Asellus aquaticus as a Potential Carrier of Escherichia coli and Other Coliform Bacteria into Drinking Water Distribution Systems

Directory of Open Access Journals (Sweden)

Hans-Jørgen Albrechtsen

2013-03-01

Full Text Available Individuals of the water louse, Asellus aquaticus, enter drinking water distribution systems in temperate parts of the world, where they establish breeding populations. We analysed populations of surface water A. aquaticus from two ponds for associated faecal indicator bacteria and assessed the risk of A. aquaticus transporting bacteria into distribution systems. Concentrations of up to two E. coli and five total coliforms·mL−1 were measured in the water and 200 E. coli and >240 total coliforms·mL−1 in the sediments of the investigated ponds. Concentrations of A. aquaticus associated bacteria never exceeded three E. coli and six total coliforms·A. aquaticus−1. During exposure to high concentrations of coliforms, concentrations reached 350 coliforms·A. aquaticus−1. A. aquaticus associated E. coli were only detected as long as E. coli were present in the water and sediment. The calculated probability of exceeding drinking water guideline values in non-disinfected systems by intrusion of A. aquaticus was low. Only in scenarios with narrow pipes and low flows, did total coliforms exceed guideline values, implying that the probability of detection by routine monitoring is also low. The study expands the knowledge base for evaluating incidents with presence of coliform indicators in drinking water by showing that intruding A. aquaticus were not important carriers of E. coli or other coliform bacteria even when emerging from faecally contaminated waters.

Dynamics of the weed infestation with Senecio vulgaris after a single entry from seeds

Directory of Open Access Journals (Sweden)

Söchting, Hans-Peter

2014-02-01

Full Text Available Due to a short generation time associated with a high seed production and a quick germination, which is possible throughout the year, Senecio vulgaris is especially in horticultural crops one of the most important weed species. Like all ragwort species, also Senecio vulgaris contains pyrrolizidine alkaloids which are converted in the liver to harmful substances. For this reason an accidental consumption of this species should be avoided completely. Belonging to the Compositae, chemical control of this weed species in vegetable crops, particularly in lettuce, is difficult. Based on a field-grown model experiment the emergence behavior and growth of Senecio vulgaris in leafy lettuce was studied. The first step was the contamination of the trial plots with Senecio seeds. For this purpose Senecio plants were planted at three different densities (1, 2 and 10 plants m2 in the designated plots. All plots were covered with fleece in order to prevent an unregulated dispersal of seeds. After seed maturity the fleece was removed, plants were cut into small pieces and the plant material including the seeds was incorporated into the soil. Then different leafy lettuces crops (rocket, asia green, spinach, lamb´s lettuce were cultivated in a six-crop sequence over two years (three crop sopecies per year. The development of Senecio vulgaris and the resulting possible contamination of the lettuces with Senecio leaves was recorded. From the date of removing the fleece on seed-production a shedding of Senecio plants was prevented to avoid further contamination. Also the entry from outside the plots was excluded. Depending on the initial plant density, the 71, 55 and 216 Senecio plants m2 which emerged after the first sowing of lettuce dropped to 7, 9 and 16 plants m2 after the sixth sowing. Thus, the density of S. vulgaris plants rapidly decreased but there was still a significant potential of emerging seedlings potentially contaminating the lettuce crops after

Sheep production as a Senecio spp. control tool

Directory of Open Access Journals (Sweden)

Paulo Mota Bandarra

2012-10-01

Full Text Available Since poisoning by Senecio spp. is one of the main causes of cattle death in southern Brazil, control of these plants is a priority for the local livestock production. After the pasture has been mowed, grazing by 16 sheep was efficient for controlling Senecio brasiliensis and Senecio madagascariensis populations in a 5.5-hectare area that had long been severely infested with these species. A total of 28,629 plants among S. brasiliensis (flower-of-souls, 10,122 and S.madagascariensis (fireweed, 18,507 were almost completely eliminated in a two-year period. The number of sheep was kept at 3.0 stock units/ha, but a variable number of cattle were temporarily stocked according to pasture availability. The major sanitary practice applied to the sheep was anthelmintic administration. Liver biopsies taken from sheep and cattle before and after experimental period didn't reveal any change associable with seneciosis. The performance levels of the sheep were comparable to those observed in flocks managed under traditional extensive grazing systems in southern Brazil.

Alcalóides pirrolizidínicos em espécies do gênero Senecio

Directory of Open Access Journals (Sweden)

Silva Chana de Medeiros da

2006-01-01

Full Text Available Senecio species contain a large variety of secondary metabolites and many of these plants afford pyrrolizidine alkaloids. This paper is a review of the literature, describing 62 pyrrolizidine alkaloids already isolated in 62 of more than 2000 species of Senecio, distributed worldwide. The structure-activity relationships involving their toxicity are also discussed, since some Senecio species used for medicinal purposes are responsible for causing serious adverse effects.

Alcalóides pirrolizidínicos em espécies do gênero Senecio

Directory of Open Access Journals (Sweden)

Chana de Medeiros da Silva

2006-10-01

Full Text Available Senecio species contain a large variety of secondary metabolites and many of these plants afford pyrrolizidine alkaloids. This paper is a review of the literature, describing 62 pyrrolizidine alkaloids already isolated in 62 of more than 2000 species of Senecio, distributed worldwide. The structure-activity relationships involving their toxicity are also discussed, since some Senecio species used for medicinal purposes are responsible for causing serious adverse effects.

Asellus aquaticus and other invertebrates in drinking water distribution systems

DEFF Research Database (Denmark)

Christensen, Sarah Christine

hygiene. Whereas invertebrates in drinking water are known to host parasites in tropical countries they are largely regarded an aesthetical problem in temperate countries. Publications on invertebrate distribution in Danish systems have been completely absent and while reports from various countries have...... other crustaceans and nematodes protect bacteria from treatment processes. The influence of A. aquaticus has never previously been investigated. Investigations in this PhD project revealed that presence of A. aquaticus did not influence microbial water quality measurably in full scale distribution...... Campylobacter jejuni. Invertebrates enter drinking water systems through various routes e.g. through deficiencies in e.g. tanks, pipes, valves and fittings due to bursts or maintenance works. Some invertebrates pass treatment processes from ground water or surface water supplies while other routes may include...

Reproduction in the freshwater crustacean Asellus aquaticus along a gradient of radionuclide contamination at Chernobyl.

Science.gov (United States)

Fuller, Neil; Ford, Alex T; Nagorskaya, Liubov L; Gudkov, Dmitri I; Smith, Jim T

2018-07-01

Nuclear accidents such as Chernobyl and Fukushima have led to contamination of the environment that will persist for many years. The consequences of chronic low-dose radiation exposure for non-human organisms inhabiting contaminated environments remain unclear. In radioecology, crustaceans are important model organisms for the development of environmental radioprotection. Previous laboratory studies have demonstrated deleterious effects of radiation exposure on crustacean reproduction. However, no studies have documented the effects of chronic radiation exposure on the reproduction of natural crustacean populations. Based on data from laboratory exposures, we hypothesised that populations of the freshwater isopod Asellus aquaticus exposed to radiation for thirty years at Chernobyl would display reduced reproductive output and altered timing of reproduction. To test this hypothesis, A. aquaticus was collected from six lakes at Chernobyl over two years with total dose rates ranging from 0.06-27.1μGy/h. No significant differences in the fecundity, mass of broods or proportion of reproducing female A. aquaticus were recorded. Significant differences in the body mass of gravid females were recorded suggesting different timings of reproduction, however this was not related to radiation contamination. No significant effect of a range of environmental parameters on A. aquaticus reproduction was recorded. Our data suggests current dose rates at Chernobyl are not causing discernible effects on the reproductive output of A. aquaticus. This study is the first to assess the effects of chronic low-dose radiation exposure on the reproductive output of an aquatic invertebrate at Chernobyl. These findings are consistent with proposed radiological protection benchmarks for the maintenance of wildlife populations and will assist in management of environments impacted by radiation. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Platinum uptake by the freshwater isopod Asellus Aquaticus in urban rivers

Energy Technology Data Exchange (ETDEWEB)

Rauch, S.; Morrison, G.M. [Department of Sanitary Engineering, Chalmers University of Technology, S-412 96 Goeteborg (Sweden)

1999-09-01

Platinum has been increasing in the environment as a result of emissions from catalytic converters. The platinum emitted is principally located in the vicinity of roads but might be transported to urban rivers through highway and urban run-off water. Platinum concentrations in the freshwater isopod Asellus aquaticus were measured for two urban rivers and a stormwater detention pond. Concentrations ranged from 0.04 to 12.4 {mu}g g{sup -1} for direct analysis and from 0.16 to 4.5 {mu}g g{sup -1} after depuration. Analyses of water, pore water and sediments indicate that platinum in urban rivers is mostly found in the sediments and these provide the major contribution of platinum to Asellus aquaticus. Exposure experiments showed the importance of platinum speciation for uptake.

Variation in sensitivity to metals in Gammarus pulex and Asellus aquaticus

Energy Technology Data Exchange (ETDEWEB)

Roberts, D.A. [Univ. of Sheffield (United Kingdom)

1994-12-31

The aim of this study was to investigate inter- and intra-specific variation in two ecologically important freshwater organisms; Asellus aquaticus and Gammarus pulex. Animals of each species were collected from contaminated and uncontaminated sites. The toxicity of zinc and cadmium to these populations was determined using acute toxicity tests. Results show that G. pulex was more sensitive to the toxicants than A. aquaticus. For both species, animals from contaminated sites were less sensitive than animals from uncontaminated sites. The mechanistic bases of this observed variation was investigated. Experiments were performed to determine the accumulation, detoxification and distribution of zinc and cadmium in animals from contaminated and uncontaminated populations. Differences in metal accumulation and production of metal binding proteins have been found and the implication of these will be discussed.

Dietary Preference of Gammarus pulex and Asellus aquaticus during a Laboratory Breeding Programme for Ecotoxicological Studies

Directory of Open Access Journals (Sweden)

M. C. Bloor

2011-01-01

Full Text Available An investigation was undertaken to establish if Gammarus pulex and Asellus aquaticus preferred a diet of unconditioned, artificially or naturally conditioned alder leaves (Alnus glutinosa. Standardised, 24 hour ex situ feeding assays were undertaken with both species to determine their food preference. The results showed that A. aquaticus ate more leaf material compared to G. pulex (Z 23.909, P 0.001 when exposed to all three test variables. Also, both G. pulex and A. aquaticus demonstrated a preference for naturally conditioned leaves compared to the other two variables, with unconditioned leaves proving the least popular food option for both macroinvertebrates (Z 18.803, <0.001. However, both species ate varying amounts of all the leaf treatments (Z 136.399, <0.001. Subsequently, the author outlined a feeding methodology for natural alder leaf conditioning that could be used during a laboratory breeding programme.

Fate of pyrrolizidine alkaloids during processing of milk of cows treated with ragwort.

Science.gov (United States)

de Nijs, Monique; Mulder, Patrick P J; Klijnstra, Mirjam D; Driehuis, Frank; Hoogenboom, Ron L A P

2017-12-01

To investigate the fate of pyrrolizidine alkaloids (PAs) during milk processing, milk of cows treated via rumen fistula with a mixture of 84% (w/w) ragwort (Jacobaea vulgaris, syn. Senecio jacobaea) and 16% narrow-leaved ragwort (Senecio inaequidens) was processed using laboratory scale heating systems with industrial settings. Pasteurised and sterilised (UHT) milk were produced, as well as set-type yoghurt and cheese. Samples were analysed for 29 PAs using LC-MS/MS, of which 11 PAs were detected above LOQ in the samples (0.1 µg l -1 ). Alterations in the PA concentration and composition between the standardised milk and the corresponding end-product(s) were evaluated. The heat treatments applied for pasteurisation and UHT sterilisation to prepare semi-skimmed consumption milk did not affect the PA levels in the end-products. In yoghurt, after fermentation of standardised milk (6 h, pH 4.4), 73% of total PAs were recovered. The PA concentration, specifically dehydrojacoline, was decreased, although not quantifiable, during cheese production. A further decrease of 38% during 6 weeks of ripening was observed. The results show that the PA concentration of natural contaminated cow's milk is not affected by heat treatment applied for pasteurised and sterilised milk, but that microbial fermentation of the milk leads to a lowered PA concentration in yoghurt and cheese. This is probably due to microbiological degradation, since PAs are fairly stable under acidic conditions.

Distribution of Asellus aquaticus and microinvertebrates in a non-chlorinated drinking water supply system – Effects of pipe material and sedimentation

DEFF Research Database (Denmark)

Christensen, Sarah Christine; Nissen, Erling; Arvin, Erik

2011-01-01

Danish drinking water supplies based on ground water without chlorination were investigated for the presence of the water louse, Asellus aquaticus, microinvertebrates (......Danish drinking water supplies based on ground water without chlorination were investigated for the presence of the water louse, Asellus aquaticus, microinvertebrates (...

Anti-tumor activity of polysaccharides extracted from Senecio ...

African Journals Online (AJOL)

Purpose: To optimize the extraction conditions of polysaccharides from the root of Senecio scandens Buch,-Ham. (PRS) and evaluate its anti-tumor effect on hepatocellular carcinoma. Methods: Response surface methodology (RSM) applied with a Box-Behnken design (BBD, three levels and three factors) was employed to ...

A Transcriptomic Analysis of Cave, Surface, and Hybrid Isopod Crustaceans of the Species Asellus aquaticus.

Directory of Open Access Journals (Sweden)

Bethany A Stahl

Full Text Available Cave animals, compared to surface-dwelling relatives, tend to have reduced eyes and pigment, longer appendages, and enhanced mechanosensory structures. Pressing questions include how certain cave-related traits are gained and lost, and if they originate through the same or different genetic programs in independent lineages. An excellent system for exploring these questions is the isopod, Asellus aquaticus. This species includes multiple cave and surface populations that have numerous morphological differences between them. A key feature is that hybrids between cave and surface individuals are viable, which enables genetic crosses and linkage analyses. Here, we advance this system by analyzing single animal transcriptomes of Asellus aquaticus. We use high throughput sequencing of non-normalized cDNA derived from the head of a surface-dwelling male, the head of a cave-dwelling male, the head of a hybrid male (produced by crossing a surface individual with a cave individual, and a pooled sample of surface embryos and hatchlings. Assembling reads from surface and cave head RNA pools yielded an integrated transcriptome comprised of 23,984 contigs. Using this integrated assembly as a reference transcriptome, we aligned reads from surface-, cave- and hybrid- head tissue and pooled surface embryos and hatchlings. Our approach identified 742 SNPs and placed four new candidate genes to an existing linkage map for A. aquaticus. In addition, we examined SNPs for allele-specific expression differences in the hybrid individual. All of these resources will facilitate identification of genes and associated changes responsible for cave adaptation in A. aquaticus and, in concert with analyses of other species, will inform our understanding of the evolutionary processes accompanying adaptation to the subterranean environment.

Interspecific transfer of pyrrolizidine alkaloids: An unconsidered source of contaminations of phytopharmaceuticals and plant derived commodities.

Science.gov (United States)

Nowak, Melanie; Wittke, Carina; Lederer, Ines; Klier, Bernhard; Kleinwächter, Maik; Selmar, Dirk

2016-12-15

Many plant derived commodities contain traces of toxic pyrrolizidine alkaloids (PAs). The main source of these contaminations seems to be the accidental co-harvest of PA-containing weeds. Yet, based on the insights of the newly described phenomenon of the horizontal transfer of natural products, it is very likely that the PA-contaminations may also be due to an uptake of the alkaloids from the soil, previously being leached out from rotting PA-plants. The transfer of PAs was investigated using various herbs, which had been mulched with dried plant material from Senecio jacobaea. All of the acceptor plants exhibited marked concentrations of PAs. The extent and the composition of the imported PAs was dependent on the acceptor plant species. These results demonstrate that PAs indeed are leached out from dried Senecio material into the soil and confirm their uptake by the roots of the acceptor plants and the translocation into the leaves. Copyright © 2016. Published by Elsevier Ltd.

Senecio grisebachii Baker: Pyrrolizidine alkaloids and experimental poisoning in calves

Science.gov (United States)

The main objectives of this study were to determine the 1,2-dehydropyrrolizidine alkaloid (DHPA) content in Senecio grisebachii Baker (Compositae), to experimentally demonstrate its toxicity in calves and to describe the main clinical and pathological findings of this toxicity. S. grisebachii plants...

Pyrrolizidine alkaloids of Senecio sp from Peru

International Nuclear Information System (INIS)

Ruiz Vasquez, Liliana; Reina Artiles, Matias; Gonzalez Coloma, Azucena; Cabrera Perez, Raimundo; Ruiz Mesia, Lastenia

2011-01-01

Six pyrrolizidine alkaloids (PAs) (two saturated macrocyclic, three unsaturated macrocyclic and one unsaturated seco-macrocyclic) were isolated from native Peruvian Senecio species. The structures of these alkaloids were established by a complete NMR spectroscopic analysis, chemical transformations and comparison of their NMR data with those published for similar alkaloids. Three PAs were then tested for antifungal activity against Fusarium moniliforme, F. (Sheldon), F. oxysporum fs. lycopersici (Scheldt) and F. solani (Mart), no significant activity being observed. (author)

Pyrrolizidine alkaloids of Senecio sp from Peru

Energy Technology Data Exchange (ETDEWEB)

Ruiz Vasquez, Liliana; Reina Artiles, Matias [Instituto de Productos Naturales y Agrobiologia, CSIC, Tenerife (Spain); Gonzalez Coloma, Azucena [Instituto de Ciencias Agrarias (ICA), CSIC, Madrid (Spain); Cabrera Perez, Raimundo [Universidad de La Laguna (ULL), Tenerife (Spain). Unidad de Fitopatologia, Facultad de Biologia; Ruiz Mesia, Lastenia [Universidad Nacional de la Amazonia Peruana (LIPNAA-UNAP), AA.HH. Nuevo San Lorenzo, San Juan, Iquitos (Peru). Lab. de Investigacion en Productos Naturales Antiparasitarios de la Amazonia

2011-07-01

Six pyrrolizidine alkaloids (PAs) (two saturated macrocyclic, three unsaturated macrocyclic and one unsaturated seco-macrocyclic) were isolated from native Peruvian Senecio species. The structures of these alkaloids were established by a complete NMR spectroscopic analysis, chemical transformations and comparison of their NMR data with those published for similar alkaloids. Three PAs were then tested for antifungal activity against Fusarium moniliforme, F. (Sheldon), F. oxysporum fs. lycopersici (Scheldt) and F. solani (Mart), no significant activity being observed. (author)

Pyrrolizidine alkaloids of senecio sp from Peru

Directory of Open Access Journals (Sweden)

Liliana Ruiz Vásquez and Matías Reina Artiles

2011-01-01

Full Text Available Six pyrrolizidine alkaloids (PAs (two saturated macrocyclic, three unsaturated macrocyclic and one unsaturated seco-macrocyclic were isolated from native Peruvian Senecio species. The structures of these alkaloids were established by a complete NMR spectroscopic analysis, chemical transformations and comparison of their NMR data with those published for similar alkaloids. Three PAs were then tested for antifungal activity against Fusarium moniliforme, F. (Sheldon, F. oxysporum fs. lycopersici (Scheldt and F. solani (Mart, no significant activity being observed.

Pyrrolizidine alkaloids from Bulgarian species of the genus Senecio

Directory of Open Access Journals (Sweden)

NADEZHDA KOSTOVA

2006-12-01

Full Text Available Nine Bulgarian species from the genus Senecio were studied phytochemically and/or by GC-MS analysis. Senecivernine-N-oxide was isolated and identified by spectral data for the first time. Different types of pyrrolizidine alkaloids were tested for cytotoxicity on murine lymphocytes. At a concentration of 100 µg/ml, the alkaloid retroisosenine showed immunosuppressive effect.

Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

OpenAIRE

Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai

2014-01-01

Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...

Three new caespitose species of Senecio (Asteraceae, Senecioneae) from South Peru

NARCIS (Netherlands)

Montesinos, D.B.

2014-01-01

Three new species of the genus Senecio (Asteraceae, Senecioneae) belonging to S. ser. Suffruticosi subser. Caespitosi were discovered in the tributaries of the upper Tambo River, Moquegua Department, South Peru. Descriptions, diagnoses and discussions about their distribution, a table with the

Gastroprotective effect of Senecio candicans DC on experimental ulcer models.

Science.gov (United States)

Hariprasath, Lakshmanan; Raman, Jegadeesh; Nanjian, Raaman

2012-03-06

Senecio candicans DC (Asteraceae) is used as a remedy for gastric ulcer and stomach pain in the Nilgiris district, Tamil Nadu for which no scientific evidence exists. The present study was performed to evaluate the gastroprotective effects and acute oral toxicity of aqueous leaf extract of Senecio candicans (AESC) in experimental models. The antiulcerogenic activity of AESC was performed in two different ulcer models viz., pylorus-ligated model and ethanol-induced model using Wistar albino rats. Acute toxicity study was also performed to get information on the admissible dose for treatment of ulcer. Preliminary phytochemical screening of AESC was performed to find the active principles present, which are thus responsible for the antiulcerogenic activity. DPPH assay was performed to confirm the antioxidant activity of AESC. The acute toxicity study did not show any mortality up to 2500mg/kg b.w. of AESC. Both the ulcer models showed gastroprotective effect comparable to that of the standard Omeprazole. The results of antioxidant enzymes, histopathology sections, ATPase and mucus content of gastric secretion showed that several mechanisms are involved in the gastroprotective effect. The preliminary phytochemical screening revealed the presence of alkaloids, flavonoids and steroids in AESC. The DPPH assay confirmed the antioxidant activity of AESC. The traditional consumption of AESC for the treatment of gastric ulcer is thus true, the antioxidant constituents present in the extract plays a major role in the gastroprotective activity, but since Senecio species are known for the presence of pyrrolizidine alkaloids, a detailed study in future is required to describe the safe dose for a prolonged period. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

The toxicity of Senecio inaequidens DC.

Directory of Open Access Journals (Sweden)

A.F.P. Dimande

2007-06-01

Full Text Available This study was designed to confirm the toxicity of a plant implicated in an outbreak of poisoning of stock in Frankfort, Free State Province, South Africa. Cows died acutely after being introduced into a camp, where an abundant, green shrublet was noted to be heavily grazed. This plant was subsequently identified as Senecio inaequidens DC. (Asteraceae by the South African National Biodiversity Institute (SANBI. Extraction and chemical analyses for pyrrolizidine alkaloids (PAs in Senecio inaequidens revealed the presence of 4 different compounds, namely retrorsine and senecionine (known to be hepatotoxic and 2 unidentified compounds. The average total PA (free base plus N-oxide concentration in plant parts of S. inaequidens collected at Frankfort during the outbreak was 0.81 %, compared with the total alkaloid content in the dried, milled S. inaequidens plant material, collected 7 weeks after the outbreak, of only 0.18 %. Male Sprague-Dawley rats (n=4, aged 8-9 weeks, were dosed per os. Each rat received a different dose of the crude Senecio inaequidens extract, ranging from 0.049 mg/g body weight (b.w. to 0.25 mg/g b.w. No clinical signs were observed in the rat receiving the lowest dose. Rats receiving higher doses showed depression, an unsteady gait, pilo-erection and jaundice, which was particularly noticeable in the ears. Clinical chemistry evaluation revealed an increase in the activities of ALP (except Rat 4, AST and GGT in all animals. Total serum bilirubin, creatinine and urea concentrations were also elevated. All rats had low serum globulin concentrations with an A/G ratio above 1.2. Post mortem examination of the rats revealed marked hepatic lesions. Histopathologically, these changes were characterised by necrosis (variable in extent of the centrilobular and midzonal hepatocytes (but sparing the portal hepatocytes, with extensive haemorrhage and congestion. Proliferation of the bile ducts, fibrosis and oedema were also present

[A new eremophilane derivative from Senecio dianthus].

Science.gov (United States)

Han, He-Dong; Hu, Hai-Qing; Li, Yan; Wang, Xiao-Ling

2013-10-01

A new eremophilane derivative, 4,5,11-trimethyl-9( 10), 7 ( 11) -eremophiladien-8-keto-12-carboxylic acid-beta-D-glucopyranoside( which named dianthuside A) 1 and four known compounds, 5,7,4'-trihydroxy-flavonone-3-0-beta-D-glucoside (2), quercetin-3-0-beta-D-glucoside(3) ,hyperin(4) and rutin(5) have been isolated from the aerial part of Senecio dianthus. Their structures were elucidated by physicochemical properties and spectroscopic data analysis. Compounds 2, 4 and 5 were isolated from this plant for the first time.

Behavioral response of cave and surface Asellus aquaticus to water current

OpenAIRE

Dacar, Maja

2017-01-01

There are many questions regarding what influences the emergence of new species. Firstly and above all, is the appearance of differences within a certain specie, where a certain part is isolated from the group and continues its own evolution. One of these differences appear between the surface- and cave-dwelling Asellus aquaticus, as the ability to hold on to their surface. The discovery of these differences was carried out using a method of experiment, namely on the cave-dwelling Asellus ...

Senecio brasiliensis (Asteraceae poisoning in Murrah buffaloes in Rio Grande do Sul Intoxicação natural por Senecio brasiliensis (Asteraceae em bubalinos no Rio Grande do Sul

Directory of Open Access Journals (Sweden)

André M.R. Corrêa

2008-03-01

Full Text Available Thirteen (14.4% out of 90 Murrah buffaloes (Bubalus bubalis became ill after con-sumption of Senecio brasiliensis, and 11 (12.2% of them died. The buffaloes were kept in a highly Senecio brasiliensis infested area. The poisoning occurred in June-August 2006 on a farm in the county of Nova Prata, Rio Grande do Sul, southern Brazil. Clinical signs included weakness, apathy, progressive weight loss, permanent decubitus, and diarrhea. Necropsy was performed in 2 of the 11 buffaloes that died. The pathological findings were typical of poisoning by pyrrolizidine alkaloids. High infestation of pastures with S. brasiliensis, severe drought, and consequent starvation were the main epidemiological factors associated with the poisoning here described.Descreve-se a ocorrência de um surto de intoxicação espontânea por Senecio brasiliensis em búfalos Murrah (Bubalus bubalis em uma propriedade localizada no município de Nova Prata, Estado do Rio Grande do Sul, no período de junho a agosto de 2006. De um total de 90 búfalos, 13 adoeceram e 11 morreram. Os animais eram mantidos em áreas de pastoreio altamente infestadas por S. brasiliensis. Os principais sinais clínicos relatados foram letargia, apatia, emagrecimento progressivo, diarréia e decúbito permanente. Necropsia foi feita em dois dos 11 animais mortos. As lesões foram características de intoxicações por alcalóides pirrolizidínicos. A grande quantidade da planta, forte estiagem e desnutrição conseqüente foram os principais achados epidemiológicos associados com a mortalidade.

Pyrrolizidine alkaloids from seven wild-growing Senecio species in Serbia and Montenegro

Directory of Open Access Journals (Sweden)

BORIS M. MANDIC

2009-01-01

Full Text Available The genus Senecio (family Asteraceae is one of the largest in the world. It comprises about 1100 species which are the rich source of pyrrolizidine alkaloids. Plants containing pyrrolizidine alkaloids are among the most important sources of human and animal exposure to plant toxins and carcinogens. The pyrrolizidine alkaloids of seven Senecio species (S. erucifolius, S. othonnae, S. wagneri, S. subalpinus, S. carpathicus, S. paludosus and S. rupestris were studied. Fourteen alkaloids were isolated and their structures determined from spectroscopic data (1H- and 13C-NMR, IR and MS. Five of them were identified in S. erucifolius, four in S. othonnae, two in S. wagneri, four in S. subalpinus, two in S. carpathicus, three in S. paludosus and three in S. rupestris. Seven pyrrolizidine alkaloids were found for the first time in particular species. The results have chemotaxonomic importance. The cytotoxic activity and antimicrobial activity of some alkaloids were also studied.

Cloning, expression, purification, crystallization and preliminary X-ray analysis of Thermus aquaticus succinyl-CoA synthetase

International Nuclear Information System (INIS)

Joyce, Michael A.; Brownie, Edward R.; Hayakawa, Koto; Fraser, Marie E.

2007-01-01

Attempts to crystallize succinyl-CoA synthetase from the thermophile T. aquaticus were thwarted by proteolysis of the β-subunit and preferential crystallization of a truncated form. Crystals of the full-length enzyme were grown after the purification protocol was modified to include frequent additions of protease inhibitors. Succinyl-CoA synthetase (SCS) is an enzyme of the citric acid cycle and is thus found in most species. To date, there are no structures available of SCS from a thermophilic organism. To investigate how the enzyme adapts to higher temperatures, SCS from Thermus aquaticus was cloned, overexpressed, purified and crystallized. Attempts to crystallize the enzyme were thwarted by proteolysis of the β-subunit and preferential crystallization of the truncated form. Crystals of full-length SCS were grown after the purification protocol was modified to include frequent additions of protease inhibitors. The resulting crystals, which diffract to 2.35 Å resolution, are of the protein in complex with Mn 2+ -GDP

The incorporation of 14C-adenine into the oocytes of Asellus aquaticus as studied by autoradiography

NARCIS (Netherlands)

Broek, C.J.H. van den; Tates, A.D.

Asellus aquaticus females were injected with 8-14C-adenine, fixed after 3 hours and sectioned. In coated autoradiographs, the number of β-tracks from 14C were counted over nucleolus, nucleus and cytoplasm of the oocytes at various stages of their development. Incorporation into nucleolar RNA, being

Arbuscular mycorrhizal colonization, plant chemistry, and aboveground herbivory on Senecio jacobaea

NARCIS (Netherlands)

Reidinger, S.; Eschen, R.; Gange, A.C.; Finch, P.; Bezemer, T.M.

2012-01-01

Arbuscular mycorrhizal fungi (AMF) can affect insect herbivores by changing plant growth and chemistry. However, many factors can influence the symbiotic relationship between plant and fungus, potentially obscuring experimental treatments and ecosystem impacts. In a field experiment, we assessed AMF

Intoxicação natural por Senecio brasiliensis em equinos

Directory of Open Access Journals (Sweden)

Welden Panziera

Full Text Available RESUMO: Intoxicações por plantas do gênero Senecio representam uma importante causa de morte em animais de produção, sendo Senecio brasiliensis a espécie mais envolvida nos casos de intoxicação espontânea. Nesse trabalho, são descritos os aspectos epidemiológicos, clínicos e anatomopatológicos de um surto de intoxicação natural por Senecio brasiliensis em equinos. Dois equinos, de um total de dezoito, foram afetados. Os casos ocorreram em uma propriedade rural no município de São Martinho da Serra, Rio Grande do Sul, Brasil. Grande quantidade de exemplares de Senecio brasiliensis em estágio de brotação foi encontrada na área onde os equinos estavam. Os animais eram da raça Crioula, sendo uma égua com quatro anos e um potro com cinco meses. A égua apresentou evolução aguda da doença com duração de três dias e o potro evolução crônica de dois meses. As principais manifestações clínicas observadas em ambos os equinos incluíam apatia, anorexia, emagrecimento, desidratação e sinais neurológicos. Além disso, havia moderado edema subcutâneo na região ventral do abdômen e marcada icterícia nas mucosas ocular, oral e vulvar da égua e palidez das mucosas no potro. Na avaliação bioquímica do potro, havia acentuado aumento da atividade sérica da gamaglutamil transferase (119 U/L, aumento da fosfatase alcalina (434 U/L e hipoalbuminemia (2,1g/dL. No hemograma do mesmo, observou-se leve anemia normocítica e normocrômica (30% de hematócrito; VCM: 39,5 fL; HCM: 15,3pg. As alterações presentes em ambas as necropsias foram observadas principalmente no fígado, que estava difusamente aumentado de tamanho, escuro e firme. Na superfície de corte, observaram-se acentuação do padrão lobular e hemorragia. Histologicamente, no fígado dos equinos, havia graus variados de necrose coagulativa, hemorragia, fibrose, proliferação de ductos biliares, hepatomegalocitose e bilestase. Nas diferentes seções analisadas

Clinical and pathological aspects of chronic Senecio spp. poisoning in sheep

Directory of Open Access Journals (Sweden)

Paula R. Giaretta

2014-10-01

Full Text Available This paper describes an outbreak of chronic Senecio spp. poisoning in grazing sheep in Rio Grande do Sul, Brazil, causing the death of 10 out of 860 adult sheep. Eight sick ewes were euthanized and necropsied. Cattle from this farm were also affected. Clinical signs included progressive weight loss, apathy and photosensitization. Four out of seven tested sheep had increased gamma-glutamyl transferase serum activity and two of them presented serum elevation of alkaline phosphatase. At necropsy, three out of eight ewes presented slightly irregular toughened livers with multifocal nodules, two out of eight ewes had a whitish liver with thickened fibrotic Glisson's capsule partially adhered to the diaphragm, and three out of eight ewes had smooth and grossly normal livers. Necropsy findings attributed to liver failure included hydropericardium (7/8, ascites (5/8, icterus (2/8, hydrothorax (1/8, and edema of mesentery (1/8. The main hepatic histological findings that allowed the establishment of the diagnosis were megalocytosis, proliferation of bile ducts and fibrosis. Spongy degeneration was observed in the brains of all eight necropsied sheep and was more severe at the cerebellar peduncles, mesencephalon, thalamus, and pons. These are suggested as the portions of election to investigate microscopic lesions of hepatic encephalopathy in sheep with chronic seneciosis. The diagnosis of Senecio spp. poisoning was based on epidemiology, clinical signs, laboratory data, necropsy and histological findings.

Antibacterial screening of Rumex species native to the Carpathian Basin and bioactivity-guided isolation of compounds from Rumex aquaticus.

Science.gov (United States)

Orbán-Gyapai, Orsolya; Liktor-Busa, Erika; Kúsz, Norbert; Stefkó, Dóra; Urbán, Edit; Hohmann, Judit; Vasas, Andrea

2017-04-01

Plants belonging to the genus Rumex (family Polygonaceae) are used worldwide in traditional medicine for the treatment of various diseases caused by different microorganisms (e.g. bacteria-related dermatologic conditions, dysentery and enteritis). The present study focused on the antibacterial screening of Rumex species native to the Carpathian Basin, and isolation of compounds from one of the most efficient species, Rumex aquaticus. The antibacterial effects of n-hexane, chloroform and aqueous fractions of methanol extracts prepared from different parts of 14 Rumex species (R. acetosella, R. acetosa, R. alpinus, R. aquaticus, R. conglomeratus, R. crispus, R. hydrolapathum, R. obtusifolius subsp. obtusifolius, R. obtusifolius subsp. subalpinus, R. patientia, R. pulcher, R. scutatus, R. stenophyllus and R. thyrsiflorus) were investigated against Staphylococcus epidermidis, S. aureus, MRSA, Bacillus subtilis, Moraxella catarrhalis, Streptococcus pyogenes, S. pneumoniae, S. agalactiae, Pseudomonas aeruginosa, Escherichia coli and Klebsiella pneumoniae using the disc diffusion method. Mainly the n-hexane and chloroform extracts prepared from the roots of the plants displayed high antibacterial activity (inhibition zones>15mm) against one or more bacterial strains. The highly active extracts of the aerial part and root of R. aquaticus were subjected to a multistep separation procedure. 19 Compounds, among them naphthalenes (musizin, and its glucoside, torachrysone-glucoside, 2-methoxystypandrone), anthraquinones (emodin, chrysophanol, physcion, citreorosein, chrysophanol-8-O-glucoside), flavonoids (quercetin, quercetin-3,3'-dimethylether, isokaempferide, quercetin 3-O-arabinoside, quercetin 3-O-galactoside, catechin), stilbenes (resveratrol, piceid), and 1-stearoylglycerol were isolated from the plant. The antibacterial activities of isolated compounds were determined, and it was observed that especially naphthalenes exerted remarkable antibacterial effects against

Host range of Secusio extensa (Lepidoptera: Arctiidae), and potential for biological control of Senecio madagascariensis (Asteraceae)

Science.gov (United States)

M. M. Ramadan; K. T. Murai; T. Johnson

2010-01-01

Secusio extensa (Lepidoptera: Arctiidae) was evaluated as a potential biological control agent for Madagascar fireweed, Senecio madagascariensis (Asteraceae), which has invaded over 400 000 acres of rangeland in the Hawaiian Islands and is toxic to cattle and horses. The moth was introduced from southeastern Madagascar...

Contaminated sediments and bioassay responses of three macroinvertebrates, the midge larva Chironomus riparius, the water louse Asellus aquaticus and the mayfly nymph Ephoron virgo

NARCIS (Netherlands)

Lange, de H.J.; Haas, de E.M.; Maas, H.; Peeters, E.T.H.M.

2005-01-01

Bioassays are widely used to estimate ecological risks of contaminated sediments. We compared the results of three whole sediment bioassays, using the midge larva Chironomus riparius, the water louse Asellus aquaticus, and the mayfly nymph Ephoron virgo. We used sediments from sixteen locations in

Sesquiterpenes, flavonoids, shikimic acid derivatives and pyrrolizidine alkaloids from Senecio kingii Hook.

Science.gov (United States)

Ruiz-Vásquez, Liliana; Reina, Matías; López-Rodríguez, M; Giménez, Cristina; Cabrera, Raimundo; Cuadra, Pedro; Fajardo, Víctor; González-Coloma, Azucena

2015-09-01

Twenty-four compounds including eleven eremophilanolides (1-11), one eremophilane (13), five shikimic acid derivatives (14-18), six flavonoids (19-24), and the macrocyclic unsaturated pyrrolizidine alkaloid integerrimine (25) were isolated from Senecio kingii, an endemic species from the Magallanes Region (Chile). Compounds 3, 5, 6, 8-11 and 13-18 have not been previously reported as natural products. Their molecular structures were determined by NMR spectroscopic analysis and comparison with published NMR data. An X-ray-analysis of compound 3 has been performed. Their insecticidal and antifungal activities were tested, being compound 3 the strongest insect antifeedant. Compounds 6, 9 and 18 were moderate antifungals. Published by Elsevier Ltd.

Acute and chronic toxicity of cadmium to different life history stages of the freshwater crustacean Asellus aquaticus (L)

Energy Technology Data Exchange (ETDEWEB)

Green, D.W.J.; Williams, K.A.; Pascoe, D.

1986-09-01

Different life-history stages of the freshwater isopod crustacean Asellus aquaticus were exposed to a range of cadmium concentrations using a semi-static toxicity testing procedure. Median lethal concentrations (96-hr LC50) ranged from 80 ..mu..g Cd/L for juveniles to > 2000 ..mu..g Cd/L for embryos. Pre-treatment of eggs with cadmium did not increase their tolerance to the metal as juveniles. The responses of each stage are discussed in relation to the use of macroinvertebrate toxicity test data in predicting the hazardous effects of pollutants.

Pyrrolizidine alkaloid variation in Senecio vulgaris populations from native and invasive ranges

Science.gov (United States)

Nguyen, Viet-Thang; Ndihokubwayo, Noel; Ge, Jiwen; Mulder, Patrick P.J.

2017-01-01

Biological invasion is regarded as one of the greatest environmental problems facilitated by globalization. Some hypotheses about the invasive mechanisms of alien invasive plants consider the plant–herbivore interaction and the role of plant defense in this interaction. For example, the “Shift Defense Hypothesis” (SDH) argues that introduced plants evolve higher levels of qualitative defense chemicals and decreased levels of quantitative defense, as they are released of the selective pressures from specialist herbivores but still face attack from generalists. Common groundsel (Senecio vulgaris), originating from Europe, is a cosmopolitan invasive plant in temperate regions. As in other Senecio species, S. vulgaris contains pyrrolizidine alkaloids (PAs) as characteristic qualitative defense compounds. In this study, S. vulgaris plants originating from native and invasive ranges (Europe and China, respectively) were grown under identical conditions and harvested upon flowering. PA composition and concentration in shoot and root samples were determined using Liquid Chromatography-Tandem Mass Spectrometry (LC-MS/MS). We investigated the differences between native and invasive S. vulgaris populations with regard to quantitative and qualitative variation of PAs. We identified 20 PAs, among which senecionine, senecionine N-oxide, integerrimine N-oxide and seneciphylline N-oxide were dominant in the roots. In the shoots, in addition to the 4 PAs dominant in roots, retrorsine N-oxide, spartioidine N-oxide and 2 non-identified PAs were also prevalent. The roots possessed a lower PA diversity but a higher total PA concentration than the shoots. Most individual PAs as well as the total PA concentration were strongly positively correlated between the roots and shoots. Both native and invasive S. vulgaris populations shared the pattern described above. However, there was a slight trend indicating lower PA diversity and lower total PA concentration in invasive S. vulgaris

Pyrrolizidine alkaloid variation in Senecio vulgaris populations from native and invasive ranges

Directory of Open Access Journals (Sweden)

Dandan Cheng

2017-08-01

Full Text Available Biological invasion is regarded as one of the greatest environmental problems facilitated by globalization. Some hypotheses about the invasive mechanisms of alien invasive plants consider the plant–herbivore interaction and the role of plant defense in this interaction. For example, the “Shift Defense Hypothesis” (SDH argues that introduced plants evolve higher levels of qualitative defense chemicals and decreased levels of quantitative defense, as they are released of the selective pressures from specialist herbivores but still face attack from generalists. Common groundsel (Senecio vulgaris, originating from Europe, is a cosmopolitan invasive plant in temperate regions. As in other Senecio species, S. vulgaris contains pyrrolizidine alkaloids (PAs as characteristic qualitative defense compounds. In this study, S. vulgaris plants originating from native and invasive ranges (Europe and China, respectively were grown under identical conditions and harvested upon flowering. PA composition and concentration in shoot and root samples were determined using Liquid Chromatography-Tandem Mass Spectrometry (LC-MS/MS. We investigated the differences between native and invasive S. vulgaris populations with regard to quantitative and qualitative variation of PAs. We identified 20 PAs, among which senecionine, senecionine N-oxide, integerrimine N-oxide and seneciphylline N-oxide were dominant in the roots. In the shoots, in addition to the 4 PAs dominant in roots, retrorsine N-oxide, spartioidine N-oxide and 2 non-identified PAs were also prevalent. The roots possessed a lower PA diversity but a higher total PA concentration than the shoots. Most individual PAs as well as the total PA concentration were strongly positively correlated between the roots and shoots. Both native and invasive S. vulgaris populations shared the pattern described above. However, there was a slight trend indicating lower PA diversity and lower total PA concentration in

Chemical Diversity Investigation of Hepatotoxic Pyrrolizidine Alkaloids in Qianliguang (Senecio scandens and Related Species by UHPLC-QTOF-MS

Directory of Open Access Journals (Sweden)

Lin Zhu

2015-04-01

Full Text Available Objective: Qianliguang (Senecio scandens is a common Chinese medicinal herb. Qianliguang-containing herbal proprietary products are registered as over-the-counter remedies in China and exported to Western countries. The presence of hepatotoxic pyrrolizidine alkaloids (PAs has raised concerns about the safety of using Qianliguang and its products. The present study aims at investigation of different types of PAs present in Qianliguang collected from representative locations in China.

Reconstructing the anterior part of the nervous system of Gordius aquaticus (Nematomorpha, cycloneuralia) by a multimethodological approach.

