysis did not reveal significant differences between p62KI/TIL-6 and WT mice, and no pagetic OCLs or lesions were detected in vivo. Thus, increased IL-6 expression in OCLs from p62KI mice

  20. Magnetic resonance imaging for extramammary Paget's disease: radiological and pathological correlations

    Energy Technology Data Exchange (ETDEWEB)

    Akaike, Gensuke; Nozaki, Taiki; Matsusako, Masaki; Saida, Yukihisa [St. Luke' s International Hospital, Department of Radiology, Tokyo (Japan); Matsui, Mizuko; Ohtake, Naoyuki [St. Luke' s International Hospital, Department of Plastic Surgery and Reconstructive Surgery, Tokyo (Japan); Eto, Hikaru [St. Luke' s International Hospital, Department of Dermatology, Tokyo (Japan); Suzuki, Koyu [St. Luke' s International Hospital, Department of Pathology, Tokyo (Japan)

    2013-03-15

    Extramammary Paget's disease (EMPD) is a rare cutaneous neoplasm that is thought to represent intraepithelial adenocarcinoma developing in an area rich in apocrine glands. Magnetic resonance imaging (MRI) findings for this disease are not well established. We report three cases of pathologically confirmed EMPD in which MRI was performed before surgery. The lesions were widespread in the epidermis and the dermis. Lesions were sharply well enhanced on gadolinium-enhanced T1-weighted imaging and appeared hyperintense on diffusion-weighted imaging in all cases. Areas with enhancement in depth corresponded well with the pathological lesion. In addition, different malignant legions were found on the same images from MRI in two cases, indicating potential associations with other malignancies. We describe the MRI findings and their pathological correlation. MRI could be useful for preoperative evaluation of disease spread and detection of associated malignancies. (orig.)

  1. Clinical report of 19 cases of paget's disease of the male urinogenital system%男性泌尿生殖系Paget's病19例临床报道

    Institute of Scientific and Technical Information of China (English)

    郑安; 吕文成; 林俊; 郝钢跃

    2013-01-01

    Objectives To study the diagnosis and treatment of Paget's disease of the male urinogenital system.Methods Between 1994 and 2012,we treated 19 male patients with Paget's disease,aged 43 ~ 85 years with an average of 66.2 years.17 of 9 cases of are scrotum Paget's disease,2 is urethra skin nipple after radical cystoctomy for bladder transitional cell carcinoma.The most common presenting symptom of Paget' disease is erubescence,papula and pruritis.Lesions occasionally show hyperpigmentation or hypopigmentation,some lesions show ulceration or areas of leukoplakia.Results The local surgical excision,ideally with 1 ~ 2 cm margin of normal skin,were pursued for all patients.16 patients were followed up,who survive 12 ~ 158 months after operation,and 8 survivals.One of them was recurrent 13 months after operation and pursued with a second operation and the outcome is satisfying.8 patients died,5 patients succumbed to nontumorous factor,2 patients with other system tumor,1 patient was dysoemia.Conclusions Early diagnosis and prompt treatment are essential to Paget's disease.Enough intraoperative section may ensure no residual disease and diminished recurrence rate and there was no influence of patient 's survival time post operation with early Paget's disease.%目的 提高男性泌尿生殖系Paget's病的诊治水平.方法 总结19例男性泌尿生殖系Paget's病患者的临床资料.19例中17例为阴囊Paget's病,2例为膀胱癌膀胱全切术后输尿管皮肤乳头Paget's病.最常见的症状是阴囊处皮肤潮红、红色丘疹及皮肤瘙痒症.病变通常表现为皮肤色素过渡沉着或色素沉着不足,也有的表现为溃疡和黏膜白斑症.结果 19例均选择手术治疗,手术切除范围距皮损处l ~2cm.16例随访者中,术后存活时间为12个月~158个月,目前存活8例.l例于术后13个月复发,仍采用手术治疗,效果良好.8例死亡,其中5例死于非肿瘤疾病,2例合并其他系统恶性肿瘤,1

  2. Desarrollo de hiperparatiroidismo primario en el seguimiento de un paciente con enfermedad de Paget Development of primary hyperparathyroidism in the follow-up of a patient with Paget´s disease

    Directory of Open Access Journals (Sweden)

    Francisco R Spivacow

    2009-02-01

    Full Text Available La asociación de hiperparatiroidismo primario y enfermedad de Paget varía entre 2.2 y 6%. Hasta el año 2006 se habían descripto 73 casos con simultaneidad de ambos diagnósticos. Se presenta el caso de un paciente varón de 68 años con un Paget poliostótico activo medicado durante 10 años con bisfosfonatos, con buena evolución. A los 10 años de seguimiento se observan elevados niveles de calcemia, calcio iónico, la fosfatasa alcalina (FAL, su isoenzima ósea (FAIO, e intactos los valores de parathormona (PTHi. Se establece el diagnóstico de hiperparatiroidismo primario. Dado el inestable estado general se decide postergar la cirugía y tratarlo con zoledronato IV con buena respuesta.According to the medical literature, the association of primary hyperparathyroidism and Paget's disease varies from 2.2 to 6%. Up to the year 2006, a total of 73 cases had been described, where both diagnoses occurred simultaneously. However, no manifestation of primary hyperparathyroidism during the follow- up of Paget's disease has been reported in the revised literature. We report the case of a well-controlled patient, who developed primary hyperparathyroidism during the 10-year follow-up of Paget's disease. A 68-yearold male patient with active polyostotic Paget's disease was successfully treated with bisphosphonates for ten years. During follow-up, increased levels of calcemia, ionic calcium, alkaline phosphatase, bone alkaline phosphatase and intact parathyroid hormone values were registered. The patient was diagnosed with primary hyperparathyroidism. As a result of his unstable general health condition, surgery was postponed and intravenous zoledronic acid was prescribed, with a favorable outcome.

  3. Life-threatening hyperkalemia following zoledronic acid infusion for Paget's disease: a case report

    Directory of Open Access Journals (Sweden)

    Naysmith Morag

    2011-08-01

    Full Text Available Abstract Introduction Zoledronic acid is a highly effective treatment in Paget's disease for persistent bone pain and prevention of further progression of the disease. The commonest electrolyte abnormality is hypocalcemia. To the best of our knowledge this is the first case of hyperkalemia secondary to zoledronic acid to be published in the world literature. The commonest arrhythmia related to zoledronic acid is atrial fibrillation. Case presentation We describe the case of an 80-year-old Caucasian man, with a history of ischemic heart disease, who had an in-hospital cardiac arrest related to hyperkalemia. Increasing potassium levels were noted following his first zoledronic acid infusion for symptomatic control of bone pain secondary to Paget's disease. Our patient suffered a cardiac arrest 10 days following the zoledronic acid infusion. Our patient's biochemistry and electrocardiogram output were monitored until his death 26 days after his cardiac arrest. Our patient developed paroxysmal atrial fibrillation in the post-resuscitation period and there was persistent hyperkalemia that required prolonged treatment with calcium resonium. All other possible causes of hyperkalemia were excluded. Conclusion In our patient's case persistent hyperkalemia and life-threatening arrhythmias were associated with use of zoledronic acid. These side effects have not been reported before and the causative mechanism is far from clear as there are no obvious systemic effects of zoledronic acid. The combination of zoledronic acid with predisposing factors such as structural heart disease might account for the clinical picture we witnessed. As a result, electrolyte monitoring should be adopted early in zoledronic acid use. Further studies are required to elucidate the underlying mechanism of hyperkalemia and identify the target group of patients where zoledronic acid can be safely administered. Great caution is advised in patients with underlying heart conditions.

  4. Prostate-specific antigen-positive extramammary Paget's disease--association with prostate cancer

    DEFF Research Database (Denmark)

    Hammer, Anne; Hager, Henrik; Steiniche, Torben

    2008-01-01

    Extramammary Paget's disease (EMPD) is a rare intraepidermal adenocarcinoma that primarily affects the anogenital region. Cases of EMPD reacting with PSA (prostate-specific antigen) have previously been associated with underlying prostate cancer. However, a recent case of EMPD in our department has...... led us to question the value of PSA as an indicator of underlying prostate cancer. Clinical and pathological data were obtained for 16 cases of EMPD. Formalin-fixed, paraffin-embedded tissue blocks from the primary skin lesions were investigated using PSA and other immunohistochemical markers. 5...... of the 16 cases of EMPD stained positive for PSA (2 women and 3 men). However, no reactivity was seen for the prostatic marker P501S. Three of the five patients had been diagnosed with internal malignant disease-two with prostate cancer, stage 1. Immunohistochemical investigations of the tumour specimens...

  5. Renal Cell Carcinoma Metastasized to Pagetic Bone.

    Science.gov (United States)

    Ramirez, Ashley; Liu, Bo; Rop, Baiywo; Edison, Michelle; Valente, Michael; Burt, Jeremy

    2016-01-01

    Paget's disease of the bone, historically known as osteitis deformans, is an uncommon disease typically affecting individuals of European descent. Patients with Paget's disease of the bone are at increased risk for primary bone neoplasms, particularly osteosarcoma. Many cases of metastatic disease to pagetic bone have been reported. However, renal cell carcinoma metastasized to pagetic bone is extremely rare. A 94-year-old male presented to the emergency department complaining of abdominal pain. A computed tomography scan of the abdomen demonstrated a large mass in the right kidney compatible with renal cell carcinoma. The patient was also noted to have Paget's disease of the pelvic bones and sacrum. Within the pagetic bone of the sacrum, there was an enhancing mass compatible with renal cell carcinoma. A subsequent biopsy of the renal lesion confirmed renal cell carcinoma. Paget's disease of the bone places the patient at an increased risk for bone neoplasms. The most commonly reported sites for malignant transformation are the femur, pelvis, and humerus. In cases of malignant transformation, osteosarcoma is the most common diagnosis. Breast, lung, and prostate carcinomas are the most common to metastasize to pagetic bone. Renal cell carcinoma associated with Paget's disease of the bone is very rare, with only one prior reported case. Malignancy in Paget's disease of the bone is uncommon with metastatic disease to pagetic bone being extremely rare. We report a patient diagnosed with concomitant renal cell carcinoma and metastatic disease within Paget's disease of the sacrum. Further research is needed to assess the true incidence of renal cell carcinoma associated with pagetic bone.

  6. Perianal and Vulvar Extramammary Paget Disease: A Report of Six Cases and Mapping Biopsy of the Anal Canal

    Science.gov (United States)

    Kazama, Sinsuke; Yamada, Daisuke; Miyagawa, Takuya; Murono, Koji; Yasuda, Koji; Nishikawa, Takeshi; Tanaka, Toshiaki; Kiyomatsu, Tomomichi; Hata, Keisuke; Kawai, Kazushige; Masui, Yuri; Nozawa, Hiroaki; Yamaguchi, Hironori; Ishihara, Soichiro; Kadono, Takafumi; Watanabe, Toshiaki

    2016-01-01

    Treatment of perianal and vulvar extramammary Paget disease (EMPD), rare intraepithelial malignancies, is often challenging because of its potential to spread into the anal canal. However, there is still no consensus regarding the optimal resection margin within the anal canal. Between 2004 and 2014, six patients (three with perianal EMPD and three with vulvar EMPD) in which the spread of Paget cells into the anal canal was highly suspected were referred to our department. To evaluate the disease extent within the anal canal, preoperative mapping biopsy of the anal canal was performed in five out of six patients. Two patients were positive for Paget cells within the anal canal (one at the dentate line and the other at 0.5 cm above the dentate line), whereas in three patients, Paget cell were present only in the skin of the anal verge. Using 1 cm margin within the anal canal from the positive biopsy sites, we performed anal-preserving wide local excision (WLE), and negative resection margins within the anal canal were confirmed in all five patients. The remaining one patient with perianal EMPD did not undergo mapping biopsy of the anal canal because preoperative colonoscopy revealed that the Paget cells had spread into the lower rectum. Therefore, WLE with abdominoperineal resection was performed. During the median follow-up period of 37.3 months, no local recurrence was observed in all patients. Our small case series suggest the usefulness of mapping biopsy of the anal canal for the treatment of perianal and vulvar EMPD. PMID:27746643

  7. Skeletal blood flow in Paget's disease of bone and its response to calcitonin therapy.

    Science.gov (United States)

    Wootton, R; Reeve, J; Spellacy, E; Tellez-Yudilevich, M

    1978-01-01

    1. Blood flow to the skeleton was measured by the 18F clearance method of Wooton, Reeve & Veall (1976) in 24 patients with untreated Paget's disease. In every patient but one, resting skeletal blood flow was increased. There was a significant positive correlation between skeletal blood flow and serum alkaline phosphatase and between skeletal blood flow and urinary total hydroxyproline excretion. 2. Fourteen patients were re-studied after they had received short-term (7 days or less) or long-term (7 weeks or more) calcitonin. Skeletal blood flow, alkaline phosphatase and urinary hydroxy-proline excretion fell towards normal in every case. There was some evidence from the short-term studies that calcitonin produced a more rapid fall in skeletal blood flow than in alkaline phosphatase. 3. Glomerular filtration rate appeared to increase transiently in response to calcitonin.

  8. Penile intraepithelial neoplasia with pagetoid features: report of an unusual variant mimicking Paget disease.

    Science.gov (United States)

    Amin, Ali; Griffith, Rogers C; Chaux, Alcides

    2014-04-01

    Precancerous lesions of the penis frequently share the morphologic features of the invasive counterpart. We have recently subclassified penile intraepithelial neoplasia into differentiated, warty, and basaloid subtypes, each one with distinctive microscopic morphology. Nevertheless, in our experience, some cases depart from this classification scheme and show unusual morphologic features, hindering the proper diagnosis on routine morphology alone. Herein we present a case of penile intraepithelial neoplasia with a pagetoid growth pattern, closely mimicking Paget disease. We describe the necessary steps to reach the final diagnose, including the use of immunohistochemistry for cytokeratin (CK) 7, CK20, CK34βE12, CAM 5.2, AE1/AE3, CEA, S100, Melan-A, and p63. We also discuss other differential diagnoses that should be considered such as malignant melanoma and urothelial carcinoma in situ with pagetoid spread and less common lesions such as pagetoid dyskeratosis, clear cell papulosis, and mucinous metaplasia.

  9. Osteitis deformans (Paget's disease) in a Burmese python (Python molurus bivittatus)--a case report.

    Science.gov (United States)

    Preziosi, Rosario; Diana, Alessia; Florio, Daniela; Gustinelli, Andrea; Nardini, Giordano

    2007-11-01

    Osteitis deformans (Paget's disease of bone) is a chronic focal disorder of bone remodelling characterized by an initial increase in osteoclast-mediated bone resorption, with subsequent compensatory increase in new bone formation, resulting in a disorganized mosaic of woven and lamellar bone. In the Burmese python (Python molurus bivittatus) of this report, multifocal gross swellings involving the proximal third of the vertebral spine were observed and associated with anorexia, a relative inability to move or to fully extend the body, and to strike at prey. Serum biochemistry revealed elevated alkaline-phosphatase activity. Radiographic changes (irregular bone proliferation along the vertebral margins), computed tomography scan results (abnormal mineral density), and histopathological features (generalized thickening of the bony trabeculae at the expense of the intertrabecular spaces and irregular patches of lamellar bone with a characteristic "mosaic" pattern) indicated osteitis deformans.

  10. Treatment of a vulvar Paget's disease by photodynamic therapy with a new light emitting fabric based device.

    Science.gov (United States)

    Vicentini, Claire; Carpentier, Olivier; Lecomte, Fabienne; Thecua, Elise; Mortier, Laurent; Mordon, Serge R

    2017-02-01

    The non-invasive vulvar Paget's disease is an intra-epidermal carcinoma with glandular characteristics. It appears like an erythematous plaque. The main symptoms are pruritus and pain. The standard treatment is surgical excision in depth. This treatment is complicated with a severe morbidity and photodynamic therapy can be an alternative choice. However, the pain experienced during the photodynamic treatment of vulvar lesion is intense and leads to a premature interruption of the treatment. The light emitting fabric is a part of a device under clinical evaluation for the treatment of actinic keratosis with photodynamic therapy. We report the observation of a vulvar Paget's disease treated by this device with a satisfactory result and an excellent tolerance. The patient has been diagnosed with non-invasive vulvar Paget's disease for 25 years. The disease recurred constantly despite several imiquimod applications, LASER treatments and conventional photodynamic therapy. These procedures were complicated with intense pain. To improve the tolerance, we performed three PDT sessions a month apart using a 16% methyl-aminolevulinate cream (Metvixia® Galderma, Lausanne, Switzerland) with the light emitting fabric at low irradiance (irradiance = 6 mW/cm(2) -fluence = 37 J/cm(2) ) with a satisfactory result and an excellent tolerance. There are no controlled trials evaluating the efficacy of photodynamic therapy in the treatment of vulvar Paget's disease. The treatment and follow-up protocols in the literature are heterogeneous. Pain is the most common side effect with greater intensity for perineal locations where photodynamic therapy is impractical outside of anesthesia or hypnosis. We report the case of a multirecidivant non-invasive vulvar Paget's disease treated with a satisfactory result and an excellent tolerance by the new light emitting fabric device. A specific study is required but the light emitting fabric could be indicated for the treatment of Paget

  11. Unilateral Pigmented Extramammary Paget's Disease of the Axilla Associated with a Benign Mole: A Case Study and a Review of Literature.

    Science.gov (United States)

    Ladak, Aleem; Bramley, Maria; Titi, Sami

    2014-08-01

    Pigmented extramammary Paget's disease (PEMPD) is an uncommon intraepithelial adenocarcinoma and a rare variant of Paget's disease affecting skin that is rich in apocrine sweat glands such as the axilla, perianal region and vulva. It most commonly occurs in postmenopausal women and presents as a superficial pigmented scaly macule, mimicking a melanocytic lesion. The histological presentation is adenocarcinoma in situ with an increased number of melanocytes scattered between the Paget's cells. Therefore, PEMPD may be misdiagnosed as a melanocytic tumour both clinically and histologically. The tumour cells are usually positive for cytokeratin 7, epithelial membrane antigen, Cam 5.2, HER2, and mucicarmine stain while S100 and human melanoma black-45 highlight the processes of reactive dendritic cells. The association between Paget's cells and intratumoural reactive melanocytes is still unclear. We report our first case of PEMPD associated with an intradermal naevus involving the axilla in a 63-year-old woman.

  12. Skrotal Pagets sygdom

    DEFF Research Database (Denmark)

    Juel, Jacob; Røge, Rasmus; Petersen, Astrid;

    2014-01-01

    A patient with extramammary Paget's disease (EMPD) had a plaque of the scrotum surgically removed. Histology and immunohistochemistry was consistent with primary EMPD. EMPD is a rare intraepidermal neoplasia mostly confined to regions of the skin with apocrine sweat glands. Clinical features...

  13. Protocol for stage 2 of the GaP study (genetic testing acceptability for Paget's disease of bone: A questionnaire study to investigate whether relatives of people with Paget's disease would accept genetic testing and preventive treatment if they were available

    Directory of Open Access Journals (Sweden)

    McCallum Marilyn

    2008-05-01

    Full Text Available Abstract Background Paget's disease of bone (PDB disrupts normal bone architecture and causes pain, deformity, deafness, osteoarthritis, and fractures. Genetic factors play a role in PDB and genetic tests are now conducted for research purposes. It is thus timely to investigate the potential for a clinical programme of genetic testing and preventative treatment for people who have a family history of PDB. This study examines the beliefs of relatives of people with PDB. It focuses particularly on illness and treatment representations as predictors of the acceptability and uptake of potential clinical programmes. Illness representations are examined using Leventhal's Common Sense Self-Regulation Model while cognitions about treatment behaviours (acceptance of testing and treatment uptake are conceptualised within the Theory of Planned Behaviour. Methods/Design A postal questionnaire of non-affected relatives of people with Paget's disease. The sample will include relatives of Paget's patients with a family history of Paget's disease and relatives of Paget's patients without a family history of Paget's disease. The questionnaire will explore whether a range of factors relate to acceptability of a programme of genetic testing and preventive treatment in relatives of Paget's disease sufferers. The questionnaire will include several measures: illness representations (as measured by the Brief Illness Perceptions Questionnaire; treatment representations (as measured by Theory of Planned Behaviour-based question items, informed by a prior interview elicitation study; descriptive and demographic details; and questions exploring family environment and beliefs of other important people. Data will also be collected from family members who have been diagnosed with Paget's disease to describe the disease presentation and its distribution within a family. Discussion The answers to these measures will inform the feasibility of a programme of genetic testing and

  14. Radiological features of Paget disease of bone associated with VCP myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)

    2012-03-15

    Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)

  15. Inclusion body myopathy, Paget's disease of the bone and fronto-temporal dementia: a disorder of autophagy

    OpenAIRE

    Ju, Jeong-Sun; Weihl, Conrad C

    2010-01-01

    Inclusion body myopathy associated with Paget's disease of the bone and fronto-temporal dementia (IBMPFD) is a progressive autosomal dominant disorder caused by mutations in p97/VCP (valosin-containing protein). p97/VCP is a member of the AAA+ (ATPase associated with a variety of activities) protein family and participates in multiple cellular processes. One particularly important role for p97/VCP is facilitating intracellular protein degradation. p97/VCP has traditionally been thought to med...

  16. Extensive Invasive Extramammary Paget Disease Evaluated by F-18 FDG PET/CT

    Science.gov (United States)

    Li, Zu-Gui; Qin, Xiao-Jing

    2015-01-01

    Abstract Extramammary Paget disease (EMPD) is a rare cutaneous, intraepithelial adenocarcinoma. Because of its rarity, little is known about the value of fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) in evaluating this disease. Our case report aims to increase current knowledge of FDG PET/CT in EMPD as a noninvasive imaging tool for assessing the extension of the disease and detecting distant metastases. We reported a 64-year-old Chinese man who presented with a slowly progressive, ill-margined erythematous lesion with a crusted, eroded, and scaly surface involving multiple sites of penis, scrotum, left pelvic wall, hip, groin, and thigh for >4 years, which became extensive in the past 1 year. He was referred for an FDG PET/CT examination to further evaluate the lesions. A following skin biopsy was performed to obtain a definitive histological diagnosis. FDG PET/CT imaging revealed mild FDG uptake at the extensive cutaneous lesion with subcutaneous invasion, involvement of lymph nodes, and multiple intense FDG-avid of skeletal metastases. According to the appearance of FDG PET/CT, a provisional diagnosis of advanced cutaneous malignancy was made. Histopathology findings indicated characteristic of EMPD. The patient was treated with radiation therapy and died from complications 2 months after the last dose of radiotherapy. Our case highlighted that a whole-body FDG PET/CT should be incorporated into the diagnostic algorithm of EMPD to give a comprehensive assessment of this disease. PMID:25621679

  17. Extensive invasive extramammary Paget disease evaluated by F-18 FDG PET/CT: a case report.

    Science.gov (United States)

    Li, Zu-Gui; Qin, Xiao-Jing

    2015-01-01

    Extramammary Paget disease (EMPD) is a rare cutaneous, intraepithelial adenocarcinoma. Because of its rarity, little is known about the value of fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) in evaluating this disease. Our case report aims to increase current knowledge of FDG PET/CT in EMPD as a noninvasive imaging tool for assessing the extension of the disease and detecting distant metastases.We reported a 64-year-old Chinese man who presented with a slowly progressive, ill-margined erythematous lesion with a crusted, eroded, and scaly surface involving multiple sites of penis, scrotum, left pelvic wall, hip, groin, and thigh for >4 years, which became extensive in the past 1 year. He was referred for an FDG PET/CT examination to further evaluate the lesions. A following skin biopsy was performed to obtain a definitive histological diagnosis.FDG PET/CT imaging revealed mild FDG uptake at the extensive cutaneous lesion with subcutaneous invasion, involvement of lymph nodes, and multiple intense FDG-avid of skeletal metastases. According to the appearance of FDG PET/CT, a provisional diagnosis of advanced cutaneous malignancy was made. Histopathology findings indicated characteristic of EMPD. The patient was treated with radiation therapy and died from complications 2 months after the last dose of radiotherapy.Our case highlighted that a whole-body FDG PET/CT should be incorporated into the diagnostic algorithm of EMPD to give a comprehensive assessment of this disease.

  18. Handheld Reflectance Confocal Microscopy for the Detection of Recurrent Extramammary Paget Disease.

    Science.gov (United States)

    Yélamos, Oriol; Hibler, Brian P; Cordova, Miguel; Hollmann, Travis J; Kose, Kivanc; Marchetti, Michael A; Myskowski, Patricia L; Pulitzer, Melissa P; Rajadhyaksha, Milind; Rossi, Anthony M; Jain, Manu

    2017-07-01

    Extramammary Paget disease (EMPD) is commonly refractory to surgical and nonsurgical therapies. Identifying recurrent or persistent EMPD is challenging because the disease is multifocal, and multiple blind scouting biopsies are usually performed in this setting. Handheld reflectance confocal microscopy (HRCM) has been used to diagnose and map primary EMPD and therefore may be used to identify EMPD recurrences. To evaluate HRCM's diagnostic accuracy in the setting of recurrent or persistent EMPD as well as its potential diagnostic pitfalls. This prospective case series study included patients referred to the Dermatology Service at Memorial Sloan Kettering Cancer Center between January 1, 2014, and December 31, 2016, with biopsy-proven EMPD in whom HRCM was used to monitor treatment response. Five patients were included, and 22 sites clinically concerning for recurrent or persistent disease were evaluated using HRCM and histopathologic examination. In 2 patients, video mosaics were created to evaluate large areas. Sensitivity and specificity of HRCM in identifying recurrent or persistent EMPD; causes for false-negative results according to their location, histopathologic findings, and previous treatments. Of the 22 clinically suspicious sites evaluated in 5 patients (4 men, 1 woman; median [range] age, 70 [56-77] years), 9 (40.9%) were positive for recurrent disease on HRCM and histopathologically confirmed, and 13 (59.1%) sites were negative on HRCM, but 3 of the 13 were positive for EMPD on histopathological examination. In general, HRCM had a sensitivity of 75% and a specificity of 100% in identifying recurrent or persistent EMPD. False-negative results were found in 2 patients and occurred at the margins of EMPD, close to previous biopsy sites. Creating video mosaics (or video mosaicking) seemed to improve the detection of EMPD. Handheld reflectance confocal microscopy is a useful auxiliary tool for diagnosing EMPD recurrences and can be used to guide scouting

  19. Place of the radiotherapy in the care of the extra-mammary Paget disease; Place de la radiotherapie dans la prise en charge therapeutique de la maladie de Paget extramammaire

    Energy Technology Data Exchange (ETDEWEB)

    Yanes, B.; Notter, M.; Dragusanu, D. [Hopital Neuchatelois, La Chaux-De-Fonds (Switzerland)

    2007-11-15

    The cutaneous tolerance of the radiotherapy was satisfactory and the treatment took place continuously at all the patient's. A patient is always in situation of clinical forgiveness, 3 years after the irradiation and another waits after two years, and finally a extra-mammary disease of Paget did it again 1 year after the irradiation and was treated by surgery of correction. It is still too much early to estimate the last two patients, treated in 2007. (N.C.)

  20. Doença de Paget óssea monostótica em vértebra lombar: uma localização atípica Monostotic Paget's disease of the lumbar vertebrae: an atypical location

    Directory of Open Access Journals (Sweden)

    Alexandre Dias Carvalho

    2010-01-01

    Full Text Available Paciente do sexo feminino, 41 anos, cor branca, com queixa de dor lombar há mais de três anos, sem irradiações, submetida há vários exames radiográficos sendo diagnosticada, por biópsia, doença de Paget monostótica na terceira vértebra lombar. Trata-se de uma localização incomum.Female patient, 41 years, Caucasian, with lumbar pain for more than three years, without irradiation, submitted to various radiological exams and diagnosed by biopsy with monostotic Paget's disease of the third lumbar vertebrae, which is an uncommon location.

  1. Doença de Paget invasiva da vulva e região perianal: relato de caso Invasive Paget's disease of the vulva and perianal region: a case report

    Directory of Open Access Journals (Sweden)

    Etelvino de Souza Trindade

    2004-05-01

    Full Text Available A doença de Paget extramamária (DPE é uma condição neoplásica incomum observada principalmente em áreas com numerosas glândulas apócrinas e écrinas. Na mulher é mais comum na vulva, embora possa ocorrer em outros locais. A doença de Paget vulvar (DPV pode ser classificada em primária, de origem cutânea, e secundária, de origem extracutânea, com significado clínico e implicações prognosticas importantes. Clinicamente a DPV começa insidiosamente com prurido e sensação de queimação. A lesão surge como uma placa isolada com superfície eczematosa, eritematosa e descamativa. Relatamos o caso de uma paciente de 72 anos com lesão eritematosa em placa, levemente espessada, com áreas de erosão envolvendo os grandes e os pequenos lábios à direita e à esquerda, o clitóris, o púbis e as regiões perineal e perianal. A cirurgia realizada foi vulvectomia radical com linfadenectomia inguinal. O histopatológico revelou doença de Paget invasiva. Métodos imuno-histoquímicos mostraram células de Paget positivas para CEA, EMA e citoceratina pan. A patogênese e o diagnóstico da DPE são discutidos, assim como os diagnósticos diferenciais e as referências com métodos imuno-histoquímicos. A recidiva ocorre em 30% dos casos, mesmo com o controle adequado da margem cirúrgica. A experiência com DPV é limitada e o seguimento é requerido para excluir recidivas e o desenvolvimento de um câncer associado.Extramammary Paget's disease (EPD is an uncommon neoplasic condition observed mostly in areas with numerous apocrine and or eccrine glands. In the woman it is most commonly seen on the vulva, although it can occur in other locations. Vulvar Paget's disease (VPD can be classified into primary, of cutaneous origin, and secondary, of extracutaneous origin, with significant clinical e prognostic implications. Clinically VPD begins insidiously with pruritus and burning sensation. The lesion appears as a solitary patch with an

  2. A rare case report of a primary large-cell neuroendocrine carcinoma of the breast with coexisting Paget disease.

    Science.gov (United States)

    Psoma, Elizabeth; Nikolaidou, Olga; Stavrogianni, Thomai; Mavromati, Areti; Lytras, Konstantinos; Xirou, Persefoni; Koumbanaki, Melanie; Panagiotopoulou, Dimitra

    2012-01-01

    Neuroendocrine carcinomas are malignancies deriving from neuroendocrine cells existing in various sites of the body, most commonly in the lungs and gastrointestinal tract. Primary neuroendocrine carcinomas of the breast are extremely rare, and their diagnosis is confirmed by positive neuroendocrine markers. We describe a case of a 46-year-old woman with a palpable mass in her left breast for the previous 3 months. The tumor was resected and a primary large-cell neuroendocrine tumor of the breast was confirmed by histopathologic examination. Paget disease of the nipple was noted as well.

  3. Usefulness of MRI in detecting occult breast cancer associated with Paget's disease of the nipple-areolar complex.

    Science.gov (United States)

    Echevarria, J J; Lopez-Ruiz, J A; Martin, D; Imaz, I; Martin, M

    2004-12-01

    MRI allows for the detection of mammographically and clinically occult breast neoplasms. We analysed the ability of MRI to detect occult breast cancer in three patients with Paget's disease of the nipple-areolar complex, proven histologically. In all three cases we observed differences in the morphological and dynamic features of healthy and pathological nipples, and we also found enhancement foci in breast tissue, with suspicious kinetic and morphological characteristics, which in the case of two patients corresponded to ductal carcinoma in situ. The detection and location with MRI of underlying neoplastic foci may be of help in choosing the most reasonable and conservative treatment in these patients.

  4. Usefulness of sentinel lymph node biopsy for prognostic prediction in extramammary Paget's disease.

    Science.gov (United States)

    Ogata, Dai; Kiyohara, Yoshio; Yoshikawa, Syusuke; Tsuchida, Tetsuya

    2016-06-01

    Complete excision of the primary lesion has long been considered the standard treatment for extramammary Paget's disease (EMPD). However, the presence of lymph node metastases has been reported as an important prognostic factor. We evaluated the association between lymph node metastasis and prognosis for EMPD using sentinel lymph node (SLN) biopsy. This retrospective study included 59 patients with histopathologically-confirmed primary EMPD. A total of 45 patients with microinvasion to the papillary dermis and deep invasion into the reticular dermis or subcutaneous tissue were included in the analysis. The survival curves of the SLN-negative group and the SLN-positive group were compared and we examined the risk factors for SLN positivity. A total of 139 SLNs were excised from one (28 patients) or both inguinal regions (31 patients). The average number of detected SLNs was 2.4. The incidence of SLN metastases was 16.9%. SLN positivity rates according to level of invasion were 0% for intraepithelial lesions, 4.1% for microinvasion, and 42.8% for dermal invasion. The five-year survival rates were 100% in the SLN-negative and 24% in the SLN-positive groups (p = 0.0001). Reticular dermis or subcutaneous tissue invasion was a significant independent risk factor for SLN positivity according to multivariate analysis. The result of SLN biopsy affected prognosis. It is extremely important to accurately ascertain the presence, i.e. the number, or absence of regional lymph node metastases in patients with EMPD. We conclude that SLN biopsy may be appropriate for cases where invasion is suspected.

  5. Gene expression profile in osteoclasts from patients with Paget's disease of bone.

    Science.gov (United States)

    Michou, Laetitia; Chamoux, Estelle; Couture, Julie; Morissette, Jean; Brown, Jacques P; Roux, Sophie

    2010-03-01

    Paget's disease of bone (PDB) is a common metabolic bone disorder with a significant genetic component. To date, only one gene associated with PDB has been identified, the p62-Sequestosome1 gene (SQSTM1), and more than 20 mutations of this gene have been reported in PDB, the most common being the P392L substitution. In order to search for differentially expressed genes in PDB, we investigated the relative gene expression profile of candidate genes in osteoclast (OCL) cultures from 12 PDB patients and six unmatched healthy controls with known genetic status regarding p62, including healthy carriers of the P392L mutation. We selected 48 OCL-expressed candidate genes that may be involved in relevant pathways of PDB pathogenesis, such as OCL signaling, survival, bone resorption activity, or adhesion. In OCL cultures derived from peripheral blood mononuclear cells, total RNA extraction was performed, followed by real-time PCR experiments. Relative quantification analysis utilized the qBase method where relative expression levels were normalized with respect to a set of reference primer pairs for three housekeeping genes. When compared to non-mutated healthy controls, OCL cultures from PDB patients displayed a significant down-regulation in genes involved in apoptosis (CASP3 and TNFRSF10A), in cell signaling (TNFRSF11A), in the OCL bone resorbing function (ACP5 and CTSK) and in the gene coding for Tau protein (MAPT) (all comparisons, pOCL, and highlight the role of altered apoptosis pathways in these cells. They also suggest that the SQSTM1 P392L mutation plays a role in PDB pathogenesis, even at early preclinical stages in healthy carriers of the P392L mutation.

  6. Mutant p62P392L stimulation of osteoclast differentiation in Paget's disease of bone.

    Science.gov (United States)

    Sundaram, Kumaran; Shanmugarajan, Srinivasan; Rao, D Sudhaker; Reddy, Sakamuri V

    2011-11-01

    Paget's disease of the bone (PDB) is an autosomal dominant trait with genetic heterogeneity, characterized by abnormal osteoclastogenesis. Sequestosome 1 (p62) is a scaffold protein that plays an important role in receptor activator of nuclear factor κB (RANK) signaling essential for osteoclast (OCL) differentiation. p62P392L mutation in the ubiquitin-associated (UBA) domain is widely associated with PDB; however, the mechanisms by which p62P392L stimulate OCL differentiation in PDB are not completely understood. Deubiquitinating enzyme cylindromatosis (CYLD) has been shown to negatively regulate RANK ligand-RANK signaling essential for OCL differentiation. Here, we report that CYLD binds with the p62 wild-type (p62WT), non-UBA mutant (p62A381V) but not with the UBA mutant (p62P392L) in OCL progenitor cells. Also, p62P392L induces expression of c-Fos (2.8-fold) and nuclear factor of activated T cells c1 (6.0-fold) transcription factors critical for OCL differentiation. Furthermore, p62P392L expression results in accumulation of polyubiquitinated TNF receptor-associated factor (TRAF)6 and elevated levels of phospho-IκB during OCL differentiation. Retroviral transduction of p62P392L/CYLD short hairpin RNA significantly increased TRAP positive multinucleated OCL formation/bone resorption activity in mouse bone marrow cultures. Thus, the p62P392L mutation abolished CYLD interaction and enhanced OCL development/bone resorption activity in PDB.

  7. Efecto de una sola dosis de ácido zoledrónico en un caso de enfermedad de Paget ósea Effect of a single dose of zoledronic acid in a case of Paget bone disease

    Directory of Open Access Journals (Sweden)

    Melina Sabán

    2010-10-01

    Full Text Available La enfermedad de Paget es un trastorno crónico del remodelado óseo, caracterizado por un aumento de la resorción ósea producido por osteoclastos atípicos, seguido por un incremento acelerado de la formación ósea, lo que resulta en la formación de hueso en mosaico desorganizado. Un excelente marcador bioquímico para orientar el diagnóstico y seguimiento es la fosfatasa alcalina (FAL. Se presenta el caso de un paciente de 90 años, de sexo masculino, con diagnóstico de enfermedad de Paget. Se inicia tratamiento con pamidronato vía oral con respuesta parcial, por lo que se rota a pamidronato endovenoso. Disminuyen el dolor y la concentración plasmática de FAL, persistiendo con centellograma óseo patológico. Luego de varios años de tratamiento, con adecuado aporte de calcio y vitamina D, comienza nuevamente con dolor y valores elevados de FAL. Se decide iniciar tratamiento con ácido zoledrónico endovenoso 4 mg, única aplicación, obteniéndose remisión clínica y bioquímica desde hace cuatro años y mejoría de la imagen centellográfica. Este informe refiere la buena respuesta, sostenida en el tiempo, al tratamiento con única dosis de ácido zoledrónico en un paciente que presentó resistencia al pamidronato.Paget's disease is a chronic disorder of bone remodeling characterized by increase of bone resorption by atypical osteoclasts, followed by rapid increase in bone formation resulting in a disorganized mosaic bone. The biochemical marker for early diagnosis and monitoring is serum alkaline phosphatase (ALP. We report the case of a 90 year old male, with diagnose of Paget's disease. Pamidronate treatment was started orally with partial response, so it was switched to intravenous pamidronate. Pain intensity and FAL levels diminished. The scyntigraphic scan, however, though improved, persisted abnormal. After several years of treatment, with adequate calcium and vitamin D support, the patient presents pain and increase of FAL

  8. Dual photon absorptiometry in patients with Paget disease (bone mineral contents of lumbar spine and femoral neck)

    Energy Technology Data Exchange (ETDEWEB)

    Talbot, J.N.; Piketty, C.; Kiffel, T.; Coutris, G.; Milhaud, G.

    1988-01-01

    The bone mineral contents (BMC) of the lumbar spine (84 cases) and of one femoral neck (53 cases) were measured by dual photon absorptiometry (DPA) in patients suffering from Paget's disease of bone. The BMC of the patients and of 53 controls were compared, taking into account the occurrence of a scintigraphic hyperfixation, in each patient. A hyperfixation of the technetium labelled diphosphonate in the lumbar spine, more frequent in males, was associated with an elevated mean BMC value. The difference versus controls was significant in men but not in women. A hyperfixation of the femoral neck was associated with an elevated mean BMC value in both sexes. BMC values greater than the mean BMC of controls + 2 SD were observed in 83 per cent of these male patients and 50 per cent of the females. In contrast, BMC values lower than in controls were observed in non-pagetic areas. DPA allows the quantification of these abnormalities which cannot be evidenced by bone scintigraphy even if alkaline phosphatases levels are assayed.

  9. [Juvenile monomelic amyotrophy: Hirayama disease].

    Science.gov (United States)

    Drozdowski, W; Baniukiewicz, E; Lewonowska, M

    1998-01-01

    We present three patients with unilateral upper limb weakness (with muscular atrophy)-two of them with distal and one with proximal localization. The disease onset was between 18th end 35-th year of life; the disease course was biphasic (i.e. progressive within first 1 to 3 years, and stabilized during following 4-24 years). The laboratory investigations permitted to diagnose juvenile monomelic amyotrophy, an entity that is very rare outside Japan. Electromyography revealed neurogenic involvement with spinal features also in clinically unaffected muscles. We suggest that these results may support the hypothesis of this disease being a benign variant of spinal muscular atrophy.

  10. Morbus paget of the skeleton

    Energy Technology Data Exchange (ETDEWEB)

    Ziegler, R.; Baldauf, M.

    1984-09-01

    Paget's disease of bone seems to be a slow virus infection of a single or several areas of the skeleton. Pagetic lesions are rather common among elderly people, but the disease does not manifest very often. Compared to the incidence of Paget's disease in England, it seems to be rarer in this country. The pelvis is most frequently involved, followed by bones of the leg, skull, lumbar spine. The patients suffer from pains and deformities, arthroses of the adhering ankles, increased temperature of the area, nerval irritation and nerve damage due to increased bone growth (e.g. hearing loss due to Paget's disease of the skull). The development of sarcoma is rare and is only seen in severe cases. Diagnosis is made by X-ray, confirmed by bone biopsy, if necessary. Asymptomatic lesions are detected by bone scintigraphy. The activity of the disease is expressed by increased alkaline serum phosphatase and urinary hydroxyproline excretion. For treatment calcitonins and diphosphonates (especially EHDP, Diphos) are used. Both inhibit the overactive osteoclasts, and the increased bone turnover is normalized. The patients feel considerable relief, the elevated biochemical parameters fall to about 50% of initial values after calcitonin- or EHDP monotherapy. In severe cases the combination of both substances may be profitable. The cytostatic drug mithramycin which can also be effective is only needed exceptionally.

  11. CLINICAL ANALYSIS AND TREATMENT OF 14 CASES OF EXTRAMAMMARY PAGET S DISEASE

    Institute of Scientific and Technical Information of China (English)

    傅敏刚

    2000-01-01

    ffesum6 Objectif POur diffdrencier la Maladie de Paget extra-mammaire (MPE) des autres maladies chroniques de lacpu. ANthaeS Faire l' analySe clinique et l' etude des traitements chirurgicaux d' excision dans 14 oas de MPE da taut de1987 jusu' d 1997. theultats ~tim non de la ma ladle: 12 oas sur 14, an penis et aux hourses, 1 oas an canal ingUinal et1 oas d la region twianale. Par ies emmens biochimiques, tons etaient ~t ifs pour cytokeratine et thetifs POur Protdine S-100.Pendant ie suivi gut-opratoire, o...

  12. Doença de Paget pigmentada do mamilo simulando melanoma cutâneo: importância da imuno-histoquímica na diferenciação dessas doenças Pigmented Paget's disease of the nipple mimicking cutaneous melanoma: importance of the immunohistochemical profile to differentiate between these diseases

    Directory of Open Access Journals (Sweden)

    Tatiana Villas Boas Gabbi

    2006-10-01

    Full Text Available A variante pigmentada da doença de Paget mamária é rara, com cerca de 12 casos relatados, e pode mimetizar clínica e histologicamente o melanoma. Como na forma clássica, em geral associa-se à neoplasia da mama acometida, com origem principalmente no carcinoma intraductal que se estende à epiderme através de ducto lactóforo. A fisiopatologia da hiperpigmentação permanece desconhecida. Relata-se o caso de paciente de 49 anos que apresentou lesão pigmentada do mamilo, suspeita de melanoma. O exame histológico não foi suficiente para confirmar o diagnóstico, sendo necessária realização de perfil imuno-histoquímico. Apesar de incomum, o diagnóstico de doença de Paget deve ser lembrado como diferencial de melanoma em lesões pigmentadas dessa região, em ambos os sexos.Pigmented mammary Paget's disease is a rare dermatosis, with approximately 12 reported cases in the literature, which can mimic cutaneous melanoma both clinically and histologically. As for classical mammary Paget's disease, the pigmented variant is associated with neoplasia of the breast, originating mainly from intraductal mammary carcinoma that extends to the epidermis of the nipple and areola through a lactiferous duct. Physiopathology of hyperpigmentation remains unknown. We present a 49-year-old female patient who presented with a pigmented lesion of the nipple suspected of melanoma. Histological examination was not sufficient to confirm diagnosis. Immunohistochemical examination confirmed the diagnosis of Paget's disease. Although uncommon, pigmented Paget's disease must be reminded as a differential diagnosis of melanoma in pigmented lesions of the nipple, in both genders.

  13. Clostridium difficile Colitis and Neutropenic Fever Associated with Docetaxel Chemotherapy in a Patient with Advanced Extramammary Paget's Disease.

    Science.gov (United States)

    Nonomura, Yumi; Otsuka, Atsushi; Endo, Yuichiro; Fujisawa, Akihiro; Tanioka, Miki; Kabashima, Kenji; Miyachi, Yoshiki

    2012-05-01

    Extramammary Paget's disease is a rare cutaneous malignant neoplasm. Previous studies indicated the efficacy of docetaxel in advanced cases. The common side effects of docetaxel are usually tolerable and seldom life-threatening. We experienced a case of severe pseudomembranous colitis and neutropenic fever that developed just after the first cycle of docetaxel chemotherapy. To the best of our knowledge, there are few reports of pseudomembranous colitis associated with docetaxel administration for skin cancers. The patient showed complete resolution of her symptoms within 2 weeks with an oral metronidazole therapy. During the second and third cycles, the patient received docetaxel safely with lower doses. The present case indicated that pseudomembranous colitis should be included in the differential diagnosis when assessing patients who develop severe diarrhea during systemic chemotherapy with docetaxel.

  14. 腋窝乳房外Paget病1例%A Case of Extramammary Paget' s Disease on the Axillary

    Institute of Scientific and Technical Information of China (English)

    单滢; 王飞

    2013-01-01

    A 83-year-old male, complaining of itch, had been suffered with erythema on the axillary fossa for 6 years, repeatedly misdiagnosed as eczema and received the Symptomatic treatment, but the symptom did not get better. He felt a little pain and much itch on the erythema with the skin disunion 3 years ago. The extent of the erythema got bigger recently and he received resection at last. Histological examnation showed; Epidermis hyperkeratosis,single or a nest of Paget cells in the epidermis and part of eecrine ductal epithelium,multiple lymphocytic infiltration in the superficial layer of dermis; AB staining( + ) ,PAS staining( — ). Immunohis-tochemistry showed: CK7 ,CK8/18 ,CEA and Ki67 ( + ) ,S100 and HMB45 ( - ). Diagnosis: extramammary Paget' s disease.%患者男,83岁.左侧腋窝红斑伴瘙痒6年.多次按湿疹治疗,无效;3年前始皮损伴轻度疼痛,瘙痒明显,反复破溃不能愈合.近日来皮损增大明显,予手术切除.切除物组织病理示:表皮轻度角化过度,表皮全层可见单个或成巢的Paget细胞,真皮浅层较多淋巴细胞浸润;AB染色(+),PAS染色(-);免疫组化示:CK7,CK8/18,CEA和Ki67均(+):S100和HM B45均(-).诊断:乳房外Paget病.

  15. Radiography, Bone Scan, and F-18 FDG PET/CT Imaging Findings in a Patient with Paget's Disease

    Energy Technology Data Exchange (ETDEWEB)

    Park, Eun Tae; Kim, Sung Eun [Korea University Guro Hospital, Seoul (Korea, Republic of)

    2010-04-15

    Background A 52-year-old female patient sought evaluation at our hospital for an incidental abnormal finding on an abdominal radiograph. The initial radiograph showed irregular sclerotic changes involving the right pelvic bone. At the same time, bone scintigraphy showed intense hot uptake in the right iliac and pubic bones. CT images showed characteristic thickening of the pelvic brim, suggesting the mixed phase of Paget's disease. The level of alkaline phosphatase (ALP) was 266 IU/I. {sup 18}F-FDG PET/CT images also showed diffusely increased {sup 18}F-FDG uptake in the right pelvic bone. However, the findings of {sup 18}F-FDG PET/CT were less notable than those of bone scintigraphy. We report the imaging findings of a patient with Paget's disease evaluated by radiography, bone scintigraphy, and {sup 18}F-FDG PET/CT.

  16. Juvenile Huntington disease in Argentina.

    Science.gov (United States)

    Gatto, Emilia Mabel; Parisi, Virginia; Etcheverry, José Luis; Sanguinetti, Ana; Cordi, Lorena; Binelli, Adrian; Persi, Gabriel; Squitieri, Ferdinando

    2016-01-01

    We analyzed demographic, clinical and genetic characteristics of juvenile Huntington disease (JHD) and it frequency in an Argentinean cohort. Age at onset was defined as the age at which behavioral, cognitive, psychiatric or motor abnormalities suggestive of JHD were first reported. Clinical and genetic data were similar to other international series, however, in this context we identified the highest JHD frequency reported so far (19.72%; 14/71). Age at onset of JHD is challenging and still under discussion. Our findings reinforce the hypothesis that clinical manifestations, other than the typical movement disorder, may anticipate age at onset of even many years. Analyses of JHD cohorts are required to explore it frequency in populations with different backgrounds to avoid an underestimation of this rare phenotype. Moreover, data from selected populations may open new pathways in therapeutic approaches and may explain new potential correlations between HD presentations and environmental or biological factors.

  17. VCP associated inclusion body myopathy and paget disease of bone knock-in mouse model exhibits tissue pathology typical of human disease.

    Directory of Open Access Journals (Sweden)

    Mallikarjun Badadani

    Full Text Available Dominant mutations in the valosin containing protein (VCP gene cause inclusion body myopathy associated with Paget's disease of bone and frontotemporal dementia (IBMPFD. We have generated a knock-in mouse model with the common R155H mutation. Mice demonstrate progressive muscle weakness starting approximately at the age of 6 months. Histology of mutant muscle showed progressive vacuolization of myofibrils and centrally located nuclei, and immunostaining shows progressive cytoplasmic accumulation of TDP-43 and ubiquitin-positive inclusion bodies in quadriceps myofibrils and brain. Increased LC3-II staining of muscle sections representing increased number of autophagosomes suggested impaired autophagy. Increased apoptosis was demonstrated by elevated caspase-3 activity and increased TUNEL-positive nuclei. X-ray microtomography (uCT images show radiolucency of distal femurs and proximal tibiae in knock-in mice and uCT morphometrics shows decreased trabecular pattern and increased cortical wall thickness. Bone histology and bone marrow derived macrophage cultures in these mice revealed increased osteoclastogenesis observed by TRAP staining suggestive of Paget bone disease. The VCP(R155H/+ knock-in mice replicate the muscle, bone and brain pathology of inclusion body myopathy, thus representing a useful model for preclinical studies.

  18. Psychological Impact of Predictive Genetic Testing in VCP Inclusion Body Myopathy, Paget Disease of Bone and Frontotemporal Dementia.

    Science.gov (United States)

    Surampalli, Abhilasha; Khare, Manaswitha; Kubrussi, Georgette; Wencel, Marie; Tanaja, Jasmin; Donkervoort, Sandra; Osann, Kathryn; Simon, Mariella; Wallace, Douglas; Smith, Charles; M McInerney-Leo, Aideen; Kimonis, Virginia

    2015-10-01

    Inclusion Body Myopathy associated with Paget's disease of bone and Fronto-temporal Dementia, also known as multisystem proteinopathy is an autosomal dominant, late onset neurodegenerative disorder caused by mutations in Valosin containing protein (VCP) gene. This study aimed to assess uptake and decision making for predictive genetic testing and the impact on psychological well-being. Individuals who had participated in the gene discovery study with a 50 % a priori risk of inheriting VCP disease were sent a letter of invitation offering genetic counseling and testing and were also invited to participate in this psychosocial study. A total of 102 individuals received an invitation and 33 individuals participated in genetic counseling and testing (32.3 %) with 29 completing baseline questionnaires. Twenty completed the follow-up post-test Hospital Anxiety and Depression Scale questionnaire including 13 of the 18 who had tested positive. Mean risk perception at baseline was 50.1 %. Reasons for testing included planning for the future, relieving uncertainty, informing children and satisfying curiosity. At baseline, one quarter of the participants had high levels of anxiety. However, scores were normal one year following testing. In this small cohort, one third of individuals at 50 % risk chose pre-symptomatic testing. Although one quarter of those choosing testing had high anxiety at baseline, this was not evident at follow-up.

  19. A proposal for a TNM staging system for extramammary Paget disease: Retrospective analysis of 301 patients with invasive primary tumors.

    Science.gov (United States)

    Ohara, Kuniaki; Fujisawa, Yasuhiro; Yoshino, Koji; Kiyohara, Yoshio; Kadono, Takafumi; Murata, Yozo; Uhara, Hisashi; Hatta, Naohito; Uchi, Hiroshi; Matsushita, Shigeto; Takenouchi, Tatsuya; Hayashi, Toshihiko; Yoshimura, Kenichi; Fujimoto, Manabu

    2016-09-01

    Although extramammary Paget disease (EMPD) usually appears as carcinoma in situ, it sometimes becomes invasive (iEMPD) and fatal. However, a TNM staging system for iEMPD has yet to be established. The aim of this study was to establish a TNM staging system for iEMPD. We retrospectively collected iEMPD patients treated at 12 institutes in Japan. Factors reported to be associated with survival such as distant metastasis, lymph node (LN) metastasis, and primary tumor status were evaluated using the log-rank test. We enrolled 301 iEMPD patients, of whom 114 had remote metastases (49 had both distant and LN metastasis; 2, distant metastasis only; and 63, LN metastasis only) and the remaining 187 patients had no remote metastasis. Distant metastasis (M1) showed worse survival (PTNM staging system: stage I, T1N0M0; stage II, T2N0M0; stage IIIa, anyTN1M0; stage IIIb, anyTN2M0; stage IV, anyTanyNM1. Other than stages II and IIIa, each stage had a statistically distinct survival curve. We propose a TNM staging system for EMPD using simple factors for classification that could provide important prognostic information in managing EMPD. However, accumulation of more patient data and further revision of the system are required. Copyright © 2016 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  20. Inclusion body myopathy, Paget's disease of the bone and fronto-temporal dementia: a disorder of autophagy.

    Science.gov (United States)

    Ju, Jeong-Sun; Weihl, Conrad C

    2010-04-15

    Inclusion body myopathy associated with Paget's disease of the bone and fronto-temporal dementia (IBMPFD) is a progressive autosomal dominant disorder caused by mutations in p97/VCP (valosin-containing protein). p97/VCP is a member of the AAA+ (ATPase associated with a variety of activities) protein family and participates in multiple cellular processes. One particularly important role for p97/VCP is facilitating intracellular protein degradation. p97/VCP has traditionally been thought to mediate the ubiquitin-proteasome degradation of proteins; however, recent studies challenge this dogma. p97/VCP clearly participates in the degradation of aggregate-prone proteins, a process principally mediated by autophagy. In addition, IBMPFD mutations in p97/VCP lead to accumulation of autophagic structures in patient and transgenic animal tissue. This is likely due to a defect in p97/VCP-mediated autophagosome maturation. The following review will discuss the evidence for p97/VCP in autophagy and how a disruption in this process contributes to IBMPFD pathogenesis.

  1. Three-Directional Reconstruction of a Massive Perineal Defect after Wide Local Excision of Extramammary Paget's Disease

    Science.gov (United States)

    Cho, Seung Woo; Kwon, Sung Tack

    2016-01-01

    Extramammary Paget's disease (EMPD) is a rare, slow-growing intraepithelial malignancy that mainly involves the genital region, including the vulva, penis, scrotum, perianal, and periurethral areas. Although several treatment options exist, wide local excision with a safe margin is considered the treatment of choice. After resection of the lesion, it is often challenging to reconstruct the defect because defects in the perineal region require adequate volume for protection and are susceptible to infections, which is a particularly significant risk for large defects. We report a case of perivulvar EMPD that was reconstructed with three-directional local flaps after wide excision of the tumor. We covered the defect sequentially using the following 3 flaps: a gracilis myocutaneous flap from the left thigh, a bipedicled V-Y advancement flap from the lower abdomen, and an internal pudendal artery perforator-based island flap from the right buttock. To the best of our knowledge, this report is the first to describe a three-directional approach to extensive perivulvar reconstruction. PMID:27689055

  2. Serum cytokeratin 19 fragment 21-1 is a useful tumor marker for the assessment of extramammary Paget's disease.

    Science.gov (United States)

    Kato, Junji; Sumikawa, Yasuyuki; Hida, Tokimasa; Kamiya, Takafumi; Horimoto, Kohei; Kamiya, Shiori; Sato, Sayuri; Takahashi, Hitomi; Sawada, Masahide; Yamashita, Toshiharu

    2017-02-02

    Cytokeratin 19 fragment 21-1 (CYFRA 21-1) has been used as a tumor marker for several malignancies. However, to date, no studies have assessed whether CYFRA 21-1 could be a useful marker for extramammary Paget's disease (EMPD). The present study aimed to evaluate the significance of CYFRA 21-1 as a serum tumor marker for EMPD progression. Concentrations of serum CYFRA 21-1 and carcinoembryonic antigen (CEA) in 13 cases of EMPD were measured prior to undergoing treatment at Sapporo Medical University Hospital from January 2014 to May 2016. Four of the 13 patients had lymph node metastases at diagnosis, but none had distant metastases. Immunohistochemistry indicated that all 13 primary tumors and four metastatic tumors in lymph nodes were positive for cytokeratin 19. Although none of the 13 patients showed high serum CEA levels, six patients (46.2%) had elevated serum CYFRA 21-1. Furthermore, CYFRA 21-1 was reduced in association with post-treatment tumor reduction in all six patients. Among these six patients, four developed recurrence and metastasis during the follow-up period. CYFRA 21-1 was re-elevated in all four of these patients; however, serum CEA was elevated only in the patient with distant metastasis. These results suggest that CYFRA 21-1 is more sensitive compared with CEA, and can be useful as a tumor marker for evaluating tumor progression and treatment efficacy in patients with EMPD.

  3. Novel, near-infrared spectroscopic, label-free, techniques to assess bone abnormalities such as Paget's disease, osteoporosis and bone fractures

    Science.gov (United States)

    Sordillo, Diana C.; Sordillo, Laura A.; Shi, Lingyan; Budansky, Yury; Sordillo, Peter P.; Alfano, Robert R.

    2015-02-01

    Near- infrared (NIR) light with wavelengths from 650 nm to 950 nm (known as the first NIR window) has conventionally been used as a non-invasive technique that can reach deeper penetration depths through media than light at shorter wavelengths. Recently, several novel, NIR, label-free, techniques have been developed to assess Paget's disease of bone, osteoporosis and bone microfractures. We designed a Bone Optical Analyzer (BOA) which utilizes the first window to measure changes of Hb and HbO2. Paget's disease is marked by an increase in vascularization in bones, and this device can enable easy diagnosis and more frequent monitoring of the patient's condition, without exposing him to a high cumulative dose of radiation. We have also used inverse imaging algorithms to reconstruct 2D and 3D maps of the bone's structure. This device could be used to assess diseases such as osteoporosis. Using 800 nm femtosecond excitation with two-photon (2P) microscopy, we acquired 2PM images of the periosteum and spatial frequency spectra (based on emission of collagen) from the periosteal regions. This technique can provide information on the structure of the periosteum and can detect abnormalities which may be an indication of disease. Most recently, we showed that longer NIR wavelengths in the second and third NIR windows (1100 nm-1350 nm, 1600 nm-1870 nm), could be used to image bone microfractures. Use of NIR light could allow for repeated studies in patients with diseases such as Paget's and osteoporosis quickly and non-invasively, and could impact the current management for these diseases.

