WorldWideScience

Sample records for inventory aperiodic blue

  1. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  2. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean

    2015-01-01

    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  3. Aperiodic Volume Optics

    Science.gov (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  4. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang

    2017-09-01

    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  5. A blue carbon soil database: Tidal wetland stocks for the US National Greenhouse Gas Inventory

    Science.gov (United States)

    Feagin, R. A.; Eriksson, M.; Hinson, A.; Najjar, R. G.; Kroeger, K. D.; Herrmann, M.; Holmquist, J. R.; Windham-Myers, L.; MacDonald, G. M.; Brown, L. N.; Bianchi, T. S.

    2015-12-01

    Coastal wetlands contain large reservoirs of carbon, and in 2015 the US National Greenhouse Gas Inventory began the work of placing blue carbon within the national regulatory context. The potential value of a wetland carbon stock, in relation to its location, soon could be influential in determining governmental policy and management activities, or in stimulating market-based CO2 sequestration projects. To meet the national need for high-resolution maps, a blue carbon stock database was developed linking National Wetlands Inventory datasets with the USDA Soil Survey Geographic Database. Users of the database can identify the economic potential for carbon conservation or restoration projects within specific estuarine basins, states, wetland types, physical parameters, and land management activities. The database is geared towards both national-level assessments and local-level inquiries. Spatial analysis of the stocks show high variance within individual estuarine basins, largely dependent on geomorphic position on the landscape, though there are continental scale trends to the carbon distribution as well. Future plans including linking this database with a sedimentary accretion database to predict carbon flux in US tidal wetlands.

  6. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  7. Simulation of aperiodic bipedal sprinting.

    Science.gov (United States)

    Celik, Huseyin; Piazza, Stephen J

    2013-08-01

    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  8. Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Povinelli, Michelle L

    2011-09-12

    We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.

  9. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.

    1997-01-01

    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  10. Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams

    Science.gov (United States)

    Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović

    2017-08-01

    We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.

  11. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

    2011-01-01

    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  12. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  13. Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing

    DEFF Research Database (Denmark)

    Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina

    2016-01-01

    Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...

  14. A method to identify aperiodic disturbances in the ionosphere

    Science.gov (United States)

    Wang, J.-S.; Chen, Z.; Huang, C.-M.

    2014-05-01

    In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  15. Topological aperiodicity for product systems over semigroups of Ore type

    DEFF Research Database (Denmark)

    Kwasniewski, Bartosz; Szymanski, Wojciech

    2016-01-01

    aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...

  16. Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L

    2012-01-02

    We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.

  17. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    Energy Technology Data Exchange (ETDEWEB)

    Findeisen, Krzysztof; Hillenbrand, Lynne [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Cody, Ann Marie, E-mail: krzys@astro.caltech.edu [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States)

    2015-01-10

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs.

  18. Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell

    Science.gov (United States)

    Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.

    2016-08-01

    In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.

  19. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

    2015-01-01

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  20. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

    Science.gov (United States)

    Kumar, Pawan; Parmananda, P.

    2018-04-01

    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  1. Shape control in wafer-based aperiodic 3D nanostructures

    International Nuclear Information System (INIS)

    Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen

    2014-01-01

    Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)

  2. Non-commutative Chern numbers for generic aperiodic discrete systems

    Science.gov (United States)

    Bourne, Chris; Prodan, Emil

    2018-06-01

    The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.

  3. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  4. Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

    Science.gov (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

    2017-11-07

    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  5. Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices

    Directory of Open Access Journals (Sweden)

    Enrique Maciá

    2015-05-01

    Full Text Available Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.

  6. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    International Nuclear Information System (INIS)

    Xie Yong; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

    2004-01-01

    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells

  7. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

    2014-01-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

  8. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    Energy Technology Data Exchange (ETDEWEB)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H. [Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); White, Russel J., E-mail: parksj@chara.gsu.edu [Georgia State University, Department of Physics and Astronomy, 25 Park Place, Room 605, Atlanta, GA 30303 (United States)

    2014-03-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K{sub s} -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK{sub s} -band amplitudes from 0.044 to 2.31 mag and Δ(J – K{sub s} ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K{sub s} time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief

  9. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1992-01-01

    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  10. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue

    2011-01-01

    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  11. Outer synchronization of complex networks with internal delay and coupling delay via aperiodically intermittent pinning control

    Science.gov (United States)

    Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu

    This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.