Science.gov (United States)

Henne, Stephan; Friedrich, Frank; Hammel, Jörg U; Sombke, Andy; Schmidt-Rhaesa, Andreas

2017-01-01

The Nematomorpha (horsehair worms) and Nematoda (round worms) are sister taxa (together Nematoida) and closely related to Scalidophora (Priapulida, Kinorhyncha, Loricifera). To date, all species were assumed to possess a specific brain type, i.e., the "cycloneuralian" brain that forms a ring-shaped neuropil around the pharynx and is composed of anteriorly and posteriorly located somata. However, descriptions of the nematomorph nervous system are rare and somewhat variable, calling in to question the validity of the cycloneuralian condition. To clarify whether there is a typical cycloneuralian pattern in the nematomorph brain, we investigated the anterior end of Gordius aquaticus with different methods: histology, immunohistochemistry and micro-CT analysis. Three-dimensional reconstructions were made from histological serial sections. The brain is composed of a central neuropil and a ring-shaped structure with associated somata. The unpaired ventral nerve cord emerges from the posteroventral part of the brain. A pharynx/esophagus is absent. In addition to the brain, a peripheral nerve plexus was detected. In summary, we interpret the architecture of the brain as potentially derived from a cycloneuralian structure, but being highly modified. The central position of the neuropil is possibly a consequence of the reduction of the anterior intestinal system as a result of the parasitic lifestyle. The ring-shaped arrangement of the somata may be a remnant of a cycloneuralian arrangement, after the two rings of somata (= cycloneuralian condition) either fused or one ring was reduced to form one massive ring-shaped structure in G. aquaticus. J. Morphol. 278:106-118, 2017. ©© 2016 Wiley Periodicals,Inc. © 2016 Wiley Periodicals, Inc.

Anti-Inflammatory Activity and Composition of Senecio salignus Kunth

Science.gov (United States)

Pérez González, Cuauhtemoc; Serrano Vega, Roberto; González-Chávez, Marco; Zavala Sánchez, Miguel Angel; Pérez Gutiérrez, Salud

2013-01-01

We investigated the anti-inflammatory activity of Senecio salignus. This medicinal plant is often used in Mexico for the treatment of fever and rheumatism. Chloroform and methanol extracts of the plant were tested on 12-O-tetradecanoylphorbol-13-acetate- (TPA-) induced edema in mice ears. The methanol extract of the plant inhibited edema by 36 ± 4.4% compared with the control, while the chloroform extract exhibited an even greater level of inhibition (64.1%). The chloroform extract was then fractionated, and the composition of the active fraction was determined by GC-MS. The anti-inflammatory activity of this fraction was then tested on TPA-induced ear edema in mice, and we found that the active fraction could inhibit edema by 46.9%. The anti-inflammatory effect of the fraction was also tested on carrageenan-induced paw edema in rats at doses of 100 mg/kg; a 58.9 ± 2.8% reduction of the edema was observed 4 h after administration of carrageenan, and the effect was maintained for 5 h. PMID:23691512

High-level expression, secretion, and purification of the thermostable aqualysin I from Thermus aquaticus YT-1 in Pichia pastoris

DEFF Research Database (Denmark)

Oledzka, G.; Dabrowski, Slawomir; Kur, J.

2003-01-01

Aqualysin I is a heat-stable subtilisin-type serine protease which is secreted into the culture medium by Thermus aquaticus YT-1, an extreme thermophile. We report the high-level expression of an aqualysin I protein using its native signal sequence for secretion in the methylotrophic yeast, Pichia...... to that of the native enzyme. We also explored the possibility of secreting the GAP expressed aqualysin I in P. pastoris by in-frame fusion of the Saccharomyces cerevisiae alpha-factor secretion signal. However, the levels of secreted pro-aqualysin I particles were approximately 10 times lower, possibly...

Morphometry and Distribution of Senecio Nemorensis agg. Species (Asteraceae in Poland

Directory of Open Access Journals (Sweden)

Rola Kaja

2014-07-01

Full Text Available A morphometric analysis based on 316 herbarium specimens of Senecio nemorensis agg. indicated the occurrence of the following four species in Poland: S. germanicus Wallr., S. hercynicus Herborg, S. ovatus (G. Gaertn. et al. Willd. and S. ucranicus Hodálová. Principal component analysis (PCA, analysis of variance (ANOVA/Kruskal-Wallis test and canonical discriminant analysis (CDA were applied. Quantitative characters such as supplementary bract length, leaf base width, ligule length and the supplementary/involucral bract length ratio clearly discriminated taxa within S. nemorensis agg. Included is a distribution map of the investigated species based on the examined material, with particular emphasis on the course of the northeastern boundary of S. hercynicus and the northwestern boundary of S. ucranicus. Also given is a determination key for species within S. nemorensis agg. in Poland, together with morphological descriptions of particular species

Changes in plant defense chemistry (pyrrolizidine alkaloids) revealed through high-resolution spectroscopy

Science.gov (United States)

Carvalho, Sabrina; Macel, Mirka; Schlerf, Martin; Moghaddam, Fatemeh Eghbali; Mulder, Patrick P. J.; Skidmore, Andrew K.; van der Putten, Wim H.

2013-06-01

Plant toxic biochemicals play an important role in defense against natural enemies and often are toxic to humans and livestock. Hyperspectral reflectance is an established method for primary chemical detection and could be further used to determine plant toxicity in the field. In order to make a first step for pyrrolizidine alkaloids detection (toxic defense compound against mammals and many insects) we studied how such spectral data can estimate plant defense chemistry under controlled conditions. In a greenhouse, we grew three related plant species that defend against generalist herbivores through pyrrolizidine alkaloids: Jacobaea vulgaris, Jacobaea erucifolia and Senecio inaequidens, and analyzed the relation between spectral measurements and chemical concentrations using multivariate statistics. Nutrient addition enhanced tertiary-amine pyrrolizidine alkaloids contents of J. vulgaris and J. erucifolia and decreased N-oxide contents in S. inaequidens and J. vulgaris. Pyrrolizidine alkaloids could be predicted with a moderate accuracy. Pyrrolizidine alkaloid forms tertiary-amines and epoxides were predicted with 63% and 56% of the variation explained, respectively. The most relevant spectral regions selected for prediction were associated with electron transitions and Csbnd H, Osbnd H, and Nsbnd H bonds in the 1530 and 2100 nm regions. Given the relatively low concentration in pyrrolizidine alkaloids concentration (in the order of mg g-1) and resultant predictions, it is promising that pyrrolizidine alkaloids interact with incident light. Further studies should be considered to determine if such a non-destructive method may predict changes in PA concentration in relation to plant natural enemies. Spectroscopy may be used to study plant defenses in intact plant tissues, and may provide managers of toxic plants, food industry and multitrophic-interaction researchers with faster and larger monitoring possibilities.

Variación en la producción de alcaloides en inflorescencias de Senecio Grisebachii por deficiencia de nutrientes Alkaloid production changes due to nutrient deficiencies in Senecio Grisebachii inflorescences

Directory of Open Access Journals (Sweden)

Margarita A Yaber Grass

2009-06-01

Full Text Available Senecio grisebachii Baker es una maleza que invade pasturas naturales y cultivos en el sur de Brasil, Uruguay, y provincias mesopotámicas y Buenos Aires en la Argentina y es considerada tóxica debido a la presencia de alcaloides pirrolizidínicos (APs en sus tejidos. Se evaluó el efecto de la deficiencia de nitrógeno y de fósforo sobre el perfil de APs en inflorescencias de esta maleza. Se realizó un ensayo utilizando un diseño completamente aleatorizado con 10 repeticiones, en el cual las plantas, que crecieron en hidroponia desde mayo hasta octubre, fueron regadas con solución de nutrientes en las que las concentraciones de N o de P reducidas en un 50% respecto del control. La cuantificación de APs en las inflorescencias de S. grisebachii por CG y CG-EM, demuestra un aumento significativo en el contenido total de APs, en los tratamientos con déficit en N o P (1,33 y 1,34 mg g-1 de materia seca, respectivamente, comparados con el control 0,35 mg g-1. Se identificaron siete APs y sus concentraciones variaron entre tratamientos. Senecionina resultó el alcaloide mayoritario en el tratamiento déficit de N, mientras senecifilina resultó más abundante en los tratamientos control y con déficit de P, seguidos en todos los casos por integerrimina y cantidades menores de espartiodina, jacobina, jacozina y retrorsina.Senecio grisebachii Baker is a weed that invades natural pastures and crops in southern Brazil, Uruguay, the mesopotamic provinces and Buenos Aires in Argentina, and is considered to be toxic because of the presence of pyrrolizidine alkaloids (PAs in its tissues. The effects of nitrogen and phosphorus deficiency was evaluated on the APs patterns of the weed inflorescences. A completely randomized design with 10 repetitions was used in an experiment where plants growing in hydroponics from May to October were irrigated with a nutrient solution containing 50% P or N concentrations with respect to the control treatment. PAs

Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

Science.gov (United States)

Suo, Zucai

2014-01-01

Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

Comparison of the anti-inflammatory active constituents and hepatotoxic pyrrolizidine alkaloids in two Senecio plants and their preparations by LC-UV and LC-MS.

Science.gov (United States)

Chen, Pinghong; Wang, Yi; Chen, Lulin; Jiang, Wei; Niu, Yan; Shao, Qing; Gao, Lu; Zhao, Quancheng; Yan, Licheng; Wang, Shufang

2015-11-10

Two Senecio plants, Senecio cannabifolius Less. and its variety S. cannabifolius Less. var. integrifolius (Kiodz.) Kidam., were both used as the raw material of Feining granule, a traditional Chinese medicine product for treating respiratory diseases. In this study, the chemical profiles of these two plants were investigated and compared by liquid chromatography-mass spectrometry (LC-MS) and nuclear magnetic resonance (NMR). A total number of 83 constituents, including 55 organic acids, 11 flavonoids, 4 alkaloids, 3 terpenes and 10 other types of compounds, were characterized. The results indicated that the levels of most flavonoids were higher in S. cannabifolius than in S. cannabifolius var. integrifolius, however, the levels of hepatotoxic pyrrolizidine alkaloids (PAs) were higher in S. cannabifolius var. integrifolius than in S. cannabifolius. Fifteen constituents were evaluated on lipopolysaccharides (LPS) induced RAW 264.7 cells, and eleven of them showed inhibition effect against nitric oxide (NO) production. Finally, the levels of ten major constituents (including seven anti-inflammatory active ones) and two PAs in Feining granule from two Senecio plants were determined and compared by the LC-UV and LC-MS methods, respectively. It was found that one organic acid (homogentisic acid) and two PAs (seneciphylline and senecionine) had higher contents in the preparation of S. cannabifolius var. integrifolius than in that of S. cannabifolius, however, the situations were inverse for the levels of four organic acids and flavonoids (chlorogenic acid, hyperoside, isoquercitrin, and isochlorogenic acid B). Based on the above results, S. cannabifolius might be a better raw material for Feining granule than S. cannabifolius var. integrifolius, because it contained more anti-inflammatory constituents and less hepatotoxic PAs than the latter. However, more pharmacological evaluations should be carried out to support the selection. The results in this study were helpful

Chemical fingerprinting identifies Echium vulgare, Eupatorium cannabinum and Senecio spp. as plant species mainly responsible for pyrrolizidine alkaloids in bee-collected pollen.

Science.gov (United States)

Kast, Christina; Kilchenmann, Verena; Reinhard, Hans; Droz, Benoit; Lucchetti, Matteo Angelo; Dübecke, Arne; Beckh, Gudrun; Zoller, Otmar

2018-02-01

Various studies have shown that bee-collected pollen sold as nutritional supplements may contain toxic pyrrolizidine alkaloids (PAs) and, thus, pose a potential health risk for consumers. The level of contamination may vary according to its geographical and botanical origin. Here, the PA content of pollen produced in Switzerland was studied and 32 commercially available bee-collected pollen supplements produced between 2010 and 2014 were analysed. In addition, at what time period bees collect PA-containing pollen was investigated. Hence, this study looked into the occurrence of PAs in pollen samples collected daily during two-to-three consecutive seasons. Furthermore, the PA spectrum in pollen was compared to the spectrum found in flower heads of PA-plants to unambiguously identify plants responsible for PA contamination of pollen. The PA concentration of commercial and daily collected pollen was determined by target analysis using an HPLC-MS/MS system, allowing the detection of 18 different PAs and PA N-oxides found in the genera Echium, Eupatorium and Senecio, while the comparison of the PA spectrum in pollen and flower heads was performed by LC-HR-MS, allowing the detection of all PA types in a sample, including saturated, non-carcinogenic PAs. Of the commercially available pollen, 31% contained PAs with a mean concentration of 319 ng/g, mainly Echium- and Eupatorium-type PAs, while the PA concentrations were below the limit of quantitation (LOQ) in 69% of the pollen samples. Bees collected pollen containing Echium-type PAs mainly in June and July, while they gathered pollen containing Eupatorium-type PAs from mid-July to August. Senecio-type PAs appeared from June to September. Comparison of the PA array in pollen and plants identified E. vulgare and E. cannabinum as the main plants responsible for PA contamination of Swiss bee-collected pollen, and to a lesser extent also identified plants belonging to the genus Senecio.

Composition and evaluation of the antimicrobial activity of the essential oil of Senecio selloi Spreng DC.

Directory of Open Access Journals (Sweden)

G.N.S. Silva

2013-01-01

Full Text Available The essential oil of the aerial parts of Senecio selloi Spreng. DC. was extracted by hydrodistillation and analyzed by GC/MS. Nineteen compounds were identified, representing 99.9% of the total. The main compounds were found to be sesquiterpene hydrocarbons (71.3%, most of them with a bisabolane skeleton (59.4%. The major constituent was α-zingiberene (54%, followed by monoterpene α-isolimonene (16%. The essential oil was also tested against two Gram-positive and two Gram-negative bacterial species, three yeasts, and an algae. From the strains assayed, only Bacillus subtilis ATCC 6633 showed susceptibility (MIC and MBC = 4400 µg/mL to the essential oil.

PERFIL SOROLÓGICO EM EQUINOS INTOXICADOS EXPERIMENTALMENTE POR SENECIO BRASILIENSIS COMPOSITAE: PARTE II BILIRRUBINAS, ALBUMINAS E PROTEÍNAS

Directory of Open Access Journals (Sweden)

Sonia Terezinha dos Anjos Lopes

1994-01-01

Full Text Available RESUMO As parte aéreas dessecadas de senecio brasiliensis, colhidas no período de brotação, foram administradas a 14 equinos de raça mista, com idade de 4 a 22 anos e pesos de 230 a 475kg. A planta era misturada à ração dada aos animais ou moída, misturada em água e administrada por sonda nasoesofágica. Foram realizadas colheitas de sangue periodicamente nos 14 equinos para avaliação dos níveis séricos de bilirrubina, albumina e proteína. Oito cavalos desenvolveram a intoxicação, três morreram por causas outras e três sobreviveram sem apresentar quaisquer sinais clínicos durante o período em que foram observados. Nos animais que desenvolveram a doença os sinais clínicos tiveram evolução de um a seis dias e caracterizaram-se por anorexia, icterícia e distúrbios neurológicos. A bilirrubina total e indireta apresentam-se elevadas na fase terminal da intoxicação e a albumina e proteína mostram níveis abaixo dos valores de referência num equino que desenvolveu a forma crônica da enfermidade. Conclui-se que dentre as provas laboratoriais usadas, a bilirrubina indireta apresenta melhor indicação da alteração hepática causada por intoxicação pelo senecio brasiliensis.

Complete 1H NMR assignments of pyrrolizidine alkaloids and a new eudesmanoid from Senecio polypodioides.

Science.gov (United States)

Villanueva-Cañongo, Claudia; Pérez-Hernández, Nury; Hernández-Carlos, Beatriz; Cedillo-Portugal, Ernestina; Joseph-Nathan, Pedro; Burgueño-Tapia, Eleuterio

2014-05-01

Chemical investigation of the aerial parts of Senecio polypodioides lead to the isolation of the new eudesmanoid 1β-angeloyloxyeudesm-7-ene-4β,9α-diol (1) and the known dirhamnosyl flavonoid lespidin (3), while from roots, the known 7β-angeloyloxy-1-methylene-8α-pyrrolizidine (5) and sarracine N-oxide (6), as well as the new neosarracine N-oxide (8), were obtained. The structure of 1 and 8 was elucidated by spectral means. Complete assignments of the (1)H NMR data for 5, 6, sarracine (7), and 8 were made using one-dimensional and two-dimensional NMR experiments and by application of the iterative full spin analysis of the PERCH NMR software. Copyright © 2014 John Wiley & Sons, Ltd.

Toxicity of Heliotropium dolosum, Heliotropium circinatum, and Senecio vernalis in Parental Quail and Their Progeny, with Residue Evaluation of Eggs

OpenAIRE

ERÖKSÜZ, Yesari; ÇERİBAŞI, Ali Osman; ÇEVİK, Aydın; ERÖKSÜZ, Hatice

2014-01-01

In all, 160 Japanese quail (80 male and 80 female) were divided into 4 groups (3 test groups and 1 control group). The test groups were fed a diet containing aerial parts (leaves, stems, and flowers) of Senecio vernalis (SV group), Heliotropium dolosum (HD group), or Heliotropium circinatum (HC group) at the level of 30% for 6 weeks, and the control group was fed 0% in order to evaluate parental and progenial toxicity, along with the transference of alkaloid residues to their eggs. The pyrrol...

Flower colour modification of chrysanthemum by suppression of F3'H and overexpression of the exogenous Senecio cruentus F3'5'H gene.

Directory of Open Access Journals (Sweden)

Huang He

Full Text Available Chrysanthemum (Chrysanthemum × morifolium is one of the most important ornamental plants in the world. They are typically used as cut flowers or potted plants. Chrysanthemum can exhibit red, purple, pink, yellow and white flowers, but lack bright red and blue flowers. In this study, we identified two chrysanthemum cultivars, C × morifolium 'LPi' and C × morifolium 'LPu', that only accumulate flavonoids in their ligulate flowers. Next, we isolated seven anthocyanin biosynthesis genes, namely CmCHS, CmF3H, CmF3'H, CmDFR, CmANS, CmCHI and Cm3GT in these cultivars. RT-PCR and qRT-PCR analyses showed that CmF3'H was the most important enzyme required for cyanidin biosynthsis. To rebuild the delphinidin pathway, we downregulated CmF3'H using RNAi and overexpressed the Senecio cruentus F3'5'H (PCFH gene in chrysanthemum. The resultant chrysanthemum demonstrated a significantly increased content of cyanidin and brighter red flower petals but did not accumulate delphinidin. These results indicated that CmF3'H in chrysanthemum is important for anthocyanin accumulation, and Senecio cruentus F3'5'H only exhibited F3'H activity in chrysanthemum but did not rebuild the delphinidin pathway to form blue flower chrysanthemum.

Flower colour modification of chrysanthemum by suppression of F3'H and overexpression of the exogenous Senecio cruentus F3'5'H gene.

Science.gov (United States)

He, Huang; Ke, Hu; Keting, Han; Qiaoyan, Xiang; Silan, Dai

2013-01-01

Chrysanthemum (Chrysanthemum × morifolium) is one of the most important ornamental plants in the world. They are typically used as cut flowers or potted plants. Chrysanthemum can exhibit red, purple, pink, yellow and white flowers, but lack bright red and blue flowers. In this study, we identified two chrysanthemum cultivars, C × morifolium 'LPi' and C × morifolium 'LPu', that only accumulate flavonoids in their ligulate flowers. Next, we isolated seven anthocyanin biosynthesis genes, namely CmCHS, CmF3H, CmF3'H, CmDFR, CmANS, CmCHI and Cm3GT in these cultivars. RT-PCR and qRT-PCR analyses showed that CmF3'H was the most important enzyme required for cyanidin biosynthsis. To rebuild the delphinidin pathway, we downregulated CmF3'H using RNAi and overexpressed the Senecio cruentus F3'5'H (PCFH) gene in chrysanthemum. The resultant chrysanthemum demonstrated a significantly increased content of cyanidin and brighter red flower petals but did not accumulate delphinidin. These results indicated that CmF3'H in chrysanthemum is important for anthocyanin accumulation, and Senecio cruentus F3'5'H only exhibited F3'H activity in chrysanthemum but did not rebuild the delphinidin pathway to form blue flower chrysanthemum.

Reproductive features of the eastern mole (Scalopus aquaticus) and star-nose mole (Condylura cristata).

Science.gov (United States)

Bedford, J M; Mock, O B; Nagdas, S K; Winfrey, V P; Olson, G E

1999-11-01

Since moles are closely related to shrews, the gametes and reproductive tracts of the star-nose mole (Condylura cristata) and the eastern mole (Scalopus aquaticus) were examined to gain further insight into unusual reproductive traits of the Soricidae. Moles display many of these soricid traits, but with some important differences. The cumulus oophorus of Scalopus, ovulated about 16 h after hCG injection, was largely dispersed by hyaluronidase and, though quite dense, was nevertheless more similar to that of higher mammals than to the compact 'ball of the soricid cumulus. Within the female tract in these moles, approximately 85% of the length of the oviduct comprises a narrow ampulla with numerous differentiated crypts that, in shrews, house spermatozoa. However, in contrast to shrews, moles produce considerably larger numbers of spermatozoa, which challenges the proposal that, in shrews, oviductal sperm crypts specifically permit lower sperm production by the males. In the sperm head of these two moles, the acrosome displays the long rostrum that is typical of other Insectivora, and the perforatorium has the barbs by which soricid spermatozoa probably bind to the zona pellucida. Perhaps allied to this, immunoblots indicated that the immunoreactive acrosomal matrix of Scalopus spermatozoa is simpler than the polypeptide complex of the bovine and hamster acrosomal matrix.

Ornithine decarboxylase, polyamines, and pyrrolizidine alkaloids in senecio and crotalaria.

Science.gov (United States)

Birecka, H; Birecki, M; Cohen, E J; Bitonti, A J; McCann, P P

1988-01-01

When tested for ornithine and arginine decarboxylases, pyrrolizidine alkaloid-bearing Senecio riddellii, S. longilobus (Compositae), and Crotalaria retusa (Leguminosae) plants exhibited only ornithine decarboxylase activity. This contrasts with previous studies of four species of pyrrolizidine alkaloid-bearing Heliotropium (Boraginaceae) in which arginine decarboxylase activity was very high relative to that of ornithine decarboxylase. Unlike Heliotropium angiospermum and Heliotropium indicum, in which endogenous arginine was the only detectable precursor of putrescine channeled into pyrrolizidines, in the species studied here-using difluoromethylornithine and difluoromethylarginine as the enzyme inhibitors-endogenous ornithine was the main if not the only precursor of putrescine converted into the alkaloid aminoalcohol moiety. In S. riddellii and C. retusa at flowering, ornithine decarboxylase activity was present mainly in leaves, especially the young ones. However, other very young organs such as inflorescence and growing roots exhibited much lower or very low activities; the enzyme activity in stems was negligible. There was no correlation between the enzyme activity and polyamine or alkaloid content in either species. In both species only free polyamines were detected except for C. retusa roots and inflorescence-with relatively very high levels of these compounds-in which conjugated putrescine, spermidine, and spermine were also found; agmatine was not identified by HPLC in any plant organ except for C. retusa roots with rhizobial nodules. Organ- or age-dependent differences in the polyamine levels were small or insignificant. The highest alkaloid contents were found in young leaves and inflorescence.

Toxic pyrrolizidinalkaloids as undesired contaminants in food and feed: degradation of the PAs from Senecio jacobaea in silage.

Science.gov (United States)

Becerra-Jiminez, J; Kuschak, M; Roeder, E; Wiedenfeld, H

2013-07-01

Pyrrolizidine alkaloids (PAs) can show a hazardous potential for men and animals. They can act as cancerogenic, mutagenic, teratogenic and fetotoxic agents. One pathway of a human intoxication is its occurence as contaminants in food and feed. Here, the contamination of cereals already led to severe and fatal intoxication episodes. Besides this, milk is of special concern as it is the main food for children which show a very high susceptibility for a PA intoxication. Milk can contain PAs in case the milk producing animals have access to contaminated feed. In this context it is of special interest whether the PA content of contaminated silage remains stable during the ensiling procedure or show a more or less high level of decomposition. We could show that ensiling will not lead to PA-free silage.

Arbuscular Mycorrhizal Fungi and Plant Chemical Defence: Effects of Colonisation on Aboveground and Belowground Metabolomes.

Science.gov (United States)

Hill, Elizabeth M; Robinson, Lynne A; Abdul-Sada, Ali; Vanbergen, Adam J; Hodge, Angela; Hartley, Sue E

2018-02-01

Arbuscular mycorrhizal fungal (AMF) colonisation of plant roots is one of the most ancient and widespread interactions in ecology, yet the systemic consequences for plant secondary chemistry remain unclear. We performed the first metabolomic investigation into the impact of AMF colonisation by Rhizophagus irregularis on the chemical defences, spanning above- and below-ground tissues, in its host-plant ragwort (Senecio jacobaea). We used a non-targeted metabolomics approach to profile, and where possible identify, compounds induced by AMF colonisation in both roots and shoots. Metabolomics analyses revealed that 33 compounds were significantly increased in the root tissue of AMF colonised plants, including seven blumenols, plant-derived compounds known to be associated with AMF colonisation. One of these was a novel structure conjugated with a malonyl-sugar and uronic acid moiety, hitherto an unreported combination. Such structural modifications of blumenols could be significant for their previously reported functional roles associated with the establishment and maintenance of AM colonisation. Pyrrolizidine alkaloids (PAs), key anti-herbivore defence compounds in ragwort, dominated the metabolomic profiles of root and shoot extracts. Analyses of the metabolomic profiles revealed an increase in four PAs in roots (but not shoots) of AMF colonised plants, with the potential to protect colonised plants from below-ground organisms.

Antifungal and phytotoxic activity of essential oil from root of Senecio amplexicaulis Kunth. (Asteraceae) growing wild in high altitude-Himalayan region.

Science.gov (United States)

Singh, Rajendra; Ahluwalia, Vivek; Singh, Pratap; Kumar, Naresh; Prakash Sati, Om; Sati, Nitin

2016-08-01

This work was aimed to evaluate the essential oil from root of medicinally important plant Senecio amplexicaulis for chemical composition, antifungal and phytotoxic activity. The chemical composition analysed by GC/GC-MS showed the presence of monoterpene hydrocarbons in high percentage with marker compounds as α-phellandrene (48.57%), o-cymene (16.80%) and β-ocimene (7.61%). The essential oil exhibited significant antifungal activity against five phytopathogenic fungi, Sclerotium rolfsii, Macrophomina phaseolina, Rhizoctonia solani, Pythium debaryanum and Fusarium oxysporum. The oil demonstrated remarkable phytotoxic activity in tested concentration and significant reduction in seed germination percentage of Phalaris minor and Triticum aestivum at higher concentrations. The roots essential oil showed high yield for one of its marker compound (α-phellandrene) which makes it important natural source of this compound.

Intoxicação espontânea por Senecio brasiliensis (Asteraceae em ovinos no Rio Grande do Sul Spontaneous poisoning in sheep by Senecio brasiliensis (Asteraceae in southern Brazil

Directory of Open Access Journals (Sweden)

Marcia R. S. Ilha

2001-09-01

Full Text Available Descreve-se a ocorrência de um surto de intoxicação espontânea por Senecio brasiliensis em ovinos em um estabelecimento do município de Mata, Estado do Rio Grande do Sul, em meados de janeiro de 1997. De um total de 94 ovinos, 51 (54,25% animais adoeceram e 50 (53,2% morreram. Esse rebanho permaneceu durante aproximadamente 7 meses (de junho de 1996 a janeiro de 1997 em piquetes de pastagem nativa onde havia grande quantidade de S. brasiliensis. O quadro clínico manifestado pelos animais afetados consistia em fotossensibilização, emagrecimento progressivo, apatia, fraqueza, perturbações neurológicas como depressão, andar a esmo e desequilibrado, icterícia e hemoglobinúria. Houve melhora das lesões de pele naqueles ovinos que desenvolveram fotossensibilização hepatógena depois que foram retirados do sol. As principais lesões macroscópicas observadas em 9 dos 10 ovinos necropsiados incluíam fígado diminuído de tamanho, firme, difusamente marrom amarelado ou esverdeado, com quantidades variáveis de nódulos de 1-3 mm de diâmetro, bem circunscritos, salientes na cápsula, amarelados, distribuídos aleatoriamente por todo o parênquima. A vesícula biliar estava repleta e preenchida por bile verde escura e espessa. Havia também derrames cavitários (hidropericárdio e ascite. Crise hemolítica aguda fatal associada à intoxicação crônica hepatógena por cobre foi observada em cinco ovinos. Além das lesões hepáticas macroscópicas já mencionadas, foi observada icterícia generalizada da carcaça, rins tumefeitos, friáveis, difusamente escurecidos ou com fino pontilhado enegrecido; a urina era marrom escura (hemoglobinúria. As principais lesões microscópicas foram observadas no fígado e consistiam em hepatomegalocitose, proliferação de ductos biliares (hiperplasia ductal e fibrose periportal moderada acompanhada de infiltrado inflamatório mononuclear. Macrófagos carregados de pigmento acastanhado formavam

Chemical Composition of the Essential Oils of the Flowers, Leaves and Stems of Two Senecio polyanthemoides Sch. Bip. Samples from South Africa

Directory of Open Access Journals (Sweden)

Lawal A. Oladipupo

2009-06-01

Full Text Available The essential oils of the flowers, leaves and stems of Senecio polyanthemoides Sch. Bip. Samples collected from two different localities within the city of uMhlathuze, KwaZulu-Natal Province (South Africa were isolated by hydrodistillation and analyzed using GC and GC/MS. Twenty-six constituents were identified, representing an average of 86.0 - 99.6% of the total oil composition. The chemical profile reveals the dominance of monoterpenoid compounds, although some quantitative variance was noticed. The main constituents of the oils were limonene (3.1 – 43.0%, p-cymene (4.9-36.3%, β-selinene (1.3-32.7%, α-pinene (1.8-21.4%, β-pinene (7.6-16.5% and 1,8-cineole (9.3-11.4%, caryophyllene oxide (4.1-13.4% and humulene epoxide II (8.6-10.3%.

Role of disulphide bonds in a thermophilic serine protease aqualysin I from Thermus aquaticus YT-1.

Science.gov (United States)

Sakaguchi, Masayoshi; Takezawa, Makoto; Nakazawa, Rie; Nozawa, Kazutaka; Kusakawa, Taro; Nagasawa, Takeshi; Sugahara, Yasusato; Kawakita, Masao

2008-05-01

A thermophilic serine protease, Aqualysin I, from Thermus aquaticus YT-1 has two disulphide bonds, which are also found in a psychrophilic serine protease from Vibrio sp. PA-44 and a proteinase K-like enzyme from Serratia sp. at corresponding positions. To understand the significance of these disulphide bonds in aqualysin I, we prepared mutants C99S, C194S and C99S/C194S (WSS), in which Cys69-Cys99, Cys163-Cys194 and both of these disulphide bonds, respectively, were disrupted by replacing Cys residues with Ser residues. All mutants were expressed stably in Escherichia coli. The C99S mutant was 68% as active as the wild-type enzyme at 40 degrees C in terms of k(cat) value, while C194S and WSS were only 6 and 3%, respectively, as active, indicating that disulphide bond Cys163-Cys194 is critically important for maintaining proper catalytic site conformation. Mutants C194S and WSS were less thermostable than wild-type enzyme, with a half-life at 90 degrees C of 10 min as compared to 45 min of the latter and with transition temperatures on differential scanning calorimetry of 86.7 degrees C and 86.9 degrees C, respectively. Mutant C99S was almost as stable as the wild-type aqualysin I. These results indicate that the disulphide bond Cys163-Cys194 is more important for catalytic activity and conformational stability of aqualysin I than Cys67-Cys99.

Synthesis of [3,5-14C]trachelanthamidine and [5-3H]isoretronecanol and their incorporation into the retronecine moiety of riddelliine in Senecio riddellii

International Nuclear Information System (INIS)

Leete, E.; Rana, J.

1986-01-01

(+/-)-[3,5- 14 C]Trachelanthamidine and (+/-)-[5- 3 H]isoretronecanol, which are diastereomers, were prepared from potassium [ 14 C]cyanide and [5- 3 H]proline, respectively. These compounds and [1,4- 14 C]putrescine were administered to Senecio riddellii plants resulting in the formation of labeled riddelliine, in which almost all the radioactivity was located in its retronecine moiety. The activity of the beta-alanine obtained by degradation of the retronecine was consistent with specific labeling of this pyrrolizidine base at the expected positions. The extremely high absolute incorporation (15.1, 22.1%) of trachelanthamidine into riddelliine strongly favors this 1-hydroxymethylpyrrolizidine as the one on the main biosynthetic pathway to retronecine. The lower incorporation (0.75%) of isoretronecanol may represent a minor or aberrant pathway to retronecine

Intoxicação por Senecio brasiliensis em bezerros: padrão e evolução de lesões hepáticas

Directory of Open Access Journals (Sweden)

Welden Panziera

Full Text Available RESUMO: Intoxicações por plantas do gênero Senecio representam uma importante causa de morte em bovinos no Rio Grande do Sul e estima-se que mais de 50% das mortes causadas por plantas tóxicas devem-se à intoxicação por Senecio spp. Nesse trabalho, são descritos os aspectos epidemiológicos, clínicos e anatomopatológicos de um surto de intoxicação natural por Senecio brasiliensis em bezerros e a caracterização e evolução das lesões hepáticas durante o surto. Um lote com 206 bovinos, fêmeas, sem raça definida, foi desmamado com aproximadamente quatro meses de idade e soltos em campo nativo com 25 hectares, contendo grande quantidade de Senecio brasiliensis em diferentes estágios. Os bovinos permaneceram nesse campo durante três meses e posteriormente foram transferidos para outra área. Na nova área, seis bezerras, com idades entre sete a oito meses, começaram a apresentar sinais clínicos de emagrecimento, fraqueza, diarreia e edema subcutâneo de declive na região submandibular. Os seis bovinos morreram em um período de 15 dias e um deles foi necropsiado. Macroscopicamente, foi visualizado o primeiro dos três padrões distintos de lesão hepática dos bovinos desse surto, que se caracterizava por um fígado aumentado de tamanho, com os bordos arredondados e com superfície capsular e de corte alaranjada. Histologicamente havia acentuada degeneração vacuolar hepatocelular difusa, bilestase, megalocitose e leve proliferação de ductos biliares e fibrose periportal. Dois meses após o início do surto, constatou-se que em um período de 20 dias adoeceram mais 28 bezerras e, dessas, 14 morreram. Os bovinos acometidos nessa segunda visita tinham idades entre nove a 10 meses. O principal sinal clínico observado foi fotossensibilização, e incluía graus variados de fotofobia, lacrimejamento, salivação excessiva, descarga ocular mucopurulenta, secreção nasal e glossite diftérica ventral. Das 14 bezerras mortas

Diversity of pyrrolizidine alkaloids in native and invasive Senecio pterophorus (Asteraceae): implications for toxicity.

Science.gov (United States)

Castells, Eva; Mulder, Patrick P J; Pérez-Trujillo, Míriam

2014-12-01

Changes in plant chemical defenses after invasion could have consequences on the invaded ecosystems by modifying the interactions between plants and herbivores and facilitating invasion success. However, no comprehensive biogeographical studies have yet determined the phenotypic levels of plant chemical defenses, as consumed by local herbivores, covering large distributional areas of a species. Senecio pterophorus is a perennial shrub native to Eastern South Africa, expanded into Western South Africa and introduced into Australia and Europe. As other Asteraceae, S. pterophorus contains pyrrolizidine alkaloids (PAs) toxic to vertebrate and invertebrate herbivores. Here we analyzed S. pterophorus PAs by LC-MS/MS on foliage sampled across its entire distributional range, including the native and all non-native areas. PA concentrations and diversity was very high: we found 57 compounds belonging to 6 distinct necine base-types, including the highly toxic 1,2-unsaturated PAs (retronecine and otonecines) and the less toxic 1,2-saturated PAs (platynecine and rosmarinecines). Plants from different origins diverged in their PA absolute and relative concentrations. Rosmarinine was the most abundant compound in Australia and South Africa, but it was nearly absent in Europe. We characterized three plant chemotypes: retrorsine-senkirkine chemotype in Eastern South Africa, rosmarinine chemotype in Australia and Western South Africa, and acetylseneciphylline chemotype in Europe. PA absolute concentrations were highest in Australia. The increased absolute and relative concentrations of retronecine PAs from Australia and Europe, respectively, indicate that S. pterophorus is potentially more toxic in the invasive range than in the native range. Copyright © 2014 Elsevier Ltd. All rights reserved.

A survey of Senecio spp. affecting livestock in Uruguay and their associated pyrrolizidine alkaloid content

Directory of Open Access Journals (Sweden)

Juan Agustín García

2018-02-01

Full Text Available ABSTRACT: In Eastern Uruguay there has been a significant increase of seneciosis in grazing livestock with most affected localities related to counties neighboring the Brazilian border. A survey in 28 farms associated with poisoning outbreaks in grazing cattle in Eastern Uruguay was carried out. Fifty populations of Senecio plants were collected for alkaloid analysis and species identification. Four species were identified: S. oxyphyllus DC, S. madagascariensis Poir, S. brasiliensis (Spreng. Less., and S. selloi DC. Alkaloids were identified by a combination of GC-MS and HPLC-MS analysis and included: retrorsine in S. oxyphyllus; retrorsine, usaramine, and senecivernine/senecionine in S. selloi; retrorsine, senecivernine/senecionine, integerrimine, and usaramine in S. madagascariensis; and integerrimine, retrorsine and senecionine in S. brasiliensis. Total mean alkaloid concentration was reported to be highest in S. brasiliensis (17.6mg/g followed by S. oxyphyllus (6.2mg/g, S. selloi (1.8mg/g and S. madagascariensis (0.6mg/g. Alkaloid concentrations were also reported to be higher in 2015 vs. 2016 probably due to a common environmental factor. The species S. oxyphyllus and S. madagascariensis were not previously recognized as toxic plants in Eastern Uruguay. Particularly, S. oxyphyllus was present in 82% of the farms surveyed and occurred in high density with relative high concentrations of pyrrolizidine alkaloids suggesting S. oxyphyllus may be the main species involved in the reported outbreaks of seneciosis.

Synthesis of (3,5-/sup 14/C)trachelanthamidine and (5-/sup 3/H)isoretronecanol and their incorporation into the retronecine moiety of riddelliine in Senecio riddellii

Energy Technology Data Exchange (ETDEWEB)

Leete, E.; Rana, J.

1986-09-01

(+/-)-(3,5-/sup 14/C)Trachelanthamidine and (+/-)-(5-/sup 3/H)isoretronecanol, which are diastereomers, were prepared from potassium (/sup 14/C)cyanide and (5-/sup 3/H)proline, respectively. These compounds and (1,4-/sup 14/C)putrescine were administered to Senecio riddellii plants resulting in the formation of labeled riddelliine, in which almost all the radioactivity was located in its retronecine moiety. The activity of the beta-alanine obtained by degradation of the retronecine was consistent with specific labeling of this pyrrolizidine base at the expected positions. The extremely high absolute incorporation (15.1, 22.1%) of trachelanthamidine into riddelliine strongly favors this 1-hydroxymethylpyrrolizidine as the one on the main biosynthetic pathway to retronecine. The lower incorporation (0.75%) of isoretronecanol may represent a minor or aberrant pathway to retronecine.

METABOLISM OF TOXIC PYRROLIZIDINE ALKALOIDS FROM TANSY RAGWORT, SENECIO JACOBAEA, IN BOVINE RUMINAL FLUID UNDER ANAEROBIC CONDITIONS. (R825689C006)

Science.gov (United States)

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

The role of propagule pressure, genetic diversity and microsite availability for Senecio vernalis invasion.

Directory of Open Access Journals (Sweden)

Alexandra Erfmeier

Full Text Available Genetic diversity is supposed to support the colonization success of expanding species, in particular in situations where microsite availability is constrained. Addressing the role of genetic diversity in plant invasion experimentally requires its manipulation independent of propagule pressure. To assess the relative importance of these components for the invasion of Senecio vernalis, we created propagule mixtures of four levels of genotype diversity by combining seeds across remote populations, across proximate populations, within single populations and within seed families. In a first container experiment with constant Festuca rupicola density as matrix, genotype diversity was crossed with three levels of seed density. In a second experiment, we tested for effects of establishment limitation and genotype diversity by manipulating Festuca densities. Increasing genetic diversity had no effects on abundance and biomass of S. vernalis but positively affected the proportion of large individuals to small individuals. Mixtures composed from proximate populations had a significantly higher proportion of large individuals than mixtures composed from within seed families only. High propagule pressure increased emergence and establishment of S. vernalis but had no effect on individual growth performance. Establishment was favoured in containers with Festuca, but performance of surviving seedlings was higher in open soil treatments. For S. vernalis invasion, we found a shift in driving factors from density dependence to effects of genetic diversity across life stages. While initial abundance was mostly linked to the amount of seed input, genetic diversity, in contrast, affected later stages of colonization probably via sampling effects and seemed to contribute to filtering the genotypes that finally grew up. In consequence, when disentangling the mechanistic relationships of genetic diversity, seed density and microsite limitation in colonization of

The role of propagule pressure, genetic diversity and microsite availability for Senecio vernalis invasion.

Science.gov (United States)

Erfmeier, Alexandra; Hantsch, Lydia; Bruelheide, Helge

2013-01-01

Genetic diversity is supposed to support the colonization success of expanding species, in particular in situations where microsite availability is constrained. Addressing the role of genetic diversity in plant invasion experimentally requires its manipulation independent of propagule pressure. To assess the relative importance of these components for the invasion of Senecio vernalis, we created propagule mixtures of four levels of genotype diversity by combining seeds across remote populations, across proximate populations, within single populations and within seed families. In a first container experiment with constant Festuca rupicola density as matrix, genotype diversity was crossed with three levels of seed density. In a second experiment, we tested for effects of establishment limitation and genotype diversity by manipulating Festuca densities. Increasing genetic diversity had no effects on abundance and biomass of S. vernalis but positively affected the proportion of large individuals to small individuals. Mixtures composed from proximate populations had a significantly higher proportion of large individuals than mixtures composed from within seed families only. High propagule pressure increased emergence and establishment of S. vernalis but had no effect on individual growth performance. Establishment was favoured in containers with Festuca, but performance of surviving seedlings was higher in open soil treatments. For S. vernalis invasion, we found a shift in driving factors from density dependence to effects of genetic diversity across life stages. While initial abundance was mostly linked to the amount of seed input, genetic diversity, in contrast, affected later stages of colonization probably via sampling effects and seemed to contribute to filtering the genotypes that finally grew up. In consequence, when disentangling the mechanistic relationships of genetic diversity, seed density and microsite limitation in colonization of invasive plants, a clear

Floral biology of Senecio macrophyllus M. BIEB. (Asteraceae, a rare Central European steppe plant

Directory of Open Access Journals (Sweden)

Bożenna Czarnecka

2014-03-01

Full Text Available Knowledge of the flowering phase and plant pollination ecology is very important for understanding the life history of long-lived perennials. In the case of rare species, the information may have implications for conservation practices. Our studies on flower morphology and blooming biology of the vulnerable plant Senecio macrophyllus M. BIEB. were conducted in situ (flowering, activity of insect visitors in the largest population in SE Poland and in laboratory (light and scanning electron microscopy. The disc florets open diurnally with most intensive anthesis in the early afternoon and attract insect visitors with nectar and pollen. In highly protandrous disc florets, pollen viability decreases in time, whereas stigma receptivity increases. The upper part of the pistil forms a brush-like pollen presenter, covered with unicellular trichomes with chromoplasts. Pollen presentation lasts 4–11 hours per floret, and 8 days in a single head, the main function of which is to extend the availability of male gamets for reproduction. The number of florets per head, the head size, and the number of pollen grains produced per anther, and the pollen grain viability differed significantly between microsites. The finding indicates that, apart from the biotic factors, abiotic conditions may considerably influence generative reproduction of the species. In the study area, the principal visitors of S. macrophyllus flowers were Hymenoptera, with predominance of Apis mellifera (53.4% of visits. The remarkable share of butterflies (13.9% recognized as the long-distance moving insects may improve the genetic variability of individuals within a fragmented population. A more detailed study is necessary to explain the role of insect visitors in effective pollination and in gene transfer between patches. The assessment of optimal conditions for the generative reproduction is fundamental for the in situ conservation of this rare species.