  4. Giant cell tumor occurring in familial Paget's disease of bone: report of clinical characteristics and linkage analysis of a large pedigree.

    Science.gov (United States)

    Gianfrancesco, Fernando; Rendina, Domenico; Merlotti, Daniela; Esposito, Teresa; Amyere, Mustapha; Formicola, Daniela; Muscariello, Riccardo; De Filippo, Gianpaolo; Strazzullo, Pasquale; Nuti, Ranuccio; Vikkula, Mikka; Gennari, Luigi

    2013-02-01

    Neoplastic degeneration represents a rare but serious complication of Paget's disease of bone (PDB). Although osteosarcomas have been described in up to 1% of PDB cases, giant cell tumors are less frequent and mainly occur in patients with polyostotic disease. We recently characterized a large pedigree with 14 affected members of whom four developed giant cell tumors at pagetic sites. The high number of affected subjects across multiple generations allowed us to better characterize the clinical phenotype and look for possible susceptibility loci. Of interest, all the affected members had polyostotic PDB, but subjects developing giant cell tumors showed an increased disease severity with a reduced clinical response to bisphosphonate treatment and an increased prevalence of bone pain, deformities, and fractures. Together with an increased occurrence of common pagetic complications, affected patients of this pedigree also evidenced a fivefold higher prevalence of coronary artery disease with respect to either the unaffected family members or a comparative cohort of 150 unrelated PDB cases from the same geographical area. This association was further enhanced in the four cases with PDB and giant cell tumors, all of them developing coronary artery disease before 60 years of age. Despite the early onset and the severe phenotype, PDB patients from this pedigree were negative for the presence of SQSTM1 or TNFRSF11A mutations, previously associated with enhanced disease severity. Genome-wide linkage analysis identified six possible candidate regions on chromosomes 1, 5, 6, 8, 10, and 20. Because the chromosome 8 and 10 loci were next to the TNFRSF11B and OPTN genes, we extended the genetic screening to these two genes, but we failed to identify any causative mutation at both the genomic and transcription level, suggesting that a different genetic defect is associated with PDB and potentially giant cell tumor of bone in this pedigree. Copyright © 2013 American Society for

  5. Genetic epidemiology of Paget's disease of bone in italy: sequestosome1/p62 gene mutational test and haplotype analysis at 5q35 in a large representative series of sporadic and familial Italian cases of Paget's disease of bone.

    Science.gov (United States)

    Falchetti, Alberto; Di Stefano, Marco; Marini, Francesca; Ortolani, Sergio; Ulivieri, Massimo Fabio; Bergui, Simona; Masi, Laura; Cepollaro, Chiara; Benucci, Maurizio; Di Munno, Ombretta; Rossini, Maurizio; Adami, Silvano; Del Puente, Antonio; Isaia, Giancarlo; Torricelli, Francesca; Brandi, Maria Luisa

    2009-01-01

    Families affected by Paget's disease of bone frequently harbor mutations in the SQSTM1/p62 gene. In this multicentric study we collected 345 sporadic and 12 familial PDB cases throughout Italy, identifying 12 different mutations, 5 of which are newly reported and 3, D335E, A381V, and Y383X, external to the UBA domain. Subjects with truncating mutations, E396X, showed a significantly younger age at clinical diagnosis, while the Y383X subjects had a higher average number of affected skeletal sites. All the mutants exhibited the CGTG-H2 haplotype. In two pairs and one triad of unrelated Italian PDB families from different Italian regions, we detected a common SQSTM1/p62 mutation for each P392L, M404V, and G425R group. Since the CGTG-H2 haplotype frequency was also high in normal subjects, and genetic influence due to migratory fluxes of different ethnic groups exists in the Italian population, to refine the search for a more geographically specific founder effect, we extended the haplotype analysis in these families using polymorphic microsatellite repeat markers, within and flanking the SQSTM1/p62 locus, from chromosome 5q35, other than the exon 6 and 3'UTR polymorphisms. All mutant carriers from two of the three M404V families and from the G425R families exhibited common extended chromosome 5q35 haplotypes, IT01 and IT02, respectively, which may be reflecting influences of past migrations. This may be helpful in estimating the true rate of de novo mutations. We confirm the data on the existence of both a mutational hotspot at the UBA domain of SQSTM1/p62 and a founder effect in the PDB population.

  6. Paget disease of bone-associated UBA domain mutations of SQSTM1 exert distinct effects on protein structure and function

    Science.gov (United States)

    Goode, Alice; Long, Jed E.; Shaw, Barry; Ralston, Stuart H.; Visconti, Micaela Rios; Gianfrancesco, Fernando; Esposito, Teresa; Gennari, Luigi; Merlotti, Daniela; Rendina, Domenico; Rea, Sarah L.; Sultana, Melanie; Searle, Mark S.; Layfield, Robert

    2014-01-01

    SQSTM1 mutations are common in patients with Paget disease of bone (PDB), with most affecting the C-terminal ubiquitin-associated (UBA) domain of the SQSTM1 protein. We performed structural and functional analyses of two UBA domain mutations, an I424S mutation relatively common in UK PDB patients, and an A427D mutation associated with a severe phenotype in Southern Italian patients. Both impaired SQSTM1's ubiquitin-binding function in pull-down assays and resulted in activation of basal NF-κB signalling, compared to wild-type, in reporter assays. We found evidence for a relationship between the ability of different UBA domain mutants to activate NF-κB signalling in vitro and number of affected sites in vivo in 1152 PDB patients from the UK and Italy, with A427D-SQSTM1 producing the greatest level of activation (relative to wild-type) of all PDB mutants tested to date. NMR and isothermal titration calorimetry studies were able to demonstrate that I424S is associated with global structural changes in the UBA domain, resulting in 10-fold weaker UBA dimer stability than wild-type and reduced ubiquitin-binding affinity of the UBA monomer. Our observations provide insights into the role of SQSTM1-mediated NF-κB signalling in PDB aetiology, and demonstrate that different mutations in close proximity within loop 2/helix 3 of the SQSTM1 UBA domain exert distinct effects on protein structure and stability, including indirect effects at the UBA/ubiquitin-binding interface. PMID:24642144

  7. 手术治愈巨大乳房外Paget病%Successful surgical treatment of a case of giant extramammary Paget's disease

    Institute of Scientific and Technical Information of China (English)

    吴信峰; 王强

    2012-01-01

    报告1例发生于阴囊、阴茎、阴阜以及腹股沟区的巨大乳房外Paget病.患者男,68岁.阴囊、阴茎及阴部出现红色浸润性斑块5年余.组织病理提示:表皮角化过度,棘层增生肥厚,表皮全层及毛囊内见单个或成巢的Paget样细胞,部分肿瘤细胞沿毛囊上皮及汗腺导管侵及真皮深部,真皮浅层见大量淋巴细胞浸润.诊断:乳房外Paget病.因肿瘤侵及外阴部范围广,切除面积较大,外阴部巨大缺损分别采用局部皮瓣与植皮相结合的方法成功修复.%We report a case of giant extramammary Paget's disease on scrotum, penis, mons pubis and groin. A 68-year-old male patient presented with of infiltrating erythematous plaques on his scrotum, penis and perineal region for 5 years. Histopathology showed that epidermis was hyperkeratotic and hyperplastic. Paget cells were observed in all layers of epidermis and hair follicles, and invaded into deep dermis along the hair follicles and ducts of sweat glands. Large number of lymphocytes infiltrated the superficial layer of dermis. The diagnosis was extramammary Paget s disease. Skin flap in combination with skin grafting were adopted after extensive excision of skin lesions.

  8. Calcitonin treatment in osteoectasia with hyperphosphatasia (juvenile Paget's disease): radiographic changes after treatment

    Energy Technology Data Exchange (ETDEWEB)

    Tueysuez, B. [Div. of Genetics and Teratology, Univ. of Istanbul (Turkey); Serencebey, Istanbul (Turkey); Mercimek, S.; Uenguer, S. [Dept. of Paediatrics, Univ. of Istanbul (Turkey); Deniz, M. [Dept. of Paediatrics, Haseki Hospital, Istanbul (Turkey)

    1999-11-01

    Osteoectasia with hyperphosphatasia is a rare skeletal disorder, characterised by demineralisation and expansion of tubular bones and elevated serum alkaline phosphatase. We present a girl diagnosed as having osteoectasia with hyperphosphatasia who had swelling of phalanges of both hands and motor retardation. She was treated with synthetic human calcitonin. Clinical and radiological findings showed remarkable improvement after 2 years' treatment. (orig.)

  9. Clinical presentation of juvenile Huntington disease

    Directory of Open Access Journals (Sweden)

    Ruocco Heloísa H.

    2006-01-01

    Full Text Available OBJECTIVE: To describe the clinical presentation a group of patients with juvenile onset of Huntington disease. METHOD: All patients were interviewed following a structured clinical questioner. Patients were genotyped for the trinucleotide cytosine-adenine-guanine (CAG repeat in the Huntington Disease gene. High resolution brain MRI was performed in all patients. RESULTS: We identified 4 patients with juvenile onset of disease among 50 patients with Huntington disease followed prospectively in our Neurogenetics clinic. Age at onset varied from 3 to 13 years, there were 2 boys, and 3 patients had a paternal inheritance of the disease. Expanded Huntington disease allele sizes varied from 41 to 69 trinucleotide repeats. The early onset patients presented with rigidity, bradykinesia, dystonia, dysarthria, seizures and ataxia. MRI showed severe volume loss of caudate and putamen nuclei (p=0.001 and reduced cerebral and cerebellum volumes (p=0.01. CONCLUSION: 8% of Huntington disease patients seen in our clinic had juvenile onset of the disease. They did not present with typical chorea as seen in adult onset Huntington disease. There was a predominance of rigidity and bradykinesia. Two other important clinical features were seizures and ataxia, which related with the imaging findings of early cortical atrophy and cerebellum volume loss.

  10. The implications of the Sequestosome 1 mutation P392L in patients with Paget's disease in a United States cohort

    Science.gov (United States)

    Seton, Margaret; Hansen, Marc; Solomon, Daniel H.

    2016-01-01

    Background Paget's disease of bone (PDB) is associated with a germline mutation in Sequestosome1 /p62 (SQSTM1) found in ≤ 16% of sporadic cases worldwide, and in 19-46% of those studied with familial PDB. The P392L is the most prevalent mutation identified to date. This mutation by itself does not confer PDB or define the phenotype of PDB in a given person. Environmental determinants remain elusive, although increasing age of the individual, other gene polymorphisms in the context of SQSTM1 mutations, and measles virus have been implicated. Measles exposure has been unexamined in this context. Objectives The goal of this study is to compare the background history and phenotype of patients with PDB carrying the SQSTM1 P392L mutation to those patients without. Focusing on age, ancestry, P329L mutation, family history, measles exposure, distribution of PDB and age of onset, we examined outcomes at 10 years. We postulated that aging may play a role in defining phenotype, and that this may become more visible in a well characterized cohort. Methods This is an observational study focused on a cohort of patients with PDB drawn from the New England Registry in whom environmental and family history has been catalogued, linked to radiographic data. Of the 217 persons who were enrolled in the Registry, 42 (19%) responded to a letter inviting them to participate in testing for the presence of the measles antibody, and in genetic testing for the P392L mutation. Results The mean age of the cohort in 2001 was 70 years (range 55-79); 27 were men (64%). The measles antibody was found in all cases tested. Nine patients had the P392L mutation (21%), 2 with familial PDB. In these persons, early diagnosis of disease and spinal stenosis marked the male phenotype only. European ancestry was noted in the minority of those with P392L mutation. Most deaths recorded occurred in the 9th decade of life or later. Conclusions Spinal stenosis emerges as a prominent phenotype in SQSTM1 P392L

  11. Management of Adenocarcinoma in the Setting of Recently Operated Perianal Paget's Disease

    Directory of Open Access Journals (Sweden)

    Margaret E. Clark

    2013-01-01

    Full Text Available Perianal Paget’s disease only rarely presents with a synchronous invasive anal or rectal cancer. The purpose of this study is to present a case of an otherwise healthy patient who developed perianal Paget’s disease. He was then found to have an invasive rectal adenocarcinoma, after having undergone an extensive resection and reconstruction with a bilateral V-to-Y reconstruction. This report describes an overview of perianal Paget’s disease, the management of this disease in association with anal or rectal cancer, and our patient’s outcome.

  12. A case report of juvenile Huntington disease

    Directory of Open Access Journals (Sweden)

    Anita Choudhary

    2017-09-01

    Full Text Available Huntington disease (HD is a progressive neurodegenerative disorder, characterized by autosomal dominant inheritance, movement disorder, dementia, and behavioural disturbances. It is caused by a mutation in IT15 gene on chromosome 4p16.3, which leads to unstable CAG trinucleotide repeat expansion. The onset of juvenile HD occurs before the 2nd decade of life and comprises approximately 10% of total HD patients. Juvenile HD differs in symptomatology and is usually transmitted from paternal side with genetic anticipation phenomenon. Magnetic resonance imaging (MRI of the brain shows specific changes of early affection of caudate nucleus and putamen. Multidisciplinary approach with symptomatic treatment of specific symptoms is the current available management. Gene editing and gene silencing treatment are under trial. Hereby, we introduce a case of an 8-year-old boy, who presented with typical symptoms of juvenile HD, positive family history with genetic anticipation phenomenon and characteristic MRI findings.

  13. Evaluation of /sup 99m/Tc diphosphonate kinetics and bone scans in patients with Paget's disease before and after calcitonin treatment

    Energy Technology Data Exchange (ETDEWEB)

    Waxman, A.D.; Ducker, S.; McKee, D.; Siemsen, J.K.; Singer, F.R.

    1977-12-01

    Eleven patients with Paget's disease of bone underwent serial total body bone scans before and after therapy with calcitonin. All patients studied showed improvement clinically as well as biochemically. Scan improvement was noted in patients with mild disease. Patients with severe disease showed either no change or only slight improvement on the serial bone scans. The scan was of greatest value in determining the extent of disease, especially in 3 patients in whom biochemical values were normal. A single pulse injection of 50 M.R.C. units of salmon calcitonin produced a significant increase in the blood clearance of /sup 99m/Tc diphosphonate. The mechanism of this effect is not clear from this study.

  14. Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone

    Science.gov (United States)

    2014-10-01

    November 25, 2013. Accepted manuscript online December 11, 2013. Address correspondence to: G David Roodman , MD, PhD, Department of Medicine, Hematology...Yukiko Kitagawa,1 Deborah L Galson,4 David W Dempster,2 Jolene J Windle,3 Noriyoshi Kurihara,1 and G David Roodman1,5 1Department of Medicine, Hematology...turnover in Paget’s disease of bone. Clin Orthop. 1987;217:26–36. 3. Siris ES, Roodman GD. Paget’s Disease of Bone, Primer on the Metabolic Bone Diseases

  15. Role of ATF7-TAF12 interactions in the vitamin D response hypersensitivity of osteoclast precursors in Paget's disease.

    Science.gov (United States)

    Teramachi, Jumpei; Hiruma, Yuko; Ishizuka, Seiichi; Ishizuka, Hisako; Brown, Jacques P; Michou, Laëtitia; Cao, Huiling; Galson, Deborah L; Subler, Mark A; Zhou, Hua; Dempster, David W; Windle, Jolene J; Roodman, G David; Kurihara, Noriyoshi

    2013-06-01

    Osteoclast (OCL) precursors from many Paget's disease (PD) patients express measles virus nucleocapsid protein (MVNP) and are hypersensitive to 1,25-dihydroxyvitamin D₂ (1,25-(OH)₂D₃; also know as calcitriol). The increased 1,25-(OH)₂D₃ sensitivity is mediated by transcription initiation factor TFIID subunit 12 (TAF12), a coactivator of the vitamin D receptor (VDR), which is present at much higher levels in MVNP-expressing OCL precursors than normals. These results suggest that TAF12 plays an important role in the abnormal OCL activity in PD. However, the molecular mechanisms underlying both 1,25-(OH)₂D₃'s effects on OCL formation and the contribution of TAF12 to these effects in both normals and PD patients are unclear. Inhibition of TAF12 with a specific TAF12 antisense construct decreased OCL formation and OCL precursors' sensitivity to 1,25-(OH)₂D₃ in PD patient bone marrow samples. Further, OCL precursors from transgenic mice in which TAF12 expression was targeted to the OCL lineage (tartrate-resistant acid phosphatase [TRAP]-TAF12 mice), formed OCLs at very low levels of 1,25-(OH)₂D₃, although the OCLs failed to exhibit other hallmarks of PD OCLs, including receptor activator of NF-κB ligand (RANKL) hypersensitivity and hypermultinucleation. Chromatin immunoprecipitation (ChIP) analysis of OCL precursors using an anti-TAF12 antibody demonstrated that TAF12 binds the 24-hydroxylase (CYP24A1) promoter, which contains two functional vitamin D response elements (VDREs), in the presence of 1,25-(OH)₂D₃. Because TAF12 directly interacts with the cyclic adenosine monophosphate-dependent activating transcription factor 7 (ATF7) and potentiates ATF7-induced transcriptional activation of ATF7-driven genes in other cell types, we determined whether TAF12 is a functional partner of ATF7 in OCL precursors. Immunoprecipitation of lysates from either wild-type (WT) or MVNP-expressing OCL with an anti-TAF12 antibody, followed by blotting with an

  16. Facts a New Patient Needs to Know about Paget's Disease of Bone

    Science.gov (United States)

    ... Your Doctor (NIA) Conversando con su médico (NIA) Sea miembro activo del equipo de cuidados de la Salud (FDA) '); docprint.document.close(); docprint.focus(); */ } //--> Print-Friendly Page May 2015 What Is Paget’s Disease of Bone? Paget’s ...

  17. Protocol for stage 1 of the GaP study (Genetic testing acceptability for Paget's disease of bone: an interview study about genetic testing and preventive treatment: would relatives of people with Paget's disease want testing and treatment if they were available?

    Directory of Open Access Journals (Sweden)

    Marteau Theresa M

    2006-06-01

    Full Text Available Abstract Background Paget's disease of bone (PDB is characterised by focal increases in bone turnover, affecting one or more bones throughout the skeleton. This disrupts normal bone architecture and causes pain, deformity, deafness, osteoarthritis, and fractures. Genetic factors are recognised to play a role in PDB and it is now possible to carry out genetic tests for research. In view of this, it is timely to investigate the clinical potential for a programme of genetic testing and preventative treatment for people who have a family history of PDB, to prevent or delay the development of PDB. Evidence from non-genetic conditions, that have effective treatments, demonstrates that patients' beliefs may affect the acceptability and uptake of treatment. Two groups of beliefs (illness and treatment representations are likely to be influential. Illness representations describe how people see their illness, as outlined in Leventhal's Self-Regulation Model. Treatment representations describe how people perceive potential treatment for their disease. People offered a programme of genetic testing and treatment will develop their own treatment representations based on what is offered, but the beliefs rather than the objective programme of treatment are likely to determine their willingness to participate. The Theory of Planned Behaviour is a theoretical model that predicts behaviours from people's beliefs about the consequences, social pressures and perceived control over the behaviour, including uptake of treatment. Methods/design This study aims to examine the acceptability of genetic testing, followed by preventative treatment, to relatives of people with PDB. We aim to interview people with Paget's disease, and their families, from the UK. Our research questions are: 1. What do individuals with Paget's disease think would influence the involvement of their relatives in a programme of genetic testing and preventative treatment? 2. What do relatives of

  18. Enfermedad de Paget extramamaria perianal Extrammary Paget - perianal carcinoma

    Directory of Open Access Journals (Sweden)

    N Grinspan Bozza

    2010-12-01

    Full Text Available Presentamos el caso de un paciente de sexo masculino de 60 años de edad, con enfermedad de Paget extramamaria primaria cutánea, de localización perianal, extensa, de un año y medio de evolución. Se describen los hallazgos clínicos, histológicos, inmunohistoquímicos y tratamientos de elección. Se destaca que a través de la clínica, se debe realizar un diagnóstico precoz y se remarca la importancia de efectuar, una búsqueda exhaustiva de neoplasias internas próximas a la lesión cutánea.We report a 60 year-old male patient with and extense perianal primary cutaneous extramamary Paget´s disease which began one and half years before. We also describe its clinical, histological, inmunohistochemical and treatments options. To remark the importance of an exhaustive search of internal tumours with regional proximity to the lesion.

  19. Spinal-cord syndrome due to non-compressive Paget's disease of bone: a spinal-artery steal phenomenon reversible with calcitonin.

    Science.gov (United States)

    Herzberg, L; Bayliss, E

    1980-07-05

    A 76-year-old man had progressive low back pain, leg weakness, and sensory loss. Radiology showed changes consistent with wide-spread Paget's disease, but no cord compression or involvement of nerve roots was detected by myelography or computerised axial tomography. His symptoms were relieved within 12 days of starting 100 MRC units of subcutaneous salmon calcitonin and recurred when calcitonin was discontinued for 5 days. The improvement continued on calcitonin treatment for 1 year, with falls in serum alkaline phosphatase and urinary hydroxyproline excretion. It is suggested that calcitonin treatment, in reducing the abnormally high metabolic activity of the diseased bone, and hence its vascular perfusion, allows more blood to reach the spinal cord.

  20. Dynamic contrast-enhanced MRI in Paget's disease of bone-correlation of regional microcirculation and bone turnover

    Energy Technology Data Exchange (ETDEWEB)

    Libicher, M. [University of Cologne, Department of Radiology, Cologne (Germany); Klinikum der Universitaet zu Koeln, Radiologische Klinik, Koeln (Germany); Kasperk, C. [University of Heidelberg, Department of Medicine, Division of Osteology, Heidelberg (Germany); Daniels, M.; Hosch, W. [University of Heidelberg, Department of Radiology, Heidelberg (Germany); Kauczor, H.U.; Delorme, S. [German Cancer Research Center, Department of Radiology, Heidelberg (Germany)

    2008-05-15

    The purpose of this study was to evaluate regional microcirculation in Paget's disease of bone (PD) with dynamic contrast-enhanced MR imaging (DCE-MRI). Additionally, we correlated regional bone perfusion with alkaline phosphatase as serum marker of bone turnover. We examined 71 patients with PD (27 men, 44 women, 67{+-}10 years) localized at the axial and appendicular skeleton. Contrast uptake was analyzed using a two-compartment model with the output variables amplitude A and exchange rate constant k{sub ep}. Color-coded parametric images were generated to visualize microcirculation. Serum levels of alkaline phosphatase (AP) were compared with DCE-MRI parameters. Amplitude A and exchange rate constant k{sub ep} were significantly increased in PD compared to unaffected bone (A{sub PD} 0.81{+-}0.24 vs. A{sub control} 0.34{+-}0.1 and k{sub ep} {sub PD} 4.0 {+-}2.86 vs. k{sub ep} {sub control} 1.73 {+-}0.88, p <0.001). There was a significant correlation (r{sub s}=0.5-0.7) of DCE-MRI parameters and AP at the axial (pelvis, spine) and appendicular skeleton (femur, tibia). The long bones showed increased circulation of the advancing peripheral zones and no vascularization of the central part, which had been replaced by fatty tissue. Regional microcirculation in PD is inhomogeneous with focal areas of excessive hypervascularity, especially in the advancing peripheral zone. There is a significant correlation of bone circulation and bone turnover in PD. DCE-MRI might therefore be a diagnostic tool for monitoring therapeutic effects of bisphoshonates in Paget's disease of bone. (orig.)

  1. 畸形性骨炎八例的临床诊治分析%Diagnosis and treatment for 8 cases with Paget disease

    Institute of Scientific and Technical Information of China (English)

    鲍春华; 章振林

    2012-01-01

    目的 对8例畸形性骨炎患者的临床诊治情况进行分析,旨在提高对该病的认识.方法 确诊的畸形性骨炎患者8例,比较其临床表现、X线片特征、骨转换生化指标及用二膦酸盐治疗的情况.结果 男5例,女3例,年龄46~76岁,平均年龄为(60.0±12.2)岁.病程1~15年,平均病程为(5.1±5.0)年.临床症状表现为受累骨骼疼痛7例,其中2例伴小腿皮温升高.病变范围:单骨性损害3例,多处骨骼受累4例,1例未能明确.病变累及部位以骨盆、股骨和脊柱最常见,其次为头颅、胫骨、腓骨和肱骨.X线片显示受损骨的骨小梁结构粗大和紊乱、皮质显著增厚、髓腔缩小及骨骼变形等典型的Paget's骨损害.骨扫描检查显示,受累骨骼的核素异常浓聚.8例患者的血清碱性磷酸酶(ALP)水平为93~1 366 U/L,中位数为326 U/L,其中1例患者的血清ALP水平在正常范围内.7例患者予二膦酸盐治疗,3个月后疼痛缓解,活动功能改善,血清ALP水平下降显著,疗效明显.结论 畸形性骨炎在我国罕见,常被误诊.X线摄片和骨核素扫描等影像学检查的表现结合骨转换生化指标的显著改变是诊断的重要依据,经静脉途径应用二膦酸盐治疗的疗效显著.%Objective To retrospectively analyze the diagnosis and treatment for 8 patients with Paget disease, so as to enhance the understanding of the disease. Methods Eight patients were diagnosed as Paget disease and were enrolled in this study. The clinical manifestations, X-ray features, biochemical marker of bone turnover and bisphosphonates treatment were evaluated. Results There were 5 males and 3 females with an average age of (60.0± 12.2) years (range 46-76 years). The average course of disease was (5.1 ±5.0) years (range 1-15 years). Pain, deformity of the involved bones were seen in seven cases, and local skin temperature increase was found in two of them. There were 3 patients with single bone lesion and 4

  2. Managing juvenile Huntington’s disease

    OpenAIRE

    Quarrell, Oliver W. J.; Nance, Martha A.; Nopoulos, Peggy; Paulsen, Jane S.; Smith, Jonathan A.; Squitieri, Ferdinando

    2013-01-01

    Huntington’s disease (HD) is a well-recognized progressive neurodegenerative disorder that follows an autosomal dominant pattern of inheritance. Onset is insidious and can occur at almost any age, but most commonly the diagnosis is made between the ages of 35 and 55 years. Onset ≤20 years of age is classified as juvenile HD (JHD). This age-based definition is arbitrary but remains convenient. There is overlap between the clinical pathological and genetic features seen in JHD and more traditio...

  3. Enfermedad de Paget perianal

    OpenAIRE

    POLANCO,DIEGO; MANZANEDO,ISRAEL; EL BOUAYADI,LILIAM; NÚÑEZ,GEMA; TARTAS,AUREA

    2010-01-01

    La enfermedad de Paget de localización extramamaria (EPEM) es una patología infrecuente que afecta preferentemente a zonas perianal y vulvar en pacientes de ambos sexos y desde la sexta década de vida. Presentamos un caso clínico tratado en conjunto por los Servicios de Cirugía General, Cirugía Plástica, Ginecología y Anatomía Patológica del Hospital Universitario de Getafe.

  4. Role of imaging in the investigation of a painful Paget's bone (excluding axial sites)

    Energy Technology Data Exchange (ETDEWEB)

    Martin, B.; Tordjman, G.; Tubiana, J.M.

    1988-01-01

    Several possible aetiologies should be considered in a patient with Paget's disease presenting with pain: sarcomatous degeneration, metastasis in a pagetic bone, lymphoma, cortical fracture or cortical fissure, site of osteomyelitis, osteoarthrosis of the hip or even an active episode of Paget's disease. These different causes are recalled and the strategic role of radiological investigation in the discussion is stressed.

  5. Demonstration of characteristic skin surface contours of extramammary Paget's disease and parapsoriasis en plaque by image analysis of negative impression replicas.

    Science.gov (United States)

    Kikuchi, Katsuko; Aiba, Setsuya; O'Goshi, Ken-ichiro; Yanai, Motohiro; Takahashi, Motoji; Kasai, Hidefumi; Tagami, Hachiro

    2002-10-01

    The surface contours of lesional skin of certain skin diseases, such as parapsoriasis en plaque (PEP) and extramammary Paget's disease (EMPD), in which there is a massive infiltration by non-epidermal cells, looks somewhat different from that of the adjacent normal skin, needless to state that they are apparently different from that of ordinary chronic inflammatory dermatoses where we found acanthotic epidermis accompanied by hyperkeratosis. We attempted to objectively characterize these unique skin surface changes qualitatively and quantitatively using non-invasive methods. Negative impression replicas were taken from the lesional skin of patients with EMPD or PEP as well as from the adjacent uninvolved skin. The findings were confirmed histologically. The replicas were examined by using computerized image analysis. Several parameters were analyzed that correlate with the changes in the anisotropy of the skin furrows (VC1), average skin roughness (KSD), average length of skin furrows (LEN), and number of skin furrows (NUM). There were significant decreases in KSD and NUM in EMPD, indicating a smoother skin surface in the lesional skin than in the adjacent normal skin. In contrast, the PEP lesion had an increase in VC1 and LEN and a decrease in NUM, which suggests larger skin ridges in the lesional skin than in the uninvolved skin. Thus the unique skin surface of the cutaneous disorders accompanied by epidermal invasion by non-epidermal cells, such as EMPD and PEP, was characterized both qualitatively and quantitatively using computerized image analysis of negative impression replicas.

  6. Juvenile autoimmune hepatitis: Spectrum of the disease

    Institute of Scientific and Technical Information of China (English)

    Giuseppe; Maggiore; Silvia; Nastasio; Marco; Sciveres

    2014-01-01

    Juvenile autoimmune hepatitis(JAIH) is a progressive inflammatory liver disease, affecting mainly young girls, from infancy to late adolescence, characterized by active liver damage, as shown by high serum activity of aminotransferases, by elevated immunoglobulin G levels, high titers of serum non organ-specific andorgan-specific autoantibodies, and by interface hepatitis on liver biopsy. It is a multifactorial disease of unknown etiology in which environmental factors act as a trigger in genetically predisposed individuals. Two types of JAIH are identified according to the autoan-tibody panel detected at diagnosis: AIH-1, characterized by the presence of anti-smooth muscle antibody and/or antinuclear antibody and AIH-2, by anti-liver-kidney microsomal antibody type 1 and/or by the presence of anti-liver cytosol type 1 antibody. Epidemiological distribution, genetic markers, clinical presentation and pattern of serum cytokines differentiate the two types of AIH suggesting possible pathogenetic mechanisms. The most effective therapy for AIH is pharmacological suppression of the immune response. Treatment should be started as soon as the diagnosis is made to avoid severe liver damage and progression of fibrosis. The aim of this review is to outline the most significant and peculiar features of JAIH, based largely on our own personal database and on a review of current literature.

  7. Pathologie des Morbus Paget

    Directory of Open Access Journals (Sweden)

    Sulzbacher I

    2012-01-01

    Full Text Available Der Morbus Paget (MP ist eine fortschreitende, mono- oder polyostotische Knochenerkrankung mit pathologischem Remodeling, gekennzeichnet durch umschriebenen Knochenabbau mit Riesenosteoklasten und darauffolgendem unkoordiniertem Knochenaufbau. Die Erkrankung tritt generell nach dem 50. Lebensjahr auf und entspricht nach der Osteoporose der zweithäufigsten metabolischen Osteopathie. Im Mittelpunkt der heutigen ätiopathogenetischen Überlegungen stehen genetische Veränderungen, und zwar Mutationen, welche den osteoklastären RANK-NF-κB-Signalweg beeinträchtigen, sowohl bei Patienten mit familiärem als auch sporadischem MP. Inwieweit diese Mutationen eine kausale Rolle spielen oder lediglich zu einer gesteigerten bzw. abnormen Suszeptibilität gegenüber Umweltfaktoren wie Viren und anderen exogenen Noxen führen, bleibt jedoch weiter zu klären.

  8. Managing juvenile Huntington’s disease

    Science.gov (United States)

    Quarrell, Oliver W. J.; Nance, Martha A.; Nopoulos, Peggy; Paulsen, Jane S.; Smith, Jonathan A.; Squitieri, Ferdinando

    2013-01-01

    SUMMARY Huntington’s disease (HD) is a well-recognized progressive neurodegenerative disorder that follows an autosomal dominant pattern of inheritance. Onset is insidious and can occur at almost any age, but most commonly the diagnosis is made between the ages of 35 and 55 years. Onset ≤20 years of age is classified as juvenile HD (JHD). This age-based definition is arbitrary but remains convenient. There is overlap between the clinical pathological and genetic features seen in JHD and more traditional adult-onset HD. Nonetheless, the frequent predominance of bradykinesia and dystonia early in the course of the illness, more frequent occurrence of epilepsy and myoclonus, more widespread pathology, and larger genetic lesion means that the distinction is still relevant. In addition, the relative rarity of JHD means that the clinician managing the patient is often doing so for the first time. Management is, at best, symptomatic and supportive with few or no evidence-based guidelines. In this article, the authors will review what is known of the condition and present some suggestions based on their experience. PMID:24416077

  9. Early onset Paget's disease of bone caused by a novel mutation (78dup27) of the TNFRSF11A gene in a Chinese family

    Institute of Scientific and Technical Information of China (English)

    Yao-hua KE; Hua YUE; Jin-wei HE; Yu-juan LIU; Zhen-lin ZHANG

    2009-01-01

    Aim: A previous study showed that individuals of Japanese descent affected by early onset familial Paget's disease of bone (PDB) car-ried a 27-bp duplication at position 75 (75dup27) in the TNFRSF11A gene encoding RANK. Here we report the identification of a novel mutation (78dup27) in exon 1 of TNFRSF11A in a Chinese family with early onset PDB. Methods: We conducted clinical and genetic studies in a non-consanguineous Chinese family with early onset PDB. The entire coding region of TNFRSF11A was amplified and directly sequenced directly.Results: A novel 27-bp duplication in exon 1 (78dup27) in TNFRSF11A was found in four affected individuals and one asymptomatic individual. Although this duplication was the same length as the previously identified mutation (27 bp, from bases 78 to 104), in our patients the nine duplicated amino acids in the RANK signal peptide were LLLLCALLA. The phenotypes of affected individuals in this family overlapped with both early onset PDB and classic PDB, but several distinguishing features were found in our patients. The key difference between our familial PDB and the Japanese early onset PDB was the age of onset, which in most of our patients was during their late 20s (except for the propositus' niece). Another notable difference was that the propositus' son (24 years old), who carried the 78dup27 mutation, had no clinical symptoms or bone abnormalities, except for increased serum ALP, OC and CTX.Conclusion: Our findings may provide a better understanding of the clinical features of early onset PDB and support the notion of a hot spot for mutations in exon 1 of the TNFRSF11A gene.

  10. Juvenile Huntington's disease: a case report and literature review.

    Science.gov (United States)

    Reyes Molón, L; Yáñez Sáez, R M; López-Ibor Alcocer, M I

    2010-01-01

    Huntington's disease is the most frequent neurodegenerative disease with a prevalence of fewer than 10 cases per 10,000 inhabitants; the juvenile form is responsible for less than 10% of all cases. Huntington's disease belongs to the group known as "triad syndromes," which evolve with cognitive, motor and neuropsychiatric manifestations. Around 30% of patients debut with behavioral symptoms, which are a major challenge for management by patients, families, and caregivers. Huntington's disease (HD) is reviewed and a case of juvenile onset is reported in this article. The characteristics of juvenile-onset Huntington's disease (HD) differ from those of adult-onset HD, as chorea does not occur, although bradykinesia, dystonia, and signs of cerebellar disorder, such as rigidity, are present, frequently in association with convulsive episodes and psychotic manifestations.

  11. Juvenile chronic arthritis and coeliac disease in the Netherlands

    NARCIS (Netherlands)

    George, EK; HertzbergertenCate, R; vanSuijlekomSmit, LWA; vonBlomberg, BME; Stapel, SO; vanElburg, RM; Mearin, ML

    1996-01-01

    Objective. It has been suggested that juvenile chronic arthritis (JCA) is associated with coeliac disease in a frequency of 0.4-2%. In order to investigate the frequency of coeliac disease in cases of JCA and the possibility of underdiagnosis in our area, we screened 62 children with JCA (mean age

  12. Juvenile polyarteritis nodosa associated with toxoplasmosis presenting as Kawasaki disease.

    Science.gov (United States)

    Başaran, Özge; Çakar, Nilgün; Gür, Gökçe; Kocabaş, Abdullah; Gülhan, Belgin; Çaycı, Fatma Şemsa; Çelikel, Banu Acar

    2014-04-01

    Polyarteritis nodosa (PAN) is a vasculitis characterized by inflammatory necrosis of medium-sized arteries. Juvenile PAN and Kawasaki disease (KD) both cause vasculitis of the medium-sized arteries, and share common features. They have overlapping clinical features. Treatment should be managed according to the severity of symptoms and persistence of clinical manifestations. Herein is described the case of a 14-year-old boy first diagnosed with KD, who then fulfilled the criteria for juvenile PAN due to the development of severe myalgia, persistent fever, polyneuropathy and coronary arterial dilatation. He also had acute toxoplasmosis at the onset of vasculitis symptoms. The final diagnosis was of juvenile PAN associated with toxoplasmosis infection. Toxoplasma infection can be considered as an etiological agent for PAN and other vasculitis syndromes. Awareness of toxoplasmosis-related PAN facilitates early diagnosis, and instigation of appropriate treatment.

  13. [Juvenile Pompe disease: retrospective clinical study].

    Science.gov (United States)

    Loureiro Neves, Filipa; Garcia, Paula Cristina; Madureira, Núria; Araújo, Henriqueta; Rodrigues, Fidjy; Estêvão, Maria Helena; Lacerda, Lúcia; Diogo Matos, Luísa Maria

    2013-01-01

    Introdução: A doença de Pompe ou glicogenose tipo II é uma doença autossómica recessiva por deficiência de maltase ácida. É uma entidade rara, com prevalência de 1/40.000 nas populações holandesa e afro-americana e 1/46000 na população australiana. Embora se distingam três formas de apresentação (infantil, juvenil e do adulto), observa-se um amplo espectro clínico. Em Portugal está disponível terapêutica enzimática de substituição desde 2006.Material e Métodos: Fez-se o estudo retrospetivo de quatro doentes (duas das quais irmãs), baseado na revisão dos processos clínicos.Resultados: Em todas, a doença manifestou-se no segundo ano de vida. O tempo até ao diagnóstico variou entre dois e onze anos. Aquando do diagnóstico, todas apresentavam miopatia com atraso de aquisições motoras e em duas havia hipertrofia miocárdica. A suspeita clínica surgiu por insuficiência respiratória em contexto infeccioso em duas doentes. Em todas havia elevação da creatina quinase e das aminotransferases. Todas evoluíram com insuficiência respiratória crónica por síndrome restritiva. O diagnóstico foi baseado na diminuição da atividade da maltase ácida em fibroblastos (0 a 1,5% do limite inferior do normal). Na biópsia muscular, realizada em três doentes, demonstrou-se acumulação lisossómica de glicogénio. Todas apresentavam a mutação c.1064T > C no exão 6 do gene GAA (glucosidase-alpha-acid), em homozigotia numa delas, associada às mutações c.1666A > G no exão 12 e c.2065G > A no exão 15 nas duas irmãs e à mutação c.380G > T no exão 2 na doente mais nova. Todas iniciaram terapia enzimática de substituiçãologo que disponível, com boa tolerância. A doente mais jovem faleceu pouco depois. As outras mantêm medidas de suporteventilatório e fisioterapia, deslocando-se a mais velha, em cadeira de rodas, mantendo a irmã marcha independente e necessitando a mais nova de andarilho.Conclusão: Os nossos casos incluem

  14. Paget disease of the bone

    Science.gov (United States)

    ... may develop a cancer of the bone called osteosarcoma. Some people will need joint replacement surgery. Possible ... any medical emergency or for the diagnosis or treatment of any medical condition. A licensed physician should ...

  15. Paget Disease of the Breast

    Science.gov (United States)

    ... Breast Cancer Breast Cancer Patient Breast Cancer Treatment Male Breast Cancer Treatment Breast Cancer Treatment & Pregnancy Breast Cancer Prevention Breast Cancer Screening Health Professional Breast Cancer Treatment Male ... Treatment Breast Cancer Treatment & Pregnancy Breast Cancer Prevention ...

  16. [Juvenile rheumatoid artritis (a single or various diseases?].

    Science.gov (United States)

    Frati Munari, A C; Criollos Torres, O; Flores Suárez, R E

    1977-01-01

    Some characteristics of juvenile rheumatoid arthritis that appeared in recent literature have led us to think that it can be divided into the following four groups: I. Seronegative poliarthritis, with more or less systemic symptoms. With the same characteristics it may appear in adulthood. II. Seropositive poliarthritis, identical to the adult rheumatoid arthritis. III. B-27 negative oligoarthritis, complicated frequently with chronic uveitis and autolimited course. IV. B-27 positive oligoarthritis evolving to ankylosing spondylitis. These groups may represent different diseases.

  17. Dermatomyositis (Juvenile)

    Science.gov (United States)

    ... Am A Patient / Caregiver Diseases & Conditions Dermatomyositis (Juvenile) Dermatomyositis (Juvenile) Fast Facts Patients with JDM have varying ... What are common signs and symptoms of juvenile dermatomyositis? The most common signs and symptoms of JDM ...

  18. Retinoschisis (Juvenile)

    Science.gov (United States)

    ... here Home › Eye Conditions Listen Retinoschisis What is Juvenile Retinoschisis? Juvenile retinoschisis is an inherited disease diagnosed in childhood ... degeneration of the retina. What are the symptoms? Juvenile retinoschisis, also known as X-linked retinoschisis, occurs ...

  19. Assessment of disease activity in juvenile idiopathic arthritis. The number and the size of joints matter

    DEFF Research Database (Denmark)

    Berntson, Lillemor; Wernroth, Lisa; Fasth, Anders

    2007-01-01

    Variables for assessment of disease activity of juvenile idiopathic arthritis (JIA) were studied, in order to develop a disease activity score for children with JIA.......Variables for assessment of disease activity of juvenile idiopathic arthritis (JIA) were studied, in order to develop a disease activity score for children with JIA....

  20. Serum melatonin in juvenile rheumatoid arthritis: correlation with disease activity.

    Science.gov (United States)

    El-Awady, Hanaa Mahmoud; El-Wakkad, Amany Salah El-Dien; Saleh, Maysa Tawheed; Muhammad, Saadia Ibraheem; Ghaniema, Eiman Mahmoud

    2007-05-01

    The study was conducted to investigate the abnormalities in early morning serum melatonin among patients with Juvenile Rheumatoid Arthritis (JRA) and to outline its relation to disease activity and severity. Twenty one patients with JRA and twenty healthy age and sex matched controls were enrolled in the study. Fifteen patients had polyarticular JRA, 3 had oligoarticular and 3 had systemic onset JRA. Evaluation was carried out clinically, functionally and radiologically by using disease activity score, Juvenile Arthritis Functional Assessment Report for Children (JAFAR-C score) and modified Larsen score, respectively. Laboratory investigations included Complete Blood Picture (CBC), The Erythrocyte Sedimentation Rate (ESR), C-Reactive Protein (CRP), classic IgM Rheumatoid Factor (RF), Anti-nuclear Antibodies (ANA) and melatonin estimation in serum. The serum levels of melatonin were significantly increased in JRA patients (mean +/- SD = 13.9 +/- 8 pg mL(-1)) as compared to healthy controls (mean +/- SD = 8.1 +/- 2.7 pg mL(-1), p 0.05). Hence the study conclude that the elevated melatonin levels among JRA patients with active synovitis and its close relation to disease activity rather than disease severity suggests that melatonin might play a promoting role in rheumatoid arthritis. Hence, inhibition of its synthesis and/or action by specific antagonists may be of therapeutic value.

  1. Juvenile neuronal ceroid lipofuscinosis (Batten disease: current insights

    Directory of Open Access Journals (Sweden)

    Ostergaard JR

    2016-08-01

    Full Text Available John R Ostergaard Department of Paediatrics, Aarhus University Hospital, Centre for Rare Diseases, Aarhus, Denmark Abstract: The present review is focused on juvenile neuronal ceroid lipofuscinosis (JNCL; Batten disease due to a mutation in CLN3. Functional vision impairment occurring around 5–6 years of age is the first symptom in more than 80% of patients. Approximately 2 years later (though sometimes simultaneously, obvious signs of cognitive impairment appear. Behavior problems can occur in advance, especially in boys. These include anxious and depressed mood, aggressive behavior, and hallucinations, and even psychotic symptoms. Following the teens, severe dementia is present, including loss of memory, attention, and general reasoning abilities, as well as loss of independent adaptive skills such as mobility, feeding, and communicating. Sleep abnormalities, such as settling problems, nocturnal awakenings, and nightmares, are reported in more than half of patients. The vast majority, if not all, patients develop seizures, starting at approximately 10 years of age. Generalized tonic–clonic seizure occurs as the only type of seizure in approximately half of patients, and in combination with partial seizures in a third of patients. There seems to be no difference in seizure severity according to sex or genotype, and there is great variation in seizure activity among patients. Soon after diagnosis, patients begin to have slight ataxic symptoms, and at adolescence extrapyramidal symptoms (rigidity, bradykinesia, slow steps with flexion in hips and knees occur with increasing frequency. Chewing and swallowing difficulties emerge as well, and food intake is hampered in the late teens. Disabling periodically involuntary movements may occur as well. A progressive cardiac involvement with repolarization disturbances, ventricular hypertrophy, and sinus-node dysfunction, ultimately leading to severe bradycardia and/or other conduction abnormalities

  2. Nuclear inclusions mimicking poly(A)-binding protein nuclear 1 inclusions in a case of inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia with a novel mutation in the valosin-containing protein gene.

    Science.gov (United States)

    Matsubara, Shiro; Shimizu, Toshio; Komori, Takashi; Mori-Yoshimura, Madoka; Minami, Narihiro; Hayashi, Yukiko K

    2016-07-01

    A middle-aged Japanese man presented with slowly progressive asymmetric weakness of legs and arm but had neither ptosis nor dysphagia. He had a family history of similar condition suggestive of autosomal dominant inheritance. A muscle biopsy showed mixture of neurogenic atrophy and myopathy with rimmed vacuoles. Furthermore we found intranuclear inclusions that had a fine structure mimicking that of inclusions reported in oculopharyngeal muscular dystrophy (OPMD). Immunohistochemical staining for polyadenylate-binding nuclear protein 1, which is identified within the nuclear inclusions of OPMD, demonstrated nuclear positivity in this case. However, OPMD was thought unlikely based on the clinical features and results of genetic analyses. Instead, a novel mutation in valosin-containing protein, c.376A>T (p.Ile126Phe), was revealed. A diagnosis of inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia was made. This is the first report of polyadenylate-binding nuclear protein 1-positive nuclear inclusions in the muscle of this condition.

  3. [Diagnosis of ivory vertebra. Bibliographic study, report of 2 cases of pagetic ivory vertebra].

    Science.gov (United States)

    Durot, J F; Gatfosse, M; Lerais, J M; Baudrillard, J C; Auquier, F

    1986-04-01

    Two cases are reported of ivory vertebra, an isolated lesion difficult to diagnose clinically or radiologically. Tomographic and if necessary computed tomographic analysis should provide a precise diagnosis of a Paget's disease origin, biopsy being reserved for cases for which a doubt exists.

  4. Juvenile idiopathic arthritis

    Science.gov (United States)

    Juvenile rheumatoid arthritis (JRA); Juvenile chronic polyarthritis; Still disease; Juvenile spondyloarthritis ... The cause of juvenile idiopathic arthritis (JIA) is not known. It ... illness . This means the body attacks and destroys healthy body ...

  5. Prevalence of Sexually Transmitted Diseases in Juvenile Prostitutes and Street Youth

    OpenAIRE

    Antonietta Caffaro Rouget; Mah, Jean K.; Lang, Reuben A; Joffres, Michel R

    1994-01-01

    Four groups of adolescents – 35 juvenile prostitutes, 36 street youth, 31 monogamous sexually active adolescents and 35 non-sexually active adolescents – were studied between January 1, 1988 and December 31, 1988 for the presence of sexually transmitted diseases and other genital pathogens. The high prevalence of sexually transmitted diseases found in the juvenile prostitutes (Neisseria gonorrhoeae, 49%; Chlamydia trachomatis, 83%) is in contrast to other studies, which document much lower ra...

  6. TBK1 Mediates Critical Effects of Measles Virus Nucleocapsid Protein (MVNP) on Pagetic Osteoclast Formation

    Science.gov (United States)

    Sun, Quanhong; Sammut, Bénédicte; Wang, Feng-Ming; Kurihara, Noriyoshi; Windle, Jolene J.; Roodman, G. David; Galson, Deborah L.

    2013-01-01

    Paget’s disease of bone (PDB) is characterized by abnormal osteoclasts with unique characteristics that include: increased sensitivity of osteoclast progenitors to 1,25(OH)2D3, RANKL and TNF-α, increased osteoclast numbers, increased expression of IL-6 and several transcription factors. We recently reported that measles virus nucleocapsid protein (MVNP) plays a key role in the development of these abnormal osteoclasts. MVNP can induce the pagetic osteoclast phenotype in vitro and in vivo in TRAP-MVNP transgenic mice. However, the molecular mechanisms by which MVNP generates pagetic osteoclasts have not been determined. TANK-binding kinase 1 (TBK1) and IκB kinase-ɛ (IKKɛ) are IKK family members which complex with MVNP and activate both IRF3 and NF-κB pathways. MVNP increases the amount of TBK1 protein in bone marrow monocytes (BMM). Interestingly, we found that RANKL increased TBK1 and IKKɛ early in osteoclast differentiation, suggesting a possible role in normal osteoclastogenesis. However, only TBK1 is further increased in osteoclasts formed by TRAP-MVNP BMM due to increased TBK1 protein stability. TBK1 over-expression induced IL6 promoter reporter activity, and elevated endogenous IL6 mRNA and p65 NF-κB, TAF12 and ATF7 proteins in several cell lines. Over-expression of TBK1 was insufficient to induce pagetic osteoclasts from WT BMM, but synergized with MVNP to increase pagetic osteoclast formation from TRAP-MVNP BMM. BX795 inhibition of TBK1 impaired MVNP-induced IL-6 expression in both NIH3T3 cells and BMM, and shRNA knockdown of Tbk1 in NIH3T3 cells impaired IL-6 secretion induced by MVNP and decreased TAF12 and ATF7, factors involved in 1,25(OH)2D3 hypersensitivity of pagetic osteoclasts. Similarly, Tbk1 knockdown in BMM from TRAP-MVNP and WT mice specifically impaired development of the MVNP-induced osteoclast pagetic phenotype. These results demonstrate that TBK1 plays a critical role in mediating the effects of MVNP on osteoclast differentiation

  7. Mechanisms of disease and therapy in severe juvenile idiopathic arthritis

    NARCIS (Netherlands)

    Vastert, S.J.

    2013-01-01

    This thesis describes results of translational research (both bench to bedside as reverse translation from bedside back to the bench) in severe Juvenile idiopathic Arthritis (JIA). It focuses on understanding critical immunological features of both systemic and polyarticular JIA and relates this to

  8. Disease activity, severity, and damage in the UK Juvenile-Onset Systemic Lupus Erythematosus Cohort.

    Science.gov (United States)

    Watson, Louise; Leone, Valentina; Pilkington, Clarissa; Tullus, Kjell; Rangaraj, Satyapal; McDonagh, Janet E; Gardner-Medwin, Janet; Wilkinson, Nick; Riley, Phil; Tizard, Jane; Armon, Kate; Sinha, Manish D; Ioannou, Yiannis; Archer, Neil; Bailey, Kathryn; Davidson, Joyce; Baildam, Eileen M; Cleary, Gavin; McCann, Liza J; Beresford, Michael W

    2012-07-01

    The UK Juvenile-Onset Systemic Lupus Erythematosus (JSLE) Cohort Study is a multicenter collaborative network established with the aim of improving the understanding of juvenile SLE. The present study was undertaken to describe the clinical manifestations and disease course in patients with juvenile SLE from this large, national inception cohort. Detailed data on clinical phenotype were collected at baseline and at regular clinic reviews and annual followup assessments in 232 patients from 14 centers across the UK over 4.5 years. Patients with SLE were identified according to the American College of Rheumatology (ACR) SLE classification criteria. The present cohort comprised children with juvenile SLE (n=198) whose diagnosis fulfilled ≥4 of the ACR criteria for SLE. Among patients with juvenile SLE, the female:male sex distribution was 5.6:1 and the median age at diagnosis was 12.6 years (interquartile range 10.4-14.5 years). Male patients were younger than female patients (PLupus Assessment Group disease activity index demonstrated significantly increased frequencies of musculoskeletal (82%), renal (80%), hematologic (91%), immunologic (54%), and neurologic (26%) involvement among the patients over time. A large proportion of the patients (93%) were taking steroids and 24% of the patients required treatment with cyclophosphamide. Disease damage was common, with 28% of the patients having a Systemic Lupus International Collaborating Clinics/ACR damage score of ≥1. The data on these patients from the UK JSLE Cohort Study, comprising one of the largest national inception cohorts of patients with juvenile SLE to date, indicate that severe organ involvement and significant disease activity are primary characteristics in children with juvenile SLE. In addition, accumulation of disease-associated damage could be seen. Copyright © 2012 by the American College of Rheumatology.

  9. Validity of a three-variable Juvenile Arthritis Disease Activity Score in children with new-onset juvenile idiopathic arthritis

    Science.gov (United States)

    Mcerlane, Flora; Beresford, Michael W; Baildam, Eileen M; Chieng, S E Alice; Davidson, Joyce E; Foster, Helen E; Gardner-Medwin, Janet; Lunt, Mark; Wedderburn, Lucy R; Thomson, Wendy; Hyrich, Kimme L

    2013-01-01

    Objectives To investigate the validity and feasibility of the Juvenile Arthritis Disease Activity Score (JADAS) in the routine clinical setting for all juvenile idiopathic arthritis (JIA) disease categories and explore whether exclusion of the erythrocyte sedimentation rate (ESR) from JADAS (the ‘JADAS3’) influences correlation with single markers of disease activity. Methods JADAS-71, JADAS-27 and JADAS-10 were determined at baseline for an inception cohort of children with JIA in the Childhood Arthritis Prospective Study. JADAS3-71, JADAS3-27 and JADAS3-10 were determined using an identical formula but with exclusion of ESR. Correlation of JADAS with JADAS3 and single measures of disease activity/severity were determined by category. Results Of 956 eligible children, sufficient data were available to calculate JADAS-71, JADAS-27 and JADAS-10 at baseline in 352 (37%) and JADAS3 in 551 (58%). The median (IQR) JADAS-71, JADAS-27 and JADAS-10 for all 352 children was 11 (5.9–18), 10.4 (5.7–17) and 11 (5.9–17.3), respectively. Median JADAS and JADAS3 varied significantly with the category (Kruskal–Wallis p=0.0001), with the highest values in children with polyarticular disease patterns. Correlation of JADAS and JADAS3 across all categories was excellent. Correlation of JADAS71 with single markers of disease activity/severity was good to moderate, with some variation across the categories. With the exception of ESR, correlation of JADAS3-71 was similar to correlation of JADAS-71 with the same indices. Conclusions This study is the first to apply JADAS to all categories of JIA in a routine clinical setting in the UK, adding further information about the feasibility and construct validity of JADAS. For the majority of categories, clinical applicability would be improved by exclusion of the ESR. PMID:23256951

  10. Prevalence of Sexually Transmitted Diseases in Juvenile Prostitutes and Street Youth

    Directory of Open Access Journals (Sweden)

    Antonietta Caffaro Rouget

    1994-01-01

    Full Text Available Four groups of adolescents – 35 juvenile prostitutes, 36 street youth, 31 monogamous sexually active adolescents and 35 non-sexually active adolescents – were studied between January 1, 1988 and December 31, 1988 for the presence of sexually transmitted diseases and other genital pathogens. The high prevalence of sexually transmitted diseases found in the juvenile prostitutes (Neisseria gonorrhoeae, 49%; Chlamydia trachomatis, 83% is in contrast to other studies, which document much lower rates of infection. This could be due to the fact that there are few studies done on juvenile prostitutes as a well defined group. Despite high risk sexual behaviour, the consistent use of contraception was low. No contraceptives were used by 57% of the juvenile prostitutes and 85% of the street youth. None of the adolescents sought medical attention although 48% of the juvenile prostitutes and 53% of the street youth had genital symptoms. It appears that the present public health education and health care delivery do not reach this high risk population.

  11. Discrimination of acute lymphoblastic leukemia from systemic-onset juvenile idiopathic arthritis at disease onset

    Directory of Open Access Journals (Sweden)

    Mirian S. Tamashiro

    2011-01-01

    Full Text Available OBJECTIVE: To assess clinical and laboratory features that differentiate acute lymphoblastic leukemia from systemic juvenile idiopathic arthritis at disease onset. METHODS: Fifty-seven leukemia patients with musculoskeletal involvement, without blasts on peripheral blood and without glucocorticoid therapy at disease onset and 102 systemic juvenile idiopathic arthritis patients (International League of Associations for Rheumatology criteria were retrospectively evaluated. The following features were examined: fever, rheumatoid rash, arthritis, limb pain, hepatomegaly, splenomegaly, pericarditis, myocarditis, pleuritis, weight loss, bleeding, anemia, leukopenia, neutropenia, thrombocytopenia, erythrocyte sedimentation rate, and lactic dehydrogenase levels. RESULTS: The median age at disease onset was significantly higher in leukemia patients than in those with systemic-onset juvenile idiopathic arthritis (5.8 vs. 3.8 years. In addition, the frequencies of limb pain, hepatomegaly, weight loss and hemorrhagic manifestations were significantly higher in leukemia patients than in systemic-onset juvenile idiopathic arthritis patients (70% vs. 1%, 54% vs. 32%, 30% vs. 8%, and 9% vs. 0%, respectively. Likewise, the frequencies of anemia, leukopenia, neutropenia, thrombocytopenia and high lactic dehydrogenase levels were statistically higher in leukemia patients than in patients with systemic-onset juvenile idiopathic arthritis (88% vs. 57%, 39% vs. 1%, 60% vs. 1%, 77% vs. 1%, and 56% vs. 14%, respectively. Remarkably, multivariate analysis revealed that limb pain (OR = 553; 95% CI =46.48-6580.42 and thrombocytopenia (OR = 754.13; 95% CI =64.57-8806.72 were significant independent variables that differentiated leukemia from systemic-onset juvenile idiopathic arthritis. The R2 of the Nagelkerke test was 0.91, and the Kaplan-Meier survival curves were similar for acute lymphoblastic leukemia patients with and without limb pain. CONCLUSION: Our study

  12. 25-hydroxyvitamin D levels and juvenile idiopathic arthritis: is there an association with disease activity?