  12. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure

    International Nuclear Information System (INIS)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

    2013-01-01

    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)

  13. An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.

  14. Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators

    DEFF Research Database (Denmark)

    Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde

    2014-01-01

    and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...

  15. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2014-01-01

    in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...

  16. Influences of Fundamental Frequency, Formant Frequencies, Aperiodicity, and Spectrum Level on the Perception of Voice Gender

    Science.gov (United States)

    Skuk, Verena G.; Schweinberger, Stefan R.

    2014-01-01

    Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…

  17. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

    2012-01-01

    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  18. Near-to far-field transformation in the aperiodic Fourier modal method

    NARCIS (Netherlands)

    Rook, R.; Pisarenco, M.; Setija, I.D.

    2013-01-01

    This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by

  19. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  20. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  1. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2013-01-01

    This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...

  2. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li

    2014-04-01

    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  3. Blue gods, blue oil, and blue people.

    Science.gov (United States)

    Fairbanks, V F

    1994-09-01

    Studies of the composition of coal tar, which began in Prussia in 1834, profoundly affected the economies of Germany, Great Britain, India, and the rest of the world, as well as medicine and surgery. Such effects include the collapse of the profits of the British indigo monopoly, the growth in economic power of Germany based on coal tar chemistry, and an economic crisis in India that led to more humane tax laws and, ultimately, the independence of India and the end of the British Empire. Additional consequences were the development of antiseptic surgery and the synthesis of a wide variety of useful drugs that have eradicated infections and alleviated pain. Many of these drugs, particularly the commonly used analgesics, sulfonamides, sulfones, and local anesthetics, are derivatives of aniline, originally called "blue oil" or "kyanol." Some of these aniline derivatives, however, have also caused aplastic anemia, agranulocytosis, and methemoglobinemia (that is, "blue people"). Exposure to aniline drugs, particularly when two or three aniline drugs are taken concurrently, seems to be the commonest cause of methemoglobinemia today.

  4. Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates

    Science.gov (United States)

    Yu, Yisheng

    This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.

  5. Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances

    Science.gov (United States)

    Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong

    2017-11-01

    Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.

  6. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

    Science.gov (United States)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

    2016-02-01

    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  7. Optimized emission in nanorod arrays through quasi-aperiodic inverse design.

    Science.gov (United States)

    Anderson, P Duke; Povinelli, Michelle L

    2015-06-01

    We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.

  8. Combinations of response-reinforcer relations in periodic and aperiodic schedules.

    Science.gov (United States)

    Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E

    2013-03-01

    Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.

  9. Investigation of aperiodic W/C multi-layer mirror for X-ray optics

    International Nuclear Information System (INIS)

    Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan

    2011-01-01

    Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.

  10. Aperiodic linear networked control considering variable channel delays: application to robots coordination.

    Science.gov (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

    2015-05-27

    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  11. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos

    2015-05-01

    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  12. Posthuman blues

    CERN Document Server

    Tonnies, Mac

    2013-01-01

    Posthuman Blues, Vol. I is first volume of the edited version of the popular weblog maintained by author Mac Tonnies from 2003 until his tragic death in 2009. Tonnies' blog was a pastiche of his original fiction, reflections on his day-to-day life, trenchant observations of current events, and thoughts on an eclectic range of material he culled from the Internet. What resulted was a remarkably broad portrait of a thoughtful man and the complex times in which he lived, rendered with intellige...