Quantification of pyrrolizidine alkaloids in North American plants and honey by LC-MS: single laboratory validation.

Science.gov (United States)

Mudge, Elizabeth M; Jones, A Maxwell P; Brown, Paula N

2015-01-01

Pyrrolizidine alkaloids (PAs) are a class of naturally occurring compounds produced by many flowering plants around the World. Their presence as contaminants in food systems has become a significant concern in recent years. For example, PAs are often found as contaminants in honey through pollen transfer. A validated method was developed for the quantification of four pyrrolizidine alkaloids and one pyrrolizidine alkaloid N-oxide in plants and honey grown and produced in British Columbia. The method was optimised for extraction efficiency from the plant materials and then subjected to a single-laboratory validation to assess repeatability, accuracy, selectivity, LOD, LOQ and method linearity. The PA content in plants ranged from1.0 to 307.8 µg/g with repeatability precision between 3.8 and 20.8% RSD. HorRat values were within acceptable limits and ranged from 0.62 to 1.63 for plant material and 0.56-1.82 for honey samples. Method accuracy was determined through spike studies with recoveries ranging from 84.6 to 108.2% from the raw material negative control and from 82.1-106.0 % for the pyrrolizidine alkaloids in corn syrup. Based on the findings in this single-laboratory validation, this method is suitable for the quantitation of lycopsamine, senecionine, senecionine N-oxide, heliosupine and echimidine in common comfrey (Symphytum officinale), tansy ragwort (Senecio jacobaea), blueweed (Echium vulgare) and hound's tongue (Cynoglossum officinale) and for PA quantitation in honey and found that PA contaminants were present at low levels in BC honey.

Thermo-reversible inhibition makes aqualysin 1 from Thermus aquaticus a potent tool for studying the contribution of the wheat gluten network to the crumb texture of fresh bread.

Science.gov (United States)

Verbauwhede, Annelien E; Lambrecht, Marlies A; Fierens, Ellen; Hermans, Senne; Shegay, Oksana; Brijs, Kristof; Delcour, Jan A

2018-10-30

The thermo-active serine peptidase aqualysin 1 (Aq1) of Thermus aquaticus was applied in bread making to study the relative contribution of thermoset gluten to bread crumb texture. Aq1 is active between 30 °C and 90 °C with an optimum activity temperature of around 65 °C. It is inhibited by wheat endogenous serine peptidase inhibitors during dough mixing and fermentation and starts hydrolyzing gluten proteins during baking above 80 °C when the enzyme is no longer inhibited and most of the starch is gelatinized and contributes to structure formation. Aq1 activity reduced the molecular weight of gluten proteins and significantly increased their extractability in sodium dodecyl sulfate containing medium. While it had no impact on the specific bread volume and only limited impact on hardness, cohesiveness, springiness, resilience and chewiness, it impacted bread crumb coherence. We conclude that starch has a greater impact on crumb texture than thermoset gluten. Copyright © 2018 Elsevier Ltd. All rights reserved.

The influence of light spectra, UV-A, and growth regulators on the in vitro seed germination of Senecio cineraria DC.

Directory of Open Access Journals (Sweden)

Cristiane Pimentel Victório

2010-10-01

Full Text Available This study was carried out to investigate the effects of light spectra, additional UV-A, and different growth regulators on the in vitro germination of Senecio cineraria DC. Seeds were surface-sterilized and inoculated in MS medium to evaluate the following light spectra: white, white plus UV-A, blue, green, red or darkness. The maximum germinability was obtained using MS0 medium under white light (30% and MS + 0.3 mg L-1 GA3 in the absence of light (30.5%. S. cineraria seeds were indifferent to light. Blue and green lights inhibited germination. Different concentrations of gibberellic acid (GA3 (0.1; 0.4; 0.6; 0.8; 1.0 and 2.0 mg L-1 and indole-3-acetic acid IAA (0.1; 0.3 and 1.0 mg L-1 were evaluated under white light and darkness. No concentration of GA3 enhanced seed germination percentage under white light. However, when the seeds were maintained in darkness, GA3 improved germination responses in all tested concentrations, except at 1.0 mg L-1. Under white light, these concentrations also increased the germination time and reduced germination rate. Germination rate, under light or darkness, was lower using IAA compared with GA3.

Tahibacter aquaticus gen. nov., sp. nov., a new gammaproteobacterium isolated from the drinking water supply system of Budapest (Hungary).

Science.gov (United States)

Makk, Judit; Homonnay, Zalán G; Kéki, Zsuzsa; Lejtovicz, Zsuzsanna; Márialigeti, Károly; Spröer, Cathrin; Schumann, Peter; Tóth, Erika M

2011-04-01

Three Gram-stain negative, aerobic, non-motile, non-spore-forming, rod-shaped bacterial strains, PYM5-11(T), RaM5-2 and PYM5-8, were isolated from the drinking water supply system of Budapest (Hungary) and their taxonomic positions were investigated by a polyphasic approach. All three strains grew optimally at 20-28°C and pH 5-7 without NaCl. The G+C content of the DNA of the type strain was 65.4mol%. On the basis of 16S rRNA gene sequence analysis, the isolates showed 94.5-94.9% sequence similarity to the type strain of Dokdonella koreensis and a similarity of 93.0-94.1% to the species of the genera Aquimonas and Arenimonas. The major isoprenoid quinone of the strains was ubiquinone Q-8. The predominant fatty acids were iso-C(15:0), iso-C(17:1)ω9c, C(16:1)ω7c, and C(16:0). Diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine and phosphatidylmonomethylethanolamine, as well as several unidentified aminolipids and phospholipids were present. The 16S rRNA gene sequence analysis, the predominant fatty acids, the polar lipid composition, RiboPrint patterns, physiological and biochemical characteristics showed that the three strains were related but distinct from the type strains of the four recognized species of the genus Dokdonella, and indicated that the strains represented a new genus within the Gammaproteobacteria. The strain PYM5-11 (=DSM 21667(T)=NCAIM B 02337(T)) is proposed as the type strain of a new genus and species, designated as Tahibacter aquaticus gen. nov., sp. nov. Copyright © 2010 Elsevier GmbH. All rights reserved.

Transcriptomics and metabolite analysis reveals the molecular mechanism of anthocyanin biosynthesis branch pathway in different Senecio cruentus cultivars

Directory of Open Access Journals (Sweden)

Xuehua Jin

2016-09-01

Full Text Available The cyanidin (Cy, pelargonidin (Pg and delphinidin (Dp pathways are the three major branching anthocyanin biosynthesis pathways that regulate flavonoid metabolic flux and are responsible for red, orange and blue flower colors, respectively. Different species have evolved to develop multiple regulation mechanisms that form the branched pathways. In the current study, five Senecio cruentus cultivars with different colors were investigated. We found that the white and yellow cultivars do not accumulate anthocyanin and that the blue, pink and carmine cultivars mainly accumulate Dp, Pg and Cy in differing densities. Subsequent transcriptome analysis determined that there were 43 unigenes encoding anthocyanin biosynthesis genes in the blue cultivar. We also combined chemical and transcriptomic analyses to investigate the major metabolic pathways that are related to the observed differences in flower pigmentation in the series of S. cruentus. The results showed that mutations of the ScbHLH17 and ScCHI1/2 coding regions abolish anthocyanin formation in the white and the yellow cultivars; the competition of the ScF3’H1, ScF3’5’H and ScDFR1/2 genes for naringenin determines the differences in branching metabolic flux of the Cy, Dp and Pg pathways. Our findings provide new insights into the regulation of anthocyanin branching and also supplement gene resources (including ScF3’5’H, ScF3’H and ScDFRs for flower color modification of ornamentals.

Teste de especificidade hospedeira de Phaedon confinis (Coleoptera, Chrysomelidae, um potencial agente de biocontrole de Senecio brasiliensis (Asteraceae.

Directory of Open Access Journals (Sweden)

Julianne Milléo

2011-07-01

Abstract. Senecio brasiliensis (Spreng. Less when ingested by cattle and horses, the plant causes seneciosis, a serious poisoning. Due to the great financial losses to cattle ranchers, controlling the plant using insects has become attractive. Systematic survey efforts have revealed that Phaedon confinis Klug causes serious damage to the plant, and may be a great biocontrol agent. The object was to extend the tests of host specificity to 52 plants using 1st larval instar and adult chrysomelid bettles. The insects were submitted to “no-choice” and “multiple-choice” tests. The following results were obtained: “NO-CHOICE” L1 – 52 plants tested: null 90.39%; negligible damage 5.77%; light 1.92%; and normal in only S. brasiliensis 1.92%, where 31.67% of larvae obtained an adult phase. “NO-CHOICE” ADULTS – 46 plants. Null damage was recorded in 82.60%; 13.04% showed negligible damage; 2.17% light; 2.17% normal in S. brasiliensis. The chysomelids oviposited during observation days only on S. brasiliensis leaves. 615 eggs were oviposited with 73.01% viability. “MULTIPLE CHOICE” LARVAE – nine plants tested. 66.67% null; 11.11% weak; 11.11% negligible damage; and 11.11% normal in S. brasiliensis. The results indicate that the normal diet, oviposition, survival and development of P. confinis is restricted to S. brasiliensis and corroborates its potential as a biocontrol agent.

Effect of Ultrafine Pulverization of Senecio Scandens on Growth, Immune System and Faecal Microorganisms in Piglets

Directory of Open Access Journals (Sweden)

J Yue1, CQ Lu1, HY Lin1, XN Wang, JQ Zheng1, JJ Chen1* and R Gooneratne2*

2016-11-01

Full Text Available There is increased interest in using naturally occurring compounds subjected to new technologies for enhancing pig nutrition to replace antibiotic usage in swine production. The effects of ultrafine pulverization on the size distribution, morphology of Senecio scandens Buch.-Ham., and the growth performance, serum immunity parameters and faecal microorganisms of piglets fed this powder were investigated. The size distribution and morphology of S. scandens were characterized by using a laser diffraction analyser and scanning electron microscopy respectively. Ninety Duroc×Landrace×Yorkshire piglets (average body weight of 10.43kg were randomly assigned to six treatments with three pens of five pigs per treatment. Group 1 (Control piglets were fed the basal diet only. Groups 2 to 5 were fed with the basal diet supplemented with ultrafine powder (median diameter [d0.5] of 8.89μm of S. scandens at 0.3, 0.6, 0.9, and 1.2% of the basal diet, respectively, for 30 days. For group 6, 1.2% of ordinary S. scandens powder (d0.5=88.59μm was added to the basal diet. Both S. scandens ordinary and ultrafine powder increased piglet body weight and reduced the feed to gain ratio, but the performance of piglets fed the ultrafine powder was better. In groups 4 to 6, the number of Escherechia coli in faeces and the diarrhoeal incidence were significantly lower (P<0.05 and the serum IgA, IgG, IgM contents significantly higher (P<0.05. Feeding S. scandens ultrafine powder in the diet improved piglet performance and the diet supplemented with 0.9% of the ultrafine powder was the most effective.

A validated high-performance liquid chromatography method with diode array detection for simultaneous determination of nine flavonoids in Senecio cannabifolius Less.

Science.gov (United States)

Niu, Tian-Zeng; Zhang, Yu-Wei; Bao, Yong-Li; Wu, Yin; Yu, Chun-Lei; Sun, Lu-Guo; Yi, Jing-Wen; Huang, Yan-Xin; Li, Yu-Xin

2013-03-25

A reversed phase high performance liquid chromatography method coupled with a diode array detector (HPLC-DAD) was developed for the first time for the simultaneous determination of 9 flavonoids in Senecio cannabifolius, a traditional Chinese medicinal herb. Agilent Zorbax SB-C18 column was used at room temperature and the mobile phase was a mixture of acetonitrile and 0.5% formic acid (v/v) in water in the gradient elution mode at a flow-rate of 1.0mlmin(-1), detected at 360nm. Validation of this method was performed to verify the linearity, precision, limits of detection and quantification, intra- and inter-day variabilities, reproducibility and recovery. The calibration curves showed good linearities (R(2)>0.9995) within the test ranges. The relative standard deviation (RSD) of the method was less than 3.0% for intra- and inter-day assays. The samples were stable for at least 96h, and the average recoveries were between 90.6% and 102.5%. High sensitivity was demonstrated with detection limits of 0.028-0.085μg/ml for flavonoids. The newly established HPLC method represents a powerful technique for the quality assurance of S. cannabifolius. Copyright © 2012 Elsevier B.V. All rights reserved.

Cell-Specific Expression of Homospermidine Synthase, the Entry Enzyme of the Pyrrolizidine Alkaloid Pathway in Senecio vernalis, in Comparison with Its Ancestor, Deoxyhypusine Synthase1

Science.gov (United States)

Moll, Stefanie; Anke, Sven; Kahmann, Uwe; Hänsch, Robert; Hartmann, Thomas; Ober, Dietrich

2002-01-01

Pyrrolizidine alkaloids (PAs) are constitutive plant defense compounds with a sporadic taxonomic occurrence. The first committed step in PA biosynthesis is catalyzed by homospermidine synthase (HSS). Recent evidence confirmed that HSS evolved by gene duplication from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of the eukaryotic translation initiation factor 5A. To better understand the evolutionary relationship between these two enzymes, which are involved in completely different biological processes, we studied their tissue-specific expression. RNA-blot analysis, reverse transcriptase-PCR, and immunolocalization techniques demonstrated that DHS is constitutively expressed in shoots and roots of Senecio vernalis (Asteraceae), whereas HSS expression is root specific and restricted to distinct groups of endodermis and neighboring cortex cells located opposite to the phloem. All efforts to detect DHS by immunolocalization failed, but studies with promoter-β-glucuronidase fusions confirmed a general expression pattern, at least in young seedlings of tobacco (Nicotiana tabacum). The expression pattern for HSS differs completely from its ancestor DHS due to the adaptation of HSS to the specific requirements of PA biosynthesis. PMID:12226485

Effects of copper on invertebrate–sediment interactions

International Nuclear Information System (INIS)

Hunting, E.R.; Mulder, C.; Kraak, M.H.S.; Breure, A.M.; Admiraal, W.

2013-01-01

Toxicants potentially decouple links between biodiversity and ecosystem processes. This study aimed to evaluate how toxicants affect invertebrate bioturbation and decomposition. Effects of copper on functionally distinct macrofaunal species (Asellus aquaticus and Tubifex spp.), decomposition (release of dissolved organic carbon, DOC) and Average Metabolic Response (AMR) and Community Metabolic Diversity (CMD) of bacteria were determined in 5-day microcosm experiments. Bioturbation was assessed as sediment redox potential (Eh) profiles. Concentration–response curves of the functional parameters DOC, and the faunal mediated AMR and CMD in the presence of Tubifex spp. depended on Tubifex spp. survival, i.e. similar EC 50 values for both endpoints. In contrast, functional parameters in the presence of A. aquaticus were more sensitive than survival. Sediment Eh-profiles showed that reduced decomposition was caused by reduced sediment reworking by A. aquaticus at sub-lethal copper concentrations. These observations hint at a decoupling of invertebrate community structure and ecosystem functioning upon stress. -- Highlights: •We compared invertebrate survival and functional responses to copper amendment. •Differential functional responses depending on invertebrate species. •Reduced functional responses with A. aquaticus at sub-lethal copper concentrations. •Sub-lethal copper concentrations reduced the bioturbating activities of A. aquaticus. •Stress decouples invertebrate community structure and ecosystem functioning. -- Sub-lethal copper concentrations reduced the bioturbating activities of A. aquaticus and invertebrate effects on decomposition, bacterial activity and community metabolic diversity

Effects of origin, seasons and storage under different temperatures on germination of Senecio vulgaris (Asteraceae seeds

Directory of Open Access Journals (Sweden)

Noel Ndihokubwayo

2016-08-01

Full Text Available Invasive plants colonize new environments, become pests and cause biodiversity loss, economic loss and health damage. Senecio vulgaris L. (Common groundsel, Asteraceae, a widely distributing cosmopolitan weed in the temperate area, is reported with large populations in the north–eastern and south–western part, but not in southern, central, or north-western parts of China. We studied the germination behavior of S. vulgaris to explain the distribution and the biological invasion of this species in China. We used seeds originating from six native and six invasive populations to conduct germination experiments in a climate chamber and under outdoor condition. When incubated in a climate chamber (15 °C, seeds from the majority of the populations showed >90% germination percentage (GP and the GP was equal for seeds with a native and invasive origin. The mean germination time (MGT was significantly different among the populations. Under outdoor conditions, significant effects of origin, storage conditions (stored at 4 °C or ambient room temperature, ca. 27 °C and seasons (in summer or autumn were observed on the GP while the MGT was only affected by the season. In autumn, the GP (38.6% was higher and the MGT was slightly longer than that in summer. In autumn, seeds stored at 4 °C showed higher GP than those stored at ambient room temperature (ca.27 °C, and seeds from invasive populations revealed higher GP than those from native populations. The results implied that the high temperature in summer has a negative impact on the germination and might cause viability loss or secondary dormancy to S. vulgaris seeds. Our study offers a clue to exploring what factor limits the distribution of S. vulgaris in China by explaining why, in the cities in South-East China and central China such as Wuhan, S. vulgaris cannot establish natural and viable populations.

Effects of origin, seasons and storage under different temperatures on germination of Senecio vulgaris (Asteraceae) seeds.

Science.gov (United States)

Ndihokubwayo, Noel; Nguyen, Viet-Thang; Cheng, Dandan

2016-01-01

Invasive plants colonize new environments, become pests and cause biodiversity loss, economic loss and health damage. Senecio vulgaris L. (Common groundsel, Asteraceae), a widely distributing cosmopolitan weed in the temperate area, is reported with large populations in the north-eastern and south-western part, but not in southern, central, or north-western parts of China. We studied the germination behavior of S. vulgaris to explain the distribution and the biological invasion of this species in China. We used seeds originating from six native and six invasive populations to conduct germination experiments in a climate chamber and under outdoor condition. When incubated in a climate chamber (15 °C), seeds from the majority of the populations showed >90% germination percentage (GP) and the GP was equal for seeds with a native and invasive origin. The mean germination time (MGT) was significantly different among the populations. Under outdoor conditions, significant effects of origin, storage conditions (stored at 4 °C or ambient room temperature, ca. 27 °C) and seasons (in summer or autumn) were observed on the GP while the MGT was only affected by the season. In autumn, the GP (38.6%) was higher and the MGT was slightly longer than that in summer. In autumn, seeds stored at 4 °C showed higher GP than those stored at ambient room temperature (ca.27 °C), and seeds from invasive populations revealed higher GP than those from native populations. The results implied that the high temperature in summer has a negative impact on the germination and might cause viability loss or secondary dormancy to S. vulgaris seeds. Our study offers a clue to exploring what factor limits the distribution of S. vulgaris in China by explaining why, in the cities in South-East China and central China such as Wuhan, S. vulgaris cannot establish natural and viable populations.

Experimental poisoning by Senecio brasiliensis in calves: quantitative and semi-quantitative study on changes in the hepatic extracellular matrix and sinusoidal cells Intoxicação experimental por Senecio brasiliensis em bovinos: estudo quantitativo e semi-quantitativo da matrix extracelular e de células sinusoidais do fígado

Directory of Open Access Journals (Sweden)

Márcia Bersane A.M. Torres

2008-01-01

Full Text Available Extracellular matrix plays an important role in chronic hepatic lesions and has been studied in experimental intoxication models. However in cattle, studies on chronic disease have focused on the hepatocellular damage and extracellular matrix (ECM changes are usually overlooked. There are no specific studies on the hepatic ECM in either normal or chronically damaged bovine liver. Thus an experimental model of hepatic toxicity model using Senecio brasiliensis poisoned calves was designed. Senecio brasiliensis contains pyrrolizidine alkaloids which cause either acute or chronic progressive dose dependent liver damage. Five calves were orally fed with 0.38g of dry leaves of S. brasiliensis/kg/day for 24 days. Liver needle biopsy specimens were obtained every 15 days for 60 days. Clinical signs of digestive complications appeared at 3rd week. One calf died on 45th day and four were evaluated up to 60th day. Biopsy samples were processed for routine light microscopy, immuno-histochemistry and transmission electron microscopy. From 30th day on progressive liver damage characterized by hepatocellular ballooning, necrosis, apoptosis and megalocytosis, centrilobular, pericellular and portal fibrosis were seen by light microscopy. Quantitative and semi-quantitative measurements of hepatic ECM components were performed before and after the onset of lesions. Morphometric analysis of total collagen and elastic fiber system was conducted. Total collagen and I and III collagen types progressively increased in throughout the liver of affected calves. Changes in location, amount and disposition of the elastic fiber system were also observed. Then numbers of Kupffer cells were significantly increased at 30th day and total numbers of sinusoidal cells were significantly increased at 45th and 60th days. Liver damage was progressive and irreversible even after the exposure to the plant was discontinued. Severe fibrotic lesions occurred mainly in portal tracts

Ecological differentiation, lack of hybrids involving diploids, and asymmetric gene flow between polyploids in narrow contact zones of Senecio carniolicus (syn. Jacobaea carniolica, Asteraceae)

Czech Academy of Sciences Publication Activity Database

Hülber, K.; Sonnleitner, M.; Suda, Jan; Krejčíková, J.; Schönswetter, P.; Schneeweiss, G. M.; Winkler, M.

2015-01-01

Roč. 5, č. 6 (2015), s. 1224-1234 ISSN 2045-7758 R&D Projects: GA ČR GB14-36079G Institutional support: RVO:67985939 Keywords : gene flow * hybridization * polyploidy Subject RIV: EF - Botanics Impact factor: 2.537, year: 2015

Asellus (Asellus) monticola en Iran (Crustacea, Isopoda, Asellota, Asellidae)

NARCIS (Netherlands)

Henry, Jean-Paul; Magniez, Guy

1996-01-01

Asellus (Asellus) monticola monticola Birstein, 1932 has been found in a spring in the extreme NW of Iran. Amplifications of the original description of this valid species, which is clearly distinct from A. aquaticus, are given. Contrary to A. aquaticus, A. monticola appears to be strongly endemic

NCBI nr-aa BLAST: CBRC-MLUC-01-1078 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MLUC-01-1078 ref|ZP_03497741.1| DNA internalization-related competence protein... ComEC/Rec2 [Thermus aquaticus Y51MC23] gb|EED09156.1| DNA internalization-related competence protein ComEC/Rec2 [Thermus aquaticus Y51MC23] ZP_03497741.1 0.005 32% ...

Asellus and Gammarus spp. (Crustacea) in changing environments: effects of acid stress and habitat permanence

Energy Technology Data Exchange (ETDEWEB)

Hargeby, A.

1993-03-01

The research underlying this thesis included laboratory and field studies on how acid stress affects the benthic crustaceans Asellus aquaticus L. and Gammarus pulex (L.). A laboratory chamber was constructed to study growth and survival of G. pulex during acid stress. Low pH (6.0) caused 64-92% mortality within three weeks and reduced growth rate and food conversion efficiency in surviving animals. In a field experiment along a pH gradient, the mortality of G. pulex increased below pH 6. The whole-body content of sodium and potassium was reduced in surviving individuals, indicating osmoregulatory disturbance. In Asellus aquaticus, mortality was not affected by pH within the tested range (4.3-7.5). Laboratory experiments showed that interspecific interactions between A. aquaticus and G. pulex can include both exploitative competition and predation by G. pulex on A. aquaticus. Effects of seasonal habitat alterations was studied in a lake by comparing invertebrate assemblages associated with two species of submerged macroalgae (Characea), one perennial and one senescent during autumn. (28 refs.).

Carcinogenic effects of riddelliine on P53 knockout mice

Science.gov (United States)

Riddelliine is a pyrrolizidine alkaloid found in Senecio riddellii and several other Senecio spp. Pyrrolizidine alkaloids are a group of over 600 toxins, found in more than 6,000 plants worldwide. As a result they are likely the most economically significant plant toxin in the world, affecting a wi...

Comparing arbuscular mycorrhizal communities of individual plants in a grassland biodiversity experiment

NARCIS (Netherlands)

Van de Voorde, T.F.J.; Van der Putten, W.H.; Gamper, H.A.; Hol, W.H.G.; Bezemer, T.M.

2010-01-01

Plants differ greatly in the soil organisms colonizing their roots. However, how soil organism assemblages of individual plant roots can be influenced by plant community properties remains poorly understood. We determined the composition of arbuscular mycorrhizal fungi (AMF) in Jacobaea vulgaris

Intoxicação experimental aguda por Senecio brasiliensis em ovinos e indução de resistência à intoxicação

Directory of Open Access Journals (Sweden)

Fabiane B. Grecco

2012-09-01

Full Text Available Ovinos são mais resistentes à intoxicação por Senecio spp. que bovinos e equinos. Para determinar se essa resistência é induzida pela ingestão de pequenas e repetidas doses da planta e se essa resistência é duradoura, foram realizados três experimentos com folhas e talos verdes de Senecio brasilienses. Para determinar a dose mínima que causa intoxicação aguda (experimento 1, foram administradas doses únicas de 60, 80, 90, 100 e 100g/kg de peso corporal (pc a cinco ovinos, respectivamente. Os animais que receberam 60 e 80 g/kg de pc de S. brasiliensis não adoeceram, porém o ovino que recebeu 80g/kg de pc apresentava fibrose e megalocitose discretas nas biópsias realizadas aos 90, 120 e 150 dias do término da administração da planta. Os ovinos que receberam 90 e 100g/kg de pc apresentaram anorexia, prostração, movimentos de pedalagem, dor abdominal e morte 12-48 horas após o aparecimento dos sinais clínicos. Na necropsia havia ascite, petéquias disseminadas e acentuação do padrão lobular hepático. Histologicamente havia necrose hemorrágica centro-lobular. No Experimento 2 a dose capaz de causar a intoxicação aguda foi fracionada e administrada em duas, cinco e 10 doses diárias para 3 ovinos, respectivamente. A dose tóxica fracionada não provocou sinais clínicos de intoxicação em nenhum dos ovinos, porém havia fibrose periportal e megalocitose moderadas nas biopsias realizadas aos 60 dias do término da administração da planta, as quais não evoluíram. O ovino que recebeu a dose fracionada em 10 administrações não apresentou lesões histológicas nas biópsias. Para determinar se os ovinos tornam-se resistentes à forma aguda da intoxicação (experimento 3, foram administradas doses diárias de 15g/kg de pc por 30 dias e 30g/kg de pc por 10 dias a quatro ovinos. No dia seguinte à última administração dois ovinos receberam a dose única de 100g/kg de pc de S. brasiliensis, mas não adoeceram nem

Extracción, caracterización y evaluación de la actividad antibacteriana del aceite esencial de Senecio graveolens Wedd (Wiskataya

Directory of Open Access Journals (Sweden)

Kiev Ochoa Pumaylle

2012-01-01

Full Text Available El objetivo del presente trabajo fue extraer, caracterizar y evaluar la actividad antibacteriana del aceite esencial de Senecio graveolens Wedd (Wiskataya frente a Escherichia coli y Staphylococcus aureus ATCC 29923. Las hojas y tallos se recolectaron a una altitud de 3800 m.s.n.m. en el distrito de Puquio, provincia de Lucanas, departamento de Ayacucho. El aceite esencial se obtuvo por destilación por arrastre con vapor de agua, a partir de las hojas y tallos desecados de S. graveolens, con rendimiento de 1,26 % (p/p. La muestra extraída fue caracterizada a través de ensayos físicos. La composición química del aceite se evaluó mediante cromatografía de gas con detector de masa (CG-SM. La actividad antibacteriana del aceite de S. graveolens se realizó por el método de difusión en agar en pocillos, utilizando cepas de microorganismos gram positivo como S. aureus y gram negativo como E. coli. La densidad del producto resultó 0,8755 g/ml a 20 ºC; índice de refracción 1,4726; índice de rotación 102°85’ y soluble en etanol; el cromatograma mostró componentes mayoritarios con un contenido de 52,39 % Sabineno, 8,20 % (+-4-careno, 7,11 % τ-terpineno, 6,74 % β-myrceno, 3,78 % 4-terpinenol, 3,67 % Pulegona. Los resultados mostraron actividad antibacteriana marcada y moderada, para S. aureus y E. coli, respectivamente, observándose formación de halos de inhibición para concentraciones del aceite esencial a 80, 90 y 100 %. El aceite esencial de S. graveolens se presenta con actividad antibacteriana promisoria.

Seneciosis in cattle associated with photosensitization

OpenAIRE

Giaretta,Paula R.; Panziera,Welden; Galiza,Glauco J.A.; Brum,Juliana S.; Bianchi,Ronaldo M.; Hammerschmitt,Márcia E.; Bazzi,Talissa; Barros,Claudio S.L.

2014-01-01

Senecio spp. poisoning is the main cause of cattle mortality in the central region of Rio Grande do Sul. This paper reports an outbreak of seneciosis in cattle with high prevalence of photosensitization, where 83 out of 162 cows (51.3%) presented this clinical sign. The outbreak occurred in September 2013, affecting adult cows that were held in a 205 hectare-pasture from April to October 2013 with abundant Senecio brasiliensis infestation. Main clinical signs were weight loss, excessive lacri...

CONTRIBUTIONS TO DISTRIBUTION OF TURKISH FRESHWATER ISOPODS (CRUSTACEA: ISOPODA

Directory of Open Access Journals (Sweden)

Belgin Çamur-Elipek

2016-11-01

Full Text Available This study was carried out to contribute to distribution of freshwater isopods in Marmara Region (including Gökçeada and Bozcaada islands of Turkey. For this aim, it was evaluated the material which was sampled during the years 1991, and 1998-2002 in a total of 37 localities from different water resources in the region. End of the study, it was observed that Asellus aquaticus (L. Racovitza, 1919 is a very common species in the area. Furthermore, subspecies and intersex forms belonging Asellus aquaticus were recorded in some localities.

Interspecific competition of early successional plant species in ex-arable fields as influenced by plant-soil feedback

OpenAIRE

Jing, Jingying; Bezemer, T. Martijn; Van der Putten, Wim H.

2015-01-01

Plant–soil feedback can affect plants that belong to the same (intraspecific feedback) or different species (interspecific feedback). However, little is known about how intra- and interspecific plant–soil feedbacks influence interspecific plant competition. Here, we used plants and soil from early-stage ex-arable fields to examine how intra- and interspecific plant–soil feedbacks affect the performance of 10 conditioning species and the focal species, Jacobaea vulgaris. Plants were grown alon...

Intoxicações em eqüinos no Brasil Intoxications in horses in Brazil

Directory of Open Access Journals (Sweden)

Franklin Riet-Correa

1998-12-01

Full Text Available Relatam-se algumas intoxicações descritas em eqüídeos no Brasil. Dentre as intoxicações por plantas, incluem-se: Senecio spp., Ateleia glazioviana, Crotalaria juncea, Equisetum spp., Pteridium aquilinum, Baccharis coridifolia, Senna occidentalis e Brachiaria spp.. Mencionam-se, também, as micotoxicoses causadas por Fusarium moniliforme, Claviceps purpurea e aflatoxinas, e as intoxicações por uréia, iodo, chumbo e inseticidas clorados.Toxic disease reported in horses in Brazil are reviewed. Intoxications by plants including: Senecio spp, Ateleia glazioviana, Crotalaria juncea, Equisetum spp., Pteridium aquilinum, Baccharis coridifolia, Senna occidentalis e Brachiaria spp. are described. Mycotoxicosis caused by Fusarium moniliforme, Claviceps purpurea and aflatoxins, and intoxications by urea, iodine, lead, chlorinated insecticides are also mentioned.

Isopoda Asellota de Turquie récoltés en 1987. Netherlands biospeleological explorations in Turkey, 5

NARCIS (Netherlands)

Henry, Jean-Paul; Magniez, Guy; Notenboom, Jos

1996-01-01

Asellus aquaticus is present in 19 of about 100 Turkish groundwater stations prospected during biospeleological explorations. All specimens of these stygophilic populations remain oculate, even though their integumental pigmentation is more or less reduced. Proasellus lykaonicus Argano & Pesce, 1978

Phytotoxicity Assessment of Certain Phytochemical Products Containing Pyrrolizidine Alkaloids

Directory of Open Access Journals (Sweden)

Cristina Șeremet Oana

2013-10-01

Full Text Available Introduction: Tussilago farfara (coltsfoot, Petasites hybridus (common butterbur, Senecio vernalis (eastern groundsel and Symphytum officinale (comfrey are species traditionally used in phytotherapy that besides the therapeutic compounds contain toxic pyrrolizidine alkaloids (PAs. The aim of the paper is to determine the total PAs content and the phytotoxicity of the above species. Material and methods: The quantitative determination of pyrrolizidine alkaloids is based on the stoichiometric reaction of protonated alkaloids with methyl orange. In acidic conditions the dye is released from the complex and its color is assessed spectrophotometrically using a linear regression curve of senecionine as a standard. The phytotoxicity was assessed by Triticum bioassay that studies the effect of the extracts (0.001-5.00%, w/v upon root elongation (inhibitory concentration - IC50 and on the karyokinetic film. Results: The highest amount of total PAs was found in Senecio vernalis (654.8 ± 35.96 μg/g dry plant and the lowest in Petasites hybridus. The lowest IC50 was found for Tussilago farfara followed by Petasites hybridus, Senecio vernalis, and Symphytum officinale. The results were supported by microscopic examination. Conclusions: The results of the spectrophotometric assay are consistent with the ones found in the literature. All extracts inhibited the elongation of the main root of wheat caryopses, however, no correlation between phytotoxicity and the PAs concentration could be emphasized

Simulating population recovery of an aquatic isopod: Effects of timing of stress and landscape structure

NARCIS (Netherlands)

Galic, N.; Baveco, H.; Hengeveld, G.M.; Thorbeck, P.; Bruns, E.; Brink, P.

2012-01-01

In agroecosystems, organisms may regularly be exposed to anthropogenic stressors, e.g. pesticides. Species' sensitivity to stress depends on toxicity, life-history, and landscape structure. We developed an individual-based model of an isopod, Asellus aquaticus, to explore how timing of stress events

Biological activity of some Patagonian plants.

Science.gov (United States)

Cuadra, Pedro; Furrianca, María; Oyarzún, Alejandra; Yáñez, Erwin; Gallardo, Amalia; Fajardo, Víctor

2005-12-01

Citotoxicity (inhibition of cell division in fertilized eggs of Loxechinus albus) and general toxicity (using embryos of Artemia salina) of plants belonging to the genera Senecio, Deschampsia, Alstroemeria, Anarthrophyllum, Chloraea and Geranium were investigated.

Sampling method, storage and pretreatment of sediment affect AVS concentrations with consequences for bioassay responses.

Science.gov (United States)

De Lange, H J; Van Griethuysen, C; Koelmans, A A

2008-01-01

Sediment treatment and sediment storage may alter sediment toxicity, and consequently biotic response. Purpose of our study was to combine these three aspects (treatment-toxicity-biotic response) in one integrated approach. We used Acid Volatile Sulfide (AVS) concentrations as a proxy of the disturbance of the sediment. AVS and Simultaneously Extracted Metal (SEM) concentrations were compared to bioassay responses with the freshwater benthic macroinvertebrate Asellus aquaticus. Storage conditions and sediment treatment affected AVS but not SEM levels. AVS can be used as a proxy for sediment disturbance. The best way to pretreat the sediment for use in a bioassay in order to maintain initial AVS conditions was to sample the sediment with an Ekman grab, immediately store it in a jar without headspace, and freeze it as soon as possible. In a survey using seven different sediments, bioassay responses of A. aquaticus were correlated with SEM and AVS characteristics.

Aportes a la Flora de Colombia: Estudios en Compuestas - VI

Directory of Open Access Journals (Sweden)

Díaz Piedrahíta Santiago

1986-12-01

Full Text Available Bajo este título se han publicado varios artículos en los cuales se han propuesto nuevas especies de asteráceas de los géneros Espeletia, Paragynoxys, Senecio y Verbesina; en esta ocasión se describe una especie de Senecio, novedad surgida en desarrollo de la revisión del material de herbario y preparación de los textos del tratamiento de las Cornpositae de la Flora de la Real Expedición Botánica del Nuevo Reino de Granada.  Se trata de una interesante especie sobresaliente por el color blanco de las flores femeninas y de la cual se conservan en los archivos del Real Jardín Botánico de Madrid, una bella lámina iluminada en color y una diagnosis.

Purification and Characterization of Taq Polymerase: A 9-Week Biochemistry Laboratory Project for Undergraduate Students

Science.gov (United States)

Bellin, Robert M.; Bruno, Mary K.; Farrow, Melissa A.

2010-01-01

We have developed a 9-week undergraduate laboratory series focused on the purification and characterization of "Thermus aquaticus" DNA polymerase (Taq). Our aim was to provide undergraduate biochemistry students with a full-semester continuing project simulating a research-like experience, while having each week's procedure focus on a single…

Rhamnolipid-producing thermophilic bacteria of species Thermus and Meiothermus

Czech Academy of Sciences Publication Activity Database

Řezanka, Tomáš; Siřišťová, L.; Sigler, Karel

2011-01-01

Roč. 15, č. 6 (2011), s. 697-709 ISSN 1431-0651 R&D Projects: GA ČR(CZ) GAP503/11/0215 Institutional research plan: CEZ:AV0Z50200510 Keywords : Thermus sp * T. aquaticus * Meiothermus ruber Subject RIV: EE - Microbiology, Virology Impact factor: 2.941, year: 2011

Vandbænkebidere og colibakterier

DEFF Research Database (Denmark)

Christensen, Sarah Christine; Nissen, Erling; Arvin, Erik

2011-01-01

På trods af at der lever småorganismer i stort set alle drikkevandssystemer verden over, ved vi meget lidt om, hvordan organismerne påvirker bakterievæksten i vandet. Det er ikke tidligere undersøgt om eksempelvis vandbænkebidere (Asellus aquaticus), der lever i danske drikkevandsdistributioner, er...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Growth of shredders on leaf litter biofilms: the effect of light intensity

NARCIS (Netherlands)

Franken, R.J.M.; Waluto, B.; Peeters, E.T.H.M.; Gardeniers, J.J.P.; Beijer, J.A.J.; Scheffer, M.

2005-01-01

1. The effect of light intensity on the decomposition of poplar (Populus nigra) leaves and growth of the shredders, Asellus aquaticus and Gammarus pulex, was studied in a laboratory experiment. The response was studied along a gradient of six light intensities of 0, 5, 23, 54, 97 and 156 ¿mol m -2

Host status of six major weeds to Meloidogyne chitwoodi and Pratylenchus penetrans, including a preliminary field survey concerning other weeds

NARCIS (Netherlands)

Kutywayo, V.; Been, T.H.

2006-01-01

A glasshouse experiment was carried out to investigate the host status of six important weeds in intensive agricultural cropping systems to Meloidogyne chitwoodi and Pratylenchus penetrans. Senecio vulgaris L., Capsella bursa-pastoris (L.) Medic. and Solanum nigrum L. were hosts of M. chitwoodi with

Rapid changes in genetic architecture of behavioural syndromes following colonization of a novel environment.

Science.gov (United States)

Karlsson Green, K; Eroukhmanoff, F; Harris, S; Pettersson, L B; Svensson, E I

2016-01-01

Behavioural syndromes, that is correlated behaviours, may be a result from adaptive correlational selection, but in a new environmental setting, the trait correlation might act as an evolutionary constraint. However, knowledge about the quantitative genetic basis of behavioural syndromes, and the stability and evolvability of genetic correlations under different ecological conditions, is limited. We investigated the quantitative genetic basis of correlated behaviours in the freshwater isopod Asellus aquaticus. In some Swedish lakes, A. aquaticus has recently colonized a novel habitat and diverged into two ecotypes, presumably due to habitat-specific selection from predation. Using a common garden approach and animal model analyses, we estimated quantitative genetic parameters for behavioural traits and compared the genetic architecture between the ecotypes. We report that the genetic covariance structure of the behavioural traits has been altered in the novel ecotype, demonstrating divergence in behavioural correlations. Thus, our study confirms that genetic correlations behind behaviours can change rapidly in response to novel selective environments. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.

Sampling method, storage and pretreatment of sediment affect AVS concentrations with consequences for bioassay responses

Energy Technology Data Exchange (ETDEWEB)

Lange, H.J. de [Aquatic Ecology and Water Quality Management Group, Wageningen University, Wageningen University and Research Centre, P.O. Box 8080, 6700 DD, Wageningen (Netherlands); Centre for Ecosystem Studies, Alterra, Wageningen University and Research Centre, P.O. Box 47, 6700 AA, Wageningen (Netherlands)], E-mail: marieke.delange@wur.nl; Griethuysen, C. van; Koelmans, A.A. [Aquatic Ecology and Water Quality Management Group, Wageningen University, Wageningen University and Research Centre, P.O. Box 8080, 6700 DD, Wageningen (Netherlands)

2008-01-15

Sediment treatment and sediment storage may alter sediment toxicity, and consequently biotic response. Purpose of our study was to combine these three aspects (treatment-toxicity-biotic response) in one integrated approach. We used Acid Volatile Sulfide (AVS) concentrations as a proxy of the disturbance of the sediment. AVS and Simultaneously Extracted Metal (SEM) concentrations were compared to bioassay responses with the freshwater benthic macroinvertebrate Asellus aquaticus. Storage conditions and sediment treatment affected AVS but not SEM levels. AVS can be used as a proxy for sediment disturbance. The best way to pretreat the sediment for use in a bioassay in order to maintain initial AVS conditions was to sample the sediment with an Ekman grab, immediately store it in a jar without headspace, and freeze it as soon as possible. In a survey using seven different sediments, bioassay responses of A. aquaticus were correlated with SEM and AVS characteristics. - Change in AVS is a good proxy for sediment disturbance and combined with SEM it can be used as a suitable predictor for biotic effects of sediment contamination.