    Science.gov (United States)

    To examine the association between serum levels of 25-hydroxyvitamin D [25(OH)D] and disease activity in juvenile idiopathic arthritis (JIA), to determine the prevalence of vitamin D (VD) deficiency [25(OH)D=19 ng/ml] and insufficiency [25(OH)D 20-29 ng/ml], and to determine factors associated with ...

  13. Gas Bubble Disease Monitoring and Research of Juvenile Salmonids : Annual Report 1996.

    Energy Technology Data Exchange (ETDEWEB)

    Maule, Alec G.; Beeman, John W.; Hans, Karen M.; Mesa, M.G.; Haner, P.; Warren, J.J. [Geological Survey, Cook, WA (United States). Columbia River Research Lab.

    1997-10-01

    This document describes the project activities 1996--1997 contract year. This report is composed of three chapters which contain data and analyses of the three main elements of the project: field research to determine the vertical distribution of migrating juvenile salmonids, monitoring of juvenile migrants at dams on the Snake and Columbia rivers, and laboratory experiments to describe the progression of gas bubble disease signs leading to mortality. The major findings described in this report are: A miniature pressure-sensitive radio transmitter was found to be accurate and precise and, after compensation for water temperature, can be used to determine the depth of tagged-fish to within 0.32 m of the true depth (Chapter 1). Preliminary data from very few fish suggest that depth protects migrating juvenile steelhead from total dissolved gas supersaturation (Chapter 1). As in 1995, few fish had any signs of gas bubble disease, but it appeared that prevalence and severity increased as fish migrated downstream and in response to changing gas supersaturation (Chapter 2). It appeared to gas bubble disease was not a threat to migrating juvenile salmonids when total dissolved gas supersaturation was < 120% (Chapter 2). Laboratory studies suggest that external examinations are appropriate for determining the severity of gas bubble disease in juvenile salmonids (Chapter 3). The authors developed a new method for examining gill arches for intravascular bubbles by clamping the ventral aorta to reduce bleeding when arches were removed (Chapter 3). Despite an outbreak of bacterial kidney disease in the experimental fish, the data indicate that gas bubble disease is a progressive trauma that can be monitored (Chapter 3).

  14. Juvenile and juvenile-onset systemic lupus erythematosus patients: Clinical characteristics, disease activity and damage

    Directory of Open Access Journals (Sweden)

    Rasha E. Gheith

    2017-07-01

    Conclusion: The existence of differences in clinical phenotype has been confirmed, between JSLE and JO-SLE especially as regards serositis, nephritis and heamatological affection. The disease damage was comparable which denotes that the maximum organ involvement occurs in childhood with an almost stationary course.

  15. [Juvenile scleroderma].

    Science.gov (United States)

    de Mâcedo, Patrícia Andrade; Shinjo, Samuel Katsuyuki; Goldenstein-Schainberg, Cláudia

    2008-01-01

    Juvenile scleroderma is a rare childhood condition characterized by fibrosis of the skin and internal organs. Clinical manifestations of childhood scleroderma are different from adult disease and early recognition, correct classification and treatment can improve long-term outcome. This review explores the most recent actualizations on clinical manifestations, classification criteria, treatment options and prognosis of juvenile scleroderma. There are two main forms of the disease: localized scleroderma and systemic sclerosis. Localized scleroderma is the most common form in children and mostly restricted to the skin. Juvenile diffuse systemic sclerosis is related to visceral involvement and cardiac disease which is the main cause of death in these patients. The outcome of juvenile systemic sclerosis is better compared with the adult form. Treatment remains a medical challenge and the EULAR task force proposed an approach to juvenile scleroderma treatment based on expert's opinion and guidelines used for the treatment of adults. Larger studies on childhood scleroderma are warranted.

  16. Different familial association patterns of autoimmune diseases between juvenile-onset systemic lupus erythematosus and juvenile rheumatoid arthritis.

    Science.gov (United States)

    Huang, Chun-Mei; Yang, Yao-Hsu; Chiang, Bor-Luen

    2004-04-01

    The aim of this study was to determine if the prevalence of autoimmune disorders in the relatives of patients with systemic lupus erythematosus (SLE) is greater than that of relatives of patients with juvenile rheumatoid arthritis (JRA). Interviews were used to obtain histories of the following autoimmune disorders among living or deceased first-, second-, and third-degree relatives of 91 SLE and 110 JRA families: ankylosing spondylitis, SLE, rheumatoid arthritis (RA), JRA, multiple sclerosis, juvenile dermatomyositis, Sjögren's syndrome, myasthenia gravis, psoriasis, and thyroid diseases. There were statistically significant differences between the SLE and JRA probands in mean age and gender ratio (19.1 +/- 4.8 vs 14.0 +/- 5.5 years; M (male)/F (female): 17/74 vs 62/48, pJRA families (11.8%), but not statistically significantly so. The mean age (18.0 +/- 5.3 vs 14.0 +/- 4.3 years), mean age at diagnosis (13.4 +/- 4.3 vs 7.9 +/- 3.9 years) and gender ratio (F/M, 16/3 vs 5/8) of the patients with affected relatives between these 2 groups all had statistically significant differences. A higher prevalence of SLE in relatives was found in SLE families than in JRA cases. Furthermore, this study revealed a higher incidence of autoimmune disorders among second- and third-degree relatives of SLE or JRA probands versus first-degree ones, especially sisters (including 1 pair of twins) and the maternal aunt in SLE families. These data demonstrate that the prevalence of autoimmune disorders in the relatives of patients with SLE is greater than those of relatives of patients with JRA. This suggests that clinically different autoimmune phenotypes may share common susceptibility genes, which may act as risk factors for autoimmunity.

  17. Paget-Schroetter Syndrome in a Baseball Pitcher.

    Science.gov (United States)

    Yagi, Shusuke; Mitsugi, Minoru; Sangawa, Teruaki; Akaike, Masashi; Sata, Masataka

    2017-08-03

    Paget-Schroetter syndrome (PSS) is thrombosis of the deep veins draining the upper extremity due to anatomic abnormalities of the thoracic outlet that cause subclavian compression and subsequent thrombosis, leading to thrombus formation in the subclavian vein. Vigorous arm activity in sports is a known risk factor. Here, we report a case of Paget-Schroetter syndrome in a 31-year-old male non-professional baseball pitcher.

  18. Juvenile fibromyalgia in an adolescent patient with sickle cell disease presenting with chronic pain.

    Science.gov (United States)

    Ramprakash, Stalin; Fishman, Daniel

    2015-10-01

    Juvenile fibromyalgia in children with sickle cell disease has not been reported in the literature. We report an adolescent patient with sickle cell whose pain symptoms progressed from having recurrent acute sickle cell pain crisis episodes to a chronic pain syndrome over several years. He was eventually diagnosed with juvenile fibromyalgia based on the clinical history and myofascial tender points and his pain symptoms responded better to multidisciplinary strategies for chronic fibromyalgia pain. Chronic pain in sickle cell disease is an area of poor research, and in addition there is inconsistency in the definition of chronic pain in sickle cell disease. Central sensitisation to pain is shown to occur after recurrent painful stimuli in a genetically vulnerable individual. In a chronic pain condition such as fibromyalgia central sensitisation is thought to play a key role. Fibromyalgia should be considered as one of the main differential diagnosis in any sickle cell patient with chronic pain.

  19. Clinical and genetic study of a juvenile-onset Huntington disease

    Directory of Open Access Journals (Sweden)

    HAO Ying

    2012-06-01

    Full Text Available Background Huntington's disease (HD is an autosomal dominant hereditary progressive neurodegenerative disorder with a distinct phenotype characterized by chorea, dementia, cognitive and affective impairment. There are selective neural cell loss and atrophy in the caudate and putamen. Dr. George Huntington firstly described the disease accurately and insightfully, which led to a widespread recognition of the inherited chorea that now bears his name. Huntington disease gene (IT15 locus on chromosome 4p16.3, and encompasses 67 exons with a trinucleotide repeat (CAG in the first exon. The CAG repeat length is highly polymorphic in the population and expanded on at least one chromosome of individuals with HD. Clinically, patient with HD are often onset in adulthood. Juvenile-onset HD is relatively rare. Adult-onset HD patients usually have a CAG expansion from 40 to 55 whereas those with juvenile-onset greater than 60 which are often inherited from the father. We investigated the clinical features of a juvenile-onset case with Huntington disease and dynamic mutation of his family. Methods The CAG repeats of IT15 gene were detected using polymerase chain reaction and capillary electrophoresis in 115 individuals with preliminary diagnosis as Huntington disease. The repeat numbers of some samples carried expanded or intermediate alleles were verified by the pMD18-T vector clone sequencing. Results Fragment analysis showed that one juvenile-onset case presenting with cognitive dysfunction and hypokinesis carried 15/68 CAG repeats of IT15. His father carried 17/37 and mother carried 15/17. Conclusion 1 The juvenile-onset case of HD presented with different clinical features compared with adult-onset cases. The typical signs of adult-onset cases include progressive chorea, rigidity and dementia. The most common sign of juvenile-onset Huntington disease is cognitive decline. 2 The dynamic mutation of IT15 gene expansion of the CAG repeats in the

  20. Síndrome de Paget-Schroetter asociado a hiperhomocisteinemia Paget-Schroetter síndrome associated with hyperhomocsyteinemia

    Directory of Open Access Journals (Sweden)

    C.I. González

    2007-12-01

    Full Text Available La enfermedad tromboembólica venosa (ETEV en extremidades superiores es una entidad poco frecuente, si bien su incidencia ha aumentado en relación con el empleo de catéteres venosos centrales. La etiología puede ser primaria (idiopática, espontánea, de esfuerzo o traumática o secundaria (relacionada con tumores, catéteres venosos centrales, etc.. Presentamos un caso de trombosis venosa primaria de extremidad superior derecha, también llamada síndrome de Paget-Schroetter. Este cuadro suele asociarse a ejercicios o esfuerzos intensos y/o repetitivos de la extremidad afecta, alteraciones anatómicas en la zona, o bien puede ser la primera manifestación de un estado trombofílico desconocido hasta ese momento, como en el caso que nos ocupa. La clínica suele consistir en dolor en extremidad afecta, acompañado frecuentemente de edema y circulación colateral. La ecografía-doppler presenta con frecuencia falsos negativos, recomendando la realización de TAC por su mayor especificidad y para valoración de las estructuras vecinas, aunque la flebografía continúa siendo la prueba oro para el diagnóstico de este cuadro. No existe unanimidad acerca del tratamiento, recomendándose individualizar de acuerdo con las características propias de cada caso.Venous thromboembolic disease (VTED in the upper extremities is an infrequent entity, although its incidence has increased in relation to the use of central venous catheters. Its etiology can be primary (idiopathic, spontaneous, due to effort or traumatic or secondary (related to tumours, central venous catheters, etc.. We present a case of primary venous thrombosis of the upper right extremity, also called the Paget-Schroetter syndrome. This clinical picture is usually associated with intensive and/or repetitive exercise or effort of the affected extremity, anatomical alterations in the zone, or it can be the first manifestation of a previously unknown thrombophilic state, as in the case that

  1. Predictive Factors of Development of Graves’ Ophthalmopathy for Patients with Juvenile Graves’ Disease

    Directory of Open Access Journals (Sweden)

    Dalia Jarusaitiene

    2016-01-01

    Full Text Available Background. Due to low incidence of Graves’ ophthalmopathy (GO among children, the manifestation is poorly analyzed, posing a risk to late identification of insidious disease. Purposes. To identify predictive factors that may influence the development of GO in pediatric and young patients with Graves’ disease (GD. Methods. A cross-sectional study of patients newly diagnosed with pediatric or juvenile GD during 2002–2012 was conducted at the Hospital of Lithuanian University of Health Sciences. Ocular evaluation was based on European Group on Graves’ Orbitopathy survey. The ocular manifestations were analyzed in relation to demographic, environmental, and clinical factors. Results. In total, 130 patients with juvenile GD were included; 29.2% had GO. Median age at GD onset was 17 yrs (IQR 4–29. Main symptoms of GO were eyelids retraction (73.7%, proptosis (65.8%, injection of conjunctiva (42.1%, and eyeball motility disturbance (21.1%. Major significant and independent risk factors for GO development were high initial concentration of FT4 (OR = 5.963, TTHAb (OR = 6.358, stress (OR = 6.030, and smoking (OR = 7.098. Conclusion. The major factors that could influence GO development were smoking, stress, and increased levels of initial TRAb, FT4. Slight proptosis, retraction of eyelids, and conjunctive injection were found as predominant ophthalmological symptoms in juvenile GO.

  2. Metabolic bone disease in juvenile koalas (Phascolartcos cinereus).

    Science.gov (United States)

    Pye, Geoffrey W; Gait, Sarah Catherine; Mulot, Baptiste; de Asua, Maria Delclaux Real; Martinez-Nevado, Eva; Bonar, Christopher J; Baines, Stephen J; Baines, Elizabeth A

    2013-06-01

    Due to climate restrictions in parts of North America and Europe, koalas (Phascolarctos cinereus) are housed indoors. Koala young (joeys) raised indoors are susceptible to the development of metabolic bone disease (MBD) due to a lack of exposure to natural ultraviolet light to themselves and their female parents (dams). In this retrospective study, radiographs from 27 koala joeys born at four zoos in North America and two zoos in Europe were evaluated for signs of MBD. Eight of the joeys were radiographically diagnosed with MBD and four additional joeys were considered suspect MBD cases; in two joeys absence or presence of MBD could not be determined. All joeys had mild to severe hip and shoulder dysplasia. There were significant associations between a lack of exposure to UV light and MBD development and between MBD and the degree of severity of hip and shoulder dysplasia. It is recommended to house breeding female koalas and their joeys outdoors whenever possible.

  3. Early-Life Intranasal Colonization with Nontypeable Haemophilus influenzae Exacerbates Juvenile Airway Disease in Mice.

    Science.gov (United States)

    McCann, Jessica R; Mason, Stanley N; Auten, Richard L; St Geme, Joseph W; Seed, Patrick C

    2016-07-01

    Accumulating evidence suggests a connection between asthma development and colonization with nontypeable Haemophilus influenzae (NTHi). Specifically, nasopharyngeal colonization of human infants with NTHi within 4 weeks of birth is associated with an increased risk of asthma development later in childhood. Monocytes derived from these infants have aberrant inflammatory responses to common upper respiratory bacterial antigens compared to those of cells derived from infants who were not colonized and do not go on to develop asthma symptoms in childhood. In this study, we hypothesized that early-life colonization with NTHi promotes immune system reprogramming and the development of atypical inflammatory responses. To address this hypothesis in a highly controlled model, we tested whether colonization of mice with NTHi on day of life 3 induced or exacerbated juvenile airway disease using an ovalbumin (OVA) allergy model of asthma. We found that animals that were colonized on day of life 3 and subjected to induction of allergy had exacerbated airway disease as juveniles, in which exacerbated airway disease was defined as increased cellular infiltration into the lung, increased amounts of inflammatory cytokines interleukin-5 (IL-5) and IL-13 in lung lavage fluid, decreased regulatory T cell-associated FOXP3 gene expression, and increased mucus production. We also found that colonization with NTHi amplified airway resistance in response to increasing doses of a bronchoconstrictor following OVA immunization and challenge. Together, the murine model provides evidence for early-life immune programming that precedes the development of juvenile airway disease and corroborates observations that have been made in human children.

  4. A Case of Juvenile Huntington Disease in a 6-Year-Old Boy

    Directory of Open Access Journals (Sweden)

    Jun-Sang Sunwoo

    2010-10-01

    Full Text Available Huntington disease is a neurodegenerative disorder distinguished by the triad of dominant inheritance, choreoathetosis and dementia, usually with onset in the fourth and fifth decades. It is caused by an unstable cytosine-adenine-guanine (CAG trinucleotide repeat expansion in the gene IT15 in locus 4p16.3. Juvenile HD that constitutes about 3% to 10% of all patients is clinically different from adult-onset form and characterized by a larger number of CAG repeats typically exceeding 60. We report a case of a 6-year-old boy with myoclonic seizure and 140 CAG repeats confirmed by molecular genetic analysis.

  5. Chronic kidney disease in an adolescent with hyperuricemia: familial juvenile hyperuricemic nephropathy.

    Science.gov (United States)

    Alaygut, Demet; Torun-Bayram, Meral; Soylu, Alper; Kasap, Belde; Türkmen, Mehmet; Kavukçu, Salih

    2013-01-01

    Chronic kidney disease (CKD) is a life-long condition associated with substantial morbidity and premature death due to complications from a progressive decrease in kidney function. Especially in children, early diagnosis and detection of the etiologic factors are important to improve their health outcomes. Familial juvenile hyperuricemic nephropathy (FJHN) is a rare autosomal-dominant disorder characterized by hyperuricemia with renal uric acid under-excretion and CKD. Genetic studies have revealed mutations in the uromodulin (UMOD) gene. Highlighting the importance of CKD in children, a 14-year-old girl with the rare diagnosis of FJHN is reported herein.

  6. The impact of Juvenile Huntington's Disease on the family: the case of a rare childhood condition.

    Science.gov (United States)

    Brewer, Helen M; Eatough, Virginia; Smith, Jonathan A; Stanley, Cath A; Glendinning, Neil W; Quarrell, Oliver W J

    2008-01-01

    There has been little research into the impact of Juvenile Huntington's Disease (JHD) on the family, and the issues facing this group are poorly understood. The study reported here is part of larger project that aimed to address this. Ten semi-structured interviews with the main carer were carried out, and were analysed using Interpretative Phenomenological Analysis (IPA). This article reports three themes arising from the study relating to the psychosocial impact of JHD on the family: (1) dealing with something so different; (2) lack of understanding (3) isolation. This information is useful in developing appropriate services for families affected by JHD, as well as being of relevance to other childhood conditions.

  7. Juvenile myasthenia

    Directory of Open Access Journals (Sweden)

    Knežević-Pogančev Marija

    2011-01-01

    Full Text Available Introduction. Juvenile myasthenia is a chronic autoimmune neuromuscular disease characterized by varying degrees of fluctuating, painless muscle weakness and rapid fatigue of any muscles under voluntary control. Juvenile myasthenia is a form of myasthenia appearing in adolescent age, representing 10% to 15% of all cases of myasthenia gravis. Juvenile myasthenia is presented by a defect in the transmission of nerve impulses to muscles, resulting from a breakdown in the normal communication between nerves and muscles. In myasthenia, antibodies produced by the body’s own immune system block, alter, or destroy the receptors for acetylcholine. Juvenile myasthenia is neither directly inherited nor is it contagious. Signs and Symptoms. The first noticeable symptoms may be eye muscle weakness, difficulty in swallowing, or slurred speech. Juvenile myasthenia usually affects muscles innervated by the cranial nerves (face, lips, tongue, neck and throat, but it can affect any muscle group. Symptoms vary in type and severity with typical periods of exacerbation interspersed with periods of remission. When the muscles necessary for breathing are affected, a patient is said to be in a myasthenic crisis, which is a life-threatening situation. Disease Outcome and Treatment. Juvenile myasthenia produces sporadic but progressive weakness and abnormal fatigability of striated (skeletal muscles, exacerbated by exercise and repeated movement, but improved by rest and anticholinesterase drugs. Juvenile myasthenia follows an unpredictable course of recurring exacerbations and periodic remissions. With current therapies, however, most cases of juvenile myasthenia are not as serious as the name implies. Although there is no known cure, drug treatment has improved prognosis and allows patients to lead relatively normal lives, except during exacerbations.

  8. Early manifestations of gastric autoimmunity in patients with juvenile autoimmune thyroid diseases.

    Science.gov (United States)

    Segni, Maria; Borrelli, Osvaldo; Pucarelli, Ida; Delle Fave, Gianfranco; Pasquino, Anna Maria; Annibale, Bruno

    2004-10-01

    Juvenile patients affected with autoimmune thyroid disorders showed a 14-21% prevalence of parietal cell antibodies (PCA) reacting against the H+/K+-ATPase of the gastric parietal cells. PCA are the principal immunological markers of atrophic body gastritis (ABG).ABG is characterized by loss of oxyntic glands, achlorhydria, and hypergastrinemia. The aim of this study was to determine whether PCA positivity could be associated with biochemical and histological manifestations of gastric autoimmunity in juvenile patients with autoimmune thyroid disease (AITD). We studied 129 children (96 females and 33 males) with chronic lymphocytic thyroiditis (n = 115) or Graves' disease (n = 14). Mean age at diagnosis of AITD was 9.7 +/- 3.3 yr, and mean age at sampling was 12.3 +/- 3.7 yr. We determined PCA and Helicobacter pylori antibodies, gastrin, and pepsinogen I plasma levels. Gastroscopy with multiple biopsies was carried out in a subgroup of patients with PCA positivity. We found that 30% of children had detectable PCA. Hypergastrinemia was found in 45% of the PCA-positive children (range, 40-675 pg/ml) vs. 12% of PCA-negative children (range, 35-65 pg/ml; P < 0.001). Eighteen patients with PCA positivity underwent gastroscopy; eight of these children had normogastrinemia, which showed no signs of ABG, and 10 children had hypergastrinemia, of whom five had mild to severe ABG. Our study shows that autoimmune gastritis is an early event in juvenile AITD with detectable PCA. Gastrin plasma level is a reliable marker of gastric atrophy.

  9. Characteristics and relationship of periodontal disease with juvenile idiopathic and rheumatoid arthritis.

    Science.gov (United States)

    Vahabi, Surena; Rostamian, Abdolrahman; Baniebrahimi, Ghazaleh

    2015-01-01

    Rheumatoid arthritis (RA) is the most prevalent chronic inflammatory disease of the joints. It is correlated with periodontal disease due to similar factors that exist in both diseases. The present study assessed the relationship of periodontal disease with RA and juvenile idiopathic arthritis (JIA). In this case-control study, 30 RA and 30 JIA patients along with similar number of matched controls were selected among patients referred to Imam Khomeini Hospital, Tehran, Iran. Periodontal parameters including pocket depth (PD), clinical attachment level (CAL), O'Leary and Bay plaque index (PI) and bleeding on probing (BOP) were determined in cases and controls. Erythrocyte sedimentation rate, number of painful and inflamed joints and severity of disease were evaluated in RA and JIA patients. Mann-Whitney U-test nonparametric, Spearman and Pearson's correlation coefficients, and Chi-square tests were used as statistical analysis (α = 0.05). PD (4.17 vs. 3.6 mm; P 4 mm (58.83% vs. 44.33%; P 3 mm (74.13% vs. 64.4%; P disease severity and number of painful and inflamed joints with periodontal factors. In JIA patients, no significant relationships were found between JIA findings and periodontal parameters. Considering the limitations of this study, there was a relationship between RA and periodontal disease. Severity of periodontal disease increases in patients with RA, while no increased risk of periodontal disease or its severity was observed among JIA patients.

  10. Juvenile Spondyloarthritis

    Science.gov (United States)

    Gmuca, Sabrina; Weiss, Pamela F.

    2015-01-01

    Purpose of review To provide a comprehensive update of the pathogenesis, diagnostic imaging, treatments, and disease activity measurements of juvenile spondyloarthritis (JSpA). Recent findings Genetic and microbiome studies have provided new information regarding possible pathogenesis of JSpA. Recent work suggests that children with JSpA have decreased thresholds for pain in comparison to healthy children. Additionally, pain on physical examination and abnormalities on ultrasound of the entheses are not well correlated. Treatment guidelines for juvenile arthritis, including JSpA, were published by the American College of Rheumatology and are based on active joint count and presence of sacroiliitis. Recent studies have established the efficacy of tumor necrosis factor inhibitors in the symptomatic treatment of axial disease, though their efficacy for halting progression of structural damage is less clear. Newly developed disease activity measures for JSpA include the Juvenile Arthritis Disease Activity Score and the JSpA Disease Activity index. In comparison to other categories of juvenile arthritis, children with JSpA are less likely to attain and sustain inactive disease. Summary Further microbiome and genetic research may help elucidate JSpA pathogenesis. More randomized therapeutic trials are needed and the advent of new composite disease activity measurement tools will hopefully allow for the design of these greatly needed trials. PMID:26002028

  11. A central role for TOR signalling in a yeast model for juvenile CLN3 disease

    Directory of Open Access Journals (Sweden)

    Michael E. Bond

    2015-11-01

    Full Text Available Yeasts provide an excellent genetically tractable eukaryotic system for investigating the function of genes in their biological context, and are especially relevant for those conserved genes that cause disease. We study the role of btn1, the orthologue of a human gene that underlies an early onset neurodegenerative disease (juvenile CLN3 disease, neuronal ceroid lipofuscinosis (NCLs or Batten disease in the fission yeast Schizosaccharomyces pombe. A global screen for genetic interactions with btn1 highlighted a conserved key signalling hub in which multiple components functionally relate to this conserved disease gene. This signalling hub includes two major mitogen-activated protein kinase (MAPK cascades, and centers on the Tor kinase complexes TORC1 and TORC2. We confirmed that yeast cells modelling CLN3 disease exhibit features consistent with dysfunction in the TORC pathways, and showed that modulating TORC function leads to a comprehensive rescue of defects in this yeast disease model. The same pathways may be novel targets in the development of therapies for the NCLs and related diseases.

  12. Studies on rickettsia-like organism(RLO)disease of tropical marine pearl oyster--Epidemiologicai investigation of RLO disease in juvenile populations of maricultured Pinctada maxima

    Institute of Scientific and Technical Information of China (English)

    Xinzhong Wu; Dengfeng Li; Jinpei Pan; Jingbo Jiang

    2003-01-01

    The death which occurred in juvenile population was a severe problem in the course ofPinctada maxima artificial culture. With the methods of field investigation, histological study andstatistic analyses, the epidemiological study was carried out on the disease and death in juvenile popula-tions of Pinctada maxima in the Xinying Pearl Oyster Mariculture Farm of Lingao County (for the A,B and C batches of cultured juveniles hanged in the sea) and the Xincun Pearl Oyster Mariculture Farmof Lingshui County (for the D batch of cultured juvenile hanged in the pond), Hainan Province fromNovember 1993 to April 1995. The results show that the deaths which occurred in juvenile populations of Pinctada maxima pre-sented an outbreak pattern. The peak of mortality rates, in general, occurred in 4-to 6-month old pearloyster juveniles, and the mortality rates gradully declined with the extention of pearl oyster age after cul-turing 8 months. The correlation between the mortality rates of juvenile populations and mean bodylengths of juvenile populations show that the mortality rate become higher under 4 cm of mean bodylengths of juvenile population and become obvious declined over 5 cm of mean body lengths. The peak ofmortality rate occurred in 1 ~3 cm of mean body lengths. The results of histological observation showedthat rickettsia-like organism inclusions were common, histological widespread infective agent among ev-ery batches (A, B, C and D) of cultured juvenile populations. The mean severity indices (SI) of rick-ettsia-like organism (RLO) infection were positively correlated with mortality rates of juvenile popula-tions. After or within every peaks of RLO infection were all accompanied with the peaks of mortalityrates of host populations and the mortality rates declined with decreased RLO infection. So the evidencesof histological observation and epidemiology in this study indicated that rickettsia-like organism (RLO)may be as an important pathogenic organism of disease

  13. Juvenile nephropathy in a Boxer dog resembling the human nephronophthisis-medullary cystic kidney disease complex.

    Science.gov (United States)

    Basile, Angelo; Onetti-Muda, Andrea; Giannakakis, Konstantinos; Faraggiana, Tullio; Aresu, Luca

    2011-12-01

    A juvenile nephropathy in a 4-year-old male Boxer dog, closely resembling the Nephronophthisis (NPHP)-Medullary Cystic Kidney Disease Complex (MCKD) in humans is described. Gross examination of the kidneys revealed several multiple cysts at the corticomedullary junction and in the medulla. Histological examination was characterized by a widespread tubular atrophy and dilatation, with a marked thickening of the tubular basement membrane, interstitial lymphocytic infiltration and fibrosis. Ultrastructural studies revealed dilated tubules with irregular basement membrane thickening and splitting. Lectin histochemistry investigation revealed that the cysts originated in the distal convoluted tubule and collecting duct. Having excluded all other known cystic diseases of the kidney, and based on the lectin histochemistry results, the macroscopic and histological findings of our case are highly compatible with a diagnosis of the NPHP-MCKD complex. To our knowledge, this is the first report describing this particular lesion.

  14. The Prevalence of Juvenile Huntington's Disease: A Review of the Literature and Meta-Analysis.

    Science.gov (United States)

    Quarrell, Oliver; O'Donovan, Kirsty L; Bandmann, Oliver; Strong, Mark

    2012-07-20

    Juvenile Huntington's disease (JHD) is usually defined as Huntington's disease with an onset ≤ 20 years. The proportion of JHD cases reported in studies of Huntington's disease (HD) varies. A review of the literature found 62 studies that reported the proportion of JHD cases amongst all HD cases. The proportion of JHD cases in these studies ranged from 1% to 15%, and in a meta-analysis the pooled proportion of JHD cases was 4.92% (95% confidence interval of 4.07% to 5.84%). Limiting the analysis to the 25 studies which used multiple methods of ascertainment resulted in a similar pooled proportion of 5.32%, (95% confidence interval 4.18% to 6.60%). A small difference was observed when the meta-analysis was restricted to studies from countries defined by the World Bank as high income, that used multiple methods of ascertainment, and that were conducted since 1980 (4.81%, 95% confidence interval 3.31% to 6.58%, n=11). This contrasts with the pooled result from three post 1980 studies using multiple methods of ascertainment from South Africa and Venezuela, defined by the World Bank as upper middle income, where the estimated mean proportion was 9.95%, (95% confidence interval 6.37% to 14.22%). These results, which are expected to be more robust than those from a single study alone, may be helpful in estimating the proportion of JHD cases in a given population. Key Words: Juvenile Huntington's disease, prevalence, epidemiology.

  15. Aerobic capacity and disease activity in children, adolescents and young adults with juvenile idiopathic arthritis (JIA

    Directory of Open Access Journals (Sweden)

    van Pelt Philomien A

    2012-08-01

    Full Text Available Abstract Background As patients with juvenile idiopathic arthritis (JIA progress into adulthood, long-term outcome is determined by disease activity, physical and psychosocial development. Decreased aerobic capacity may play a critical role in health-related outcomes in JIA, since it has been linked with cardiovascular morbidity and mortality in late adulthood. The objectives of the current study are to examine the aerobic capacity and its relation to parameters of disease activity in children, adolescents and young adults with JIA. Methods Sixty-three patients with JIA (aged 10–27 years were cross sectional studied regarding their aerobic capacity and correlations were made to demographic, disease-related variables, and medication utilization. in a cross-sectional study group of 63 patients of all subtypes. Patients were divided in three age groups, 10–13 years; 14–17 years and 18–27 years. Results Reduced aerobic capacity is found in clinical remission as well as active disease in all subtypes and all age groups. Aerobic capacity is more impaired in active disease shown by DAS 28, JADAS 27, ESR and serum thrombocyte counts. Lower haemoglobin has a negative impact. Long-term used medication including methotrexate and corticosteroids didn’t influence outcome. There is no association with current sports participation. Conclusion Reduced aerobic capacity is present in children and adolescents with JIA, both in active disease and in patients with remission. Measures of aerobic capacity may serve as important outcome measure in JIA.

  16. Juvenile angiofibroma

    Science.gov (United States)

    Nasal tumor; Angiofibroma - juvenile; Benign nasal tumor; Juvenile nasal angiofibroma; JNA ... Juvenile angiofibroma is not very common. It is most often found in adolescent boys. The tumor contains ...

  17. Efficacy of phosphodiesterase‐4 inhibitors in juvenile Batten disease (CLN3)

    Science.gov (United States)

    Aldrich, Amy; Bosch, Megan E.; Fallet, Rachel; Odvody, Jessica; Burkovetskaya, Maria; Rama Rao, Kakulavarapu V.; Cooper, Jonathan D.; Drack, Arlene V.

    2016-01-01

    Objective Juvenile neuronal ceroid lipofuscinosis (JNCL), or juvenile Batten disease, is a pediatric lysosomal storage disease caused by autosomal recessive mutations in CLN3, typified by blindness, seizures, progressive cognitive and motor decline, and premature death. Currently, there is no treatment for JNCL that slows disease progression, which highlights the need to explore novel strategies to extend the survival and quality of life of afflicted children. Cyclic adenosine monophosphate (cAMP) is a second messenger with pleiotropic effects, including regulating neuroinflammation and neuronal survival. Here we investigated whether 3 phosphodiesterase‐4 (PDE4) inhibitors (rolipram, roflumilast, and PF‐06266047) could mitigate behavioral deficits and cell‐specific pathology in the Cln3Δex7/8 mouse model of JNCL. Methods In a randomized, blinded study, wild‐type (WT) and Cln3Δex7/8 mice received PDE4 inhibitors daily beginning at 1 or 3 months of age and continuing for 6 to 9 months, with motor deficits assessed by accelerating rotarod testing. The effect of PDE4 inhibitors on cAMP levels, astrocyte and microglial activation (glial fibrillary acidic protein and CD68, respectively), lysosomal pathology (lysosomal‐associated membrane protein 1), and astrocyte glutamate transporter expression (glutamate/aspartate transporter) were also examined in WT and Cln3Δex7/8 animals. Results cAMP levels were significantly reduced in the Cln3Δex7/8 brain, and were restored by PF‐06266047. PDE4 inhibitors significantly improved motor function in Cln3Δex7/8 mice, attenuated glial activation and lysosomal pathology, and restored glutamate transporter expression to levels observed in WT animals, with no evidence of toxicity as revealed by blood chemistry analysis. Interpretation These studies reveal neuroprotective effects for PDE4 inhibitors in Cln3Δex7/8 mice and support their therapeutic potential in JNCL patients. Ann Neurol 2016;80:909–923 PMID:27804148

  18. Characteristics and relationship of periodontal disease with juvenile idiopathic and rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Surena Vahabi

    2015-01-01

    Full Text Available Background: Rheumatoid arthritis (RA is the most prevalent chronic inflammatory disease of the joints. It is correlated with periodontal disease due to similar factors that exist in both diseases. The present study assessed the relationship of periodontal disease with RA and juvenile idiopathic arthritis (JIA. Materials and Methods: In this case-control study, 30 RA and 30 JIA patients along with similar number of matched controls were selected among patients referred to Imam Khomeini Hospital, Tehran, Iran. Periodontal parameters including pocket depth (PD, clinical attachment level (CAL, O′Leary and Bay plaque index (PI and bleeding on probing (BOP were determined in cases and controls. Erythrocyte sedimentation rate, number of painful and inflamed joints and severity of disease were evaluated in RA and JIA patients. Mann-Whitney U-test nonparametric, Spearman and Pearson′s correlation coefficients, and Chi-square tests were used as statistical analysis (α = 0.05. Results: PD (4.17 vs. 3.6 mm; P 4 mm (58.83% vs. 44.33%; P 3 mm (74.13% vs. 64.4%; P < 0.001, percentage of sites with BOP (9.67% vs. 6.87%; P < 0.0001 and PI index (85.73% vs. 80.63%; P < 0.0001 were significantly higher in RA patients than controls. In this group, direct and significant correlations were found between serologic findings, disease severity and number of painful and inflamed joints with periodontal factors. In JIA patients, no significant relationships were found between JIA findings and periodontal parameters. Conclusion: Considering the limitations of this study, there was a relationship between RA and periodontal disease. Severity of periodontal disease increases in patients with RA, while no increased risk of periodontal disease or its severity was observed among JIA patients.

  19. Tics as an initial manifestation of juvenile Huntington's disease: case report and literature review.

    Science.gov (United States)

    Cui, Shi-Shuang; Ren, Ru-Jing; Wang, Ying; Wang, Gang; Chen, Sheng-Di

    2017-08-08

    Huntington's disease (HD) is an autosomal dominant disorder, typically characterized by chorea due to a trinucleotide repeat expansion in the HTT gene, although the clinical manifestations of patients with juvenile HD (JHD) are atypical. A 17-year-old boy with initial presentation of tics attended our clinic and his DNA analysis demonstrated mutation in the HTT gene (49 CAG repeats). After treatment, his symptoms improved. Furthermore, we performed literature review through searching the databases and summarized clinical features in 33 JHD patients. The most prevalent symptoms are ataxia, and two cases reported that tics as initial and prominent manifestation in JHD. Among them, 88% patients carried CAG repeats beyond 60 and most of them have family history. This case here illustrates the variable range of clinical symptoms of JHD and the necessity of testing for the HD mutation in young patients with tics with symptoms unable to be explained by Tourette's syndrome (TS).

  20. Juvenile Huntington's disease confirmed by genetic examination in twins Doença de Huntington juvenil confirmada por exame genético em gêmeas

    Directory of Open Access Journals (Sweden)

    GILBERTO LEVY

    1999-09-01

    Full Text Available Early-onset Huntington's disease (HD occurs in approximately 10% of HD's cases. We report juvenile HD in phenotypically identical twins, evaluated by history, clinical and neurologic examination, mini-mental state examination, blood laboratory exams, cerebrospinal fluid examination, skull computed tomography, and genetic examination for HD. Patients had the akinetic-rigid variety (Westphal variant of the disease and paternal inheritance. The laboratory workup confirmed the clinical diagnosis of HD, which adds this report to the rare cases of HD in twins reported in the literature.Doença de Huntington (DH de início precoce ocorre em aproximadamente 10% dos casos de DH. Relatamos DH juvenil em gêmeas fenotipicamente idênticas, avaliadas por história, exames clínico e neurológico, mini-exame do estado mental, exames de sangue, exame do líquido cefalorraquidiano, tomografia computadorizada de crânio e exame genético para DH. As pacientes apresentavam a variedade rígido-acinética (variante de Westphal da doença e herança paterna. A avaliação laboratorial confirmou o diagnóstico clínico de DH, acrescentando-se este relato aos raros casos de DH em gêmeos relatados na literatura.

  1. Unraveling pathology in juvenile Alexander disease: serial quantitative MR imaging and spectroscopy of white matter

    Energy Technology Data Exchange (ETDEWEB)

    Voorn, J.P. van der [VU University Medical Center, Department of Child Neurology, Amsterdam (Netherlands); VU University Medical Center, Department of Pathology, Amsterdam (Netherlands); Pouwels, Petra J.W. [VU University Medical Center, Department of Physics and Medical Technology, Amsterdam (Netherlands); Salomons, Gajja S. [VU University Medical Center, Department of Clinical Chemistry (Metabolic Unit), Amsterdam (Netherlands); Barkhof, Frederik [VU University Medical Center, Department of Radiology, Amsterdam (Netherlands); Knaap, Marjo S. van der [VU University Medical Center, Department of Child Neurology, Amsterdam (Netherlands)

    2009-10-15

    Alexander disease is a rare disorder of the central nervous system with characteristic symmetric white matter abnormalities with frontal predominance on magnetic resonance (MR) images. Histopathology shows a lack of myelin in the affected white matter, variably interpreted as hypomyelination or demyelination. To increase our insight into the nature of the pathology leading to the MR imaging findings in Alexander disease, we applied serial MR imaging, spectroscopy, magnetization transfer (MT) imaging (MTI), and diffusion tensor imaging (DTI) in six patients with juvenile Alexander disease. The MR imaging protocol comprised T1- and T2-weighted spin echo images and fluid-attenuated inversion recovery images. Fractional anisotropy (FA), apparent diffusion coefficient (ADC), and MT ratio (MTR) maps were generated, and MR spectroscopy concentrations were quantified for several metabolites. MR imaging showed similar cerebral white matter abnormalities in all patients, with only minor increase on prolonged follow-up, despite sometimes serious clinical progression. MR spectroscopy showed highly elevated levels of myo-inositol, lactate, and choline-containing compounds and decreased total N-acetyl-aspartate and N-acetyl-aspartyl-glutamate levels in the abnormal white matter. High values of ADC were observed, and both FA and MTR were attenuated. The sequential MR imaging findings in Alexander disease provide strong evidence against active demyelination as sole explanation for the underlying pathology. An alternative explanation for our spectroscopic, DTI, and MTI findings - which would suggest demyelination - could be hyperplasia and hypertrophy of astrocytes, as seen in low grade gliomas. (orig.)

  2. The pattern of female genital hormonal disease in juvenile myoclonic epilepsy

    Directory of Open Access Journals (Sweden)

    D. V. Anisimova

    2016-01-01

    Full Text Available Objective: to reveal and investigate hormonal characteristics in women of childbearing age in juvenile myoclonic epilepsy (JME.Patients and methods. The concentrations of sex steroid and tropic hormones were analyzed in 48 women of childbearing age who suffered from JME and received monotherapy or bitherapy with antiepileptic drugs (AEDs for more than a year. For comparison of their values, a control group included 15 healthy women who did not take AEDs. Results and discussion. 66.7% of the patients were found to have ovarian hormonal dysfunction characterized by a significant increase in the level of luteinizing hormone and testosterone in the follicular phase of the cycle and a decrease in that of progesterone in the luteal phase compared with the control group. The hormonal deviations were influenced by disease duration and age-related onset in JME. Generalized tonicclonic seizures concurrent with myoclonic ones, bitherapy, and disease onset before menarche and in the period of the menstrual cycle favored the  development of hormonal deviations to a greater extent than myoclonic seizures only, monotherapy, and disease onset after the establishment of the cycle. Valproates were most commonly used in the therapy of JME; however, there were no significant differences in the hormonal deficiencies when different chemical groups of AEDs were administered.

  3. Disease: H00506 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available impairment also manifest in indivisuals with osteogenesis imperfecta. Mutations in the CRTAP, LEPRE1, and P...ption, gene) Michou L, Brown JP Genetics of bone diseases: Paget's disease, fibrous dysplasia, osteopetrosis, and osteogenesis

  4. Overlap of disease susceptibility loci for rheumatoid arthritis and juvenile idiopathic arthritis

    Science.gov (United States)

    Hinks, Anne; Eyre, Steve; Ke, Xiayi; Barton, Anne; Martin, Paul; Flynn, Edward; Packham, Jon; Worthington, Jane; Thomson, Wendy

    2010-01-01

    Background Genome-wide association studies (GWAS) have been extremely successful in the search for susceptibility risk factors for complex genetic autoimmune diseases. As more studies are published, evidence is emerging of considerable overlap of loci between these diseases. In juvenile idiopathic arthritis (JIA), another complex genetic autoimmune disease, the strategy of using information from autoimmune disease GWAS or candidate gene studies to help in the search for novel JIA susceptibility loci has been successful, with confirmed association with two genes, PTPN22 and IL2RA. Rheumatoid arthritis (RA) is an autoimmune disease that shares similar clinical and pathological features with JIA and, therefore, recently identified confirmed RA susceptibility loci are also excellent JIA candidate loci. Objective To determine the overlap of disease susceptibility loci for RA and JIA. Methods Fifteen single nucleotide polymorphisms (SNPs) at nine RA-associated loci were genotyped in Caucasian patients with JIA (n=1054) and controls (n=3531) and tested for association with JIA. Allele and genotype frequencies were compared between cases and controls using the genetic analysis software, PLINK. Results Two JIA susceptibility loci were identified, one of which was a novel JIA association (STAT4) and the second confirmed previously published associations of the TRAF1/C5 locus with JIA. Weak evidence of association of JIA with three additional loci (Chr6q23, KIF5A and PRKCQ) was also obtained, which warrants further investigation. Conclusion All these loci are good candidates in view of the known pathogenesis of JIA, as genes within these regions (TRAF1, STAT4, TNFAIP3, PRKCQ) are known to be involved in T-cell receptor signalling or activation pathways. PMID:19674979

  5. Aerobic capacity and disease activity in children, adolescents and young adults with juvenile idiopathic arthritis (JIA

    Directory of Open Access Journals (Sweden)

    van Pelt Philomine A

    2012-08-01

    Full Text Available Abstract Background As patients with juvenile idiopathic arthritis (JIA progress into adulthood, long-term outcome is determined by disease activity, physical and psychosocial development. Decreased aerobic capacity may play a critical role in health-related outcomes in JIA, since it has been linked with cardiovascular morbidity and mortality in late adulthood. The objectives of the current study are to examine the aerobic capacity and its relation to parameters of disease activity in children, adolescents and young adults with JIA. Methods Sixty-three patients with JIA (aged 10–27 years were cross sectional studied regarding their aerobic capacity and correlations were made to demographic, disease-related variables, and medication utilization. in a cross-sectional study group of 63 patients of all subtypes. Patients were divided in three age groups, 10–13 years; 14–17 years and 18–27 years. Results Reduced aerobic capacity is found in clinical remission as well as active disease in all subtypes and all age groups. Aerobic capacity is more impaired in active disease shown by DAS 28, JADAS 27, ESR and serum thrombocyte counts. Lower haemoglobin has a negative impact. Long-term used medication including methotrexate and corticosteroids didn’t influence outcome. There is no association with current sports participation. Conclusion Reduced aerobic capacity is present in adolescents and young adults with JIA, both in active disease and in patients with remission. Measures of aerobic capacity may serve as important outcome measure in JIA.

  6. Dermatomiosite juvenil e linfoma de Hodgkin: uma rara associação Juvenile dermatomyositis and Hodgkin disease: a rare association

    Directory of Open Access Journals (Sweden)

    André Cavalcanti

    2007-12-01

    Full Text Available A dermatomiosite (DM em adultos está freqüentemente associada com câncer. Já na faixa etária pediátrica, a dermatomiosite juvenil (DMJ é predominantemente idiopática, e sua associação com neoplasia é rara e com base apenas em relatos de casos. Embora rara, a presença de neoplasia em pacientes com DMJ deve ser sempre suspeitada quando houver manifestações clínicas atípicas e alterações laboratoriais incomuns. A seguir, descrevemos e discutimos um caso de DMJ e linfoma de Hodgkin em uma adolescente.Dermatomyositis (DM in adults is frequently associated with cancer. In contrast, during childhood juvenile dermatomyositis (JDM is predominantly idiopathic and its association with neoplasia is rare and based only in case reports. Although rare, the presence of neoplasia in JDM patients must always be suspected in face of atypical clinical manifestations and uncommon laboratorial findings. We describe and discuss a case of JDM and Hodgkin disease in an adolescent.

  7. Chromosome 16 microdeletion in a patient with juvenile neuronal ceroid lipofuscinosis (Batten disease)

    Energy Technology Data Exchange (ETDEWEB)

    Taschner, P.E.M.; Vos, N. de [Leiden Univ. (Netherlands); Thompson, A.D.; Callen, D.F. [Adelaide`s Children Hospital, North Adelaide (United Kingdom); Doggett, N. [Los Alamos National Lab., NM (United States); Mole, S.E. [University College London (United Kingdom); Dooley, T.P. [Southwest Foundation for Biomedical Research, San Antonio, TX (United States); Barth, P.G. [Amsterdam Medical Center (Netherlands); Breuning, M.H. [Leiden Univ. (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands)

    1995-03-01

    The gene that is involved in juvenile neuronal ceroid lipofuscinosis (JNCL), or Batten disease - CLN3 - has been localized to 16p12, and the mutation shows a strong association with alleles of microsatellite markers D16S298, D16S299, and D16S288. Recently, haplotype analysis of a Batten patient from a consanguineous relationship indicated homozygosity for a D16S298 null allele. PCR analysis with different primers on DNA from the patient and his family suggests the presence of a cytogenetically undetectable deletion, which was confirmed by Southern blot analysis. The microdeletion is embedded in a region containing chromosome 16-specific repeated sequences. However, putative candidates for CLN3, members of the highly homologous sulfotransferase gene family, which are also present in this region in several copies, were not deleted in the patient. If the microdeletion in this patient is responsible for Batten disease, then we conclude that the sulfotransferase genes are probably not involved in JNCL. By use of markers and probes flanking D15S298, the maximum size of the microdeletion was determined to be {approximately}29 kb. The microdeletion may affect the CLN3 gene, which is expected to be in close proximity to D16S298. 27 refs., 6 figs.

  8. Paget-Schroetter syndrome in the absence of common predisposing factors: a case report.

    Science.gov (United States)

    Ibrahim, Ramy; Dashkova, Irina; Williams, Myia; Kozikowski, Andrzej; Abrol, Neeraj; Gandhi, Anjula; Pekmezaris, Renee

    2017-01-01

    Paget-Schrotter Syndrome (PSS) also known as "effort thrombosis" is a form of primary thrombosis in the subclavian vein at the costoclavicular junction is usually seen in younger patients after repeated strenuous activity of the shoulders and arms. When occurring in younger patients, PSS presents itself with predisposing factors such as unilateral dull, aching pain in the shoulder or axilla and swelling of the arm and hand. We report a rare case of unusual left axillo-subclavian vein thrombosis in absence of clear risk factors and a negative hypercoagulable workup in a 36-year-old Hispanic woman who presented with 2 days duration of left upper extremity pain and swelling after a week of heavy exercise in aerobic class. Very few documented cases of primary or spontaneous ASVT in absence of clear factors and in such anatomical location have been previously reported. The patient was started on strict precautions of left upper extremity immobilization, analgesics in the form of Tylenol 650 mg every 6 h for pain as well as cold compresses. Lovenox 90 mg subcutaneous twice daily (1 mg/kg BID) was started together with warfarin to keep INR 2-3. In addition to the unusual location in the left upper extremity in our case, the absence of common etiologic factors makes our case of Paget-Schroetter Syndrome a very unique one. Presently, there is a lack of guided management of rare conditions such as our case, or consensus among the sources. Physicians should be aware of this rare disease since untreated conditions may be debilitating for the patient and very costly especially if diagnosed with a delay.

  9. Systematic review of disease-modifying antirheumatic drugs for juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Kemper Alex R

    2012-03-01

    Full Text Available Abstract Background Treatment of juvenile idiopathic arthritis (JIA with disease-modifying antirheumatic drugs (DMARDs may improve outcomes compared to conventional therapy (e.g., non-steroidal anti-inflammatory drugs, intra-articular corticosteroids. The purpose of this systematic review was to evaluate the comparative effectiveness and safety of DMARDs versus conventional therapy and versus other DMARDs. Results A systematic evidence review of 156 reports identified in MEDLINE®, EMBASE®, and by hand searches. There is some evidence that methotrexate is superior to conventional therapy. Among children who have responded to a biologic DMARD, randomized discontinuation trials suggest that continued treatment decreases the risk of having a flare. However, these studies evaluated DMARDs with different mechanisms of action (abatacept, adalimumab, anakinra, etanercept, intravenous immunoglobulin, tocilizumab and used varying comparators and follow-up periods. Rates of serious adverse events are similar between DMARDs and placebo in published trials. This review identified 11 incident cases of cancer among several thousand children treated with one or more DMARD. Conclusions Few data are available to evaluate the comparative effectiveness of either specific DMARDs or general classes of DMARDs. However, based on the overall number, quality, and consistency of studies, there is moderate strength of evidence to support that DMARDs improve JIA-associated symptoms. Limited data suggest that short-term risk of cancer is low.

  10. Inflammatory cervicovaginal cytology is associated with disease activity in juvenile systemic lupus erythematosus.

    Science.gov (United States)

    Febronio, M V; Pereira, R M R; Bonfa, E; Takiuti, A D; Pereyra, E A G; Silva, C A A

    2007-01-01

    To evaluate cervicovaginal cytology in adolescents with juvenile systemic lupus erythematosus (JSLE) and to compare them to controls. Fifty-two female adolescents with JSLE (ACR criteria) were compared to 52 age-matched healthy controls. All Pap smears were evaluated by the same cytopathologist blinded to gynecology examination (Bethesda 2001). The mean age of JSLE patients and controls were similar (16.17 +/- 1.94 versus 16.13 +/- 2.16 years, P = 0.92). The cervicovaginal cytology was found to be similar in both groups, although sexual intercourses in the last month were less frequent in JSLE than controls (23% versus 59.6%, P = 0.0003). Only one patient (2%) with JSLE versus two controls (4%) had cervical dysplasia (LGSIL) and human papilomavirus (P = 1.0). Candida spp vaginitis was observed in seven JSLE (14%) versus none in controls (P = 0.012) and was associated with immunosuppressive drugs (P = 0.01) and high dose of prednisone (P = 0.002). Of interest, inflammatory cervicovaginal cytology was observed in 21 (60%) of patients with SLEDAI > or = 4 and only four (23%) of those with SLEDAI < 4 (P = 0.001). Likewise, a higher frequency of inflammatory changes was also observed in virgin JSLE (57% versus 8%, P = 0.005). Our findings supports the notion that female genital tract may be a potential target organ in SLE since cervical inflammation is associated to disease activity independently of sexual activity.

  11. Juvenile idiopathic arthritis in adulthood: fulfilment of classification criteria for adult rheumatic diseases, long-term outcomes and predictors of inactive disease, functional status and damage

    Science.gov (United States)

    Oliveira-Ramos, Filipa; Eusébio, Mónica; M Martins, Fernando; Mourão, Ana Filipa; Furtado, Carolina; Campanilho-Marques, Raquel; Cordeiro, Inês; Ferreira, Joana; Cerqueira, Marcos; Figueira, Ricardo; Brito, Iva; Santos, Maria José; Melo-Gomes, José A; Fonseca, João Eurico

    2016-01-01

    Objectives To determine how adult juvenile idiopathic arthritis (JIA) patients fulfil classification criteria for adult rheumatic diseases, evaluate their outcomes and determine clinical predictors of inactive disease, functional status and damage. Methods Patients with JIA registered on the Rheumatic Diseases Portuguese Register (Reuma.pt) older than 18 years and with more than 5 years of disease duration were included. Data regarding sociodemographic features, fulfilment of adult classification criteria, Health Assessment Questionnaire, Juvenile Arthritis Damage Index—articular (JADI-A) and Juvenile Arthritis Damage Index—extra-articular (JADI-E) damage index and disease activity were analysed. Results 426 patients were included. Most of patients with systemic JIA fulfilled criteria for Adult Still's disease. 95.6% of the patients with rheumatoid factor (RF)-positive polyarthritis and 57.1% of the patients with RF-negative polyarthritis matched criteria for rheumatoid arthritis (RA). 38.9% of the patients with extended oligoarthritis were classified as RA while 34.8% of the patients with persistent oligoarthritis were classified as spondyloarthritis. Patients with enthesitis-related arthritis fulfilled criteria for spondyloarthritis in 94.7%. Patients with psoriatic arthritis maintained this classification. Patients with inactive disease had lower disease duration, lower diagnosis delay and corticosteroids exposure. Longer disease duration was associated with higher HAQ, JADI-A and JADI-E. Higher JADI-A was also associated with biological treatment and retirement due to JIA disability and higher JADI-E with corticosteroids exposure. Younger age at disease onset was predictive of higher HAQ, JADI-A and JADI-E and decreased the chance of inactive disease. Conclusions Most of the included patients fulfilled classification criteria for adult rheumatic diseases, maintain active disease and have functional impairment. Younger age at disease onset was predictive

  12. Validity and predictive ability of the juvenile arthritis disease activity score based on CRP versus ESR in a Nordic population-based setting

    DEFF Research Database (Denmark)

    Nordal, E B; Zak, Marek Stanislaw; Aalto, K

    2012-01-01

    To compare the juvenile arthritis disease activity score (JADAS) based on C reactive protein (CRP) (JADAS-CRP) with JADAS based on erythrocyte sedimentation rate (ESR) (JADAS-ESR) and to validate JADAS in a population-based setting.......To compare the juvenile arthritis disease activity score (JADAS) based on C reactive protein (CRP) (JADAS-CRP) with JADAS based on erythrocyte sedimentation rate (ESR) (JADAS-ESR) and to validate JADAS in a population-based setting....

  13. Estudio molecular de la enfermedad ósea de Paget

    OpenAIRE

    2016-01-01

    [ES]La Enfermedad Ósea de Paget es una enfermedad que se define como un trastorno esquelético, focal y crónico. Se produce debido a que los osteoclastos aumentan en número, tamaño y actividad. El recambio óseo se acelera, con un gran aumento de la resorción ósea acoplada a una formación excesiva y desorganizada de hueso; lo que genera un hueso no laminar (plexiforme) muy vascularizado, aumentado de volumen y con resistencia disminuida. Sus principales manifestaciones clínicas son el dolor, la...

  14. Telangiectatic osteosarcoma of the skull. A post-Paget case.

    Science.gov (United States)

    Donato, G; Lavano, A; Volpentesta, G; Chirchiglia, D; Veraldi, A; De Rose, F; Iannello, A N; Stroscio, C; Signorelli, C D

    1997-01-01

    We report a case of post-Paget telangiectatic osteosarcoma of the skull in a 75-year-old woman. Such a neoplasia is a rare variant of osteosarcoma, a tumor rare in the cranic bones. The patient was submitted for a careful analysis by the following procedures: technetium scintigram, X-rays, CT scan, and MRI. After the surgical procedure, pathological examination confirmed the diagnosis. Both radiological and pathological pattern of this tumor are discussed in relation to the differential diagnosis. Our report shows that benign lesions may represent a possible cause of diagnostic errors. They must be excluded by histological analysis.

  15. Increased IgE serum levels are unrelated to allergic and parasitic diseases in patients with juvenile systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Bernadete L. Liphaus

    2012-11-01

    Full Text Available OBJECTIVE: The aim of this study was to assess the IgE serum levels in juvenile systemic lupus erythematosus patients and to evaluate possible associations with clinical and laboratory features, disease activity and tissue damage. METHODS: The IgE serum concentrations in 69 consecutive juvenile systemic lupus erythematosus patients were determined by nephelometry. IgG, IgM and IgA concentrations were measured by immunoturbidimetry. All patients were negative for intestinal parasites. Statistical analysis methods included the Mann-Whitney, chi-square and Fisher's exact tests, as well as the Spearman rank correlation coefficient. RESULTS: Increased IgE concentrations above 100 IU/mL were observed in 31/69 (45% juvenile systemic lupus erythematosus patients. The mean IgE concentration was 442.0 ± 163.4 IU/ml (range 3.5-9936.0 IU/ml. Fifteen of the 69 patients had atopic disease, nine patients had severe sepsis and 56 patients presented with nephritis. The mean IgE level in 54 juvenile systemic lupus erythematosus patients without atopic manifestations was 271.6 ± 699.5 IU/ml, and only nine of the 31 (29% patients with high IgE levels had atopic disease. The IgE levels did not statistically differ with respect to the presence of atopic disease, severe sepsis, nephritis, disease activity, or tissue damage. Interestingly, IgE concentrations were inversely correlated with C4 levels (r = -0.25, p = 0.03 and with the SLICC/ACR-DI score (r = -0.34, p = 0.005. The IgE concentration was also found to be directly correlated with IgA levels (r = 0.52, p = 0.03. CONCLUSIONS: The present study demonstrated for the first time that juvenile systemic lupus erythematosus patients have increased IgE serum levels. This increase in IgE levels was not related to allergic or parasitic diseases. Our results are in line with the hypothesis that high IgE levels can be considered a marker of immune dysregulation.

  16. Thoracic Aortic Disease in Two Patients with Juvenile Polyposis Syndrome and SMAD4 mutations

    Science.gov (United States)

    Teekakirikul, Polakit; Milewicz, Dianna M.; Miller, David T.; Lacro, Ronald V.; Regalado, Ellen S.; Rosales, Ana Maria; Ryan, Daniel P.; Toler, Tomi L.; Lin, Angela E.