  13. Inventory parameters

    CERN Document Server

    Sharma, Sanjay

    2017-01-01

    This book provides a detailed overview of various parameters/factors involved in inventory analysis. It especially focuses on the assessment and modeling of basic inventory parameters, namely demand, procurement cost, cycle time, ordering cost, inventory carrying cost, inventory stock, stock out level, and stock out cost. In the context of economic lot size, it provides equations related to the optimum values. It also discusses why the optimum lot size and optimum total relevant cost are considered to be key decision variables, and uses numerous examples to explain each of these inventory parameters separately. Lastly, it provides detailed information on parameter estimation for different sectors/products. Written in a simple and lucid style, it offers a valuable resource for a broad readership, especially Master of Business Administration (MBA) students.

  14. Application of the three-dimensional aperiodic Fourier modal method using arc elements in curvilinear coordinates.

    Science.gov (United States)

    Bucci, Davide; Martin, Bruno; Morand, Alain

    2012-03-01

    This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.

  15. Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene

    Science.gov (United States)

    Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel

    2016-01-01

    We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.

  16. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...

  17. Stochastic resonance in a bistable system subject to multi-time-delayed feedback and aperiodic signal

    International Nuclear Information System (INIS)

    Li Jianlong; Zeng Lingzao

    2010-01-01

    We discuss in detail the effects of the multi-time-delayed feedback driven by an aperiodic signal on the output of a stochastic resonance (SR) system. The effective potential function and dynamical probability density function (PDF) are derived. To measure the performance of the SR system in the presence of a binary random signal, the bit error rate (BER) defined by the dynamical PDF is employed, as is commonly used in digital communications. We find that the delay time, strength of the feedback, and number of time-delayed terms can change the effective potential function and the effective amplitude of the signal, and then affect the BER of the SR system. The numerical simulations strongly support the theoretical results. The goal of this investigation is to explore the effects of the multi-time-delayed feedback on SR and give a guidance to nonlinear systems in the application of information processing.

  18. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    Science.gov (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  19. Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number

    Science.gov (United States)

    Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.

    2017-09-01

    Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.

  20. Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers

    Science.gov (United States)

    Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.

    2018-02-01

    Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.

  1. Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.

    Science.gov (United States)

    Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S

    2016-01-15

    Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.

  2. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.

    1992-09-01

    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  3. The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns

    Science.gov (United States)

    Duarte, Fabiola; Lemus, Luis

    2017-01-01

    The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406

  4. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

    2012-02-01

    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  5. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  6. Riparian Inventory

    Data.gov (United States)

    Kansas Data Access and Support Center — This dataset is a digital representation of the 1:24,000 Land Use Riparian Areas Inventory for the state of Kansas. The dataset includes a 100 foot buffer around all...

  7. Dual-wavelength green laser with a 4.5 THz frequency difference based on self-frequency- doubling in Nd3+ -doped aperiodically poled lithium niobate.

    Science.gov (United States)

    Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J

    2008-05-01

    We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.

  8. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon

    2009-06-01

    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  9. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    Science.gov (United States)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  10. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

    2011-01-01

    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  11. Synchronization of coupled stochastic complex-valued dynamical networks with time-varying delays via aperiodically intermittent adaptive control

    Science.gov (United States)

    Wang, Pengfei; Jin, Wei; Su, Huan

    2018-04-01

    This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.

  12. Blue and Orange Two-Color CW Laser Based on Single-Pass Second-Harmonic and Sum-Frequency Generation in MgO:PPLN

    Directory of Open Access Journals (Sweden)

    Dismas K. Choge

    2018-04-01

    Full Text Available We demonstrate a compact blue and orange-two color continuous wave laser source emitting at 487 nm and from 597.4 to 600.3 nm, respectively. The temperature tunable coherent orange radiation is achieved by frequency mixing 974 nm laser diode (LD and a C-band amplified spontaneous emission laser source while the temperature insensitive blue radiation is generated by second-order quasi-phase-matching frequency doubling of 974 nm LD. We implement the simultaneous nonlinear processes in a single magnesium oxide doped periodically poled lithium niobate bulk crystal without the need of an aperiodic design.