Megalocitose de células luteínicas grandes de vacas prenhes com seneciose crônica

Directory of Open Access Journals (Sweden)

Adriano A. Krabbe

Full Text Available Diversas espécies de Senecio estão amplamente difundidas nas pastagens de propriedades rurais do Sul do Brasil. Criadores dessa região relatam quedas nos índices reprodutivos dos rebanhos bovinos, muitas vezes de causas não determinadas. Várias plantas tóxicas são capazes de causar alterações reprodutivas diretas e indiretas em bovinos em diversos países, incluindo o Brasil, no entanto seus mecanismos patogenéticos ainda são pouco compreendidos. O objetivo desse trabalho é descrever lesões ovarianas em vacas com seneciose crônica proveniente de propriedades rurais da mesorregião Sudoeste Rio-grandense. Foram estudados 21 casos positivos de seneciose crônica diagnosticados entre 2011 e 2014. O estudo revelou que a seneciose crônica é a principal causa de morte de bovinos adultos na região. Quatro vacas prenhes apresentaram lesões hepáticas clássicas da intoxicação por Senecio spp. Essas vacas tiveram seus ovários avaliados histologicamente e células luteínicas grandes (CLG desses ovários apresentavam megalocitose e pseudoinclusões nucleares. Algumas CLG apresentaram núcleos com até 23,69μm de diâmetro e o aumento no tamanho desses núcleos foi significativamente maior que os de vacas controle. Conclui-se que a intoxicação por Senecio spp. causa alterações ovarianas em vacas e é possível que a intoxicação cause perdas reprodutivas nos rebanhos bovinas da região.

Relaciones polen-vegetación de algunos taxa de la estepa patagónica (Argentina Pollen-vegetation relationships of some taxa from the Patagonian steppe (Argentina

Directory of Open Access Journals (Sweden)

LIDIA S. BURRY

2001-06-01

Full Text Available La aplicación de un análisis de regresión lineal simple a datos de lluvia de polen y de vegetación, en una zona de la Patagonia (Provincia de Chubut, Argentina permitió relacionar cuantitativamente los porcentajes de lluvia polínica y de cobertura de la vegetación para los taxa Poaceae, Papilionoideae, tipo Senecio y Mulinum spinosum. Se obtuvo un buen ajuste de las rectas de regresión para cada uno de los taxa considerados, con coeficientes de correlación r de Pearson altos para M. spinosum (0,82 y tipo Senecio (0,81 y coeficientes algo menores en el caso de Poaceae (0,66 y Papilionoideae (0,61. Estas regresiones permitieron inferir la presencia o ausencia de polen regional y el valor predictivo de la presencia de polen en ausencia de la vegetación que lo produce. Al respecto, la lluvia de polen estudiada incluye el aporte regional (excepto Papilionoideae aun cuando M. spinosum tiene una baja contribución. Esta sobrerrepresentación es atribuible al transporte de larga distancia, a través de los vientos que provienen del oeste. Estas relaciones cuantitativas nos permitirán extrapolar cambios vegetacionales pasados en estos taxa a partir de espectros de polen fósil para el área de estudioThe use of simple linear regression to data of pollen rain and vegetation cover in Patagonia (Province of Chubut, Argentina allowed us to develop quantitative relationships between modern pollen rain perecentages and vegetation cover for the taxa Poaceae, Papilionoideae, Senecio type, and Mulinum spinosum. The analysis revealed a good fit of data to regression lines for all taxa, with high Pearson r coefficient values in the case of M. spinosum (0.82 and Senecio type (0.81, and somewhat lower values in the case of Poaceae (0.66 and Papilionoideae (0.61. These regressions allowed us to infer the presence or absence of regional pollen and predict the quantity of pollen in the absence of the vegetation producing it. In this regard, the studied pollen

Intoxicação por alcaloides pirrolizidínicos em ruminantes e equinos no Brasil Poisoning by pyrrolizidine alkaloids in ruminants and horses in Brazil

Directory of Open Access Journals (Sweden)

Ricardo B. Lucena

2010-05-01

Full Text Available Casos de intoxicação por alcaloides pirrolizidínicos (APs em ruminantes e equinos foram investigados retrospectivamente através do acesso aos arquivos de dois laboratórios de diagnóstico veterinário no Sul e Nordeste brasileiro. Os dados obtidos foram comparados com aqueles retirados da literatura concernentes a surtos dessa toxicose no Brasil, onde ela é associada com a ingestão de plantas que contêm APs dos gêneros Senecio, Crotalaria e Echium. Formas aguda e crônica da toxicose foram encontradas. A doença aguda foi observada em associação com a ingestão de Crotalaria retusa em ovinos e caprinos. C. retusa e Senecio spp. também foram responsáveis pela intoxicação crônica em bovinos, equinos e ovinos. A intoxicação por APs é uma importante causa de morte em animais pecuários no Brasil. Essa é a principal causa de morte em bovinos na região Central do Rio Grande do Sul e uma das principais causas de morte em equinos na Paraíba. A epidemiologia, os sinais clínicos, a patologia e a importância da intoxicação por APs são descritos e discutidos.Cases of poisoning by pyrrolizidine alkaloids (PAs in ruminants and horses were surveilled retrospectively by accessing the files of two veterinary diagnostic laboratories in southern and northeastern Brazil. The data obtained were compared with those withdrawn from the literature and pertaining to outbreaks of the toxicosis in Brazil where it is associated with the ingestion of PAs-containing plants from the genera Senecio, Crotalaria and Echium. Acute and chronic forms of the toxicosis were encountered. Acute disease was observed in association with the ingestion of Crotalaria retusa in sheep and goats. C. retusa and Senecio spp. were also responsible for chronic poisoning in cattle, horses and sheep. PAs poisoning is an important cause of death in livestock in Brazil. It is the major cause of death in cattle in the Central region of Rio Grande do Sul and one of the major

Peroxiredoxins: A Model for a Self-Assembling Nanoscale System

Science.gov (United States)

2014-08-24

Introduction 24 Chapter Three describes the identification of a potential peroxiredoxin enzyme in the genome of the thermophilic bacterium Thermus...Discussion (TaqPrx) 80 3.9 Summary of results Comparison of the sequences of thermophilic peroxiredoxins showed that the enzyme reported by Logan and...well as that of the other two variants. A second enzyme was also examined, a thermophilic peroxiredoxin from the bacterium Thermus aquaticus. This

Environmental Impact Analysis Process. Final Environmental Impact Statement. Supersonic Flight Operations in the Reserve Military Operations Area, Holloman, New Mexico

Science.gov (United States)

1983-01-01

Juniper, one-seed Juniperus monosperma Juniper, rocky mountain Juniperus scopulorum Oak, Gambel Querqus gambeli Oak, gray Quercus grisea Oak, silverleaf... Quercus hypoleucoides Pine, Chihuahua (localized) Pinus leiophylla Pine, pinyon Pinus edulis Pine, ponderosa Pinus ponderosa Pine, southwestern white...stansburiana Currant, Golden Ribes aureum Grape, Canyon Vitis Arizonica Groundsel, Ragwort Senecio multicapitatus Morning Glory, Red Starflower Ipomea

The influence of sward competition on shoot growth and ...

African Journals Online (AJOL)

In each of two seasons the growth form of Senecio retrorsus plants in Natal Tall Grassveld differed in accordance with the degree of utilization of the grasses and thus the degree of competition offered. In rested veld the main stems of seedlings and mature plants were long and spindly while those in frequently clipped veld ...

Microplastic Effect Thresholds for Freshwater Benthic Macroinvertebrates

Science.gov (United States)

2018-01-01

Now that microplastics have been detected in lakes, rivers, and estuaries all over the globe, evaluating their effects on biota has become an urgent research priority. This is the first study that aims at determining the effect thresholds for a battery of six freshwater benthic macroinvertebrates with different species traits, using a wide range of microplastic concentrations. Standardized 28 days single species bioassays were performed under environmentally relevant exposure conditions using polystyrene microplastics (20–500 μm) mixed with sediment at concentrations ranging from 0 to 40% sediment dry weight (dw). Microplastics caused no effects on the survival of Gammarus pulex, Hyalella azteca, Asellus aquaticus, Sphaerium corneum, and Tubifex spp. and no effects were found on the reproduction of Lumbriculus variegatus. No significant differences in growth were found for H. azteca, A. aquaticus, S. corneum, L. variegatus, and Tubifex spp. However, G. pulex showed a significant reduction in growth (EC10 = 1.07% sediment dw) and microplastic uptake was proportional with microplastic concentrations in sediment. These results indicate that although the risks of environmentally realistic concentrations of microplastics may be low, they still may affect the biodiversity and the functioning of aquatic communities which after all also depend on the sensitive species. PMID:29337537

Pollination, biogeography and phylogeny of oceanic island bellflowers (Campanulaceae)

DEFF Research Database (Denmark)

Olesen, Jens Mogens; Alarcón, M.; Ehlers, Bodil

2012-01-01

. These examples of vertebrate pollination evolved independently on each island or archipelago. We discuss if these pollination systems have an island or mainland origin and when they may have evolved, and finally, we attempt to reconstruct the pollinator-interaction history of each species.......We studied the pollination biology of nine island Campanulaceae species: Azorina vidalii, Musschia aurea, M. wollastonii, Canarina canariensis, Campanula jacobaea, Nesocodon mauritianus, and three species of Heterochaenia. In addition, we compared C. canariensis to its two African mainland...... relatives C. eminii and C. abyssinica. We asked to what extent related species converge in their floral biology and pollination in related habitats, i.e. oceanic islands. Study islands were the Azores, Madeira, Canary Islands, Cape Verde, Mauritius, and Réunion. Information about phylogenetic relationships...

Aportaciones a la flora de Galicia, VIII

OpenAIRE

Gómez Vigide, F.; García Martínez, X.R.; Silva Pando, F.J.; González Domínguez, J.; Blanco Dios, J.B.; Rodríguez González, A.; Rial Pousa, S.; Álvarez Graña, D.; Caamaño Portela, J.L.; Pino Pérez, J.J.; Pino Pérez, R.

2006-01-01

Se citan 37 plantas de variado interés para la flora gallega. Se incluyen 8 novedades de carácter regional (Pteris incompleta Cav., Potentilla recta L., Myriophyllum spicatum L., Solanum sisymbrifolium Lam., Knautia integrifolia (L.) Bertol., Senecio inaequidens DC. Melica arrecta G. Kunze y Stipa clausa Trab.), 17 novedades provinciales (Vandenboschia speciosa (Willd.) G. Kunkel, Ranunculus bupleuroides Brot., Silene niceensis All., Armeria transmontana (Samp.) Lawr., Alcea rosea...

Toxicity tests based on predator-prey and competitive interactions between freshwater macroinvertebrates

Energy Technology Data Exchange (ETDEWEB)

Taylor, E.J.; Blockwell, S.J.; Pascoe, D. [Univ. of Wales Coll. of Cardiff (United Kingdom)

1994-12-31

Simple multi-species toxicity tests based on the predation of Daphnia magna Straus by Hydra oligactis (Pallas) and competition between Gammarus pulex (L.) and Asellus aquaticus (L.) were used to determine the effects of three reference chemicals. Criteria examined included functional responses; time to first captures; handling times (predator/prey systems) and co-existence and growth. The tests which proved most practicable and sensitive (lowest observed effects 0.1, 21, and 80 {micro}g/l for lindane, copper and 3,4 dichloroaniline, respectively) were: (1) predator-prey tests: determining changes in the size-structure of predated D. magna populations and (2) competition tests: measuring the feeding rate of G. pulex competing with A. aquaticus, using a bioassay based on the time-response analysis of the consumption of Artemia salina eggs. The concentration of a chemical which affected particular response criteria was fond to depend on the test system employed. Results of the tests indicated that effects were often not dose-related and that a given criterion could be variously affected by different test concentrations. The complex pattern of responses may be explained in terms of the differential sensitivity of the interacting species and perhaps subtle alteration in strategies. The sensitivity of the bioassay endpoints is compared to those of a range of single species tests, and their value for predicting the impact pollutants may have upon natural freshwater ecosystems is discussed.

Flavin-dependent monooxygenases as a detoxification mechanism in insects: new insights from the arctiids (lepidoptera.

Directory of Open Access Journals (Sweden)

Sven Sehlmeyer

2010-05-01

Full Text Available Insects experience a wide array of chemical pressures from plant allelochemicals and pesticides and have developed several effective counterstrategies to cope with such toxins. Among these, cytochrome P450 monooxygenases are crucial in plant-insect interactions. Flavin-dependent monooxygenases (FMOs seem not to play a central role in xenobiotic detoxification in insects, in contrast to mammals. However, the previously identified senecionine N-oxygenase of the arctiid moth Tyria jacobaeae (Lepidoptera indicates that FMOs have been recruited during the adaptation of this insect to plants that accumulate toxic pyrrolizidine alkaloids. Identification of related FMO-like sequences of various arctiids and other Lepidoptera and their combination with expressed sequence tag (EST data and sequences emerging from the Bombyx mori genome project show that FMOs in Lepidoptera form a gene family with three members (FMO1 to FMO3. Phylogenetic analyses suggest that FMO3 is only distantly related to lepidopteran FMO1 and FMO2 that originated from a more recent gene duplication event. Within the FMO1 gene cluster, an additional gene duplication early in the arctiid lineage provided the basis for the evolution of the highly specific biochemical, physiological, and behavioral adaptations of these butterflies to pyrrolizidine-alkaloid-producing plants. The genes encoding pyrrolizidine-alkaloid-N-oxygenizing enzymes (PNOs are transcribed in the fat body and the head of the larvae. An N-terminal signal peptide mediates the transport of the soluble proteins into the hemolymph where PNOs efficiently convert pro-toxic pyrrolizidine alkaloids into their non-toxic N-oxide derivatives. Heterologous expression of a PNO of the generalist arctiid Grammia geneura produced an N-oxygenizing enzyme that shows noticeably expanded substrate specificity compared with the related enzyme of the specialist Tyria jacobaeae. The data about the evolution of FMOs within lepidopteran insects

Sex Pheromone of the Cotton Mealybug, Phenacoccus solenopsis, with an Unusual Cyclobutane Structure.

Science.gov (United States)

Tabata, Jun; Ichiki, Ryoko T

2016-11-01

The cotton mealybug, Phenacoccus solenopsis, the distribution of which was formerly limited to Nearctic and Neotropical regions, recently invaded many countries in various regions including Asia, Africa, and the Pacific. More recently, P. solenopsis was newly recorded in Japan and is currently an emerging pest of agricultural crops. In this study, we determined the structure of a sex pheromone of P. solenopsis in order to develop an effective lure for monitoring this pest. From volatiles emitted by virgin adult females, we isolated a compound attractive to males. By means of coupled gas chromatography-mass spectrometry and nuclear magnetic resonance spectroscopy, we identified this as (2,2-dimethyl-3-isopropylidenecyclobutyl)methyl 3-methylbut-2-enoate. This compound was synthesized and shown to be attractive to male P. solenopsis. Analysis by gas chromatography using an enantioselective stationary phase and polarimetry analyses of the natural pheromone and synthetic enantiomers showed the natural compound to be the (R)-(-)-enantiomer. This compound is an ester of maconelliol, which has an unusual cyclobutane structure found in sex pheromones of other mealybug species, and senecioic acid, also found in the pheromones of other mealybug species. However, this is the first example of the ester of maconelliol and senecioic acid as a natural product.

Seneciosis in cattle associated with photosensitization

Directory of Open Access Journals (Sweden)

Paula R. Giaretta

2014-05-01

Full Text Available Senecio spp. poisoning is the main cause of cattle mortality in the central region of Rio Grande do Sul. This paper reports an outbreak of seneciosis in cattle with high prevalence of photosensitization, where 83 out of 162 cows (51.3% presented this clinical sign. The outbreak occurred in September 2013, affecting adult cows that were held in a 205 hectare-pasture from April to October 2013 with abundant Senecio brasiliensis infestation. Main clinical signs were weight loss, excessive lacrimation or mucopurulent ocular discharge, nasal serous discharge, ventral diphteric glossitis, crusts in the nose, teats, dorsum of ears, and vulva. Liver biopsy was performed in all the cows under risk; the histopathological findings in the liver biopsies consisted of fibrosis, megalocytosis, and biliary ductal proliferation and were present in 73.4% of the biopsied animals. Six cows had increased serum activity of gamma glutamyl transferase. Three affected cows were necropsied. The main necropsy findings were a hard liver, distended gall bladder, edema of the mesentery and abomasum. Liver histological changes in the necropsied cows were similar to those of the biopsied livers. Spongiosis was detected in the brain of necropsied cows and is characteristic of hepatic encephalopathy.

Nuevas citas de Asteraceae para la provincia de Catamarca (Argentina New records of Asteraceae for the province of Catamarca (Argentina

Directory of Open Access Journals (Sweden)

Susana E. Freire

2011-06-01

Full Text Available Se mencionan los siguientes nuevos registros de Asteráceas para la provincia de Catamarca, Argentina: Baccharis acaulis, B. boliviensis var. latifolia, B. flexuosa, B. glutinosa var. angustissima, B. stenophylla (Tribu Astereae, Eupatorium patens var. tomentosum (Tribu Eupatorieae, Cosmos bipinnatus, C. peucedanifolius var. peucedanifolius, Helianthus annuus (Tribu Heliantheae, Gamochaeta erythractis, G. longipedicellata, Gnaphalium lacteum, Tessaria integrifolia var. integrifolia (Tribu Inuleae, Chuquiraga ruscifolia (Tribu Mutisieae, Senecio crepidifolius, S. subulatus var. subulatus, Xenophyllum incisum var. incisum (Tribu Senecioneae. Se citan además el hábitat de los taxones y las provincias fitogeográficas que integran. Se propone una nueva combinación, Baccharis glutinosa Pers. var. angustissima (DC. Giuliano.The following Asteraceae are mentioned for the province of Catamarca: Baccharis acaulis, B. boliviensis var. latifolia, B. flexuosa, B. glutinosa var. angustissima, B. stenophylla (Tribe Astereae, Eupatorium patens var. tomentosum (Tribe Eupatorieae, Cosmos bipinnatus, C. peucedanifolius var. peucedanifolius, Helianthus annuus (Tribe Heliantheae, Gamochaeta erythractis, G. longipedicellata, Gnaphalium lacteum, Tessaria integrifolia var. integrifolia (Tribe Inuleae, Chuquiraga ruscifolia (Tribe Mutisieae, Senecio crepidifolius, S. subulatus var. subulatus, Xenophyllum incisum var. incisum (Tribe Senecioneae. The habitat and phytogeographic provinces of the taxa are mentioned. The following new combination is proposed: Baccharis glutinosa Pers. var. angustissima (DC. Giuliano.

Phenotypic plasticity in response to the social environment: effects of density and sex ratio on mating behaviour following ecotype divergence.

Directory of Open Access Journals (Sweden)

Kristina Karlsson

Full Text Available The ability to express phenotypically plastic responses to environmental cues might be adaptive in changing environments. We studied phenotypic plasticity in mating behaviour as a response to population density and adult sex ratio in a freshwater isopod (Asellus aquaticus. A. aquaticus has recently diverged into two distinct ecotypes, inhabiting different lake habitats (reed Phragmites australis and stonewort Chara tomentosa, respectively. In field surveys, we found that these habitats differ markedly in isopod population densities and adult sex ratios. These spatially and temporally demographic differences are likely to affect mating behaviour. We performed behavioural experiments using animals from both the ancestral ecotype ("reed" isopods and from the novel ecotype ("stonewort" isopods population. We found that neither ecotype adjusted their behaviour in response to population density. However, the reed ecotype had a higher intrinsic mating propensity across densities. In contrast to the effects of density, we found ecotype differences in plasticity in response to sex ratio. The stonewort ecotype show pronounced phenotypic plasticity in mating propensity to adult sex ratio, whereas the reed ecotype showed a more canalised behaviour with respect to this demographic factor. We suggest that the lower overall mating propensity and the phenotypic plasticity in response to sex ratio have evolved in the novel stonewort ecotype following invasion of the novel habitat. Plasticity in mating behaviour may in turn have effects on the direction and intensity of sexual selection in the stonewort habitat, which may fuel further ecotype divergence.

Anti-tumor activity of polysaccharides extracted from Senecio ...

African Journals Online (AJOL)

*, Bao Zhang, Mingming Han, Xin Jin, Liyuan Sun and Tao Li. Department of ..... Yang J, Li X, Xue Y, Wang N, Liu W. Anti-hepatoma activity and mechanism of corn ... Peng W, Wu JG, Jiang YB, Liu YJ, Sun T, Wu N, Wu CJ. Antitumor activity of ...

The influence of intercrop plants and the date of their ploughing-in on weed infestation of root chicory (Cichorium intybus L. var. sativum (Bisch. Janch.

Directory of Open Access Journals (Sweden)

Marzena Błażewicz-Woźniak

2012-12-01

Full Text Available The field experiment was carried out in 2006-2008 in the Felin Experimental Farm (University of Life Sciences in Lublin on podzolic soil developed from dusty medium loam. Root chicory (Cichorium intybus L. var. sativum (Bisch. Janch. cv. Polanowicka was involved in the experiment. The experimental factors were 3 species of intercrop plants: common vetch (Vicia sativa, phacelia (Phacelia tanacetifolia, oat (Avena sativa and 2 dates of ploughing-in: pre-winter and spring. In total, 26 taxons characteristic for vegetable plantations were identified in chicory weed infestation. Monocarpic species dominated, among which Senecio vulgaris, Chenopodium album, Lamium amplexicaule, Galinsoga ciliata, and Capsella bursa-pastoris were predominant. The date of ploughing-in did not significantly affect the status and size of weed infestation of chicory plots. Short-lived species occurred after pre-winter ploughing-in, while perennial - after spring ploughing-in. The application of intercrops significantly reduced chicory weed infestation as compared to the cultivation with no intercrop. The ploughing-in of Avena sativa biomass appeared to be the most efficient. The intercrop plants reduced the occurrence of Senecio vulgaris and Capsella bursa-pastoris which were the most numerous in the treatment without intercrops. Biomass of Vicia sativa favored the growth of Chenopodium album and Lamium amplexicaule. The secondary weed infestation did not depend on agrotechnical factors applied during the experiment.

Surto de aflatoxicose em bezerros no Rio Grande do Sul Outbreak of aflatoxicosis in calves in southern Brazil

Directory of Open Access Journals (Sweden)

Felipe Pierezan

2010-05-01

Full Text Available Um surto de aflatoxicose crônica é relatado em bezerros de raça leiteira. Quarenta bezerros holandeses machos de quatro meses de idade e aproximadamente 100kg eram mantidos em gaiolas individuais de 1,5 x 1,5m e alimentados com uma ração constituída por feno de alfafa, milho quebrado e substituto de leite. Seis bezerros (15% morreram após apresentar uma doença caracterizada por mau desenvolvimento geral, diarreia, pelagem áspera, dor abdominal, tenesmo, prolapso de reto e bruxismo. Alguns bezerros "deitavam e rolavam" no chão da gaiola. A duração do curso clínico, segundo observado pelos proprietários, foi de 2-3 dias; muitos terneiros desse lote que não morreram permaneceram pouco desenvolvidos. Três bezerros foram necropsiados. Os achados de necropsia incluíam fígado firme e castanho-claro, marcados hidrotórax e ascite, e edema do mesentério, mesocólon e das dobras da mucosa do abomaso. Os principais achados histopatológicos estavam restritos ao fígado e consistiam de fibrose, moderada megalocitose, hiperplasia de ductos biliares e lesão veno-oclusiva. A procura por contaminação de Senecio spp. no feno de alfafa resultou negativa. A análise do milho do alimento dos bezerros por cromatografia de camada delgada revelou 5.136ppb de aflatoxina B1. O diagnóstico de aflatoxicose foi feito baseado nos sinais clínicos e patologia característicos, na ausência de Senecio spp. na alimentação dos terneiros e na presença de altos níveis de aflatoxina no milho da alimentação dos bezerros.An outbreak of chronic aflatoxicosis is reported in dairy calves. Forty 4-month-old male Holstein calves of approximately 100kg were kept in individual cages of 1.5 x 1.5m and were fed a ration constituted by alfalfa hay, broken corn and milk substitute. Six calves (15% died after presenting a disease characterized by general unthriftiness, diarrhea, rough hair coats, abdominal pain, prolapsed rectum, grinding of teeth, and lying down

Occupational dermatitis in Danish gardeners and greenhouse workers (III)

DEFF Research Database (Denmark)

Paulsen, Evy; Søgaard, Jes; Andersen, Klaus Ejner

1998-01-01

. The Compositae mix detected 2x as many as the SL mix, and the overall detection rate with both was 76%, making aimed patch testing necessary. Chrysanthemum (Dendranthema), marguerite daisy (Argyranthemum frutescens) and lettuce (Lactuca sativa) were frequent sensitizers. Occupational type I allergy to Compositae...... comprised sensitization to Gerbera, chrysanthemum, lettuce, Senecio cruentus and Aster. Among 1657 respondents in the questionnaire part of the study, 824 had worked with Compositae, and 160 (19%) reported occupational Compositae-related symptoms of skin and mucous membranes. Possible risk factors...

Mutational analysis of Escherichia coli elongation factor Tu in search of a role for the N-terminal region

DEFF Research Database (Denmark)

Mansilla, Francisco; Knudsen, Charlotte Rohde; Laurberg, M

1998-01-01

We have mutated lysine 2 and arginine 7 in elongation factor Tu from Escherichia coli separately either to alanine or glutamic acid. The aim of the work was to reveal the possible interactions between the conserved N-terminal part of the molecule, which is rich in basic residues and aminoacyl...... this activity. Furthermore, arginine 7 seems to play a role in regulating the binding of GTP. The three-dimensional structure of the ternary complex, EF-Tu:GTP:Phe-tRNAPhe, involving Thermus aquaticus EF-Tu and yeast Phe-tRNA(Phe), shows that Arg7 is in a position which permits salt bridge formation with Asp284...

Food-chain analysis (lead and cadmium) in free-living animal populations in the Saar area

Energy Technology Data Exchange (ETDEWEB)

Mueller, P.

1983-02-01

The populations and substrates involved in food webs are integrators of the burdening of areas and ecosystems. After several years of experiences my study group started continuous populations and residue analyses in Saarland (Aromatics, Heavy metals). It was shown that with the knowledge of the ecological variables, the analyses of soil types, of earth-worms (Lumbricidae), ground beetles (Carabidae), blackbirds (Turdus meruala), honey-bees (Apis mellifica), goshawks (Accipiter gentilis) and foxes (Vulpes vulpes) carried out at the same site yielded expecially useful area-related results. Heavy metal concentration (Pb, Cd) in leaves of Populus nigra, Physa acuta, Erprobdella octoculata, Asellus aquaticus, earthworms, Carabids, goshawks and foxes are presented.

Metal-resistant rhizobacteria isolates improve Mucuna deeringiana phytoextraction capacity in multi-metal contaminated soils from a gold mining area.

Science.gov (United States)

Boechat, Cácio Luiz; Giovanella, Patricia; Amorim, Magno Batista; de Sá, Enilson Luiz Saccol; de Oliveira Camargo, Flávio Anastácio

2017-01-01

Phytoremediation consists of biological techniques for heavy metal remediation, which include exploring the genetic package of vegetable species to remove heavy metals from the environment. The goals of this study were to investigate heavy metal and bioaugmentation effects on growth and nutrient uptake by Mucuna deeringiana; to determine the metal translocation factor and bioconcentration factor and provide insight for using native bacteria to enhance heavy metal accumulation. The experiment was conducted under greenhouse conditions using a 2 × 4 factorial scheme with highly and slightly contaminated soil samples and inoculating M. deeringiana with three highly lead (Pb +2 )-resistant bacteria Kluyvera intermedia (Ki), Klebsiella oxytoca (Ko), and Citrobacter murliniae (Cm) isolated from the rhizosphere of native plants identified as Senecio brasiliensis (Spreng.) Less., Senecio leptolobus DC., and Baccharis trimera (Less) DC., respectively. The increased heavy metal concentrations in soil samples do not decrease the root dry mass of M. deeringiana, concerning the number and dry weight of nodules. The shoot dry mass is reduced by the increasing concentration of heavy metals in soil associated with Kluyvera intermedia and Klebsiella oxytoca bacteria. The number of nodules is affected by heavy metals associated with Citrobacter murliniae bacteria. The bacteria K. intermedia, C. murliniae, and K. oxytoca increase the lead and cadmium available in the soil and enhanced metal uptake by Mucuna deeringiana. The M. deeringiana specie has characteristics that make it hyperaccumulate copper and zinc. The translocation and bioconcentration factors for M. deeringiana characterize it as a promising candidate to phytostabilize multi-metal contaminated soils.

Safety assessment of food and herbal products containing hepatotoxic pyrrolizidine alkaloids: interlaboratory consistency and the importance of N-oxide determination.

Science.gov (United States)

Cao, Yu; Colegate, Steven M; Edgar, John A

2008-01-01

Two recent mass spectrometry-based reports concerning Senecio scandens yielded remarkably dissimilar pyrrolizidine alkaloid constituents. In both studies, and in a related analysis of Senecio scandens and Tussilago farfara using micellar electrokinetic chromatography, the presence of hazardous N-oxides of the alkaloids was either not considered or was inadequately considered. This raises concerns about the effectiveness of the methodologies used in these, and similar, studies in assessing the pyrrolizidine alkaloid content and the safety of food, food supplements and medicines for human use. To highlight essential analytical requirements for confident assessment of pyrrolizidine alkaloid-related safety of food and herbal products for human use. Direct infusion-ESI MS and HPLC-ESI MS were used to analyse samples derived from liquid-liquid partitioning experiments and from strong cation exchange, solid-phase extraction of pyrrolizidine alkaloids and their N-oxides. A simple solvent partitioning experiment using pure senecionine and senecionine-N-oxide, two constituents reported in one of the mass spectrometry-based studies of S. scandens, clearly demonstrated the inadequacy of the reported method to detect and quantitate hazardous pyrrolizidine alkaloid N-oxide components. A preliminary LCMS analysis of commercially-prepared extracts of comfrey roots (Symphytum officinale and S. uplandicum s. l.) was used as a model to highlight the analytical importance of N-oxides in the safety assessment of pyrrolizidine alkaloid-containing medicinal herbs. This study highlighted significant differences in the reported identification of pyrrolizidine alkaloids from the same plant species, and clearly demonstrated the inadequacy of some procedures to include N-oxides in the assessment of pyrrolizidine alkaloid-related safety of food and herbal products.

The Analysis of Pyrrolizidine Alkaloids in Jacobaea vulgaris; a Comparison of Extraction and Detection Methods

NARCIS (Netherlands)

Joosten, L.; Mulder, P.P.J.; Vrieling, K.; Veen, van der M.R.; Klinkhamer, P.G.L.

2010-01-01

Introduction – Pyrrolizidine alkaloids (PAs) serve an important function in plant defence. Objective – To compare different extraction methods and detection techniques, namely gas chromatography with nitrogen phosphorus detection (GC-NPD) and liquid chromatography tandem mass spectrometry (LC-MS/MS)

Radioactive background in principal components of the Jihlava River ecosystem

International Nuclear Information System (INIS)

Stanek, Z.; Penaz, M.; Trnkova, J.; Wohlgemuth, E.

1980-01-01

In 1976 through to 1978, the radioactive background was investigated in the various components of the Jihlava River ecosystem. The investigations involved total β-activity, 40 K, residual β-activity, sup(nat)U, 226 Ra and, in some of the samples, also 210 Pb, 90 Sr and 137 Cs. The analyses included water, bottom sediments, samples of aquatic macrophytes (Batrachium fluitans), samples of aquatic invertebrates (Herpobdella octoculata, Anodonta cygnea, Asellus aquaticus, larval Ephemeroptera, larval Trichoptera, exuviae of pupae of Chironomidae) and samples of the tissues of 8 species of fishes (Salmo trutta m. fario, Cyprinus carpio, Rutilus rutilus, Leuciscus cephalus, Leuciscus leuciscus, Chondrostoma nasus, Gobio gobio, Barbus barbus). The activity of the radionuclides under study corresponded to the values reported for uncontaminated streams. (author)

2-[(1R*,4R*-1,4-Dihydroxycyclohexyl]acetic acid

Directory of Open Access Journals (Sweden)

Mohammad Arfan

2011-04-01

Full Text Available The title compound, C8H14O4, is an isolation product of the aerial parts of Senecio desfontanei. The acetic acid group is oriented at a dihedral angle of 48.03 (9° with respect to the basal plane of the cyclohexane-1,4-diol chair. An intramolecular O—H...O hydrogen bond generates an S(6 ring with an envelope conformation. In the crystal, molecules are linked by O—H...O hydrogen bonds, resulting in R33(20 ring motifs and C(2 O—H...O—H...O—H... chains. Overall, a three-dimensional polymeric network arises. A C—H...O contact is also present.

Predators and resources influence phosphorus transfer along an invertebrate food web through changes in prey behaviour.

Directory of Open Access Journals (Sweden)

Edoardo Calizza

Full Text Available Predators play a fundamental role in prey trophic behaviour, with indirect consequences for species coexistence and ecosystem functioning. Resource quality and availability also influence prey trophic behaviour, with potential effects on predator-prey dynamics. Although many studies have addressed these topics, little attention has been paid to the combined effects of predators and resources on prey species coexistence and nutrient transfer along food chains, especially in detritus-based systems. To determine the influence of predators and resource quality on the movement and P uptake of detritivores, we carried out a field experiment on the River Kelvin (Scotland using (32P to test the hypothesis of reduced prey vagility among resource patches as a strategy to avoid predation. Thirty leaf sacks containing alder leaves and two detritivore prey populations (Asellus aquaticus and Lymnaea peregra were placed in cages, half of them with two predator species (Dendrocoelum lacteum and Erpobdella octoculata and the other half without predators. Five alder leaf bags, each individually inoculated with a different fungus strain to simulate a patchy habitat, were placed inside each leaf sack. One bag in each sack was labelled with (32P, in order to assess the proportion of detritivores using it as food and thus their movement among the five resource patches. Three replicates for each labelled fungus and each predation treatment (i.e. with and without predators were left on the riverbed for 7 days. The presence of predators had negligible effects on the number of detritivores in the leaf bags, but it did reduce the proportion of (32P-labelled detritivores and their P uptake. The most strongly affected species was A. aquaticus, whose vagility, trophic overlap with L. peregra and P uptake were all reduced. The results confirm the importance of bottom-up and top-down forces acting simultaneously to regulate nutrient transfer along food chains in patchy

Coupling of anaerobic waste treatment to produce protein- and lipid-rich bacterial biomass

Science.gov (United States)

Steinberg, Lisa M.; Kronyak, Rachel E.; House, Christopher H.

2017-11-01

Future long-term manned space missions will require effective recycling of water and nutrients as part of a life support system. Biological waste treatment is less energy intensive than physicochemical treatment methods, yet anaerobic methanogenic waste treatment has been largely avoided due to slow treatment rates and safety issues concerning methane production. However, methane is generated during atmosphere regeneration on the ISS. Here we propose waste treatment via anaerobic digestion followed by methanotrophic growth of Methylococcus capsulatus to produce a protein- and lipid-rich biomass that can be directly consumed, or used to produce other high-protein food sources such as fish. To achieve more rapid methanogenic waste treatment, we built and tested a fixed-film, flow-through, anaerobic reactor to treat an ersatz wastewater. During steady-state operation, the reactor achieved a 97% chemical oxygen demand (COD) removal rate with an organic loading rate of 1740 g d-1 m-3 and a hydraulic retention time of 12.25 d. The reactor was also tested on three occasions by feeding ca. 500 g COD in less than 12 h, representing 50x the daily feeding rate, with COD removal rates ranging from 56-70%, demonstrating the ability of the reactor to respond to overfeeding events. While investigating the storage of treated reactor effluent at a pH of 12, we isolated a strain of Halomonas desiderata capable of acetate degradation under high pH conditions. We then tested the nutritional content of the alkaliphilic Halomonas desiderata strain, as well as the thermophile Thermus aquaticus, as supplemental protein and lipid sources that grow in conditions that should preclude pathogens. The M. capsulatus biomass consisted of 52% protein and 36% lipids, the H. desiderata biomass consisted of 15% protein and 7% lipids, and the Thermus aquaticus biomass consisted of 61% protein and 16% lipids. This work demonstrates the feasibility of rapid waste treatment in a compact reactor design

Ornithological aspects on the swamp Herghelie – Mangalia (Romania

Directory of Open Access Journals (Sweden)

GACHE Carmen

2005-09-01

Full Text Available This ornithological notice present information on the avifauna recorded in the swamp Herghelie – Mangalia beginning with the 1998’s summer. We identified 132 species of birds. The reedbeds cover about 35% of the swamp’s surface, offering good conditions for the breeding season (Ixobrychus minutus, Botaurus stellaris, Cygnus olor, Himantopus himantopus, Recurvirostra avosetta and Sterna hirundo but also for migration period. The breeding population is low due the high level of the human pressure. Due the presence of sulphurous sources and peat bed, the water is not freezing during the winter, transforming this territory in an important wintering site in the southeastern Dobroudja. Interesting is also the presence in this area during the winter of some summer visitors’ species for Romania like: Phalacrocorax pygmeus, Botaurus stellaris and Rallus aquaticus.

Alkaloid-Containing Plants Poisonous to Cattle and Horses in Europe.

Science.gov (United States)

Cortinovis, Cristina; Caloni, Francesca

2015-12-08

Alkaloids, nitrogen-containing secondary plant metabolites, are of major interest to veterinary toxicology because of their occurrence in plant species commonly involved in animal poisoning. Based on epidemiological data, the poisoning of cattle and horses by alkaloid-containing plants is a relatively common occurrence in Europe. Poisoning may occur when the plants contaminate hay or silage or when forage alternatives are unavailable. Cattle and horses are particularly at risk of poisoning by Colchicum autumnale (meadow saffron), Conium maculatum (poison hemlock), Datura stramonium (jimson weed), Equisetum palustre (marsh horsetail), Senecio spp. (ragwort and groundsel) and Taxus baccata (European yew). This review of poisonous alkaloid-containing plants describes the distribution of these plants, conditions under which poisoning occurs, active toxic principles involved and subsequent clinical signs observed.

Flexibility of cold- and heat-adapted subtilisin-like serine proteinases evaluated with fluorescence quenching and molecular dynamics

DEFF Research Database (Denmark)

Sigtryggsdóttir, Asta Rós; Papaleo, Elena; Thorbjarnardóttir, Sigríður H.

2014-01-01

activity of cold adapted enzymes when compared to homologues from thermophiles, reflects their higher molecular flexibility. To assess a potential difference in molecular flexibility between the two homologous proteinases, we have measured their Trp fluorescence quenching by acrylamide at different......The subtilisin-like serine proteinases, VPR, from a psychrotrophic Vibrio species and aqualysin I (AQUI) from the thermophile Thermus aquaticus, are structural homologues, but differ significantly with respect to stability and catalytic properties. It has been postulated that the higher catalytic...... to Trp (Y191W). A lower quenching effect of acrylamide on the intrinsic fluorescence of the thermophilic AQUI_Y191W was observed at all temperatures measured (10-55°C), suggesting that it possesses a more rigid structure than VPR. The MD analysis (Cα rmsf profiles) showed that even though VPR and AQUI...

Patogênese, sinais clínicos e patologia das doenças causadas por plantas hepatotóxicas em ruminantes e eqüinos no Brasil Pathogenesis, clinical signs and pathology of diseases caused by hepatotoxic plants in ruminants and horses in Brazil

Directory of Open Access Journals (Sweden)

Julio Cesar A. Santos

2008-01-01

Full Text Available Plantas que causam lesões hepáticas em ruminantes e eqüinos constituem um grupo importante de plantas tóxicas no Brasil. Em geral essas plantas podem ser divididas em três grandes grupos: plantas que causam necrose hepática aguda; plantas que causam fibrose hepática; e plantas que causam fotossensibilização. Em algumas dessas plantas os princípios tóxicos já foram identificados. Das plantas que causam necrose hepática aguda, os carboxiatractilosídeos estão presentes em Cestrum parqui e Xanthium cavanillesi. Os alcalóides pirrolizidínicos estão presentes nas plantas que causam fibrose hepática (Senecio spp., Echium plantagineum, Heliotropum spp. e Crotalaria spp.. Das plantas que causam fotossensibilização hepatógena são conhecidos os furanossesquiterpenos em Myoporum spp., triterpenos em Lantana spp., e saponinas esteroidais em Brachiaria spp. e Panicum spp. O quadro clínicopatológico dessas intoxicações e o mecanismo geral da insuficiência hepática, incluindo meios de diagnóstico, são descritos neste artigo de revisão.Plants causing hepatic lesions in ruminants and horses constitute one important group of poisonous plants in Brazil. These plants can be placed in three major groups: plants causing acute liver necrosis; plants causing liver fibrosis; and plants causing hepatogenous photosensitization. For some of these plants the toxic principles are known. Cestrum parqui and Xanthium cavanillesi that cause acute liver necrosis contain carboxy-atractylosides. Senecio spp., Crotalaria spp., and Echium plantagineum that cause liver fibrosis contain pyrrolizidine alkaloids. As for the group of plants causing hepatogenous photosensibilization, Myoporum spp. contain furanosesquiterpenes, Lantana spp contain triterpenes, and Brachiaria spp. and Panicum spp. contain steroidal saponins. The clinical and pathologic features of the toxicosis caused by these phytotoxins, general mechanisms of production for the production of

Alkaloid-Containing Plants Poisonous to Cattle and Horses in Europe

Directory of Open Access Journals (Sweden)

Cristina Cortinovis

2015-12-01

Full Text Available Alkaloids, nitrogen-containing secondary plant metabolites, are of major interest to veterinary toxicology because of their occurrence in plant species commonly involved in animal poisoning. Based on epidemiological data, the poisoning of cattle and horses by alkaloid-containing plants is a relatively common occurrence in Europe. Poisoning may occur when the plants contaminate hay or silage or when forage alternatives are unavailable. Cattle and horses are particularly at risk of poisoning by Colchicum autumnale (meadow saffron, Conium maculatum (poison hemlock, Datura stramonium (jimson weed, Equisetum palustre (marsh horsetail, Senecio spp. (ragwort and groundsel and Taxus baccata (European yew. This review of poisonous alkaloid-containing plants describes the distribution of these plants, conditions under which poisoning occurs, active toxic principles involved and subsequent clinical signs observed.

The role of Glu259 in Escherichia coli elongation factor Tu in ternary complex formation

DEFF Research Database (Denmark)

Nautrup Pedersen, Gitte; Rattenborg, Thomas; Knudsen, Charlotte Rohde

1998-01-01

Determination of the crystal structure of the ternary complex formed between elongation factor Tu:GTP and aminoacylated tRNA revealed three regions of interaction between elongation factor Tu and tRNA. The structure indicates that the conserved glutamic acid at position 271 in Thermus aquaticus EF-Tu...... could be involved in the binding of the 3' CCA-Phe end of the aminoacylated tRNA. Therefore, the corresponding residue, Glu259, of Escherichia coli EF-Tu was mutated into alanine, aspartic acid, glutamine and tyrosine, in order to substantiate the crystallographic structural evidence and to obtain...... of interaction with tRNA, while mutation to tyrosine abolished completely the interaction with tRNA. Finally, mutation to glutamine resulted in an elongation factor Tu variant behaving like the wild type. In conclusion, the environment around the site binding the CCA-Phe end of the tRNA is very restricted...