    2012-01-01

    Dilation or aneurysm of the ascending aorta can progress to acute aortic dissection (Thoracic Aortic Aneurysms and Aortic Dissections, TAAD). Mutations in genes encoding TGF-β related proteins (TGFBR1, TGFBR2, FBN1, and SMAD3) cause syndromic and inherited TAAD. SMAD4 mutations are associated with juvenile polyposis (JPS) and a combined JPS-hereditary hemorrhagic telangiectasia (HHT) known as JPS-HHT. A family with JPS-HHT was reported to have aortic root dilation and mitral valve abnormalities. We report on two patients with JPS-HHT with SMAD4 mutations associated with thoracic aortic disease. The first patient, an 11-year-old boy without Marfan syndrome features, had JPS and an apparently de novo SMAD4 mutation (c.1340_1367dup28). Echocardiography showed mild dilation of the aortic annulus and aortic root, and mild dilation of the sinotubular junction and ascending aorta. Computed tomography confirmed aortic dilation and showed small pulmonary arteriovenous malformations (PAVM). The second patient, a 34-year-old woman with colonic polyposis, HHT, and Marfan syndrome, had a SMAD4 mutation (c.1245_1248delCAGA). Echocardiography showed mild aortic root dilation. She also had PAVM and hepatic focal nodular hyperplasia. Her family history was significant for polyposis, HHT, thoracic aortic aneurysm, and dissection and skeletal features of Marfan syndrome in her father. These two cases confirm the association of thoracic aortic disease with JPS-HHT resulting from SMAD4 mutations. We propose that the thoracic aorta should be screened in patients with SMAD4 mutations to prevent untimely death from dissection. This report also confirms that SMAD4 mutations predispose to TAAD. PMID:23239472

  17. Investigation of type 1 diabetes and coeliac disease susceptibility loci for association with juvenile idiopathic arthritis

    Science.gov (United States)

    Hinks, Anne; Martin, Paul; Flynn, Edward; Eyre, Steve; Packham, Jon; Barton, Anne; Worthington, Jane; Thomson, Wendy

    2010-01-01

    Background There is strong evidence suggesting that juvenile idiopathic arthritis (JIA) shares many susceptibility loci with other autoimmune diseases. Objective To investigate variants robustly associated with type 1 diabetes (T1D) or coeliac disease (CD) for association with JIA. Methods Sixteen single-nucleotide polymorphisms (SNPs) already identified as susceptibility loci for T1D/CD were selected for genotyping in patients with JIA (n=1054) and healthy controls (n=3129). Genotype and allele frequencies were compared using the Cochrane–Armitage trend test implemented in PLINK. Results One SNP in the LPP gene, rs1464510, showed significant association with JIA (ptrend=0.002, OR=1.18, 95% CI 1.06 to 1.30). A second SNP, rs653178 in ATXN2, also showed nominal evidence for association with JIA (ptrend=0.02, OR=1.13, 95% CI 1.02 to 1.25). The SNP, rs17810546, in IL12A showed subtype-specific association with enthesitis-related arthritis (ERA) subtype (ptrend=0.005, OR=1.88, 95% CI 1.2 to 2.94). Conclusions Evidence for a novel JIA susceptibility locus, LPP, is presented. Association at the SH2B3/ATXN2 locus, previously reported to be associated with JIA in a US series, also supports this region as contributing to JIA susceptibility. In addition, a subtype-specific association of IL12A with ERA is identified. All findings will require validation in independent JIA cohorts. PMID:20647273

  18. Clinical and Genetic Characteristics of Mexican Patients with Juvenile Presentation of Niemann-Pick Type C Disease

    Directory of Open Access Journals (Sweden)

    Raul E. Piña-Aguilar

    2014-01-01

    Full Text Available Niemann-Pick type C disease (NPC is a rare lysosomal disease with a protean presentation, ranging from a fatal neonatal course with visceromegaly to an adult presentation with only neurological or psychiatric symptomatology. In this report we describe the genetic and clinical characteristics of 3 Mexican patients from different families with juvenile presentation of NPC. Clinical examination, imaging of central nervous and gastrointestinal system, and EEG were performed. Genetic studies include sequencing and deletion/duplication analysis of NPC1 and NPC2 genes. All patients presented with cognitive impairment, ataxia, and supranuclear vertical gaze palsy; one case had gelastic cataplexy. Also they developed epilepsy and cortical atrophy and two patients had thinning of corpus callosum. The 3 patients were compound heterozygotes for NPC1 sequence variants, including 5 missense and 1 nonsense mutations: p.P1007A and p.F1087L in Case 1; p.Q921P and p.G992R in Case 2; and p.R348* and p.V1165M in case 3. Mexican patients with juvenile NPC presented with a variable clinical phenotype and compound heterozygosity. This suggests a relative high frequency of mutation carriers as it is reported for European population. Consequently, clinicians should consider NPC as a diagnosis possibility in any adolescent or young adult patient with juvenile dementia and/or ataxia, even in absence of gelastic cataplexy and supranuclear vertical gaze palsy.

  19. Heart Disease, Hypertension, Gestational Diabetes Mellitus, and Preeclampsia/Eclampsia in Mothers With Juvenile Arthritis: A Nested Case-Control Study.

    Science.gov (United States)

    Feldman, Debbie E; Vinet, Évelyne; Bérard, Anick; Duffy, Ciarán; Hazel, Beth; Meshefedjian, Garbis; Sylvestre, Marie-Pierre; Bernatsky, Sasha

    2017-02-01

    To determine whether women with a history of juvenile arthritis are at higher risk for heart disease and hypertension and for developing adverse maternal outcomes: gestational diabetes mellitus, maternal hypertension, and preeclampsia/eclampsia. We designed a nested case-control study from a cohort of first-time mothers with prior physician billing codes suggesting juvenile arthritis, and a matched comparison group without juvenile arthritis. For the nested case-control design, we selected 3 controls for each case for the outcomes of heart disease (n = 403), prepregnancy hypertension (n = 66), gestational diabetes mellitus (n = 285), maternal hypertension (n = 561), and preeclampsia/eclampsia (n = 236). We used conditional logistic regression, adjusting for maternal age and education. Having juvenile arthritis was associated with heart disease (odds ratio [OR] 2.44 [95% confidence interval (95% CI) 1.15-5.15]) but not with gestational hypertension, diabetes mellitus, or preeclampsia/eclampsia. All 66 cases of prepregnancy hypertension had juvenile arthritis. Having prepregnancy hypertension was strongly associated with preeclampsia/eclampsia (OR 8.05 [95% CI 2.69-24.07]). Women with a history of juvenile arthritis had a higher risk of heart disease. This risk signals the potential importance of cardiac prevention strategies in juvenile arthritis. As this was a retrospective study, it was not possible to correct for some relevant potential confounders. Further studies should assess the impact of medications, disease severity, and other factors (e.g., obesity) on cardiac outcomes in juvenile arthritis. © 2016, American College of Rheumatology.

  20. The significance of elevated serologic markers of celiac disease in children with juvenile rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Al-Mayouf Sulaiman

    2003-01-01

    Full Text Available Aim: The aim of this study is to determine the frequency of celiac disease (CD in a group of children with juvenile rheumatoid arthritis (JRA and determine the correlation between the presence of the serologic markers and the histological diagnosis of CD. Patients and Methods : Forty-two children (24 females with JRA, aged between 5-15 years underwent study of serologic markers for CD (gliadin-IgA, gliadin-IgG, reticulin and endomysium-IgA antibodies. Endoscopic intestinal biopsy was performed in patients who had positive serologic markers for CD. The diagnosis of CD was based on the classic finding of villous atrophy and crypt hypertrophy. Results: Eighteen patients (42.8% had serologic markers for CD; ten of them with a systemic form, five with a polyarticular form and three with a pauciarticular form of JRA. Levels of AGA -IgG were high in 14 patients (77.8%, four patients (22.2% had high levels of AGA-IgA and seven patients (38.9% had anti-endomysium antibodies (AEA. One patient had anti-reticulin antibodies (ARA 5.5%. Sixteen patients underwent intestinal biopsy; in only one patient with AEA antibodies (2.38%, biopsy revealed typical finding of CD. The patient with CD showed improvement in both growth parameter as well as articular symptoms after starting gluten-free diet Conclusion: Our study shows that the screening for silent CD among children with JRA may be useful. Those patients with AEA need further follow up since these antibodies are quite sensitive and specific for CD

  1. Ongoing disease activity and changing categories in a long-term nordic cohort study of juvenile idiopathic arthritis

    DEFF Research Database (Denmark)

    Nordal, Ellen; Zak, Marek; Aalto, Kristiina

    2011-01-01

    OBJECTIVE: The aim of the study was to describe disease characteristics, long-term course and outcome of juvenile idiopathic arthritis (JIA) in a population-based setting. METHODS: Consecutive cases of JIA from defined geographical areas of Denmark, Finland, Sweden and Norway with disease onset...... repeated visits with last visit more than seven years after disease onset (median 98 months, range 84-147). Changes in ILAR category occurred in 10.8% of the children, in addition to extended oligoarthritis developing in 34.8% of the oligoarticular group. Disease modifying anti-rheumatic drugs (DMARD......), including biologic medications, were used in 58.0% of the children during the observation period. Ongoing disease activity was mostly mild, but 22.9% developed some JIA-related damage. At the last follow-up, remission off medication was found in 42.4% of the children, 8.9% were in remission on medication...

  2. Erythrocyte-methotrexate and disease activity in children treated with oral methotrexate for juvenile chronic arthritis

    DEFF Research Database (Denmark)

    Kristensen, K; Nielsen, S; Karup Pedersen, F;

    2000-01-01

    The concentration of methotrexate (MTX) in erythrocytes (E-MTX) was measured twice with three months interval in 21 children suffering from juvenile chronic arthritis (JCA). At the same time joint score, visual analogue scale (VAS), and laboratory parameters (CRP, WBC, PMNs, and ALAT) were obtained...

  3. The Growth Attainment, Hematological, Iron Status and Inflammatory Profile of Guatemalan Juvenile End-Stage Renal Disease Patients.

    Directory of Open Access Journals (Sweden)

    Juliana Casimiro de Almeida

    Full Text Available Stunting, anemia and inflammation are frequently observed in children with end-stage renal disease (ESRD.To assess anthropometric, hematological and inflammatory data and to study their potential interrelationship in Guatemalan juveniles undergoing hemodialysis (HD and peritoneal dialysis (PD.54 juveniles 7-20 years of age were recruited in FUNDANIER, Guatemala City: 27 on HD and 27 PD. Hemoglobin, serum iron, transferrin, serum transferrin receptor (sTfR, serum ferritin, transferrin saturation and iron-binding capacity, white blood cell count (WBC, erythrocyte sedimentation rate (ESR, C-reactive protein (CRP, as well as IL-6, IL-1 and TNF-α, weight and height were determined by standard methods. Hepcidin-25 (Hep-25 was assessed by weak cation exchange time-of-flight mass-spectrometry.92% and 55% of HD and PD children, respectively, were stunted and 95% and 85% were anemic. Among iron status biomarkers, serum ferritin was massively increased and significantly higher in the HD group compared to the PD group. Hep-25 was also greatly elevated in both groups. 41% of HD patients showed increments in three or more inflammatory biomarkers, while it was 2 or less in all PD subjects.The degree of stunting, the prevalence and severity of anemia in Guatemalan juvenile ESRD far exceed the national statistics for this low-income Central American country. Ferritin and Hep-25 concentrations were elevated, with the latter to an extraordinary magnitude. Additional biomarkers of inflammation not directly related to iron status were elevated as well. The role of both disease- and environment-related factors in combination best explains the magnitude of the biomarker abnormalities.

  4. An Animal Model for the Juvenile Non-Alcoholic Fatty Liver Disease and Non-Alcoholic Steatohepatitis

    Science.gov (United States)

    Marin, Veronica; Rosso, Natalia; Dal Ben, Matteo; Raseni, Alan; Boschelle, Manuela; Degrassi, Cristina; Nemeckova, Ivana; Nachtigal, Petr; Avellini, Claudio; Tiribelli, Claudio; Gazzin, Silvia

    2016-01-01

    Non Alcoholic Fatty Liver Disease (NAFLD) and Non-Alcoholic Steatohepatitis (NASH) are the hepatic manifestations of the metabolic syndrome; worrisome is the booming increase in pediatric age. To recreate the full spectrum of juvenile liver pathology and investigate the gender impact, male and female C57Bl/6 mice were fed with high fat diet plus fructose in the drinking water (HFHC) immediately after weaning (equal to 3-years old human), and disease progression followed for 16 weeks, until adults (equal to 30-years old human). 100% of subjects of both genders on HFHC diet developed steatosis in 4weeks, and some degree of fibrosis in 8weeks, with the 86% of males and 15% of females presenting a stage 2 fibrosis at 16weeks. Despite a similar final liver damage both groups, a sex difference in the pathology progression was observed. Alterations in glucose homeostasis, dyslipidemia, hepatomegaly and obese phenotype were evident from the very beginning in males with an increased hepatic inflammatory activity. Conversely, such alterations were present in females only at the end of the HFHC diet (with the exception of insulin resistance and the hepatic inflammatory state). Interestingly, only females showed an altered hepatic redox state. This juvenile model appears a good platform to unravel the underlying gender dependent mechanisms in the progression from NAFLD to NASH, and to characterize novel therapeutic approaches. PMID:27391242

  5. Juvenile Scleroderma

    Science.gov (United States)

    Juvenile Scleroderma INTRODUCTION Every parent will experience a moment of panic when told their child has scleroderma. ... in all their family members as well. CONCLUSION Juvenile scleroderma can be unsettling for the child and ...

  6. Osteoclast Inhibitory Peptide-1 Therapy for Paget’s Disease

    Science.gov (United States)

    2010-08-01

    of the murine Ly-6 family, is induced by retinoic acid during the differentiation of acute promyelocytic leukemia cell. Proc Natl Acad Sci USA 93:5910...and Maloney murine leukemia virus reverse transcriptase (Applied Biosystems). The resulting cDNAs were subjected to quantitative real-time RT-PCR

  7. Osteoclast Inhibitory Peptide-1 Therapy for Paget’s Disease

    Science.gov (United States)

    2011-08-01

    autosomal dominant trait with genetic heterogeneity and characterized by highly localized areas of bone turnover with increased osteoclast ( OCL ) actively followed by an exaggerated osteoblast response.

  8. Extremely elevated IL-18 levels may help distinguish systemic-onset juvenile idiopathic arthritis from other febrile diseases

    Directory of Open Access Journals (Sweden)

    Y. Xia

    Full Text Available The aim of this research was to explore whether IL-18 can be a serological marker for the diagnosis of systemic-onset juvenile idiopathic arthritis (sJIA. A total of 23 sJIA patients (13 males, median age 8.2, 20 acute lymphoblastic leukemia (ALL patients, 18 patients with severe infections (SIF, 26 Kawasaki disease (KD patients, 18 juvenile idiopathic arthritis (JIA patients, and 25 healthy control patients were selected for this study. Enzyme-linked immunosorbent assays (ELISAs were used to determine the serum concentrations of the S100A8, S100A9, and IL-6 proteins. The serum IL-18 levels were detected by a cytometric bead array (CBA. The serum IL-6 concentrations in various disease groups were significantly higher than that in the healthy control group. The IL-6 concentrations exhibited no significant difference between disease groups. The S100A8 level in the sJIA group was significantly higher than those of the ALL, JIA, and healthy control groups but showed no significant difference compared to the SIF and KD groups. The S100A9 serum concentration in the sJIA group was significantly higher than those in the ALL and healthy control groups and exhibited no significant difference from the SIF, KD, and JIA groups. The IL-18 level of the sJIA group was significantly higher than that of the other febrile disease groups. The IL-18 serum concentration may be used as a biological serum marker to distinguish sJIA from other febrile diseases.

  9. Extremely elevated IL-18 levels may help distinguish systemic-onset juvenile idiopathic arthritis from other febrile diseases

    Science.gov (United States)

    Xia, Y.; Cui, P.; Li, Q.; Liang, F.; Li, C.; Yang, J.

    2017-01-01

    The aim of this research was to explore whether IL-18 can be a serological marker for the diagnosis of systemic-onset juvenile idiopathic arthritis (sJIA). A total of 23 sJIA patients (13 males, median age 8.2), 20 acute lymphoblastic leukemia (ALL) patients, 18 patients with severe infections (SIF), 26 Kawasaki disease (KD) patients, 18 juvenile idiopathic arthritis (JIA) patients, and 25 healthy control patients were selected for this study. Enzyme-linked immunosorbent assays (ELISAs) were used to determine the serum concentrations of the S100A8, S100A9, and IL-6 proteins. The serum IL-18 levels were detected by a cytometric bead array (CBA). The serum IL-6 concentrations in various disease groups were significantly higher than that in the healthy control group. The IL-6 concentrations exhibited no significant difference between disease groups. The S100A8 level in the sJIA group was significantly higher than those of the ALL, JIA, and healthy control groups but showed no significant difference compared to the SIF and KD groups. The S100A9 serum concentration in the sJIA group was significantly higher than those in the ALL and healthy control groups and exhibited no significant difference from the SIF, KD, and JIA groups. The IL-18 level of the sJIA group was significantly higher than that of the other febrile disease groups. The IL-18 serum concentration may be used as a biological serum marker to distinguish sJIA from other febrile diseases. PMID:28225869

  10. Juvenile Spondyloarthritis Treatment Recommendations

    OpenAIRE

    Tse, Shirley; Burgos-Vargas, Ruben; Colbert, Robert A

    2012-01-01

    No specific recommendations for the treatment of juvenile spondyloarthritis have been established. Important differences exist in how spondyloarthritis begins and progresses in children and adults, supporting the need for pediatric-specific recommendations. Recently published recommendations for the treatment of juvenile arthritis consider children with sacroiliitis in a separate group, and allow for more accelerated institution of a TNF inhibitor depending on disease activity and prognostic ...

  11. Interaction of infection with Renibacterium salmoninarum and physical stress in juvenile chinook salmon: Physiological responses, disease progression, and mortality

    Science.gov (United States)

    Mesa, M.G.; Maule, A.G.; Schreck, C.B.

    2000-01-01

    We experimentally infected juvenile spring chinook salmon Oncorhynchus tshawytscha with Renibacterium salmoninarum (Rs), the causative agent of bacterial kidney disease (BKD), in order to compare the physiological responses of Rs-infected and Rs-noninfected fish to a series of multiple, acute stressors and to determine whether exposure to these stressors worsens the infection and leads to increased mortality. After subjecting groups of fish to a waterborne challenge of Rs, we sampled them biweekly to monitor infection levels, mortality, and some stress-related physiological changes. As infections worsened, fish developed decreased hematocrits and blood glucose levels and increased levels of cortisol and lactate, indicating that BKD is stressful, particularly during the later stages. Eight weeks after the challenge, when fish had moderate to high infection levels, we subjected them, along with unchallenged control fish, to three 60-s bouts of hypoxia, struggling, and mild agitation that were separated by 48-72 h. Our results indicate that the imposition of these stressors on Rs-infected fish did not lead to higher infection levels or increased mortality when compared with diseased fish that did not receive the stressors. Furthermore, the kinetics of plasma cortisol, glucose, and lactate over a 24-h period following each application of the stressor were similar between fish with moderate to high Rs infections and those that had low or no detectable infection. Some differences in the stress responses of these two groups did exist, however. Most notably, fish with moderate to high Rs infections had higher titers of cortisol and lactate prior to each application of the stressor and also were unable to consistently elicit a significant hyperglycemia in response to the stressors. Collectively, our results should be important in understanding the impact that BKD has on the survival of juvenile salmonids, but we caution that our results represent the combined effects of one

  12. Effects of the live attenuated measles-mumps-rubella booster vaccination on disease activity in patients with juvenile idiopathic arthritis : a randomized trial

    NARCIS (Netherlands)

    Heijstek, Marloes W; Kamphuis, Sylvia; Armbrust, Wineke; Swart, Joost; Gorter, Simone; de Vries, Lara D; Smits, Gaby P; van Gageldonk, Pieter G; Berbers, Guy A M; Wulffraat, Nico M

    2013-01-01

    IMPORTANCE: The immunogenicity and the effects of live attenuated measles-mumps-rubella (MMR) vaccination on disease activity in patients with juvenile idiopathic arthritis (JIA) are matters of concern, especially in patients treated with immunocompromising therapies. OBJECTIVES: To assess whether M

  13. CD28⁻ CD8⁺ T cells are significantly reduced and correlate with disease duration in juveniles with type 1 diabetes.

    Science.gov (United States)

    Yarde, Danielle N; Lorenzo-Arteaga, Kristina; Corley, Kevin P; Cabrera, Monina; Sarvetnick, Nora E

    2014-10-01

    Type 1 diabetes (T1D) is a chronic disease caused by autoimmune destruction of insulin-producing pancreatic β-cells. T1D is typically diagnosed in children, but information regarding immune cell subsets in juveniles with T1D is scarce. Therefore, we studied various lymphocytic populations found in the peripheral blood of juveniles with T1D compared to age-matched controls (ages 2-17). One population of interest is the CD28(-) CD8(+) T cell subset, which are late-differentiated cells also described as suppressors. These cells are altered in a number of disease states and have been shown to be reduced in adults with T1D. We found that the proportion of CD28(-) cells within the CD8(+) T cell population is significantly reduced in juvenile type 1 diabetics. Furthermore, this reduction is not correlated with age in T1D juveniles, although a significant negative correlation between proportion CD28(-) CD8(+) T cells and age was observed in the healthy controls. Finally, correlation analysis revealed a significant and negative correlation between the proportion of CD28(-) CD8(+) T cells and T1D disease duration. These findings show that the CD28(-) CD8(+) T cell population is perturbed following onset of disease and may prove to be a valuable marker for monitoring the progression of T1D.

  14. HLA-B27 predicts a more extended disease with increasing age at onset in boys with juvenile idiopathic arthritis

    DEFF Research Database (Denmark)

    Berntson, Lillemor; Damgård, Michael; Andersson-Gäre, Boel

    2008-01-01

    OBJECTIVE: Juvenile idiopathic arthritis (JIA) is a heterogeneous condition with very few clinical and laboratory signs that can help predict the course and severity of the disease in the individual patient. The cell-surface antigen HLA-B27 is well known to be associated with spondyloarthropathies...... to a population-based study as possible. METHODS: We studied an incidence-based cohort of 305 patients collected prospectively in 3 Nordic countries (Sweden, Norway, Denmark). Clinical and serological data of the first 3 years of the disease were collected. RESULTS: HLA-B27 was found to be positive in 25.......5% of the patients, and we found a higher proportion of HLA-B27-positive boys with older age at disease onset (p=0.034). Regression analysis showed a correlation of 0.7 in the HLA-B27-positive boys, pointing to a higher risk of more joint involvement with older age at disease onset. By Fisher's exact test...

  15. Synovial and inflammatory diseases in childhood: role of new imaging modalities in the assessment of patients with juvenile idiopathic arthritis

    Energy Technology Data Exchange (ETDEWEB)

    Damasio, Maria Beatrice [G. Gaslini Institute, Department of Diagnostic Imaging, Genoa (Italy); Malattia, Clara [G. Gaslini Institute, Department of Pediatrics 2, Genoa (Italy); Martini, Alberto [University of Genova, Department of Pediatrics, Genoa (Italy); Toma, Paolo [Bambin Gesu Pediatric Hospital, Rome (Italy)

    2010-06-15

    Juvenile idiopathic arthritis (JIA) represents a group of heterogeneous diseases characterized by a chronic inflammatory process primarily targeting the synovial membrane. A persistent synovitis is associated with an increased risk of osteocartilaginous damage. With the advent of effective structure-modifying treatment for JIA, it may be possible to significantly reduce or even completely prevent structural damage and associated functional disability. The trend towards early suppression of inflammation, in order to prevent erosive disease, shifts the emphasis away from conventional radiographic detectable structural damage to the slightest traces of early joint damage, and drives the need for alternative imaging techniques more sensitive in detecting early signs of disease activity and damage. In this regard MRI and US are playing an increasing role in the evaluation of arthritic joints. This article will review the key aspects of the current status and recent important advances of imaging techniques available to investigate the child with rheumatic disease, briefly discussing conventional radiography, and particularly focusing on MRI and US. In this era of advancing imaging technology, knowledge of the relative values of available imaging techniques is necessary to optimize the management of children with JIA. (orig.)

  16. Juvenile mammary papillomatosis; Papilomatosis juvenil mamaria

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez, M.; Jimenez, A. V. [Hospital Reina Sofia. Cordoba (Spain)

    2001-07-01

    Juvenile mammary papillomatosis is a benign proliferative disease of young patients, generally under 30 years of age. The most frequent clinical presentation is the existence of an elastic and mobile lymph node of the breast. Anatomopathologically, it is characterized because it presents ductal epithelial hyperplasia, sometimes with marked atypia, and there are numerous cysts having different sizes among the findings. It has been associated with an increase in the incidence of breast cancer, both in the patient herself as well as her family. We review the literature on the subject and present the mammographic and ultrasonographic findings of a 22 year old woman diagnosed of juvenile mammary papillomatosis. (Author) 12 refs.

  17. A pruritic linear urticarial rash, fever, and systemic inflammatory disease in five adolescents: adult-onset still disease or systemic juvenile idiopathic arthritis sine arthritis?

    Science.gov (United States)

    Prendiville, Julie S; Tucker, Lori B; Cabral, David A; Crawford, Richard I

    2004-01-01

    The characteristic rash of systemic juvenile idiopathic arthritis is a transient erythematous eruption associated with a quotidian spiking fever. Usually asymptomatic, it can be pruritic, with dermatographism at sites of scratching or pressure. An illness similar to this entity in adults is designated adult-onset Still disease. The relationship between the pediatric and adult disease is uncertain and differences in case definition have evolved. Specifically, a sustained arthritis for at least 6 weeks is required for a diagnosis of systemic juvenile idiopathic arthritis, whereas transient arthritis and arthralgia are accepted criteria in adult-onset Still disease. We describe five patients less than 16 years of age who presented with an acute illness characterized by fever and a distinctive skin eruption. Intense pruritus and linear erythematous lesions flared with a spiking fever, usually in the late afternoon and evening. Periorbital edema/erythema and nonlinear urticarial lesions were also seen. Two children had splinter hemorrhages of the nail beds and one girl developed a fixed, scaling, pigmented, linear eruption. Severe malaise, myalgia, arthralgia, and leukocytosis were present in every patient. Other systemic manifestations included sore throat, transient arthritis, abdominal pain, lymphadenopathy, hepatomegaly, splenomegaly, hyperferritinemia, and hepatic dysfunction. No patient had a sustained arthritis. The course of the disease was variable. One patient, diagnosed with macrophage activation syndrome, recovered on oral naproxen. Two patients responded to systemic corticosteroid therapy. One girl developed status epilepticus and died from aspiration and asphyxia. A boy with severe hepatitis developed renal failure and thrombotic thrombocytopenic purpura and was treated with plasmapheresis, dialysis, and systemic corticosteroids; he had recurrent episodes of rash and fever into adult life. These children did not fulfill the case definition of systemic

  18. Juvenile Judge

    Institute of Scientific and Technical Information of China (English)

    1997-01-01

    SHANG Xiuyun was among the first sitting judges when the juvenile court was set up in Beijing 10 years ago. With enriched experience she has altered the way judges ask questions in court. She began the practice of inviting juvenile offenders, their parents, relatives, friends and teachers to the juvenile court to work hand in hand in dealing with cases: Facing their relatives and friends and hearing their heartfelt words, juvenile offenders would often be touched, thus bringing forth a positive attitude toward life.

  19. Juvenile idiopathic arthritis

    NARCIS (Netherlands)

    Prakken, Berent; Albani, Salvatore; Martini, Alberto

    2011-01-01

    Juvenile idiopathic arthritis is a heterogeneous group of diseases characterised by arthritis of unknown origin with onset before age of 16 years. Pivotal studies in the past 5 years have led to substantial progress in various areas, ranging from disease classification to new treatments. Gene expres

  20. Contrast-enhanced MRI compared with the physical examination in the evaluation of disease activity in juvenile idiopathic arthritis

    Energy Technology Data Exchange (ETDEWEB)

    Hemke, Robert; Maas, Mario [Academic Medical Centre, University of Amsterdam, Department of Radiology, Amsterdam (Netherlands); Veenendaal, Mira van; Kuijpers, Taco W. [University of Amsterdam, Department of Paediatric Haematology, Immunology, Rheumatology and Infectious Disease, Emma Children' s Hospital AMC, Amsterdam (Netherlands); Dolman, Koert M. [Department of Paediatric Rheumatology, Amsterdam (Netherlands); St. Lucas Andreas Hospital, Department of Paediatrics, Amsterdam (Netherlands); Rossum, Marion A.J. van; Berg, J.M. van den [University of Amsterdam, Department of Paediatric Haematology, Immunology, Rheumatology and Infectious Disease, Emma Children' s Hospital AMC, Amsterdam (Netherlands); Department of Paediatric Rheumatology, Amsterdam (Netherlands)

    2014-02-15

    To assess the value of magnetic resonance imaging (MRI) in discriminating between active and inactive juvenile idiopathic arthritis (JIA) patients and to compare physical examination outcomes with MRI outcomes in the assessment of disease status in JIA patients. Consecutive JIA patients with knee involvement were prospectively studied using an open-bore MRI. Imaging findings from 146 JIA patients were analysed (59.6 % female; mean age, 12.9 years). Patients were classified as clinically active or inactive. MRI features were evaluated using the JAMRIS system, comprising validated scores for synovial hypertrophy, bone marrow oedema, cartilage lesions and bone erosions. Inter-reader reliability was good for all MRI features (intra-class correlation coefficient [ICC] = 0.87-0.94). No differences were found between the two groups regarding MRI scores of bone marrow oedema, cartilage lesions or bone erosions. Synovial hypertrophy scores differed significantly between groups (P = 0.016). Nonetheless, synovial hypertrophy was also present in 14 JIA patients (35.9 %) with clinically inactive disease. Of JIA patients considered clinically active, 48.6 % showed no signs of MRI-based synovitis. MRI can discriminate between clinically active and inactive JIA patients. However, physical examination is neither very sensitive nor specific in evaluating JIA disease activity compared with MRI. Subclinical synovitis was present in >35 % of presumed clinically inactive patients. (orig.)

  1. Nosology of juvenile muscular atrophy of distal upper extremity: from monomelic amyotrophy to Hirayama disease--Indian perspective.

    Science.gov (United States)

    Hassan, Kaukab Maqbool; Sahni, Hirdesh

    2013-01-01

    Since its original description by Keizo Hirayama in 1959, "juvenile muscular atrophy of the unilateral upper extremity" has been described under many nomenclatures from the east. Hirayama disease (HD), also interchangeably referred to as monomelic amyotrophy, has been more frequently recognised in the west only in the last two decades. HD presents in adolescence and young adulthood with insidious onset unilateral or bilateral asymmetric atrophy of hand and forearm with sparing of brachioradialis giving the characteristic appearance of oblique amyotrophy. Symmetrically bilateral disease has also been recognized. Believed to be a cervical flexion myelopathy, HD differs from motor neuron diseases because of its nonprogressive course and pathologic findings of chronic microcirculatory changes in the lower cervical cord. Electromyography shows features of acute and/or chronic denervation in C7, C8, and T1 myotomes in clinically affected limb and sometimes also in clinically unaffected contralateral limb. Dynamic forward displacement of dura in flexion causes asymmetric flattening of lower cervical cord. While dynamic contrast magnetic resonance imaging is diagnostic, routine study has high predictive value. There is a need to lump all the nomenclatures under the rubric of HD as prognosis in this condition is benign and prompt diagnosis is important to institute early collar therapy.

  2. Serum ferritin levels as a useful diagnostic marker for the distinction of systemic juvenile idiopathic arthritis and Kawasaki disease.

    Science.gov (United States)

    Mizuta, Mao; Shimizu, Masaki; Inoue, Natsumi; Kasai, Kazuko; Nakagishi, Yasuo; Takahara, Tadamori; Hamahira, Kiyoshi; Yachie, Akihiro

    2016-11-01

    The clinical features and laboratory parameters of patients with Kawasaki disease (KD) and systemic juvenile idiopathic arthritis (s-JIA) tend to overlap. Furthermore, there have been no definitive biomarkers for these diseases, making clinical diagnosis difficult. The purpose of this study was to investigate the diagnostic value of serum ferritin levels for differentiating KD from s-JIA and predicting the disease severity of KD. We analyzed 228 patients with KD and 81 patients with s-JIA. Serum ferritin levels were compared between patients with s-JIA and KD. Furthermore, serum ferritin levels in patients with KD were compared with respect to clinical features such as responsiveness to intravenous immunoglobulin (IVIG) therapy. Serum ferritin levels in KD patients with no response to IVIG therapy were significantly higher than those in KD patients with a good response to IVIG therapy. Serum ferritin levels in patients with KD needing plasma exchange (PE) were significantly higher than those in patients not needing PE. However, serum ferritin levels overlapped between severe KD patients with nonresponsiveness to IVIG therapy or needing PE and other patients with mild KD. Furthermore, patients with s-JIA showed a distinct elevation of serum ferritin levels compared with KD patients. The cutoff value of serum ferritin levels for differentiating KD from s-JIA was 369.6 ng/ml. Serum ferritin levels were significantly elevated in s-JIA patients compared with KD patients. Measurement of serum ferritin levels can be useful for differentiating s-JIA from KD.

  3. Quantitative MR characterization of disease activity in the knee in children with juvenile idiopathic arthritis: a longitudinal pilot study

    Energy Technology Data Exchange (ETDEWEB)

    Workie, Dagnachew W. [University of Cincinnati, Department of Physics, Cincinnati, OH (United States); Cincinnati Children' s Hospital Medical Center, Imaging Research Center, Cincinnati, OH (United States); Graham, T.B. [Cincinnati Children' s Hospital Medical Center, Division of Rheumatology, Cincinnati, OH (United States); Laor, Tal; Racadio, Judy M. [Cincinnati Children' s Hospital Medical Center, Department of Pediatrics, Cincinnati, OH (United States); Cincinnati Children' s Hospital Medical Center, Department of Radiology, Cincinnati, OH (United States); Rajagopal, Akila; O' Brien, Kendall J.; Bommer, Wendy A. [Cincinnati Children' s Hospital Medical Center, Imaging Research Center, Cincinnati, OH (United States); Shire, Norah J. [University of Cincinnati, Division of Epidemiology and Biostatistics, Cincinnati, OH (United States); University of Cincinnati, Division of Digestive Diseases, Cincinnati, OH (United States); Dardzinski, Bernard J. [Cincinnati Children' s Hospital Medical Center, Imaging Research Center, Cincinnati, OH (United States); Cincinnati Children' s Hospital Medical Center, Department of Pediatrics, Cincinnati, OH (United States); Cincinnati Children' s Hospital Medical Center, Department of Radiology, Cincinnati, OH (United States)

    2007-06-15

    The development of a quantifiable and noninvasive method of monitoring disease activity and response to therapy is vital for arthritis management. The purpose of this study was to investigate the utility of quantitative dynamic contrast-enhanced MRI (DCE-MRI) based on pharmacokinetic (PK) modeling to evaluate disease activity in the knee and correlate the results with the clinical assessment in children with juvenile idiopathic arthritis (JIA). A group of 17 children with JIA underwent longitudinal clinical and laboratory assessment and DCE-MRI of the knee at enrollment, 3 months, and 12 months. A PK model was employed using MRI signal enhancement data to give three parameters, K{sup trans} ' (min{sup -1}), k{sub ep} (min{sup -1}), and V{sub p} ' and to calculate synovial volume. The PK parameters, synovial volumes, and clinical and laboratory assessments in most children were significantly decreased (P < 0.05) at 12 months when compared to the enrollment values. There was excellent correlation between the PK and synovial volume and the clinical and laboratory assessments. Differences in MR and clinical parameter values in individual subjects illustrate persistent synovitis when in clinical remission. A decrease in PK parameter values obtained from DCE-MRI in children with JIA likely reflects diminution of disease activity. This technique may be used as an objective follow-up measure of therapeutic efficacy in patients with JIA. MR imaging can detect persistent synovitis in patients considered to be in clinical remission. (orig.)

  4. Alteration of Fecal Microbiota Profiles in Juvenile Idiopathic Arthritis. Associations with HLA-B27 Allele and Disease Status

    Science.gov (United States)

    Di Paola, Monica; Cavalieri, Duccio; Albanese, Davide; Sordo, Maddalena; Pindo, Massimo; Donati, Claudio; Pagnini, Ilaria; Giani, Teresa; Simonini, Gabriele; Paladini, Alessia; Lionetti, Paolo; De Filippo, Carlotta; Cimaz, Rolando

    2016-01-01

    Alteration of gut microbiota is involved in several chronic inflammatory and autoimmune diseases, including rheumatoid arthritis, and gut microbial “pro-arthritogenic” profiles have been hypothesized. Intestinal inflammation may be involved in spondyloarthropathies and in a subset of patients affected by Juvenile Idiopathic Arthritis (JIA), the most common chronic rheumatic disease of childhood. We compared the fecal microbiota composition of JIA patients with healthy subjects (HS), evaluating differences in microbial profiles between sub-categories of JIA, such as enthesitis-related arthritis (JIA-ERA), in which inflammation of entheses occurs, and polyarticular JIA, non-enthesitis related arthritis (JIA-nERA). Through taxon-level analysis, we discovered alteration of fecal microbiota components that could be involved in subclinical gut inflammation, and promotion of joint inflammation. We observed abundance in Ruminococcaceae in both JIA categories, reduction in Clostridiaceae and Peptostreptococcaceae in JIA-ERA, and increase in Veillonellaceae in JIA-nERA, respectively, compared with HS. Among the more relevant genera, we found an increase in Clostridium cluster XIVb, involved in colitis and arthritis, in JIA-ERA patients compared with HS, and a trend of decrease in Faecalibacterium, known for anti-inflammatory properties, in JIA-nERA compared with JIA-ERA and HS. Differential abundant taxa identified JIA patients for the HLA-B27 allele, including Bilophila, Clostridium cluster XIVb, Oscillibacter, and Parvimonas. Prediction analysis of metabolic functions showed that JIA-ERA metagenome was differentially enriched in bacterial functions related to cell motility and chemotaxis, suggesting selection of potential virulence traits. We also discovered differential microbial profiles and intra-group variability among active disease and remission, suggesting instability of microbial ecosystem in autoimmune diseases with respect to healthy status. Similarly to

  5. Alteration of fecal microbiota profiles in juvenile idiopathic arthritis. Associations with HLA-B27 allele and disease status.

    Directory of Open Access Journals (Sweden)

    Monica Di Paola

    2016-10-01

    Full Text Available Alteration of gut microbiota is involved in several chronic inflammatory and autoimmune diseases, including rheumatoid arthritis, and gut microbial pro-arthritogenic profiles have been hypothesized. Intestinal inflammation may be involved in spondyloarthropathies and in a subset of patients affected by Juvenile Idiopathic Arthritis (JIA, the most common chronic rheumatic disease of childhood. We compared the fecal microbiota composition of JIA patients with healthy subjects (HS, evaluating differences in microbial profiles between sub-categories of JIA, such as enthesitis-related arthritis (JIA-ERA, in which inflammation of entheses occurs, and polyarticular JIA, non-enthesitis related arthritis (JIA-nERA. Through taxon-level analysis, we discovered alteration of fecal microbiota components that could be involved in subclinical gut inflammation, and promotion of joint inflammation. We observed abundance in Ruminococcaceae in both JIA categories, reduction in Clostridiaceae and Peptostreptococcaceae in JIA-ERA, and increase in Veillonellaceae in JIA-nERA, respectively compared with HS. Among the more relevant genera, we found an increase in Clostridium cluster XIVb, involved in colitis and arthritis, in JIA-ERA patients compared with HS, and a trend of decrease in Faecalibacterium, known for anti-inflammatory properties, in JIA-nERA compared with JIA-ERA and HS. Differential abundant taxa identified JIA patients for the HLA-B27 allele, including Bilophila, Clostridium cluster XIVb, Oscillibacter and Parvimonas. Prediction analysis of metabolic functions showed that JIA-ERA metagenome was differentially enriched in bacterial functions related to cell motility and chemotaxis, suggesting selection of potential virulence traits. We also discovered differential microbial profiles and intra-group variability among active disease and remission, suggesting instability of microbial ecosystem in autoimmune diseases with respect to healthy status. Similarly

  6. Juvenile Arthritis

    Science.gov (United States)

    Juvenile arthritis (JA) is arthritis that happens in children. It causes joint swelling, pain, stiffness, and loss of motion. It can affect any joint, but ... of JA that children get is juvenile idiopathic arthritis. There are several other forms of arthritis affecting ...

  7. Measurement of biomarkers in juvenile idiopathic arthritis patients and their significant association with disease severity: a comparative study.

    Science.gov (United States)

    Gilliam, B E; Chauhan, A K; Low, J M; Moore, T L

    2008-01-01

    To evaluate in juvenile idiopathic arthritis (JIA) patients a biomarker panel of anti-cyclic citrullinated peptide (anti-CCP) antibodies, cartilage oligomeric matrix protein (COMP), C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), IgM rheumatoid factor (RF), IgG RF, and IgA RF and compare to the presence of joint erosions (JE), joint space narrowing (JSN), and synovitis in order to evaluate aggressive disease. Sixty-eight JIA patients (19 RF positive polyarthritis, 23 RF negative polyarthritis, 17 persistent oligoarthritis, and 9 systemic-onset) were evaluated using the biomarker panel and compared to 18 healthy controls. All RF isotypes, anti-CCP antibodies, and COMP were measured by enzyme-linked immunosorbent assays (ELISA). Statistically significant differences and associations were assessed for each biomarker in relation to JE, JSN, and synovitis. Multiple regression analysis was used to find the variables associated with joint damage and synovitis. Patients with JE and JSN had significantly elevated levels of IgA RF, IgM RF, and anti-CCP antibodies. COMP levels were higher in early disease, but also later in disease in patients with no JE or JSN. ESR, CRP, and IgA RF were significantly elevated in patients with active synovitis. Regression analysis showed IgM RF and disease duration to be associated with JE and JSN. Anti-CCP antibodies and COMP were also associated with JSN. CRP and IgA RF were associated with synovitis. Our findings demonstrate the importance of measuring IgM RF and IgA RF by ELISA and anti-CCP antibodies by ELISA, in addition to COMP in the assessment of JIA patients to determine severity of disease.

  8. Temporary Efficacy of Pyrimethamine in Juvenile-Onset Tay-Sachs Disease Caused by 2 Unreported HEXA Mutations in the Indian Population.

    Science.gov (United States)

    Udwadia-Hegde, Anaita; Hajirnis, Omkar

    2017-01-01

    Juvenile Tay-Sachs disease is rarer than other forms of Tay-Sachs disease and is usually seen in children between the age of 2 and 10 years. Pyrimethamine as a pharmacological chaperone was used to increase β-hexosaminidase A activity in this patient. We describe a patient with Tay-Sachs disease from the Indian population, a juvenile case who presented with developmental regression starting at the age of three, initially with motor followed by language regression. She is currently incapacitated with severe behavioral issues. This brief communication gives an insight into the efficacy of pharmacological chaperones. It also describes two unreported mutations in hexosaminidase A gene from the Indian population. After commencing Pyrimethamine, though initial benefits with increase in levels corresponded with briefly halting the motor regression, the observed increase was only transient and not associated with discernible beneficial neurological or psychiatric effects.

  9. Juvenile idiopatiske inflammatoriske myopatier

    Directory of Open Access Journals (Sweden)

    Helga Sanner

    2009-10-01

    Full Text Available Juvenile idiopathic inflammatory myopathies (JIIM is a group of rare autoimmune systemic diseases in children and adolescents, characterized by chronic skeletal muscle inflammation. Unlike in adults, dermatomyositis (JDM is by far the most common of the idiopathic inflammatory myopathies in children and adolescents. The hallmark of JDM is calcinosis, lipodystrophy and vasculitis, findings that differs the juvenile form of dermatomyosits from the adult form. JDM is still diagnosed and classified by Bohan and Peter’s criteria from 1975. There are limited data on long time outcome of this disease

  10. Genetic Screening of Mutations Associated with Fabry Disease in a Nationwide Cohort of Juvenile Idiopathic Arthritis Patients

    Science.gov (United States)

    Gonçalves, Maria J.; Mourão, Ana F.; Martinho, António; Simões, Olívia; Melo-Gomes, José; Salgado, Manuel; Estanqueiro, Paula; Ribeiro, Célia; Brito, Iva; Fonseca, João E.; Canhão, Helena

    2017-01-01

    Fabry’s disease (FD) is a lysosomal storage disorder associated with an alpha-galactosidase A deficiency. The prevalence of FD among juvenile idiopathic arthritis (JIA) patients with established diagnosis is unknown, but as musculoskeletal pain may be an important complaint at presentation, misdiagnosed cases are anticipated. With this study, we aim to calculate the frequency of FD-associated mutations in a cohort of JIA patients. Children with JIA from a national cohort were selected. Clinical and laboratorial information was recorded in the Portuguese rheumatic diseases register (http://Reuma.pt). Molecular genetic testing to detect GLA gene mutations was performed. After the multiplex polymerase chain reactions technique for DNA amplification, direct sequencing of the complete sequence of GLA gene was completed. From a cohort of 292 patients with JIA (188 females, 104 males), mutations were identified in 5 patients (all female). Four patients had the mutation D313Y, a rare GLA variant, which is associated with low enzymatic levels in plasma, but normal lysosomal levels. One patient presented the missense mutation R118C, which was previously described in Mediterranean patients with FD. This is the first screening of FD mutations in a cohort of JIA patients. No “classic” pathogenic FD mutations were reported. The late-onset FD-associated mutation, R118C, was found in a frequency of 0.34% (1/292). PMID:28299312

  11. Ankle arthritis predicts polyarticular disease course and unfavourable outcome in children with juvenile idiopathic arthritis

    DEFF Research Database (Denmark)

    Esbjörnsson, Anna-Clara; Aalto, Kristiina; Broström, Eva W

    2015-01-01

    on remission was available for 427 of these children. Occurrence of clinically assessed ankle arthritis was analysed in relation to JIA category, clinical characteristics and remission data eight years after disease onset. RESULTS: In 440 children with JIA, 251 (57%) experienced ankle arthritis during...... the first eight years of disease. Ankle arthritis was least common in the persistent oligoarticular category (25%) and most common in children with extended oligoarticular (83%) and polyarticular RF-negative (85%) JIA. Children who developed ankle arthritis during the first year of disease were younger...... at disease onset (median age 4.9 (IQR 2.1-8.8) vs. 6.6 (IQR 2.8-10.1) years, pdisease onset, if the ankle joint...

  12. Cartilage oligomeric matrix protein in patients with juvenile idiopathic arthritis: relation to growth and disease activity

    DEFF Research Database (Denmark)

    Bjørnhart, Birgitte; Juul, Anders; Nielsen, Susan

    2009-01-01

    OBJECTIVE: Cartilage oligomeric matrix protein (COMP) has been identified as a prognostic marker of progressive joint destruction in rheumatoid arthritis. In this population based study we evaluated associations between plasma concentrations of COMP, disease activity, and growth velocity in patie......OBJECTIVE: Cartilage oligomeric matrix protein (COMP) has been identified as a prognostic marker of progressive joint destruction in rheumatoid arthritis. In this population based study we evaluated associations between plasma concentrations of COMP, disease activity, and growth velocity...

  13. Germline mutation of CBL is associated with moyamoya disease in a child with juvenile myelomonocytic leukemia and Noonan syndrome-like disorder.

    Science.gov (United States)

    Hyakuna, Nobuyuki; Muramatsu, Hideki; Higa, Takeshi; Chinen, Yasutsugu; Wang, Xinan; Kojima, Seiji

    2015-03-01

    Germline mutations in CBL have been identified in patients with Noonan syndrome-like phenotypes, while juvenile myelomonocytic leukemia (JMML) harbors duplication of a germline CBL, resulting in acquired isodisomy. The association between moyamoya disease and Noonan syndrome carrying a PTPN11 mutation has recently been reported. We present a patient with JMML who developed moyamoya disease and neovascular glaucoma. Our patient exhibited a Noonan syndrome-like phenotype. Genetic analysis revealed acquired isodisomy and a germline heterozygous mutation in CBL. This is a rare case of CBL mutation associated with moyamoya disease. Prolonged RAS pathway signaling may cause disruption of cerebrovascular development.

  14. Juvenile Prostitution.

    Science.gov (United States)

    Csapo, Marg

    1986-01-01

    Recent research and Canadian government committee reports concerning juvenile prostitution are reviewed. Proposals are made in the realms of law and social policy; and existing programs are described. (DB)

  15. Juvenile Prostitution.

    Science.gov (United States)

    Csapo, Marg

    1986-01-01

    Recent research and Canadian government committee reports concerning juvenile prostitution are reviewed. Proposals are made in the realms of law and social policy; and existing programs are described. (DB)

  16. Extending juvenility in grasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaeppler, Shawn; de Leon Gatti, Natalia; Foerster, Jillian

    2017-04-11

    The present invention relates to compositions and methods for modulating the juvenile to adult developmental growth transition in plants, such as grasses (e.g. maize). In particular, the invention provides methods for enhancing agronomic properties in plants by modulating expression of GRMZM2G362718, GRMZM2G096016, or homologs thereof. Modulation of expression of one or more additional genes which affect juvenile to adult developmental growth transition such as Glossy15 or Cg1, in conjunction with such modulation of expression is also contemplated. Nucleic acid constructs for down-regulation of GRMZM2G362718 and/or GRMZM2G096016 are also contemplated, as are transgenic plants and products produced there from, that demonstrate altered, such as extended juvenile growth, and display associated phenotypes such as enhanced yield, improved digestibility, and increased disease resistance. Plants described herein may be used, for example, as improved forage or feed crops or in biofuel production.

  17. Usefulness and limitation of MR imaging and MR angiography in diagnosis of juvenile moyamoya disease

    Energy Technology Data Exchange (ETDEWEB)

    Aoki, Takeshi; Matsuzawa, Hitoshi; Houkin, Kiyohiro; Kamiyama, Hiroyasu; Abe, Hiroshi; Miyasaka, Kazuo (Hokkaido Univ., Sapporo (Japan). School of Medicine); Saito, Hisatoshi

    1993-04-01

    Magnetic resonance (MR) images and MR angiograms (MRA) were studied in 20 childhood cases of moyamoya disease. Both MRI and MRA successfully demonstrated moyamoya vessels in the basal ganglia in all cases, with a positive but not definite correlation to the conventional angiographic findings. MRI depicted the stenotic and occlusive lesions of the carotid fork and horizontal portion of the middle cerebral artery effectively. MRA demonstrated some lesions which even MRI failed to prove, but it tended to overestimate the lesions. Post-operative state of collateral flow and the patency of EC-IC bypass graft could be evaluated as accurately with MRA as with conventional angiography, although MRA was limited in spatial resolution and evaluation of flow direction. In conclusion, MRI and MRA were considered to be useful in the diagnosis of moyamoya disease in stages 3 and 4, but less effective in the evaluation of its angiographical stage. (author).

  18. Juvenile Polyposis Syndrome

    Science.gov (United States)

    ... Types of Cancer > Juvenile Polyposis Syndrome Request Permissions Juvenile Polyposis Syndrome Approved by the Cancer.Net Editorial Board , 12/2015 What is juvenile polyposis syndrome? Juvenile polyposis syndrome (JPS) is a ...

  19. Consenso em reumatologia pediátrica: parte I - definição dos critérios de doença inativa e remissão em artrite idiopática juvenil/artrite reumatóide juvenil Consensus in pediatric rheumatology: part I - criteria definition of inactive disease and remission in juvenile idiopathic arthritis / juvenile rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Claudia Machado

    2005-02-01

    Full Text Available Não há critérios universalmente aceitos para a remissão clínica em artrite idiopática juvenil/artrite reumatóide juvenil (AIJ/ARJ. OBJETIVO: formar consenso sobre estes critérios. MÉTODOS: foi utilizado um inquérito pelo método Delphi para reunir os critérios vigentes e utilizados por especialistas em reumatologia pediátrica (RP no mundo todo. A análise dos resultados constituiu a base para uma Consensus Conference utilizando a nominal group technique (NGT para alcançar o consenso nas questões não resolvidas após a análise dos questionários deste inquérito. Cento e trinta RP de 34 países responderam ao inquérito e 20 RP de nove países elegeram os critérios durante dois dias, em processo de discussão estruturada, para formar consenso pela NGT. RESULTADOS: os critérios de doença inativa deveriam incluir: 1 nenhuma articulação com artrite em atividade; 2 ausência de febre, rash, serosite, esplenomegalia ou linfadenopatia generalizada atribuída à AIJ/ARJ; 3 ausência de uveíte em atividade; 4 VHS ou PCR negativas (se ambos forem testados, ambos devem ser normais; 5 a avaliação global pelo médico deve indicar o melhor escore possível, indicando doença inativa. CONCLUSÕES: de acordo com o voto de consenso, seis meses contínuos de doença inativa são necessários para se considerar um paciente em estado de remissão com medicação; 12 meses contínuos de doença inativa e sem medicação são necessários para considerar um paciente em estado de remissão sem medicação. O critério para remissão sem medicação deve prever com acurácia de 95% a probabilidade inferior a 20% de recaída em cinco anos.Validated and widely accepted criteria for clinical remission in JIA/JRA do not currently exist. OBJECTIVE: To achieve consensus in this matter. METHODS: The Delphi consensus-formation approach was used to gather the criteria in use by pediatric rheumatologists (PR worldwide. Results from the questionnaires

  20. Childhood-onset (Juvenile Huntington′s disease: A rare case report

    Directory of Open Access Journals (Sweden)

    Kailash Chandra Patra

    2015-01-01

    Full Text Available Huntington′s disease (HD is a rare dominantly inherited neurodegenerative disorder characterized clinically by a combination of abnormal involuntary (choreic movements, neuropsychiatric manifestations, and dementia. It is caused by an unstable CAG repeat expansion in the gene IT15 which encodes a Huntingtin protein. We present a case of a 9 year old boy who had developmental regression starting from the age of 8 years of age along with resistant seizures and signs of cerebellar involvement with absence of chorea and is on anticonvulsants, baclofen, and tetrabenzine. As is expected in a case of childhood-onset HD, our patient is rapidly deteriorating and is currently in the terminal phase of his illness along with resistant convulsions.

  1. Guidelines for the diagnosis, treatment and clinical monitoring of patients with juvenile and adult Pompe disease

    Directory of Open Access Journals (Sweden)

    Juan Clinton Llerena Junior

    2015-01-01

    Full Text Available ABSTRACT Pompe disease (PD is a potentially lethal illness involving irreversible muscle damage resulting from glycogen storage in muscle fiber and activation of autophagic pathways. A promising therapeutic perspective for PD is enzyme replacement therapy (ERT with the human recombinant enzyme acid alpha-glucosidase (Myozyme®. The need to organize a diagnostic flowchart, systematize clinical follow-up, and establish new therapeutic recommendations has become vital, as ERT ensures greater patient longevity. A task force of experienced clinicians outlined a protocol for diagnosis, monitoring, treatment, genetic counseling, and rehabilitation for PD patients. The study was conducted under the coordination of REBREPOM, the Brazilian Network for Studies of PD. The meeting of these experts took place in October 2013, at L’Hotel Port Bay in São Paulo, Brazil. In August 2014, the text was reassessed and updated. Given the rarity of PD and limited high-impact publications, experts submitted their views.

  2. EULAR/PReS standards and recommendations for the transitional care of young people with juvenile-onset rheumatic diseases.

    Science.gov (United States)

    Foster, Helen E; Minden, Kirsten; Clemente, Daniel; Leon, Leticia; McDonagh, Janet E; Kamphuis, Sylvia; Berggren, Karin; van Pelt, Philomine; Wouters, Carine; Waite-Jones, Jennifer; Tattersall, Rachel; Wyllie, Ruth; Stones, Simon R; Martini, Alberto; Constantin, Tamas; Schalm, Susanne; Fidanci, Berna; Erer, Burak; Dermikaya, Erkan; Ozen, Seza; Carmona, Loreto

    2017-04-01

    To develop standards and recommendations for transitional care for young people (YP) with juvenile-onset rheumatic and musculoskeletal diseases (jRMD). The consensus process involved the following: (1) establishing an international expert panel to include patients and representatives from multidisciplinary teams in adult and paediatric rheumatology; (2) a systematic review of published models of transitional care in jRMDs, potential standards and recommendations, strategies for implementation and tools to evaluate services and outcomes; (3) setting the framework, developing the process map and generating a first draft of standards and recommendations; (4) further iteration of recommendations; (5) establishing consensus recommendations with Delphi methodology and (6) establishing standards and quality indicators. The final consensus derived 12 specific recommendations for YP with jRMD focused on transitional care. These included: high-quality, multidisciplinary care starting in early adolescence; the integral role of a transition co-ordinator; transition policies and protocols; efficient communications; transfer documentation; an open electronic-based platform to access resources; appropriate training for paediatric and adult healthcare teams; secure funding to continue treatments and services into adult rheumatology and the need for increased evidence to inform best practice. These consensus-based recommendations inform strategies to reach optimal outcomes in transitional care for YP with jRMD based on available evidence and expert opinion. They need to be implemented in the context of individual countries, healthcare systems and regulatory frameworks. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  3. Proteomics of juvenile senegal sole (Solea senegalensis) affected by gas bubble disease in hyperoxygenated ponds.

    Science.gov (United States)

    Salas-Leiton, E; Cánovas-Conesa, B; Zerolo, R; López-Barea, J; Cañavate, J P; Alhama, J

    2009-01-01

    Solea senegalensis is a commercial flat fish traditionally farmed in earth ponds in coastal wetlands that might also become important to more intensive aquaculture. Gas bubble disease (GBD) is a potential risk for outdoor fish farming, particularly in certain periods of the year, related to improper management leading to macroalgae blooms. Physical-chemical conditions inducing hyperoxia, including radiation, temperature, and high levels of dissolved oxygen, have been monitored in fish affected by GBD together with observed symptoms. Exophthalmia, subcutaneous emphysemas, obstruction of gill lamellae, hemorrhages, and anomalous swimming were the main effects of oxygen supersaturation. A proteomic study was carried out for the first time under aquaculture conditions and protein expression changes are described for fish that were subject to hyperoxic conditions. Proteins identified in gill of GBD-affected fish are related to oxidative alteration of cytoskeleton structure/function (beta-tubulin, beta-actin), motility (light myosin chain, alpha-tropomyosin), or regulatory pathways (calmodulin, Raf kinase inhibitor protein), reflecting the central role of gill in oxygen exchange. Hepatic proteins identified are related to protein oxidative damages (beta-globin, FABPs), protection from oxidative stress (DCXR, GNMT), and inflammatory response (C3), in agreement with the predominant metabolic role of liver. Comparison of protein expression patterns and protein identification are suggested as potentially specific hyperoxia biomarkers that would facilitate prevention of GBD outbreaks.