  13. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

    Science.gov (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

    2001-04-01

    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  14. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

    Science.gov (United States)

    Koju, Vijay

    Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

  15. A novel scenario of aperiodical impacts appearance in the turbine draft tube

    Science.gov (United States)

    Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.

    2016-11-01

    The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.

  16. Optimization of Inventory

    OpenAIRE

    PROKOPOVÁ, Nikola

    2017-01-01

    The subject of this thesis is optimization of inventory in selected organization. Inventory optimization is a very important topic in each organization because it reduces storage costs. At the beginning the inventory theory is presented. It shows the meaning and types of inventory, inventory control and also different methods and models of inventory control. Inventory optimization in the enterprise can be reached by using models of inventory control. In the second part the company on which is...

  17. Blue-Green Algae

    Science.gov (United States)

    ... that taking a specific blue-green algae product (Super Blue-Green Algae, Cell Tech, Klamath Falls, OR) ... system. Premenstrual syndrome (PMS). Depression. Digestion. Heart disease. Memory. Wound healing. Other conditions. More evidence is needed ...

  18. Theoretical and experimental study of bent fully aperiodic large-pitch fibers for enhancing the high-order modes delocalization

    Science.gov (United States)

    du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe

    2018-02-01

    The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.

  19. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

    Science.gov (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

    2018-03-01

    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  20. Inventory Abstraction

    International Nuclear Information System (INIS)

    Leigh, C.

    2000-01-01

    The purpose of the inventory abstraction as directed by the development plan (CRWMS M and O 1999b) is to: (1) Interpret the results of a series of relative dose calculations (CRWMS M and O 1999c, 1999d). (2) Recommend, including a basis thereof, a set of radionuclides that should be modeled in the Total System Performance Assessment in Support of the Site Recommendation (TSPA-SR) and the Total System Performance Assessment in Support of the Final Environmental Impact Statement (TSPA-FEIS). (3) Provide initial radionuclide inventories for the TSPA-SR and TSPA-FEIS models. (4) Answer the U.S. Nuclear Regulatory Commission (NRC)'s Issue Resolution Status Report ''Key Technical Issue: Container Life and Source Term'' (CLST IRSR) (NRC 1999) key technical issue (KTI): ''The rate at which radionuclides in SNF [Spent Nuclear Fuel] are released from the EBS [Engineered Barrier System] through the oxidation and dissolution of spent fuel'' (Subissue 3). The scope of the radionuclide screening analysis encompasses the period from 100 years to 10,000 years after the potential repository at Yucca Mountain is sealed for scenarios involving the breach of a waste package and subsequent degradation of the waste form as required for the TSPA-SR calculations. By extending the time period considered to one million years after repository closure, recommendations are made for the TSPA-FEIS. The waste forms included in the inventory abstraction are Commercial Spent Nuclear Fuel (CSNF), DOE Spent Nuclear Fuel (DSNF), High-Level Waste (HLW), naval Spent Nuclear Fuel (SNF), and U.S. Department of Energy (DOE) plutonium waste. The intended use of this analysis is in TSPA-SR and TSPA-FEIS. Based on the recommendations made here, models for release, transport, and possibly exposure will be developed for the isotopes that would be the highest contributors to the dose given a release to the accessible environment. The inventory abstraction is important in assessing system performance because

  1. INVENTORY ABSTRACTION

    International Nuclear Information System (INIS)

    Ragan, G.