The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

Science.gov (United States)

Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

1989-01-01

Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

Aspectos epidemiológicos da seneciose na região sul do Rio Grande do Sul Epidemiological aspects of seneciosis in southern Rio Grande do Sul, Brazil

Directory of Open Access Journals (Sweden)

Fernando Sérgio Castilhos Karam

2004-12-01

Full Text Available Seneciose é a principal intoxicação por planta no sul do Rio Grande do Sul, Brasil. Neste trabalho apresentam-se os dados de 24 surtos de seneciose em bovinos e de um em eqüinos, diagnosticados pelo Laboratório Regional de Diagnóstico (LRD da Universidade Federal de Pelotas, no período de 1998 a 2000. Adicionalmente são avaliados os dados epidemiológicos de 54 surtos ocorridos no período 1978-1997. Os dados epidemiológicos e clínicos do período 1998-2000 foram coletados em visitas às propriedades onde estavam ocorrendo os surtos. Em 11 (45,83% surtos os animais tinham até 3 anos de idade e, em 13 (54,16%, 3 anos ou mais. Quanto ao sexo, 9 (37,5% surtos atingiram fêmeas e 15 (62,5% afetaram machos. Em relação à época de ocorrência, 10 (41,66% surtos ocorreram na primavera, 4 (16,66% no verão, 5 (20,83% no outono, e 5 (20,83% no inverno. A morbidade foi estimada em 4,92% e a letalidade em 95,59%. As espécies de Senecio que predominaram nas propriedades visitadas foram S. brasiliensis em 12 (57,14%, S. selloi em 10 (47,61%, S. oxyphyllus em 6 (28,57%, S. heterotrichius em 3 (14,28%, e S. leptolobus em 1 (4,76% propriedade. Os sinais clínicos mais freqüentes foram emagrecimento progressivo, incoordenação, diarréia, tenesmo, prolapso retal e agressividade. O curso clínico da intoxicação, levando em consideração somente os animais necropsiados ou os observados durante as visitas às fazendas, foi de 24 a 96 horas em 4 (16,66% surtos, de 4 a 7 dias em 7 (29,16%, de 1 a 2 semanas em 4 (16,66%, de 2 a 3 semanas em 2 (8,33%, de 1 a 2 meses em 2 (8,33%, e de 2 a 3 meses em 1 (4,16% surto. Em quatro (16,66% surtos o período de manifestação clínica não foi observado. Nos surtos em que o curso clínico foi mais prolongado, alguns animais apresentaram fotossensibilização. Os achados de necropsia mais comuns foram fígado aumentado de tamanho e endurecido, vesícula biliar aumentada, edema no mesentério e abomaso e l

Pyrrolizidine alkaloid-containing toxic plants (Senecio, Crotalaria, Cynoglossum, Amsinckia, Heliotropium, and Echium spp.).

Science.gov (United States)

Stegelmeier, Bryan L

2011-07-01

Pyrrolizidine alkaloid (PA)-containing plants are found throughout the world and are probably the most common plant cause of poisoning of livestock, wildlife, and humans. PAs are potent liver toxins that under some conditions can be carcinogenic. This article briefly introduces high-risk North American PA-containing plants, summarizing their toxicity and subsequent pathology. Current diagnostic techniques, treatments, and strategies to avoid losses to PA poisoning are also reviewed. Published by Elsevier Inc.

Limnologic-geologic excursion in the territory of the lower Erft River

Energy Technology Data Exchange (ETDEWEB)

Friedrich, G.; Thome, K.N.

1976-01-01

The geography and hydrology of the area of the excursion are described. There is much damage due to brown coal strip mining operations. Ground water was drained through a canal leading to the Erft River. The water in nearby springs is rich in Fe which repels plant life. The canal contains only a few blue algae (Oscillatoria splendida) and filamentous green algae (Ulothrix tenerrima) which tolerate high Fe concentrations. The Erft shore plant population includes Sparganium erectum, Potamogeton natans, P. pectinatus and Ranunculus fluitans. On flowering plants and stones, diatoms, various green algae (Cladophora glomerata, Stigeoclonium tenue, Oedogonium capillare) and the tropical red alga Compsopogon hookeri were found. The macrozoobenthos is composed mainly of snails (Bithynia tenaculata, Lumnaea ovata, Physa fontinalis, P. acuta and worms of North American origin (Dugesia tifrina, Dendrocoelum lacteum and Planaria lugubris). The Isopoda included Asellus coxalis and A. aquaticus. Leeches (Herpobdella octoculata) and insect larvae (Chironomids, Limnephilids) were also found.

An enigmatic aquatic snake from the Cenomanian of Northern South America

Directory of Open Access Journals (Sweden)

Adriana Albino

2016-05-01

Full Text Available We report the first record of a snake from the Cretaceous of northern South America. The remains come from the La Luna Formation (La Aguada Member, Cenomanian of Venezuela and consist of several vertebrae, which belong to the precloacal region of the vertebral column. Comparisons to extant and extinct snakes show that the remains represent a new taxon, Lunaophis aquaticus gen. et sp nov. An aquatic mode of life is supported by the ventral position of the ribs, indicating a laterally compressed body. The systematic relationships of this new taxon are difficult to determine due to the scarcity of fossil material; it is, however, a representative of an early lineage of snakes that exploited tropical marine pelagic environments, as reflected by the depositional conditions of the La Aguada Member. Lunaophis is also the first aquatic snake from the Cenomanian found outside of the African and European Tethyan and Boreal Zones.

Avoidance of polycyclic aromatic hydrocarbon-contaminated sediments by the freshwater invertebrates Gammarus pulex and Asellus aquaticus

NARCIS (Netherlands)

Lange, de H.J.; Sperber, V.; Peeters, E.T.H.M.

2006-01-01

Contamination of sediments is a serious problem in most industrialized areas. Sediments are often contaminated with trace metals and organic contaminants like polycyclic aromatic hydrocarbons (PAHs) and polychlorinated biphenyls (PCBs). Bioassays are often used to determine the effect of

Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

Science.gov (United States)

Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

2013-03-11

The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

Science.gov (United States)

Ober, Dietrich; Hartmann, Thomas

1999-01-01

Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

The complete chloroplast genome sequence of Aster spathulifolius (Asteraceae); genomic features and relationship with Asteraceae.

Science.gov (United States)

Choi, Kyoung Su; Park, SeonJoo

2015-11-10

Aster spathulifolius, a member of the Asteraceae family, is distributed along the coast of Japan and Korea. This plant is used for medicinal and ornamental purposes. The complete chloroplast (cp) genome of A. sphathulifolius consists of 149,473 bp that include a pair of inverted repeats of 24,751 bp separated by a large single copy region of 81,998 bp and a small single copy region of 17,973 bp. The chloroplast genome contains 78 coding genes, four rRNA genes and 29 tRNA genes. When compared to other cpDNA sequences of Asteraceae, A. spathulifolius showed the closest relationship with Jacobaea vulgaris, and its atpB gene was found to be a pseudogene, unlike J. vulgaris. Furthermore, evaluation of the gene compositions of J. vulgaris, Helianthus annuus, Guizotia abyssinica and A. spathulifolius revealed that 13.6-kb showed inversion from ndhF to rps15, unlike Lactuca of Asteraceae. Comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates with J. vulgaris revealed that synonymous genes related to a small subunit of the ribosome showed the highest value (0.1558), while nonsynonymous rates of genes related to ATP synthase genes were highest (0.0118). These findings revealed that substitution has occurred at similar rates in most genes, and the substitution rates suggested that most genes is a purified selection. Copyright © 2015 Elsevier B.V. All rights reserved.

Convergence characteristics between a rodent, the South American lowland paca, and a ruminant, the African water chevrotain: An exemplary case study.

Science.gov (United States)

Dubost, Gérard

2017-03-01

The level of convergence between a rodent, the South American lowland paca Cuniculus paca, and a ruminant, the African water chevrotain Hyemoschus aquaticus, is analysed using 231 characteristics belonging to different biological sectors. A convergence index is established based on the degree of rarity of each characteristic in each species compared to other members of its zoological group. Although the divergent characteristics are as numerous as the convergent ones, the two species are globally similar. Convergent characteristics occur in all biological categories, but their rate varies a great deal among them. From internal anatomy and osteology, through behaviour and ecology to the external appearance of the body, convergent characteristics are all the more frequent since the biological category is directly implicated in the adaptation of animals to their external environment (lowland rainforest). However, only the individuals' characteristics are concerned and not those of their population or social organisation. This could be due to differences between the communities of terrestrial mammals to which they belong. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.

Predicting life-history adaptations to pollutants

Energy Technology Data Exchange (ETDEWEB)

Maltby, L. [Univ. of Sheffield (United Kingdom). Dept. of Animal and Plant Sciences

1995-12-31

Animals may adapt to pollutant stress so that individuals from polluted environments are less susceptible than those from unpolluted environments. In addition to such direct adaptations, animals may respond to pollutant stress by life-history modifications; so-called indirect adaptations. This paper will demonstrate how, by combining life-history theory and toxicological data, it is possible to predict stress-induced alterations in reproductive output and offspring size. Pollutant-induced alterations in age-specific survival in favor of adults and reductions in juvenile growth, conditions are predicted to select for reduced investment in reproduction and the allocation of this investment into fewer, larger offspring. Field observations on the freshwater crustaceans, Asellus aquaticus and Gammarus pulex, support these predictions. Females from metal-polluted sites had lower investment in reproduction and produced larger offspring than females of the same species from unpolluted sites. Moreover, interpopulation differences in reproductive biology persisted in laboratory cultures indicating that they had a genetic basis and were therefore due to adaptation rather than acclimation. The general applicability of this approach will be considered.

Çapalı Gölü (Afyon Makrobentik Omurgasızlarının Taban Yapısı ve Su Kalitesine Bağlı Olarak Dağılımı.

Directory of Open Access Journals (Sweden)

Ö. Osman Ertan

2015-12-01

Full Text Available Temmuz 2000 ve Haziran 2001 tarihleri arasında yapılan bu çalışmada, Çapalı Gölü’nün bazı su kalitesi parametreleri ile makrobentik omurgasızlarının dağılım ve yoğunluğu ikişer ay arayla, bir yıl boyunca izlenmiştir. Kaynak suyu özelliği gösteren I. istasyonda Theodoxus anatolicus (Recluz, 1841, Graecoanatolica tenuis (Radoman, 1943 (Gastropoda ve Trichoptera larvaları yoğun olarak bulunurken; mezotrofik ve ötrofik özellik gösteren II. ve III. istasyonlarda makrobentik organizma çeşitliliği ve yoğunluğunun çok düşük düzeyde olduğu tespit edilmiştir. Ötrofik-hiperötrofik özellikte olan IV. istasyonda ise Chironomus larvaları (Diptera, Tubifex sp. (Oligochaeta ve Asellus aquaticus (Linnaeus, 1758 (Isopoda yoğun olarak belirlenmiştir

Vegetative propagation of native species potentially useful in the restoration of México City's vegetation Propagación vegetativa de especies nativas potencialmente útiles en la restauración de la vegetación de la ciudad de México

Directory of Open Access Journals (Sweden)

Renato Ramos-Palacios

2012-09-01

Full Text Available Hardwood and softwood cuttings of Buddleja cordata HBK, Dodonaea viscosa Jacq and Senecio praecox D.C. were tested to know their ability to form adventitious roots. Cuttings were prepared in 2 different seasons (wet and dry and treated with different microclimatic conditions and auxin concentrations (IBA and NAA. Hardwood and softwood cuttings of B. cordata rooted during the dry and wet season, whilst hardwood and softwood cuttings of D. viscosa rooted only in the wet season, cuttings of S. praecox rooted only in wet season with a higher rooting for hardwood than softwood cuttings. Low hormone concentrations (10 - 100 ppm favored the rooting percentage more than high concentrations (1000 - 10 000 ppm. However, high hormone concentrations favored number, length of roots and number of developed shoots. Natural regeneration of these species is limited and the species are difficult to propagate from seeds. Vegetative propagation of these species could be an alternative to get clonal planting stock for reforestation programs in some Mexico City areas.Se probó la habilidad de estacas lignificadas y suaves de Buddleja cordata HBK, Dodonaea viscosa Jacq y Senecio praecox D.C. para formar raíces adventicias. Las estacas se prepararon en las estaciones húmeda y seca; se trataron con diferentes concentraciones de auxinas (IBA y NAA y en diferentes condiciones microclimáticas. Las estacas de madera lignificadas y madera suave de B. cordata enraizaron durante la estación seca y húmeda, mientras que las de D. viscosa lo hicieron sólo en la época húmeda, las estacas de S. praecox sólo en la estación seca teniendo las estacas lignificadas un mayor enraizamiento que las de madera suave. Las concentraciones bajas de hormonas (10 - 100 ppm favorecieron más el porcentaje de enraizamiento que las altas concentraciones (1000 - 10 000 ppm. . Sin embargo, las concentraciones altas de hormonas favorecieron el número y la longitud de las raíces, además del

Biodiversidad de la flora del flanco oriental del Cordón del Plata (Luján de Cuyo, Mendoza, Argentina. Catálogo florístico Biodiversity of the flora of the eastern slope of the Cordón del Plata (Luján de Cuyo, Mendoza, Argentina

Directory of Open Access Journals (Sweden)

Eduardo Méndez

2009-07-01

Full Text Available La biodiversidad de la flora de la vertiente oriental del Cordón del Plata, Luján de Cuyo, Mendoza, Argentina se analizó a lo largo de un gradiente altitudinal, entre los 1200 y 4500 m s.n.m. Para ello se utilizó la lista florística de las especies de 89 comunidades vegetales distribuidas en 14 unidades de vegetación, 5 pisos de vegetación y 3 unidades fitogeográficas. Para cada especie se consideró su distribución en los grupos de comunidades vegetales, ubicación fitogeográfica, formas de vida, origen y registro de colección. La flora examinada contiene 667 especies vegetales que se corresponden con 338 géneros y 82 familias. Las familias están representadas por 8 Pteridophyta, 1 Gymnospermae y 73 Angiospermae, con 12 Monocotyledoneae y 61 Dicotyledoneae. Las familias mejor representadas son Asteraceae y Poaceae que tienen en conjunto 110 géneros y 249 especies. Los géneros Senecio, Baccharis y Adesmia son los más ricos en especies. Aproximadamente el 20 % de las especies son endémicas de Argentina. La flora del área se la compara con la del país, la provincia y la de otras áreas.Floristic catalogue. The floristic biodiversity of the eastern slope of the Cordón del Plata, Luján de Cuyo, Mendoza, Argentina, was studied along an altitudinal gradient, between 1200 and 4500 m a.s.l. For this we used a floristic list of 89 plant communities, distributed in 14 vegetation types, 5 vegetation belts and 3 phytogeographic units. For each of the species, its distribution in the groups of plant communities, phytogeographic position, life form, biogeographical origin, and registration of each collection was considered. The studied flora has 667 species, corresponding to 338 genera and 82 families. There are 8 Pteridophyta, 1 Gymnospermae, and 73 Angiospermae, of which 12 are Monocotyledons and 61 Dicotyledons. The most represented families are Asteraceae and Poaceae, which in total have 110 genera and 249 species. The most species

Flora apícola primaveral en la región del Monte de la Provincia de La Pampa (Argentina Springtime beekeeping flora in the Monte region of La Pampa province (Argentine

Directory of Open Access Journals (Sweden)

Ofelia Naab

Full Text Available Con el fin de evaluar la flora utilizada por Apis mellifera L. fueron analizadas muestras de miel inmadura y cargas corbiculares de dos apiarios demostradores ubicados en la Provincia Fitogeográfica del Monte, Provincia de La Pampa. Las muestras se extrajeron periódicamente durante la primavera y fueron analizadas aplicando las técnicas melisopalinológicas convencionales. La vegetación arbustiva nativa presentó la mayor abundancia y el mayor número de especies en óptima floración en noviembre. Las familias más representadas en los espectros polínicos de mieles inmaduras y de cargas corbiculares fueron: Zygophyllaceae ( Larrea divaricata Cav., Rhamnaceae ( Condalia microphylla Cav., Solanaceae ( Lycium sp., Asteraceae ( Senecio subulatus Don ex Hook. & Arn. y Verbenaceae ( Glandularia sp. - Junellia sp. - Verbena sp.. Los análisis polínicos evidenciaron que las especies nativas ofrecieron al mismo tiempo recursos nectaríferos y poliníferos sin embargo se observó una alta selección de pocos recursos florales. La oferta floral produjo mieles monoflorales de L. divaricata , C. microphylla y Lycium sp. Ambos apiarios pudieron diferenciarse teniendo en cuenta la diversidad de tipos polínicos y la presencia de ciertos taxones en las categorías de polen dominante y secundario.In order to evaluate the utilized flora by Apis mellifera L. we analized inmmature honey samples and corbicular pollen loads from two demonstrative apiaries located in the Monte Phytogeographical Province of La Pampa. The samples were periodically collected during springtime and were analyzed using the conventional melissopalynological techniques. The native flora presented the major abundance and the highest number of species at an optimum flowering level in november. The most represented families in the pollen spectrum of immature honeys and corbicular loads were: Zygophyllaceae ( Larrea divaricata Cav., Rhamnaceae ( Condalia microphylla Cav., Solanaceae

Interactions between Plant Metabolites Affect Herbivores: A Study with Pyrrolizidine Alkaloids and Chlorogenic Acid

Science.gov (United States)

Liu, Xiaojie; Vrieling, Klaas; Klinkhamer, Peter G.L.

2017-01-01

The high structural diversity of plant metabolites suggests that interactions among them should be common. We investigated the effects of single metabolites and combinations of plant metabolites on insect herbivores. In particular we studied the interacting effects of pyrrolizidine alkaloid (PAs), and chlorogenic acid (CGA), on a generalist herbivore, Frankliniella occidentalis. We studied both the predominantly occurring PA N-oxides and the less frequent PA free bases. We found antagonistic effects between CGA and PA free bases on thrips mortality. In contrast PA N-oxides showed synergistic interactions with CGA. PA free bases caused a higher thrips mortality than PA N-oxides while the reverse was through for PAs in combination with CGA. Our results provide an explanation for the predominate storage of PA N-oxides in plants. We propose that antagonistic interactions represent a constraint on the accumulation of plant metabolites, as we found here for Jacobaea vulgaris. The results show that the bioactivity of a given metabolite is not merely dependent upon the amount and chemical structure of that metabolite, but also on the co-occurrence metabolites in, e.g., plant cells, tissues and organs. The significance of this study is beyond the concerns of the two specific groups tested here. The current study is one of the few studies so far that experimentally support the general conception that the interactions among plant metabolites are of great importance to plant-environment interactions. PMID:28611815

Interactions between Plant Metabolites Affect Herbivores: A Study with Pyrrolizidine Alkaloids and Chlorogenic Acid

Directory of Open Access Journals (Sweden)

Xiaojie Liu

2017-05-01

Full Text Available The high structural diversity of plant metabolites suggests that interactions among them should be common. We investigated the effects of single metabolites and combinations of plant metabolites on insect herbivores. In particular we studied the interacting effects of pyrrolizidine alkaloid (PAs, and chlorogenic acid (CGA, on a generalist herbivore, Frankliniella occidentalis. We studied both the predominantly occurring PA N-oxides and the less frequent PA free bases. We found antagonistic effects between CGA and PA free bases on thrips mortality. In contrast PA N-oxides showed synergistic interactions with CGA. PA free bases caused a higher thrips mortality than PA N-oxides while the reverse was through for PAs in combination with CGA. Our results provide an explanation for the predominate storage of PA N-oxides in plants. We propose that antagonistic interactions represent a constraint on the accumulation of plant metabolites, as we found here for Jacobaea vulgaris. The results show that the bioactivity of a given metabolite is not merely dependent upon the amount and chemical structure of that metabolite, but also on the co-occurrence metabolites in, e.g., plant cells, tissues and organs. The significance of this study is beyond the concerns of the two specific groups tested here. The current study is one of the few studies so far that experimentally support the general conception that the interactions among plant metabolites are of great importance to plant-environment interactions.

Livestock Poisoning with Pyrrolizidine Alkaloid Containing Plants (Senecio, Crotalaria, Cynoglossum, Amsinckia, Heliotropium and Echium spp.)

Science.gov (United States)

Pyrrolizidine alkaloids (PAs) are potent liver toxins that have been identified in over 6,000 plants throughout the world. Alkaloids are nitrogen-based compounds with potent biological activity. About half of the identified PAs are toxic and several cause cancer (carcinogenic). PA-containing plants...

A survey of Senecio spp. affecting livestock in Uruguay and their associated pyrrolizidine alkaloid content

Science.gov (United States)

In Eastern Uruguay there has been a significant increase of seneciosis in grazing livestock with most affected localities related to counties neighboring the Brazilian border. A survey in 28 farms associated with poisoning outbreaks in grazing cattle in Eastern Uruguay was carried out. Fifty populat...

Rodent diversity and habitat use in a protected area of Buenos Aires province, Argentina Diversidad y uso del hábitat por roedores en un área protegida de Buenos Aires, Argentina

Directory of Open Access Journals (Sweden)

Isabel E. Gómez-Villafañe

2012-09-01

Full Text Available Habitat use of rodents is associated to environmental variables, species requirements and biological interactions. The aim of this study was to analyse the macro and microhabitat use and spatial variation in the abundance of small wild rodents that inhabit Otamendi Natural Reserve, Argentina. We studied the rodent communities in 6 habitats: riparian forest, Celtis tala forest, lowland grassland, salt marsh and 2 highland grasslands. We captured a total of 153 individual of Scapteromys aquaticus, Akodon azarae, Oxymycterus rufus, Oligoryzomys flavescens, Deltamys kempi and O. nigripes, with a trapping effort of 3636 trap-nights. The species richness is maintained by the presence of different habitats that satisfy specific requirements from specialist and generalist species, using differentially the reserve and forming communities of different specific composition in each habitat. A differential macrohabitat use was observed by all species, and a certain level of selectivity at microhabitat scale was observed in individuals of 2 species. This study shows that the diversity of environments in the Otamendi Natural Reserve, which allows the maintenance of many wild species of small rodents; confirming the high ecological and conservational value of the reserves inside an urban region.El uso del habitat de los roedores está asociado a variables ambientales, requerimientos específicos e interacciones biológicas. El objetivo de este estudio fue analizar el uso del macro y microhábitat y la variación espacial en la abundancia de pequeños roedores que habitan la Reserva Natural Otamendi, Argentina. Estudiamos la comunidad de roedores en 6 ambientes: bosque ribereño, talares, pastizales bajos, pastizal salino y 2 pastizales altos. Capturamos 153 individuos de Scapteromys aquaticus, Akodon azarae, Oxymycterus rufus, Oligoryzomys flavescens, Deltamys kempi y O. nigripes, con un esfuerzo de 3 636 trampas-noche. La riqueza de especies se mantiene

Effects of diversity and identity of the neighbouring plant community on the abundance of arthropods on individual ragwort (Jacobaea vulgaris) plants

NARCIS (Netherlands)

Kostenko, O.; Grootemaat, Saskia S.; Van der Putten, W.H.; Bezemer, T.M.

2012-01-01

The diversity of plant community can greatly affect the abundance and diversity of arthropods associated to that community, but can also influence the composition or abundance of arthropods on individual plants growing in that community. We sampled arthropods and recorded plant size of individual

Plants that can be Poisonous for Cows. A Review

Directory of Open Access Journals (Sweden)

Cristina EL MAHDY

2017-11-01

Full Text Available Romania is blessed with a rich spontaneous flora, but some of the plants are toxic by their consumption in cattle, affecting the health, productions and endangering consumer safety. Sometimes even the consumption of small amounts causes poisoning with a broad extension: from mild, moderate to severe and with chronic or acute manifestations. Plant action is not similar. Taxus Buccata, Eupatorium spp. (E. rugosum, E. urticaefolium, E. ogeratoides are cardiotoxic plants, but, Eupatorium spp. also acts through depression of the central nervous system; Datura stramonium (Jimson weed, Solanum spp. (nightshades, Atropa belladonna (belladonna, are plants with cholinergic blocking; haemolytic anemia is caused by Pteridium aquilinum (Bracken fern and Equisetum (horsetail. The poisoning with cyanogenic principles occurs at Sorghum spp (Johnson grass, sudan grass; Elderberry consumption, Senecio spp. and Hypericum (St John’s wort induces liver toxicity. Plants containing alkaloids outside their toxicity also have teratogenic action: Lupinus spp., Nicotiana spp, Conium maculatum, Veratrum album. However, some of these plants can be used in certain cows’ treatments.

Plants growing on contaminated and brownfield sites appropriate for use in Organisation for Economic Co-operation and Development terrestrial plant growth test.

Science.gov (United States)

Sinnett, Danielle E; Lawrence, Victoria K; Hutchings, Tony R; Hodson, Mark E

2011-01-01

The Organisation for Economic Co-operation and Development (OECD) terrestrial plant test is often used for the ecological risk assessment of contaminated land. However, its origins in plant protection product testing mean that the species recommended in the OECD guidelines are unlikely to occur on contaminated land. Six alternative species were tested on contaminated soils from a former Zn smelter and a metal fragmentizer with elevated concentrations of Cd, Cu, Pb, and Zn. The response of the alternative species was compared with that of two species recommended by the OECD: Lolium perenne (perennial ryegrass) and Trifolium pratense (red clover). Urtica dioica (stinging nettle) and Poa annua (annual meadowgrass) had low emergence rates in the control soil and so may be considered unsuitable. Festuca rubra (Chewings fescue), Holcus lanatus (Yorkshire fog), Senecio vulgaris (common groundsel), and Verbascum thapsus (great mullein) offer good alternatives to the OECD species. In particular, H. lanatus and S. vulgaris were more sensitive to the soils with moderate concentrations of Cd, Cu, Pb, and Zn than the OECD species. © 2010 SETAC.

Seasonal variation in pyrrolizidine alkaloid concentration and plant development in Senecio madagascariensis poir. (Asteraceae) in Brazil

Science.gov (United States)

This chapter presents the results of studies conducted in the municipality of Eldorado do Sul, State of Rio Grande do Sul, Brazil, in July and October 2007 and January and May 2008 to measure the pyrrolizidine alkaloid (PA) concentrations of S. madagascariensis plant material (including leaves, flow...

Bioturbation and dissolved organic matter enhance contaminant fluxes from sediment treated with powdered and granular activated carbon.

Science.gov (United States)

Kupryianchyk, D; Noori, A; Rakowska, M I; Grotenhuis, J T C; Koelmans, A A

2013-05-21

Sediment amendment with activated carbon (AC) is a promising technique for in situ sediment remediation. To date it is not clear whether this technique sufficiently reduces sediment-to-water fluxes of sediment-bound hydrophobic organic chemicals (HOCs) in the presence of bioturbators. Here, we report polychlorobiphenyl (PCB) pore water concentrations, fluxes, mass transfer coefficients, and survival data of two benthic species, for four treatments: no AC addition (control), powdered AC addition, granular AC addition and addition and subsequent removal of GAC (sediment stripping). AC addition decreased mass fluxes but increased apparent mass transfer coefficients because of dissolved organic carbon (DOC) facilitated transport across the benthic boundary layer (BBL). In turn, DOC concentrations depended on bioturbator activity which was high for the PAC tolerant species Asellus aquaticus and low for AC sensitive species Lumbriculus variegatus. A dual BBL resistance model combining AC effects on gradients, DOC facilitated transport and biodiffusion was evaluated against the data and showed how the type of resistance differs with treatment and chemical hydrophobicity. Data and simulations illustrate the complex interplay between AC and contaminant toxicity to benthic organisms and how differences in species tolerance affect mass fluxes from sediment to the water column.

Food selectivity of perch (Perca fluviatilis L. ) in acidified lakes on the west coast of Sweden

Energy Technology Data Exchange (ETDEWEB)

Andersson, B

1972-01-01

The objective of the present paper was to examine presumed changes in the food composition of perch in lakes subjected to recent acidification, which emanates from sulfuric acid in the precipitation. The material analyzed (825 preserved specimens from 49 different lakes) was collected by the Fishery Board. These lakes represent a great variability in terms of pH. The perch were divided into four size groups and the stomach contents of each specimen was analyzed qualitatively and quantitatively. The results indicate that fish, which make up the bulk of food for adult perch, are replaced by various invertebrates at a decreasing pH. With a moderate decrease the water hog-louse (Asellus aquaticus) appears of major importance, whereas its place is taken by Corixa bugs in the most acidified lakes. These latter invertebrates are normally absent in the food of adult perch. Also, plankton accounts for a substantial share of the stomach contents. The reasons for these changes are manifold, but two factors are primarily discussed in this paper, viz. the effect of the acidification on the prey populations and the elimination of certain species by selective predation in a normal lake.

Quantification of the Pyrrolizidine Alkaloid Jacobine in Crassocephalum crepidioides by Cation Exchange High-Performance Liquid Chromatography.

Science.gov (United States)

Rozhon, Wilfried; Kammermeier, Lukas; Schramm, Sebastian; Towfique, Nayeem; Adebimpe Adedeji, N; Adesola Ajayi, S; Poppenberger, Brigitte

2018-01-01

Pyrrolizidine alkaloids (PAs) are secondary plant metabolites with considerable hepatoxic, tumorigenic and genotoxic potential. For separation, reversed phase chromatography is commonly used because of its excellent compatibility with detection by mass spectrometry. However, reversed phase chromatography has a low selectivity for PAs. The objective of this work was to investigate the suitability of cation exchange chromatography for separation of PAs and to develop a rapid method for quantification of jacobine in Crassocephalum crepidioides that is suitable for analysis of huge sample numbers as required for mutant screening procedures. We demonstrate that cation exchange chromatography offers excellent selectivity for PAs allowing their separation from most other plant metabolites. Due to the high selectivity, plant extracts can be directly analysed after simple sample preparation. Detection with UV at 200 nm instead of mass spectrometry can be applied, which makes the method very simple and cost-effective. The recovery rate of the method exceeded 95%, the intra-day and inter-day standard deviations were below 7% and the limit of detection and quantification were 1 mg/kg and 3 mg/kg, respectively. The developed method is sufficiently sensitive for reproducible detection of jacobine in C. crepidioides. Simple sample preparation and rapid separation allows for quantification of jacobine in plant material in a high-throughput manner. Thus, the method is suitable for genetic screenings and may be applicable for other plant species, for instance Jacobaea maritima. In addition, our results show that C. crepidioides cannot be considered safe for human consumption. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Parallel evolution in an invasive plant species : evolutionary changes in allocation to growth, defense, competitive ability and regrowth of invasive Jacobaea vulgaris

NARCIS (Netherlands)

Lin, Tiantian

2015-01-01

Although the introduction of invasive plant species in a given area causes economic and ecological problems, it still provides an ideal opportunity for ecologists to study evolutionary changes. According to the Evolution of Increased Competitive Ability hypothesis and Shifting Defense Hypothesis,

Toxicity of dietary Heliotropium dolosum seed to Japanese quail.

Science.gov (United States)

Eroksuz, Y; Eroksuz, H; Ozer, H; Ilhan, N; Cevik, A; Yaman, I; Ceribasi, A O

2002-10-01

Five groups of 30 male Japanese quail, each 7-w-old, were fed diets containing 0, 1, 3, 5, or 10% (w/w) of dehulled H dolosum seed. Half of the birds from the each group were killed at 6 and 24 w after beginning of the trial. At the end of 6th w, neither mortality nor clinical sign occurred in test groups. In the 5 and 10% inclusion levels, mild to moderate hepatic injury was detected as evidenced by mild karyomegaly, moderate fatty change, focal or portal fibrosis, bile duct hyperplasie, and ovalocyte proliferation along with lower serum protein and albumin levels. By the termination of the experiment (24 w), 5 birds died in the 10% dosed group. Hepatic cirrhosis was the most prominent finding in the 5 and 10% group; at these levels, serum protein and albumin values decreased significanty while billuribin and ALP levels increased. Based on relative weights and histological evaluations, testicularatrophywasdosedependent. These results partly affirm earlier studies that the quail is highly resistant to the toxic effects of H dolosumseed. However, the resistance to H dolosum is less than Senecio Jacobae and Crotalaria spectabilis when considering tissue injury.

Weed infestation of onion in soil reduced cultivation system

Directory of Open Access Journals (Sweden)

Marzena Błażej-Woźniak

2013-12-01

Full Text Available Field experiment was conducted in the years 1998-2000 in GD Felin. The influence of no-tillage cultivation and conventional tillage with spring ploughing on weed infestation of onion was compared. In experiment four cover crop mulches (Sinapis alba L., Vicia sativa L., Phacelia tanacetifolia B., Avena sativa L. were applied. From annual weeds in weed infestation of onion in great number Matricaria chamomilla L., and Senecio vulgaris L. stepped out. and from perennial - Agropyron repens (L.P.B. Reduced soil cultivation system (no-tillage caused the significant growth of primary weed infestation of onion in comparison with conventional tillage. In all years of investigations the executed pre-sowing ploughing limited significantly the annual weeds' number in primary weed infestation. The applied mulches from cover plants limited in considerable degree the number of primary weed infestation. In all years of investigations the most weeds stepped out on control object. Among investigated cover crop mulches Vicia sativa L. and Avena sativa L. had a profitable effect on decrease of onion`s primary weed infestation. Soil cultivation system and cover crop mulches had no signi ficant residual influence on the secondary weed infestation of onion.

Fire cue effects on seed germination of six species of northwestern Patagonian grasslands

Science.gov (United States)

Gonzalez, S. L.; Ghermandi, L.

2012-09-01

Postfire recruitment of seedlings has been attributed to a stimulation of germination by fire-related cues. The germination response to heat shock (80 °C - 5 min), smoke (60 min), the combination of both factors and no heat no smoke (control) was studied in six native species (two dominant grasses, two dominant shrubs and two annual fugitive herbs) of northwestern Patagonian grasslands. Seeds of the grasses Festuca pallescens and Stipa speciosa and the shrub Senecio bracteolatus (Asteraceae) germinated when they were exposed to heat shock, whereas seeds of the other shrub, Mulinum spinosum (Apiaceae), were killed by this fire cue. In grasses, probably the glume of caryopsis protected embryos from heat. Possibly, the seed size could explain the different responses of the two shrubs. Heat combined with smoke reduced seed germination for S. speciosa and S. bracteolatus. The heat could have scarified seeds and the longer exposure to smoke could have been toxic for embryos. The same treatment increased germination of the annual fugitive herb Boopis gracilis (Calyceraceae). We concluded that fire differentially affects the seedling recruitment of the studied species in the northwestern Patagonian grasslands.

Interspecific competition between alien and native congeneric species

Science.gov (United States)

Garcia-Serrano, H.; Sans, F. X.; Escarré, J.

2007-01-01

A good way to check hypotheses explaining the invasion of ecosystems by exotic plants is to compare alien and native congeneric species. To test the hypothesis that invasive alien plants are more competitive than natives, we designed a replacement series experiment to evaluate interspecific competition between three Senecio species representing the same bushy life form: two alien species ( S. inaequidens and S. pterophorus, both from South Africa) and a native species from the south-east of the Iberian Peninsula and Maghreb ( S. malacitanus). While S. inaequidens is widespread throughout western Europe and is expanding towards the south of Spanish-French border, the geographical distribution of the recently introduced S. pterophorus is still limited to north-eastern Spain. Plants from each species were grown in pure and in mixed cultures with one of their congeners, and water availability was manipulated to evaluate the effects of water stress on competitive abilities. Our results show that the alien S. inaequidens is the most competitive species for all water conditions. The native S. malacitanus is more competitive that the alien S. pterophorus in water stress conditions, but this situation is reversed when water availability is not limiting.

Biomarkers for ragwort poisoning in horses: identification of protein targets

Directory of Open Access Journals (Sweden)

Beynon Robert J

2008-08-01

Full Text Available Abstract Background Ingestion of the poisonous weed ragwort (Senecio jacobea by horses leads to irreversible liver damage. The principal toxins of ragwort are the pyrrolizidine alkaloids that are rapidly metabolised to highly reactive and cytotoxic pyrroles, which can escape into the circulation and bind to proteins. In this study a non-invasive in vitro model system has been developed to investigate whether pyrrole toxins induce specific modifications of equine blood proteins that are detectable by proteomic methods. Results One dimensional gel electrophoresis revealed a significant alteration in the equine plasma protein profile following pyrrole exposure and the formation of a high molecular weight protein aggregate. Using mass spectrometry and confirmation by western blotting the major components of this aggregate were identified as fibrinogen, serum albumin and transferrin. Conclusion These findings demonstrate that pyrrolic metabolites can modify equine plasma proteins. The high molecular weight aggregate may result from extensive inter- and intra-molecular cross-linking of fibrinogen with the pyrrole. This model has the potential to form the basis of a novel proteomic strategy aimed at identifying surrogate protein biomarkers of ragwort exposure in horses and other livestock.

The effects of comfrey derived pyrrolizidine alkaloids on rat liver.

Science.gov (United States)

Yeong, M L; Clark, S P; Waring, J M; Wilson, R D; Wakefield, S J

1991-01-01

Three groups of young adult rats were fed pyrrolizidine alkaloids derived from Russian comfrey to study the effects of the herb on the liver. Group I animals received a single dose of 200 mg/kg body wt, Group II 100 mg/kg three times a week for 3 weeks and Group III 50 mg/kg three times a week for 3 weeks. All rats showed light and electron-microscopic evidence of liver damage, the severity of which was dose dependent. There was swelling of hepatocytes and hemorrhagic necrosis of perivenular cells. There was a concomitant loss of sinusoidal lining cells with disruption of sinusoidal wall and the sinusoids were filled with cellular debris, hepatocyte organelles and red blood cells. Extravasation of red blood cells was evident. Terminal hepatic venules were narrowed by intimal proliferation, and in Group II and III, reiculin fibres radiated from these vessels. These appearances have been described in veno-occlusive disease due to pyrrolizidine alkaloids from other plant sources such as Senecio and Crotalaria. The safety of comfrey, a widely used herb, in relation to human consumption requires further investigation.

Properties of Thermus ruber Strains Isolated from Icelandic Hot Springs and DNA:DNA Homology of Thermus ruber and Thermus aquaticus

Science.gov (United States)

Sharp, Richard J.; Williams, Ralph A. D.

1988-01-01

Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714

Thermus arciformis sp. nov., a thermophilic species from a geothermal area.

Science.gov (United States)

Zhang, Xin-Qi; Ying, Yi; Ye, Ying; Xu, Xue-Wei; Zhu, Xu-Fen; Wu, Min

2010-04-01

Two aerobic, Gram-negative, non-motile, non-sporulating, yellow-pigmented bacteria, strains TH92(T) and TH91, were isolated from a hot spring located in Laibin, Guangxi, in the south-eastern geothermal area of China. The isolates grew at 40-77 degrees C (optimally at 70 degrees C) and at pH 6.0-9.5 (optimally at pH 7.5-8.0). Phylogenetic analysis of 16S rRNA gene sequences and levels of DNA-DNA relatedness together indicated that the new isolates represented a novel species of the genus Thermus with closest affinity to Thermus aquaticus, Thermus igniterrae and Thermus thermophilus. Compared with their closest relatives, strains TH92( T) and TH91 were able to assimilate a wider range of carbohydrates, amino acids and organic acids as sole carbon sources for growth, such as lactose and melibiose. The new isolates had lower combined levels of C(16 : 0 ) and iso-C(16 : 0) compared with their closest relatives. On the basis of polyphasic taxonomic characterization, strains TH92(T) and TH91 are considered to represent a single novel species of the genus Thermus, for which the name Thermus arciformis sp. nov. is proposed. The type strain is TH92(T) (=CGMCC 1.6992(T) =JCM 15153(T)).

Isolation and partial characterization of carotenoid underproducing and overproducing mutants from an extremely thermophilic Thermus thermophilus HB27

International Nuclear Information System (INIS)

Hoshino, T.; Yoshino, Y.; Guevarra, E.D.; Ishida, S.; Hiruta, T.; Fujii, R.; Nakahara, T.

1994-01-01

Twenty-two carotenoid underproducing and thirteen overproducing mutants were obtained from Thermus thermophilus HB27. The strain HB27 was found to produce at least seven colored carotenoids, believed to be identical to those produced by Thermus aquaticus YT1. Based on the results of the genetic analyses performed on twelve carotenoid underproducing mutants, they were classified into three groups; groups 1, 2 and 3. No colored carotenoid was extracted from the cells of mutants belonging to groups 2 and 3, although the accumulation of phytoene, a colorless carotenoid, was observed in group 2 strains. Group 1 was subdivided into groups 1-a and 1-b, where 1-a stains produced neither colored carotenoids nor phytoene and 1-b strains produced two polar colored carotenoids. All of the overproducing mutants produced about twelve times as much seven colored carotenoid mixtures as the parental strain. The mutation loci among all the overproducing mutants were very close to one another, possibly in the same gene. Carotenoid overproducing mutants showed an extensive resistance to UV-irradiation and showed poorer growth at higher temperatures. Carotenoid underproducing mutants were slightly more UV-sensitive but they grew almost normally at higher temperatures. These results suggest that carotenoids are secondary metabolites which are not essential for growth of T. thermophilus

Protective Effect of ECQ on Rat Reflux Esophagitis Model.

Science.gov (United States)

Jang, Hyeon-Soon; Han, Jeong Hoon; Jeong, Jun Yeong; Sohn, Uy Dong

2012-12-01

This study was designed to determine the protective effect of Rumex Aquaticus Herba extracts containing quercetin-3-β-D-glucuronopyranoside (ECQ) on experimental reflux esophagitis. Reflux esophagitis was induced by surgical procedure. The rats were divided into seven groups, namely normal group, control group, ECQ (1, 3, 10, 30 mg/kg) group and omeprazole (30 mg/kg) group. ECQ and omeprazole groups received intraduodenal administration. The Rats were starved for 24 hours before the experiments, but were freely allowed to drink water. ECQ group attenuated the gross esophagitis significantly compared to that treated with omeprazole in a dose-dependent manner. ECQ decreased the volume of gastric juice and increased the gastric pH, which are similar to those of omeprazole group. In addition, ECQ inhibited the acid output effectively in reflux esophagitis. Significantly increased amounts of malondialdehyde (MDA), myeloperoxidase (MPO) activity and the mucosal depletion of reduced glutathione (GSH) were observed in the reflux esophagitis. ECQ administration attenuated the decrement of the GSH levels and affected the MDA levels and MPO activity. These results suggest that the ECQ has a protective effect which may be attributed to its multiple effects including anti-secretory, anti-oxidative and anti-inflammatory actions on reflux esophagitis in rats.

Acute toxicity of birch tar oil on aquatic organisms

Directory of Open Access Journals (Sweden)

M. HAGNER

2008-12-01

Full Text Available Birch tar oil (BTO is a by-product of processing birch wood in a pyrolysis system. Accumulating evidence suggests the suitability of BTO as a biocide or repellent in terrestrial environments for the control of weeds, insects, molluscs and rodents. Once applied as biocide, BTO may end up, either through run-off or leaching, in aquatic systems and may have adverse effects on non-target organisms. As very little is known about the toxicity of BTO to aquatic organisms, the present study investigated acute toxicity (LC50/EC50 of BTO for eight aquatic organisms. Bioassays with the Asellus aquaticus (crustacean, Lumbriculus variegatus (oligochaeta worm, Daphnia magna (crustacean, Lymnea sp. (mollusc, Lemna minor (vascular plant, Danio rerio (fish, Scenedesmus gracilis (algae, and Vibrio fischeri (bacterium were performed according to ISO, OECD or USEPA-guidelines. The results indicated that BTO was practically nontoxic to most aquatic organisms as the median effective BTO concentrations against most organisms were >150 mg L-1. In conclusion, our toxicity tests showed that aquatic organisms are to some extent, invariably sensitive to birch tar oil, but suggest that BTO does not pose a severe hazard to aquatic biota. We deduce that, unless BTOs are not applied in the immediate vicinity of water bodies, no special precaution is required.;

Contemporary parallel diversification, antipredator adaptations and phenotypic integration in an aquatic isopod.