  4. Severe diseases security for rural juveniles in Qinghai%青海省农村未成年人大病保障现况分析

    Institute of Scientific and Technical Information of China (English)

    张璐莹; 张智若; 王和平; 赵晖; 李琰; 杨立嵘

    2011-01-01

    Objective To investigate the status quo of the assurance and subsidy for severe diseases acquired by juvenile in rural areas in Qinghai, and provide evidences for building a subsidy system for such population. Methods Quantitative surveys were made to collect data on medical expenses and the compensation practice for such expenses for severe diseases of juvenile in the area, for a knowledge of the present medication and disease load in question; specialists in two hospitals were interviewed to learn the present treatnents for such a population, and their expenditures in case of such diseases. Results Juveniles in rural Qinghai rely on the new rural cooperative medical scheme, under which however the reimbursement rate was only 26% ~35%. Families with juvenile patients of severe diseases were found to suffer heavy burdens. As a result, a high percentage of the patients give up treatment. To make things worse, as only two hospitals in the provincial capital city can provide professional treatment for children with severe diseases, rural children have to pay heavy indirect costs other than medication such as heavy travel expenses. Conclusion It is critical to build a medical assurance system for juvenile with severe diseases. It is also imperative to build and strengthen the capacity of medical centers for such a population in Qinghai, and upgrade the diagnosis and treatment competence of local health providers, ensuring adequate medical resources for juvenile with severe diseases upon joint development of both healthcare providers and the medical insurance system.%目的通过对青海省农村未成年人大病的保障现况的调查,探索农村未成年人大病保障制度的依据.方法通过定量调查,获取青海省新型农村合作医疗制度中未成年人大病患者医疗费用和补偿情况,了解青海省农村未成年患者大病医疗的现状以及疾病负担;通过对2所医院相关疾病专家进行深入访谈,了解青海省农村未

  5. Unbiased Stereologic Estimation of the Spatial Distribution of Paget’s Disease in the Human Temporal Bone

    DEFF Research Database (Denmark)

    Bloch, Sune Land; Sørensen, Mads Sølvsten

    2014-01-01

    BACKGROUND: It has been suggested that Paget's disease of bone and otosclerosis may share a myxoviral etiology. However, the association between virus infection and pathologic bone remodeling is still controversial. The aim of this study was to estimate the spatial distribution of pagetic bone...... remodeling around the inner ear space and to compare it with that of otosclerosis in a contemporary context of temporal bone dynamics. MATERIALS AND METHODS: From the temporal bone collection of Massachusetts Eye and Ear Infirmary, 15 of 29 temporal bones with Paget's disease were selected to obtain...... is similar to the normal distribution of perilabyrinthine bone remodeling but entirely different from the spatial location of otosclerosis, which are focal and centripetally distributed around the inner ear space. CONCLUSION: In Paget's disease, the antiresorptive barrier around the inner ear space becomes...

  6. Parent Perceptions of Illness Uncertainty and Child Depressive Symptoms in Juvenile Rheumatic Diseases: Examining Caregiver Demand and Parent Distress as Mediators.

    Science.gov (United States)

    Chaney, John M; Gamwell, Kaitlyn L; Baraldi, Amanda N; Ramsey, Rachelle R; Cushing, Christopher C; Mullins, Alexandria J; Gillaspy, Stephen R; Jarvis, James N; Mullins, Larry L

    2016-10-01

    Examine caregiver demand and general parent distress as mediators in the parent illness uncertainty-child depressive symptom association in youth with juvenile rheumatic diseases.   Children and adolescents completed the Child Depression Inventory; caregivers completed the Parent Perceptions of Uncertainty Scale, the Care for My Child with Rheumatic Disease Scale, and the Brief Symptom Inventory. The pediatric rheumatologist provided ratings of clinical disease status.   Analyses revealed significant direct associations between illness uncertainty and caregiver demand, and between caregiver demand and both parent distress and child depressive symptoms. Results also revealed significant parent uncertainty → caregiver demand → parent distress and parent uncertainty → caregiver demand → child depressive symptom indirect paths.   Results highlight the role of illness appraisals in adjustment to juvenile rheumatic diseases, and provide preliminary evidence that parent appraisals of illness uncertainty impact parent distress and child depressive symptoms indirectly through increased perceptions of caregiver demand. © The Author 2016. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Juvenile onset systemic lupus erythematosus: a possible role for vitamin D in disease status and bone health.

    Science.gov (United States)

    Casella, C B; Seguro, L P C; Takayama, L; Medeiros, D; Bonfa, E; Pereira, R M R

    2012-10-01

    In juvenile onset systemic lupus erythematosus (JoSLE), evidence for the association between vitamin D status, lupus activity, and bone health is very limited and not conclusive. The aim of this study was, therefore, to assess in JoSLE patients the possible relevance of vitamin D deficiency in disease and bone parameters. Fifty-seven JoSLE patients were initially compared to 37 age, race and body mass index (BMI) -matched healthy controls. The serum concentration of 25 hydroxyvitamin D (25OHD) was determined by radioimmunoassay. Patients with 25OHD deficiency (≤20 ng/mL) were compared to those with levels >20 ng/mL. Disease activity was evaluated by SLE Disease Activity Index (SLEDAI). Bone mineral density (BMD) and body composition (BC) were measured using dual-energy X-ray absorptiometry (DXA). 25OHD levels were similar in patients and controls (21.44 ± 7.91 vs 22.54 ± 8.25 ng/mL, p = 0.519), regardless of supplementation (65% of patients and none in controls). Thirty-one patients with 25OHD deficiency (≤20 ng/mL) were further compared to the 26 JoSLE patients with levels >20 ng/mL. These two groups were well-balanced regarding vitamin D confounding variables: age (p = 0.100), ethnicity (p = 1.000), BMI (p = 0.911), season (p = 0.502), frequency of vitamin D supplementation (p = 0.587), creatinine (p = 0.751), renal involvement (p = 0.597), fat mass (p = 0.764), lean mass (p = 0.549), previous/current use of glucocorticoids(GC) (p = 1.0), immunosuppressors (p = 0.765), and mean current daily dose of GC (p = 0.345). Patients with vitamin D deficiency had higher SLEDAI (3.35 ± 4.35 vs 1.00 ± 2.48, p = 0.018), lower C4 levels (12.79 ± 6.78 vs 18.38 ± 12.24 mg/dL, p = 0.038), lower spine BMD (0.798 ± 0.148 vs 0.880 ± 0.127 g/cm(2), p = 0.037) and whole body BMD (0.962 ± 0.109 vs 1.027 ± 0.098 g/cm(2), p = 0.024). JoSLE vitamin D

  8. Doença de Graves associada à artrite idiopática juvenil Graves' disease associated with juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Vanessa de Matos Santos Mendonça Marques

    2011-04-01

    Full Text Available Os autores relatam o caso de uma menina de 10 anos de idade com diagnóstico de doença de Graves (DG, em tratamento com propiltiouracil, que desenvolveu uveíte e artrite poliarticular e cuja mãe também tem DG e lúpus discoide. São discutidos os diagnósticos diferenciais de artrite inflamatória que surge em uma criança com doença tireoidiana autoimune medicada com drogas antitireóideas.The authors report the case of a 10-year-old girl with Graves' disease (GD, treated with propylthiouracil, who developed uveitis and polyarticular arthritis, and whose mother also had GD and discoid lupus. The differential diagnosis of inflammatory arthritis that appears in a child with autoimmune thyroid disease managed with antithyroid drugs is discussed.

  9. Juvenile Dermatomyositis in Pregnancy

    Directory of Open Access Journals (Sweden)

    Anthony Emeka Madu

    2013-01-01

    Full Text Available Juvenile dermatomyositis has variable clinical presentations both in and outside of pregnancy. A literature review indicated that optimal maternal and fetal outcomes can be anticipated when the pregnancy is undertaken while the disease is in remission. Poorer outcomes are associated with flare-up of the disease in early pregnancy compared with exacerbation in the second or third trimester, when fetal prognosis is usually good. We present a case of JDM in pregnancy with disease exacerbation late in pregnancy and review of the relevant literature.

  10. Juvenile dermatomyositis in pregnancy.

    Science.gov (United States)

    Madu, Anthony Emeka; Omih, Edwin; Baguley, Elaine; Lindow, Stephen W

    2013-01-01

    Juvenile dermatomyositis has variable clinical presentations both in and outside of pregnancy. A literature review indicated that optimal maternal and fetal outcomes can be anticipated when the pregnancy is undertaken while the disease is in remission. Poorer outcomes are associated with flare-up of the disease in early pregnancy compared with exacerbation in the second or third trimester, when fetal prognosis is usually good. We present a case of JDM in pregnancy with disease exacerbation late in pregnancy and review of the relevant literature.

  11. Juvenile Justice in Milwaukee

    Science.gov (United States)

    Williams, Gary L.; Greer, Lanetta

    2010-01-01

    Historically, there have been several attempts made to address issues surrounding juvenile delinquency. The Wisconsin Legislature outlines the objectives of the juvenile justice system in the Juvenile Justice Code in s. 939.01, ?to promote a juvenile justice system capable of dealing with the problem of juvenile delinquency, a system which will…

  12. Juvenile xanthogranuloma.

    Science.gov (United States)

    Singh, R; Ghazali, W

    1992-05-01

    Juvenile xanthogranuloma is a benign cutaneous growth presenting as papules or nodules. It is characterized by an intradermal collection of lipid-laden macrophages and varying degrees of fibroblastic proliferation. We have recently observed two patients with xanthogranulomas: one was found to have a papular type and the second patient had multiple nodular growths. We present these cases, which should be considered in the differential diagnosis of skin nodules.

  13. Childhood Arthritis and Rheumatology Research Alliance consensus clinical treatment plans for juvenile dermatomyositis with skin predominant disease

    OpenAIRE

    Kim, Susan; Kahn, Philip; Robinson, Angela B; Lang, Bianca; Shulman, Andrew; Oberle, Edward J.; Schikler, Kenneth; Curran, Megan Lea; Barillas-Arias, Lilliana; Spencer, Charles H; Rider, Lisa G; Huber, Adam M.

    2017-01-01

    Background Juvenile dermatomyositis (JDM) is the most common form of the idiopathic inflammatory myopathies in children. A subset of children have the rash of JDM without significant weakness, and the optimal treatments for these children are unknown. The goal of this study was to describe the development of consensus clinical treatment plans (CTPs) for children with JDM who have active skin rashes, without significant muscle involvement, referred to as skin predominant JDM in this manuscript...

  14. Genetics in juvenile idiopathic arthritis

    NARCIS (Netherlands)

    Albers, Heleen Marion

    2015-01-01

    Juvenile idiopathic arthritis (JIA) is a non-common disease in children that can persist into adulthood. JIA is considered to be an auto-immune disease. Genetic factors play a role in the pathogenesis. In a new cohort of JIA patients from North-West European descent genetic candidate gene associatio

  15. Finding the most appropriate mouse model of juvenile CLN3 (Batten disease for therapeutic studies: the importance of genetic background and gender

    Directory of Open Access Journals (Sweden)

    Attila D. Kovács

    2015-04-01

    Full Text Available Mutations in the CLN3 gene cause a fatal neurodegenerative disorder: juvenile CLN3 disease, also known as juvenile Batten disease. The two most commonly utilized mouse models of juvenile CLN3 disease are Cln3-knockout (Cln3−/− and Cln3Δex7/8-knock-in mice, the latter mimicking the most frequent disease-causing human mutation. To determine which mouse model has the most pronounced neurological phenotypes that can be used as outcome measures for therapeutic studies, we compared the exploratory activity, motor function and depressive-like behavior of 1-, 3- and 6-month-old Cln3−/− and Cln3Δex7/8-knock-in mice on two different genetic backgrounds (129S6/SvEv and C57BL/6J. Although, in many cases, the behavior of Cln3−/− and Cln3Δex7/8 mice was similar, we found genetic-background-, gender- and age-dependent differences between the two mouse models. We also observed large differences in the behavior of the 129S6/SvEv and C57BL/6J wild-type strains, which highlights the strong influence that genetic background can have on phenotype. Based on our results, Cln3−/− male mice on the 129S6/SvEv genetic background are the most appropriate candidates for therapeutic studies. They exhibit motor deficits at 1 and 6 months of age in the vertical pole test, and they were the only mice to show impaired motor coordination in the rotarod test at both 3 and 6 months. Cln3−/− males on the C57BL/6J background and Cln3Δex7/8 males on the 129S6/SvEv background also provide good outcome measures for therapeutic interventions. Cln3−/− (C57BL/6J males had serious difficulties in climbing down (at 1 and 6 months and turning downward on (at 1, 3 and 6 months the vertical pole, whereas Cln3Δex7/8 (129S6/SvEv males climbed down the vertical pole drastically slower than wild-type males at 3 and 6 months of age. Our study demonstrates the importance of testing mouse models on different genetic backgrounds and comparing males and females in order to

  16. Dermatomiositis juvenil

    OpenAIRE

    Goldaracena, Pablo; Pérez, Federico

    2008-01-01

    La dermatomiositis juvenil (DMJ) es una enfermedad multi sistémica de etiología desconocida, caracterizada por una vasculitis que ocasiona una inflamación no supurativa del músculo estriado y lesiones cutáneas distintivas. La cobertura de los criterios de Bohan y Peter establece el diagnóstico: exantema patognomónico junto a debilidad muscular proximal simétrica, elevación sérica de enzimas musculares, s...

  17. Juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Krupa H Bhatt

    2014-01-01

    Full Text Available Juvenile Idiopathic Arthritis (JIA is the most chronic musculoskeletal disease of pediatric population. The chronic course of disease has a great impact on oral health. Temporomandibular joint is involved in JIA causing limited mouth opening with progressive open bite, retrognathia, microgenia and bird like appearance. Joints of upper and lower extremities are also involved. Effect on upper limb function leads to difficulty with fine motor movements required for brushing and flossing. This increases incidence of caries and periodontal disease in children. The cause of JIA is still poorly understood and none of the available drugs for JIA can cure the disease. However, prognosis has improved as a result of progress in disease classification and management. The dental practitioner should be familiar with the symptoms and oral manifestations of JIA to help manage as multidisciplinary management is essential.

  18. The impact of disease and antirheumatic therapy factors on growth retardation in children suffering from juvenile rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    T.M. Bzarova

    2006-01-01

    Full Text Available THE STUDY EVALUATED THE IMPACT OF REFRACTORY JUVENILE IDIOPATHIC ARTHRITIS (JIA AND INTERFERENCE OF ANTIRHEUMATIC THERAPY ON PHYSICAL STATURE AND GROWTH AND PHYSICAL DEVELOPMENT IN CHILDREN. WE OBSERVED 133 PATIENTS WITH JIA WITH AGE FROM 4.6 TO 18 YEARS. WE ASSESSED PATIENTS' PHYSICAL STATURE (DOCUMENTING HEIGHT AND WEIGHT AND FURTHER GROWTH AND DEVELOPMENT STARING FROM BIRTH, BEFORE THE ONSET OF JIA, AT THE FIRST YEAR FROM THE ONSET OF THE DISB EASE AND LATER ON. PHYSICAL RETARDATION WAS MARKED IN ALL CHILDREN IN THE FIRST YEAR FROM THE ONSET OF JIA. SYSTEMIC JIA, WHICH IS KNOWN FOR HIGH ACTIVITY AND POLYARTICULAR OR GENERALIZED JOINT LESION, WAS LINKED TO SIGNIFICANT PHYSICAL RETARDATION IN ALL CHILDREN WITH SYSBTEMIC JIA. LONGBTERM GLUCOCORTICOID ADMINISTRATION, EVEN AT LOW DOSES, ACCENTUATED THE NEGATIVE IMPACT OF JIA ON GROWTH RESULTING IN MARKED GROWTH DELAY OR ITS' TOTAL ARREST. WE HAVE ELABORATED RISK FACTORS FOR SHORT STATURE IN CHILDREN WITH JIA, WHICH SUGGEST THERAPY GUIDELINES, PRESENTED IN THIS ARTICLE.KEY WORDS: JUVENILE IDIOPATHIC ARTHRITIS, СHILDREN.

  19. [JUVENILE DERMATOMYOSITIS AND CALCINOSIS].

    Science.gov (United States)

    Zhvania, M

    2015-01-01

    Juvenile Dermatomiositis (JD) is autoimmune disease that progresses with time; JD's main differentiated syndromes are rash on the skin, poor function of muscles, and often developing invalidism. If the health practitioners manage to diagnose the JD on an early stage and prescribe the adequate treatment the disease will not progress aggressively. This approach is tangible for practical rheumatology and pediatric. The article aims to present the reasons of the development of the JD and calcinosis. The study based on the description of the patients with JD. There are distinguished the main symptoms of the disease in children: frequent and acute developments of muscles calcinosis, occasionally with diffuse character followed with hypotrophy of the muscles, contractures and invalidism. One of the patient cases that describe the article is the thirteen-year boy with JD indicating repeated sequence of the disease, with diffusive calcinosis, cellulitis followed with secondary infection and impaired vision.

  20. The Heterogeneity of Juvenile Myositis

    Science.gov (United States)

    Rider, Lisa G.

    2007-01-01

    Juvenile myositis is a heterogeneous group of systemic autoimmune diseases, in which clinical and serologic subgroups result in subsets of patients with distinct clinical manifestations, disease courses, immunogenetic associations, responses to therapy, and prognoses. A newly identified autoantibody of unknown specificity, anti-p155, is myositis-associated and seen in up to 20 – 30% of juvenile and adult DM patients. HLA DRB1*0301 and its linked allele DQA1*0501 have been identified as the major immunogenetic risk factor for juvenile and adult DM in both European- and African- American patients, and DQA1*0301 is an additional risk factor in European American patients. Several DQA1 alleles also are protective for juvenile DM. Environmental risk factors are poorly understood, but growing evidence suggests a role for infectious agents and ultraviolet radiation. The current therapy of juvenile DM consists of corticosteroids and other immunosuppressive agents, with the adjunctive treatment of cutaneous manifestations and rehabilitation. Therapeutic trials of biologic agents, including anti-TNFα and anti-CD20, may aid in developing promising new therapies for these disorders. PMID:17317616

  1. Juvenile hyaline fibromatosis.

    Science.gov (United States)

    Larralde, M; Santos-Muñoz, A; Calb, I; Magariños, C

    2001-01-01

    Juvenile hyaline fibromatosis (JHF) is a rare autosomal recessive disease with onset in infancy or early childhood. It is characterized by papulonodular skin lesions, soft tissue masses, gingival hypertrophy, and flexion contractures of the large joints. The light and electron microscopic features are very distinctive. Here we report an 8-month-old boy with characteristic stiffness of the knees and elbows and pink confluent papules on the paranasal folds, and periauricular and perianal regions. He also had hard nodules all over the scalp and around the mouth, and severe gingival hypertrophy. Histologic and ultrastructural features were typical of JHF. Clinical features, pathology, and physiology are discussed.

  2. Clinical and genetic study of a juvenile-onset Huntington disease%少年型亨廷顿病临床与基因突变分析

    Institute of Scientific and Technical Information of China (English)

    郝莹; 陈园园; 顾卫红; 王国相; 马惠姿; 李丽林; 王康; 金淼; 段晓慧

    2012-01-01

    Background Huntington's disease (HD) is an autosomal dominant hereditary progressive neurodegenerative disorder with a distinct phenotype characterized by chorea, dementia, cognitive and affective impairment. There are selective neural cell loss and atrophy in the caudate and putamen. Dr. George Huntington firstly described the disease accurately and insightfully, which led to a widespread recognition of the inherited chorea that now bears his name. Huntington disease gene (1T15) locus on chromosome 4p16.3, and encompasses 67 exons with a trinucleotide repeat (CAG) in the first exon.The CAG repeat length is highly polymorphic in the population and expanded on at least one chromosome of individuals with HD. Clinically, patient with HD are often onset in adulthood. Juvenile - onset HD is relatively rare. Adult-onset HD patients usually have a CAG expansion from 40 to 55 whereas those with juvenile - onset greater than 60 which are often inherited from the father. We investigated the clinical features of a juvenile-onset case with Huntington disease and dynamic mutation of his family. Methods The CAG repeats of 1T15 gene were detected using polymerase chain reaction and capillary electrophoresis in 115 individuals with preliminary diagnosis as Huntington disease. The repeat numbers of some samples carried expanded or intermediate alleles were verified by the pMD18-T vector clone sequencing. Results Fragment analysis showed that one juvenile - onset case presenting with cognitive dysfunction and hypokinesis carried 15/68 CAG repeats of 1T15. His father carried 17/37 and mother carried 15/17. Conclusion 1) The juvenile-onset case of HD presented with different clinical features compared with adult-onset cases. The typical signs of adult-onset cases include progressive chorea, rigidity and dementia. The most common sign of juvenile-onset Huntington disease is cognitive decline. 2) The dynamic mutation of IT15 gene expansion of the CAG repeats in the intergenerational

  3. FDA Approved Registration of Erythromycin for Treatment of Bacterial Kidney Disease (BKD) in Juvenile and Adult Chinook Salmon : Annual Report, Reporting Period March 10, 1989 to March 9, 1990.

    Energy Technology Data Exchange (ETDEWEB)

    Moffitt, Christine A.

    1991-04-01

    Erythromycin is a therapeutic substance useful against bacterial kidney disease in salmon. In 1989 we began a multi year project to learn more about erythromycin applied to juvenile and adult salmon, with the goal of achieving registration of erythromycin with the US Food and Drug Administration. To begin the study, we studied the pharmacokinetics of erythromycin administered to both adult and juvenile chinook salmon. We monitored blood plasmas time curves from individual adult fish injected with two forms of injectable erythromycin using one of three routes of administration. In addition, we began experiments to evaluate hatchery applications of erythromycin to individually marked adult salmon, and we recovered blood tissues from these fish at the time of spawning. To determine how to use erythromycin in juvenile salmon, we evaluated the adsorption and elimination of erythromycin applied arterially and orally to individual juvenile fish. In feeding trials we determined the palatability to juvenile chinook salmon of feed made with one of two different carriers for erythromycin thiocyanate. 35 refs., 4 figs. , 3 tabs.

  4. Case Report: Juvenile Tophaceous Gout

    Directory of Open Access Journals (Sweden)

    Seyma Gunes

    2016-01-01

    Full Text Available Gout is a metabolic disease that manifests as recurrent arthritis. Its incidance increases with age. Clinical findings include recurrent acute arthritis, tophus at joints and tissues, uricacid stones and gouty nephropathy. Tophi is a late period complication of arthritis. In this casereport we presented  a patient with early-onset juvenile tophaceous gout.

  5. [Sex-linked juvenile retinoschisis].

    Science.gov (United States)

    François, P; Turut, P; Soltysik, C; Hache, J C

    1976-02-01

    About 13 observations of sexe linked juvenile retinoschisis, the authors describe the ophthalmoscopic, fluorographic and functional aspects of the disease whose caracteristics are:--its sexe linked recessive heredity; --its clinical characterestics associating: a microcystic macular degeneration, peripheral retinal lesions, vitreous body alterations, --an electroretinogram of the negative type.

  6. Genetic heterogeneity in neuronal ceroid lipofuscinosis (NCL): Evidence that the late-infantile subtype (Jansky-Bielschowsky disease; CLN2) is not an allelic form of the juvenile or infantile subtypes

    Energy Technology Data Exchange (ETDEWEB)

    Williams, R.; McKay, T.; Mitchison, H.; Gardiner, M. (Univ. College of London Medical School (United Kingdom)); Vesa, J.; Jaervelae, I.; Hellsten, E.; Peltonen, L.; Thompson, A.; Callen, D.; Sutherland, G.; Luna-Battadano, D.; Stallings, R.

    1993-10-01

    The neuronal ceroid lipofuscinoses (NCLs) are a group of inherited neurodegenerative disorders characterized by the accumulation of autofluorescent lipopigment in neurons and other cell types. Inheritance is autosomal recessive. Three main childhood subtypes are recognized: Infantile (Haltia-Santavuori disease; MIM 256743), late infantile (Jansky-Bielschowsky disease; MIM 204500), and juvenile (Spielmeyer-Sjoegren-Vogt, or Batten disease; MIM 204200). The gene loci for the juvenile (CLN3) and infantile (CLN1) types have been mapped to human chromosomes 16p and 1p, respectively, by linkage analysis. Linkage analysis of 25 families segregating for late-infantile NCL has excluded these regions as the site of this disease locus (CLN2). The three childhood subtypes of NCL therefore arise from mutations at distinct loci. 17 refs., 2 figs., 3 tabs.

  7. Evolution of Juvenile Ankylosing Spondylitis

    Directory of Open Access Journals (Sweden)

    Ye.V. Prohorov

    2013-03-01

    Full Text Available Evolution of juvenile ankylosing spondylitis tend to follow a more frequent involvement in the pathological process of elbow and ankle joints, development of enthesiopathies, changes of intraarticular meniscal horns, forming of Baker’s cysts, cartilage flaps and systemic osteoporosis, and total value of all these signs 13 times exceeds thereof in patients with with the debut of disease in adulthood, but for juvenile ankylosing spondylitis vertebral lesion is less common. Age dimorphism of the use of certain groups of drugs and physiotherapy facilities is observed.

  8. Juvenile chronic arthritis.

    Science.gov (United States)

    Southwood, T R; Woo, P

    1995-05-01

    The nomenclature and classification criteria for arthritis in children should be dealt with initially as separate issues, although they are undoubtedly intertwined. The classification criteria should aim to delineate homogeneous patient populations, yet should be flexible enough to incorporate advances in disease knowledge. It should be recognized that arriving at an international consensus for classification criteria will merely provide a set of operational definitions to facilitate research, and not a set of diagnostic criteria. Indeed the only point to obtaining consensus is to begin a process of systematic ongoing review of the criteria. The labels attached to any of these diseases should facilitate accurate communication. In view of the heterogeneous nature of childhood arthritis, consideration should be given to using a broad umbrella term such as juvenile or childhood arthritis only for communicating with the lay public. Medical nomenclature should be formulated to reflect accurately homogeneous subgroups of arthritis, and should not artificially proscribe a relationship between paediatric and adult disease.

  9. Juvenile hyaline fibromatosis

    Directory of Open Access Journals (Sweden)

    Jayashree Krishnamurthy

    2011-01-01

    Full Text Available Juvenile hyaline fibromatosis is a rare, autosomal-recessive disease characterized by papular and nodular skin lesions, gingival hyperplasia, joint contractures and bone involvement in variable degrees. It is a connective tissue disorder with aberrant synthesis of glycosaminoglycans by fibroblasts. We report a 5-year-old female born of first-degree consanguineous marriage who presented with multiple, recurrent, painless, variable-sized nodules. Fine needle aspiration cytology smears and the subsequent histopathological examination from the nodules showed benign spindle cells in a Periodic acid Schiff-positive myxoid background. The disease has a relentlessly progressive course, with most patients surviving only up to the 4 th decade. As of now, there is no specific treatment for this disorder. Genetic counseling is essential to explain to parents about a 25% chance of having a diseased baby in any pregnancy. With the gene being mapped recently, techniques for antenatal diagnosis are likely to be established.

  10. Clinical features and outcome in a Danish cohort of juvenile dermatomyositis patients

    DEFF Research Database (Denmark)

    Mathiesen, P R; Zak, M; Herlin, Troels

    2010-01-01

    To assess disease characteristics and outcome in Danish juvenile dermatomyositis (JDM) patients (1977-2007).......To assess disease characteristics and outcome in Danish juvenile dermatomyositis (JDM) patients (1977-2007)....

  11. Absence of Btn1p in the yeast model for juvenile Batten disease may cause arginine to become toxic to yeast cells.

    Science.gov (United States)

    Vitiello, Seasson Phillips; Wolfe, Devin M; Pearce, David A

    2007-05-01

    Lymphoblast cell lines established from individuals with juvenile Batten disease (JNCL) bearing mutations in CLN3 and yeast strains lacking Btn1p (btn1-Delta), the homolog to CLN3, have decreased intracellular levels of arginine and defective lysosomal/vacuolar transport of arginine. It is important to establish the basis for this decrease in arginine levels and whether restoration of arginine levels would be of therapeutic value for Batten disease. Previous studies have suggested that synthesis and degradation of arginine are unaltered in btn1-Delta. Using the yeast model for the Batten disease, we have determined that although btn1-Delta results in decreased intracellular arginine levels, it does not result from altered arginine uptake, arginine efflux or differences in arginine incorporation into peptides. However, expression of BTN1 is dependent on arginine and Gcn4p, the master regulator of amino acid biosynthesis. Moreover, deletion of GCN4 (gcn4-Delta), in combination with btn1-Delta, results in a very specific growth requirement for arginine. In addition, increasing the intracellular levels of arginine through overexpression of Can1p, the plasma membrane basic amino acid permease, results in increased cell volume and a severe growth defect specific to basic amino acid availability for btn1-Delta, but not wild-type cells. Therefore, elevation of intracellular levels of arginine in btn1-Delta cells is detrimental and is suggestive that btn1-Delta and perhaps mutation of CLN3 predispose cells to keep arginine levels lower than normal.

  12. Effects of hirami lemon, Citrus depressa Hayata, leaf meal in diets on the immune response and disease resistance of juvenile barramundi, Lates calcarifer (bloch), against Aeromonas hydrophila.

    Science.gov (United States)

    Shiu, Ya-Li; Lin, Hsueh-Li; Chi, Chia-Chun; Yeh, Shinn-Pyng; Liu, Chun-Hung

    2016-08-01

    The present study was conducted to evaluate the dietary supplementation of leaf meal from Citrus depressa Hayata on the growth, innate immune response, and disease resistance of juvenile barramundi, Lates calcarifer. Four diets were formulated to contain 0% (control), 1% (C1), 3% (C3), and 5% (C5) leaf meal, respectively. During a 56 d feeding trial, fish survival, growth performance, and feed efficiency were not significantly different among all groups. For immune response, respiratory burst, superoxide dismutase and lysozyme activities were not significantly different among all groups. However, fish fed the C5 diet for 56 d had significantly higher phagocytic activity. Also, fish fed C3 and C5 diets had significantly higher Mx gene expressions in spleens and head kidneys with nerve necrosis virus injections after 24 h. Disease resistance against Aeromonas hydrophila was increased by the C5 diet. In this study, barramundi fed on a diet containing 5% C. depressa Hayata leaf meal had significantly better innate immune response and disease resistance against A. hydrophila.

  13. A PCR-based diagnostic assay for the detection of Roseovarius crassostreae in Crassostrea virginica affected by juvenile oyster disease (JOD)

    Science.gov (United States)

    Maloy, A.P.; Barber, B.J.; Boettcher, K.J.

    2005-01-01

    We have developed a PCR-assay for the diagnosis of juvenile oyster disease (JOD) based on the detection of Roseovarius crassostreae directly from affected oysters. Species-specific primers are used to amplify the 16S-23S rDNA internal transcribed spacer (ITS) of R. crassostreae, and confirmation of product identity is accomplished by restriction enzyme analysis. No false positives were obtained with either closely related bacterial species or from other DNAs present in oyster samples. The assay has the potential to detect as few as 10 cells of R. crassostreae per oyster when samples are taken from the inner valve surfaces of the animal. Inclusion of material from soft body surfaces is not necessary, and may reduce sensitivity approximately 10-fold. In a JOD-affected population, a positive PCR result was obtained from all oysters from which these bacteria were subsequently cultured. The assay also detected the presence of R. crassostreae in 2 oysters from which no R. crassostreae isolates were recovered. No R. crassostreae was detected by either PCR or bacteriology in oysters from a population that was not exhibiting JOD-signs. This assay is expected to advance regional disease management efforts and provide valuable insights into the disease process and epizootiology of JOD. ?? Inter-Research 2005.

  14. Paget-Schroetter syndrome and pulmonary thromboembolism: clinical follow-up over 5 years.

    Science.gov (United States)

    Kobayashi, Hideo; Mimura, Satoshi; Motoyoshi, Kazuo

    2005-09-01

    A scaffold constructor lost consciousness at work, leading to emergency admission to our hospital. He had noted gradual worsening of exertional dyspnea over the previous 1 month. Chest radiography showed localized oligemia and enlarged hilar vessels. Pulmonary perfusion scintigraphy confirmed the existence of multiple perfusion defects, so a diagnosis of pulmonary thromboembolism was made. Upper and lower limb venography disclosed interruption of the right subclavian vein (so-called Paget-Schroetter syndrome). However, there was no difference in appearance between the right and left upper extremities. Five years after starting anticoagulant therapy, his symptoms have resolved, but serial perfusion scintigraphy and upper extremity venography revealed the persistence of abnormalities. In patients with pulmonary thromboembolism, lifestyle factors (especially heavy manual labor) should be considered and the possibility of subclavian vein thrombosis should be kept in mind.

  15. A Practical Approach to Juvenile Dermatomyositis and Juvenile Scleroderma.

    Science.gov (United States)

    McCann, Liza J; Pain, Clare E

    2016-02-01

    Juvenile dermatomyositis and juvenile scleroderma are rare multisystem autoimmune disorders. Although they share some pathognomonic hallmarks with adult onset myositis or scleroderma, there are significant differences in presentation, characteristics and associated features when the diseases present in childhood. In view of this, and the rarity of the conditions, it is important for care to be led by teams with expertise in pediatric rheumatology conditions. Prognosis has improved significantly in the West; likely due to early diagnosis and aggressive treatment with immunosuppressive medications. However, this trend is not replicated in the developing world. Early recognition of these diseases is crucial to achieve rapid and sustained remission and prevent disease or medication associated complications. This article aims to provide a practical overview for recognition, diagnosis and treatment of these conditions.

  16. What Is Juvenile Arthritis?

    Science.gov (United States)

    ... Analgesics for Osteoarthritis (Report from AHRQ) Joint Replacement Surgery: Health Information Basics for You and Your Family NIH Pediatric Rheumatology Clinic Health Information Juvenile Arthritis Find a Clinical Trial Journal Articles Juvenile Arthritis PDF Version Size: 123 KB ...

  17. Juvenile Delinquency: An Introduction

    Science.gov (United States)

    Smith, Carolyn A.

    2008-01-01

    Juvenile Delinquency is a term which is often inaccurately used. This article clarifies definitions, looks at prevalence, and explores the relationship between juvenile delinquency and mental health. Throughout, differences between males and females are explored. (Contains 1 table.)

  18. Parenting and juvenile delinquency

    NARCIS (Netherlands)

    Hoeve, Machteld

    2008-01-01

    Juvenile delinquency is a noteworthy problem. This thesis addressed the association between parenting and juvenile delinquency by analyzing the concepts of parenting adopted in family research in relation to criminological concepts and measures of delinquent behavior. Four studies were conducted.

  19. [Juvenile idiopathic arthritis].

    Science.gov (United States)

    Herlin, Troels

    2002-08-19

    The new classification of juvenile idiopathic arthritis (JIA) is described in this review. Clinical characteristics divide JIA in to subtypes: systemic, oligoarticular (persistent and extended type), RF-positive and--negative polyarticular, enthesitis-related arthritis and psoriatic arthritis. In addition to the clinical characteristics, genetic and biochemical differences suggest that JIA could be regarded as a general term covering various diseases. Complications described are uveitis, temporomandibular joint affection and growth disturbances. The therapeutic strategy should be planned individually according to age, subtype and disease activity and carried out as teamwork with several specialties. Drugs showing significant effectiveness in controlled studies are primarily methotrexate and sulphasalazine. An immunomodulating agent, etanercept, a soluble TNF alpha-receptor fusion protein, has shown a promising effect in severe polyarticular JIA refractory to methotrexate treatment.

  20. The relationship between CAG repeat length and age of onset differs for Huntington's disease patients with juvenile onset or adult onset.

    Science.gov (United States)

    Andresen, J Michael; Gayán, Javier; Djoussé, Luc; Roberts, Simone; Brocklebank, Denise; Cherny, Stacey S; Cardon, Lon R; Gusella, James F; MacDonald, Marcy E; Myers, Richard H; Housman, David E; Wexler, Nancy S

    2007-05-01

    Age of onset for Huntington's disease (HD) varies inversely with the length of the disease-causing CAG repeat expansion in the HD gene. A simple exponential regression model yielded adjusted R-squared values of 0.728 in a large set of Venezuelan kindreds and 0.642 in a North American, European, and Australian sample (the HD MAPS cohort). We present evidence that a two-segment exponential regression curve provides a significantly better fit than the simple exponential regression. A plot of natural log-transformed age of onset against CAG repeat length reveals this segmental relationship. This two-segment exponential regression on age of onset data increases the adjusted R-squared values by 0.012 in the Venezuelan kindreds and by 0.035 in the HD MAPS cohort. Although the amount of additional variance explained by the segmental regression approach is modest, the two slopes of the two-segment regression are significantly different from each other in both the Venezuelan kindreds [F(2, 439) = 11.13, P= 2 x 10(-5)] and in the HD MAPS cohort [F(2, 688) = 38.27, P= 2 x 10(-16)]. In both populations, the influence of each CAG repeat on age of onset appears to be stronger in the adult-onset range of CAG repeats than in the juvenile-onset range.

  1. Juvenile Arrests, 2007. Juvenile Justice Bulletin

    Science.gov (United States)

    Puzzanchera, Charles

    2009-01-01

    This Bulletin summarizes 2007 juvenile crime and arrest data reported by local law enforcement agencies across the country and cited in the FBI report, "Crime in the United States 2007." The Bulletin describes the extent and nature of juvenile crime that comes to the attention of the justice system. It serves as a baseline for comparison for…

  2. Juvenile polyposis syndrome

    NARCIS (Netherlands)

    L.A.A. Brosens; D. Langeveld; W.A. van Hattem; F.M. Giardiello; G.J.A. Offerhaus

    2011-01-01

    Juvenile polyposis syndrome is a rare autosomal dominant syndrome characterized by multiple distinct juvenile polyps in the gastrointestinal tract and an increased risk of colorectal cancer. The cumulative life-time risk of colorectal cancer is 39% and the relative risk is 34. Juvenile polyps have a

  3. Estudo comparativo de testes diagnósticos para olho seco entre crianças saudáveis e portadoras de artrite reumatóide juvenil Comparative study of diagnostic tests for dry eye disease between healthy and juvenile rheumatoid arthritis children

    Directory of Open Access Journals (Sweden)

    Jayter Silva de Paula

    2004-10-01

    clinically and underwent tests for keratoconjunctivitis sicca: Schirmer's 1, tear film break-up time and rose bengal staining tests. RESULTS: Six children with juvenile rheumatoid arthritis presented one or more symptoms of keratoconjunctivitis sicca (40% and five of them (83.3% presented meibomitis or other signs of this disease. In group 2, no child presented symptoms or signs of keratoconjunctivitis sicca. Mean Schirmer test did not differ between group 1 and 2 (p=0.156. However, the mean tear film break-up time was significantly reduced in group 1 (p=0.0005 and the mean rose Bengal staining score in group 1 was significantly greater than in group 2 (p=0.0038. Five of the fifteen children of group 1 (33% have two or more abnormal tests and were diagnosed as having definite keratoconjunctivitis sicca, while four children (26% were labeled with probable keratoconjunctivitis sicca. No child of group 2 had more than one positive test. CONCLUSIONS: Signs and symptoms of keratoconjunctivitis sicca appear to be a common ocular finding in juvenile rheumatoid arthritis children. Although only tear film break-up time and rose bengal staining score were significantly different in these groups, there was a trend toward worsening of the other dry eye tests in juvenile rheumatoid arthritis children.

  4. Imaging of juvenile idiopathic arthritis

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Karl [Birmingham Children' s Hospital, Radiology Department, Birmingham (United Kingdom)

    2006-08-15

    Over the past decade there have been considerable changes in the classification and imaging of juvenile idiopathic arthritis (JIA). Radiology now has a considerable role in the management of JIA, the differential diagnosis, monitoring disease progression and detecting complications. The different imaging modalities available, their role and limitations are discussed in this article and the various disease features that the radiologist should be aware of are described. An approach to the imaging of the child with joint disease and in the monitoring of disease complications are also discussed. (orig.)

  5. Juveniles on trial.

    Science.gov (United States)

    Quinn, Kathleen M

    2002-10-01

    This article describes common forensic evaluations requested of juvenile court mental health evaluators. There has been a legal shift toward criminalization of juvenile court, with a greater emphasis on rights, abandonment of the rehabilitative model, and greater movement of adolescents into the adult criminal court. A resulting shift has been the redefinition of juvenile court forensic evaluations toward the specificity of adult forensic work. The challenge for evaluators is to refine their knowledge of the forensic standards and bring knowledge of development, assessment, and diagnosis in juveniles and interview techniques appropriate to juveniles to improve the evaluation and forensic reports.

  6. Founders lecture 2007. Metabolic bone disease: what has changed in 30 years?

    Energy Technology Data Exchange (ETDEWEB)

    Sundaram, Murali [Cleveland Clinic, Diagnostic Radiology, MSK, Cleveland, OH (United States)

    2009-09-15

    To provide an update on imaging of metabolic bone disease based on new developments, findings, and changing practices over the past 30 years. Literature review of osteoporosis, osteomalacia, renal osteodystrophy, Paget's disease, bisphosphonates, with an emphasis on imaging. Cited references and pertinent findings. Significant developments have occurred in the imaging of metabolic bone disease over the past 30 years. (orig.)

  7. Genome-wide copy number profiling using a 100K SNP array reveals novel disease-related genes BORIS and TSHZ1 in juvenile angiofibroma.

    Science.gov (United States)

    Schick, Bernhard; Wemmert, Silke; Willnecker, Vivienne; Dlugaiczyk, Julia; Nicolai, Piero; Siwiec, Henryk; Thiel, Christian T; Rauch, Anita; Wendler, Olaf

    2011-11-01

    Juvenile angiofibroma (JA) is a unique fibrovascular tumor, which is almost exclusively found in the posterior nasal cavity of adolescent males. Although histologically classified as benign, the tumor often shows an aggressive growth pattern and has been associated with chromosomal imbalances, amplification of oncogenes and epigenetic dysregulation. We present the first genome-wide profiling of JAs (n=14) with a 100K single nucleotide polymorphism (SNP) microarray. Among the 30 novel JA-specific amplifications detected on autosomal chromosomes with this technique, the genes encoding the cancer-testis antigen BORIS (brother of the regulator of imprinted sites) and the developmental regulator protein TSHZ1 (teashirt zinc finger homeobox 1) were selected for further analysis. Gains for both BORIS (20q13.3) and TSHZ1 (18q22.3) were confirmed by quantitative genomic PCR. Furthermore, quantitative RT-PCR revealed a significant up-regulation of BORIS (ptool for identifying novel disease-related genes in JAs and newly implicates BORIS and TSHZ1 overexpression in the pathogenesis of JAs. Detection of BORIS in JAs is described with special regard to tumor proliferation and epigenetic dysregulation, and the finding of TSHZ1 amplifications is discussed with special respect to the hypothesis of JAs as malformations of the first branchial arch artery.

  8. Etanercept in the treatment of disease-modifying anti-rheumatic drug (DMARD)-refractory polyarticular course juvenile idiopathic arthritis: experience from Japanese clinical trials.

    Science.gov (United States)

    Mori, Masaaki; Takei, Syuji; Imagawa, Tomoyuki; Imanaka, Hiroyuki; Nerome, Yasuhito; Kurosawa, Rumiko; Kawano, Yoshifumi; Yokota, Shumpei; Sugiyama, Noriko; Yuasa, Hirotoshi; Fletcher, Tracey; Wajdula, Joseph S

    2011-12-01

    Efficacy, safety, and pharmacokinetics results from 4 studies-3 open-label (OL) and 1 randomized double-blind (DB)-have provided data for approval of etanercept for treatment of disease-modifying anti-rheumatic drug (DMARD)-refractory juvenile idiopathic arthritis (JIA) in Japan. Results from the 3 shorter-term (2 OL and 1 DB) studies are reported here. Subjects (4-17 years) enrolled in the OL studies had active JIA, i.e. ≥5 swollen joints and ≥3 joints with limitation of motion and pain or tenderness. Subjects enrolled in the primary OL study received etanercept 0.4 mg/kg subcutaneously twice weekly; in the lower-dose OL study subjects received etanercept 0.2 mg/kg. Subjects in the primary OL study who completed ≥48 weeks could continue into a 12-week DB dose-down extension study in which subjects received etanercept 0.4 or 0.2 mg/kg twice weekly. The primary endpoint in all 3 studies, i.e. 30% improvement in the American College of Rheumatology criteria for JIA (ACR Pedi 30) at 12 weeks, was achieved by ≥80% of subjects by week 2 and sustained to week 12. Common adverse events reported were injection site reactions, nasopharyngitis, and gastroenteritis. These results provide further evidence that etanercept is effective therapy for DMARD-refractory polyarticular JIA patients.

  9. Polymorphisms of CSF1 and TM7SF4 genes in a case of mild juvenile Paget’s disease found using next-generation sequencing

    Science.gov (United States)

    Donáth, Judit; Speer, Gábor; Kósa, János P.; Árvai, Kristóf; Balla, Bernadett; Juhász, Péter; Lakatos, Péter; Poór, Gyula

    2015-01-01

    Juvenile Paget’s disease (JPD) is a rare autosomal-recessive condition. It is diagnosed in young children and characterized by a generalized increase in bone turnover, bone pain, and skeletal deformity. Our patient was diagnosed after a pathological fracture when she was 11 years old. When we first examined her at the age of 30 she had bone pain and deformity in both the femur and tibia. Serum alkaline phosphatase (ALP) level, radiology, bone scintigraphy, and densitometry were monitored. Next generation sequencing (NGS) technology, namely semiconductor sequencing, was used to determine the genetic background of JPD. Seven target genes and regions were selected and analyzed after literature review (TM7SF4, SQSTM1, TNFRSF11A, TNFRSF11B, OPTN, CSF1, VCP). No clear pathogenic mutation was found, but we detected missense polymorphisms in CSF1 and TM7SF4 genes. After treatment with zoledronic acid, infusion bone pain and ALP level decreased. We can conclude that intravenous zoledronic acid therapy is effective and safe for suppressing bone turnover and improving symptoms in JPD, but the long-term effects on clinical outcomes are unclear. Our findings also suggest that NGS may help explore the pathogenesis and aid the diagnosis of JPD. PMID:25891874

  10. Juvenile polyposis syndrome

    Institute of Scientific and Technical Information of China (English)

    Lodewijk AA Brosens; Danielle Langeveld; W Arnout van Hattem; Francis M Giardiello; G Johan A Offerhaus

    2011-01-01

    Juvenile polyposis syndrome is a rare autosomal dominant syndrome characterized by multiple distinct juvenile polyps in the gastrointestinal tract and an increased risk of colorectal cancer.The cumulative life-time risk of colorectal cancer is 39% and the relative risk is 34.Juvenile polyps have a distinctive histology characterized by an abundance of edematous lamina propria with inflammatory cells and cystically dilated glands lined by cuboidal to columnar epithelium with reactive changes.Clinically, juvenile polyposis syndrome is defined by the presence of 5 or more juvenile polyps in the colorectum,juvenile polyps throughout the gastrointestinal tract or any number of juvenile polyps and a positive family history of juvenile polyposis.In about 50%-60% of patients diagnosed with juvenile polyposis syndrome a germline mutation in the SMAD4 or BMPR1A gene is found.Both genes play a role in the BMP/TGF-beta signalling pathway.It has been suggested that cancer in juvenile polyposis may develop through the so-alled "landscaper mechanism" where an abnormal stromal environment leads to neoplastic transformation of the adjacent epithelium and in the end invasive carcinoma.Recognition of this rare disorder is important for patients and their families with regard to treatment,follow-up and screening of at risk individuals.Each clinician confronted with the diagnosis of a juvenile polyp should therefore consider the possibility of juvenile polyposis syndrome.In addition, juvenile polyposis syndrome provides a unique model to study colorectal cancer pathogenesis in general and gives insight in the molecular genetic basis of cancer. This review discusses clinical manifestations, genetics, pathogenesis and management of juvenile polyposis syndrome.

  11. Effect of enzyme therapy in juvenile patients with Pompe disease: a three-year open-label study.

    NARCIS (Netherlands)

    Capelle, C.I. van; Beek, N.A. van der; Hagemans, M.L.; Arts, W.F.M.; Hop, W.C.J.; Lee, P.; Jaeken, J.; Frohn-Mulder, I.M.; Merkus, P.J.F.M.; Corzo, D.; Puga, A.C.; Reuser, A.J.J.; Ploeg, A.T. van der

    2010-01-01

    Pompe disease is a rare neuromuscular disorder caused by deficiency of acid alpha-glucosidase. Treatment with recombinant human alpha-glucosidase recently received marketing approval based on prolonged survival of affected infants. The current open-label study was performed to evaluate the response

  12. Effect of enzyme therapy in juvenile patients with Pompe disease: a three-year open-label study.

    NARCIS (Netherlands)

    Capelle, C.I. van; Beek, N.A. van der; Hagemans, M.L.; Arts, W.F.M.; Hop, W.C.J.; Lee, P.; Jaeken, J.; Frohn-Mulder, I.M.; Merkus, P.J.F.M.; Corzo, D.; Puga, A.C.; Reuser, A.J.J.; Ploeg, A.T. van der

    2010-01-01

    Pompe disease is a rare neuromuscular disorder caused by deficiency of acid alpha-glucosidase. Treatment with recombinant human alpha-glucosidase recently received marketing approval based on prolonged survival of affected infants. The current open-label study was performed to evaluate the response

  13. Wheel running from a juvenile age delays onset of specific motor deficits but does not alter protein aggregate density in a mouse model of Huntington's disease

    Directory of Open Access Journals (Sweden)

    Spires Tara L

    2008-04-01

    Full Text Available Abstract Background Huntington's disease (HD is a neurodegenerative disorder predominantly affecting the cerebral cortex and striatum. Transgenic mice (R6/1 line, expressing a CAG repeat encoding an expanded polyglutamine tract in the N-terminus of the huntingtin protein, closely model HD. We have previously shown that environmental enrichment of these HD mice delays the onset of motor deficits. Furthermore, wheel running initiated in adulthood ameliorates the rear-paw clasping motor sign, but not an accelerating rotarod deficit. Results We have now examined the effects of enhanced physical activity via wheel running, commenced at a juvenile age (4 weeks, with respect to the onset of various behavioral deficits and their neuropathological correlates in R6/1 HD mice. HD mice housed post-weaning with running wheels only, to enhance voluntary physical exercise, have delayed onset of a motor co-ordination deficit on the static horizontal rod, as well as rear-paw clasping, although the accelerating rotarod deficit remains unaffected. Both wheel running and environmental enrichment rescued HD-induced abnormal habituation of locomotor activity and exploratory behavior in the open field. We have found that neither environment enrichment nor wheel running ameliorates the shrinkage of the striatum and anterior cingulate cortex (ACC in HD mice, nor the overall decrease in brain weight, measured at 9 months of age. At this age, the density of ubiquitinated protein aggregates in the striatum and ACC is also not significantly ameliorated by environmental enrichment or wheel running. Conclusion These results indicate that enhanced voluntary physical activity, commenced at an early presymptomatic stage, contributes to the positive effects of environmental enrichment. However, sensory and cognitive stimulation, as well as motor stimulation not associated with running, may constitute major components of the therapeutic benefits associated with enrichment

  14. Correlation between the Modified Systemic Lupus Erythematosus Disease Activity Index 2000 and the European Consensus Lupus Activity Measurement in juvenile systemic lupus erythematosus.

    Science.gov (United States)

    Sato, J O; Corrente, J E; Saad-Magalhães, C

    2016-11-01

    Objective The objective of this study was to assess Modified Systemic Lupus Erythematosus Disease Activity Index 2000 (SLEDAI-2K) and European Consensus Lupus Activity Measurement (ECLAM) disease activity correlation in addition to their respective correlation to Pediatric Systemic Lupus International Collaborative Clinics/American College of Rheumatology (SLICC/ACR) Damage Index (Ped-SDI), in juvenile systemic lupus erythematosus (JSLE). Methods The activity indices were scored retrospectively and summarized by adjusted means during follow-up. The Ped-SDI was scored during the last visit for those with more than six months follow-up. Pearson correlation between the Modified SLEDAI-2K and ECLAM, as well as Spearman correlations between the Modified SLEDAI-2K, ECLAM, and Ped-SDI were calculated. The receiver operating characteristic (ROC) curve was calculated for both activity indices discriminating damage measured by Ped-SDI. Results Thirty-seven patients with mean age at diagnosis 11 ± 2.9 years and mean follow-up time 3.2 ± 2.4 years were studied. The Modified SLEDAI-2K and ECLAM adjusted means were highly correlated ( r = 0.78, p  0.7, p < 0.001), but Modified SLEDAI-2K and ECLAM correlation with Ped-SDI was only moderate. ROC analysis discriminant performance for both activity indices resulted in area under curve (AUC) of 0.74 and 0.73 for Modified SLEDAI-2K and ECLAM, respectively. Conclusion The high correlation found between the Modified SLEDAI-2K and ECLAM adjusted means indicated that both tools can be equally useful for longitudinal estimates of JSLE activity.

  15. Criteria for evaluating response and outcome in clinical trials for children with juvenile myelomonocytic leukemia

    NARCIS (Netherlands)

    C.M. Niemeyer (Charlotte); M.L. Loh (Mignon); A. Cseh (Annamaria); T. Cooper (Todd); J. Dvorak (Jennie); R. Chan (Rebecca); B. Xicoy (Blanca); U. Germing (Ulrich); S. Kojima (Seiji); A. Manabe (Atsushi); M.N. Dworzak (Michael); B. de Moerloose (Barbara); J. Starý (Jan); O.P. Smith (Owen Patrick); R. Masetti (Riccardo); F. Catala; E. Bergstraesser (Eva); M. Ussowicz (Marek); O. Fabri (Oskana); A. Baruchel (André); H. Cavé (Helene); C.M. Zwaan (Christian Michel); F. Locatelli (Franco); H. Hasle (Henrik); M.M. van den Heuvel-Eibrink (Marry); C. Flotho (Christian); A. Yoshimi (Ayami)

    2015-01-01

    textabstractJuvenile myelomonocytic leukemia is a rare myeloproliferative disease in young children. While hematopoietic stem cell transplantation remains the only curative therapeutic option for most patients, children with juvenile myelomonocytic leukemia increasingly receive novel agents in phase

  16. Clinical trial perspective for adult and juvenile Huntington′s disease using genetically-engineered mesenchymal stem cells

    Directory of Open Access Journals (Sweden)

    Peter Deng

    2016-01-01

    Full Text Available Progress to date from our group and others indicate that using genetically-engineered mesenchymal stem cells (MSC to secrete brain-derived neurotrophic factor (BDNF supports our plan to submit an Investigational New Drug application to the Food and Drug Administration for the future planned Phase 1 safety and tolerability trial of MSC/BDNF in patients with Huntington′s disease (HD. There are also potential applications of this approach beyond HD. Our biological delivery system for BDNF sets the precedent for adult stem cell therapy in the brain and could potentially be modified for other neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS, spinocerebellar ataxia (SCA, Alzheimer′s disease, and some forms of Parkinson′s disease. The MSC/BDNF product could also be considered for studies of regeneration in traumatic brain injury, spinal cord and peripheral nerve injury. This work also provides a platform for our future gene editing studies, since we will again use MSCs to deliver the needed molecules into the central nervous system.

  17. Clinical trial perspective for adult and juvenile Huntington’s disease using genetically-engineered mesenchymal stem cells

    Institute of Scientific and Technical Information of China (English)

    Peter Deng; Audrey Torrest; Kari Pollock; Heather Dahlenburg; Geralyn Annett; Jan A. Nolta; Kyle D. Fink

    2016-01-01

    Progress to date from our group and others indicate that using genetically-engineered mesenchymal stem cells (MSC) to secrete brain-derived neurotrophic factor (BDNF) supports our plan to submit an Investigational New Drug application to the Food and Drug Administration for the future planned Phase 1 safety and tolera-bility trial of MSC/BDNF in patients with Huntington’s disease (HD). There are also potential applications of this approach beyond HD. Our biological delivery system for BDNF sets the precedent for adult stem cell ther-apy in the brain and could potentially be modiifed for other neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia (SCA), Alzheimer’s disease, and some forms of Parkinson’s dis-ease. The MSC/BDNF product could also be considered for studies of regeneration in traumatic brain injury, spinal cord and peripheral nerve injury. This work also provides a platform for our future gene editing studies, since we will again use MSCs to deliver the needed molecules into the central nervous system.

  18. A study of dynamic F-waves in juvenile spinal muscular atrophy of the distal upper extremity (Hirayama disease).

    Science.gov (United States)

    Zheng, Chaojun; Zhu, Yu; Yang, Shuo; Lu, Feizhou; Jin, Xiang; Weber, Robert; Jiang, Jianyuan

    2016-08-15

    The study aimed to analyse changes in the upper limb F-waves during neck flexion in patients with Hirayama disease (HD). This study included 41 healthy subjects, 38 HD patients and 24 patients with amyotrophic lateral sclerosis (ALS). Bilateral F-waves were consecutively recorded 20 times with the neck both in the standard position and after persistent neck flexion for 30min. The persistence, minimal latencies, chronodispersion, F/M ratios and amplitudes of the F-waves and repeater F-waves were compared between the standard neck and neck flexion positions. During neck flexion, repeater F-waves were found in more HD patients, the percentage of both the ulnar and median repeater F-waves increased significantly, and higher F/M ratios were observed on the symptomatic side (P0.05). HD might be more likely to present as a position-related dysfunction rather than a spinal cord-intrinsic disease. Thus, HD patients could be counselled to avoid neck flexion for long periods of time to prevent further damage, especially in the progressive stage of the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Heterogeneity and frequency of movement disorders in juvenile and adult-onset Niemann-Pick C disease.

    Science.gov (United States)

    Anheim, Mathieu; Lagha-Boukbiza, Ouhaïd; Fleury-Lesaunier, Marie-Céline; Valenti-Hirsch, Maria-Paola; Hirsch, Edouard; Gervais-Bernard, Hélène; Broussolle, Emmanuel; Thobois, Stéphane; Vanier, Marie T; Latour, Philippe; Tranchant, Christine

    2014-01-01

    Niemann-Pick type C disease (NPC) is a recessive neurolipidosis. We report five adolescent and adult NPC cases to underscore the frequency and heterogeneity of movement disorders in NPC. Clinical, morphologic, biochemical and genetic study was performed in the five patients. Disease onset was between 8 and 50 years. Movement disorders were present in all cases, were heterogeneous and often combined [cerebellar ataxia (5/5), myoclonus (3/5), dystonia (2/5), chorea (1/5) and tremor (1/5)] and were the first sign in 4/5. Two patients were reported to have no vertical supranuclear gaze palsy (VSGP) at the first examination. Two patients experienced acute neuropsychiatric signs leading to death in one case due to myoclonic storm. Filipin staining was always positive. Two NPC1 mutations were identified in three patients, only one in two siblings. NPC should be considered in case of unexplained movement disorders, even when VSGP or cataplexy are not reported. Filipin staining remains a strong support for the diagnosis. Treatment with miglustat should be considered which is currently the only approved disease-specific treatment of NPC in children and adults.