    2001-01-01

    The purpose of the inventory abstraction, which has been prepared in accordance with a technical work plan (CRWMS M andO 2000e for/ICN--02 of the present analysis, and BSC 2001e for ICN 03 of the present analysis), is to: (1) Interpret the results of a series of relative dose calculations (CRWMS M andO 2000c, 2000f). (2) Recommend, including a basis thereof, a set of radionuclides that should be modeled in the Total System Performance Assessment in Support of the Site Recommendation (TSPA-SR) and the Total System Performance Assessment in Support of the Final Environmental Impact Statement (TSPA-FEIS). (3) Provide initial radionuclide inventories for the TSPA-SR and TSPA-FEIS models. (4) Answer the U.S. Nuclear Regulatory Commission (NRC)'s Issue Resolution Status Report ''Key Technical Issue: Container Life and Source Term'' (CLST IRSR) key technical issue (KTI): ''The rate at which radionuclides in SNF [spent nuclear fuel] are released from the EBS [engineered barrier system] through the oxidation and dissolution of spent fuel'' (NRC 1999, Subissue 3). The scope of the radionuclide screening analysis encompasses the period from 100 years to 10,000 years after the potential repository at Yucca Mountain is sealed for scenarios involving the breach of a waste package and subsequent degradation of the waste form as required for the TSPA-SR calculations. By extending the time period considered to one million years after repository closure, recommendations are made for the TSPA-FEIS. The waste forms included in the inventory abstraction are Commercial Spent Nuclear Fuel (CSNF), DOE Spent Nuclear Fuel (DSNF), High-Level Waste (HLW), naval Spent Nuclear Fuel (SNF), and U.S. Department of Energy (DOE) plutonium waste. The intended use of this analysis is in TSPA-SR and TSPA-FEIS. Based on the recommendations made here, models for release, transport, and possibly exposure will be developed for the isotopes that would be the highest contributors to the dose given a release

  2. Achieving sub-50 nm controlled diameter of aperiodic Si nanowire arrays by ultrasonic catalyst removal for photonic applications

    Science.gov (United States)

    Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit

    2018-05-01

    We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.

  3. Blue Emission in Proteins

    OpenAIRE

    Sarkar, Sohini; Sengupta, Abhigyan; Hazra, Partha; Mandal, Pankaj

    2014-01-01

    Recent literatures reported blue-green emission from amyloid fibril as exclusive signature of fibril formation. This unusual visible luminescence is regularly used to monitor fibril growth. Blue-green emission has also been observed in crystalline protein and in solution. However, the origin of this emission is not known exactly. Our spectroscopic study of serum proteins reveals that the blue-green emission is a property of protein monomer. Evidences suggest that semiconductor-like band struc...

  4. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

    Science.gov (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

    2017-12-01

    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  5. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

    Science.gov (United States)

    Kato, N.

    2017-12-01

    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  6. Dermatoscopy of blue vitiligo.

    Science.gov (United States)

    Chandrashekar, L

    2009-07-01

    Blue vitiligo is a distinct variant of vitiligo characterized by a blue-grey appearance of the skin, which corresponds histologically with absence of epidermal melanocytes and presence of numerous dermal melanophages. A 23-year-old woman of Indian origin with Fitzpatrick skin type V presented with a 1-month history of normoaesthetic depigmented macules over the right forearm, dorsa of the hands and right areola. The macule over the right forearm had a bluish tinge. A clinical diagnosis of vitiligo vulgaris with blue vitiligo was made. Dermatoscopy of the interface between the blue macule and the hypopigmented macule revealed a linear depigmented macule in the centre with multiple blue dots and absence of epidermal melanin on the side of the blue macule, and reticular pigmentation with a few depigmented macules and scattered blue dots over the side of the hypopigmented macule. Blue vitiligo was described previously in a patient seropositive for human immunodeficiency virus, and believed to represent postinflammatory hyperpigmentation in areas bordering the vitiliginous patches as a result of psoralen ultraviolet A treatment. This case is unusual because of its rarity and the description of the associated dermatoscopical findings.

  7. Blue Ocean Thinking

    Science.gov (United States)

    Orem, Donna

    2016-01-01

    This article describes a concept called the "blue ocean thinking strategy," developed by W. Chan Kim and Renée Mauborgne, professors at INSEAD, an international graduate school of business in France. The "blue ocean" thinking strategy considers opportunities to create new markets for services, rather than focusing solely on…

  8. Forest inventory in Myanmar

    Energy Technology Data Exchange (ETDEWEB)

    Bo, Sit [Forest Resource Div., Forest Department (Myanmar)