Directory of Open Access Journals (Sweden)

Fabrice Eroukhmanoff

2009-07-01

Full Text Available It is increasingly being recognized that predation can be a strong diversifying agent promoting ecological divergence. Adaptations against different predatory regimes can emerge over short periods of time and include many different traits. We studied antipredator adaptations in two ecotypes of an isopod (Asellus aquaticus that have, diverged in parallel in two Swedish lakes over the last two decades. We quantified differences in escape speed, morphology and behavior for isopods from different ecotypes present in these lakes. Isopods from the source habitat (reed coexist with mainly invertebrate predators. They are more stream-profiled and have higher escape speeds than isopods in the newly colonized stonewort habitat, which has higher density of fish predators. Stonewort isopods also show more cautious behaviors and had higher levels of phenotypic integration between coloration and morphological traits than the reed isopods. Colonization of a novel habitat with a different predation regime has thus strengthened the correlations between pigmentation and morphology and weakened escape performance. The strong signature of parallelism for these phenotypic traits indicates that divergence is likely to be adaptive and is likely to have been driven by differences in predatory regimes. Furthermore, our results indicate that physical performance, behavior and morphology can change rapidly and in concert as new habitats are colonized.

First data of Iberian Nematomorpha, with redescription of Gordius aquaticus Linnaeus, G. plicatulus Heinze, Gordionus wolterstorffii (Camerano) and Paragordius tricuspidatus (Dufour)

NARCIS (Netherlands)

Villalobos, de Leonor Cristina; Ribera, Ignacio; Bilton, David T.

2001-01-01

Four species of Nematomorpha are recorded from NE Spain, representing the first reliable data on the group in the Iberian peninsula. Gordius aquations Linnaeus, 1758, G. plicatulus Heinze, 1937, Gordionus wolterstorffii (Camerano, 1888) and Paragordius tricuspidatus (Dufour, 1828) are redescribed

Temporal priority effects on competition are not consistent among intermountain grassland species

Science.gov (United States)

Zuo, Shengpeng; Li, Hongli; Ma, Yongqing; Callaway, Ragan M.

2016-08-01

Previous work indicates that priority effects exist, but mechanisms are not well understood. So we explored shifts in competitive outcomes and intensities as a potential general mechanism. In a standard greenhouse experiment the temporal priority effects of the target species Pseudoroegneria spicata and its competitive responses to five receptor species, i.e., Bromus ciliatus, Bromus marginatus, Coreopsis tinctoria, Senecio atratus, and Solidago canadensis were evaluated. P. spicata adults with a high root: shoot ratio had a significant inhibitory priority effect on B. ciliatus, B. marginatus, and C. tinctoria. Compared with the target species, under later and simultaneous sowing, B. ciliatus, B. marginatus, C. tinctoria, and S. atratus exhibited an increasing trend in terms of competition. However, S. canadensis did not display priority effects. In addition, the gram per gram competitive effect of P. spicata depended on the receptor species in the following order: B. marginatus > B. ciliatus > C. tinctoria > S. atratus. There were positive relationships between the relative interaction indices and the root: shoot ratios in B. ciliatus, B. marginatus, and C. tinctoria, thereby suggesting that the early germination or emergence of P. spicata may reduce the root: shoot ratios of these receptors. The results of this study indicate that priority effects occurred in early colonizers with high root: shoot ratios and greater competitive capacities.

Occupational dermatitis in Danish gardeners and greenhouse workers (III). Compositae-related symptoms.

Science.gov (United States)

Paulsen, E; Søgaard, J; Andersen, K E

1998-03-01

The clinical part of the study aimed at describing epidemiological and diagnostic aspects of occupational Compositae dermatitis. Patch testing with the sesquiterpene lactone (SL) and Compositae mixes, feverfew extract and supplementary allergens in 250 selected gardeners showed Compositae allergy in 25, 17 females and 8 males. 24 were possibly occupationally sensitized. The mean age was lower and the preponderance of women higher compared to classical Compositae dermatitis, and the distribution and course of the dermatitis most often did not differ from other occupational plant dermatoses. The Compositae mix detected 2x as many as the SL mix, and the overall detection rate with both was 76%, making aimed patch testing necessary. Chrysanthemum (Dendranthema), marguerite daisy (Argyranthemum frutescens) and lettuce (Lactuca sativa) were frequent sensitizers. Occupational type I allergy to Compositae comprised sensitization to Gerbera, chrysanthemum, lettuce, Senecio cruentus and Aster. Among 1657 respondents in the questionnaire part of the study, 824 had worked with Compositae, and 160 (19%) reported occupational Compositae-related symptoms of skin and mucous membranes. Possible risk factors for the development of these were assessed in a stepwise logistic regression model and a history of childhood eczema, hay fever and duration of exposure were significantly associated with Compositae-related irritant and allergic symptoms in both sexes.

Hyperspectral reflectance of leaves and flowers of an outbreak species discriminates season and successional stage of vegetation

Science.gov (United States)

Carvalho, Sabrina; Schlerf, Martin; van der Putten, Wim H.; Skidmore, Andrew K.

2013-10-01

Spectral reflectance can be used to assess large-scale performances of plants in the field based on plant nutrient balance as well as composition of defence compounds. However, plant chemical composition is known to vary with season - due to its phenology - and it may even depend on the succession stage of its habitat. Here we investigate (i) how spectral reflectance could be used to discriminate successional and phenological stages of Jacobaea vulgaris in both leaf and flower organs and (ii) if chemical content estimation by reflectance is flower or leaf dependent. We used J. vulgaris, which is a natural outbreak plant species on abandoned arable fields in north-western Europe and studied this species in a chronosequence representing successional development during time since abandonment. The chemical content and reflectance between 400 and 2500 nm wavelengths of flowers and leaves were measured throughout the season in fields of different successional ages. The data were analyzed with multivariate statistics for temporal discrimination and estimation of chemical contents in both leaf and flower organs. Two main effects were revealed by spectral reflectance measurements: (i) both flower and leaf spectra show successional and seasonal changes, but the pattern is complex and organ specific (ii) flower head pyrrolizidine alkaloids, which are involved in plant defence against herbivores, can be detected through hyperspectral reflectance.We conclude that spectral reflectance of both leaves and flowers can provide information on plant performance during season and successional stages. As a result, remote sensing studies of plant performance in complex field situations will benefit from considering hyperspectral reflectance of different plant organs. This approach may enable more detailed studies on the link between spectral information and plant defence dynamics both aboveground and belowground.

Seasonal diet pattern of non-native tubenose goby (Proterorhinus semilunaris in a lowland reservoir (Mušov, Czech Republic

Directory of Open Access Journals (Sweden)

Adámek Z.

2010-08-01

Full Text Available The tubenose goby (Proterorhinus semilunaris is a gobiid species currently extending its area of distribution in Central Europe. The objective of the study was to evaluate the annual pattern of its feeding habits in the newly colonised habitats of the Mušov reservoir on the Dyje River (the Danube basin, Czech Republic with respect to natural food resources. In the reservoir, tubenose goby has established a numerous population, densely colonising stony rip-rap banks. Its diet was exclusively of animal origin with significant dominance of and preference for two food items – chironomid (Chironomidae larvae and waterlouse (Asellus aquaticus, which contributed 40.2 and 27.6%, respectively, to the total food bulk ingested. The index of preponderance for the two items was also very high, amounting to 73.8 and 26.5, respectively. In the annual pattern, a remarkable preference for chironomid larvae was recorded in the summer period whilst waterlouse were consumed predominantly in winter months. The proportion of other food items was rather marginal – only corixids, copepods, ceratopogonids and cladocerans were of certain minor importance with proportions of 5.4, 4.3, 4.1 and 3.9%, respectively. Certain signs of cannibalism were also recorded, with 0.9 and 0.2% of the diet consisting of their own progeny and eggs, respectively.

Worm grunting, fiddling, and charming--humans unknowingly mimic a predator to harvest bait.

Directory of Open Access Journals (Sweden)

Kenneth C Catania

Full Text Available BACKGROUND: For generations many families in and around Florida's Apalachicola National Forest have supported themselves by collecting the large endemic earthworms (Diplocardia mississippiensis. This is accomplished by vibrating a wooden stake driven into the soil, a practice called "worm grunting". In response to the vibrations, worms emerge to the surface where thousands can be gathered in a few hours. Why do these earthworms suddenly exit their burrows in response to vibrations, exposing themselves to predation? PRINCIPAL FINDINGS: Here it is shown that a population of eastern American moles (Scalopus aquaticus inhabits the area where worms are collected and that earthworms have a pronounced escape response from moles consisting of rapidly exiting their burrows to flee across the soil surface. Recordings of vibrations generated by bait collectors and moles suggest that "worm grunters" unknowingly mimic digging moles. An alternative possibility, that worms interpret vibrations as rain and surface to avoid drowning is not supported. CONCLUSIONS: Previous investigations have revealed that both wood turtles and herring gulls vibrate the ground to elicit earthworm escapes, indicating that a range of predators may exploit the predator-prey relationship between earthworms and moles. In addition to revealing a novel escape response that may be widespread among soil fauna, the results show that humans have played the role of "rare predators" in exploiting the consequences of a sensory arms race.

Spatial and temporal distribution of weeds in no-tillage system

Directory of Open Access Journals (Sweden)

Eduardo L. Bottega

Full Text Available ABSTRACT Brazil is one of the largest grain producers in the world, due to its extensive arable land and favorable climate for the cultivation of any species. The production could be higher, but problems such as competition between crops and weeds reduces crop yields. This study aimed to analyze the spatial distribution of weeds, especially milkweed (Sonchus oleraceus, horse weed (Conyza spp. and ‘maria-mole’ (Senecio brasiliensis in an area under no-tillage system for two harvests. The work was carried out during the 2013/14 and 2014/15 crop years in an area of 22.5 ha, where soybean is grown in the summer and oat in the winter. The weeds were mapped using a sampling grid of 85 points. The number of plants present in 0.25 m2 was recorded at each sampling point. The data collected in the field composed the information bank and were used for geostatistical analysis and production of maps. Using geostatistical analysis, it was possible to map the horseweed infestation in the studied area for the 2013/14 season. The species ‘maria-mole’ and milkweed did not show spatial dependence. During the 2014/2015 season, because of the management carried out in the off season, none of the studied species showed spatial dependence.

Panthaleus major /Duges/ of cereals in Bulgaria

Directory of Open Access Journals (Sweden)

V. Maneva

2016-12-01

Full Text Available Abstract. Until recently, Penthaleus major (Dugès has not been recognized as an economically significant pest for the cereal crops. After climatic changes, its population began to grow and inflict damages around the world. The aim of this study was to investigate its distribution in Bulgaria and establish whether it presents a danger to the cereal crops. In the autumn of 2015 and the spring of 2016, a monitoring survey was conducted to establish Penthaleus major (Dugès with the cereal crops in Bulgaria. Over 60 sowed fields were investigated from all around the country. Samples were taken to identify the pest. It was established that Penthaleus major (Dugès inflicted harm to the wheat in north-eastern (12-14 mites per stem and south-eastern Bulgaria (6-8 mites per stem. Its density was under the threshold of economic harm. There was not found infestation of barley, rye, oat and triticale. On the field boundaries bordering the areas attacked by the mite were reported the following weeds: Capsella bursa pastoris (L. Medic, Descurania sophia (L. Welb. et Berth, Senecio spp., Sisymbrium orientale Torn., Taraxsacum officinale Weber, Anthemis spp., Bromus arvensis L., Eragrostis pilosa (L. P.B. Lolium temulentum L., which can be habitat for Penthaleus major (Dugès.

Application of heat stress in situ demonstrates a protective role of irradiation on photosynthetic performance in alpine plants.

Science.gov (United States)

Buchner, Othmar; Stoll, Magdalena; Karadar, Matthias; Kranner, Ilse; Neuner, Gilbert

2015-04-01

The impact of sublethal heat on photosynthetic performance, photosynthetic pigments and free radical scavenging activity was examined in three high mountain species, Rhododendron ferrugineum, Senecio incanus and Ranunculus glacialis using controlled in situ applications of heat stress, both in darkness and under natural solar irradiation. Heat treatments applied in the dark reversibly reduced photosynthetic performance and the maximum quantum efficiency of photosystem II (Fv /Fm), which remained impeded for several days when plants were exposed to natural light conditions subsequently to the heat treatment. In contrast, plants exposed to heat stress under natural irradiation were able to tolerate and recover from heat stress more readily. The critical temperature threshold for chlorophyll fluorescence was higher under illumination (Tc (')) than in the dark (Tc). Heat stress caused a significant de-epoxidation of the xanthophyll cycle pigments both in the light and in the dark conditions. Total free radical scavenging activity was highest when heat stress was applied in the dark. This study demonstrates that, in the European Alps, heat waves can temporarily have a negative impact on photosynthesis and, importantly, that results obtained from experiments performed in darkness and/or on detached plant material may not reliably predict the impact of heat stress under field conditions. © 2014 The Authors. Plant, Cell & Environment published by John Wiley & Sons Ltd.

Descrição da larva de 3º ínstar e redescrição do adulto de Phaedon confinis Klug (Coleoptera: Chrysomelidae

Directory of Open Access Journals (Sweden)

2015-08-01

Abstract. In view of the potential of Phaedon confinis Klug as an biological control agent of the Senecio brasiliensis Less and the lack of taxonomic knowledge of the species Phaedon recorded for Brazil, this paper aimed to describe the 3rd larval instar, redescribe the adult, as well as add new characters and illustrations to acknowledgment of the specie. The P. confinis larvae are eruciform, subcylindrical, elongated and slightly convex; dorsal surface dark brown and ventral surface with yellowish lighter regions; four setae in the front; six stemmata arranged in three groups; brown labrum, with four pairs of setae, pronotal plate with ten setae; pleural region of prothorax with tubercle T; meso- and metathorax with tubercles Dai and Dae close, but not fused, and tubercles Es-Ss fused between themselves by midline; simple tarsal claws; abdomen with tubercle Dae absent and Dai present, little pronounced; abdominal tubercles with two setae in Dpi and Dpe. Adult has oval body and dorsally convex; pronotum and elytral glabrous; predominant colour blue metallic violet; lateral margins of pronotum rounded, yellowish brown with central macula metallic blue, elytral striae with deep punctuation and arranged in eight longitudinal rows; yellowish brown regions on the head, prothorax and legs; head with two small oval black maculae, posterior to the eyes in vertex region.

A comparative study of AMF diversity in annual and perennial plant species from semiarid gypsum soils.

Science.gov (United States)

Alguacil, M. M.; Torrecillas, E.; Roldán, A.; Díaz, G.; Torres, P.

2012-04-01

The arbuscular mycorrhizal fungi (AMF) communities composition regulate plant interactions and determine the structure of plant communities. In this study we analysed the diversity of AMF in the roots of two perennial gypsophyte plant species, Herniaria fruticosa and Senecio auricula, and an annual herbaceous species, Bromus rubens, growing in a gypsum soil from a semiarid area. The objective was to determine whether perennial and annual host plants support different AMF communities in their roots and whether there are AMF species that might be indicators of specific functional plant roles in these ecosystems. The roots were analysed by nested PCR, cloning, sequencing of the ribosomal DNA small subunit region and phylogenetic analysis. Twenty AMF sequence types, belonging to the Glomus group A, Glomus group B, Diversisporaceae, Acaulosporaceae, Archaeosporaceae and Paraglomeraceae, were identified. Both gypsophyte perennial species had differing compositions of the AMF community and higher diversity when compared with the annual species, showing preferential selection by specific AMF sequences types. B. rubens did not show host specificity, sharing the full composition of its AMF community with both perennial plant species. Seasonal variations in the competitiveness of AM fungi could explain the observed differences in AMF community composition, but this is still a working hypothesis that requires the analysis of further data obtained from a higher number of both annual and perennial plant species in order to be fully tested.

Extensive range persistence in peripheral and interior refugia characterizes Pleistocene range dynamics in a widespread Alpine plant species (Senecio carniolicus, Asteraceae)

Czech Academy of Sciences Publication Activity Database

García, P. E.; Winkler, M.; Flatscher, R.; Sonnleitner, M.; Krejčíková, Jana; Suda, Jan; Hülber, K.; Schneeweiss, G. M.; Schönswetter, P.

2012-01-01

Roč. 21, č. 5 (2012), s. 1255-1270 ISSN 0962-1083 Grant - others:Austrian Science Fund (FWF)(AT) P20736–B16 Institutional research plan: CEZ:AV0Z60050516 Institutional support: RVO:67985939 Keywords : phylogeny * cytometry * polyploidy Subject RIV: EF - Botanics Impact factor: 6.275, year: 2012

Incidence of Pyrrolizidine Alkaloids in Herbal Medicines from German Retail Markets: Risk Assessments and Implications to Consumers.

Science.gov (United States)

Letsyo, Emmanuel; Jerz, Gerold; Winterhalter, Peter; Lindigkeit, Rainer; Beuerle, Till

2017-12-01

The occurrence of potentially toxic pyrrolizidine alkaloids (PAs) in herbal medicines (HMs) is currently intensely being discussed in Europe. Pyrrolizidine alkaloids, particularly the 1,2-unsaturated PAs, are undesired compounds in HMs due to their potential hepatotoxic and carcinogenic properties. In this study, 98 widely patronized HMs from six popular German retail supermarkets/drugstores, as well as from pharmacies, were analyzed by high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry for the presence of PAs. The results showed that about 63% of the HMs were PA positive, whereas the average PA concentration of the samples was 201 μg/kg, the highest concentration of PAs (3270 μg/kg) was attributed to a product that was purchased from the pharmacy and contained Hypericum perforatum L. (St. John's Wort) as an active ingredient. In addition, H. perforatum-containing products were frequently contaminated with PAs from Echium spp., while both Cynara cardunculus L. products and fixed-combination products of Gentiana lutea L., Rumex acetosa L., Verbena officinalis L., Sambucus nigra L., and Primula veris L. products were commonly contaminated with PAs of Senecio spp. The study showed that H. perforatum, C. cardunculus, Urtica dioica L., and fixed-combination products were frequently contaminated with PA levels above the recommended values of both the German and European Medicines Agencies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Carry-over of pyrrolizidine alkaloids from feed to milk in dairy cows.

Science.gov (United States)

Hoogenboom, L A P; Mulder, P P J; Zeilmaker, M J; van den Top, H J; Remmelink, G J; Brandon, E F A; Klijnstra, M; Meijer, G A L; Schothorst, R; Van Egmond, H P

2011-03-01

Pyrrolizidine alkaloids are toxins present in many plants belonging to the families of Asteraceae, Boraginaceae and Fabaceae. Particularly notorious are pyrrolizidine alkaloids present in ragwort species (Senecio), which are held responsible for hepatic disease in horses and cows and may lead to the death of the affected animals. In addition, these compounds may be transferred to edible products of animal origin and as such be a threat for the health of consumers. To investigate the possible transfer of pyrrolizidine alkaloids from contaminated feed to milk, cows were put on a ration for 3 weeks with increasing amounts (50-200 g day(-1)) of dried ragwort. Milk was collected and sampled twice a day; faeces and urine twice a week. For milk, a dose-related appearance of pyrrolizidine alkaloids was found. Jacoline was the major component in milk despite being a minor component in the ragwort material. Practically no N-oxides were observed in milk, notwithstanding the fact that they constituted over 80% of the pyrrolizidine alkaloids in ragwort. The overall carry-over of the pyrrolizidine alkaloids was estimated to be only around 0.1%, but for jacoline 4%. Notwithstanding the low overall carry-over, this may be relevant for consumer health considering the genotoxic and carcinogenic properties demonstrated for some of these compounds. Analysis of the faeces and urine samples indicated that substantial metabolism of pyrrolizidine alkaloids is taking place. The toxicity and potential transfer of metabolites to milk is unknown and remains to be investigated.

Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

Science.gov (United States)

Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

2001-08-15

Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

Novel Hepatozoon in vertebrates from the southern United States.

Science.gov (United States)

Allen, Kelly E; Yabsley, Michael J; Johnson, Eileen M; Reichard, Mason V; Panciera, Roger J; Ewing, Sidney A; Little, Susan E

2011-08-01

Novel Hepatozoon spp. sequences collected from previously unrecognized vertebrate hosts in North America were compared with documented Hepatozoon 18S rRNA sequences in an effort to examine phylogenetic relationships between the different Hepatozoon organisms found cycling in nature. An approximately 500-base pair fragment of 18S rDNA common to Hepatozoon spp. and some other apicomplexans was amplified and sequenced from the tissues or blood of 16 vertebrate host species from the southern United States, including 1 opossum (Didelphis virginiana), 2 bobcats (Lynx rufus), 1 domestic cat (Felis catus), 3 coyotes (Canis latrans), 1 gray fox (Urocyon cinereoargenteus), 4 raccoons (Procyon lotor), 1 pet boa constrictor (Boa constrictor imperator), 1 swamp rabbit (Sylvilagus aquaticus), 1 cottontail rabbit (Sylvilagus floridanus), 4 woodrats (Neotoma fuscipes and Neotoma micropus), 3 white-footed mice (Peromyscus leucopus), 8 cotton rats (Sigmodon hispidus), 1 cotton mouse (Peromyscus gossypinus), 1 eastern grey squirrel (Sciurus carolinensis), and 1 woodchuck (Marmota monax). Phylogenetic analyses and comparison with sequences in the existing database revealed distinct groups of Hepatozoon spp., with clusters formed by sequences obtained from scavengers and carnivores (opossum, raccoons, canids, and felids) and those obtained from rodents. Surprisingly, Hepatozoon spp. sequences from wild rabbits were most closely related to sequences obtained from carnivores (97.2% identical), and the sequence from the boa constrictor was most closely related to the rodent cluster (97.4% identical). These data are consistent with recent work identifying prey-predator transmission cycles in Hepatozoon spp. and suggest this pattern may be more common than previously recognized.

Deinococcus antarcticus sp. nov., isolated from soil.

Science.gov (United States)

Dong, Ning; Li, Hui-Rong; Yuan, Meng; Zhang, Xiao-Hua; Yu, Yong

2015-02-01

A pink-pigmented, non-motile, coccoid bacterial strain, designated G3-6-20(T), was isolated from a soil sample collected in the Grove Mountains, East Antarctica. This strain was resistant to UV irradiation (810 J m(-2)) and slightly more sensitive to desiccation as compared with Deinococcus radiodurans. Phylogenetic analyses based on the 16S rRNA gene sequence of the isolate indicated that the organism belongs to the genus Deinococcus. Highest sequence similarities were with Deinococcus ficus CC-FR2-10(T) (93.5 %), Deinococcus xinjiangensis X-82(T) (92.8 %), Deinococcus indicus Wt/1a(T) (92.5 %), Deinococcus daejeonensis MJ27(T) (92.3 %), Deinococcus wulumuqiensis R-12(T) (92.3 %), Deinococcus aquaticus PB314(T) (92.2 %) and Deinococcus radiodurans DSM 20539(T) (92.2 %). Major fatty acids were C18 : 1ω7c, summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c), anteiso-C15 : 0 and C16 : 0. The G+C content of the genomic DNA of strain G3-6-20(T) was 63.1 mol%. Menaquinone 8 (MK-8) was the predominant respiratory quinone. Based on its phylogenetic position, and chemotaxonomic and phenotypic characteristics, strain G3-6-20(T) represents a novel species of the genus Deinococcus, for which the name Deinococcus antarcticus sp. nov. is proposed. The type strain is G3-6-20(T) ( = DSM 27864(T) = CCTCC AB 2013263(T)). © 2015 IUMS.

The influence of insecticide exposure and environmental stimuli on the movement behaviour and dispersal of a freshwater isopod.

Science.gov (United States)

Augusiak, Jacqueline; Van den Brink, Paul J

2016-09-01

Behaviour links physiological function with ecological processes and can be very sensitive towards environmental stimuli and chemical exposure. As such, behavioural indicators of toxicity are well suited for assessing impacts of pesticides at sublethal concentrations found in the environment. Recent developments in video-tracking technologies offer the possibility of quantifying behavioural patterns, particularly locomotion, which in general has not been studied and understood very well for aquatic macroinvertebrates to date. In this study, we aim to determine the potential effects of exposure to two neurotoxic pesticides with different modes of action at different concentrations (chlorpyrifos and imidacloprid) on the locomotion behaviour of the water louse Asellus aquaticus. We compare the effects of the different exposure regimes on the behaviour of Asellus with the effects that the presence of food and shelter exhibit to estimate the ecological relevance of behavioural changes. We found that sublethal pesticide exposure reduced dispersal distances compared to controls, whereby exposure to chlorpyrifos affected not only animal activity but also step lengths while imidacloprid only slightly affected step lengths. The presence of natural cues such as food or shelter induced only minor changes in behaviour, which hardly translated to changes in dispersal potential. These findings illustrate that behaviour can serve as a sensitive endpoint in toxicity assessments. However, under natural conditions, depending on the exposure concentration, the actual impacts might be outweighed by environmental conditions that an organism is subjected to. It is, therefore, of importance that the assessment of toxicity on behaviour is done under relevant environmental conditions.

Molecular basis of a novel adaptation to hypoxic-hypercapnia in a strictly fossorial mole

Directory of Open Access Journals (Sweden)

Bonaventura Joseph

2010-07-01

Full Text Available Abstract Background Elevated blood O2 affinity enhances survival at low O2 pressures, and is perhaps the best known and most broadly accepted evolutionary adjustment of terrestrial vertebrates to environmental hypoxia. This phenotype arises by increasing the intrinsic O2 affinity of the hemoglobin (Hb molecule, by decreasing the intracellular concentration of allosteric effectors (e.g., 2,3-diphosphoglycerate; DPG, or by suppressing the sensitivity of Hb to these physiological cofactors. Results Here we report that strictly fossorial eastern moles (Scalopus aquaticus have evolved a low O2 affinity, DPG-insensitive Hb - contrary to expectations for a mammalian species that is adapted to the chronic hypoxia and hypercapnia of subterranean burrow systems. Molecular modelling indicates that this functional shift is principally attributable to a single charge altering amino acid substitution in the β-type δ-globin chain (δ136Gly→Glu of this species that perturbs electrostatic interactions between the dimer subunits via formation of an intra-chain salt-bridge with δ82Lys. However, this replacement also abolishes key binding sites for the red blood cell effectors Cl-, lactate and DPG (the latter of which is virtually absent from the red cells of this species at δ82Lys, thereby markedly reducing competition for carbamate formation (CO2 binding at the δ-chain N-termini. Conclusions We propose this Hb phenotype illustrates a novel mechanism for adaptively elevating the CO2 carrying capacity of eastern mole blood during burst tunnelling activities associated with subterranean habitation.

Işıklı Gölü ve Kaynaklarının (Çivril-Denizli Crustacea Faunası.

Directory of Open Access Journals (Sweden)

Cem Aygen

2015-12-01

Full Text Available Bu çalışmada, Işıklı Gölü Crustacea faunasının taksonomik açıdan incelenmesi hedeflenmiştir. Bu amaçla Şubat 1998-Ocak 1999 ayları arasında, gölde ve göle akan kaynak bölgesinde belirlenen 6 istasyondan aylık periyotlarla biyolojik örnekler ve su örnekleri alınmıştır. Araştırma sonunda Işıklı Gölü ve Kaynağı’nda bulunan Crustacea faunasının başlıca Cladocera (16 tür, Copepoda (12 tür, Ostracoda (1 tür, Amphipoda (2 tür, Isopoda (1 tür, Mysidacea (1 tür ve Decapoda (1 tür gruplarından oluştuğu saptanmıştır. Tespit edilen türlerden Cladocera grubundan Diaphanosoma brachyurum, Diaphanosoma mongolianum, Ceriodaphnia pulchella, Simocephalus vetulus, Macrothrix laticornis, Alona rectangula, Alona guttata, Graptoleberis testudinaria, Leydigia leydigi, Biapertura affinis, Chydorus sphaericus, Pleuroxus aduncus ve Disparalona rostrata; Copepoda grubundan Macrocyclops albidus, Eucyclops serrulatus, Eucyclops speratus, Eucyclops macruroides, Metacyclops gracilis, Mesocyclops leuckarti, Cyclops vicinus, Cyclops abyssorum, Cyclops strenuus, Megacyclops viridis, Acanthocyclops robustus, Canthocamptus staphylinus; Ostracoda grubundan Psychrodromus olivaceus; Amphipoda grubundan Gammarus balcanicus, Gammarus obnixus; Isopoda grubundan Asellus aquaticus türleri Işıklı Gölü’nden ilk kez bildirilmektedir

Male behaviors reveal multiple pherotypes within vine mealybug Planococcus ficus (Signoret) (Hemiptera; Pseudococcidae) populations

Science.gov (United States)

Kol-Maimon, Hofit; Levi-Zada, Anat; Franco, José Carlos; Dunkelblum, Ezra; Protasov, Alex; Eliyaho, Miriam; Mendel, Zvi

2010-12-01

The vine mealybug (VM) females collected in Israel produce two sex pheromone compounds: lavandulyl senecioate (LS) and ( S)-lavandulyl isovalerate (LI). The males display ambiguous behavior to LI: repulsion in the vineyard and attraction of laboratory-reared males. We addressed the question of individual male behavior, i.e., do males respond to both LS and LI, or might they display a distinct response to each of the two pheromone compounds. We compared male pherotype frequencies between wild-caught and laboratory-reared populations. Then, we examined the relationship between pherotype composition and male capture rates in pheromone traps. Finally, we addressed the heredity of the pherotypes. The Israeli VM populations contain nine different male pherotypes, as defined according to the male behavior to pheromone compounds. The studied Portuguese populations included five of the nine pherotypes; none of the Portuguese males were attracted to LI. It seems that the high frequency of males that were attracted to LI is related to dense VM populations. It is hypothesized that selection for the male pherotypes, I males, those that respond to LI, occur under high-density rearing conditions. This may result from shorter development times of males and females that produce more I male pherotypes. The lower relative frequency of trapping of males in LI-baited traps than expected from the percentage determined in a Petri dish arena suggests that males that respond solely to LS (S males) are better fliers. The results also suggest that the pherotype trait is inherited by both sexes of the VM.

[Odocoileus virginianus diet (Artiodactyla: Cervidae) in a temperate forest of Northern Oaxaca, Mexico].

Science.gov (United States)

González, Graciela; Briones-Salas, Miguel

2012-03-01

The Sierra Madre de Oaxaca region, located in the Northern state of Oaxaca, Mexico, is an area of forest ecosystems subject to high exploitation rates, although in some areas its temperate forests are conserved by indigenous community initiatives that live there. We analyzed the diet of white tailed-deer (Odocoileus virginianus) in the localities of Santa Catarina Lachatao and San Miguel Amatlán from June 1998 to August 1999. Sampling was done during both the wet and dry seasons, and included the observation of browsing traces (238 observations), microhistological analysis of deer feces (28 deer pellet-groups), and two stomach content analysis. The annual diet of white-tailed deer was composed of 42 species from 23 botanical families. The most represented families in the diet of this deer were Fagaceae, Asteraceae, Ericaceae and Fabaceae. There were significant differences in the alpha diversity of the diet during the wet and dry seasons (H'=2.957 and H'=1.832, respectively). The similarity percentage between seasons was 56%. Differences in plant species frequency were significantly higher during the wet season. Herbaceous plants made up the greatest percentage of all the species consumed. The preferred species throughout the year were Senecio sp. (shrub), Sedum dendroideum (herbaceous), Arctostaphylos pungens (shrub) and Satureja macrostema (shrub). Diet species richness was found to be lower than that observed in a tropical forest (Venezuela), tropical dry forest (Mexico) and temperate deciduous and mixed forest (Mexico), but similar to the diet species richness observed in a tropical dry forest (Costa Rica) and temperate coniferous and deciduous forests (USA).

Conncomitant bovine viral diarrhea, mycotoxicosis, and seneciosis in cattle from northern Paraná, Brazil

Directory of Open Access Journals (Sweden)

Selwyn Arligton Headley

2014-10-01

Full Text Available This study investigated the causes of mortality in cattle from northern Paraná, southern Brazil, during which 9.5% (23/242 of Nellore cows died after clinical manifestations of uncoordinated gait, fever, transient bloody diarrhea, dyspnea, and lateral decumbency. All cattle were maintained on poor pastures, and ingested moldy silage and sprouts of Senecio brasiliensis. Serum samples (n=17 were collected for virus neutralizing (VN antibodies assays against bovine viral diarrhea virus (BVDV and bovine herpesvirus 1 (BoHV-1. Three cows were necropsied; fragment of tissue samples collected during necropsy from two cows were used in polymerase chain reaction (PCR and reverse transcription- PCR assays to identify BoHV-1 and BVDV; blood samples (n=6 were obtained for hematological and biochemical analyses. Significant gross findings of all cows included increased liver consistency, intestinal bleeding, and pulmonary hemorrhage. Histopathology revealed hepatic fibrosis, hemorrhagic enteritis, renal tubular necrosis, pulmonary hemorrhage, and widespread vasculitis. All serum samples contained VN antibodies against BoHV-1, but only four of these reacted positively to BVDV. The RTPCR assays amplified specific amplicons of the untranslated region of BVDV from tissues samples of both animals; direct sequencing and sequence analyses demonstrated that these sequences clustered within the BVDV subgenotype 1d; all PCRs were negative for BoHV-1. Toxicological analyses of the moldy silage demonstrated elevated concentrations of ochratoxin (75.94 ?g/kg. Laboratory evaluations revealed renal and hepatic dysfunctions. These findings confirmed the combined actions of BVDV-1d infection and toxicosis by mycotoxin and S. brasiliensis in cattle mortality at this farm.

Quantitative analysis of total retronecine esters-type pyrrolizidine alkaloids in plant by high performance liquid chromatography

International Nuclear Information System (INIS)

Zhang Fang; Wang Changhong; Xiong Aizhen; Wang Wan; Yang Li; Branford-White, Christopher J.; Wang Zhengtao; Bligh, S.W. Annie

2007-01-01

Pyrrolizidine alkaloids (PAs) are alkaloids which typically contain a necine (7-hydroxy-1-hydroxymethyl-6,7-dihydro-5H-pyrrolizidine) base unit, and they can be found in one third of the higher plants around the world. They are hepatotoxic, mutagenic and carcinogenic and pose a threat to human health and safety. A specific, quick and sensitive method is therefore needed to detect and quantify the PAs sometimes in trace amount in herbs, tea or food products. Based on high performance liquid chromatography with prior derivatization of the alkaloids using o-chloranil and Ehrlich's reagent, we report an improved method for quantitative analysis of the total amount of retronecine esters-type pyrrolizidine alkaloids (RET-PAs) in a plant extract. The total quantitation of RET-PAs is achieved because of a common colored retronecine marker, a 7-ethoxy-1-ethoxylmethyl retronecine derivative, is produced with all the different RET-PAs during the derivatization reaction. The chemical identity of the common retronecine marker was characterized on-line by positive mode electrospray ionization mass spectrometry and nuclear magnetic resonance spectroscopy. The limit of detection using the improved method is 0.26 nmol mL -1 and the limit of quantitation is 0.79 nmol mL -1 . The advantages of this method are much enhanced sensitivity in detection and quantitation, and, no restriction on the choice of RET-PA as a calibration standard. Application of the developed method to the quantitation of total RET esters-type PAs in Senecio scandens from different regions of China is also reported

Prevention, early detection and containment of invasive, nonnative plants in the Hawaiian Islands: current efforts and needs

Science.gov (United States)

Christoph Kueffer,; Loope, Lloyd

2009-01-01

Introduction: Invasive, non-native plants (or environmental weeds) have long been recognized as a major threat to the native biodiversity of oceanic islands (Cronk & Fuller, 1995; Denslow, 2003). Globally, several hundred non-native plant species have been reported to have major impacts on natural areas on oceanic islands (Kueffer et al., 2009). In Hawaii, at least some 50 non-native plant species reach dominance in natural areas (Kueffer et al., 2009) and many of them are known to impact ecosystem processes or biodiversity. One example is the invasive Australian tree fern (Cyathea cooperi), which has been shown to be very efficient at utilizing soil nitrogen and can grow six times as rapidly in height, maintain four times more fronds, and produce significantly more fertile fronds per month than the native Hawaiian endemic tree ferns, Cibotium spp. (Durand & Goldstein, 2001a, b). Additionally, while native tree ferns provide an ideal substrate for epiphytic growth of many understory ferns and flowering plants, the Australian tree fern has the effect of impoverishing the understory and failing to support an abundance of native epiphytes (Medeiros & Loope, 1993). Other notorious examples of invasive plant species problematic for biodiversity and ecosystem processes in Hawaii include miconia (Miconia calvescens), strawberry guava (Psidium cattleianum), albizia (Falcataria moluccana), firetree (Morella faya), clidemia (Clidemia hirta), kahili ginger (Hedychium gardnerianum), and fountain grass (Pennisetum setaceum), to name just a few. Fireweed (Senecio madagascariensis) is a recent example of a seriously problematic invasive species for Hawaii’s agriculture and is damaging certain high-elevations native ecosystems as well.

Oral toxicity study of certain plant extracts containing pyrrolizidine alkaloids.

Science.gov (United States)

Şeremet, Oana Cristina; Bărbuceanu, Florica; Ionică, Floriana Elvira; Margină, Denisa Marilena; GuŢu, Claudia Maria; Olaru, Octavian Tudorel; Ilie, Mihaela; Gonciar, Veaceslav; Negreş, Simona; ChiriŢă, Cornel

2016-01-01

Pyrrolizidine alkaloids (PAs) are a class of toxic compounds which are found in plants. Poisoning caused by these toxins is associated with acute and chronic liver damage. Tussilago farfara (coltsfoot), Petasites hybridus (common butterbur), Senecio vernalis (eastern groundsel) and Symphytum officinale (comfrey) are traditional phytotherapic species, which beside the therapeutic bioactive compounds contain PAs. The aim of the paper was to assess the safety of some dry extracts obtained from these species. For the determination of acute toxicity, Organization for Economic Cooperation and Development (OECD) Guideline No. 423 was used. For the determination of repeated dose oral toxicity, Senecionis vernalis herba and Symphyti radix extracts (250 mg÷kg) were administrated, by gavage, for 28 days, and their effects on animal weight, liver and biliary functions, hepatic tissue and oxidative stress were investigated. After the acute toxicity testing, the dry extracts were placed in the GHS Category V (LD50>5000 mg÷kg, p.o.). For the subacute toxicity testing, no death or any signs of toxicity were observed. Also, no significant differences in biochemical parameters were observed between control and treated groups. The observed histopathological lesions were non-specific and were not consistent with the data reported in the literature for PAs exposure. In conclusion, the administration for 28 days, of the tested extracts, in a dose which correspond to a PAs concentration over the limits imposed in some countries, produced no hepatic and biliary toxic effects. Further studies, extended over a longer period of time, are needed in order to determine the safety of plant extracts containing PAs.

Quantitative analysis of total retronecine esters-type pyrrolizidine alkaloids in plant by high performance liquid chromatography

Energy Technology Data Exchange (ETDEWEB)

Zhang Fang; Wang Changhong; Xiong Aizhen; Wang Wan; Yang Li [Key Laboratory of Standardization of Chinese Medicines of Ministry of Education, Shanghai University of Traditional Chinese Medicine, 1200 Cai Lun Road, Zhangjiang Hi-Tech Park, Shanghai 201203 (China); Branford-White, Christopher J. [Institute for Health Research and Policy, London Metropolitan University, 166-220 Holloway Road, London N7 8DB (United Kingdom); Wang Zhengtao [Key Laboratory of Standardization of Chinese Medicines of Ministry of Education, Shanghai University of Traditional Chinese Medicine, 1200 Cai Lun Road, Zhangjiang Hi-Tech Park, Shanghai 201203 (China); School of Chinese Pharmacy, China Pharmaceutical University, Nanjing 210038 (China)], E-mail: wangzt@shutcm.edu.cn; Bligh, S.W. Annie [Institute for Health Research and Policy, London Metropolitan University, 166-220 Holloway Road, London N7 8DB (United Kingdom)], E-mail: a.bligh@londonmet.ac.uk

2007-12-12

Pyrrolizidine alkaloids (PAs) are alkaloids which typically contain a necine (7-hydroxy-1-hydroxymethyl-6,7-dihydro-5H-pyrrolizidine) base unit, and they can be found in one third of the higher plants around the world. They are hepatotoxic, mutagenic and carcinogenic and pose a threat to human health and safety. A specific, quick and sensitive method is therefore needed to detect and quantify the PAs sometimes in trace amount in herbs, tea or food products. Based on high performance liquid chromatography with prior derivatization of the alkaloids using o-chloranil and Ehrlich's reagent, we report an improved method for quantitative analysis of the total amount of retronecine esters-type pyrrolizidine alkaloids (RET-PAs) in a plant extract. The total quantitation of RET-PAs is achieved because of a common colored retronecine marker, a 7-ethoxy-1-ethoxylmethyl retronecine derivative, is produced with all the different RET-PAs during the derivatization reaction. The chemical identity of the common retronecine marker was characterized on-line by positive mode electrospray ionization mass spectrometry and nuclear magnetic resonance spectroscopy. The limit of detection using the improved method is 0.26 nmol mL{sup -1} and the limit of quantitation is 0.79 nmol mL{sup -1}. The advantages of this method are much enhanced sensitivity in detection and quantitation, and, no restriction on the choice of RET-PA as a calibration standard. Application of the developed method to the quantitation of total RET esters-type PAs in Senecio scandens from different regions of China is also reported.

Inclusão de material herborizado em metacrilato para estudos de anatomia vegetal

Directory of Open Access Journals (Sweden)

Meira Renata Maria Strozi Alves

2003-01-01

Full Text Available As técnicas usuais empregadas no processamento de materiais herborizados são limitantes porque não permitem reproduzir um laminário permanente e porque o registro dos resultados é temporário. Em estudos de anatomia aplicada à taxonomia, muitas vezes, é necessário utilizar exsicatas. Este trabalho teve como objetivo testar a utilização de metacrilato (Historesin, Leica na preparação e inclusão de material herborizado, visando a obtenção de laminário permanente. Foram utilizadas folhas de plantas herborizadas do gênero Senecio Tourn. ex L. (Asteraceae, previamente reidratadas em H2O e armazenadas em etanol 70%. As amostras foram desidratadas em série etanólica e submetidas à (1v:1v mistura de AE 95% e resina pura. Durante a infiltração, com resina pura, o material foi submetido a vácuo durante 72 horas. Os blocos foram cortados em micrótomo de avanço automático, com navalhas de aço descartáveis, e os cortes foram corados com azul-de-toluidina (pH 4,0. As lâminas foram montadas em Permount. O laminário permanente obtido apresentou qualidade superior à dos produzidos pelas técnicas usuais, pois foi possível obter cortes seriados, com espessura determinada. Essa técnica possibilitou otimizar a obtenção de cortes, a partir de pequenos fragmentos de exsicatas.

A nonsense mutation causing decreased levels of insulin receptor mRNA: Detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction

International Nuclear Information System (INIS)

Kadowaki, T.; Kadowaki, H.; Taylor, S.I.