  20. Clinical and molecular characteristics of a child with juvenile Sandhoff disease%青少年型Sandhoff病一例临床特点及基因分析

    Institute of Scientific and Technical Information of China (English)

    黄永兰; 谢婷; 郑纪鹏; 赵小媛; 刘鸿圣; 刘丽

    2014-01-01

    Objective To explore the clinical features and molecular mutation of HEXB gene in a case with juvenile Sandhoff disease.Method We retrospectively reviewed the clinical,neuroimaging and biochemical findings in this Chinese child with juvenile Sandhoff disease.Hexosaminidase A and hexosaminidase A & B activities were measured in blood leukocytes by fluorometric assay.HEXB gene molecular analysis was performed by PCR and direct sequencing.Result The 9-year-old boy was admitted for psychomotor regression.He presented slowly progressive gait disorder and dysarthria during the last three years.Cranial MRI revealed a marked cerebellar atrophy with normal intensity in the thalamus and basal ganglia.Brain MRS showed normal in the thalamus and basal ganglia.Hexosaminidase A was 69.5 (mg·h) [normal controls 150-360 nmol/(mg · h)],hexosaminidase A & B activity was 119 nmol/(mg · h) [normal controls 600-3 500 nmol/(mg · h)],confirming the diagnosis of Sandhoff disease.The patient was a compound heterozygote for a novel deletion mutation c.1404delT (p.P468P fsX62) and a reported mutation c.1509-26G > A.Conclusion The clinical features of juvenile Sandhoff disease include ataxia,dysarthria and cerebellar atrophy.The enzyme assay and molecular analysis of HEXB gene can confirm the diagnosis of Sandhoff disease.The novel mutation c.1404delT(p.P468P fsX62) is a diseaserelated mutation.%目的 探讨青少年型Sandhoff病的临床及氨基己糖苷酶β-亚单位基因(HEXB)突变特点.方法 回顾性分析2012年5月广州市妇女儿童医疗中心内分泌代谢科确诊的1例青少年型Sandhoff病患儿的临床、头颅MRI及生化表现,采用荧光底物法分别测定外周血白细胞氨基己糖苷酶A(Hex A)及氨基己糖苷酶A和B(Hex A&B)酶活性,PCR-DNA直接测序法进行HEXB突变分析.结果 患儿男,9岁,主因“走路不稳、讲话变慢并进行性加重3年”就诊,病情进展缓慢.头颅MRI表现为双侧小脑半球、小脑蚓脑沟明

  1. MRI findings of nonprogressive juvenile spinal muscular atrophy of the distal upper limbs (Hirayama's disease)

    Energy Technology Data Exchange (ETDEWEB)

    Lee, In Sook; Lee, Tae Hong; Kim, Hak Jin; Song, Jong Woon; Lee, Suk Hong; Choi, Kwang Dong; Park, Kyoung Pil; Choi, Ki Bok [Pusan National University College of Medicine, Pusan (Korea, Republic of)

    2003-05-01

    The aim of this study was to describe the dynamic changes of the cervical dural sac and the spinal cord during neck flexion in patients suffering from Hirayama's disease and to present the usefulness of flexion MR study for the diagnosis. Seven consecutive male patients (age ranging 17-43 years, mean age 23.7 years) with the clinical diagnosis of Hirayama's disease and 5 healthy subjects (aged 25-32 years) for controls had done cervical MRI from January 2001 through June 2002. Cervical MRI was done in neutral and neck flexed positions using 1.5T system (Sonata, Siemens, Germany) and obtained images were reviewed by two radiologists. We compared the cervical MRI findings of 7 patients with those of 5 healthy controls regarding neck flexion induced changes in the lower cervical segments. Neutral positioned cervical sagittal MR images revealed subtle or mild cord atrophy in only 2 patients. On maximal neck flexion, AP diameter of the cresent posterior epidural space was increased and also cord flattening with anterior shifting of posterior wall of the lower cervical dural canal was noted in all 7 patients. In all 7 cases, the level and side of spinal cord changes corresponded to the clinical phenotype. All control subjects showed neither cord flattening nor widening of posterior epidural space on neck flexion. In patients with the clinical diagnosis of Hirayama's disease, MRI scans obtained on maximal neck flexion showed characteristically dynamic flattening of lower cervical cord and widening of posterior epidural space. Therefore, a flexion MR study is needed to prove the diagnosis.

  2. MRI findings of nonprogressive juvenile spinal muscular atrophy of the distal upper limbs(Hirayama's disease)

    Energy Technology Data Exchange (ETDEWEB)

    Lee, In Sook; Lee, Tae Hong; Kim, Hak Jin; Song, Jong Woon; Lee, Suk Hong; Choi, Kwang Dong; Park, Kyoung Pil [Pusan National University College of Medicine, Pusan (Korea, Republic of); Choi, Ki Bok [Inje University College of Medicine, Pusan (Korea, Republic of)

    2003-05-01

    The aim of this study was to describe the dynamic changes of the cervical dural sac and the spinal cord during neck flexion in patients suffering from Hirayama's disease and to present the usefulness of flexion MR study for the diagnosis. Seven consecutive male patients (age ranging 17-43 years, mean age 23.7 years) with the clinical diagnosis of Hirayama's disease and 5 healthy subjects (aged 25-32 years) for controls had done cervical MRI from January 2001 through June 2002. Cervical MRI was done in neutral and neck flexed positions using 1.5 T system (Sonata, Siemens, Germany) and obtained images were reviewed by two radiologists. We compared the cervical MRI findings of 7 patients with those of 5 healthy controls regarding neck flexion induced changes in the lower cervical segments. Neutral positioned cervical sagittal MR images revealed subtle or mild cord atrophy in only 2 patients. On maximal neck flexion, AP diameter of the cresent posterior epidural space was increased and also cord flattening with anterior shifting of posterior wall of the lower cervical dural canal was noted in all 7 patients. In all 7 cases, the level and side of spinal cord changes corresponded to the clinical phenotype. All control subjects showed neither cord flattening nor widening of posterior epidural space on neck flexion. In patients with the clinical diagnosis of Hirayama's disease, MRI scans obtained on maximal neck flexion showed characteristically dynamic flattening of lower cervical cord and widening of posterior epidural space. Therefore, a flexion MR study is needed to prove the diagnosis.

  3. Lethal disease in infant and juvenile Syrian hamsters experimentally infected with Imjin virus, a newfound crocidurine shrew-borne hantavirus.

    Science.gov (United States)

    Gu, Se Hun; Kim, Young-Sik; Baek, Luck Ju; Kurata, Takeshi; Yanagihara, Richard; Song, Jin-Won

    2015-12-01

    To gain insights into the pathogenicity of Imjin virus (MJNV), a newfound hantavirus isolated from the Ussuri white-toothed shrew (Crocidura lasiura), groups of Syrian hamsters (Mesocricetus auratus) of varying ages (<1, 5, 10, 14, 21, 35 and 56 days) were inoculated by the intraperitoneal route with 1000 pfu of MJNV strains 04-55 and 05-11. MJNV-infected Syrian hamsters, aged 21 days or less, exhibited reduced activity, weight loss, respiratory distress, hind-limb paralysis and seizures. Death ensued 1 to 6 days after onset of clinical disease. MJNV RNA was detected in brain and other major organs by RT-PCR and real time-PCR. Histopathological examination showed alveolar hemorrhage, interstitial pneumonia and severe pulmonary congestion; focal hepatic necrosis and portal inflammation; and acute meningoencephalitis. By immunohistochemistry, MJNV antigen was detected in pulmonary microvascular endothelial cells and glial cells. Older hamsters (35 and 56 days of age) developed subclinical infection without histopathological changes. Future studies are warranted to determine the pathophysiologic bases for the differential age susceptibility of Syrian hamsters to lethal MJNV disease.

  4. Juvenile polymyositis with unremitting pain and progressive loss of motor and bulbar function on a background of sickle cell disease.

    Science.gov (United States)

    Bali, Shreya; D'Cruz, David; Lazaro, Marion; Inusa, Baba P D

    2015-03-27

    The diagnosis of acute autoimmune rheumatic disorders in sickle cell disease (SCD) can be challenging. Polymyositis is an inflammatory myopathy which, like SCD, may present with myalgia but is usually associated with proximal muscle weakness. We describe an adolescent boy presenting with limb pain, difficulty in mobilisation, with progressive loss of motor function and later bulbar weakness. Investigations showed massive elevation of creatine kinase, and MRI and muscle biopsy findings consistent with severe polymyositis. The patient was treated with corticosteroids, intravenous immunoglobulin and intensive rehabilitation therapy. He made a good recovery and was discharged on azathioprine and prednisolone. In the context of SCD, multisystem symptoms, unexplained muscle pain and weakness, unresponsive to conventional treatment in the presence of steady state haemoglobin, should alert the clinician to autoimmune phenomena. Key factors in making a diagnosis are an autoimmune screen and early discussion with a rheumatology expert.

  5. Juvenile polymyositis with unremitting pain and progressive loss of motor and bulbar function on a background of sickle cell disease

    Science.gov (United States)

    Bali, Shreya; D'Cruz, David; Lazaro, Marion; Inusa, Baba P D

    2015-01-01

    The diagnosis of acute autoimmune rheumatic disorders in sickle cell disease (SCD) can be challenging. Polymyositis is an inflammatory myopathy which, like SCD, may present with myalgia but is usually associated with proximal muscle weakness. We describe an adolescent boy presenting with limb pain, difficulty in mobilisation, with progressive loss of motor function and later bulbar weakness. Investigations showed massive elevation of creatine kinase, and MRI and muscle biopsy findings consistent with severe polymyositis. The patient was treated with corticosteroids, intravenous immunoglobulin and intensive rehabilitation therapy. He made a good recovery and was discharged on azathioprine and prednisolone. In the context of SCD, multisystem symptoms, unexplained muscle pain and weakness, unresponsive to conventional treatment in the presence of steady state haemoglobin, should alert the clinician to autoimmune phenomena. Key factors in making a diagnosis are an autoimmune screen and early discussion with a rheumatology expert. PMID:25819817

  6. Assessing the likelihood of new-onset inflammatory bowel disease following tumor necrosis factor-alpha inhibitor therapy for rheumatoid arthritis and juvenile rheumatoid arthritis.

    Science.gov (United States)

    Krishnan, Asha; Stobaugh, Derrick J; Deepak, Parakkal

    2015-04-01

    The association between inhibition of tumor necrosis factor-alpha (TNF-α) in patients with rheumatoid arthritis (RA) and juvenile rheumatoid arthritis (JRA) and the onset of inflammatory bowel disease (IBD) is unclear. We sought to evaluate this association by analyzing adverse events (AEs) reported to the Food and Drug Administration Adverse Event Reporting System (FAERS) with a standardized scoring tool for drug-induced AEs. A search of the FAERS for RA or JRA (January 2003-December 2011) reported with adalimumab, certolizumab pegol, etanercept, golimumab, or infliximab was performed. This dataset was then queried for cases indicating IBD. Full-length reports were accessed using the Freedom of Information Act and organized by age, sex, concomitant medications, co-morbidities, type of TNF-α inhibitor used, and diagnosis/treatment details. The Naranjo score was used to determine whether the drug-induced AEs were definite, probable, possible, or doubtful. There were 158 cases of IBD after TNF-α inhibitor exposure in RA or JRA patients. Use of the Naranjo score revealed that, in a majority of the cases (71.5 %), TNF-α inhibitor exposure was considered a 'possible' cause. A majority of the 'probable cases' in JRA were reported with etanercept (40 patients, 90.91 %). There were no 'definite' cases of anti-TNF-induced IBD. After applying the Naranjo scale, a weak association between new-onset IBD and TNF-α inhibitor therapy in RA patients and a moderately strong association especially with etanercept exposure in JRA patients was observed. However, causality cannot be determined due to limitations of the FAERS and the Naranjo score.

  7. 川崎病合并幼年特发性关节炎一例%Kawasaki disease combined with systemic juvenile idiopathic arthritis:a case report

    Institute of Scientific and Technical Information of China (English)

    汤昔康; 陈泽楷; 覃丽君

    2014-01-01

    In clinics,pediatric fever is commonly encountered characterized with a variety of causes, complex condition and rapid changes. This article reported the diagnosis and treatment of a child with typical kawasaki disease (KD)combined with systemic juvenile idiopathic arthritis (SJIA). After the failed therapy of administration of IVIG,the child then developed arthritis. The diagnosis was corrected to KD complicated with SJIA. The symptoms were alleviated after effective treatment. Albeit KD and SJIA share similar manifestations in clinical and laboratory tests,much attention should be paid to distinguish the differences and avoid treatment delay.%临床工作中,儿科发热患儿多见,病因多样,部分患儿病情复杂且变化快。该文报道了1例川崎病合并幼年特发性关节炎患儿的诊治过程。患儿经丙种球蛋白治疗无反应后,出现关节炎症状,修正诊断为川崎病合并全身型幼年特发性关节炎,调整治疗方案后得到缓解。该例提示,川崎病及全身型幼年特发性关节炎虽有许多类似的临床表现及实验室数据,但应根据其不同点进一步鉴别诊断,以防延误治疗。

  8. Retrocalcaneal bursitis in juvenile chronic arthritis.

    OpenAIRE

    Goldenstein-Schainberg, C; Homsi, C; Rodrigues Pereira, R M; W. Cossermelli

    1992-01-01

    Retrocalcaneal bursitis has been described in various adult rheumatic diseases and septic bursitis unrelated to previous bursal disease has been reported in children. The case is reported here of a girl with juvenile chronic arthritis who developed non-septic retrocalcaneal bursitis; the diagnosis was suggested by a combination of clinical and radiographic studies and was confirmed by ultrasonography.

  9. Retrocalcaneal bursitis in juvenile chronic arthritis.

    Science.gov (United States)

    Goldenstein-Schainberg, C; Homsi, C; Rodrigues Pereira, R M; Cossermelli, W

    1992-01-01

    Retrocalcaneal bursitis has been described in various adult rheumatic diseases and septic bursitis unrelated to previous bursal disease has been reported in children. The case is reported here of a girl with juvenile chronic arthritis who developed non-septic retrocalcaneal bursitis; the diagnosis was suggested by a combination of clinical and radiographic studies and was confirmed by ultrasonography. Images PMID:1444631

  10. Juvenile giant fibroadenoma

    Directory of Open Access Journals (Sweden)

    Vipul Yagnik

    2011-07-01

    Full Text Available Fibroadenomas are benign solid tumor associated with aberration of normal lobular development. Juvenile giant fibroadenoma is usually single and >5 cm in size /or >500 gms in weight. Important differential diagnoses are: phyllodes tumor and juvenile gigantomastia. Simple excision is the treatment of choice.

  11. Renewing Juvenile Justice

    Science.gov (United States)

    Macallair, Daniel; Males, Mike; Enty, Dinky Manek; Vinakor, Natasha

    2011-01-01

    The Center on Juvenile and Criminal Justice (CJCJ) was commissioned by Sierra Health Foundation to critically examine California's juvenile justice system and consider the potential role of foundations in promoting systemic reform. The information gathered by CJCJ researchers for this report suggests that foundations can perform a key leadership…

  12. Philanthropist in Juvenile Reformatory

    Institute of Scientific and Technical Information of China (English)

    HAN NIU

    2007-01-01

    @@ On the afternoon of February 1, 2007, Chen Guangbiao, a noted philanthropist, found himself in the Jiangsu Provincial Juvenile Reformatory in Jurong City for a ceremony to donate two buses, 100 computers, and 100 desks and 100 chairs for the juvenile offenders to use in their study.

  13. Parenting and juvenile delinquency

    NARCIS (Netherlands)

    Hoeve, Machteld

    2008-01-01

    Juvenile delinquency is a noteworthy problem. This thesis addressed the association between parenting and juvenile delinquency by analyzing the concepts of parenting adopted in family research in relation to criminological concepts and measures of delinquent behavior. Four studies were conducted. Th

  14. Juvenile Confinement in Context

    Science.gov (United States)

    Mendel, Richard A.

    2012-01-01

    For more than a century, the predominant strategy for the treatment and punishment of serious and sometimes not-so-serious juvenile offenders in the United States has been placement into large juvenile corrections institutions, alternatively known as training schools, reformatories, or youth corrections centers. America's heavy reliance on…

  15. Parenting and juvenile delinquency

    NARCIS (Netherlands)

    Hoeve, Machteld

    2008-01-01

    Juvenile delinquency is a noteworthy problem. This thesis addressed the association between parenting and juvenile delinquency by analyzing the concepts of parenting adopted in family research in relation to criminological concepts and measures of delinquent behavior. Four studies were conducted. Th

  16. Paget-Schroetter syndrome after a dental procedure in a patient with factor V Leiden (R506Q) heterozygosity.

    Science.gov (United States)

    Sharma, Prabin

    2017-04-01

    : Paget-Schroetter syndrome or effort thrombosis is characterized by spontaneous thrombosis of the upper extremity venous system, commonly seen in a young healthy patient after repetitive use of the upper extremities. It is rarely associated with coagulopathy and thus, hypercoagulable work-up is not usually a part of the investigation. We present a first case of a young woman, who was diagnosed with left upper extremity effort thrombosis following a dental procedure. Interestingly, she was also noted to be heterozygous for factor V Leiden mutation.

  17. Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone

    Science.gov (United States)

    2013-10-01

    WT T/L-6 p62KI p62KI MVNP WT T/L-6 p62KI p62KI MVNP IT/L-6 ITIL -6 p62KVfiL-6 3±1 22±3 26±3 RANKL 5±3 16±3 8±2 31±5 MVNP 32±2 100 26...MVNP RANKL(ng/ml) RANKL (100ng/ml) 0 u_L_i_L_LJ~~~-L-L~-L~~L-~L-L-L D WT TIL -6 p62KI p62KI MVNP WT T/L-6 p62KI p62KI MVNP WT TAF12 TFIIB ITIL -6... ITIL -6 TIL-6 p62KI p62KI IT/L-6 T AF12/TFIIB 1.0 2.5 1.0 5.1 27 c Figure 3 A p62KI WT p62KI TIL-6 IT/L-6 WT MVNP p62KI RANKLI

  18. Understanding the Delay in Onset of Paget’s Disease of Bone

    Science.gov (United States)

    2014-09-01

    of the measles virus   5 genome in which all three reading frames encode distinct genes (MVP, MVV and MVC ) using the same sequence. Our problem...gene M S K T D W N V S G L S R MVC gene gccgagcccatcggctcgctggccgtcgaggaagccatggcagcatggtcagaaatatca A E P...R W P S R K P W Q H G Q K Y Q MVC gene gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C

  19. Juvenile dermatomyositis in a Nigerian girl

    Science.gov (United States)

    Adelowo, Olufemi; Nwankwo, Madu; Olaosebikan, Hakeem

    2014-01-01

    Juvenile dermatomyositis is an autoimmune connective tissue disease occurring in children less than 16 years old. It is part of a heterogeneous group of muscle diseases called idiopathic Iiflammatory myopathies. It had previously been reported in black Africans resident in UK. However, there is no documented case reported from Africa. The index sign of heliotrope rashes is often difficult to visualise in the black skin. An 11-year-old Nigerian girl presenting with clinical, laboratory and histopathological features of juvenile dermatomyositis is presented here. It is hoped that this case will heighten the index of suspicion of this condition among medical practitioners in Africa. PMID:24706700

  20. Paracoccidioidomycosis: acute-subacute clinical form, juvenile type*

    Science.gov (United States)

    Marques, Silvio Alencar; Lastória, Joel Carlos; de Camargo, Rosangela Maria Pires; Marques, Mariangela Esther Alencar

    2016-01-01

    The authors report aspects of paracoccidioidomycosis, acute-subacute clinical form, juvenile type, in a 19-year-old female patient. Paracoccidioidomycosis, juvenile type, classically occurs in young patients, both sexes, with lymphoma-like aspects as initial presentation. However, following the natural history of the disease the lymph nodes assume patterns of infectious disease, as an abscess and fistulae. Systemic dissemination of the disease can occur and lethality and morbidity are significant in this clinical presentation. PMID:27438214

  1. Long-term outcome in patients with juvenile dermatomyositis

    DEFF Research Database (Denmark)

    Mathiesen, P; Hegaard, H; Herlin, Troels

    2012-01-01

    To evaluate a group of 53 patients with juvenile dermatomyositis (JDM), on average 13.9 years after disease onset, in order to describe the long-term disease outcome and to identify disease-related parameters associated with poor disease outcome.......To evaluate a group of 53 patients with juvenile dermatomyositis (JDM), on average 13.9 years after disease onset, in order to describe the long-term disease outcome and to identify disease-related parameters associated with poor disease outcome....

  2. SUBTYPES OF JUVENILE SYSTEMIC SCLERODERMA

    Directory of Open Access Journals (Sweden)

    M N Slarovoitova

    2001-01-01

    Full Text Available Aim: to allot clinical forms of juvenile systemic scleroderma (JSSD. Material and methods: investigation and dynamic observation of 60 patients aged 14-54 (mean age 25.1 ±7.2 with onset of disease in child's and adolescent’s ages from 1 to 16 years old ( in average 11. 4±3.8 year old and disease duration from 1 to 39 years (in average 13.1 ±7.9. Results: 55% of patients demonstrated JSSD subtype with focal cutaneous lesion of different localization. The possibility of overlap-syndrome development in JSSD patients with onset in adolescent age typical for SSD-rheumatoid arthritis, SSD-polymvositis should be underlined. Conclusion: knowledge of different clinical forms and courses of the disease, modern diagnostics and early beginning of differential JSSD treatment will enable us to improve the prognosis and disease outcome.

  3. JUVENILE RHEUMATOID ARTHRITIS

    Directory of Open Access Journals (Sweden)

    I N Sartika

    2012-11-01

    Full Text Available Juvenile rheumatoid arthritis (JRA is the most common rheumatic condition in children. JRA is defined as persistent arthritis in 1 or more joints for at least 6 weeks, with the onset before age 16 years. The etiology of JRA is unknown. Antigen activated CD4+ T cell stimulate monocytes, macrophages, and synovial fibroblasts to produce the cytokines Interleukin-1 (IL-1, IL-6, and tumor necrosis factor ? (TNF-? and to secrete matrix metalloproteinases, which lead to chronic inflammation due to infiltration of inflammatory cell, angiogenesis, destruction of cartilage and bone with pannus formation. The 3 major subtypes of JRA are based on the symptoms at disease onset and are designated systemic onset, pauciarticular onset, and polyarticular onset. For all patients, the goals of therapy are to decrease chronic joint pain and suppress the inflammatory process. Poor prognostic have been observed in patients with polyarticular onset, rheumatoid factor, persistent morning stiffness, tenosynovitis, involvement of the small joints, rapid appearance of erosions, active late onset childhood, subcutaneous nodules, or antinuclear antibody.

  4. Glucocorticoids in juvenile idiopathic arthritis.

    Science.gov (United States)

    Malattia, Clara; Martini, Alberto

    2014-05-01

    Although the use of corticosteroids in juvenile idiopathic arthritis (JIA) is now much more limited owing to the availability of methotrexate and biological agents, there are clinical scenarios where it is still indicated. For example, corticosteroids may be indicated for intraarticular injections to prevent joint deformities, as a "bridge" drug to relieve symptoms in polyarticular disease while waiting for methotrexate and biologics to exert their full therapeutic effects, and in the treatment of chronic iridocyclitis, macrophage activation syndrome, and systemic JIA, although the advent of interleukin (IL)-1 and IL-6 blockers has greatly reduced the latter indication.

  5. Cryopyrin-Associated Autoinflammatory Syndromes (CAPS) - Juvenile

    Science.gov (United States)

    ... Cryopyrin-Associated Autoinflammatory Syndrome (CAPS) (Juvenile) Dermatomyositis (Juvenile) Familial Mediterranean Fever (Juvenile) Fibromyalgia Giant Cell Arteritis Glucocorticoid-induced Osteoperosis ...

  6. Juvenil idiopatisk arthritis

    DEFF Research Database (Denmark)

    Herlin, Troels

    2002-01-01

    The new classification of juvenile idiopathic arthritis (JIA) is described in this review. Clinical characteristics divide JIA in to subtypes: systemic, oligoarticular (persistent and extended type), RF-positive and--negative polyarticular, enthesitis-related arthritis and psoriatic arthritis...

  7. Juvenile Rockfish Recruitment Cruise

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — In 1983, the groundfish analysis project began a series of yearly cruises designed to assess the annual abundance of juvenile rockfish along the central California...

  8. Juvenile Idiopathic Arthritis

    Science.gov (United States)

    ... Physical Therapy Regular Exercise en español Artritis idiopática juvenil It may begin with a swollen knuckle, a ... may suddenly appear and disappear, developing in one area and then another. High fevers that tend to ...

  9. Juvenile Sex Offenders.

    Science.gov (United States)

    Ryan, Eileen P; Otonichar, Joseph M

    2016-07-01

    Sexual offending by juveniles accounts for a sizable percentage of sexual offenses, especially against young children. In this article, recent research on female juvenile sex offenders (JSOs), risk factors for offending in juveniles, treatment, and the ways in which these youth may differ from general delinquents will be reviewed. Most JSOs do not go on to develop paraphilic disorders or to commit sex offenses during adulthood, and as a group, they are more similar to nonsexual offending juvenile delinquents than to adult sex offenders. Recent research has elucidated some differences between youth who commit sex offenses and general delinquents in the areas of atypical sexual interests, the use of pornography, and early sexual victimization during childhood.

  10. Parenting and juvenile delinquency

    OpenAIRE

    Hoeve, Machteld

    2008-01-01

    Juvenile delinquency is a noteworthy problem. This thesis addressed the association between parenting and juvenile delinquency by analyzing the concepts of parenting adopted in family research in relation to criminological concepts and measures of delinquent behavior. Four studies were conducted. The first study addressed a meta-analysis on parenting characteristics and styles in relation to delinquency. In this meta-analysis, previous manuscripts were systematically analyzed, computing mean ...

  11. Evaluation of the Role of Vibrational Spectroscopy in the Assessment of Vulval Disease

    Science.gov (United States)

    2016-02-10

    Normal Vulval Skin; Lichen Sclerosus; High Grade Dysplasia - Usual Type ('VIN 2-3'); High Grade Dysplasia - Differentiated Type ('VIN 2-3'); Squamous Cell Carcinoma; Epithelial Hyperplasia Without Atypia; Atypia Not Otherwise Specified/ Low Grade Dysplasia ('VIN 1'); Pagets Disease of the Vulva

  12. Antineutrophil cytoplasmic antibodies in juvenile chronic arthritis

    NARCIS (Netherlands)

    Mulder, L; Horst, G; Limburg, P; deGraeffMeeder, ER; Kuis, W; Kallenberg, C

    1997-01-01

    Objective, To evaluate the diagnostic significance of antineutrophil cytoplasmic antibodies (ANCA) by assessing the prevalence of ANCA in juvenile chronic arthritis (JCA) (n = 93) of either oligoarticular, polyarticular, or systemic onset. To investigate the prevalence of ANCA in other diseases of c

  13. The human microbiome and juvenile idiopathic arthritis

    NARCIS (Netherlands)

    Verwoerd, Anouk; ter Haar, Nienke M.; de Roock, Sytze; Vastert, Sebastiaan J.; Bogaert, Debby

    2016-01-01

    Juvenile idiopathic arthritis (JIA) is the most common rheumatic disease in childhood. The pathogenesis of JIA is thought to be the result of a combination of host genetic and environmental triggers. However, the precise factors that determine one's susceptibility to JIA remain to be unravelled. The

  14. The human microbiome and juvenile idiopathic arthritis

    NARCIS (Netherlands)

    Verwoerd, Anouk; ter Haar, Nienke M.; de Roock, Sytze; Vastert, Sebastiaan J.; Bogaert, Debby

    2016-01-01

    Juvenile idiopathic arthritis (JIA) is the most common rheumatic disease in childhood. The pathogenesis of JIA is thought to be the result of a combination of host genetic and environmental triggers. However, the precise factors that determine one's susceptibility to JIA remain to be unravelled. The

  15. 大口黑鲈鱼种弹状病毒病的诊断%Diagnosis of rhabdovirus disease in juvenile largemouth bass Micropterus salmonides

    Institute of Scientific and Technical Information of China (English)

    雷燕; 戚瑞荣; 崔龙波; 肖洋; 张文文; 马家好; 王雪鹏

    2015-01-01

    Diagnosis of acute mortality was investigated in cultured juvenile largemouth bass Micropterus salmonides collected in Foshan, Guangdong Province. The morbid largemouth bass swam on the water surface, had blacken and rotten skin, and fins, and was devoid of food. The postmortem examination revealed that the sick fish had hem-orrhagic gills, swollen liver, spleen and kidney, reddish intestine and empting stomach. Epidemiological survey in-dicated that no pathogenic bacteria and parasites were found in the organs including liver, spleen and kidney, the disease being obvious infectious. The diffused necrosis was histologically observed in liver, spleen and kidney. The specific products with predicted size were obtained in the diseased fish by primers designed according to the se-quence of GenBank. Comparative analysis of nucleotide sequences in the GenBank databases using Blast database network service showed that the putative gene products from the infected largemouth bass shared high homologous i-dentity of 96 . 9% with hybrid snakehead rhabdovirus ( HSHV ) and 95 . 3% with Siniperca chuatsi rhabdovirus ( SCRV) , indicating that the mortality of largemouth bass is caused by rhabdoviruses.%对广东佛山一突发批量急性死亡现象的大口黑鲈Micropterus salmoides养殖池塘中的患病大口黑鲈鱼种进行了研究。结果表明:濒死的大口黑鲈在水面漫游,烂身、烂鳍,停止摄食,严重者体色发黑;解剖病鱼鳃有少量出血点,肝脏严重肿大、充血,脾脏肿大,胃肠空虚,肾脏肿大;流行病学调查发现,该病具有明显的传染性;从病鱼肝脏、脾脏和肾脏中未分离到致病菌,也未检测到大量寄生虫;组织病理切片观察发现,肝脏、脾脏和肾脏均呈弥漫性坏死;参考GenBank中弹状病毒的基因序列,设计并合成检测引物,以从自然发病鱼提取的DNA 作为模板,检测结果显示,病鱼均能扩增出与预期大小片段相

  16. [HLA antigens in juvenile rheumatoid arthritis].

    Science.gov (United States)

    Rumba, I V; Sochnev, A M; Kukaĭne, E M; Burshteĭn, A M; Benevolenskaia, L I

    1990-01-01

    Antigens of I class HLA system (locus A and B) were investigated in 67 patients of Latvian nationality suffering from juvenile rheumatoid arthritis (JRA). Associations of HLA antigens with juvenile rheumatoid arthritis partially coincided with the ones revealed earlier. Typing established an increased incidence of antigen B27 (p less than 0.01) and gaplotype A2, B40 (p less than 0.01). Antigen B15 possessed a protective action with respect to JRA. Interlocus combinations demonstrated a closer association with the disease than a single antigen. The authors also revealed markers of various clinico-anatomical variants of JRA.

  17. Juvenil Pityriasis Rubra Pilaris: A Case Report

    Directory of Open Access Journals (Sweden)

    M. Emin YANIK et al.

    2010-05-01

    Full Text Available Juvenile pityriasis rubra pilaris (PRP is an uncommon skin disease characterized by follicularkeratotic papules, erythemato-squamous plaques and palmoplantar keratoderma. Etyology isunknown. A 8 years-old boy presented with a 15 days history of scaly patches and plaques withfollicular papules involving his scalp and face. However he had palmoplantar keratoderma onhis hands and feet. Based upon clinical and histopatological findings, he was diagnosed asJuvenile PRP. Acitretin was initiated for therapy. We presented our case because of its rarity.

  18. Acute respiratory failure in 3 children with juvenile myelomonocytic leukemia

    DEFF Research Database (Denmark)

    Gustafsson, Britt; Hellebostad, Marit; Ifversen, Marianne

    2011-01-01

    Juvenile myelomonocytic leukemia is a rare hematopoietic stem cell disease in children with features of both myelodysplasia and myeloproliferation. Extramedullary involvement has been reported and pulmonary involvement secondary to leukemic infiltration is an initial manifestation, which may resu...

  19. Acute Respiratory Failure in 3 Children With Juvenile Myelomonocytic Leukemia

    DEFF Research Database (Denmark)

    Gustafsson, Britt; Hellebostad, Marit; Ifversen, Marianne

    2011-01-01

    Juvenile myelomonocytic leukemia is a rare hematopoietic stem cell disease in children with features of both myelodysplasia and myeloproliferation. Extramedullary involvement has been reported and pulmonary involvement secondary to leukemic infiltration is an initial manifestation, which may result...

  20. [Physiotherapy for juvenile idiopathic arthritis].

    Science.gov (United States)

    Spamer, M; Georgi, M; Häfner, R; Händel, H; König, M; Haas, J-P

    2012-07-01

    Control of disease activity and recovery of function are major issues in the treatment of children and adolescents suffering from juvenile idiopathic arthritis (JIA). Functional therapies including physiotherapy are important components in the multidisciplinary teamwork and each phase of the disease requires different strategies. While in the active phase of the disease pain alleviation is the main focus, the inactive phase requires strategies for improving motility and function. During remission the aim is to regain general fitness by sports activities. These phase adapted strategies must be individually designed and usually require a combination of different measures including physiotherapy, occupational therapy, massage as well as other physical procedures and sport therapy. There are only few controlled studies investigating the effectiveness of physical therapies in JIA and many strategies are derived from long-standing experience. New results from physiology and sport sciences have contributed to the development in recent years. This report summarizes the basics and main strategies of physical therapy in JIA.

  1. [Unusual presentation of juvenile idiopathic arthritis and autoimmune hepatitis].

    Science.gov (United States)

    Moreno Prieto, M; Carbonero Celis, M J; Cuadrado Caballero, M C

    2015-01-01

    The coexistence of autoimmune hepatitis and juvenile idiopathic arthritis is very rare. This is the case of an 18 month old female patient whose first sign of disease was torticollis due to an underlying atlanto-axial subluxation. Three months later, bilateral knee arthritis developed and she was diagnosed with Juvenile Idiopathic Arthritis. Throughout the disease a persistent elevation of liver enzymes was noted, combined with positive antinuclear antibodies and hypergammaglobulinemia, reaching the diagnosis of concomitant autoimmune hepatitis.

  2. Vocational Teachers' Role in Serving Juvenile Offenders.

    Science.gov (United States)

    Meers, Gary D.

    1983-01-01

    Educators need to understand the juvenile justice system to understand what juvenile offenders go through while completing their sentences. This article reviews cases and juvenile charge classifications, and presents a model for alternative sentencing options for juveniles. (JOW)

  3. Atherosclerosis in Juvenile Idiopathic Arthritis

    Directory of Open Access Journals (Sweden)

    Ewa Jednacz

    2012-01-01

    Full Text Available Atherosclerosis is a chronic inflammatory disease of the arteries. Clinical consequences of the atherosclerotic process occur in the adult population, however atherosclerotic process begins in childhood. The classic risk factors for atherosclerosis include obesity, dyslipidaemia, age, gender or family history. In recent years, attention has been drawn to the similarity between atherosclerotic inflammatory processes and inflammatory changes in the course of systemic connective tissue disease, in particular systemic lupus etythematosus (SLE or rheumatoid arthritis (RA. There is also observed the similarity of the pathogenetic background of development of atherosclerosis and juvenile idiopathic arthritis (JIA. Elevated levels of pro-inflammatory cytokines are observed in the course of juvenile idiopathic arthritis. Also homocysteine concentrations, which may play a significant role in the development of atherosclerotic lesions, are observed higher in patients with JIA. Some studies revealed higher carotid intima-media thickness (IMT index values in children with JIA. In view of the fact that atherosclerotic process begins as early as in childhood, the introduction of appropriate preventive measures in children is a matter of utmost importance.

  4. Serum neopterin is not increased in obese juveniles.

    Science.gov (United States)

    Mangge, Harald; Freytag, Florian; Almer, Gunter; Weghuber, Daniel; Bauer-Denk, Carmen; Fuchs, Dietmar

    2011-01-01

    Objective. Cardiovascular disease is associated with inflammation and immune activation, concentrations of immune activation markers like neopterin predict outcome in adults. Methods. Serum neopterin concentrations and early metabolic and pre-atherosclerotic symptoms were analyzed in 295 obese juveniles and 101 normal weight controls of similar age. Additionally, the influence of a 12 months weight reduction program on neopterin levels was investigated in 31 obese juveniles. Results. Intima-media thickness of common carotid arteries (IMT) and the concentrations of C-reactive protein (CRP) were increased in the obese juveniles (P juveniles (P juvenile obesity behaved considerably different from what was demonstrated in adults, levels did not correlate with metabolic and pre-atherosclerotic symptoms found in early phases although early vascular burden and chronic low grade inflammation was indicated by increased IMT and CRP. Neopterin concentrations increased after a 12 months intervention program.

  5. Trunk asymmetry in juveniles

    Directory of Open Access Journals (Sweden)

    Triantafyllopoulos Georgios

    2008-09-01

    Full Text Available Abstract Background Trunk asymmetry (TA is a common phenomenon in children, but its incidence in juveniles is not known. The present cross sectional study reports TA in normal juveniles and provides data which describe the evolution of TA from early childhood to adolescence. Materials and methods The scoliometer readings in both standing and sitting forward bending position (FBP of 3301 children, (1645 boys, and 1656 girls aged from 3 to 9 years old were studied. TA was quantified by measuring angle of trunk rotation (ATR and children were categorized as symmetric (ATR = 0°, mild asymmetric (ATR 1° – 6° and severely asymmetric (ATR ≥ 7°. The difference of TA between standing and sitting FBP as well as differences between boys and girls in frequency of TA were also calculated. The scoliometer readings were analyzed by age to reveal at which age the juvenile pattern of TA changes into the adolescent one. Results 74.2% of boys and 77% of girls were symmetric (ATR = 0° in the thoracic region in standing FBP, while 82.7% of boys and 84.1% of girls were symmetric in the thoracic region in sitting FBP. Juvenile girls are more symmetric than boys but severe TA was found almost the same between the two genders. A significant reduction in the frequency of mild TA from standing into sitting FBP, in all the examined regions in both boys and girls was found, but in severe TA this reduction is very small. Analysing scoliometer readings by age it appears that significant TA changes take place between 8–9 years of age for boys and between 6–7 and 8–9 years for girls. TA in boys is changing into the adolescent pattern at a later age than in girls. Conclusion Juveniles were found more symmetric than adolescents, who were studied previously in a different study. Furthermore, juvenile girls were found more symmetric than boys. Juvenile TA pattern seems to be in accordance with the higher incidence of juvenile idiopathic scoliosis in boys. Furthermore

  6. Juvenile Incarceration and Health.

    Science.gov (United States)

    Barnert, Elizabeth S; Perry, Raymond; Morris, Robert E

    2016-03-01

    Addressing the health status and needs of incarcerated youth represents an issue at the nexus of juvenile justice reform and health care reform. Incarcerated youth face disproportionately higher morbidity and higher mortality compared to the general adolescent population. Dental health, reproductive health, and mental health needs are particularly high, likely as a result of lower access to care, engagement in high-risk behaviors, and underlying health disparities. Violence exposure and injury also contribute to the health disparities seen in this population. Further, juvenile incarceration itself is an important determinant of health. Juvenile incarceration likely correlates with worse health and social functioning across the life course. Correctional health care facilities allow time for providers to address the unmet physical and mental health needs seen in this population. Yet substantial challenges to care delivery in detention facilities exist and quality of care in detention facilities varies widely. Community-based pediatricians can serve a vital role in ensuring continuity of care in the postdetention period and linking youth to services that can potentially prevent juvenile offending. Pediatricians who succeed in understanding and addressing the underlying social contexts of their patients' lives can have tremendous impact in improving the life trajectories of these vulnerable youth. Opportunities exist in clinical care, research, medical education, policy, and advocacy for pediatricians to lead change and improve the health status of youth involved in the juvenile justice system.

  7. Avaliação de provas de fase aguda em crianças e adolescentes com artrite idiopática juvenil e sua correlação com atividade da doença Acute phase reactants evaluation in children and adolescents with juvenile idiopathic arthritis and its correlation with disease activity

    Directory of Open Access Journals (Sweden)

    Aline Alencar M. F. Nicácio

    2009-06-01

    Full Text Available OBJETIVO:Analisar a relação entre as provas de fase aguda e a atividade clínica da artrite idiopática juvenil e avaliar a concordância entre velocidade de hemossedimentação e proteína C reativa (VHS e PCR na fase aguda da doença. MÉTODOS: Foi realizado estudo retrospectivo tipo coorte a partir da análise de prontuários de 30 crianças e adolescentes que preenchiam os critérios diagnósticos para artrite idiopática juvenil, estavam em atendimento em ambulatório de Reumatologia Pediátrica e haviam realizado as provas de fase aguda (VHS e PCR. RESULTADOS: Dos 30 pacientes, 21 (70% eram do sexo feminino e 19 (63,3% apresentavam o subtipo oligoarticular da doença. A média de idade de início dos sintomas foi 65,6 meses, a idade de diagnóstico de 85,3 e o tempo de evolução, 57,2 meses. As provas de fase aguda mostraram associação positiva com a atividade de doença. A anemia não teve relação com a atividade de doença. A concordância entre as duas provas de fase aguda foi superior a 80%. CONCLUSÕES: As provas de fase aguda mantêm relação positiva com a atividade da doença e o seu uso concomitante aumenta a especificidade.OBJECTIVE:To analyze the relationship between the acute phase reactants and the disease activity of Juvenile Idiopathic Arthritis (JIA and to evaluate the agreement between erythrocyte sedimentation rate and C-reactive protein during the acute phase of the disease. METHODS: a cohort retrospective study has been conducted based on the analysis of 30 children and adolescents who fulfilled the diagnostic criteria of JIA. All of them were in current follow-up at the pediatric rheumatology outpatient clinic and had acute phase reactants blood tests performed. RESULTS: Studied population comprised 30 patients: 21 (70% of them were females and 19 (63.3% presented oligoarticular subtype. The mean age at disease onset was 65.6 months; the age at diagnosis was 85.3 months and the follow-up had 57.2 months of

  8. DERMATOMIOSITIS JUVENIL Y EMBARAZO

    OpenAIRE

    Evans M,Gregorio; Poulsen R,Ronald; Blanco R,Romiely; Luna V,Viviana

    2002-01-01

    La dermatomiositis juvenil es un desorden inflamatorio crónico multisistémico del tejido conectivo. Tiene una incidencia de 2-3/100.000/año. Con la disminución en la mortalidad experimentada en los últimos decenios, la atención está cifrada en la morbilidad a largo plazo y en las alteraciones funcionales. Con un tratamiento agresivo los niños con dermatomiositis juvenil generalmente tienen un futuro promisorio, sin incapacidad o con incapacidad mínima. La mortalidad actualmente se estima cerc...

  9. Juvenile idiopathic arthritis overview and involvement of the temporomandibular joint: prevalence, systemic therapy.

    Science.gov (United States)

    Carrasco, Ruy

    2015-02-01

    The temporomandibular joint (TMJ) is one of the many joints involved in the inflammatory arthritides. As imaging of joints has developed, so have the data regarding extent and prevalence of TMJ involvement in these diseases. TMJ disease is especially prevalent in juvenile arthritis. The adult and pediatric inflammatory arthritides share common pathophysiology but are still markedly different. The preponderance of TMJ arthritis research exists in juvenile arthritis. This article discusses classification, treatment, and TMJ involvement in juvenile idiopathic arthritis.

  10. Juvenile Victimization and Delinquency.

    Science.gov (United States)

    Esbensen, Finn-Aage; Huizinga, David

    1991-01-01

    Demographic characteristics of juvenile victims of crime and a potential relationship between victimization and self-reported delinquency are examined for 877 adolescents from a large midwestern city. Lifetime victimization rates (LVRs) are higher for those involved in delinquency, and LVRs rise with age and higher levels of delinquent behavior.…

  11. Bite force and temporomandibular disorder in juvenile chronic arthritis.

    Science.gov (United States)

    Wenneberg, B; Kjellberg, H; Kiliaridis, S

    1995-08-01

    The aim of this study was to investigate the functional condition of the stomatognathic system in children suffering from juvenile chronic arthritis, with respect to bite force and temporomandibular disorder in relation to radiographic abnormalities of the mandibular condyle, occlusal factors and systemic disease parameters. Thirty-five children with juvenile chronic arthritis were compared to 89 healthy children with an Angle Class I occlusion and 62 children with an Angle Class II malocclusion. Subjective symptoms and clinical signs of temporomandibular disorder and radiographic mandibular condylar changes were more common in children with juvenile chronic arthritis than in the two comparison groups. Maximal molar and incisal bite forces and maximal molar bite force endurance times were also significantly reduced in children with juvenile chronic arthritis. It is concluded that the differences between the groups are caused mainly by the systemic inflammatory disease itself, but a functional influence of weakened masticatory muscles cannot be excluded.

  12. Exercise testing and fitness training in juvenile idiopathic arthritis

    NARCIS (Netherlands)

    Singh-Grewal, D.

    2010-01-01

    Juvenile Idiopathic Arthritis is the commonest rheumatic disease of childhood affecting 1:1000 children under the age of 16 years. Children with JIA have long been sidelined from physical activity due to active disease or irrational concerns that activity may in some way worsen disease. Children

  13. Exercise testing and fitness training in juvenile idiopathic arthritis

    NARCIS (Netherlands)

    Singh-Grewal, D.

    2010-01-01

    Juvenile Idiopathic Arthritis is the commonest rheumatic disease of childhood affecting 1:1000 children under the age of 16 years. Children with JIA have long been sidelined from physical activity due to active disease or irrational concerns that activity may in some way worsen disease. Children wit

  14. AUTOINFLAMMATORY DISEASES IN CHILDREN(The Lecture from 18th of September 2013, Conference «Topical Problems of Diagnostics and Treatment of Juvenile Rheumatoid Arthritis» (18–20 of September, 2013, St. Petersburg

    Directory of Open Access Journals (Sweden)

    M. Gattorno

    2014-01-01

    Full Text Available Data about clinical signs, diagnostics and treatment of hereditary autoinflammatory syndromes, e.g. cryopyrin-associated periodic syndrome (CAPS, familial Mediterranean fever (FMF, TNF-receptor associated periodic syndrome (TRAPS-syndrome, hyperimmunoglobulinemia D syndrome (HIDS, Pyogenic Sterile Arthritis, Pyoderma Gangrenosum and Acne (PAPA syndrome, juvenile sarcoidosis (Blau-syndrome are shown in the article. These diseases are typically genetic disease with autosomal dominant and autosomal recessive type of inheritance. All diseases have common pathogenic features, such as spontaneous activation of innate immunity, maintaining of uncontrolled inflammation, absence of auto-antibodies and antigen-specific T-lymphocytes, over-secretion of interleukin-1 and good response to anti-interleukin-1 treatment. In this article you can see the basis of pathogenesis of the diseases, which determine the choice of treatment modalities and diagnostic algorhythms. Differences between clinical phenotypes of cryopyrin-associated periodic syndrome, such as familial cold urticaria (FCAS, Muckle-Wells syndrome and CINCA / NOMID syndrome are described thoroughly. You can find information about the whole group of periodic fevers and their differentiation. Data about international project «EuroFever» which can facilitate international collaboration in the fields of periodic fever are available.

  15. Ocular complications and visual outcome in juvenile chronic arthritis: a 25-year follow-up study

    DEFF Research Database (Denmark)

    Zak, Marek; Fledelius, Hans; Pedersen, Freddy Karup

    2003-01-01

    Assessment of longterm ophthalmic outcome in juvenile chronic arthritis (JCA) with emphasis on visual acuity and identification of disease-related parameters associated with rheumatic eye affection.......Assessment of longterm ophthalmic outcome in juvenile chronic arthritis (JCA) with emphasis on visual acuity and identification of disease-related parameters associated with rheumatic eye affection....

  16. Trends in paediatric rheumatology referral times and disease activity indices over a ten-year period among children and young people with Juvenile Idiopathic Arthritis: results from the childhood arthritis prospective Study.

    Science.gov (United States)

    McErlane, Flora; Foster, Helen E; Carrasco, Roberto; Baildam, Eileen M; Chieng, S E Alice; Davidson, Joyce E; Ioannou, Yiannis; Wedderburn, Lucy R; Thomson, Wendy; Hyrich, Kimme L

    2016-07-01

    The medical management of JIA has advanced significantly over the past 10 years. It is not known whether these changes have impacted on outcomes. The aim of this analysis was to identify and describe trends in referral times, treatment times and 1-year outcomes over a 10-year period among children with JIA enrolled in the Childhood Arthritis Prospective Study. The Childhood Arthritis Prospective Study is a prospective inception cohort of children with new-onset inflammatory arthritis. Analysis included all children recruited in 2001-11 with at least 1 year of follow-up, divided into four groups by year of diagnosis. Median referral time, baseline disease pattern (oligoarticular, polyarticular or systemic onset) and time to first definitive treatment were compared between groups. Where possible, clinical juvenile arthritis disease activity score (cJADAS) cut-offs were applied at 1 year. One thousand and sixty-six children were included in the analysis. The median time from symptom onset and referral to first paediatric rheumatology appointment (22.7-24.7 and 3.4-4.7 weeks, respectively) did not vary significantly (∼20% seen within 10 weeks of onset and ∼50% within 4 weeks of referral). For oligoarticular and polyarticular disease, 33.8-47 and 25.4-34.9%, respectively, achieved inactive disease by 1 year, with ∼30% in high disease activity at 1 year. A positive trend towards earlier definitive treatment reached significance in oligoarticular and polyarticular pattern disease. Children with new-onset JIA have a persistent delay in access to paediatric rheumatology care, with one-third in high disease activity at 1 year and no significant improvement over the past 10 years. Contributing factors may include service pressures and poor awareness. Further research is necessary to gain a better understanding and improve important clinical outcomes. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Rheumatology.

  17. Clinical outcome measures in juvenile idiopathic arthritis.

    Science.gov (United States)

    Consolaro, Alessandro; Giancane, Gabriella; Schiappapietra, Benedetta; Davì, Sergio; Calandra, Serena; Lanni, Stefano; Ravelli, Angelo

    2016-04-18

    Juvenile idiopathic arthritis (JIA), as a chronic condition, is associated with significant disease- and treatment-related morbidity, thus impacting children's quality of life. In order to optimize JIA management, the paediatric rheumatologist has begun to regularly use measurements of disease activity developed, validated and endorsed by international paediatric rheumatology professional societies in an effort to monitor the disease course over time and assess the efficacy of therapeutic interventions in JIA patients.A literature review was performed to describe the main outcome measures currently used in JIA patients to determine disease activity status.The Juvenile Disease Activity Score (JADAS), in its different versions (classic JADAS, JADAS-CRP and cJADAS) and the validated definitions of disease activity and response to treatment represent an important tool for the assessment of clinically relevant changes in disease activity, leading more and more to a treat-to-target strategy, based on a tight and thorough control of the patient condition. Moreover, in recent years, increasing attention on the incorporation of patient-reported or parent-reported outcomes (PRCOs), when measuring the health state of patients with paediatric rheumatic diseases has emerged.We think that the care of JIA patients cannot be possible without taking into account clinical outcome measures and, in this regard, further work is required.

  18. Late Onset Juvenile Xanthogranuloma

    Directory of Open Access Journals (Sweden)

    Punithwavathy K

    1999-01-01

    Full Text Available A 19 year old female was seen with multiple skin coloured and hyperpigmented macules, discrete as well as grouped papules and nodules of varying sizes distributed over the face, neck, extensor and flexor aspects of both upper and lower extremities including joints. The trunk was spared. Some of the lesions showed features of spontaneous regression. Investigations confirmed the diagnosis of juvenile xanthogranuloma. Lesions regressed satisfactorily with liquid nitrogen cryotherapy.

  19. Juvenile Incarceration and Health

    OpenAIRE

    Barnert, ES; R Perry; Morris, RE

    2015-01-01

    © 2015. Addressing the health status and needs of incarcerated youth represents an issue at the nexus of juvenile justice reform and health care reform. Incarcerated youth face disproportionately higher morbidity and higher mortality compared to the general adolescent population. Dental health, reproductive health, and mental health needs are particularly high, likely as a result of lower access to care, engagement in high-risk behaviors, and underlying health disparities. Violence exposure a...

  20. Treatment in juvenile rheumatoid arthritis and new treatment options.

    Science.gov (United States)

    Kasapçopur, Özgür; Barut, Kenan

    2015-03-01

    Juvenile idiopathic arthritis (JIA) is the most common chronic rheumatic disease of the childhood with the highest risk of disability. Active disease persists in the adulthood in a significant portion of children with juvenile rheumatoid arthritis despite many developments in the diagnosis and treatment. Therefore, initiation of efficient treatment in the early period of the disease may provide faster control of the inflammation and prevention of long-term harms. In recent years, treatment options have also increased in children with juvenile idiopathic arthritis owing to biological medications. All biological medications used in children have been produced to target the etiopathogenesis leading to disease including anti-tumor necrosis factor, anti-interleukin 1 and anti-interleukin 6 drugs. In this review, scientific data about biological medications used in the treatment of rheumatoid arthritis and new treatment options will be discussed.

  1. Treatment in juvenile rheumatoid arthritis and new treatment options

    Science.gov (United States)

    Kasapçopur, Özgür; Barut, Kenan

    2015-01-01

    Juvenile idiopathic arthritis (JIA) is the most common chronic rheumatic disease of the childhood with the highest risk of disability. Active disease persists in the adulthood in a significant portion of children with juvenile rheumatoid arthritis despite many developments in the diagnosis and treatment. Therefore, initiation of efficient treatment in the early period of the disease may provide faster control of the inflammation and prevention of long-term harms. In recent years, treatment options have also increased in children with juvenile idiopathic arthritis owing to biological medications. All biological medications used in children have been produced to target the etiopathogenesis leading to disease including anti-tumor necrosis factor, anti-interleukin 1 and anti-interleukin 6 drugs. In this review, scientific data about biological medications used in the treatment of rheumatoid arthritis and new treatment options will be discussed. PMID:26078691

  2. Juvenile Ultracool Dwarfs

    CERN Document Server

    Rice, Emily L; Cruz, Kelle; Barman, Travis; Looper, Dagny; Malo, Lison; Mamajek, Eric E; Metchev, Stanimir; Shkolnik, Evgenya L

    2011-01-01

    Juvenile ultracool dwarfs are late spectral type objects (later than ~M6) with ages between 10 Myr and several 100 Myr. Their age-related properties lie intermediate between very low mass objects in nearby star-forming regions (ages 1-5 Myr) and field stars and brown dwarfs that are members of the disk population (ages 1-5 Gyr). Kinematic associations of nearby young stars with ages from ~10-100 Myr provide sources for juvenile ultracool dwarfs. The lowest mass confirmed members of these groups are late-M dwarfs. Several apparently young L dwarfs and a few T dwarfs are known, but they have not been kinematically associated with any groups. Normalizing the field IMF to the high mass population of these groups suggests that more low mass (mainly late-M and possibly L dwarf) members have yet to be found. The lowest mass members of these groups, along with low mass companions to known young stars, provide benchmark objects with which spectroscopic age indicators for juvenile ultracool dwarfs can be calibrated and...

  3. Disease: H00614 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available H00614 Infantile systemic hyalinosis and juvenile hyaline fibromatosis Infantile sy...stemic hyalinosis (ISH) and juvenile hyaline fibromatosis (JHF) are autosomal recessive diseases with consid

  4. Juvenile fibromyalgia: Guidance for management.

    Science.gov (United States)

    Yokota, Shumpei; Kikuchi, Masako; Miyamae, Takako

    2013-08-01

    Juvenile fibromyalgia (JFM) is a disease in which patients complain of acute and chronic severe pain, an overt primary cause for which cannot be found or surmised. Although patients with JFM mainly complain of systemic pain or allodynia in the medical interview and physical examination, the concept of the disease is the total sum of painful illness, chronic fatigue, hypothermia and many other autonomic symptoms and signs. Many issues are interacting including individual traits (personality, temperament, sensitivity, memory of pain; age: early adolescence), individual states (self-esteem, anxiety, developmental level), and external stressors (parent especially mother, school environment). JFM is diagnosed on the combination of disease history, physical examination to determine the 18 tender points and allodynia, pain from gently touching their hair, and negative results of blood tests (inflammatory markers, thyroid function, myogenic enzymes). The goals of treatment are the following: restoration of function and relief of pain. Psychological support is advocated. Although the exact number of patients with JFM is still to be elucidated, it seems to be growing because pediatric rheumatologists in Japan encounter children with a wide variety of musculoskeletal pains. This guideline describes how to diagnose JFM in children and how to treat them appropriately.

  5. Genetics Home Reference: juvenile idiopathic arthritis

    Science.gov (United States)

    ... Home Health Conditions juvenile idiopathic arthritis juvenile idiopathic arthritis Printable PDF Open All Close All Enable Javascript ... view the expand/collapse boxes. Description Juvenile idiopathic arthritis refers to a group of conditions involving joint ...

  6. Genetics Home Reference: juvenile primary osteoporosis

    Science.gov (United States)

    ... Home Health Conditions juvenile primary osteoporosis juvenile primary osteoporosis Enable Javascript to view the expand/collapse boxes. ... PDF Open All Close All Description Juvenile primary osteoporosis is a skeletal disorder characterized by thinning of ...

  7. Genetics Home Reference: juvenile myoclonic epilepsy

    Science.gov (United States)

    ... Home Health Conditions juvenile myoclonic epilepsy juvenile myoclonic epilepsy Enable Javascript to view the expand/collapse boxes. ... PDF Open All Close All Description Juvenile myoclonic epilepsy is a condition characterized by recurrent seizures (epilepsy). ...

  8. Temporomandibular Involvement and Craniofacial Development in Juvenile Idiopathic Arthritis

    NARCIS (Netherlands)

    M. Twilt (Marinka)

    2006-01-01

    textabstractJuvenile Idiopathic Arthritis (JIA) is a generalised autoimmune disease, which starts in childhood. JIA is one of the most frequent occurring autoimmune diseases in childhood, and concerns approximately 1 in a 1000 children. JIA is a heterogeneous group of conditions divided into seve

  9. Safety and Efficacy of Anti-Pandemic H1N1 Vaccination in Rheumatic Diseases

    Science.gov (United States)

    2010-06-25

    Rheumatoid Arthritis; Spondyloarthritis; Systemic Lupus Erythematosus (SLE); Dermatomyositis (DM); DMixed Connective Tissue Disease; Systemic Vasculitis; Systemic Sclerosis (SSc); Sjögren's Syndrome; Antiphospholipid Syndrome; Juvenile Idiopathic Arthritis; Juvenile SLE; Juvenile DM

  10. Juvenile Justice Bulletin: Aftercare Services. Juvenile Justice Practices Series.

    Science.gov (United States)

    Gies, Steve V.

    This bulletin examines aftercare services that provide youth with comprehensive health, education, family, and vocational services upon their release from the juvenile justice system. Aftercare can be defined as reintegrative services that prepare out-of-home placed juveniles for reentry into the community by reestablishing the necessary…

  11. Severe glomerular disease in juvenile grey snapper Lutjanus griseus L. in the Gulf of Mexico caused by the myxozoan Sphaerospora motemarini n. sp.