    1993-10-01

    Forest inventory in Myanmar started in 1850s. Up till 1975, Myanmar Forest Department conducted forest inventories covering approximately one forest division every year. The National Forest Survey and Inventory Project funded by UNDP and assisted by FAO commenced in 1981 and the National Forest Management and Inventory project followed in 1986. Up till end March 1993, pre-investment inventory has covered 26.7 million acres, reconnaissance inventory 5.4 million acres and management inventory has carried out in 12 townships

  9. Forest inventory in Myanmar

    International Nuclear Information System (INIS)

    Sit Bo

    1993-01-01

    Forest inventory in Myanmar started in 1850s. Up till 1975, Myanmar Forest Department conducted forest inventories covering approximately one forest division every year. The National Forest Survey and Inventory Project funded by UNDP and assisted by FAO commenced in 1981 and the National Forest Management and Inventory project followed in 1986. Up till end March 1993, pre-investment inventory has covered 26.7 million acres, reconnaissance inventory 5.4 million acres and management inventory has carried out in 12 townships

  10. Blue ocean strategy.

    Science.gov (United States)

    Kim, W Chan; Mauborgne, Renée

    2004-10-01

    Despite a long-term decline in the circus industry, Cirque du Soleil profitably increased revenue 22-fold over the last ten years by reinventing the circus. Rather than competing within the confines of the existing industry or trying to steal customers from rivals, Cirque developed uncontested market space that made the competition irrelevant. Cirque created what the authors call a blue ocean, a previously unknown market space. In blue oceans, demand is created rather than fought over. There is ample opportunity for growth that is both profitable and rapid. In red oceans--that is, in all the industries already existing--companies compete by grabbing for a greater share of limited demand. As the market space gets more crowded, prospects for profits and growth decline. Products turn into commodities, and increasing competition turns the water bloody. There are two ways to create blue oceans. One is to launch completely new industries, as eBay did with online auctions. But it's much more common for a blue ocean to be created from within a red ocean when a company expands the boundaries of an existing industry. In studying more than 150 blue ocean creations in over 30 industries, the authors observed that the traditional units of strategic analysis--company and industry--are of limited use in explaining how and why blue oceans are created. The most appropriate unit of analysis is the strategic move, the set of managerial actions and decisions involved in making a major market-creating business offering. Creating blue oceans builds brands. So powerful is blue ocean strategy, in fact, that a blue ocean strategic move can create brand equity that lasts for decades.

  11. Blue Ribbon Panel Report

    Science.gov (United States)

    An NCI Cancer Currents blog by the NCI acting director thanking the cancer community for contributing to the Cancer Moonshot Blue Ribbon Panel report, which was presented to the National Cancer Advisory Board on September 7.

  12. Northeast Atlantic blue whiting

    OpenAIRE

    Heino, Mikko

    2010-01-01

    Heino, M. 2010. Northeast Atlantic blue whiting. In Life cycle spatial patterns of small pelagic fish in the Northeast Atlantic, pp. 59-64. Ed by P. Petitgas. ICES Cooperative Research Report 306. ICES, Copenhagen.

  13. New York Blue

    Data.gov (United States)

    Federal Laboratory Consortium — New York Blue is used cooperatively by the Laboratory and Stony Brook University as part of the New York Center for Computation Sciences. Ranked as the 28th fastest...

  14. Housing Inventory Count

    Data.gov (United States)

    Department of Housing and Urban Development — This report displays the data communities reported to HUD about the nature of their dedicated homeless inventory, referred to as their Housing Inventory Count (HIC)....

  15. Integrated inventory information system

    Digital Repository Service at National Institute of Oceanography (India)

    Sarupria, J.S.; Kunte, P.D.

    The nature of oceanographic data and the management of inventory level information are described in Integrated Inventory Information System (IIIS). It is shown how a ROSCOPO (report on observations/samples collected during oceanographic programme...

  16. World Glacier Inventory

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The World Glacier Inventory (WGI) contains information for over 130,000 glaciers. Inventory parameters include geographic location, area, length, orientation,...