1990-01-01

Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA

Food Web Responses to Artificial Mixing in a Small Boreal Lake

Directory of Open Access Journals (Sweden)

Lauri Arvola

2017-07-01

Full Text Available In order to simulate food web responses of small boreal lakes to changes in thermal stratification due to global warming, a 4 year whole-lake manipulation experiment was performed. Within that time, period lake mixing was intensified artificially during two successive summers. Complementary data from a nearby lake of similar size and basic water chemistry were used as a reference. Phytoplankton biomass and chlorophyll a did not respond to the greater mixing depth but an increase was observed in the proportional abundance of diatoms, and the proportional abundance of cryptophytes also increased immediately after the onset of mixing. Obligate anoxic green sulphur bacteria vanished at the onset of mixing but gradually recovered after re-establishment of hypolimnetic anoxic conditions. No major effect on crustacean zooplankton was found, but their diversity increased in the metalimnion. During the mixing, the density of rotifers declined but protozoan density increased in the hypolimnion. Littoral benthic invertebrate density increased during the mixing due to Ephemeroptera, Asellus aquaticus and Chironomidae, whereas the density of Chaoborus larvae declined during mixing and lower densities were still recorded one year after the treatment. No structural changes in fish community were found although gillnet catches increased after the onset of the study. The early growth of perch (Perca fluviatilis increased compared to the years before the mixing and in comparison to the reference lake, suggesting improved food availability in the experimental lake. Although several food web responses to the greater mixing depth were found, their persistence and ecological significance were strongly dependent on the extent of the disturbance. To better understand the impacts of wind stress on small lakes, long term whole-lake experiments are needed.

Genomic footprinting in mammalian cells with ultraviolet light

International Nuclear Information System (INIS)

Becker, M.M.; Wang, Z.; Grossmann, G.; Becherer, K.A.

1989-01-01

A simple and accurate genomic primer extension method has been developed to detect ultraviolet footprinting patterns of regulatory protein-DNA interactions in mammalian genomic DNA. The technique can also detect footprinting or sequencing patterns introduced into genomic DNA by other methods. Purified genomic DNA, containing either damaged bases or strand breaks introduced by footprinting or sequencing reactions, is first cut with a convenient restriction enzyme to reduce its molecular weight. A highly radioactive single-stranded DNA primer that is complementary to a region of genomic DNA whose sequence or footprint one wishes to examine is then mixed with 50 micrograms of restriction enzyme-cut genomic DNA. The primer is approximately 100 bases long and contains 85 radioactive phosphates, each of specific activity 3000 Ci/mmol (1 Ci = 37 GBq). A simple and fast method for preparing such primers is described. Following brief heat denaturation at 100 degrees C, the solution of genomic DNA and primer is cooled to 74 degrees C and a second solution containing Taq polymerase (Thermus aquaticus DNA polymerase) and the four deoxynucleotide triphosphates is added to initiate primer extension of genomic DNA. Taq polymerase extends genomic hybridized primer until its polymerization reaction is terminated either by a damaged base or strand break in genomic DNA or by the addition of dideoxynucleotide triphosphates in the polymerization reaction. The concurrent primer hybridization-extension reaction is terminated after 5 hr and unhybridized primer is digested away by mung bean nuclease. Primer-extended genomic DNA is then denatured and electrophoresed on a polyacrylamide sequencing gel, and radioactive primer extension products are revealed by autoradiography

Interactive effects of an insecticide and a fungicide on different organism groups and ecosystem functioning in a stream detrital food web.

Science.gov (United States)

Dawoud, Mohab; Bundschuh, Mirco; Goedkoop, Willem; McKie, Brendan G

2017-05-01

Freshwater ecosystems are often affected by cocktails of multiple pesticides targeting different organism groups. Prediction and evaluation of the ecosystem-level effects of these mixtures is complicated by the potential not only for interactions among the pesticides themselves, but also for the pesticides to alter biotic interactions across trophic levels. In a stream microcosm experiment, we investigated the effects of two pesticides targeting two organism groups (the insecticide lindane and fungicide azoxystrobin) on the functioning of a model stream detrital food web consisting of a detritivore (Ispoda: Asellus aquaticus) and microbes (an assemblage of fungal hyphomycetes) consuming leaf litter. We assessed how these pesticides interacted with the presence and absence of the detritivore to affect three indicators of ecosystem functioning - leaf decomposition, fungal biomass, fungal sporulation - as well as detritivore mortality. Leaf decomposition rates were more strongly impacted by the fungicide than the insecticide, reflecting especially negative effects on leaf processing by detritivores. This result most like reflects reduced fungal biomass and increased detritivore mortality under the fungicide treatment. Fungal sporulation was elevated by exposure to both the insecticide and fungicide, possibly representing a stress-induced increase in investment in propagule dispersal. Stressor interactions were apparent in the impacts of the combined pesticide treatment on fungal sporulation and detritivore mortality, which were reduced and elevated relative to the single stressor treatments, respectively. These results demonstrate the potential of trophic and multiple stressor interactions to modulate the ecosystem-level impacts of chemicals, highlighting important challenges in predicting, understanding and evaluating the impacts of multiple chemical stressors on more complex food webs in situ. Copyright © 2017 Elsevier B.V. All rights reserved.

Multi-scale habitat selection in highly territorial bird species: Exploring the contribution of nest, territory and landscape levels to site choice in breeding rallids (Aves: Rallidae)

Science.gov (United States)

Jedlikowski, Jan; Chibowski, Piotr; Karasek, Tomasz; Brambilla, Mattia

2016-05-01

Habitat selection often involves choices made at different spatial scales, but the underlying mechanisms are still poorly understood, and studies that investigate the relative importance of individual scales are rare. We investigated the effect of three spatial scales (landscape, territory, nest-site) on the occurrence pattern of little crake Zapornia parva and water rail Rallus aquaticus at 74 ponds in the Masurian Lakeland, Poland. Habitat structure, food abundance and water chemical parameters were measured at nests and random points within landscape plots (from 300-m to 50-m radius), territory (14-m) and nest-site plots (3-m). Regression analyses suggested that the most relevant scale was territory level, followed by landscape, and finally by nest-site for both species. Variation partitioning confirmed this pattern for water rail, but also highlighted the importance of nest-site (the level explaining the highest share of unique variation) for little crake. The most important variables determining the occurrence of both species were water body fragmentation (landscape), vegetation density (territory) and water depth (at territory level for little crake, and at nest-site level for water rail). Finally, for both species multi-scale models including factors from different levels were more parsimonious than single-scale ones, i.e. habitat selection was likely a multi-scale process. The importance of particular spatial scales seemed more related to life-history traits than to the extent of the scales considered. In the case of our study species, the territory level was highly important likely because both rallids have to obtain all the resources they need (nest site, food and mates) in relatively small areas, the multi-purpose territories they defend.

Using a kairomone-based attracting system to enhance biological control of mealybugs (Hemiptera: Pseudococcidae by Anagyrus sp. near pseudococci (Hymenoptera: Encyrtidae in Sicilian vineyards

Directory of Open Access Journals (Sweden)

Ramzi Mansour

2010-11-01

Full Text Available The “potato trap” technique was applied for the fi rst time in Italian (Sicily vineyards in an attempt to assess: a the impact of the kairomonal activity of the vine mealybug sex pheromone (S-(+-lavandulyl senecioate (LS on the parasitism of mealybugs by the encyrtid Anagyrus sp. near pseudococci, b the influence of two commonly used insecticides on the parasitization activity of A. sp. near pseudococci towards mealybugs, and c the efficiency of the release of A. sp. near pseudococci in enhancing parasitism rates of mealybugs. The number of captured A. sp. near pseudococci females in LS baited traps was significantly higher than that in unbaited traps. The minimal number of days for the first parasitoid emergence in LS baited traps was almost 3 days earlier, compared to unbaited control, suggesting a faster host detection by the encyrtid when LS is applied. These findings resulted in a significant increase in parasitism of mealybugs by A. sp. near pseudococci in LS baited traps relative to unbaited traps suggesting that the LS is used by the encyrtid as kairomone to ensure greater potential for host searching activity. Insecticide treatments significantly affected parasitization activity of A. sp. near pseudococci on mealybugs when compared to an untreated control with parasitoid release. The buprofezin, chlorpyriphos-methyl and untreated control with no parasitoid release treatments had statistically similar numbers of emerged parasitoids from exposed mealybugs. The obtained results provide evidence that, in the absence of conventional insecticides applications, the use of the LS could be a promising tool to improve and strengthen biological control of mealybugs by A. sp. near pseudococci within Sicilian vineyard conditions.

The response of some common Egyptian plants to ozone and their use as biomonitors.

Science.gov (United States)

El-Khatib, A A

2003-01-01

Relative sensitivity of five common Egyptian plant species namely, Senecio vulgaris, Malva parviflora, Sonchus oleraceus, Medicago sativa and Melilotus indicus to elevated levels of ozone has been studied. The plants were exposed to charcoal filtered air (CFA) and different levels of O3 (50 and 100 ppb) for 5 h per day. The studied parameters were recorded for five consecutive days after fumigation. The foliar injury varied significantly among species in a dose-dependent manner. Severe injury symptoms were recorded on the leaves of M. sativa. With the exception of M. parviflora, all species exhibited significant increases in the percentage reduction of the above-ground dry weight as a result of reductions in both leaf and stem dry weights. M. sativa showed a marked reduction in its relative growth rate at elevated levels of O3. The extent of chlorophyll a destruction was higher in both M. sativa and S. oleraceus than in the other species tested. No differences in the sensitivity of chlorophylls a+b and carotenoids to ozone levels were recorded in this work. Percentage reduction of ascorbic acid was higher in M. sativa and S. oleraceus, compared with the other species studied. With respect to relative percentages of proline, there was a significant difference in the responses of plants to ozone. According to the ozone resistance (R%), measured as relative growth rate, the test species were arranged in the descending order: M. parviflora>M. Indicus>S. Vulgaris>S. Oleraceus>M. sativa. In M. sativa, both determinant and correlation coefficients are well reflected in the relationship between its physiological response, its performance and ozone levels, supporting its recommendation as a candidate for biomonitoring in Egypt.

Traditional medicine in Sakarya province (Turkey) and antimicrobial activities of selected species.

Science.gov (United States)

Uzun, Ergin; Sariyar, Günay; Adsersen, Anne; Karakoc, Berna; Otük, Gülten; Oktayoglu, Ercan; Pirildar, Sevda

2004-12-01

Traditional medicine in North-West of Turkey (Sakarya province) were studied during a 2 months field study by interviewing local informants from several villages. Plant species used to treat infections were tested for antimicrobial activity. Information was collected for 46 plant species from 30 families and for 5 animal species. Twenty four of the plant species were cultivated. Most used families were Asteraceae, Cucurbitaceae, Lamiaceae and Rosaceae and the most used plants were Artemisia absinthium, Equisetum telmateia, Lavandula stoechas, Melissa officinalis, Tussilago farfara and Urtica dioica. A total of 139 medicinal uses were obtained. Plants are used mainly for infectious diseases (18%), for neurological and psychological disorders (13.7%), cardiovascular disorders (13%), skin disorders (12.2%) and respiratory disorders (10.1%). Extracts were tested in vitro for antimicrobial activity against Staphylococcus aureus ATCC 65538, Staphylococcus epidermidis ATCC 12228, Escherichia coli ATCC 8739, Klebsiella pneumonia ATCC 4352, Pseudomonas aeruginosa ATCC 1539, Salmonella typhi, Shigella flexneri, Proteus mirabilis and Candida albicans ATCC 10231, using microbroth dilution technique according to National Committee for Clinical Laboratory Standards (NCCLS). This research showed that Arum maculatum, Datura stramonium, Geranium asphodeloides and Equisetum telmateia petroleum ether extracts had MIC values of 39.1 microg/ml, 78.1 microg/ml, 78.1 microg/ml and 39.1 microg/ml, respectively against Staphylococcus epidermidis. Datura stramonium petroleum ether extract had a MIC value of 39.1 microg/ml against Escherichia coli and Trachystemon orientalis ethanol extract had a MIC value of 39.1 microg/ml against Escherichia coli. The antimicrobial activity of Arum maculatum, Equisetum telmateia, Geranium asphodeloides, Plantago intermedia, Senecio vulgaris and Trachystemon orientalis has been reported here for the first time.

Involvement of Bcl-xL degradation and mitochondrial-mediated apoptotic pathway in pyrrolizidine alkaloids-induced apoptosis in hepatocytes

International Nuclear Information System (INIS)

Ji Lili; Chen Ying; Liu Tianyu; Wang Zhengtao

2008-01-01

Pyrrolizidine alkaloids (PAs) are natural hepatotoxins with worldwide distribution in more than 6000 high plants including medicinal herbs or teas. The aim of this study is to investigate the signal pathway involved in PAs-induced hepatotoxicity. Our results showed that clivorine, isolated from Ligularia hodgsonii Hook, decreased cell viability and induced apoptosis in L-02 cells and mouse hepatocytes. Western-blot results showed that clivorine induced caspase-3/-9 activation, mitochondrial release of cytochrome c and decreased anti-apoptotic Bcl-xL in a time (8-48 h)- and concentration (1-100 μM)-dependent manner. Furthermore, inhibitors of pan-caspase, caspase-3 and caspase-9 significantly inhibited clivorine-induced apoptosis and rescued clivorine-decreased cell viability. Polyubiquitination of Bcl-xL was detected after incubation with 100 μM clivorine for 40 h in the presence of proteasome specific inhibitor MG132, indicating possible degradation of Bcl-xL protein. Furthermore, pretreatment with MG132 or calpain inhibitor I for 2 h significantly enhanced clivorine-decreased Bcl-xL level and cell viability. All the other tested PAs such as senecionine, isoline and monocrotaline decreased mouse hepatocytes viability in a concentration-dependent manner. Clivorine (10 μM) induced caspase-3 activation and decreased Bcl-xL was also confirmed in mouse hepatocytes. Meanwhile, another PA senecionine isolated from Senecio vulgaris L also induced apoptosis, caspase-3 activation and decreased Bcl-xL in mouse hepatocytes. In conclusion, our results suggest that PAs may share the same hepatotoxic signal pathway, which involves degradation of Bcl-xL protein and thus leading to the activation of mitochondrial-mediated apoptotic pathway

The weed composition in an orchard as a result of long-term foliar herbicide application

Directory of Open Access Journals (Sweden)

Maria Licznar-Małańczuk

2016-09-01

Full Text Available The weed composition and the dominance of individual species occurring in an orchard were assessed at the Research Station of the Wrocław University of Environmental and Life Sciences, Poland, during the first 10 years after orchard establishment. ‘Ligol’ apple trees were planted in the spring of 2004 (3.5 × 1.2 m. Foliar herbicides were applied in 1 m wide tree rows twice or three times per each vegetation period. In the inter-row spaces, perennial grass was maintained. Ten years of maintenance of herbicide fallow contributed to a change in the weed composition in the orchard. It changed as a result of different responses of the most important weed species to the foliar herbicides. Total suppression of Elymus repens was observed in the first year after planting the trees. Convolvulus arvensis, Cirsium arvense, and other perennial weeds, completely disappeared in the succeeding periods. The maintenance of herbicide fallow did not affect the abundance of Taraxacum officinale. The percentage of the soil surface covered by Trifolium repens and Epilobium adenocaulon, perennial weeds with considerable tolerance to post-emergence herbicides, increased during the fruit-bearing period of the trees. The abundance of these weeds was significantly reduced only in the rows with the stronger growing trees on the semi-dwarf P 2 rootstock. Stellaria media was the dominant annual weed. Senecio vulgaris, Poa annua, Capsella bursa-pastoris, and Lamium spp. were also frequently observed. A significant increase in the abundance of annual and perennial weeds was found in the tree rows as a result of improved water availability after a period of high precipitation.

Gradients in microbial methanol uptake: productive coastal upwelling waters to oligotrophic gyres in the Atlantic Ocean

Science.gov (United States)

Dixon, Joanna L; Sargeant, Stephanie; Nightingale, Philip D; Colin Murrell, J

2013-01-01

Methanol biogeochemistry and its importance as a carbon source in seawater is relatively unexplored. We report the first microbial methanol carbon assimilation rates (k) in productive coastal upwelling waters of up to 0.117±0.002 d−1 (∼10 nmol l−1 d−1). On average, coastal upwelling waters were 11 times greater than open ocean northern temperate (NT) waters, eight times greater than gyre waters and four times greater than equatorial upwelling (EU) waters; suggesting that all upwelling waters upon reaching the surface (⩽20 m), contain a microbial population that uses a relatively high amount of carbon (0.3–10 nmol l−1 d−1), derived from methanol, to support their growth. In open ocean Atlantic regions, microbial uptake of methanol into biomass was significantly lower, ranging between 0.04–0.68 nmol l−1 d−1. Microbes in the Mauritanian coastal upwelling used up to 57% of the total methanol for assimilation of the carbon into cells, compared with an average of 12% in the EU, and 1% in NT and gyre waters. Several methylotrophic bacterial species were identified from open ocean Atlantic waters using PCR amplification of mxaF encoding methanol dehydrogenase, the key enzyme in bacterial methanol oxidation. These included Methylophaga sp., Burkholderiales sp., Methylococcaceae sp., Ancylobacter aquaticus, Paracoccus denitrificans, Methylophilus methylotrophus, Methylobacterium oryzae, Hyphomicrobium sp. and Methylosulfonomonas methylovora. Statistically significant correlations for upwelling waters between methanol uptake into cells and both chlorophyll a concentrations and methanol oxidation rates suggest that remotely sensed chlorophyll a images, in these productive areas, could be used to derive total methanol biological loss rates, a useful tool for atmospheric and marine climatically active gas modellers, and air–sea exchange scientists. PMID:23178665

Responses of aquatic organisms to metal pollution in a lowland river in Flanders: A comparison of diatoms and macroinvertebrates

International Nuclear Information System (INIS)

Jonge, Maarten de; Vijver, Bart van de; Blust, Ronny; Bervoets, Lieven

2008-01-01

The role of macroinvertebrates and diatoms as indicator for metal pollution was investigated by assessing both biota along a metal gradient in the Belgian river the Dommel. Macroinvertebrates and diatoms were sampled in summer and winter and physical-chemical characteristics of the water were measured at four different sample periods and related to sediment characteristics. Although metal concentrations, except cadmium, in the water nowhere exceeded water quality standards, high metal concentrations were measured in the sediment, indicating historical contamination of the Dommel. At the sites that were situated downstream of the pollution source, high levels of conductivity and chloride were measured in the water. Redundancy Analysis (RDA) indicated pH, phosphate and zinc as the significant environmental variables explaining each respectively 7.7%, 11.6% and 22.6% of the macroinvertebrate community composition. Two clusters could be separated, with Gammarus pulex, Leptocerus interruptus, Baetis rhodani and Cloeon dipterum associated with low zinc concentrations and Tubificidae, Asellus aquaticus, Erpobdella sp. and Chironomus thummi-plumosus associated with higher zinc concentrations. Ammonium (10.6%), conductivity (16.5%), chloride (11.4%) and zinc (5.9%) turned out to be significant variables explaining the diatom community structure. Based on physical-chemical differences and species composition, three different groups could be separated. With this Tabellaria flocculosa and Fragilaria capucina var. rumpens were associated with low metal concentrations, Gomphonema parvulum and Nitzschia palea with elevated concentrations and Eolimna minima and Sellaphora seminulum with high zinc concentrations. In conclusion, the diatom community best reflected the metal gradient. With regard to water quality indices, those based on macroinvertebrates best followed the metal pollution gradient and were most strongly correlated with physical-chemical variables of water and

Responses of aquatic organisms to metal pollution in a lowland river in Flanders: A comparison of diatoms and macroinvertebrates

Energy Technology Data Exchange (ETDEWEB)

Jonge, Maarten de [Department of Biology, Ecophysiology, Biochemistry and Toxicology Group, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)], E-mail: maarten.dejonge@ua.ac.be; Vijver, Bart van de [Department of Bryophytes and Thallophytes, National Botanic Garden of Belgium, Domein van Bouchout, 1860 Meise (Belgium); Blust, Ronny; Bervoets, Lieven [Department of Biology, Ecophysiology, Biochemistry and Toxicology Group, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)

2008-12-15

The role of macroinvertebrates and diatoms as indicator for metal pollution was investigated by assessing both biota along a metal gradient in the Belgian river the Dommel. Macroinvertebrates and diatoms were sampled in summer and winter and physical-chemical characteristics of the water were measured at four different sample periods and related to sediment characteristics. Although metal concentrations, except cadmium, in the water nowhere exceeded water quality standards, high metal concentrations were measured in the sediment, indicating historical contamination of the Dommel. At the sites that were situated downstream of the pollution source, high levels of conductivity and chloride were measured in the water. Redundancy Analysis (RDA) indicated pH, phosphate and zinc as the significant environmental variables explaining each respectively 7.7%, 11.6% and 22.6% of the macroinvertebrate community composition. Two clusters could be separated, with Gammarus pulex, Leptocerus interruptus, Baetis rhodani and Cloeon dipterum associated with low zinc concentrations and Tubificidae, Asellus aquaticus, Erpobdella sp. and Chironomus thummi-plumosus associated with higher zinc concentrations. Ammonium (10.6%), conductivity (16.5%), chloride (11.4%) and zinc (5.9%) turned out to be significant variables explaining the diatom community structure. Based on physical-chemical differences and species composition, three different groups could be separated. With this Tabellaria flocculosa and Fragilaria capucina var. rumpens were associated with low metal concentrations, Gomphonema parvulum and Nitzschia palea with elevated concentrations and Eolimna minima and Sellaphora seminulum with high zinc concentrations. In conclusion, the diatom community best reflected the metal gradient. With regard to water quality indices, those based on macroinvertebrates best followed the metal pollution gradient and were most strongly correlated with physical-chemical variables of water and

Sphagnum mosses as a microhabitat for invertebrates in acidified lakes and the colour adaptation and substrate preference in Leucorrhinia dubia (Odonata, Anisoptera)

Energy Technology Data Exchange (ETDEWEB)

Henrikson, B.-I. (Dept. of Zoology, Sect. of Animal Ecology, Univ. of Goeteborg, Goeteborg (Sweden))

1993-01-01

The increase of peat mosses, Sphagnum spp., in acidified lakes leads to a changed microhabitat structure for benthic invertebrates. The importance of this change was investigated for some benthic invertebrates. Comparisons between quantitative samples of Sphagnum and debris within the acidified Lake Stora Haestevatten, in the Lake Gaardsjoen catchment of SW Sweden, showed significantly higher abundances of Chironomidae, Ceratopogonidae, Odonata, Trichoptera, Cladocera and Argyroneta aquatica (Araneae) in Sphagnum. For chironomidae and Cladocera the differences were tenfold. Special reference was made to the libellulid Leucorrhinia dubia which is common in acid lakes. In a laboratory test, late instar larvae of L. dubia were shown to change colour to correspond to the brown and green colour of Sphagnum. This result was completed with a field test where larvae of L. dubia were significantly more common in Sphagnum of the same colour as the larvae. The ability to change colour may have an adaptive value when coexisting with visual predators. Small larvae were more prevalent in Sphagnum and they also showed a preference for this substrate in the laboratory test. Laboratory tests showed mediumsized larvae preferred Sphagnum. Larvae of L. dubia were more successful as predators on Asellus aquaticus in Sphagnum substrate than in debris in the laboratory test. Laboratory predation tests with notonecta glauca, Corixa dentipes, Acilius sulcatus, Hyphydrus ovatus and L. dubia showed that they could all feed on larvae of L. dubia. The complex habitat structure of Sphagnum is probably the reason for the high abundance of invertebrates since it may serve as both shelter against predation and as foraging sites. it is probably important as a key habitat for young instars of, for example, L. dubia. In lakes with large Sphagnum mats, L. dubia can coexist with fish. The expansion of Sphagnum due to acidification will probably benefit many acid-tolerant invertebrate species. (au)

Importância econômica, epidemiologia e controle das intoxicações por plantas no Brasil

Directory of Open Access Journals (Sweden)

Clarice R.M. Pessoa

2013-06-01

Full Text Available A importância econômica, epidemiologia e controle das intoxicações por plantas em animais domésticos no Brasil são revisadas. Com os dados dos laboratórios de diagnóstico de diferentes regiões do país, as perdas anuais por mortes de animais foram estimadas em 820.761 a 1.755.763 bovinos, 399.800 a 445.309 ovinos, 52.675 a 63.292 caprinos e 38.559 equinos. No Brasil, atualmente, o número de plantas tóxicas é de 131 espécies e 79 gêneros e aumenta permanentemente. No entanto, a maioria das perdas são causadas por poucas plantas, incluindo Palicourea marcgravii, Amorimia spp., Senecio spp., Pteridium aquilinum, Ateleia glazioviana e Cestrum laevigatum em bovinos, Brachiaria spp em bovinos e ovinos, Nierembergia veitchii, Mimosa tenuiflora e Ipomoea asarifolia em ovinos, plantas que contêm swainsonina (Ipomoea carnea, Turbina cordata e Sida carpinifolia em caprinos e Brachiaria humidicola e Crotalaria retusa em equinos. Os principais fatores epidemiológicos relacionados às intoxicações por plantas incluem palatabilidade, fome, sede, facilitação social, desconhecimento da planta, acesso a plantas tóxicas, dose tóxica, período de ingestão, variações de toxicidade e resistência/susceptibilidade dos animais às intoxicações. Quanto aos métodos de controle e profilaxia descrevem-se os resultados obtidos no Brasil com métodos recentemente desenvolvidos, incluindo controle biológico, aversão alimentar condicionada, utilização de variedades não tóxicas de forrageiras, utilização de animais resistentes às intoxicações e técnicas de indução de resistência.

Environmentally induced development costs underlie fitness tradeoffs.

Science.gov (United States)

Walter, Greg M; Wilkinson, Melanie J; Aguirre, J David; Blows, Mark W; Ortiz-Barrientos, Daniel

2018-06-01

Local adaptation can lead to genotype-by-environment interactions, which can create fitness tradeoffs in alternative environments, and govern the distribution of biodiversity across geographic landscapes. Exploring the ecological circumstances that promote the evolution of fitness tradeoffs requires identifying how natural selection operates and during which ontogenetic stages natural selection is strongest. When organisms disperse to areas outside their natural range, tradeoffs might emerge when organisms struggle to reach key life history stages, or alternatively, die shortly after reaching life history stages if there are greater risks of mortality associated with costs to developing in novel environments. We used multiple populations from four ecotypes of an Australian native wildflower (Senecio pinnatifolius) in reciprocal transplants to explore how fitness tradeoffs arise across ontogeny. We then assessed whether the survival probability for plants from native and foreign populations was contingent on reaching key developmental stages. We found that fitness tradeoffs emerged as ontogeny progressed when native plants were more successful than foreign plants at reaching seedling establishment and maturity. Native and foreign plants that failed to reach seedling establishment died at the same rate, but plants from foreign populations died quicker than native plants after reaching seedling establishment, and died quicker regardless of whether they reached sexual maturity or not. Development rates were similar for native and foreign populations, but changed depending on the environment. Together, our results suggest that natural selection for environment-specific traits early in life history created tradeoffs between contrasting environments. Plants from foreign populations were either unable to develop to seedling establishment, or they suffered increased mortality as a consequence of reaching seedling establishment. The observation of tradeoffs together with

The response of some common Egyptian plants to ozone and their use as biomonitors

International Nuclear Information System (INIS)

El-Khatib, A.A.

2003-01-01

Growth and physiological response of plants was shown to be an effective tool for O 3 -biomonitoring. - Relative sensitivity of five common Egyptian plant species namely, Senecio vulgaris, Malva parviflora, Sonchus oleraceus, Medicago sativa and Melilotus indicus to elevated levels of ozone has been studied. The plants were exposed to charcoal filtered air (CFA) and different levels of O 3 (50 and 100 ppb) for 5 h per day. The studied parameters were recorded for five consecutive days after fumigation. The foliar injury varied significantly among species in a dose-dependent manner. Severe injury symptoms were recorded on the leaves of M. sativa. With the exception of M. parviflora, all species exhibited significant increases in the percentage reduction of the above-ground dry weight as a result of reductions in both leaf and stem dry weights. M. sativa showed a marked reduction in its relative growth rate at elevated levels of O 3 . The extent of chlorophyll a destruction was higher in both M. sativa and S. oleraceus than in the other species tested. No differences in the sensitivity of chlorophylls a+b and carotenoids to ozone levels were recorded in this work. Percentage reduction of ascorbic acid was higher in M. sativa and S. oleraceus, compared with the other species studied. With respect to relative percentages of proline, there was a significant difference in the responses of plants to ozone. According to the ozone resistance (R%), measured as relative growth rate, the test species were arranged in the descending order: M. parviflora>M. Indicus>S. Vulgaris>S. Oleraceus>M. sativa. In M. sativa, both determinant and correlation coefficients are well reflected in the relationship between its physiological response, its performance and ozone levels, supporting its recommendation as a candidate for biomonitoring in Egypt

The response of some common Egyptian plants to ozone and their use as biomonitors

Energy Technology Data Exchange (ETDEWEB)

El-Khatib, A A

2003-08-01

Growth and physiological response of plants was shown to be an effective tool for O{sub 3}-biomonitoring. - Relative sensitivity of five common Egyptian plant species namely, Senecio vulgaris, Malva parviflora, Sonchus oleraceus, Medicago sativa and Melilotus indicus to elevated levels of ozone has been studied. The plants were exposed to charcoal filtered air (CFA) and different levels of O{sub 3} (50 and 100 ppb) for 5 h per day. The studied parameters were recorded for five consecutive days after fumigation. The foliar injury varied significantly among species in a dose-dependent manner. Severe injury symptoms were recorded on the leaves of M. sativa. With the exception of M. parviflora, all species exhibited significant increases in the percentage reduction of the above-ground dry weight as a result of reductions in both leaf and stem dry weights. M. sativa showed a marked reduction in its relative growth rate at elevated levels of O{sub 3}. The extent of chlorophyll a destruction was higher in both M. sativa and S. oleraceus than in the other species tested. No differences in the sensitivity of chlorophylls a+b and carotenoids to ozone levels were recorded in this work. Percentage reduction of ascorbic acid was higher in M. sativa and S. oleraceus, compared with the other species studied. With respect to relative percentages of proline, there was a significant difference in the responses of plants to ozone. According to the ozone resistance (R%), measured as relative growth rate, the test species were arranged in the descending order: M. parviflora>M. Indicus>S. Vulgaris>S. Oleraceus>M. sativa. In M. sativa, both determinant and correlation coefficients are well reflected in the relationship between its physiological response, its performance and ozone levels, supporting its recommendation as a candidate for biomonitoring in Egypt.

Females engage in stronger relationships: positive and negative effects of shrubs are more intense for Poa ligularis females than for males.

Science.gov (United States)

Graff, Pamela; Aguiar, Martin R; Almeida, Rocio J

2018-05-22

Dioecious plants are of particular concern in view of global environmental changes because reproductive females are more sensitive to abiotic stresses, thus compromising population viability. Positive interactions with other plants may counteract the direct effects of any abiotic environmental stress, allowing them to thrive and maintain a viable population in suboptimal habitats, although this process has not been tested for dioecious species. Furthermore, almost no data are available on the outcome of such species interactions and their link with local spatial patterns and sex ratios. We set up a field experiment with Poa ligularis, a dioecious native grass from the arid grasslands of South America. We studied the interaction of male and female plants with cushion shrubs of contrasting ecological strategies. We experimentally limited direct shrub-grass competition for soil moisture and transplanted plants to evaluate the amelioration of abiotic stress by shrub canopies (i.e. sun and wind) on grasses. We also studied the distribution of naturally established female and male plants to infer process-pattern relationships. Positive canopy effects as well as negative below-ground effects were more intense for females than for males. Deep-rooted Mulinum spinosum shrubs strongly facilitated survival, growth and reproduction of P. ligularis females. Naturally established female plants tended to distribute more closely to Mulinum than co-occurring males. Female growth suffered intensive negative root competition from the shallow-rooted Senecio filaginoides shrub. Interactions with other plants may reduce or enhance the effect of abiotic stresses on the seemingly maladapted sex to arid environments. We found that these biased interactions are evident in the current organization of sexes in the field, confirming our experimental findings. Therefore, indirect effects of climate change on population sex ratios may be expected if benefactor species abundances are

Rapid plant invasion in distinct climates involves different sources of phenotypic variation.

Directory of Open Access Journals (Sweden)

Arnaud Monty

Full Text Available When exotic species spread over novel environments, their phenotype will depend on a combination of different processes, including phenotypic plasticity (PP, local adaptation (LA, environmental maternal effects (EME and genetic drift (GD. Few attempts have been made to simultaneously address the importance of those processes in plant invasion. The present study uses the well-documented invasion history of Senecio inaequidens (Asteraceae in southern France, where it was introduced at a single wool-processing site. It gradually invaded the Mediterranean coast and the Pyrenean Mountains, which have noticeably different climates. We used seeds from Pyrenean and Mediterranean populations, as well as populations from the first introduction area, to explore the phenotypic variation related to climatic variation. A reciprocal sowing experiment was performed with gardens under Mediterranean and Pyrenean climates. We analyzed climatic phenotypic variation in germination, growth, reproduction, leaf physiology and survival. Genetic structure in the studied invasion area was characterized using AFLP. We found consistent genetic differentiation in growth traits but no home-site advantage, so weak support for LA to climate. In contrast, genetic differentiation showed a relationship with colonization history. PP in response to climate was observed for most traits, and it played an important role in leaf trait variation. EME mediated by seed mass influenced all but leaf traits in a Pyrenean climate. Heavier, earlier-germinating seeds produced larger individuals that produced more flower heads throughout the growing season. However, in the Mediterranean garden, seed mass only influenced the germination rate. The results show that phenotypic variation in response to climate depends on various ecological and evolutionary processes associated with geographical zone and life history traits. Seeing the relative importance of EME and GD, we argue that a "local

Accumulation of trace metals by aquatic macrophytes and their possible use in phytoremediation techniques

Directory of Open Access Journals (Sweden)

Michaela Hillermannová

2008-01-01

Full Text Available The aim of the performed research was to obtain knowledge on the ability of aquatic plants naturally growing at a site to absorb trace metals contained in bottom sediments and surface water. Furthermore, we compared differences in the accumulation of trace metals by the individual groups of aquatic plants (submerged and emergent and assessed a possible use of the individual plant species in phytoremediation techniques. Representative samples of water, sediments and aquatic macrophytes were taken from three anthropogenically loaded streams in six monitoring cycles in several collection profiles differing in the distance from a source of contamination. The samples were analysed for the total content of selected trace metals (As, Cd, Pb, Al, Hg, Zn, Fe, Mn, Cr, Ni and Cu. For comparison, one profile at an unloaded site was sampled as well. The obtained results were subjected to multivariate statistical analysis of data. Increased contents of Fe, Al, Mn, Cr and Zn were detected in sediments and plant biomass at loaded sites, namely 2–3× higher than at the comparing site. The contents of metals in surface water samples were altogether below the detection limit of the analytical method. When evaluating the individual plant species, we can state that the lowest contents of metals were detected in shore species (reed canary grass Phalaroides arundinacea, wood club-rush Scirpus silvaticus and red dock Rumex aquaticus; plant species growing in the very water current (water star-wort Callitriche sp. and flote-grass Glyceria fluitans exhibited mean contents of metals. In species forming mats (Fontinalis antipyretica and Cladophora sp., these contents were several times higher as compared to the previous species. The results of the performed research show that one of important factors, which influence the accumulation of trace metals in plants, is their ecological group (emergent – submerged affiliation and the species classification within this group

Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

Science.gov (United States)

Lorenz, Todd C

2012-05-22

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

Deinococcus daejeonensis sp. nov., isolated from sludge in a sewage disposal plant.

Science.gov (United States)

Srinivasan, Sathiyaraj; Kim, Myung Kyum; Lim, Sangyong; Joe, Minho; Lee, Myungjin

2012-06-01

A Gram-stain-positive, strictly aerobic, spherical, non-motile red-pigmented bacterial strain, designated MJ27(T), was isolated from a sludge sample of the Daejeon sewage disposal plant in South Korea. A polyphasic approach was used to study the taxonomic position of strain MJ27(T). Strain MJ27(T) shared highest 16S rRNA gene sequence similarity with Deinococcus grandis DSM 3963(T) (98.8 %), Deinococcus caeni Ho-08(T) (97.5 %) and Deinococcus aquaticus PB314(T) (96.6 %.); levels of sequence similarity with the type strains of other Deinococcus species were less than 96.0 %. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain MJ27(T) belonged to the clade formed by members of the genus Deinococcus in the family Deinococcaceae. The G+C content of the genomic DNA of strain MJ27(T) was 67.6 mol%. The chemotaxonomic characteristics of strain MJ27(T) were typical of members of the genus Deinococcus, with MK-8 as the predominant respiratory quinone, C(16:1)ω7c, C(15:1)ω6c, C(16:0) and C(15:0) as major fatty acids (>12 %), ornithine as the diamino acid in the cell-wall peptidoglycan and resistance to gamma radiation [D(10) (dose required to reduce the bacterial population by tenfold) >9 kGy]. The low levels of DNA-DNA relatedness reported here (5.3±1.5-29.2±2.3 %) indicate that strain MJ27(T) represents a species that is separate from its closest relatives in the genus Deinococcus. On the basis of phylogenetic inference, fatty acid profile and other phenotypic properties, strain MJ27(T) is considered to represent a novel species of the genus Deinococcus, for which the name Deinococcus daejeonensis sp. nov. is proposed. The type strain is MJ27(T) ( = KCTC 13751(T) = JCM 16918(T)).

Hippophae leaf extract (SBL-1) countered radiation induced dysbiosis in jejunum of total body 60Cobalt gamma - irradiated mice

International Nuclear Information System (INIS)

Beniwal, C.S.; Madhu Bala

2014-01-01

Single dose of SBL-1 administered at the rate 30 mg/kg body weight (b.w.) 30 min prior to whole body 60 Co-gamma-irradiation at lethal dose (10 Gy), rendered >90% survival in comparison to zero survival in the non-SBL-1 treated 60 Co-gamma-irradiated (10 Gy) mice population (J Herbs Spices Med Plants, 2009; 15(2): 203-215). Present study investigated the effect of SBL-1 on jejunal microbiota in lethally irradiated mice. Study was performed with inbred Swiss albino Strain 'A' male mice (age 9 weeks) weighing 28±2 g. The animals were maintained under controlled environment at 26±2℃; 12 h light/dark cycle and offered standard animal food (Golden feed, Delhi) as well as tap water ad libitum. Metagenomic DNA was extracted, purified and quantified from jejunum of the mice. Universal primers (27f and 1492r) were used to amplify the 16S rRNA DNA from the metagenomic DNA. Amplicons were sequenced, vector contamination and chimeras were removed. The sequences (GenBank Accession No: KF681283 to KF681351) were taxonomically classified by using Sequence Match program, Ribosomal Database Project as well as by nucleotide-BLAST (E-value: 10, database: 16S rRNA gene sequences, Bacteria and Archea). Phylogenetic Tree was prepared using MEGA 5.2 package, using maximum likelihood algorithm after sequence alignment by MUSCLE. Thermus aquaticus was used as out-group to construct rooted tree. Branch stability was assessed by bootstrap analysis. Untreated animals and the animals treated with SBL-1 had 100% Lactobacillus; 60 Co gamma-irradiated animals had 55% Cohaesibacter (Alphaproteobacteria); 27% Mycoplasma (Tenericutes) and only 18% Lactobacillus; animals treated with SBL-1 prior to irradiation had 89% Lactobacillus and 11% Clostridium. This study demonstrated that treatment with SBL-1 at radioprotective doses before total body irradiation with lethal dose (10 Gy) countered the jejunal dysbiosis. (author)

The protective mechanism of quercetin-3-O-β-D-glucuronopyranoside (QGC) in H2O2-induced injury of feline esophageal epithelial cells.

Science.gov (United States)

Sohn, Uy Soo; Lee, Se Eun; Lee, Sung Hee; Nam, Yoonjin; Hwang, Wan Kyunn; Sohn, Uy Dong

2016-09-01

Quercetin-3-O-β-D-glucuronopyranoside (QGC) is a flavonoid glucoside extracted from Rumex Aquaticus. Recent studies have shown that QGC exhibits anti-inflammatory, anti-oxidateve effect in vivo and cytoprotective effect in vitro. Reactive oxygen species (ROS), at low concentration, play role as a primary signal or second messenger, however, at high concentration, ROS are cytotoxic. In this study, we investigated the protective mechanism of QGC in H2O2-induced injury of Feline Esophageal Epithelial Cells. Primary-cultured feline esophagus cells were identified by an indirect immunofluorescent staining method using a cytokeratin monoclonal antibody. Cell viability was determined by the conventional MTT reduction assay. Western blot analysis was performed with specific antibodies to investigate the activation of MAPKs, NF-κB, and IκB-α, and the expression of COX-2. When the cells were exposed to 600 μM H2O2 medium for 24 h, cell viability decreased to 54 %. However, when cells were pretreated with 50-150 μM QGC for 12 h, the viability of cells exposed to H2O2 significantly increased in the dose dependent manner. QGC (50 μM, 12 h) also inhibited the expression of COX-2 induced by 10 μM H2O2 for 24 h. We found that treatment of H2O2 activated p38 MAPK and JNK, but not ERK. However QGC inhibited the H2O2-induced p38 MAPK and JNK phosphorylation. In addition, NF-κB was activated by H2O2 and translocated into the nucleus, but QGC inhibited the activation of NF-κB by blocking degradation of IκB. These data suggest that QGC reduces H2O2-induced COX-2 production by modulating the p38 MAPK, JNK, NF-κB signal pathway in feline esophageal epithelial cells.

An Internet-based platform for the estimation of outcrossing potential between cultivated and Chilean vascular plants.

Science.gov (United States)

Cid, Pablo; Aguirre, Carlos; Sánchez, Miguel Ángel; Zamorano, Daniel; Mihoc, Maritza; Salazar, Erika; Chacón, Gustavo; Navarrete, Humberto; Rosas, Marcelo; Prieto, Humberto

2017-04-01

A national-scale study of outcrossing potential within Chilean vascular flora was conducted using an upgraded algorithm, which adds parameters such as pollinator agents, climate, and geographic conditions. Datasets were organized and linked in a Web platform (www.flujogenico.cl), in which the development of a total outcrossing potential (TOP) predictor was formulated. The TOP predictor is the engine in the Web platform, which models the effect of a type of agricultural practice on others (coexistence calculation mode) and on the environment (biodiversity calculation mode). The scale for TOP results uses quintiles in order to define outcrossing potential between species as "very low," "low," "medium," "high," or "very high." In a coexistence analysis considering 256 species (207 genera), the 10 highest TOP values were for genera Citrus , Prunus , Trifolium , Brassica , Allium , Eucalyptus , Cucurbita , Solanum , Lollium , and Lotus . The highest TOP for species in this analysis fell at "high" potential, 4.9% of the determined values. In biodiversity mode, seven out of 256 cultivated species (2.7%) were native, and 249 (97.3%) corresponded to introduced species. The highest TOP was obtained in the genera Senecio , Calceolaria , Viola , Solanum , Poa , Alstroemeria , Valeriana , Vicia , Atriplex , and Campanula , showing "high" potential in 4.9% of the values. On the other hand, 137 genetically modified species, including the commercial and pre-commercial developments, were included and represented 100 genera. Among these, 22 genera had relatives (i.e., members of the same genus) in the native/introduced group. The genera with the highest number of native/introduced relatives ranged from one ( Ipomea , Limonium , Carica , Potentilla , Lotus , Castanea , and Daucus ) to 66 species ( Solanum ). The highest TOP was obtained when the same species were coincident in both groups, such as for Carica chilensis , Prosopis tamarugo , and Solanum tuberosum . Results are

Host Suitability of 32 Common Weeds to Meloidogyne hapla in Organic Soils of Southwestern Quebec

Science.gov (United States)

Bélair, G.; Benoit, D. L.