    Science.gov (United States)

    Holzer, Astrid S; Pecková, Hanka; Patra, Sneha; Brennan, Nathan P; Yanes-Roca, Carlos; Main, Kevan L

    2013-12-01

    In the eastern Gulf of Mexico, off the coast of Florida, grey snapper, Lutjanus griseus was found to be infected with the myxozoan parasite Sphaerospora motemarini n. sp., with high prevalence (83%) and intensity of infection occuring in age-0 fish, and with parasite levels decreasing with age (age-1 snapper 40%; age-2 snapper 0%). The morphological, molecular and phylogenetic characterisation of the myxozoan showed that it is a member of the typically marine, polysporoplasmid Sphaerospora spp. which form a subclade within the Sphaerospora sensu stricto clade of myxozoans, which is characterised by large expansion segments in their SSU rDNA sequences. Presporogonic stages of S. motemarini n. sp. were detected in the blood, using PCR. Pseudoplasmodia and spores were found to develop in the renal corpuscles of the host, causing their massive expansion. Macroscopic and histopathological changes were observed in age-0 fish and show that S. motemarini n. sp. causes severe glomerulonephritis in L. griseus leading to a compromised host condition, which makes it more susceptible to stress (catch-and-release, predators, water quality) and can result in mortalities. These results are discussed in relation to the exploitation of grey snapper populations by commercial and recreational fisheries and with the observed increased mortalities with temperature along the coast of Florida. In the future, we would like to determine prevalence and intensity of infection with S. motemarini n. sp. in juvenile L. griseus in different areas of the Gulf of Mexico in order to be able to estimate the temperature dependence of S. motemarini n. sp. proliferation and to be able to predict its distribution and severity during climatic changes in the Gulf.

  12. Effects of dietary supplementation of citrus by-products fermented with a probiotic microbe on growth performance, innate immunity and disease resistance against Edwardsiella tarda in juvenile olive flounder, Paralichthys olivaceus (Temminck & Schlegel).

    Science.gov (United States)

    Lee, B-J; Kim, S-S; Song, J-W; Oh, D-H; Cha, J-H; Jeong, J-B; Heo, M-S; Kim, K-W; Lee, K-J

    2013-07-01

    Two consecutive studies were conducted to evaluate the dietary supplementation of citrus by-products (CB) fermented with probiotic bacteria on growth performance, feed utilization, innate immune responses and disease resistance of juvenile olive flounder. In Experiment I, five diets were formulated to contain 0% (control) or 3% four different CB fermented with Bacillus subtilis (BS), Enterococcus faecium (EF), Lactobacillus rhamnosus (LR) and L. plantarum (LP) (designated as CON, CBF-BS, CBF-EF, CBF-LR and CBF-LP, respectively). During 10 weeks of a feeding trial, growth performance and feed efficiency were not significantly different among all the fish groups. However, fish fed CBF containing diets had significantly higher survivals than the CON group. Disease resistance of fish against Edwardsiella tarda was increased by the fermentation of CB. In Experiment II, we chose the BS as a promising probiotic and formulated five diets to contain 0%, 2%, 4%, 6% and 8% CBF-BS. Growth performance was not significantly affected by the CBF-BS supplementation during 6 weeks of a feeding trial. Innate immunity of fish was significantly enhanced by CBF-BS supplementation. Myeloperoxidase and lysozyme activities were increased in a dose-dependent manner by dietary CBF-BS inclusions. In a consecutive challenge test against E. tarda, an increased disease resistance was found by CBF-BS supplementation. These studies indicate that the fermentation process of CB with probiotic has beneficial effects on innate immunity and thereby increases disease resistance of olive flounder against E. tarda. Bacillus subtilis can be used as a promising probiotic microbe for by-product fermentation in fish feeds.

  13. Miastenia gravis juvenil Juvenile myasthenia gravis

    Directory of Open Access Journals (Sweden)

    Oscar Papazian

    2009-01-01

    Full Text Available La miastenia gravis juvenil (MGJ es un trastorno crónico auto inmune en el cual existen anticuerpos séricos que al unirse a los receptores de acetilcolin nicotínicos de la membrana muscular de la placa motora alteran la transmisión neuromuscular. El resultado es fatiga muscular precoz con progresión a la parálisis durante estados de contracción muscular iterativos (movimientos o sostenidos (posturas y más raramente parálisis permanente durante el reposo. Los músculos inervados por los nervios craneales, especialmente los extraoculares y elevadores de los párpados, tienen más tendencia a la debilidad muscular persistente que los inervados por otros pares craneales y las extremidades. Las formas clínicas de presentación son generalizadas, oculares y respiratorias. El diagnóstico se sospecha mediante la anamnesia, la fatiga anormal se comprueba mediante el examen físico y la estimulación eléctrica iterativa del nervio que inerva al músculo afectado pero no paralizado. Se corrobora mediante la administración de inhibidores de la acetilcolin esterasa (IACE que al aumentar la cantidad de acetilcolin en la hendidura sináptica, corrigen la fatiga o la debilidad muscular transitoriamente. Se hace el diagnóstico de certeza mediante la demostración sérica de anticuerpos contra los receptores de acetilcolin (ACRA. El tratamiento es a largo plazo sintomático con IACE y etiopatogénico con inmunosupresores, plasmaféresis, gamma globulina endovenosa y timectomía. El curso es crónico. La remisión espontánea o después de tratamiento sintomático o etiopatogénico ocurre entre 1-10 años respectivamente. La mortalidad es prácticamente nula aun durantes las crisis miastenias gracias a la educación de padres, pacientes y público en general sobre el tema, al desarrollo del sistema de respuesta rápida de auxilio domiciliario y las unidades de cuidados intensivos y el empleo de la ventilación asistida profiláctica, plasmaféresis y

  14. Juvenile idiopathic arthritis: the paediatric perspective

    Energy Technology Data Exchange (ETDEWEB)

    Jordan, Alison [Birmingham Children' s Hospital, Department of Adolescent Rheumatology, Birmingham (United Kingdom); McDonagh, Janet E. [Birmingham Children' s Hospital, Institute of Child Health, Birmingham (United Kingdom)

    2006-08-15

    Paediatric rheumatology is a relatively new specialty that has developed rapidly over the last 30 years. There have been major advances, which have included improvements in the classification and management of juvenile idiopathic arthritis (JIA). The former has led to enhanced international collaboration with disease registries, multicentre research and the development of new therapeutic agents. This has resulted in improved disease control and remission induction in many. There is, however, still significant morbidity associated with JIA during childhood, adolescence and adulthood, and challenges for the future include early identification of those with a poorer prognosis, appropriate administration of safe therapies and optimizing outcomes as young people move through adolescence into adulthood. (orig.)

  15. [Current therapy of polyarticular forms of juvenile idiopathic arthritis].

    Science.gov (United States)

    Hospach, A; Rühlmann, J M; Weller-Heinemann, F

    2016-04-01

    Juvenile idiopathic arthritis (JIA) is the most common rheumatic disease in infancy and childhood. Approximately 20 % of patients with JIA suffer from the polyarticular form of the disease, which causes a substantial disease burden and long-term sequelae. Therapeutic approaches have used steroids and conventional disease modifying antirheumatic drugs (DMARD) but over the last decade new drugs have become available for the treatment of JIA, in particular biologic DMARD. This article summarizes the current therapy options for polyarticular JIA.

  16. Juvenile Justice in Rural America.

    Science.gov (United States)

    Jankovic, Joanne, Ed.; And Others

    Producing a much-needed organized body of literature about rural juvenile justice, 14 papers (largely from the 1979 National Symposium on Rural Justice) are organized to identify current issues, identify forces causing changes in current systems, review programs responding to rural juvenile justice problems, and provide planning models to aid…

  17. Tocilizumab in the treatment of systemic juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Murakami M

    2012-07-01

    Full Text Available Miho Murakami,1 Minako Tomiita,2,3 Norihiro Nishimoto11Laboratory of Immune Regulation, Wakayama Medical University, Wakayama, 2Department of Pediatrics, Graduate School of Medicine, Chiba University, Chiba, 3Department of Allergy and Rheumatology, Chiba Children's Hospital, Chiba, JapanAbstract: Systemic juvenile idiopathic arthritis is one of the common rheumatic diseases in childhood and characterized by spiking fever, evanescent skin rash, lymphadenopathy, hepatosplenomegaly, and serositis, in addition to arthritis. Children with systemic juvenile idiopathic arthritis often show growth retardation and developmental abnormality, as well as macrophage activation syndrome, a life-threatening complication. Overproduction of interleukin-6 is pathologically responsible for the systemic inflammatory manifestations and abnormal laboratory results with systemic juvenile idiopathic arthritis. Thus, tocilizumab, a humanized antihuman interleukin-6 receptor antibody, has been developed as a therapeutic agent for the disease. A series of clinical studies have demonstrated the excellent efficacy and safety of tocilizumab for patients with active disease. Tocilizumab was approved for systemic juvenile idiopathic arthritis in Japan in 2008 and in the European Union and the United States in 2011.Keywords: systemic juvenile idiopathic arthritis, tocilizumab, antihuman interleukin-6 receptor antibody, biologics

  18. Juvenile arthritis and uveitis.

    Science.gov (United States)

    Kanski, J J

    1990-01-01

    The association between juvenile arthritis and uveitis is reviewed. Some children with the HLA-B27 related spondyloarthropathies develop anterior uveitis. About 20% of patients with juvenile rheumatoid arthritis (JRA) who are negative for IgM rheumatoid factor develop a frequently bilateral, nongranulomatous chronic anterior uveitis. Risk factors for uveitis in JRA patients are: female gender, pauciarticular onset of arthritis, presence of circulating antinuclear antibodies, and the antigens HLA-DW5 and HLA-DPw2. Uveitis is rare after seven years or more have elapsed from the onset of arthritis. The visual prognosis in patients with uveitis is good in 25% and fair in 50%. The remaining 25% develop visual impairment from complicated cataract and/or secondary inflammatory glaucoma. The potential benefit of cytotoxic agents in the treatment of intractable uveitis is outweighed by the risk of serious side effects. The management of secondary inflammatory glaucoma is unsatisfactory, but the results of treatment of complicated cataracts by lensectomy-vitrectomy are good.

  19. Aggressive juvenile mandibular fibromatosis.

    Science.gov (United States)

    Ivanov, Georgi P; Atanasov, Dimitar T; Anavi, Beniamin L

    2013-01-01

    Aggressive juvenile fibromatosis of the jawbones is a rare tumor presenting as infiltrative mass with unpredictable evolution. We report herein a 17-year-old student with a 6-month history of radiologically proven resorption of a part of the mandible, lingual displacement of tooth 34 and malocclusion. Alveolar ridge resorption and three dark-brown foci in the bone were seen after the tooth was extracted. Histological study showed the tumor tissue to have a bundle-like structure; immunohistochemically it was positive for vimentin, smooth muscle actin, beta-catenin, Ki-67 (5%), and negative for desmin and cytokeratin 34bE12. The golden standard in the diagnostics of desmoid fibromatoses is the nuclear or membrane expression of beta-catenin, which is found in 90% of the cases. Differential diagnosis include mandibular fibroma, well-differentiated fibrosarcoma, fibrosing histiocytoma, and infiltration from adjacent soft-tissue tumor. Aggressive juvenile fibromatosis should be managed by radical excision. Local recurrences are not rare, but metastases do not develop. In rare cases this type of fibromatosis has been known to regress spontaneously. Aggressive fibromatosis is a diagnostic challenge, since it remains in the grey zone between benign and malignant lesions of the oral cavity.

  20. Juvenile justice mental health services.

    Science.gov (United States)

    Thomas, Christopher R; Penn, Joseph V

    2002-10-01

    As the second century of partnership begins, child psychiatry and juvenile justice face continuing challenges in meeting the mental health needs of delinquents. The modern juvenile justice system is marked by a significantly higher volume of cases, with increasingly complicated multiproblem youths and families with comorbid medical, psychiatric, substance abuse disorders, multiple family and psychosocial adversities, and shrinking community resources and alternatives to confinement. The family court is faced with shrinking financial resources to support court-ordered placement and treatment programs in efforts to treat and rehabilitate youths. The recognition of high rates of mental disorders for incarcerated youth has prompted several recommendations for improvement and calls for reform [56,57]. In their 2000 annual report, the Coalition for Juvenile Justice advocated increased access to mental health services that provide a continuum of care tailored to the specific problems of incarcerated youth [58]. The specific recommendations of the report for mental health providers include the need for wraparound services, improved planning and coordination between agencies, and further research. The Department of Justice, Office of Juvenile Justice and Delinquency Prevention has set three priorities in dealing with the mental health needs of delinquents: further research on the prevalence of mental illness among juvenile offenders, development of mental health screening assessment protocols, and improved mental health services [59]. Other programs have called for earlier detection and diversion of troubled youth from juvenile justice to mental health systems [31,56]. Most recently, many juvenile and family courts have developed innovative programs to address specific problems such as truancy or substance use and diversionary or alternative sentencing programs to deal with first-time or nonviolent delinquents. All youths who come in contact with the juvenile justice system

  1. Pediatric cardiology. Clinical and practical experiences with heart diseases of children, juveniles and young adults; Kinderkardiologie. Klinik und Praxis der Herzerkrankungen bei Kindern, Jugendlichen und jungen Erwachsenen

    Energy Technology Data Exchange (ETDEWEB)

    Haas, Nikolaus A. [Herz- und Diabeteszentrum NRW, Bad Oeynhausen (Germany). Klinik fuer angeborene Herzfehler; Kleideiter, Ulrich [Klinik fuer Kinder- und Jugendmedizin, Coesfeld (Germany)

    2011-07-01

    The book on pediatric cardiology covers the following chapters: (I) Fundamentals and diagnostics: pediatric cardiologic anamnesis, electrocardiograms, thorax X-radiography, MRT and CT of the heart, nuclear medical diagnostics, exercise tests, heart catheter examination, electrophysiological tests. (II) Leading symptoms: Cyanosis, cardiac murmur, thorax pain, palpitation, syncopes. (III) Disease pictures: congenital heart defects, acquired heart defects, cardiomyopathies, heart rhythm disturbances, heart insufficiency, arterial hypertension, pulmonary hypertension, other heart involving syndromes. (IV) Therapy: Catheter interventional therapy, post-surgical pediatric cardiac therapy, surgery involving the life-support machine, mechanical cardiovascular support systems, initial treatment of newborns with critical heart defects, heart transplantation, vaccination of children with heart diseases, medicinal therapy.

  2. Miranda Rights: Implications for Juveniles with Disabilities

    Science.gov (United States)

    Katsiyannis, Antonis; Barrett, David E.; Losinski, Mickey L.

    2011-01-01

    Juvenile delinquency in the United States has been a persistent concern for decades. Consequently, because more juveniles have been referred to juvenile court and the arrest rate of preteen offenders has increased to almost three times that of older youth, the persistent and often controversial issue of the capacity of juvenile offenders to waive…

  3. Juvenile prison in parallel legislation

    Directory of Open Access Journals (Sweden)

    Lutovac Mitar

    2016-01-01

    Full Text Available The need for punishment of juveniles occurred from the time when there was no clear line separating them from the adult criminal population. At the same time, the evolution of the juvenile punishment is not in itself involve substantial changes to their criminal status. On the contrary, the status of minors in society did not show serious differences regarding the status of young adults, as well as the adult elderly. On the other hand, on the ground of their punishment is recorded deviations that go in the direction of application of mild corporal punishment. Closing the minor was performed in a physically separate parts of the general penal institutions with the use of a lower degree of restrictions while serving juvenile prison. Due to the different treatment of minors during the evolution of their criminal status leads to their different treatment in comparative law. That is why we are witnessing the existence of numerous differences in the juvenile punishment in some countries in the world. On the European continent there is a wide range of different legal solutions when it comes to punishing juveniles. There are considerable differences in the procedure pronouncing juvenile prison and in particular penal treatment of juveniles in penitentiary institutions. For these reasons, the author has decided to show the basic statutory provisions in the part that relates to the issue of punishment of minors in the legislation of individual countries.

  4. Update on juvenile myasthenia gravis.

    Science.gov (United States)

    Liew, Wendy K M; Kang, Peter B

    2013-12-01

    Juvenile myasthenia gravis is a relatively rare autoimmune neuromuscular disorder. The pathophysiology of juvenile myasthenia gravis is similar to that of adult myasthenia gravis, though there remain important differences regarding presentation and therapeutic options. We review the pathophysiology, clinical presentation, and treatment options for juvenile myasthenia gravis. Randomized clinical studies of myasthenia gravis have been carried out primarily in adult populations. As juvenile myasthenia gravis is rare, it has been difficult to collect prospective randomized controlled data to evaluate treatment outcomes and efficacy. A recent retrospective series suggests that, as in adult myasthenia gravis, thymectomy is a viable therapeutic option for selected cases of generalized juvenile myasthenia gravis. This is corroborated by the clinical experience of the authors in a referral center with a cohort of patients affected by juvenile myasthenia gravis over a number of years. Recent studies illustrate that some, but not all, adult research on myasthenia gravis is applicable to children and adolescents with juvenile myasthenia gravis. Adult research can inform pediatric studies, but should not be regarded as a substitute for dedicated research in those populations.

  5. [Lung is also involved in juvenile dermatomyositis].

    Science.gov (United States)

    Pouessel, G; Thumerelle, C; Nève, V; Santangelo, T; Flammarion, S; Pruvot, I; Tillie-Leblond, I; Deschildre, A

    2014-07-01

    Juvenile dermatomyositis is the leading cause of chronic idiopathic inflammatory myopathy of auto-immune origin in children. Lung involvement in inflammatory myopathies is well described in adults, involving mostly interstitial lung disease, aspiration pneumonia and alveolar hypoventilation. We propose to describe its specificities in children. Pulmonary involvement may be asymptomatic and therefore must be systematically screened for. In case of clinical or functional respiratory abnormality, a chest computed tomographic (CT) scan is necessary. In children, a decrease of respiratory muscle strength seems common and should be systematically and specifically searched for by non-invasive and reproducible tests (sniff test). Interstitial lung disease usually associates restrictive functional defect, impairment of carbon monoxide diffusion and interstitial lung disease on CT scan. As in adults, the first-line treatment of juvenile dermatomyositis is based on corticosteroids. Corticosteroid resistant forms require corticosteroid bolus or adjuvant immunosuppressive drugs (methotrexate or cyclosporine). There is no consensus in pediatrics for the treatment of diffuse interstitial lung disease. Complications of treatment, including prolonged steroid therapy, are frequent and therefore a careful assessment of the treatments risk-benefit ratio is necessary, especially in growing children.

  6. Treatment of naturally occurring bovine respiratory disease in juvenile calves with a single administration of a florfenicol plus flunixin meglumine formulation.

    Science.gov (United States)

    Thiry, J; González-Martín, J V; Elvira, L; Pagot, E; Voisin, F; Lequeux, G; Weingarten, A; de Haas, V

    2014-04-26

    The efficacy and safety of a florfenicol plus flunixin meglumine formulation in the treatment of respiratory disease was evaluated in calves less than six weeks of age, compared with a positive control group treated with a well-established florfenicol formulation. A total of 210 calves, selected from nine sites in Belgium, France and Spain, showing severe signs of respiratory disease, were randomly assigned to treatment with either florfenicol plus flunixin meglumine (Resflor; MSD Animal Health) or florfenicol (Nuflor; MSD Animal Health), both administered subcutaneously once. Animals were clinically observed daily for 10 days following treatment initiation. The predominant respiratory pathogens were Pasteurella multocida, Mycoplasma bovis, Mannheimia haemolytica and Histophilus somni. All isolates were subject to in vitro sensitivity testing and found susceptible to florfenicol. In both groups, rectal temperature dropped and clinical index (depression and respiratory signs) significantly improved after treatment. Specifically, for the change in rectal temperature from pretreatment to six hours post-treatment, the florfenicol-flunixin formulation was found significantly superior to florfenicol. Moreover, the florfenicol-flunixin formulation alleviated the clinical signs of disease more rapidly, and was demonstrated to be non-inferior to florfenicol on days 4 and 10. The use of the product combining florfenicol and flunixin in calves is safe and efficacious in the treatment of outbreaks of bovine respiratory disease.

  7. Polipose juvenil: relato de 2 casos Juvenile polyposis: case two report

    Directory of Open Access Journals (Sweden)

    Juvenal da Rocha Torres Neto

    2010-06-01

    Full Text Available A Polipose Juvenil é uma afecção rara e faz parte do grupo das poliposes hamartomatosas familiares (PHF. É uma síndrome autossômica dominante que pode ser desencadeada por mutações no gene SMAD4/DPC4 (que codifica um sinalizador intermediário de TGF-b. Caracteriza-se pelo aparecimento de 10 ou mais pólipos hamartomatosos (juvenis no trato gastrintestinal, predominando no cólon. Costuma manifestar-se entre 4 e 14 anos de idade. Alguns pólipos adquirem focos adenomatosos apesar da natureza hamartomatosa das lesões e há chance de malignização. Relato de 2 casos de pacientes portadores de Polipose Juvenil colônica associada a focos de adenoma com displasia e revisão da literatura.Juvenile Polyposis Syndrome is a rare disease and is included in the Hamartomatous Familial Polyposis's (HFP group. It's an autosomal dominant syndrome which can be determinated by SMAD4/DPC4 germline mutations (which codifies an intermediary mediator of TGF-b. It's characterized by 10 or more hamartomatous polyps (juveniles throughout the gastrointestinal tract, especially in the colon. The symptoms usually appears between the ages of 4 and 14 years old. Some polyps can acquire adenomatous changes despite the lesion's hamartomatous nature and there's chance of colorectum malignization. Case report of two patients with Juvenile Polyposis coli associated to adenomatous changes with dysplasia and literature review.

  8. Anemia of chronic disease

    Science.gov (United States)

    ... disease Long-term infections, such as bacterial endocarditis, osteomyelitis (bone infection), HIV/AIDS , hepatitis B or hepatitis ... disease Crohn disease Erythropoietin test Juvenile idiopathic arthritis Osteomyelitis Rheumatic fever Ulcerative colitis Review Date 2/1/ ...

  9. Juvenile homosexual homicide.

    Science.gov (United States)

    Myers, Wade C; Chan, Heng Choon Oliver

    2012-01-01

    Limited information exists on juvenile homosexual homicide (JHH), that is, youths who perpetrate sexual homicides against same-sex victims. Only a handful of cases from the United States and internationally have been described in the literature. This study, the first of its kind, examines the epidemiology, victimology, victim-offender relationship, and weapon-use patterns in JHH offenders using a large U.S. database on homicide spanning three decades. The data for this study were derived from the Federal Bureau of Investigation's Supplementary Homicide Reports (SHRs) for the years 1976 through 2005. A total of 93 cases of JHH were identified. On average, three of these crimes occurred annually in the U.S., and there was a marked decline in its incidence over the study period. Ninety-five percent were male offender-male victim cases and 5% were female offender-female victim cases. JHH offenders were over-represented amongst all juvenile sexual murderers, similar to their adult counterparts. The majority of these boys were aged 16 or 17 and killed adult victims. They were significantly more likely to kill adult victims than other age groups, to be friends or acquaintances of the victims, and to use contact/edged weapons or firearms. Most offenders killed same-race victims, although Black offenders were significantly more likely than White offenders to kill interracially. A case report is provided to illustrate JHH. Further research is needed to promote our understanding of the pathogenesis, etiology, and associated risk factors for this aberrant form of murder by children.

  10. Non-progressive juvenile spinal muscular atrophy of the distal upper limb (Hirayama's disease: a clinical variant of the benign monomelic amyotrophy

    Directory of Open Access Journals (Sweden)

    NASCIMENTO OSVALDO J. M.

    2000-01-01

    Full Text Available Hirayama's disease (HD is frequently found in Asia, and is rarely referred among westerners. It affects young people with higher incidence in males. It is a focal distal amyotrophy with unilateral or asymmetric bilateral involvement of C7, C8 and T1 innervated muscles. HD appears sporadically and has a benign evolution with clinical stabilization in around one year. We report four young male patients with clinical and electrophysiological alterations described in HD, which were followed-up during 5 years. Electromyographic findings were indicative of lower motor neuron involvement. We analyzed cervical MRI aiming at understanding if a questionable spinal cord compression could be implicated in the pathogenesis, but no abnormality was verified. In view of its clinical, and EMG characteristics, HD is no more than a benign monomelic amyotrophy (BMA clinical variant, and not a specific disease. This eponym could be considered only for the distal upper limb variant (Hirayama's variant of the BMA.

  11. Non-progressive juvenile spinal muscular atrophy of the distal upper limb (Hirayama's disease): a clinical variant of the benign monomelic amyotrophy.

    Science.gov (United States)

    Nascimento, O J; Freitas, M R

    2000-09-01

    Hirayama's disease (HD) is frequently found in Asia, and is rarely referred among westerners. It affects young people with higher incidence in males. It is a focal distal amyotrophy with unilateral or asymmetric bilateral involvement of C7, C8 and T1 innervated muscles. HD appears sporadically and has a benign evolution with clinical stabilization in around one year. We report four young male patients with clinical and electrophysiological alterations described in HD, which were followed-up during 5 years. Electromyographic findings were indicative of lower motor neuron involvement. We analyzed cervical MRI aiming at understanding if a questionable spinal cord compression could be implicated in the pathogenesis, but no abnormality was verified. In view of its clinical, and EMG characteristics, HD is no more than a benign monomelic amyotrophy (BMA) clinical variant, and not a specific disease. This eponym could be considered only for the distal upper limb variant (Hirayama's variant) of the BMA.

  12. Non-progressive juvenile spinal muscular atrophy of the distal upper limb (Hirayama's disease): a clinical variant of the benign monomelic amyotrophy

    OpenAIRE

    NASCIMENTO OSVALDO J.M.; FREITAS MARCOS R.G. DE

    2000-01-01

    Hirayama's disease (HD) is frequently found in Asia, and is rarely referred among westerners. It affects young people with higher incidence in males. It is a focal distal amyotrophy with unilateral or asymmetric bilateral involvement of C7, C8 and T1 innervated muscles. HD appears sporadically and has a benign evolution with clinical stabilization in around one year. We report four young male patients with clinical and electrophysiological alterations described in HD, which were followed-up d...

  13. Manifestações clínicas e procedimentos diagnósticos da Doença de Paget do osso

    Directory of Open Access Journals (Sweden)

    Leticia Sales Nascimento

    2011-03-01

    Full Text Available A doença de Paget do osso (DPO é uma patologia osteometabólica caracterizada pelo aumento da remodelação óssea, tornando o osso mais espesso, frágil, suscetível a fraturas e complicações clínicas. A DPO normalmente é assintomática, tornando-se uma patologia de diagnóstico tardio ou com achados acidentais por exames laboratoriais e imaginológicos. Portanto o objetivo deste trabalho é analisar as manifestações clínicas da Doença de Paget do osso avaliando qual o melhor procedimento diagnóstico para cada caso. Para isso o trabalho baseia-se numa pesquisa não sistemática de revisão bibliográfica por meio da consulta aos indexadores de pesquisa nas bases de dados eletrônicos (Medline, Lilacs, Scielo e PubMed até o ano de 2010. Concluímos que o diagnóstico, geralmente, encontra-se alicerçado nas manifestações clínicas, exames radiográficos e bioquímicos, mas dar-se escolha para os métodos por imagem, dando ênfase para a radiografia convencional e cintilografia de corpo inteiro.

  14. Juvenile hyaline fibromatosis: a case report.

    Science.gov (United States)

    Karaçal, Naci; Gülçelik, Nevzat; Yildiz, Kadriye; Mungan, Sevdegül; Kutlu, Necmettin

    2005-07-01

    Juvenile hyaline fibromatosis ( JHF ) is a rare autosomal recessive disease characterized by papulonodular skin lesions, gingival hyperplasia, joint contractures, and bone lesions. The skin lesions may consist of multiple large tumors, commonly on the scalp and around the neck, and small pearly, pink papules and plaques on the trunk, chin, ears, and around the nostrils. Here, we report a 2-year-old boy with characteristic stiffness of the knees and elbows and pink confluent papules on the paranasal folds, and periauricular and perianal regions. He also had hard nodules all over the scalp and around the mouth, and severe gingival hyperplasia. The lesions were totally excised and clinicopathological diagnosis was JHF.

  15. Do juvenile Amphiprion ocellaris (Pisces

    DEFF Research Database (Denmark)

    Brolund, Thea Marie; Nielsen, Lis Engdahl; Arvedlund, Michael

    2003-01-01

    . This is contrary to the settling mechanisms of the damselfish D. aruanus and D. reticulatus, and of the temperate herring Clupea harengus. Hence the results emphasize the variation of sensory abilities and behaviours in fish larvae and juveniles. It is not an area prone for generalizations.......Juvenile anemonefish Amphiprion ocellaris were tested in two behavioural laboratory set-ups for their ability to visually or chemically recognize conspecifics. Individuals of two other species of anemonefish, A. clarkii and Dascyllus aruanus, were also used as test specimens for recognition....... The results indicate that juvenile A. ocellaris recognize conspecifics visually rather than by olfaction. This is contrary to their finding mechanism of their host anemone. However, the results also indicate that the juvenile A ocellaris are neither attracted nor deterred by the presence of conspecifics...

  16. Bilateral, independent juvenile nasopharyngeal angiofibroma

    DEFF Research Database (Denmark)

    Mørkenborg, Marie-Louise; Frendø, M; Stavngaard, T;

    2015-01-01

    BACKGROUND: Juvenile nasopharyngeal angiofibroma is a benign, vascular tumour that primarily occurs in adolescent males. Despite its benign nature, aggressive growth patterns can cause potential life-threatening complications. Juvenile nasopharyngeal angiofibroma is normally unilateral, originating...... from the sphenopalatine artery, but bilateral symptoms can occur if a large tumour extends to the contralateral side of the nasopharynx. This paper presents the first reported case of true bilateral extensive juvenile nasopharyngeal angiofibroma involving clinically challenging pre-surgical planning...... embolisation. Radical removal performed as one-step, computer-assisted functional endoscopic sinus surgery was performed. The follow-up period was uncomplicated. CONCLUSION: This case illustrates the importance of suspecting bilateral juvenile nasopharyngeal angiofibroma in patients presenting with bilateral...

  17. Editor's Shelf: International Juvenile Titles.

    Science.gov (United States)

    Mitchell-Powell, Brenda

    1994-01-01

    Provides an annotated list of international juvenile picture books and notes those that emphasize text over pictures. The 49 titles present international perspectives for educators, librarians, and parents seeking materials with alternative cultural content. The majority are folk tales. (SLD)

  18. Managing juvenile idiopathic arthritis-associated uveitis.

    Science.gov (United States)

    Hawkins, Madeleine J; Dick, Andrew D; Lee, Richard J W; Ramanan, Athimalaipet V; Carreño, Ester; Guly, Catherine M; Ross, Adam H

    2016-01-01

    Bilateral chronic anterior uveitis is an extra-articular feature of juvenile idiopathic arthritis. Although figures vary, uveitis occurs in approximately 11%-13% of patients with this disease and is most commonly associated with the female gender, oligoarthritis, and presence of antinuclear antibodies. The disease has an insidious onset and is often asymptomatic. Managing patients with juvenile idiopathic arthritis-associated uveitis remains challenging as the disease may prove to be refractory to traditional treatment regimens. Stepwise immunomodulatory therapy is indicated, with new biologic drugs being used last in cases of refractory uveitis. Small scale studies and practice have provided the evidence to undertake randomized control trials to evaluate the efficacy, safety, and cost-effectiveness of anti-tumor necrosis factor-α therapies, such as infliximab and adalimumab. These have demonstrated promising results, with further data awaited from ongoing trials for adalimumab (as SYCAMORE and ADJUVITE trials). Lower grade evidence is supporting the use of newer biologics such as rituximab, daclizumab, tocilizumab, and abatacept in those cases refractory to anti-tumor necrosis factor-α therapy.

  19. Measles Virus Nucleocapsid (MVNP) Gene Expression and RANK Receptor Signaling in Osteoclast Precursors, Osteoclast Inhibitors Peptide Therapy for Pagets Disease

    Science.gov (United States)

    2008-10-01

    re- sult in upregulation of p62 expression in osteoclast pre- cursor cells, and the genetic inactivation of p62 in mice impaired PTHrP -induced...cells and that the genetic inactivation of p62 in mice impaired PTHrP induced osteoclastogenesis in vivo. However, p62 null mice have grossly normal

  20. Identification of a Major Locus for Paget's Disease on Chromosome 10p13 in Families of British Descent

    National Research Council Canada - National Science Library

    Lucas, Gavin JA; Riches, Phillip L; Hocking, Lynne J; Cundy, Tim; Nicholson, Geoff C; Walsh, John P; Ralston, Stuart H

    2008-01-01

    .... A major susceptibility locus for PDB was identified on chromosome 10p13 by a genome‐wide linkage scan in families of British descent, which accounted for the vast majority of cases not caused by SQSTM1 mutations. Introduction...

  1. Analysis of the Juvenile Idiopathic Arthritis Immunization Schedule

    Directory of Open Access Journals (Sweden)

    L. S. Namazova-Baranova

    2016-01-01

    Full Text Available Background: The connection between vaccination and autoimmune diseases (and rheumatic pathology in particular is still a subject of discussions. When discussing the possibility of vaccinating rheumatic patients we should take into account the ultra high dangers that infectious diseases pose for such patients, including those that can be prevented by vaccination. We should also take into account the experience of using various vaccine types in rheumatic patients, which illustrates of their high safety profile.Objective: Our aim was to study the immunization schedule in children with juvenile idiopathic arthritis.Methods: The evaluation of vaccine history and other anamnestic data in juvenile idiopathic arthritis patients was based on individual medical records (individual child’s card/preventive vaccination certificate, as well as questionnaires filled by mothers.Results: It has been determined that a significant proportion of children with vaccination schedule deviations are juvenile idiopathic arthritis patients. Almost one in four children with a confirmed rheumatic diagnosis has not been immunized against the major vaccine-preventable diseases. In one non-vaccinated group, there was a case of juvenile arthritis onset after recovering from measles. A small number of patient mothers connects the manifestation of rheumatic diseases with vaccination.Conclusion: Violations of vaccination status in JIA patients require corrections according to the results of clinical studies and the recommendations of international experts.

  2. Imaging in juvenile idiopathic arthritis with a focus on ultrasonography

    DEFF Research Database (Denmark)

    Laurell, Louise; Court-Payen, Michel; Boesen, Mikael;

    2013-01-01

    Early therapeutic intervention and use of new highly efficacious treatments have improved the outcome in many patients with juvenile idiopathic arthritis (JIA), but have also led to the need for more precise methods to evaluate disease activity. In adult rheumatology, numerous studies have establ...

  3. Physical activity in adolescents with juvenile idiopathic arthritis

    NARCIS (Netherlands)

    Lelieveld, Otto; Armbrust, Wineke; van Leeuwen, M.A.; Duppen, N.; Geertzen, J.H.; Sauer, P.J.; van Weert, E.

    2008-01-01

    OBJECTIVE: To explore physical activity (PA) in adolescents with juvenile idiopathic arthritis (JIA) compared with a healthy population and to examine associations between PA and disease-related factors. METHODS: Total energy expenditure (TEE), activity-related energy expenditure (AEE), PA level, an

  4. Exercise in action for JUVENILE DERMATOMYOSITIS : Steps towards understanding

    NARCIS (Netherlands)

    Habers, G.E.A.

    2015-01-01

    This thesis describes studies in the field of juvenile dermatomyositis (JDM), a chronic inflammatory disease in which the microvasculature is attacked by the immune system. Clinical characteristics include symptoms of muscles (e.g. weakness) and skin (e.g. Gottron’s papules over the extensor joint s

  5. Impact of Juvenile Idiopathic Arthritis Associated Uveitis in Early Adulthood

    NARCIS (Netherlands)

    Haasnoot, Anne-Mieke J. W.; Vernie, Lenneke A.; Rothova, Aniki; van der Doe, Patricia; Los, Leonoor I.; Schalij-Delfos, Nicoline E.; de Boer, Joke H.

    2016-01-01

    Background Typically juvenile idiopathic arthritis (JIA)-associated uveitis (further referred as 'JIA-uveitis') has its onset in childhood, but some patients suffer its, sometimes visual threatening, complications or ongoing disease activity in adulthood. The objective of this study was to analyze u

  6. Impact of juvenile idiopathic arthritis associated uveitis in early adulthood

    NARCIS (Netherlands)

    Haasnoot, A.-M.J.W. (Anne-Mieke J. W.); Vernie, L.A. (Lenneke A.); A. Rothova (Aniki); Doe, P.V.D. (Patricia V. D.); L.I. Los (Leonoor I.); N.E. Schalij-Delfos (Nicoline); J.H. de Boer (Joke)

    2016-01-01

    textabstractBackground: Typically juvenile idiopathic arthritis (JIA)-associated uveitis (further referred as 'JIA-uveitis') has its onset in childhood, but some patients suffer its, sometimes visual threatening, complications or ongoing disease activity in adulthood. The objective of this study was

  7. Impact of Juvenile Idiopathic Arthritis Associated Uveitis in Early Adulthood

    NARCIS (Netherlands)

    Haasnoot, AJW; Vernie, Lenneke A; Rothova, Aniki; V D Doe, Patricia; Los, Leonoor I; Schalij-Delfos, Nicoline E; de Boer, Joke H

    2016-01-01

    BACKGROUND: Typically juvenile idiopathic arthritis (JIA)-associated uveitis (further referred as 'JIA-uveitis') has its onset in childhood, but some patients suffer its, sometimes visual threatening, complications or ongoing disease activity in adulthood. The objective of this study was to analyze

  8. Impact of juvenile idiopathic arthritis associated uveitis in early adulthood

    NARCIS (Netherlands)

    Haasnoot, A.-M.J.W. (Anne-Mieke J. W.); Vernie, L.A. (Lenneke A.); A. Rothová (Aniki); Doe, P.V.D. (Patricia V. D.); L.I. Los (Leonoor I.); N.E. Schalij-Delfos (Nicoline); J.H. de Boer (Joke)

    2016-01-01

    textabstractBackground: Typically juvenile idiopathic arthritis (JIA)-associated uveitis (further referred as 'JIA-uveitis') has its onset in childhood, but some patients suffer its, sometimes visual threatening, complications or ongoing disease activity in adulthood. The objective of this study was

  9. Impact of Juvenile Idiopathic Arthritis Associated Uveitis in Early Adulthood

    NARCIS (Netherlands)

    Haasnoot, AJW; Vernie, Lenneke A; Rothova, Aniki; V D Doe, Patricia; Los, Leonoor I; Schalij-Delfos, Nicoline E; de Boer, Joke H|info:eu-repo/dai/nl/140201890

    2016-01-01

    BACKGROUND: Typically juvenile idiopathic arthritis (JIA)-associated uveitis (further referred as 'JIA-uveitis') has its onset in childhood, but some patients suffer its, sometimes visual threatening, complications or ongoing disease activity in adulthood. The objective of this study was to analyze

  10. Impact of Juvenile Idiopathic Arthritis Associated Uveitis in Early Adulthood

    NARCIS (Netherlands)

    Haasnoot, Anne-Mieke J. W.; Vernie, Lenneke A.; Rothova, Aniki; van der Doe, Patricia; Los, Leonoor I.; Schalij-Delfos, Nicoline E.; de Boer, Joke H.

    2016-01-01

    Background Typically juvenile idiopathic arthritis (JIA)-associated uveitis (further referred as 'JIA-uveitis') has its onset in childhood, but some patients suffer its, sometimes visual threatening, complications or ongoing disease activity in adulthood. The objective of this study was to analyze u

  11. Mild Form of Treacher Collins Syndrome Imitating Juvenile Otosclerosis

    Directory of Open Access Journals (Sweden)

    Karol Zeleník

    2012-01-01

    Full Text Available Treacher Collins syndrome (TCS is an inherited developmental disorder. More than 40% of individuals with TCS have conductive hearing loss attributed to external and middle ear anomalies. Mild cases of TCS often pass undiagnosed at birth or early childhood. The disease may be manifested as conductive hearing loss in teenagers and may resemble juvenile otosclerosis. Patients could suffer from slight facial variabilities including retrognathia (as in our case and others, which point out to a possible middle ear anomaly. Surgical corrections of middle ear anomalies including TCS generally lead to poorer outcomes comparing with juvenile otosclerosis, which should be discussed with parents during preoperative counselling.

  12. Mild form of treacher collins syndrome imitating juvenile otosclerosis.

    Science.gov (United States)

    Zeleník, Karol; Komínek, Pavel

    2012-01-01

    Treacher Collins syndrome (TCS) is an inherited developmental disorder. More than 40% of individuals with TCS have conductive hearing loss attributed to external and middle ear anomalies. Mild cases of TCS often pass undiagnosed at birth or early childhood. The disease may be manifested as conductive hearing loss in teenagers and may resemble juvenile otosclerosis. Patients could suffer from slight facial variabilities including retrognathia (as in our case) and others, which point out to a possible middle ear anomaly. Surgical corrections of middle ear anomalies including TCS generally lead to poorer outcomes comparing with juvenile otosclerosis, which should be discussed with parents during preoperative counselling.

  13. Models of bovine babesiosis including juvenile cattle.

    Science.gov (United States)

    Saad-Roy, C M; Shuai, Zhisheng; van den Driessche, P

    2015-03-01

    Bovine Babesiosis in cattle is caused by the transmission of protozoa of Babesia spp. by ticks as vectors. Juvenile cattle (Babesiosis, rarely show symptoms, and acquire immunity upon recovery. Susceptibility to the disease varies between breeds of cattle. Models of the dynamics of Bovine Babesiosis transmitted by the cattle tick that include these factors are formulated as systems of ordinary differential equations. Basic reproduction numbers are calculated, and it is proved that if these numbers are below the threshold value of one, then Bovine Babesiosis dies out. However, above the threshold number of one, the disease may approach an endemic state. In this case, control measures are suggested by determining target reproduction numbers. The percentage of a particular population (for example, the adult bovine population) needed to be controlled to eradicate the disease is evaluated numerically using Columbia data from the literature.

  14. GANGGUAN PERTUMBUHAN MANDIBULA PADA JUVENILE RHEUMATOID ARTHRITIS

    Directory of Open Access Journals (Sweden)

    Ria Puspitawati

    2015-08-01

    Full Text Available Juvenile Rheumatoid Arthritis (JRA is a systemic disease on childhood, which has chronic arthritis as its most prominent manifestation. One very common complication of JRA is growth disturbance. JRA involving temporomandibular joint usually result in mandibular growth retardation which eventually can lead to micrognathia, retrognathia, malocclusion and other mandibulofacial developmental aberrations. Factors considered to be the cause of these growth and developmental disturbances are: congenital, the disease's direct effect on the condyle, functional deficiency of the temporomandibular joint, duration, age of disease onset and type of the JRA and corticosteroid therapy. However, the mechanism for the mandibulofacial growth and developmental aberrations due to JRA are not fully understood. This literature review will discuss the hypotheses concerning mechanisms of those growth and developmental disturbances, especially based on clinical and radiographic studies on JRA cases.

  15. Juvenil neuronal ceroid lipofuscinosis

    DEFF Research Database (Denmark)

    Ostergaard, J R; Hertz, Jens Michael

    1998-01-01

    Neuronal ceroid-lipofuscinosis is a group of neurodegenerative diseases which are characterized by an abnormal accumulation of lipopigment in neuronal and extraneuronal cells. The diseases can be differentiated into several subgroups according to age of onset, the clinical picture...

  16. AA amyloidosis associated with systemic-onset juvenile idiopathic arthritis.

    Science.gov (United States)

    Saha, Abhijeet; Chopra, Yogiraj; Theis, Jason D; Vrana, Julie A; Sethi, Sanjeev

    2013-10-01

    We report a 12-year-old boy with nephrotic syndrome due to renal AA amyloidosis. The AA amyloidosis was associated with a 3-year history of systemic-onset juvenile idiopathic arthritis. The presence of serum amyloid A protein was confirmed by laser microdissection of Congo Red-positive glomeruli and vessels followed by liquid chromatography and tandem mass spectrometry; this analysis excluded hereditary and familial amyloidosis. Aggressive management of the systemic-onset juvenile idiopathic arthritis resulted in improvement in clinical and laboratory parameters. The case represents an unusual cause of nephrotic syndrome in children. Early diagnosis of renal amyloidosis and management of systemic-onset juvenile idiopathic arthritis is paramount to preventing progression of kidney disease.

  17. Prostate carcinoma metastatic to the skin as an extrammamary Paget’s disease

    Directory of Open Access Journals (Sweden)

    Petcu Eugen

    2012-08-01

    Full Text Available Abstract Aim The current paper describes a case of prostatic adenocarcinoma metastatic to the skin presenting as an extrammamary Paget's disease, a very rare and poorly characterised morphological entity. We report a case of prostatic carcinoma metastatic to skin showing a pattern of extramammary Paget's disease which has not been clearly illustrated in the literature Case presentation: A 63 year-old man with prostatic adenocarcinoma developed cutaneous metastases after 16 years. The inguinal metastases were sessile and 'keratotic.' The tumour displayed solid, glandular areas as well as a polypoid region suggestive of extramammary Paget's disease were identified. Discussion and conclusions We review the diagnostic criteria that have led to the correct histopathological diagnosis in this case. A differential diagnosis of the pagetoid spread in the skin and various forms of cutaneous metastases determined by a prostatic adenocarcinoma as well as the role of immunohistochemistry in establishing the prostatic origin are presented in the context of this case. Although, morphologically the cells presented in the skin deposits were not characteristic for adenocarcinoma of prostate, immunohistochemistry for PSA and PSAP suggested a prostatic origin. Virtual Slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1395450057455276

  18. Cytokine profiles in peripheral blood and whole blood cell cultures associated with aggressive periodontitis, juvenile idiopathic arthritis, and rheumatoid arthritis

    DEFF Research Database (Denmark)

    Poulsen, Anne Havemose; Sørensen, Lars Korsbaek; Stoltze, Kaj

    2005-01-01

    Cytokines play a key role in the pathogenesis of inflammatory diseases. An obvious question is whether patients with aggressive periodontitis, juvenile idiopathic arthritis, or rheumatoid arthritis share blood cytokine profiles distinguishing them from individuals free of disease....

  19. Cytokine profiles in peripheral blood and whole blood cell cultures associated with aggressive periodontitis, juvenile idiopathic arthritis, and rheumatoid arthritis

    DEFF Research Database (Denmark)

    Poulsen, Anne Havemose; Sørensen, Lars Korsbaek; Stoltze, Kaj

    2005-01-01

    Cytokines play a key role in the pathogenesis of inflammatory diseases. An obvious question is whether patients with aggressive periodontitis, juvenile idiopathic arthritis, or rheumatoid arthritis share blood cytokine profiles distinguishing them from individuals free of disease....

  20. Paralisia bulbar progressiva juvenil doença de Fazio-Londe: relato de caso Progressive bulbar palsy (Fazio-Londe disease: case report

    Directory of Open Access Journals (Sweden)

    Bianca Helena Brum Batista

    2002-09-01

    Full Text Available A paralisia bulbar progressiva, também denominada doença de Fazio-Londe, caracteriza-se pelo acometimento degenerativo progressivo de nervos cranianos bulbares em crianças. Foi descrita primeiramente por Fazio em 1892 e até a presente data somente 30 casos foram relatados na literatura. Acomete ambos os sexos, assumindo dois padrões clínicos, um de início precoce (idade Progressive bulbar palsy, also called Fazio -Londe disease, is characterized by progressive impairment of cranial nerves in children. It was first reported by Fazio in 1892 and until now only 30 cases have been published in the literature. Both sexes can be affected and clinical course can be divided on early (< 6 years age, predominance of respiratory symptoms and late course (6-20 years of age, predominance of motor symptoms on superior limbs. We report a 4 years old boy that started with intense stridor and respiratory distress, initially being diagnosed as an acute asthma attack. Clinical signs worsened and 12 months latter he already had impairment of cranial nerves V, VII, VIII, IX and X confirmed by clinical examination and neurophysiological evaluation.

  1. Systemic-onset juvenile idiopathic arthritis.

    Science.gov (United States)

    Cimaz, Rolando

    2016-09-01

    Systemic-onset juvenile idiopathic arthritis (SoJIA) is a systemic inflammatory disease which has up to now been classified as a category of juvenile idiopathic arthritis. However, in this context, systemic inflammation has been associated with dysregulation of the innate immune system, suggesting that it may rather be part of the spectrum of autoinflammatory disorders. The disease is in fact unique with regard to the other JIA categories, in terms of clinical manifestations, prognosis, and response to conventional immunosuppressant therapies. It is characterized clinically by fever, lymphadenopathy, arthritis, rash, and serositis. IL-1 and IL-6 play a major role in the pathogenesis of SoJIA, and treatment with IL-1 and IL-6 inhibitors has shown to be highly effective. However, complications of SoJIA, including macrophage activation syndrome, limitations in functional outcome by arthritis and long-term damage from chronic inflammation continue to be a major issue in patients' care. Recent advances on the pathogenesis and treatment have revolutionized the care and prognosis of this potentially life-threatening pediatric condition.

  2. Effects of dietary Spirulina platensis on growth performance, humoral and mucosal immune responses and disease resistance in juvenile great sturgeon (Huso huso Linnaeus, 1754).

    Science.gov (United States)

    Adel, Milad; Yeganeh, Sakineh; Dadar, Maryam; Sakai, Masahiro; Dawood, Mahmoud A O

    2016-09-01

    Dietary supplementation of Spirulina platensis at different levels (0% control, 2.5%, 5% and 10%) was evaluated to find out the effects on growth performance, digestive enzyme activities, humoral and skin innate immune responses and disease resistance in the great sturgeon (Huso huso). After 8 weeks of experimental trial, growth parameters, intestinal lactic acid bacteria count, protease and lipase activities were significantly high in 10% S. platensis fed group (P < 0.05). Similarly, in this group, respiratory burst activity of leucocytes and total protein of serum were also significantly high. Furthermore, supplementation of S. platensis at 5 or 10% exhibited higher serum IgM and lysozyme activity than the other experimental groups (P < 0.05). On the contrary, serum triglycerides and number of blood lymphocytes were lower in experimental groups than that of control group. Total proteins, lysozyme, protease and esterase, as well as in vitro bactericidal activity (against Streptococcus iniae, Yersinia ruckeri, Aeromonas hydrophila and Lactococcus garviea) were significantly high in skin mucus from fish fed 5% and 10% S. platensis, while, alkaline phosphatase was significantly high in fish fed 10% S. platensis (P < 0.05). Further, fish infected with Streptococcus iniae bacteria increased mortality, but it was alleviated by a diet supplemented with S. platensis. The present results demonstrate that this dietary supplementation with S. platensis (mainly at 10% level) could be useful for maintaining the overall health status of great sturgeon.

  3. Psychosocial functioning in children and young adults with juvenile arthritis.

    Science.gov (United States)

    Ungerer, J A; Horgan, B; Chaitow, J; Champion, G D

    1988-02-01

    A questionnaire survey of 363 children and young adults with juvenile arthritis was conducted to assess the relations among disease severity, psychosocial functioning, and adjustment in three age groups--primary school, high school, and young adult. Parents were surveyed separately to determine which characteristics of the ill child at different ages most significantly impact the well-being of the family. Indices of psychologic functioning and disease severity were associated with adjustment in the primary school and high school groups, whereas measures of social relationships were strongly associated with adjustment only in the high school group. Relations among measures of psychologic functioning, social relationships, disease severity, and adjustment in young adults were minimal. Level of disease severity was associated with the presence of financial concerns, emotional problems, and physical strain in parents of high school children and young adults. The results emphasize the importance of using a developmental model for understanding the adjustment of individuals with chronic juvenile arthritis and their families.

  4. Juveniles tried as adults: the age of the juvenile matters.

    Science.gov (United States)

    Semple, Jaclyn K; Woody, William Douglas

    2011-08-01

    Serious juvenile crimes require evaluation of a child as a criminal defendant in adult court. In such cases, it is crucial to understand jurors' attitudes, biases, and ability to follow legal instructions and maintain fairness. 308 undergraduate psychology students served as mock jurors, were randomly separated into four groups, and each group read the same realistic summary of a trial with the defendant's age presented as 13, 15, 17, or 21 years. Participants were asked to render guilty or not guilty verdicts and, if guilty, to suggest sentences. Chi-squared analysis indicated 13- and 15-year-old defendants were convicted less often than 17- and 21-year-old defendants, showing that jurors distinguished between juvenile defendants of different ages, but not minors and adults as defined by law. Additional analysis showed that age did not affect sentencing recommendations. Decision processes jurors use for juveniles tried as adults are discussed.

  5. Forensic aspects of juvenile violence.

    Science.gov (United States)

    Haller, L H

    2000-10-01

    The juvenile justice system was created because it was recognized that youthful offenders needed to be managed differently from adults. They were to receive habilitation services instead of punishment. It is now more than a century since the creation of the first juvenile court. After 67 years, the US Supreme Court, in Kent v United States stated that the model was not working because juveniles in the criminal justice system received no treatment and they had no rights. Because the issue that had been appealed was the lack of rights (not lack of treatment), the Court mandated that juveniles, like adults, be given certain rights. The following year, in In re Gault, the Court expanded these rights. Subsequent Supreme Court cases have dealt with these kinds of issues--that is, whether juvenile offenders are entitled to the same rights as adults and subject to the same penalties. The Supreme Court has never heard a "right to treatment" case, which is the other part of the juvenile court system. Cases have been brought in lower courts (e.g., Nelson v. Heyne, 1972) alleging inadequate treatment services, but no national impact has resulted. Thus, in general, children in the juvenile court system do not have an enforceable right to treatment and can obtain only what services are available in their jurisdictions. The services often are woefully inadequate. Sentencing a youth to probation, with the requirement that he or she participate in counseling or mental health treatment, is meaningless if services are not available. Community-based, model programs that provide effective treatment do exist. They are, as yet, the rare exception rather than the norm and, therefore, are not available to most youthful offenders. Incarcerated juveniles, obviously, cannot avail themselves of community programs. Litigation to give these youth the same rights as adults in penal institutions is not the answer because incarcerated adults don't have a right to treatment, only a right to be free

  6. Concurrence of Juvenile Idiopathic Arthritis and Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Ben Abdelghani Kaouther

    2011-01-01

    Full Text Available We report a 21-year-old female patient known to have Juvenile idiopathic arthritis (JIA who later developed multiple sclerosis (MS. The disease was documented on the brain and cerebral magnetic resonance imaging (MRI and the visual evoked potential. Our case emphasizes the need to evaluate the symptoms and brain MRI carefully. The concurrence of MS and JIA is uncommon. The possible relationship between the 2 diseases was discussed.

  7. Paget's Disease of the Breast: Clinical Analvsis of 45 Patients

    Institute of Scientific and Technical Information of China (English)

    MingtianYang; HaoLong; JiehuaHe; XiWang; ZemingXie

    2004-01-01

    OBJECTIVE Paget's disease is an uncommon breast malignancy and often misdiagnosed. If the patient is treated at an early stage, the prognos is is satisfactory. Our study analyzed the clinical characteristics of the disease and the factors influencing the prognosis.METHOOS Fourty-five patients with Paget's disease who were admitted to our hospital were analyzed retrospectively.RESULTS The most common symptoms of the disease were erosion and a bleeding-like eczematoid change at the nipple/areola. Qf the 40 patients with an eczematoid change, 11 patients had verified Paget's disease with a palpable mass on physical examination, and 29 patients had verified Paget's disease with a nonpalpable mass. Only 5 patients manifested a mass with no eczematiod change. Thirteen patients had ipsilateral axillary lymphadenopathy. In this study, 25 cases were treated by radical mastectomy and 20 cases were treated by modified radical mastectomy.Five and 10-year survival rates for the patients with nonpalpable massesand for those with palpable masses were 95.5%, 78.6%, and 53.8%, 36.4% respectively. The former were significantly higher than the latter (P <0.01 and <0.05 respectively). Five and 10-year survival rates for the patients without underlying carcinoma (DClS/IDC) and for the patients with underlyingcarcinoma were 100%, 88.9% and 69.6%, 43.8% respectively. The former were significantly higher than the latter (P<0.05) Five and 10-year survival rates for the patients with negative lymph nodes and for the patients with positive lymph nodes were 92.0%, 76.5% and 50.0%, 25.0% respectively.The former were also significantly higher than the latter (P <0.05).CONCLUSION Treatment at an early stage is very important and influences the prognosis directly for Paget's disease of the breast. The survival rates of patients with nonpalpable masses without underlying carcinoma and without lymphadenopathy, were significantly higher than patients with palpable masses with underlying carcinoma

  8. Juvenile Correctional Institutions Library Services: A Bibliography.

    Science.gov (United States)

    McAlister, Annette M.

    This bibliography lists citations for 14 articles, books, and reports concerned with library services in juvenile correctional institutions. A second section lists 21 additional materials on adult correctional libraries which also contain information relevant to the juvenile library. (KP)

  9. Cytokines in juvenile rheumatoid arthritis (JRA).

    Science.gov (United States)

    Mangge, H; Schauenstein, K

    1998-06-01

    Juvenile rheumatoid arthritis (JRA), unlike rheumatoid arthritis of adulthood (RA), is a heterogenous disease comprising at least five subtypes that differ in clinical course and prognosis, and require different therapeutical approaches. As compared to RA, the production of local and systemic cytokines in JRA have not yet been as extensively investigated. In this article we review the available literature on cytokine expression in serum and synovial fluid in all five different subtypes of JRA. Even though the data are still fragmentary, the evidence so far suggests that the determination of serum cytokines yields relevant information as to clinical subtype and inflammatory activity of the disease. Furthermore, the cytokine data suggest that the pathogenesis of JRA may even by more heterogenous than defined by the clinical subtypes. Finally, future directions of research in this area are proposed, and-based on the latest results-arguments for (anti)cytokine therapies in JRA are critically discussed.

  10. The Toll-like receptor 4 agonist MRP8/14 protein complex is a sensitive indicator for disease activity and predicts relapses in systemic-onset juvenile idiopathic arthritis.

    NARCIS (Netherlands)

    Holzinger, D.; Frosch, M.; Kastrup, A.; Prince, F.H.; Otten, M.H.; Suijlekom-Smit, L.W. van; Cate, R. ten; Hoppenreijs, E.P.A.H.; Hansmann, S.; Moncrieffe, H.; Ursu, S.; Wedderburn, L.R.; Roth, J.; Foell, D.; Wittkowski, H.

    2012-01-01

    BACKGROUND: Analysis of myeloid-related protein 8 and 14 complex (MRP8/14) serum concentrations is a potential new tool to support the diagnosis of systemic-onset juvenile idiopathic arthritis (SJIA) in the presence of fever of unknown origin. OBJECTIVE: To test the ability of MRP8/14 serum concentr

  11. Juvenile technologies in foreign publications

    Directory of Open Access Journals (Sweden)

    Shpagina E.M.