1996-01-01

Thirty-two weeds commonly found in the organic soils of southwestern Quebec were evaluated for host suitability to a local isolate of the northern root-knot nematode Meloidogyne hapla under greenhouse conditions. Galls were observed on the roots of 21 species. Sixteen of the 21 had a reproduction factor (Pf/Pi = final number of M. hapla eggs and juveniles per initial number of M. hapla juveniles per pot) higher than carrot (Pf/Pi = 0.37), the major host crop in this agricultural area. Tomato cv. Rutgers was also included as a susceptible host and had the highest Pf/Pi value of 13.7. Bidens cernua, B. frondosa, B. vulgata, Erysimum cheiranthoides, Eupatorium maculatum, Matricaria matricarioides, Polygonum scabrum, Thalictrum pubescens, Veronica agrestis, and Sium suave are new host records for M. hapla. Bidens cernua, B. frondosa, B. wulgata, D. carota, M. matricarioides, Pasticana sativa, P. scabrum, S. suave, and Thlaspi arvense sustained moderate to high galling by M. hapla and supported high M. hapla production (12.4 ≤ Pf/Pi ≥ 2.9). Capsella bursa-pastoris, Chrysanthemum leucanthemum, Gnaphalium uliginosum, Stellaria media, and Veronica agrestis sustained moderate galling and supported moderate M. hapla reproduction (2.8 ≤ Pf/Pi ≥ 0.5). Chenopodium album, C. glaucum, E. cheiranthoides, P. convolvulus, Portulaca oleracea, and Rorippa islandica supported low reproduction (0.25 ≤ Pf/Pi ≥ 0.02) and sustained low galling. Galling was observed on Senecio vulgaris but no eggs or juveniles; thus, S. vulgaris may be useful as a trap plant. Eupatorium maculatum, and T. pubescens harbored no distinct galling but supported low to moderate M. hapla reproduction, respectively. Amaranthus retroflexus, Ambrosia artemisiifolia, Echinochloa crusgalli, Erigeron canadensis, Oenothera parviflora, Panicum capillare, Setaria glauca, S. viridis, and Solidago canadensis were nonhosts. Our results demonstrate the importance of adequate weed control in an integrated program

Controles alternativos para el gorgojo del frijol (Acanthoscelides obtectus Say en granos almacenados a partir de materiales naturales y minerales

Directory of Open Access Journals (Sweden)

Carlos Ernesto Lopez-Monzon

2017-03-01

Full Text Available Con el fin de controlar el daño del gorgojo del frijol [Acanthoscelides obtectus (Say], se evaluó la efectividad en polvo de raíces deshidratadas de chilca (Senecio salignus DC., frutos deshidratados de pimienta negra (Piper nigrum L., fragmentos de madera de pino (Pinus oocarpa Schiede, maíz pulverizado (Zea mays L., cascabillo de frijol (Phaseolus vulgaris L., cal mezclada con ceniza, y arena de río. Se evaluaron ocho tratamientos, con cuatro repeticiones cada uno, en arreglo totalmente al azar. Los materiales naturales y minerales fueron colectados en el municipio de Malacatancito, Huehuetenango y el ensayo se montó en el laboratorio del Centro Universitario de Nor Occidente (Cunoroc, empleando por réplica un frasco de vidrio con capacidad de 1 L y aplicando a cada uno 100 g de semilla de frijol, 10 parejas de gorgojos adultos y 1 g de polvo de los materiales evaluados, según su tratamiento. El análisis se realizó 60 días después de la infestación, donde se evaluó: el porcentaje de daño del gorgojo del frijol, número de gorgojos vivos, correlación del porcentaje de daño versus número de gorgojos vivos y porcentaje de germinación del frijol. El polvo de pimienta negra y la mezcla de cal con ceniza evidenciaron los mejores resultados con el menor porcentaje de daño (1.64% y 3.55%, respectivamente. Las variables porcentaje de daño y número de gorgojos vivos marcaron una fuerte correlación con valor de r = .892. Se estableció que ninguno de los materiales utilizados influyó en la viabilidad de la semilla, registrándose porcentajes de germinación por arriba del 97% en todos los tratamientos. Se recomienda implementar estos productos en el almacenamiento del frijol, para contrarrestar los daños ocasionados por la plaga, obteniendo así beneficios económicos, sociales y ambientales.

The Vascular Flora of Rarău Massif (Eastern Carpathians, Romania. Note I

Directory of Open Access Journals (Sweden)

Adrian Oprea

2012-10-01

Full Text Available The present study is concerned with the flora of the Rarău Massif, an area lying in the northeastern part of Romania, nearby the town of Câmpulung Moldovenesc. This study attempt to list all the vascular plants (i.e. ferns, conifers, and flowering plants from the whole area of Rarău Massif. Till now, there are published several papers on this area, but no paper deals with the whole surface of Rarău Massif. The research was carried out between 2000 to 2011. During the study period, 1377 taxa (1089 species and 288 subspecies, belonging to 95 families and 411 genera; 43 of the species belong to Pteridophytes, 8 belongs to Gymnosperms, and 1038 belongs to Angiosperms (835 Dicotyledons, 203 Monocotyledons subdivisions. The largest families (in terms of the number of species and subspecies included are: Asteraceae (167, Poaceae (78, Brassicaceae (53, Rosaceae and Lamiaceae (50, Scrophulariaceae and Cyperaceae (47, Caryophyllaceae and Ranunculaceae (42. The highest number of species, of a certain genus, is like the next: Carex L. (39, Centaurea L. (25, Hieracium L. (21, Festuca L. (19, Senecio L. (12, Cirsium, Pilosella, and Poa (11, etc. Since the flora of the area is analysed according to Raunkiaer’s life forms, the results are as follows: Hemicryptophytes 605 species (H=55.6%, Cryptophytes (also called Geophytes 137 species (G=12.6%, Therophytes 120 species (11.0%, Phanerophytes 84 species (Ph=7.7%, Chamaephytes 57 species (Ch=5.2%, Hemitherophytes 77 species (Ht=7.1%, Helo-hydatophytes 8 species (HH=0.7%, and Epiphytes 1 species (Ep=0.1%. The phytogeographic elements are the next ones: European=375 species (36.6%, Eurasian=349 species (34.0%, Circumboreal=148 species (14.8%, Cosmopolite=37 species (3.6%, Carpathians=31 species (3.0%, Pontics=19 species (1.9%, Mediterranean-submediterrannean=11 species (1.1%, and Adventitious=2 species (0.2%. The number of endemic and near-endemic taxa (species and subspecies within the study area is 53 (5.2%.

Tissue distribution, core biosynthesis and diversification of pyrrolizidine alkaloids of the lycopsamine type in three Boraginaceae species.

Science.gov (United States)

Frölich, Cordula; Ober, Dietrich; Hartmann, Thomas

2007-04-01

Three species of the Boraginaceae were studied: greenhouse-grown plants of Heliotropium indicum and Agrobacterium rhizogenes transformed roots cultures (hairy roots) of Cynoglossum officinale and Symphytum officinale. The species-specific pyrrolizidine alkaloid (PA) profiles of the three systems were established by GC-MS. All PAs are genuinely present as N-oxides. In H. indicum the tissue-specific PA distribution revealed the presence of PAs in all tissues with the highest levels in the inflorescences which in a flowering plant may account for more than 70% of total plant alkaloid. The sites of PA biosynthesis vary among species. In H. indicum PAs are synthesized in the shoot but not roots whereas they are only made in shoots for C. officinale and in roots of S. officinale. Classical tracer studies with radioactively labelled precursor amines (e.g., putrescine, spermidine and homospermidine) and various necine bases (trachelanthamidine, supinidine, retronecine, heliotridine) and potential ester alkaloid intermediates (e.g., trachelanthamine, supinine) were performed to evaluate the biosynthetic sequences. It was relevant to perform these comparative studies since the key enzyme of the core pathway, homospermidine synthase, evolved independently in the Boraginaceae and, for instance, in the Asteraceae [Reimann, A., Nurhayati, N., Backenkohler, A., Ober, D., 2004. Repeated evolution of the pyrrolizidine alkaloid-mediated defense system in separate angiosperm lineages. Plant Cell 16, 2772-2784.]. These studies showed that the core pathway for the formation of trachelanthamidine from putrescine and spermidine via homospermidine is common to the pathway in Senecio ssp. (Asteraceae). In both pathways homospermidine is further processed by a beta-hydroxyethylhydrazine sensitive diamine oxidase. Further steps of PA biosynthesis starting with trachelanthamidine as common precursor occur in two successive stages. Firstly, the necine bases are structurally modified and either

Pyrrolizidine alkaloids in honey: comparison of analytical methods.

Science.gov (United States)

Kempf, M; Wittig, M; Reinhard, A; von der Ohe, K; Blacquière, T; Raezke, K-P; Michel, R; Schreier, P; Beuerle, T

2011-03-01

Pyrrolizidine alkaloids (PAs) are a structurally diverse group of toxicologically relevant secondary plant metabolites. Currently, two analytical methods are used to determine PA content in honey. To achieve reasonably high sensitivity and selectivity, mass spectrometry detection is demanded. One method is an HPLC-ESI-MS-MS approach, the other a sum parameter method utilising HRGC-EI-MS operated in the selected ion monitoring mode (SIM). To date, no fully validated or standardised method exists to measure the PA content in honey. To establish an LC-MS method, several hundred standard pollen analysis results of raw honey were analysed. Possible PA plants were identified and typical commercially available marker PA-N-oxides (PANOs). Three distinct honey sets were analysed with both methods. Set A consisted of pure Echium honey (61-80% Echium pollen). Echium is an attractive bee plant. It is quite common in all temperate zones worldwide and is one of the major reasons for PA contamination in honey. Although only echimidine/echimidine-N-oxide were available as reference for the LC-MS target approach, the results for both analytical techniques matched very well (n = 8; PA content ranging from 311 to 520 µg kg(-1)). The second batch (B) consisted of a set of randomly picked raw honeys, mostly originating from Eupatorium spp. (0-15%), another common PA plant, usually characterised by the occurrence of lycopsamine-type PA. Again, the results showed good consistency in terms of PA-positive samples and quantification results (n = 8; ranging from 0 to 625 µg kg(-1) retronecine equivalents). The last set (C) was obtained by consciously placing beehives in areas with a high abundance of Jacobaea vulgaris (ragwort) from the Veluwe region (the Netherlands). J. vulgaris increasingly invades countrysides in Central Europe, especially areas with reduced farming or sites with natural restorations. Honey from two seasons (2007 and 2008) was sampled. While only trace amounts of

New synonyms and a new name in Asteraceae: Senecioneae from the southern African winter rainfall region

Directory of Open Access Journals (Sweden)

J. C. Manning

2010-07-01

Full Text Available A review of the genera Othonna and Senecio undertaken for the forthcoming Greater Cape plants 2: Namaqualand-southern Namib and western Karoo (Manning in prep. led to a re-examination of the taxonomic status of several species. This was facilitated by the recent availability of high-resolution digital images on the Aluka website (www.aluka.org of the Drege isotypes in the Paris Herbarium that formed the basis of many species described by De Candolle in his Prodromus systematis naturalis regni vegetabilis. These images made it possible to identify several names whose application had remained uncertain until now. Each case is briefly discussed, with citation of additional relevant herbarium specimens. The following species are reduced to synonomy: O. incisa Harv. is included in O. rosea Harv.; O. spektakelensis Compton and O. zeyheri Sond. ex Harv. are included in O. retrorsa DC.; S. maydae Merxm. is included in S. albopunctatus Bolus, which is now considered to include forms with radiate and discoid capitula; S. cakilefolius DC. is included in  O. arenarius Thunb.; S. pearsonii Hutch, is included in O. aspertdus DC.; S. parvifolius DC. is included in S. carroensis DC.; S. eriobasis DC. is included in S. erosus L.f.; and S. lobelioides DC. is included in S. flavus (Decne. Sch.Bip. The name S. panduratus (Thunb. Less, is identified as a synonym of S. erosus L.f. and plants that are currently know n under this name should be called S. robertiifolius DC. The confusion in the application o f the names O. perfoliata (L.f. Jacq. and O. filicaulis Jacq. is examined. O. perfoliata is lecto- typified against a specimen in the Linnaean Herbarium (LINN  w ith radiate capitula. The name O. filicaulis correctly applies to a radiate species and is treated as a synonym of O. perfoliata. The vegetatively similar taxon with disciform capitula that is currently known as O. filicaulis should be known as (  undulosa (DC. J.C.Manning  & Goldblatt, comb. nov. The

Floristic composition and vegetation analysis in Hail region north of central Saudi Arabia.

Science.gov (United States)

El-Ghanim, Wafaa M; Hassan, Loutfy M; Galal, Tarek M; Badr, Abdelfattah

2010-04-01

In this study, 19 sites representing different habitats in Hail region were regularly visited for two years, in each site 2-5 stands were selected for investigating floristic composition and vegetation types in the area. A total of 124 species representing 34 families were recorded. The family Asteraceae is represented by the highest number of species (21 species) followed by the Poaceae (17 species) and the Brassicaceae (10 species) whereas, 15 families including Acanthaceae, Convolvulaceae, Moraceae, Nyctaginaceae and Primulaceae, are represented by a single species each. Chronological analysis of the vegetation in the area revealed the domination of Saharo-Sindian elements in the wild vegetations and of weedy species in the cultivated plots. Therophytes and chamaephytes are the dominating life forms of the vegetation spectra; therophytes represent 49.20% and chamaephytes represent 29.00% of the total species in the study area. Application of TWINISPAN and DECORANA classification and ordination techniques to the data produced seven vegetation groups. Ruderal habitats comprised two small groups A and F dominated by Phragmites australis and Imperata cylindrical (A), Euphorbia peplus and Sisymbrium irio (F), respectively. Two vegetation groups (B and G) have been recognized in the mountains and slopes dominated by Launaea mucronata, Trigonella stellata (B) and Ficus palmate and Fagonia bruguieri (G). Other two groups (C and E) inhabit the desert and mountainous wadies; these are represented by Gymnocarpos decandrus and Ochradenus baccatus (C) and Senecio glaucus subsp. coronopifolius and Rumex equisetiforme (E). On the other hand, one group (D) inhabits the cultivated plots and is represented by Plantago albicans and Rumex vesicarius, the last group also includes species restricted to the sand dune habitat of the Al-Nafud desert north of Hail city and represented by Calligonum polygonoides and Halyxolon salicornicum. The vegetation analysis indicated the invasion of

The first report of Pb and Zn accumulation in some native plants from the Peruvian Andes

Science.gov (United States)

Bech, Jaume; Duran, Paola; Poma, Wilfredo; Sánchez, Isidoro; Barceló, Juan; Roca, Núria; Boluda, Rafael; Roca-Pérez, Luís.; Poschenrieder, Charlotte

2010-05-01

Until recent decades little has been known about the remediation of mining sites using metalophytes in Latin America. Metal mining has helped to create severe and diverse environmental problems. The present study proposed to identify and characterize spontaneously growing heavy metal tolerant plant species in the area around the polimetalic mine in Hualgayoc (Cajamarca, Peru). These species are potentially useful for phytorremediation. Plant and soils from their rhizosphere were sampled and analized for concentration of As, Fe, Mn, Pb and Zn. Translocation Factor (TF) defined the metals concentrations ratio between shoots and root biomass and Shoot Accumulation Factor (SAF) the metal concentration ratio between shoot and soil concentration were determined and used to measure the effectiveness of a plant in concentrating metals into its biomass. The soils were neutral pH (7,4±0,5) with variable content of organic carbon (2,4±1,1) and loam texture: sand (42,9±10,8) and clay (16,7±4,6). According to the total metals, all samples exceeded toxicity thresholds, high Pb (20016 ± 32559 mg•kg-1) and Zn (22512 ± 13056 mg•kg-1) concentrations were detected. High shoot Pb and Zn concentrations were found in Plantaginaceae Plantago orbignyana (6998 and 9617 μg/g); Brassicaceae Lepidium bipinnatifidum (6886 and 5034 mg•kg-1) and Asteraceae Senecio sp (4253 and 3870 mg•kg-1) and Baccharis latifolia (2554 and 1284 mg•kg-1 respectively). The high values of TFs indicates that the plants effectively traslocated metales. Lepidium bipinnatifidum shows the highest TFs values (143 in Pb and 21,5 in Zn). The SAF values were much lower than those reported for other species such as Paspalum sp in the Peruvian copper mine, which may be due to a high top soil Pb and Zn concentrations. These species can surely be considered as interesting for phytoextraction, due not only to its accumulative capacity but also since they showed an elevated transfer factor and grew in the

Floristic composition and vegetation analysis in Hail region north of central Saudi Arabia

Science.gov (United States)

El-Ghanim, Wafaa M.; Hassan, Loutfy M.; Galal, Tarek M.; Badr, Abdelfattah

2010-01-01

In this study, 19 sites representing different habitats in Hail region were regularly visited for two years, in each site 2–5 stands were selected for investigating floristic composition and vegetation types in the area. A total of 124 species representing 34 families were recorded. The family Asteraceae is represented by the highest number of species (21 species) followed by the Poaceae (17 species) and the Brassicaceae (10 species) whereas, 15 families including Acanthaceae, Convolvulaceae, Moraceae, Nyctaginaceae and Primulaceae, are represented by a single species each. Chronological analysis of the vegetation in the area revealed the domination of Saharo-Sindian elements in the wild vegetations and of weedy species in the cultivated plots. Therophytes and chamaephytes are the dominating life forms of the vegetation spectra; therophytes represent 49.20% and chamaephytes represent 29.00% of the total species in the study area. Application of TWINISPAN and DECORANA classification and ordination techniques to the data produced seven vegetation groups. Ruderal habitats comprised two small groups A and F dominated by Phragmites australis and Imperata cylindrical (A), Euphorbia peplus and Sisymbrium irio (F), respectively. Two vegetation groups (B and G) have been recognized in the mountains and slopes dominated by Launaea mucronata, Trigonella stellata (B) and Ficus palmate and Fagonia bruguieri (G). Other two groups (C and E) inhabit the desert and mountainous wadies; these are represented by Gymnocarpos decandrus and Ochradenus baccatus (C) and Senecio glaucus subsp. coronopifolius and Rumex equisetiforme (E). On the other hand, one group (D) inhabits the cultivated plots and is represented by Plantago albicans and Rumex vesicarius, the last group also includes species restricted to the sand dune habitat of the Al-Nafud desert north of Hail city and represented by Calligonum polygonoides and Halyxolon salicornicum. The vegetation analysis indicated the invasion

Evaluación de la incidencia del Virus de la marchitez moteada del tomate (TSWV en arvenses asociadas al cultivo de crisantemo en el Valle de San Nicolás

Directory of Open Access Journals (Sweden)

Elizabeth Castro

2017-08-01

Full Text Available Para la región del Oriente antioqueño el cultivo de crisantemo es una importante fuente de empleo y motor de desarrollo, una limitante de la producción de este cultivo es la enfermedad causada por TSWV. En un programa de manejo integrado de enfermedades se busca identificar y detener la entrada y dispersión del patógeno dentro del cultivo; en el caso del patosistema TSWV-Crisantemo, una puerta de entrada importante pueden ser las arvenses aledañas a los bloques de producción, ya que permiten la propagación del vector (trips y sirven de reservorio para la enfermedad. Es por esto que este trabajo tuvo como objetivos: identificar las especies de arvenses adyacentes a los cultivos de crisantemo del Oriente antioqueño, evaluar la incidencia de TSWV en ellas y determinar las especies de trips presentes en las arvenses más frecuentemente encontradas. Se colectaron 360 plantas en 6 fincas productoras de Crisantemo de la región, se clasificaron taxonómicamente y se encontraron 34 especies dentro de 19 familias botánicas de las cuales las especies encontradas con mayor frecuencia fueron: Galinsoga quadriradiata, Cardamine hirsuta, Oxalis latifolia, Amaranthus viridis, Senecio vulgaris y Polygonum nepalense. Se realizó prueba DAS-ELISA para la detección de TSWV a las 34 especies y se encontró que solo una arvense fue positiva, Portulaca oleracea; en un muestreo posterior se evaluaron otras 20 plantas por RT-PCR de las más frecuentes que se encontraron y en este segundo grupo no fue detectada ninguna planta infectada por TSWV. Los trips encontrados en las especies de arvenses evaluadas pertenecen al género Frankliniella sp., especies: F. occidentallis y F. panamensis. En este trabajo se observó una mayor captura de insectos en crisantemo que en las arvenses acompañantes, lo que sugiere su mayor preferencia por el cultivo y explicaría la baja transmisión de TSWV observada en las plantas arvenses.

Comparación de los patrones electroforéticos de proteínas en extractos de hojas de Senecio niveoaureus Cuatr . en un gradiente altitudinal en el Páramo de Chingaza (Colombia

Directory of Open Access Journals (Sweden)

Fagua Alvarez Florez

2000-01-01

Full Text Available En los ecosistemas de alta montaña (páramo, las plantas están expuestas a temperaturasbajas en horas nocturnas. En este trabajo se comparan, por primera vez, los patroneselectroforéticos de proteínas de apoplasto en Espeletia killipii, (caulirrósula y de Senecioniveoaureus(acaule. Estas especies presentan principalmente proteínas de pesos moleculares de35 a 11 kDa. Proteínas con pesos moleculares similares se han descrito como proteínasanticongelantes (AFP en peces del ártico y en el apoplasto de plantas de zonas templadas.Algunos extractos analizados presentaron actividad beta 1-3 glucanasa y quitinasa (enzimasrelacionadas con proteínas de protección a temperaturas bajas. Mediante las metodologíasConA-peroxidasa y Schiff, se determinó que algunas proteínas presentes en los extractosapoplásticos tienen carácter glicoproteico.

Histomorfologia do gânglio de Gasser, da rete mirabile carotídea e da hipófise de bovinos: estudo de 199 casos Histomorphology of the Gasserian ganglion, carotid rete mirabile and pituitary gland in cattle: a study of 199 cases

Directory of Open Access Journals (Sweden)

Raquel R. Rech

2006-06-01

Full Text Available O complexo heterogêneo de tecidos formado pelo gânglio de Gasser, rete mirabile carotídea e hipófise (GRH de 199 bovinos foram macro e microscopicamente avaliados. Vinte e um GRH eram de casos confirmados de raiva, 19 com diagnóstico de meningoencefalite por herpesvírus bovino-5 (BoHV-5, 11 casos de febre catarral maligna (FCM, 7 tinham abscesso de pituitária, 17 apresentaram lesões de encefalopatia hepática (status spongiosus atribuído à fibrose crônica por intoxicação por Senecio sp; e os 124 GRH restantes eram provenientes de bovinos que não apresentaram sinais neurológicos e que morreram ou foram eutanasiados por causas diversas. Nenhuma alteração histológica significativa foi observada no GRH dos 124 bovinos que não tinham sinais neurológicos, nos 17 bovinos com encefalopatia hepática, nem nos 19 bovinos afetados por meningoencefalite por BoHV-5. Alterações inflamatórias foram encontradas em 20 dos 21 casos de raiva e consistiam de proliferação de células satélites, nódulos gliais e infiltrado linfo-plasmocitário; alterações degenerativas incluíam cromatólise central, vacuolização neuronal e necrose neuronal com neuronofagia. Corpúsculos de inclusão eosinofílicos intracitoplasmáticos (de Negri foram encontrados em 19 dos 21 casos de raiva; neurite do nervo trigêmeo em 11 casos e neuroipofisite em 4 casos. O complexo GRH de 9 de 11 casos de FCM apresentava arterite necrosante, que afetava as artérias da rete mirabile carotídea. Em 7 dos 199 GRH examinados havia abscessos de pituitária caracterizados por agregados de neutrófilos e detritos celulares circundados por infiltrado mononuclear e cápsula fibrosa. Vários achados incidentais foram observados nos 199 GRH examinados histologicamente e não foram correlacionados com alterações ligadas a doenças. Estes incluíam cistos na cavidade hipofisária, agregados de fibrina e neutrófilos no seio cavernoso da rete mirabile carotídea, leve aumento

The adaptive value of habitat preferences from a multi-scale spatial perspective: insights from marsh-nesting avian species

Directory of Open Access Journals (Sweden)

Jan Jedlikowski

2017-03-01

Full Text Available Background Habitat selection and its adaptive outcomes are crucial features for animal life-history strategies. Nevertheless, congruence between habitat preferences and breeding success has been rarely demonstrated, which may result from the single-scale evaluation of animal choices. As habitat selection is a complex multi-scale process in many groups of animal species, investigating adaptiveness of habitat selection in a multi-scale framework is crucial. In this study, we explore whether habitat preferences acting at different spatial scales enhance the fitness of bird species, and check the appropriateness of single vs. multi-scale models. We expected that variables found to be more important for habitat selection at individual scale(s, would coherently play a major role in affecting nest survival at the same scale(s. Methods We considered habitat preferences of two Rallidae species, little crake (Zapornia parva and water rail (Rallus aquaticus, at three spatial scales (landscape, territory, and nest-site and related them to nest survival. Single-scale versus multi-scale models (GLS and glmmPQL were compared to check which model better described adaptiveness of habitat preferences. Consistency between the effect of variables on habitat selection and on nest survival was checked to investigate their adaptive value. Results In both species, multi-scale models for nest survival were more supported than single-scale ones. In little crake, the multi-scale model indicated vegetation density and water depth at the territory scale, as well as vegetation height at nest-site scale, as the most important variables. The first two variables were among the most important for nest survival and habitat selection, and the coherent effects suggested the adaptive value of habitat preferences. In water rail, the multi-scale model of nest survival showed vegetation density at territory scale and extent of emergent vegetation within landscape scale as the most

Ethnoveterinary plant remedies used by Nu people in NW Yunnan of China

Directory of Open Access Journals (Sweden)

Shen Shicai

2010-08-01

Full Text Available Abstract Background Nu people are the least populous ethnic group in Yunnan Province of China and most are distributed in Gongshan County, NW Yunnan. Animal production plays an important role in Nu livelihoods and the Nu people have abundant traditional knowledge of animal management and ethnoveterinary practices. This study documents the animal diseases, ethnoveterinary plant remedies and related traditional knowledge in three Nu villages of Gongshan County. Methods This study was carried out in three Nu villages of Gongshan County between July 2009 and February 2010. Data was obtained through the use of semi-structured questionnaires, field observation and PRA tools. A total of 60 Nu respondents (34 men and 26 women provided information on animal ailments and ethnoveterinary plant medicines used for Nu livestock production. Information on traditional ethnoveterinary medicine knowledge and choice of treatment providers was also obtained. Results Thirty-five animal conditions were identified in the surveyed area. The major and most common animal diseases among livestock were skin conditions, diarrhea, heat, fevers, colds, and parasites. Most ailments occurred between June and August. The ethnoveterinary medicinal use of 45 plant species was documented. Most medicinal species (86.7% were collected from the wild. The most frequently used plant parts were whole plants (35.6%, followed by roots (22.2%. The most important medicinal plant species were Saussurea costus (Falc. Lipech. (UV = 0.67, Senecio scandens Buch.-Ham.ex D.Don (UV = 0.67, Plantago depressa Willd. (UV = 0.63, Rubus corchorifolius L. f. (UV = 0.62, Bupleurum yunnanense Franch. (UV = 0.60, and Polygonum paleaceum Wall. (UV = 0.60. Animal diseases treated with the highest number of ethnoveterinary plant remedies were diarrhea (16 plant species, heat, fever, colds (11 plant species, retained afterbirth (11 plant species, and skin conditions and sores (11 plant species. Many Nu villagers

Hydrothermal Fluid Permeability, Temperature, and Nutrient Fluxes: Three Controls on the Structure and the Dynamics of Subsurface Extremophilic Microbe Communities

Science.gov (United States)

Ryan, M. P.; Yang, J.

2002-05-01

We continue to develop a set of models whose aim is to provide broad constraints on the range of possible community structures for subsurface thermally-tolerant microbes. We combine studies of the three-dimensional internal structure of the dike and sill complexes of active volcanoes, studies of the scale- and direction-dependent 3-D in-situ permeability of intrusive and extrusive rocks from in-situ and laboratory data, numerical modelling of hydrothermal convection in volcanic interiors, data on the optimal metabolic and life-limiting thermal requirements of extremophilic microbes, with the set of nutrients and nutrient pathways required for the survival of given species of thermophiles and hyperthermophiles. With this mix of data bases and analysis tools, we can begin to divine a set of broad theoretical guidelines for constraining the structure and dynamics of extremophilic communities in the subsurface environments of volcanoes. We are searching for the first-order controls on transport. The effects of mineral attachment, detachment, and microbial reproduction may be incorporated in refinements of this basic model. Critical thermal intervals and/or isotherms that correlate with (1) optimal metabolic and (2) life-limiting temperatures for thermophilic microbes are, e.g., in degrees Celcius: Thermus thermophilius [70, 85]; Thermomicrobium roseum [70-75, 85]; Thermus aquaticus [70, 79]; and Sulfolobus acidocaldarius [70-75, 90]. Numerical models of the convective migration of thermophilic (50-80 C), and hyperthermophilic (80-113 C) microbes and their macromolecular amino acid building blocks (113- ~200 C) have been developed that explicitly incorporate the roles of fractures and fluid properties. Fluid transport properties are evaluated through the optimal metabolic and life-limiting temperate ranges and beyond. These models quantify our intuition with respect to controls on community structure and dynamics. Important relationships appear to be: (1) Great

Estimating intraspecific genetic diversity from community DNA metabarcoding data

Directory of Open Access Journals (Sweden)

Vasco Elbrecht

2018-04-01

Taeniopteryx nebulosa and the caddisfly Hydropsyche pellucidula showed a distinct north–south cline with respect to haplotype distribution, while the beetle Oulimnius tuberculatus and the isopod Asellus aquaticus displayed no clear population pattern but differed in genetic diversity. Discussion We developed a strategy to infer intraspecific genetic diversity from bulk invertebrate metabarcoding data. It needs to be stressed that at this point this metabarcoding-informed haplotyping is not capable of capturing the full diversity present in such samples, due to variation in specimen size, primer bias and loss of sequence variants with low abundance. Nevertheless, for a high number of species intraspecific diversity was recovered, identifying potentially isolated populations and taxa for further more detailed phylogeographic investigation. While we are currently lacking large-scale metabarcoding datasets to fully take advantage of our new approach, metabarcoding-informed haplotyping holds great promise for biomonitoring efforts that not only seek information about species diversity but also underlying genetic diversity.

Differential responses of invasive and native plants to warming with simulated changes in diurnal temperature ranges.

Science.gov (United States)

Chen, Bao-Ming; Gao, Yang; Liao, Hui-Xuan; Peng, Shao-Lin

2017-07-01

Although many studies have documented the effects of global warming on invasive plants, little is known about whether the effects of warming on plant invasion differ depending on the imposed change in different diurnal temperature ranges (DTR). We tested the impact of warming with DTR change on seed germination and seedling growth of eight species in the family Asteraceae. Four of these are invasive ( Eupatorium catarium , Mikania micrantha , Biodens pilosa var. radiate , Ageratum conyzoides ) in China, and four are native ( Sonchus arvensis , Senecios candens , Pterocypsela indica , Eupatorium fortunei ). Four temperature treatments were set in growth chambers (three warming by 3 °C with different DTRs and control), and experiments were run to mimic wintertime and summertime conditions. The control treatment ( T c ) was set to the mean temperature for the corresponding time of year, and the three warming treatments were symmetric (i.e. equal night-and-day) (DTR sym ), asymmetric warming with increased (DTR inc ) and decreased (DTR dec ) DTR. The warming treatments did not affect seed germination of invasive species under any of the conditions, but DTR sym and DTR inc increased seed germination of natives relative to the control, suggesting that warming may not increase success of these invasive plant species via effects on seed germination of invasive plants relative to native plants. The invasive plants had higher biomass and greater stem allocation than the native ones under all of the warming treatments. Wintertime warming increased the biomass of the invasive and wintertime DTR sym and DTR inc increased that of the native plants, whereas summertime asymmetric warming decreased the biomass of the invasives but not the natives. Therefore, warming may not facilitate invasion of these invasive species due to the suppressive effects of summertime warming (particularly the asymmetric warming) on growth. Compared with DTR sym , DTR dec decreased the biomass of

Doenças do sistema nervoso central em bovinos no Sul do Brasil

Directory of Open Access Journals (Sweden)

Sanches Adrien Wilhelm Dilger

2000-01-01

Full Text Available Um estudo retrospectivo foi realizado em 6.021 necropsias de bovinos realizadas num período de 36 anos no Sul do Brasil. Desses, 552 (9,16% apresentaram sinais clínicos de distúrbios nervosos e seus protocolos foram revisados para colher informações sobre os diagnósticos macro e microscópicos, etiologia e sinais clínicos. Em 147 casos (26,63% de 552 não havia lesões significativas no sistema nervoso central, em 79 (14,31% de 552 o sistema nervoso não havia sido enviado e em 21 (3,81% de 552 os tecidos foram submetidos autolisados, apresentando-se impróprios para o diagnóstico histológico. As lesões encontradas nos restantes 305 casos foram classificadas como inflamatórias, degenerativas, circulatórias, congênitas e neoplásicas. As lesões inflamatórias constituíram a maior categoria (66,89% de 305 casos. Essa categoria foi subdividida em lesões inflamatórias produzidas por vírus (57,38% de 305 casos e por bactérias (9,51% de 305 casos. As três doenças causadas por vírus foram raiva (49,51% de 305 casos, meningoencefalite necrosante por herpesvírus bovino (4,59% de 305 casos e febre catarral maligna (3,28% de 305 casos. As alterações degenerativas foram representadas por 74 casos (24,26% de 305 casos. Condições incluídas nessa categoria foram status spongiosus causado por insuficiência hepática relacionada à intoxicação por Senecio spp (10,49% de 305 casos ou ao efeito direto da intoxicação por Ateleia glazioviana (0,33% de 305 casos, casos de insuficiência hepática sem alterações morfológicas no cérebro (2,95% de 305 casos, mielomalácia por compressão da medula (2,62% de 305 casos, degeneração neuronal primária na intoxicação por Solanum fastigiatum (2,29% de 305 casos, polioencefalomalácia (1,97% de 305 casos, tétano (1,31% de 305 casos e coccidiose intestinal em terneiros, cetose e botulismo com um caso cada (0,33% de 305 casos. Alterações circulatórias foram representadas por 19 casos

Dieta de Odocoileus virginianus (Artiodactyla: Cervidae en un bosque templado del norte de Oaxaca: México

Directory of Open Access Journals (Sweden)

Graciela González

2012-03-01

Santa Catarina Lachatao and San Miguel Amatlán from June 1998 to August 1999. Sampling was done during both the wet and dry seasons, and included the observation of browsing traces (238 observations, microhistological analysis of deer feces (28 deer pellet-groups, and two stomach content analysis. The annual diet of white-tailed deer was composed of 42 species from 23 botanical families. The most represented families in the diet of this deer were Fagaceae, Asteraceae, Ericaceae and Fabaceae. There were significant differences in the alpha diversity of the diet during the wet and dry seasons (H’=2.957 and H’=1.832, respectively. The similarity percentage between seasons was 56%. Differences in plant species frequency were significantly higher during the wet season. Herbaceous plants made up the greatest percentage of all the species consumed. The preferred species throughout the year were Senecio sp. (shrub, Sedum dendroideum (herbaceous, Arctostaphylos pungens (shrub and Satureja macrostema (shrub. Diet species richness was found to be lower than that observed in a tropical forest (Venezuela, tropical dry forest (Mexico and temperate deciduous and mixed forest (Mexico, but similar to the diet species richness observed in a tropical dry forest (Costa Rica and temperate coniferous and deciduous forests (USA.

Analysis of landslide overgrowing rates at Vaskiny Dachi key site, Central Yamal, Russia

Science.gov (United States)

Khomutov, A.

2009-04-01

Equiesetum arvense ssp. boreale were presented, pioneer moss species (Bryum sp., Ceratodon purpureus appropriate for disturbed habitats appeared. In the "frontal zone" transformed initial communities were observed and sedge communities with Carex glareosa were developing (Rebristaya et al. 1995). In 2005 landslide shear surface was characterized by abundance of pioneer grass and chamomile-grass with herb communities on rather dry portions (Deschampsia borealis, Puccinellia sibirica, Draba hirta, Tanacetum bipinnatum, Senecio congestus), and sedge (Carex glaerosa, Carex bigelowii ssp. arctisibirica) or cottongrass (Eriophorum angustifolium, Eriophorim vaginatum) meadows in depressions, but edges of gentle troughs were overgrowing poorly. On the landslide body, initial moss cover did not recover, on separate blocks crustose lichens developed. However, everywhere in more stable herb-shrub communities with Salix polaris typical moss cover formed. In "frontal zone" sedge bogs appeared. Some activation of overgrowing was noted in 2007-2008 in connection with favorable weather conditions with warm summers in preceding 2005-2006 and relatively high summer precipitation, but shear surfaces of majority of landslides got overgrown by 30-40 % because of poorly developed organic horizon and high erosion liability of these surfaces, as well as shear surfaces of small landslides on steep slopes. Different are landslides on gentle southern slopes. Their shear surfaces got overgrown by herb, cotton grass and sedge communities by 90% while communities on landslide bodies are similar to those on surrounding undisturbed slopes. Specific are landslides with actively developing thermoerosion on shear surface. Overgrowing and thermoerosion are developing simultaneously at such landslides. At one of such landslides depth of thermoerosion gully reached to 2 m in 2008. At the same time shear surface around the gully got overgrown by pioneer grass and chamomile-grass communities with equisetum and

Mapping the Distribution and Flora of the Weeds in Canola Fields of Gorgan Township by Geographic Information System (GIS

Directory of Open Access Journals (Sweden)

sahar jannati ataie

2018-02-01

species in canola fields of Gorgan Township and these belonged to 18 families. About 17.1 percent of these species belong to Poaceae and 11.4 percent belongs to Asteraceae and other families, respectively. In general, 77.2 and 22.8 percent of species were annual and perennial weeds, respectively. Also, 80 percent of weeds belong to dicotyledonous and 20 percent to monocotyledonous. The most important species of Poaceae family were Phalaris minor, Avena ludoviciana, Alopecuros sp., Poa annua, Lolium temulentum and Bromus sp. Also, the most important species of Asteraceae were Artemisia annua, Cirsium arvense, Sonchus sp. and Senecio vulgaris. 85.7 percent of weeds reported as broad-leaved weeds and 14.3 percent belong to the narrow leaves. Phalaris minor was the most important weed of narrow leaves and Melilotus officinalis was the most important broad leaf out groups. Among the weeds have been identified, 88.5 percent had photosynthetic cycle of C3 and 11.5 percent were C4. The study results also showed that Phalaris minor had the highest relative dominance among the 35 species and then Melilotus officinalis, Rapistrum rugosum and Avena ludoviciana had 29.4, 28.9 and 23.5 of relative dominance, respectively. To view maps of distribution, based on the abundance of weeds, the three categories 50-100 percent, 30-50 percent and lower than 30 percent were classified. Weeds that have had 50-100 percent frequency were considered as the most important weeds in canola fields of Gorgan. These weeds includes: Phalaris minor and Melilotus officinalis. Weeds that have a frequency between 30-50 percent were considered as medium importance weeds that included Sinapis arvensis, Veronica persica, Avena ludoviciana and Rapistrum rugosum. In final, the weeds with a frequency of less than 30 percent, were placed in the third group as small percentage of surveyed fields. The most important weeds in this group recorded as Artemisia annua, Ranunculus sp., Polygonum convolvulus and Alopecuros sp

Two epigraphic-historical notes

Directory of Open Access Journals (Sweden)

Loma Svetlana

2008-01-01

Maximus Aemilianus (PIR2 L56 - probably son of Marcus Laelius Maximus (PIR2 L55, one of the leading senators under Septimius Severus - and M. Nummius Senecio Albinus (PIR2 N235 were the eponymous consuls of 227. The pair is attested in several inscriptions, e.g. CIL VIII 18831 from Numidia which resembles this one in recording the exact date: Bacaci Aug(usto \\ sac(rum \\ Albino et Ma\\ximo co(ns(ulibus \\ Kal(endis Mai(is [3] Si\\ttius Novellus \\ et Q. Galerius Mu\\stianus magg(istri \\ [Thib(ilitanorum?]. Here Albinus' name precedes that of Maximus, which is usually the case. Nevertheless, a parallel with Maximus named before Albinus is provided by an inscription from Dacia (ILD 774, near Cluj: Deae Ne\\mesi sac\\rum Aur(elius Ru[f]inus \\ be(nef(iciarius co(ns(ularis \\ leg(ionis XIII Gem(inae \\ Sever(ianae v(otum l(ibens p(osuit Maximo et Albi\\[no] co(ns(ulibus. Consequently, № 21 is a votive inscription, largely restorable and precisely datable. The Collegium curatorum of the Cohors II Delmatarum in an inscription from Čačak Forty years ago within the Ascension Church yard in Čačak the lower part of a Roman limestone monument has been accidentally unearthed, bearing an inscription, three last lines of which are partially preserved (№ 20 of the catalogue, (fig. 2, wherein only the mention of a cohort was recognized by the editors, who read: ]\\[- - -]ALB[- - -| -]GIATI +[- - -|- - -co]h(ortis eiusde(m [- - -|- - - The elegant, shaded letters are lined up one below the other, which suggests that the text was arranged following the principle of centering. Above the L in the first line there is a trace of an O or a Q, unnoticed by the editors. So, there are 4 lines partially preserved. The space left between the lines 2 and 3 being larger than that between 1-2 and 3-4 respectively, the two last lines seem to constitute a separate entry. The genitive case cohortis eiusdem implies a preceding designation of the dedicant(s, and what we have before is a nominative

Astrobiology - The New Synthesis

Science.gov (United States)

Sik, A.; Simon, T.

. They research intensified for more reason: by analyzing their biochemistry and genetics we can get closer the understanding of formation and early evolution of life; their special enzymes ("extremozymes") have more and more significant scien- tific and industrial applications [13]; and terrestrial extremophile-analogies can help to understand the possible extreme ecosystems of other planets or moons. Most of the extremophiles are bacteria (eubacteria and archaea-bacteria as well) but in some extreme ecosystems eukaryotes also can be found. The base of their classification is the environmental factor that is tolerated extremely. - Thermophiles and hyperther- mophiles: the best known group and probably the most important in the understand- ing of life. Mainly prokaryotes that tolerate temperatures higher than 45C (if this is higher than 80C, the organism is hyperthermophile). The first species with higher optimum than 70C, Thermus aquaticus, an eubacterium was found in the thermal 3 springs of Yellowstone National Park (DNA polymerase enzyme was produced from it, which has revolutionized many aspects of genetics through the Polymerase Chain Reaction). However the first hyperthermophile was an archaea-bacteria (Sulfolobus acidocaldarius). After 1970 a lot of other species was found near to black smokers, so today approximately 50 hyperthermophiles are known. The record is 121C (Pyrod- ictium occultum) and the upper limit of tolerable temperature-range is not uncertain, 150C is the estimated value. - Psychrofiles: they can live in the polar ice layers, in glacier-ice and in permafrost soils also. - Acidophiles: pH-tolerance between value 5-2, lot of them are hyperthermophiles as well and lives in black smokers. The most ancient genome sequences are from these organisms signing that the first terrestrial organisms were acidophiles- hyperthermophiles. - Alkaliphiles: life functions above 9 pH value, general in soda-lakes. Together with the acidophiles they way of life is not