    2012-09-01

    Full Text Available The article provides the review of foreign publications, concerning the juvenile technologies used in France, Canada, Germany and Switzerland. The paper presents legal, social and psychotherapeutic aspects of juvenile judiciary in foreign countries. The authors paid special attention to the complexity of approaches to young children and teenagers who found themselves in complicated life circumstances or got into trouble with the law. The article gives examples of using the following techniques: cognitive-behavioral intervention, mediation, family therapy (including family background and family history, relations theory, narrative practices, utilization of «emotional intelligence» resources.

  12. On the Prevention of Juvenile Crime

    Science.gov (United States)

    Lelekov, V. A.; Kosheleva, E. V.

    2008-01-01

    Crimes committed by juveniles are among the most urgent social problems. Juvenile crime is as prevalent as crime itself is, and it has not been solved completely in any society and cannot be solved through law enforcement measures alone. In this article, the authors discuss the dynamics and structure of juvenile crime in Russia and present data…

  13. School-Related Characteristics of Male Juveniles.

    Science.gov (United States)

    Sapp, Gary L.; Abbott, Gypsy A.

    School-related characteristics of 256 male juveniles under the jurisdiction of a Family Court system were examined by perusing court records and conducting individual interviews with the juveniles. Results indicated that most juveniles last attended eighth grade, more than 81% had failed at least once, and more than half had fought frequently at…

  14. Intensive Reading Instruction in Juvenile Correctional Settings

    Science.gov (United States)

    Williams, Jacob L.; Wexler, Jade; Roberts, Greg; Carpenter, Clint

    2011-01-01

    Despite 60 years of evidence linking juvenile illiteracy and delinquency, practitioners and policymakers have been painfully slow in the implementation of evidence-based reading interventions for incarcerated juveniles. We will present the Texas Juvenile Justice Tiered Instructional Model, an evidence-based reading program model created…

  15. Sex Differences in Attributions of Juvenile Delinquency.

    Science.gov (United States)

    Sagatun, Inger J.

    This paper is an application of attribution theory to the processing of juvenile delinquents in an attempt to understand the differential treatment of female and male offenders within the juvenile justice system. The paper explores the attributions of juvenile delinquency both by male and female minors, by male and female parents, and by male and…

  16. Do Juveniles Bully More than Young Offenders?

    Science.gov (United States)

    Ireland, Jane L.

    2002-01-01

    Study compares bullying behavior among juvenile and young offenders. Ninety-five male juvenile and 196 male young offenders completed two questionnaires, measuring bullying directly and behaviors indicative of "being bullied" or of "bullying others". Juveniles perceived a higher extent of bullying and reported significantly…

  17. The Juvenile Court: Changes and Challenges.

    Science.gov (United States)

    Feld, Barry C.

    2000-01-01

    Explores the changes in the juvenile court system, in particular, the juvenile waiver and sentencing laws, as it transformed from a social welfare agency into a type of criminal court system for young offenders. Addresses whether states should create an integrated juvenile and criminal justice system. (CMK)

  18. Reforming Our Expectations about Juvenile Justice

    Science.gov (United States)

    Rodriguez, Pamela F.; Baille, Daphne M.

    2010-01-01

    Typing the term "juvenile justice reform" into a Google[TM] search will result in 60 pages of entries. But what is meant by juvenile justice reform? What does it look like? How will one know when it is achieved? This article defines juvenile justice reform, discusses the principles of effective reform, and describes the practice of juvenile…

  19. Juvenile rheumatoid arthritis: therapeutic perspectives.

    Science.gov (United States)

    Chikanza, Ian C

    2002-01-01

    Juvenile rheumatoid arthritis (JRA) is the most common childhood chronic systemic autoimmune inflammatory disease. The therapeutic approach to JRA has, to date, been casual and based on extensions of clinical experiences gained in the management of adult rheumatoid arthritis (RA). The physiology of inflammation has been systemically studied and this has led to the identification of specific therapeutic targets and the development of novel approaches to the management of JRA. The classical treatments of the disease such as methotrexate, sodium aurothiomalate and sulfasalazine, are not always effective in controlling RA and JRA. This has necessitated the development of novel agents for treating RA, most of which are biological in nature and are targeted at specific sites of the inflammatory cascades. These biological therapeutic strategies in RA have proved successful and are being applied in the management of JRA. These developments have been facilitated by the advances in molecular biology which have heralded the advent of biodrugs (recombinant proteins) and gene therapy, in which specific genes can be introduced locally to enhance in vivo gene expression or suppress gene(s) of interest with a view to down-regulating inflammation. Some of these biodrugs, such as anti-tumor necrosis factor alpha (anti-TNFalpha), monoclonal antibodies (infliximab, adalimumab), TNF soluble receptor constructs (etanercept) and interleukin-1 receptor antagonist (IL-1Ra) have been tested and shown to be effective in RA. Etanercept has now been licensed for JRA. Clinical trials of infliximab in JRA are planned. Studies show that the clinical effects are transient, necessitating repeated treatments and the risk of vaccination effects. Anti-inflammatory cytokines such as IL-4, IL-10, transforming growth factor-beta and interferon-beta (IFN-beta) are undergoing clinical trials. Many of these agents have to be administered parenterally and production costs are very high; thus, there is a need

  20. Efecto de una sola dosis de ácido zoledrónico en un caso de enfermedad de Paget ósea

    Directory of Open Access Journals (Sweden)

    Melina Sabán

    2010-10-01

    Full Text Available La enfermedad de Paget es un trastorno crónico del remodelado óseo, caracterizado por un aumento de la resorción ósea producido por osteoclastos atípicos, seguido por un incremento acelerado de la formación ósea, lo que resulta en la formación de hueso en mosaico desorganizado. Un excelente marcador bioquímico para orientar el diagnóstico y seguimiento es la fosfatasa alcalina (FAL. Se presenta el caso de un paciente de 90 años, de sexo masculino, con diagnóstico de enfermedad de Paget. Se inicia tratamiento con pamidronato vía oral con respuesta parcial, por lo que se rota a pamidronato endovenoso. Disminuyen el dolor y la concentración plasmática de FAL, persistiendo con centellograma óseo patológico. Luego de varios años de tratamiento, con adecuado aporte de calcio y vitamina D, comienza nuevamente con dolor y valores elevados de FAL. Se decide iniciar tratamiento con ácido zoledrónico endovenoso 4 mg, única aplicación, obteniéndose remisión clínica y bioquímica desde hace cuatro años y mejoría de la imagen centellográfica. Este informe refiere la buena respuesta, sostenida en el tiempo, al tratamiento con única dosis de ácido zoledrónico en un paciente que presentó resistencia al pamidronato.

  1. Mobilizing Communities To Prevent Juvenile Crime. Juvenile Justice Bulletin.

    Science.gov (United States)

    Bownes, Donna; Ingersoll, Sarah

    Through Title V Incentive Grants for Local Delinquency Prevention Programs (Community Prevention Grants), the Office of Juvenile Justice and Delinquency Prevention (OJJDP) allocated $20 million in fiscal year 1997 to states to complement law enforcement and justice system efforts by helping local communities foster strong families and nurture…

  2. Juvenile Idiopathic Arthritis

    Science.gov (United States)

    ... of the inside of the eye/s is called iritis or anterior uveitis. While uveitis usually causes symptoms ... treating diseases of the eye) to check for iritis in any patient with JIA What are the ...

  3. Juvenil idiopatisk arthritis

    DEFF Research Database (Denmark)

    Herlin, Troels

    2002-01-01

    . In addition to the clinical characteristics, genetic and biochemical differences suggest that JIA could be regarded as a general term covering various diseases. Complications described are uveitis, temporomandibular joint affection and growth disturbances. The therapeutic strategy should be planned...

  4. [Juvenil idiopathic arthritis. Part 1: diagnosis, pathogenesis and clinical manifestations].

    Science.gov (United States)

    Espada, Graciela

    2009-10-01

    Juvenile idiopathic arthritis is not a single disease and constitutes an heterogeneous group of illnesses or inflammatory disorders. This new nomenclature encompasses different disease categories, each of which has different presentation, clinical signs, symptoms, and outcome. The cause of the disease is still unknown but both environmental and genetic factors seem to be related to its pathogenesis. Is the most common chronic rheumatic disease in children and an important cause of short-term and long-term disability. In this article, clinical manifestation, new classification and approach to diagnosis are reviewed.

  5. Juvenile Dermatomyositis Diagnosed by {sup 99m}Tc-HDP Three-phase Bone Scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ja Hye; Song, Ho Chun; Yoo, Su Ung; Ha, Jung Min; Chong, A Ri; Oh, Jong Ryool; Min, Jung Joon; Bom, Hee Seung; Jeong, Eun Hui; Lee, Min Chul [Chonnam National University Hospital, Gwangju (Korea, Republic of)

    2009-12-15

    Juvenile dermatomyositis is a common inflammatory muscle disease of childhood, characterized by weakness in proximal muscles and specific skin rash. In case of juvenile dermatomyositis without characteristic clinical features, non-invasive imaging tools such as {sup 99m}Tc-HDP three-phase bone scan are very helpful in diagnostic workup of myopathies. We report a case of 13-year old female with juvenile dermatomyositis, in which {sup 99m}Tc-HDP three-phase bone scan was useful in diagnosis and assessing therapy response.

  6. Juvenile Justice and Substance Use

    Science.gov (United States)

    Chassin, Laurie

    2008-01-01

    Laurie Chassin focuses on the elevated prevalence of substance use disorders among young offenders in the juvenile justice system and on efforts by the justice system to provide treatment for these disorders. She emphasizes the importance of diagnosing and treating these disorders, which are linked both with continued offending and with a broad…

  7. Juvenile Courts. Creation and development

    Directory of Open Access Journals (Sweden)

    Montserrat GONZÁLEZ FERNÁNDEZ

    2013-11-01

    Full Text Available This paper studies the creation of Juvenile or Children's Courts in Spain, analysing their reasons and aims, as well as the ethical and political connotations present on their way of acting. Their history and the one of the institutions that complement them is built from the legislation, writings and ideas of their promoters.

  8. Juvenile Diabetes and Rehabilitation Counseling.

    Science.gov (United States)

    Stone, J. Blair; Gregg, Charles H.

    1981-01-01

    Severe complications of diabetes are more likely to occur with the juvenile diabetic and problems of psychosocial adjustment are recurring and difficult. Implications for the rehabilitation counselor are discussed in terms of employment considerations, the effects of complications, genetic counseling, and cooperation with other professionals.…

  9. Do juvenile Amphiprion ocellaris (Pisces

    DEFF Research Database (Denmark)

    Brolund, Thea Marie; Nielsen, Lis Engdahl; Arvedlund, Michael

    2003-01-01

    . This is contrary to the settling mechanisms of the damselfish D. aruanus and D. reticulatus, and of the temperate herring Clupea harengus. Hence the results emphasize the variation of sensory abilities and behaviours in fish larvae and juveniles. It is not an area prone for generalizations....

  10. Comparison of the Utility and Validity of Three Scoring Tools to Measure Skin Involvement in Patients With Juvenile Dermatomyositis

    OpenAIRE

    Campanilho-Marques, R; Almeida, B.; Deakin, C; Arnold, K; Gallot, N.; De Iorio, M.; Nistala, K; Pilkington, C.A.; Wedderburn, L. R.; Juvenile Dermatomyositis Research Group

    2016-01-01

    OBJECTIVE: To compare the abbreviated Cutaneous Assessment Tool (CAT), Disease Activity Score (DAS), and Myositis Intention to Treat Activity Index (MITAX) and correlate them with the physician's 10-cm skin visual analog scale (VAS) in order to define which tool best assesses skin disease in patients with juvenile dermatomyositis. METHODS: A total of 71 patients recruited to the UK Juvenile Dermatomyositis Cohort and Biomarker Study were included and assessed for skin disease using the CAT, D...

  11. Nephrotic syndrome due to immunoglobulin M mesangial glomerulonephritis preceding juvenile idiopathic arthritis.

    Science.gov (United States)

    Voyer, Luis E; Alvarado, Caupolican; Cuttica, Rubén J; Balestracci, Alejandro; Zardini, Marta; Lago, Néstor

    2013-05-21

    The association between nephrotic syndrome and juvenile idiopathic arthritis have rarely been described in pediatric patients. We report a child with steroid-responsive nephrotic syndrome, with frequent relapses, who presented with a new relapse of nephrotic syndrome associated with arthritis and uveitis at 21 months in remission after treatment with chlorambucil. Juvenile idiopathic arthritis was diagnosed and kidney biopsy examination showed mesangial glomerulonephritis with immunoglobulin M deposits. To our knowledge, only 2 cases of nephrotic syndrome preceding juvenile idiopathic arthritis have been reported, one without histopathology assessment and the other with minimal change disease. Although mesangial glomerulonephritis with nephrotic syndrome and juvenile idiopathic arthritis could have been coincidental, the immune pathogenic mechanism accepted for both diseases suggests they could be related.

  12. The Clinical Phenotypes of the Juvenile Idiopathic Inflammatory Myopathies

    Science.gov (United States)

    Shah, Mona; Mamyrova, Gulnara; Targoff, Ira N.; Huber, Adam M.; Malley, James D.; Rice, Madeline Murguia; Miller, Frederick W.; Rider, Lisa G.

    2013-01-01

    Abstract The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. Although juvenile dermatomyositis (JDM), the most common form of JIIM, has been well studied, the other major clinical subgroups of JIIM, including juvenile polymyositis (JPM) and juvenile myositis overlapping with another autoimmune or connective tissue disease (JCTM), have not been well characterized, and their similarity to the adult clinical subgroups is unknown. We enrolled 436 patients with JIIM, including 354 classified as JDM, 33 as JPM, and 49 as JCTM, in a nationwide registry study. The aim of the study was to compare demographics; clinical features; laboratory measures, including myositis autoantibodies; and outcomes among these clinical subgroups, as well as with published data on adult patients with idiopathic inflammatory myopathies (IIM) enrolled in a separate natural history study. We used random forest classification and logistic regression modeling to compare clinical subgroups, following univariate analysis. JDM was characterized by typical rashes, including Gottron papules, heliotrope rash, malar rash, periungual capillary changes, and other photosensitive and vasculopathic skin rashes. JPM was characterized by more severe weakness, higher creatine kinase levels, falling episodes, and more frequent cardiac disease. JCTM had more frequent interstitial lung disease, Raynaud phenomenon, arthralgia, and malar rash. Differences in autoantibody frequency were also evident, with anti-p155/140, anti-MJ, and anti-Mi-2 seen more frequently in patients with JDM, anti-signal recognition particle and anti-Jo-1 in JPM, and anti-U1-RNP, PM-Scl, and other myositis-associated autoantibodies more commonly present in JCTM. Mortality was highest in patients with JCTM, whereas hospitalizations and wheelchair use were highest in JPM patients. Several demographic and clinical

  13. Diagnosis and classification of juvenile idiopathic arthritis.

    Science.gov (United States)

    Eisenstein, Eli M; Berkun, Yackov

    2014-01-01

    In recent years, it has become increasingly clear that the term Juvenile Idiopathic Arthritis (JIA) comprises not one disease but several. Moreover, recent studies strongly suggest that some of these clinico-pathophysiologic entities appear to cross current diagnostic categories. The ultimate goal of the JIA classification is to facilitate development of better, more specific therapy for different forms of disease though improved understanding of pathophysiology. The past two decades have witnessed significant advances in treatment and improved outcomes for many children with chronic arthritis. However, understanding of the basic biologic processes underlying these diseases remains far from complete. As a result, even the best biologic agents of today represent "halfway technologies". Because they do not treat fundamental biologic processes, they are inherently expensive, need to be given for a long time in order to ameliorate the adverse effects of chronic inflammation, and do not cure the disease. Pediatric rheumatology is now entering an era in which diagnostic categories may need to change to keep up with discovery. A more precise, biologically based classification is likely to contribute to development of more specific and improved treatments for the various forms of childhood arthritis. In this review, we discuss how genetic, gene expression, and immunologic findings have begun to influence how these diseases are understood and classified.

  14. CLINICAL CASE OF TOCILIZUMAB THERAPY IN A PATIENT WITH SYSTEMIC JUVENILE IDIOPATHIC ARTHRITIS

    Directory of Open Access Journals (Sweden)

    E. I. Alexeeva

    2013-01-01

    Full Text Available The article presents a case of successful application of a monoclonal antibodies drug to interleukin 6 receptors (tocilizumab at severe systemic juvenile idiopathic arthritis with the development of secondary hemophagocytic syndrome. Tocilizumab treatment secured a decrease in clinical and laboratory parameters of the disease activity, life quality improvement, systemic juvenile idiopathic arthritis and hemophagocytic syndrome remission and allowed avoiding the per os prescription of glucocorticoids.

  15. Juvenile papillomatosis of the breast in young male: a case report.

    Science.gov (United States)

    Sanguinetti, A; Fioriti, L; Brugia, M; Roila, F; Farabi, R; Sidoni, A; Avenia, N

    2011-01-01

    Juvenile papillomatosis of the breast ("Swiss cheese disease'') is a benign localized proliferative condition of the breast which occurs almost exclusively in young adult women. Patients with this lesion often have a family history of breast carcinoma, but rarely carcinoma may coexist with the lesion at the time of diagnosis. We present a case of a young male with juvenile papillomatosis of the breast. The pathology and clinical management of this rare lesion is discussed.

  16. Sex differences in metabolic and adipose tissue responses to juvenile-onset obesity in sheep

    OpenAIRE

    Bloor, Ian D.; Sébert, Sylvain P.; Saroha, Vivek; Gardner, David S.; Keisler, Duane H.; Budge, Helen; Symonds, Michael E.; Mahajan, Ravi P.

    2013-01-01

    Sex is a major factor determining adipose tissue distribution and the subsequent adverse effects of obesity-related disease including type 2 diabetes. The role of gender on juvenile obesity and the accompanying metabolic and inflammatory responses is not well established. Using an ovine model of juvenile onset obesity induced by reduced physical activity, we examined the effect of gender on metabolic, circulatory, and related inflammatory and energy-sensing profiles of the major adipose tissu...

  17. Galactorrhea associated with juvenile systemic lupus erythematosus: a review of the role of prolactin

    Directory of Open Access Journals (Sweden)

    Duffy Karen

    2009-10-01

    Full Text Available Abstract This case report is based on the clinical observation of a patient with juvenile systemic lupus erythematosus (SLE who developed transient galactorrhea. The subsequent literature review documented an interesting association between prolactin and rheumatic diseases and in particular, hyperprolactinemia and SLE. The discussion that follows the case report explores this relationship and proposes a hypothesis regarding why this patient with juvenile SLE developed galactorrhea.

  18. Juvenile Crime, Juvenile Justice. Panel on Juvenile Crime: Prevention, Treatment, and Control.

    Science.gov (United States)

    McCord, Joan, Ed.; Widom, Cathy Spatz, Ed.; Crowell, Nancy A., Ed.

    This book discusses patterns and trends in crimes committed by children and adolescents, analyzing youth crime as a subset of general crime and studying the impact of race and gender. It evaluates different approaches to forecasting future crime rates. Data come from a national panel that examined what is known about juvenile crime and its…

  19. A case of juvenile hyaline fibromatosis.

    Science.gov (United States)

    Yayli, Savaş; Uncu, Sibel; Alpay, Köksal; Yildiz, Kadriye; Cimşit, Gülseren; Bahadir, Sevgi

    2006-04-01

    Juvenile hyaline fibromatosis (JHF) is a rare, autosomally-recessive disease characterized by papulonodular skin lesions, soft tissue masses, joint contractures, gingival hypertrophy and osteolytic bone lesions. Its onset is in infancy or early childhood. The most commonly affected sites are the nose, chin, ears, scalp, back and knees. The accumulation of an amorphous, hyaline material is typical in the skin and the other organs. Herein, we report a 14-month-old boy who presented with confluent pink papules on the paranasal folds and the chin, and nodular lesions on the periauricular and perianal regions. He had gingival hypertrophy and contractures of the shoulders, knees and elbows. He also had third-degree consanguineous parents. Histopathological studies confirmed the diagnosis of JHF with the presence of increased numbers of fibroblasts embedded in a hyalinized connective tissue stroma.

  20. EXPERIENCE OF RITUXIMAB TREATMENT IN A PATIENT WITH JUVENILE SCLERODERMA

    Directory of Open Access Journals (Sweden)

    E. I. Alexeeva

    2012-01-01

    Full Text Available A clinical case of severe juvenile scleroderma is represented in this article. The patient had a high activity and aggressive course of disease, he was resistant to steroid, cyclophosphomide and methotrexate therapy in combination with drugs, improving blood circulation. The authors describe the successful usage of chimeric monoclonal antibody against the protein CD20 — Rituximab. By the 4th week of the treatment the signs of intoxication and local manifestations of the disease (density and area of scleroderma patches have diminished. By the 24th week the immunological markers of activity have become normal. Afore-mentioned clinical case demonstrates high efficacy of Rituximab in patient with severe course of juvenile scleroderma. By now the stage of clinical and laboratory remission has maintained for 52 weeks.

  1. Juvenile idiopathic arthritis in the new world of biologics.

    Science.gov (United States)

    Ostring, Genevieve Tyra; Singh-Grewal, Davinder

    2013-09-01

    Juvenile idiopathic arthritis results in significant pain and disability in both children and adults. Advances in treatment resulting in improved long-term outcomes have occurred; however, an emphasis on early and aggressive diagnosis and management hopes to improve outcomes further. Juvenile idiopathic arthritis remains a clinical diagnosis of exclusion, but further research may delineate biological markers associated with the disease and its subtypes. Therapy for patients includes intra-articular steroid injections, disease modifying agents such as methotrexate and biological agents. Biological agents have provided exciting new therapeutic options in the last decade; however, long-term side effects of modulating the immune system are not yet fully understood. Systemic steroids may also be required but their long-term use is avoided. Uveitis needs to be screened for in all of those with the diagnosis. Multidisciplinary team care is required in managing these young people.

  2. Juvenile arthritis: current concepts in terminology, etiopathogenesis, diagnosis, and management.

    Science.gov (United States)

    Abramowicz, S; Kim, S; Prahalad, S; Chouinard, A F; Kaban, L B

    2016-07-01

    The latest change in terminology from juvenile rheumatoid arthritis (JRA) to juvenile idiopathic arthritis (JIA), established by the International League of Associations for Rheumatology (ILAR), has resulted in some confusion for OMFS and other treating clinicians. JIA comprises a group of systemic inflammatory diseases that result in the destruction of hard and soft tissues in a single or multiple joints. In a significant number of patients, one or both temporomandibular joints (TMJ) are also involved. TMJ disease may be accompanied by pain, swelling, and limitation of motion, as well as mandibular retrognathism, open bite, and asymmetry. The purpose of this article is to provide a review, for the oral and maxillofacial surgeon, of the terminology, etiopathogenesis, diagnosis, and management of children with JIA.

  3. Juvenile Dermatomyositis: New Developments in Pathogenesis, Assessment and Treatment

    OpenAIRE

    2009-01-01

    Juvenile dermatomyositis (JDM) is a rare, potentially life-threatening systemic autoimmune disease primarily affecting muscle and skin. Recent advances in the recognition, standardised assessment and treatment of JDM have been greatly facilitated by large collaborative research networks. Through these networks, a number of immunogenetic risk factors have now been defined, as well as a number of potential pathways identified in the aetio-pathogenesis of JDM. Myositis-associated and myositis-sp...

  4. Marcadores de inmunorrespuesta en la periodontitis juvenil

    Directory of Open Access Journals (Sweden)

    Amparo Pérez Borrego,

    2002-12-01

    Full Text Available La periodontitis juvenil es una enfermedad del periodonto propia de adolescentes y adultos jóvenes, afecta principalmente los primeros molares y los incisivos y se caracteriza por la pérdida severa del hueso alveolar alrededor de dientes permanentes sin correspondencia entre la rapidez y severidad de la destrucción con los factores locales. En la causa de la enfermedad se citan factores genéticos, infecciosos e inmunológicos. Estudiamos algunos marcadores de inmunorrespuesta en 6 adolescentes que acudieron a nuestro servicio con el diagnóstico de periodontitis juvenil, además de su valoración clínica y radiológica. Ambos sexos se afectaron por igual, la movilidad dentaria y el sangramiento al sondeo fueron los hallazgos clínicos más relevantes y el índice de higiene bucal fue adecuado en todos los casos. No encontramos homogeneidad en las alteraciones inmunológicas, pero todos los pacientes estuvieron afectados en más de un marcador. Predominaron las alteraciones funcionales de linfocitos T en los estudios celulares. La hipogammaglobulinemia y la IgM elevada fueron las alteraciones más frecuentes en la inmunidad de anticuerpos. Se señala la dificultad que aún existe para explicar la patogenia de la enfermedad basándose solamente en un único factor de riesgo, así como la importancia de la valoración individual de cada enfermo.Juvenile periodontitis is a disease of the periodontium inherent to adolescents and young adults, affecting mainly the first molars and incisives and characterized by the severe loss of the alveolar bone sorrounding the permanent teeth with no correspondance between the celerity and severity of the destruction and the local factors. Genetic, infectious and immunological factors are considereed as the causes of the disease. Some immunoresponse markers were studied in 6 adolescents that were seen at our service with the diagnosis of juvenile periodontitis in addition to their clinical and radiological

  5. 8 CFR 236.3 - Detention and release of juveniles.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Detention and release of juveniles. 236.3... Aliens Prior to Order of Removal § 236.3 Detention and release of juveniles. (a) Juveniles. A juvenile is defined as an alien under the age of 18 years. (b) Release. Juveniles for whom bond has been posted,...

  6. Uveíte na artrite idiopática juvenil Uveitis in juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Adriana M. Roberto

    2002-02-01

    üente na população de pacientes com AIJ associada com uveíte (60% do que naqueles sem uveíte (12% (pObjective: to evaluate the frequency of chronic anterior uveitis in patients with juvenile idiopathic arthritis and its association with the presence of antinuclear antibodies. Patients and methods: we retrospectively studied 72 patients with juvenile idiopathic arthritis. All of them were submitted to slit-lamp examination of the anterior chamber at diagnosis. Both antinuclear antibodies and rheumatoid factor were determined. Patients with positive results for antinuclear antibodies were evaluated every three months and those with negative results were assessed every six months.Results: forty patients were male (55.5% and 36 were Caucasoid (50%. The mean age at the onset of juvenile idiopathic arthritis was 6.4 years (range = 1 to 14 years and the mean age at the beginning of the study was 10.4 years (1 to 19 years. According to the type of disease at onset, 32 were pauciarticular (44.4% (17 boys and 15 girls, 30 were polyarticular (41.6% (17 boys and 13 girls and 10 were systemic (14% (6 boys and 4 girls. We observed chronic anterior uveitis in five patients (6.5% (mean age = 11.4 years. Among them, four (80% had pauciarticular juvenile idiopathic arthritis at disease onset (three girls with type I juvenile idiopathic arthritis and positive antinuclear antibodies and one boy with type I juvenile idiopathic arthritis and negative antinuclear antibodies and one girl with polyarticular juvenile idiopathic arthritis (negative antinuclear antibodies and rheumatoid factor. In this group, the mean age at the onset of juvenile idiopathic arthritis was 5.1 years and the mean age of uveitis onset was 9 years. Antinuclear antibodies were positive in 3/5 patients (60% with uveitis. Antinuclear antibodies were positive in 12% of the patients without uveitis (n = 67. Among the patients with uveitis, three had only one flare and the other two had four flares with cataract. The

  7. Uveitis in juvenile chronic arthritis.

    Science.gov (United States)

    Kanski, J J

    1990-01-01

    About 20% of patients with juvenile chronic arthritis develop uveitis which is frequently bilateral. Risk factors for uveitis are: female gender, pauciarticular onset of arthritis, presence of circulating antinuclear antibodies, and the antigens HLA-DW5 and HLA-DPw2. The visual prognosis in patients with uveitis is good in 25% and fair in 50%. The remaining 25% develop cataract and/or glaucoma. The management of glaucoma is unsatisfactory, but the results of cataract surgery by lensectomy are good.

  8. EXPERIENCE OF RITUXIMAB APPLICATION ON A PATIENT, SUFFERING FROM JUVENILE RHEUMATOID ARTHRITIS

    Directory of Open Access Journals (Sweden)

    E.I. Alexeeva

    2006-01-01

    Full Text Available The article describes the run of the severe systemic juvenile rheumatoid arthritis, which is resistant to the standard antirheumatic therapy. The disease was characterized by such systemic implications of the disease, as: fever, rash, pericarditis, lymphadenopathy, hepatomegaly accompanied by the generalized joint syndrome and high laboratory indices of activity. Introduction of rituximab into the treatment scheme allowed the researchers to decrease the general activity of the disease, arrest the systemic implications, improve functional status of the joints, and normalize the laboratory indices of activity. The effect duration was 5 months and 4 months after the first and second course of treatment by rituximab accordingly. The treatment results prove the perspective of rituximab application with in the complex therapy for the patients, suffering from juvenile rheumatoid arthritis. However, it is necessary to conduct further research to identify the location of antibodies to cd 20+ within the therapy scheme of this disease. Key words: children, treatment, rituximab, juvenile rheumatoid arthritis.

  9. Increased IL-6 Expression in Osteoclasts Is Necessary But Not Sufficient for the Development of Paget’s Disease of Bone

    Science.gov (United States)

    Teramachi, Jumpei; Zhou, Hua; Subler, Mark A; Kitagawa, Yukiko; Galson, Deborah L; Dempster, David W; Windle, Jolene J; Kurihara, Noriyoshi; Roodman, G David

    2015-01-01

    Measles virus nucleocapsid protein (MVNP) expression in osteoclasts (OCLs) and mutation of the SQSTM1 (p62) gene contribute to the increased OCL activity in Paget’s disease (PD). OCLs expressing MVNP display many of the features of PD OCLs. Interleukin-6 (IL-6) production is essential for the pagetic phenotype, because transgenic mice with MVNP targeted to OCLs develop pagetic OCLs and lesions, but this phenotype is absent when MVNP mice are bred to IL-6−/− mice. In contrast, mutant p62 expression in OCL precursors promotes receptor activator of NF-κB ligand (RANKL) hyperresponsivity and increased OCL production, but OCLs that form have normal morphology, are not hyperresponsive to 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3), nor produce elevated levels of IL-6. We previously generated p62P394L knock-in mice (p62KI) and found that although OCL numbers were increased, the mice did not develop pagetic lesions. However, mice expressing both MVNP and p62KI developed more exuberant pagetic lesions than mice expressing MVNP alone. To examine the role of elevated IL-6 in PD and determine if MVNP mediates its effects primarily through elevation of IL-6, we generated transgenic mice that overexpress IL-6 driven by the tartrate-resistant acid phosphatase (TRAP) promoter (TIL-6 mice) and produce IL-6 at levels comparable to MVNP mice. These were crossed with p62KI mice to determine whether IL-6 overexpression cooperates with mutant p62 to produce pagetic lesions. OCL precursors from p62KI/TIL-6 mice formed greater numbers of OCLs than either p62KI or TIL-6 OCL precursors in response to 1,25-(OH)2D3. Histomorphometric analysis of bones from p62KI/TIL-6 mice revealed increased OCL numbers per bone surface area compared to wild-type (WT) mice. However, micro-quantitative CT (μQCT) analysis did not reveal significant differences between p62KI/TIL-6 and WT mice, and no pagetic OCLs or lesions were detected in vivo. Thus, increased IL-6 expression in OCLs from p62KI mice

  10. Juvenile morphology in baleen whale phylogeny.

    Science.gov (United States)

    Tsai, Cheng-Hsiu; Fordyce, R Ewan

    2014-09-01

    Phylogenetic reconstructions are sensitive to the influence of ontogeny on morphology. Here, we use foetal/neonatal specimens of known species of living baleen whales (Cetacea: Mysticeti) to show how juvenile morphology of extant species affects phylogenetic placement of the species. In one clade (sei whale, Balaenopteridae), the juvenile is distant from the usual phylogenetic position of adults, but in the other clade (pygmy right whale, Cetotheriidae), the juvenile is close to the adult. Different heterochronic processes at work in the studied species have different influences on juvenile morphology and on phylogenetic placement. This study helps to understand the relationship between evolutionary processes and phylogenetic patterns in baleen whale evolution and, more in general, between phylogeny and ontogeny; likewise, this study provides a proxy how to interpret the phylogeny when fossils that are immature individuals are included. Juvenile individuals in the peramorphic acceleration clades would produce misleading phylogenies, whereas juvenile individuals in the paedomorphic neoteny clades should still provide reliable phylogenetic signals.

  11. Juvenile morphology in baleen whale phylogeny

    Science.gov (United States)

    Tsai, Cheng-Hsiu; Fordyce, R. Ewan

    2014-09-01

    Phylogenetic reconstructions are sensitive to the influence of ontogeny on morphology. Here, we use foetal/neonatal specimens of known species of living baleen whales (Cetacea: Mysticeti) to show how juvenile morphology of extant species affects phylogenetic placement of the species. In one clade (sei whale, Balaenopteridae), the juvenile is distant from the usual phylogenetic position of adults, but in the other clade (pygmy right whale, Cetotheriidae), the juvenile is close to the adult. Different heterochronic processes at work in the studied species have different influences on juvenile morphology and on phylogenetic placement. This study helps to understand the relationship between evolutionary processes and phylogenetic patterns in baleen whale evolution and, more in general, between phylogeny and ontogeny; likewise, this study provides a proxy how to interpret the phylogeny when fossils that are immature individuals are included. Juvenile individuals in the peramorphic acceleration clades would produce misleading phylogenies, whereas juvenile individuals in the paedomorphic neoteny clades should still provide reliable phylogenetic signals.

  12. A Rare Case of Juvenile Systemic Lupus Erythematosus with Disseminated Histoplasmosis

    Science.gov (United States)

    Sarkar, Piyabi; Basu, Keya; Mallick (Sinha), Mamata Guha

    2016-01-01

    Histoplasmosis is a systemic fungal infection caused by dimorphic fungus, Histoplasma capsulatum. Immunocompetent individuals usually have self-limiting or localized disease whereas immunocompromised individuals develop disseminated disease. The occurrence of progressive disseminated histoplasmosis in juvenile systemic lupus erythematosus is extremely rare with only one reported case in literature showing such association. Therefore, we report a case of severe opportunistic fungal infection caused by Histoplasma in a 13-year-old girl who was diagnosed with juvenile lupus erythematosus, subsequently developed septic shock and died of the disease despite of aggressive antifungal therapy. PMID:27904204

  13. Juvenile psammomatoid ossifying fibroma. Case report

    OpenAIRE

    Vahtsevanos, Konstantinos; Persephone XIROU; Giorgos BALLIS; Tsekos, Antonis; Ntomouchtsis, Aris; Alexandros VALASIDIS; Doxa MAGGOUDI

    2012-01-01

    Ossifying fibroma (OS) represents a slow growing, benign neoplasm that belongs to the greater group of fibro-osseous lesions. Based on its histological features, ossifying fibroma is divided into: a) juvenile trabecular OS and b) juvenile psammomatoid OS which affects mainly the paranasal sinuses of children and teenagers aging from 5 to 15 years.A rare case of juvenile psammomatoid ossifying fibroma in a 30 year old male patient located in the left mandibular ramus is presented. Treatment pl...

  14. EFFICACY OF ETANERCEPT IN TREATMENT OF VARIOUS TYPES OF JUVENILE IDIOPATHIC ARTHRITIS

    Directory of Open Access Journals (Sweden)

    O. Yu. Konopel'ko

    2013-01-01

    Full Text Available Aim: to assess efficacy and safety of etanercept in treatment of various types of juvenile idiopathic arthritis in children under conditions of real clinical practice. Patients and methods: 52 children were included into the study, among them 16 were with systemic and 36 with juvenile idiopathic arthritis without extra-articular involvement. Results: etanercept treatment was the most efficient in patients with systemic juvenile idiopathic arthritis without extra-articular involvement. In 6 and 12 months of the treatment 50 and 70% improvement according to the ACRpedi criteria were established in 31/36 (86% and 28/36 (78% of the patients, respectively. In 24 months in 5 (29% of 17 children remained in the study remission stage of the diseases was confirmed. Conclusions: etanercept treatment was not associated with significant unfavorable effects, which allows to recommend this drug for treatment of juvenile idiopathic arthritis without extra-articular involvent and resistant to standard anti-rheumatic therapy.

  15. Giant juvenile fibroadenoma: a case and review of novel modalities in treatment.

    Science.gov (United States)

    Sosin, Michael; Feldman, Elizabeth

    2012-01-01

    A giant juvenile fibroadenoma is defined as a fibroadenoma greater than 5 centimeters in size occurring in the pediatric population. It frequently affects adolescents. Rapid growth of the mass may result in breast asymmetry and deformity. Varying techniques in surgical extirpation have been described in order to optimize aesthetics and minimize distortion. The advent of new methods to remove benign breast disease is in its infancy stages. Many practitioners are unaware of the novel options that are emerging in the treatment of fibroadenoma. We describe an excision of a 12 centimeter giant juvenile fibroadenoma and adjacent juvenile fibroadenoma using a strategically atypical incision that resulted in excellent cosmesis and contour of the breast without subsequent reconstruction. Multiple modalities of removing a fibroadenoma are described with a review of the associated risks, benefits, and long term implications as well as a discussion on the indication for reconstructive surgery in patients with giant juvenile fibroadenoma.

  16. Juvenile nasopharyngeal angiofibroma: A single institution study

    Directory of Open Access Journals (Sweden)

    Mistry Rajesh

    2005-01-01

    Full Text Available BACKGROUND : Juvenile nasopharyngeal angiofibroma (JNA is a rare tumor of adolescent males and there is a paucity of Indian studies on this subject. AIMS : To present the experience of management of JNA at a single institution. SETTING AND DESIGN : This is a retrospective observational study of patients with JNA who presented at the Tata Memorial Hospital between May 1988 and August 2001. MATERIALS AND METHODS : Thirty-two patients with JNA were treated in the study period. Since the time period was prolonged and diagnostic and therapeutic protocols had undergone many changes, the patients were divided into two groups, namely 1988-1996 and 1997-2001. The age distribution, disease patterns, management approaches and treatment outcomes of patients in the two groups were recorded. Statistical analyses were done using students ′t′ test and test for proportion. RESULTS : The mean age at presentation was 16 years and more than 90% of the patients had Stage III or IV disease. Preoperative embolization was carried out in 19 patients. The surgical approaches used were median maxillectomy, infratemporal fossa, transpalatal, maxillary swing and craniofacial approach. The recurrence rate, complete resection rate and cure rates were 12.5%, 41% and 63% respectively. CONCLUSION : Surgery is the mainstay of treatment of JNA. Preoperative embolization and newer surgical approaches result in less blood loss and complete resection. Aggressive re-resection should be done for resectable recurrences reserving radiotherapy for unresectable, recurrent/ residual disease.

  17. Juvenile idiopathic arthritis and oral health

    Directory of Open Access Journals (Sweden)

    Agnieszka Kobus

    2016-05-01

    Full Text Available Juvenile idiopathic arthritis (JIA is the most common autoimmune inflammatory disease of connective tissue in children. It is characterized by progressive joint destruction which causes preserved changes in the musculoskeletal system. The literature describes fully clinical symptoms and radiological images in different subtypes of JIA. However, there is still a limited number of studies reporting on the medical condition of the oral cavity of ill children. JIA can affect hard and soft tissues of the oral cavity by: the general condition of the child’s health, arthritis of the upper limbs, as the result of the pharmacotherapy, changes in secretion and composition of saliva, inflammation of the temporomandibular joint and facial deformity.The study summarizes the available literature on the condition of the teeth and periodontal and oral hygiene in the course of JIA. The presence of diverse factors that modify the oral cavity, such as facial growth, functioning of salivary glands, or the supervision and care provided by adults, prevents clear identification if JIA leads to severe dental caries and periodontal disease. Despite conflicting results in studies concerning the clinical oral status, individuals with JIA require special attention regarding disease prevention and maintenance of oral health.

  18. The human microbiome and juvenile idiopathic arthritis.

    Science.gov (United States)

    Verwoerd, Anouk; Ter Haar, Nienke M; de Roock, Sytze; Vastert, Sebastiaan J; Bogaert, Debby

    2016-09-20

    Juvenile idiopathic arthritis (JIA) is the most common rheumatic disease in childhood. The pathogenesis of JIA is thought to be the result of a combination of host genetic and environmental triggers. However, the precise factors that determine one's susceptibility to JIA remain to be unravelled. The microbiome has received increasing attention as a potential contributing factor to the development of a wide array of immune-mediated diseases, including inflammatory bowel disease, type 1 diabetes and rheumatoid arthritis. Also in JIA, there is accumulating evidence that the composition of the microbiome is different from healthy individuals. A growing body of evidence indeed suggests that, among others, the microbiome may influence the development of the immune system, the integrity of the intestinal mucosal barrier, and the differentiation of T cell subsets. In turn, this might lead to dysregulation of the immune system, thereby possibly playing a role in the development of JIA. The potential to manipulate the microbiome, for example by faecal microbial transplantation, might then offer perspectives for future therapeutic interventions. Before we can think of such interventions, we need to first obtain a deeper understanding of the cause and effect relationship between JIA and the microbiome. In this review, we discuss the existing evidence for the involvement of the microbiome in JIA pathogenesis and explore the potential mechanisms through which the microbiome may influence the development of autoimmunity in general and JIA specifically.

  19. Juvenile idiopathic arthritis-associated uveitis.

    Science.gov (United States)

    Clarke, Sarah L N; Sen, Ethan S; Ramanan, Athimalaipet V

    2016-04-27

    Juvenile idiopathic arthritis (JIA) is the most common rheumatic disease of childhood, with JIA-associated uveitis its most common extra-articular manifestation. JIA-associated uveitis is a potentially sight-threatening condition and thus carries a considerable risk of morbidity. The aetiology of the condition is autoimmune in nature with the predominant involvement of CD4(+) T cells. However, the underlying pathogenic mechanisms remain unclear, particularly regarding interplay between genetic and environmental factors. JIA-associated uveitis comes in several forms, but the most common presentation is of the chronic anterior uveitis type. This condition is usually asymptomatic and thus screening for JIA-associated uveitis in at-risk patients is paramount. Early detection and treatment aims to stop inflammation and prevent the development of complications leading to visual loss, which can occur due to both active disease and burden of disease treatment. Visually disabling complications of JIA-associated uveitis include cataracts, glaucoma, band keratopathy and macular oedema. There is a growing body of evidence for the early introduction of systemic immunosuppressive therapies in order to reduce topical and systemic glucocorticoid use. This includes more traditional treatments, such as methotrexate, as well as newer biological therapies. This review highlights the epidemiology of JIA-associated uveitis, the underlying pathogenesis and how affected patients may present. The current guidelines and criteria for screening, diagnosis and monitoring are discussed along with approaches to management.

  20. [Juvenile idiopathic arthritis and oral health].

    Science.gov (United States)

    Kobus, Agnieszka; Kierklo, Anna; Sielicka, Danuta; Szajda, Sławomir Dariusz

    2016-05-04

    Juvenile idiopathic arthritis (JIA) is the most common autoimmune inflammatory disease of connective tissue in children. It is characterized by progressive joint destruction which causes preserved changes in the musculoskeletal system. The literature describes fully clinical symptoms and radiological images in different subtypes of JIA. However, there is still a limited number of studies reporting on the medical condition of the oral cavity of ill children. JIA can affect hard and soft tissues of the oral cavity by: the general condition of the child's health, arthritis of the upper limbs, as the result of the pharmacotherapy, changes in secretion and composition of saliva, inflammation of the temporomandibular joint and facial deformity. The study summarizes the available literature on the condition of the teeth and periodontal and oral hygiene in the course of JIA. The presence of diverse factors that modify the oral cavity, such as facial growth, functioning of salivary glands, or the supervision and care provided by adults, prevents clear identification if JIA leads to severe dental caries and periodontal disease. Despite conflicting results in studies concerning the clinical oral status, individuals with JIA require special attention regarding disease prevention and maintenance of oral health.

  1. Distinct synovial immunopathologic characteristics of juvenile-onset spondylarthritis and other forms of juvenile idiopathic arthritis

    NARCIS (Netherlands)

    E. Kruithof; V. van den Bossche; L. de Rycke; B. Vandooren; R. Joos; J.D. Canete; P.P. Tak; A.M.H. Boots; E.M. Veys; D. Baeten

    2006-01-01

    Objective. To characterize the synovial immunopathologic features of juvenile-onset spondylarthritis (SpA) in relation to adult SpA and other forms of juvenile idiopathic arthritis (JIA). Methods. Synovial biopsy samples were obtained from 10 patients with juvenile-onset SpA, 23 with adult SpA, 19 w

  2. Justicia juvenil restaurativa como respuesta alternativa

    OpenAIRE

    Mariño Rojas, Cielo

    2016-01-01

    El artículo explora las posibilidades de la justicia juvenil restaurativa como respuesta alternativa en los sistemas de justicia juvenil en la región. Si bien la justicia restaurativa no aparece explícitamente en los instrumentos internacionales sobre justicia penal juvenil, estos dan la oportunidad para que aquella se desarrolle dentro de los sistemas de justicia juvenil. Inicialmente se aborda su evolución histórica para establecer el origen de sus principales características. A continuació...

  3. "Immune Complexes in Juvenile Idiopathic Arthritis"

    Directory of Open Access Journals (Sweden)

    Terry Lynn Moore

    2016-05-01

    Full Text Available Abstract for invited review in Molecular Mechanisms of Immune Complex Pathophysiology thematic issue to be published in Frontiers in Immunology. Immune Complexes(ICin Juvenile Idiopathic Arthritis (JIA Terry L. Moore, MD, FAAP, FACR, MACR Professor of Internal Medicine,Pediatrics, and Molecular Biology and Immunology Director of Adult and Pediatric Rheumatology Saint Louis University School of Medicine Saint Louis, Missouri 631`04,USA Juvenile idiopathic arthritis (JIA reflects a group of clinically heterogeneous, autoimmune disorders in children characterized by chronic arthritis and hallmarked by elevated levels of circulating immune complexes (CICs and associated complement activation by-products in their sera. ICs have been detected in patients’ sera with JIA utilizing a variety of methods, including the anti-human IgM affinity column,C1q solid phase assay, polyethylene glycol precipitation, Staphylococcal Protein A separation method, anti-C1q/C3 affinity columns, and FcγRIII affinity method. As many as 75% of JIA patients have had IC detected in their sera. The CIC proteome in JIA patients has been examined to elucidate disease-associated proteins that are expressed in active disease. Evaluation of these IC s have shown the presence of multiple peptide fragments by SDS-PAGE and 2-DE. Subsequently, all isotypes of rheumatoid factor (RF, isotypes of anti-cyclic citrullinated (CCP peptide antibodies, IgG, C1q, C4, C3, and the membrane attack complex (MAC were detected in these IC. Complement activation and levels of IC correlate with disease activity in JIA, indicating their role in the pathophysiology of the disease. This review will summarize the existing literature and discuss the role of possible protein modification that participates in the generation of immune response. We will address the possible role of these events in the development of ectopic germinal centers that become the secondary site of plasma cell development in JIA. We

  4. Juvenile hyaline fibromatosis. Radiological diagnosis. Fibromatosis hialina juvenil. Diagnostico radiologico

    Energy Technology Data Exchange (ETDEWEB)

    Fuentes, R.; Sar, V.; Cabrera, J.J.; Diaz, L.; Hernandez, B.; Valeron, P.; Baez, O.; Rodriguez, M.

    1993-10-01

    Juvenile hyaline fibromatosis (JHF) is a rare disorder of unknown etiology, very few cases of which have been reported in the literature. It presents similarities to other fibromatosys, but has its particular radiological features which differentiate it from them. The clinical findings consist of several, slow growing, subcutaneous nodules, flexion contractures of the joints which can lead to disability, gingival hypertrophy and muscular atrophy. The suspected radiological diagnosis is confirmed by electron microscopy study of the nodules, although light microscopy can also reveal suggestive images. Author (9 refs.)

  5. An unusual cluster of circumscribed juvenile pityriasis rubra pilaris cases.

    Science.gov (United States)

    Martin, Kari L; Holland, Kristen E; Lyon, Valerie; Chiu, Yvonne E

    2014-01-01

    Circumscribed juvenile pityriasis rubra pilaris (PRP) is an uncommon dermatosis. We describe the unusual clustering of circumscribed juvenile PRP cases in our pediatric dermatology clinic in 2011. A retrospective chart review was done of patients presenting during the summer of 2011 with classic findings of circumscribed juvenile PRP. Clinical data including past medical and family history, presenting symptoms, infectious disease history and evaluation, biopsy results, and management were recorded. Seven patients, ages 5 to 19 years, all had strikingly similar skin findings of pink to hyperpigmented, well-defined, scaly papules and plaques on their elbows, knees, dorsal hands, ankles, and Achilles tendons. Four of the seven also had palmoplantar involvement. Four were sibling pairs and the other three were unrelated. Streptococcus pyogenes infection was suspected as a trigger in four of the patients. The unusual clustering of this uncommon disease, along with the occurrence in two sibling pairs, suggests that a genetic susceptibility unmasked by an infectious agent may play a role in its pathogenesis. © 2014 Wiley Periodicals, Inc.

  6. Results of surgical treatment for juvenile myasthenia gravis.

    Science.gov (United States)

    Vázquez-Roque, F J; Hernández-Oliver, M O; Medrano Plana, Y; Castillo Vitlloch, A; Fuentes Herrera, L; Rivero-Valerón, D

    2017-04-01

    Radical or extended thymectomy is an effective treatment for myasthenia gravis in the adult population. There are few reports to demonstrate the effectiveness of this treatment in patients with juvenile myasthenia gravis. The main objective of this study was to show that extended transsternal thymectomy is a valid option for treating this disease in paediatric patients. Twenty-three patients with juvenile myasthenia gravis underwent this surgical treatment in the period between April 2003 and April 2014; mean age was 12.13 years and the sample was predominantly female. The main indication for surgery, in 22 patients, was the generalised form of the disease (Osserman stage II) together with no response to 6 months of medical treatment. The histological diagnosis was thymic hyperplasia in 22 patients and thymoma in one patient. There were no deaths and no major complications in the postoperative period. After a mean follow-up period of 58.87 months, 22 patients are taking no medication or need less medication to manage myasthenic symptoms. Extended (radical) transsternal thymectomy is a safe and effective surgical treatment for juvenile myasthenia gravis. Copyright © 2015 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  7. Disease: H00274 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available dontitis. Inherited metabolic disease hsa04142(1075) Lys...ving dipeptides from the amino termini of its substrates. The disease is characterized by palmoplantar keratoderma and juvenile perio

  8. Self-control with urinalysis in juvenile diabetes.

    Science.gov (United States)

    Ludvigsson, J; Svensson, P G

    1979-11-01

    Urinary glucose excretion reflects the blood glucose levels and is therefore recommended and used as a relevant and practical method for self-control in juvenile diabetes. The purpose of this study was to estimate the attitudes of diabetic children and their parents towards such daily urinalysis. In 1975 69 juvenile diabetics 6--18 years old and their parents were studied and three years later another 69 patients were added. Standardized interviews and questionnaires were used. Only 3 out of 138 patients refused to test their urine regularly and to write down their results in the diary. The results indicate that a great majority of the patients and the parents easily accept the self-testing method and regard it as a valuable tool in the management of the disease. Almost nobody experienced the urine tests as a psychological problem.

  9. Subpopulations Within Juvenile Psoriatic Arthritis: A Review of the Literature

    Directory of Open Access Journals (Sweden)

    Matthew L. Stoll

    2006-01-01

    Full Text Available The presentation of juvenile psoriatic arthritis (JPsA has long been recognized to be clinically heterogeneous. As the definition of JPsA expanded to accommodate atypical manifestations of psoriasis in young children, studies began to reflect an increasingly clear biphasic distribution of age of onset, with peaks in the first few years of life and again in early adolescence. These two subpopulations differ in gender ratio, pattern of joint involvement, laboratory findings and potentially response to therapy. Intriguingly, a similar distribution of age of onset has been observed in juvenile rheumatoid arthritis (JRA, and correlates with patterns of HLA association. While a secure classification of subpopulations within JPsA awaits improved pathophysiologic understanding, future research must consider the possibility that different disease mechanisms may be operative in distinct subsets of patients with this disorder.

  10. Physiotherapy in pauciarticular juvenile idiopathic arthritis. Case study.

    Science.gov (United States)

    Zuk, Beata; Kaczor, Zofia; Zuk-Drążyk, Berenika; Księżopolska-Orłowska, Krystyna

    2014-01-01

    Juvenile idiopathic arthritis (JIA) is the most common arthropathy of childhood and adolescence. This term encompasses a group of chronic systemic inflammatory diseases of the connective tissue which cause arthritis in patients under 16 years of age lasting at least 6 weeks. The authors presented the characteristic features of physiotherapy based on functional examination results on the basis of two cases of girls with pauciarticular JIA treated according to an established pharmacological regimen. Physiotherapy should be introduced at an early stage of the disease. Kinesiotherapy preceded by history-taking and a functional examination of the patient, has to focus on both primary and secondary joint lesions.

  11. Update on Genetic Susceptibility and Pathogenesis in Juvenile Idiopathic Arthritis

    Directory of Open Access Journals (Sweden)

    Morten Herlin

    2014-07-01

    Full Text Available Juvenile idiopathic arthritis (JIA is a multifactorial disease with a pathogenesis which remains inexplicable. However, genome-wide association studies brought forward within recent years have discovered several new susceptibility genes, and accumulating evidence supports genetic variability as playing a key role in JIA development. This review summarises the present knowledge of human leukocyte antigen (HLA and non-HLA polymorphisms conferring disease susceptibility, and discusses the areas in JIA genetics, which are still to be investigated in order to apply JIA genetics in a clinical setting.

  12. Una mutación en el gen PARK2 causa enfermedad de Parkinson juvenil en una extensa familia colombiana Mutation c.255delA in the PARK2 gene as cause of juvenile Parkinson´s disease in a large Colombian family

    Directory of Open Access Journals (Sweden)

    Nicolas Pineda Trujillo

    2009-05-01

    -pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin;}

    Parkinson´s is a common disease (PD caused by degeneration of dopaminergic neurons in the substantia nigra and other brain areas. Several genes and mutations have been mplicated in its pathogenesis, the latter have been identified mainly in the PARK2 gene.

    We report the evaluation of this gene and of its flanking region in a large family from the southwestern part of Colombia. The parents are first cousins and four out of their ten children were affected at juvenile age.

    Molecular evaluation included typing of microsatellites (SSTRs and direct sequencing of the exons of the gene.

    Our findings showed the presence, in a homozygous manner, of the mutation c.255delA, at exon 2 of PARK2. In addition, it was possible to identify a haplotype carried by both parents, and present in a homozygous manner in the affected children. A high rate of recombinants was observed in the analysed

  13. Juvenile ossifying fibroma: Psammamatoid variant

    Directory of Open Access Journals (Sweden)

    Shivani Aggarwal

    2012-01-01

    Full Text Available Juvenile ossifying fibroma is a rare fibro-osseous lesion containing variable amount of calcified masses, which resembles bone or cementum within a fibrocellular connective tissue stroma. It has variable clinical behavior, highly aggressive in nature including invasion and destruction of adjacent anatomic structures with a strong tendency to recur. We reported a 28-year-old female patient with a growth in the upper left vestibule region extending from canine to molar region with clinical, histopathological, and radiological features are presented. Surgical management was done, and regular follow-up was advised.

  14. Juvenile Competency to Stand Trial.

    Science.gov (United States)

    Stepanyan, Sofia T; Sidhu, Shawn S; Bath, Eraka

    2016-01-01

    Competency to stand trial is interpreted as a protected due process right for all defendants and is defined as a defendant's fundamental knowledge and understanding of the criminal charges being filed, roles and procedures within the courtroom, and a general ability to work with the defense counsel. Questions of competency are most often raised by the judge, defense, or the prosecution, and competency evaluations are most often completed by psychiatrists or psychologists with forensic training or work experience. Mental illness, intellectual disability, developmental disorders, and developmental immaturity are the 4 main factors considered in most juvenile competency evaluations.

  15. THE STUDY OF FEATURES OF GUILT OF JUVENILE OFFENDERS IN THE CONTEXT OF JUVENILE JUSTICE

    Directory of Open Access Journals (Sweden)

    Natalija Vladimirovna Galkina

    2015-08-01

    Full Text Available The article is devoted to the results of empirical studies of the experiences of guilt of juvenile offenders in the context of juvenile justice where a minor appears as the subject of legal relations. Restorative approach of juvenile justice is based on an admission of guilt to the victim. In connection with it, the research of features of the guilt of minors who have committed an offence and the conditions for the development of the subjectivity will enhance understanding of the possibilities of restorative juvenile justice system in the prevention of juvenile delinquency.Thus, the results of empirical research presented in the article are important for determining of the psychological bases of realization of rehabilitation programs in the context of juvenile justice. In particular, the results are important for the organization and conduct of psychological work to overcome the psychological barriers in the behavior of juveniles having inherently maladaptive guilt and destructive psychological defense mechanisms.

  16. Changes in Juvenile Justice in China.

    Science.gov (United States)

    Wong, Dennis S. W.

    2001-01-01

    Discusses rising juvenile and youth crime in China, highlighting the essence of Chinese Marxist criminological thought and changing conceptions of delinquency from the postrevolutionary period to the present; examining official responses to delinquency and the recent development of juvenile justice; and suggesting that current delinquency control…

  17. Juvenile Anorexia Nervosa: Family Therapy's Natural Niche

    Science.gov (United States)

    Fishman, H. Charles

    2006-01-01

    Juvenile Anorexia Nervosa (AN) is a severe problem both in terms of presenting symptomatology and its tendency toward chronicity. Researchers have consistently shown that family-based approaches are superior to individual approaches for the treatment of juvenile AN. This article addresses the capacity deficit of trained family therapists to treat…

  18. Sexually dimorphic body plumage in juvenile crossbills

    NARCIS (Netherlands)

    Edelaar, P; Phillips, RE; Knops, P

    2005-01-01

    Sexual dimorphism in color and pattern of contour feathers is rare in juvenile songbirds. We describe how captive-bred juvenile males of Scottish Crossbill (Loxia scotica) and nominate Red Crossbill (L. curvirostra curvirostra) can be differentiated from females prior to prebasic molt by an unstreak

  19. Juveniles' Motivations for Remaining in Prostitution

    Science.gov (United States)

    Hwang, Shu-Ling; Bedford, Olwen

    2004-01-01

    Qualitative data from in-depth interviews were collected in 1990-1991, 1992, and 2000 with 49 prostituted juveniles remanded to two rehabilitation centers in Taiwan. These data are analyzed to explore Taiwanese prostituted juveniles' feelings about themselves and their work, their motivations for remaining in prostitution, and their difficulties…

  20. Alternative sanctions for juveniles in the Netherlands

    NARCIS (Netherlands)

    Laan, P.H. van der

    1993-01-01

    In the Netherlands alternative sanctions for juveniles have become very popular. In less than ten years, the alternative sanction has surpassed the fine as the most frequently imposed penal sanction for juveniles. As a result of this popularity, some net widening has occured. In general, alternativl