  17. HHS Enterprise Data Inventory

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Enterprise Data Inventory (EDI) is the comprehensive inventory listing of agency data resources including public, restricted public, and non-public datasets.

  18. Science Inventory | US EPA

    Science.gov (United States)

    The Science Inventory is a searchable database of research products primarily from EPA's Office of Research and Development. Science Inventory records provide descriptions of the product, contact information, and links to available printed material or websites.

  19. National Wetlands Inventory Polygons

    Data.gov (United States)

    Minnesota Department of Natural Resources — Wetland area features mapped as part of the National Wetlands Inventory (NWI). The National Wetlands Inventory is a national program sponsored by the US Fish and...

  20. Functional Assessment Inventory Manual.

    Science.gov (United States)

    Crewe, Nancy M.; Athelstan, Gary T.

    This manual, which provides extensive new instructions for administering the Functional Assessment Inventory (FAI), is intended to enable counselors to begin using the inventory without undergoing any special training. The first two sections deal with the need for functional assessment and issues in the development and use of the inventory. The…

  1. Natural Blue Food Colour

    DEFF Research Database (Denmark)

    Roda-Serrat, Maria Cinta

    In recent years, there has been a growing tendency to avoid the use of artificial colorants and additives in food products, especially after some studies linked their consumption with behavioural changes in children. However, the incorporation of colorants from natural origin remains a challenge...... for food technologists, as these are typically less vivid and less stable than their synthetic alternatives. Regarding blue colorants, phycocyanins from cyanobacteria are currently in the spotlight as promising new natural blue colorants. Phycocyanins are proteins which blue colour results from...... the presence of the chromophore phycocyanobilin (PCB), a covalently attached linear tetrapyrrole. The applications of phycocyanins as food colorants are however limited, as they show poor stability in certain conditions of pH, light and temperature. Cleavage of PCB from the protein followed by careful product...

  2. Evidence for deterministic chaos in aperiodic oscillations of acute lymphoblastic leukemia cells in long-term culture

    Science.gov (United States)

    Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.

    Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.

  3. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

    2012-01-01

    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  4. A Blue Lagoon Function

    DEFF Research Database (Denmark)

    Markvorsen, Steen

    2007-01-01

    We consider a specific function of two variables whose graph surface resembles a blue lagoon. The function has a saddle point $p$, but when the function is restricted to any given straight line through $p$ it has a {\\em{strict local minimum}} along that line at $p$.......We consider a specific function of two variables whose graph surface resembles a blue lagoon. The function has a saddle point $p$, but when the function is restricted to any given straight line through $p$ it has a {\\em{strict local minimum}} along that line at $p$....

  5. Inventory - Dollars and sense

    International Nuclear Information System (INIS)

    Samson, J.R.

    1992-01-01

    Nuclear utilities are becoming more aware of the importance of having an inventory investment that supports two opposing philosophies. The business philosophy wants a minimal inventory investment to support a better return on invested dollars. This increase in return comes from having the dollars available to invest versus having the money tied up in inventory sitting on the shelf. The opposing viewpoint is taken by maintenance/operations organizations, which desire the maximum inventory available on-site to repair any component at any time to keep the units on-line at all times. Financial managers also want to maintain cash flow throughout operations so that plants run without interruptions. Inventory management is therefore a mixture of financial logistics with an operation perspective in mind. A small amount of common sense and accurate perception also help. The challenge to the materials/inventory manager is to optimize effectiveness of the inventory by having high material availability at the lowest possible cost

  6. The "Blue Banana" Revisited

    NARCIS (Netherlands)

    Faludi, A.K.F.

    2015-01-01

    This essay is about the “Blue Banana”. Banana is the name given subsequently by others to a Dorsale européenne (European backbone) identified empirically by Roger Brunet. In a background study to the Communication of the European Commission ‘Europe 2000’, Klaus Kunzmann and Michael Wegener put

  7. Experimental investigation of the transverse modal instabilities onset in high power fully-aperiodic-large-pitch fiber lasers

    Science.gov (United States)

    Malleville, Marie-Alicia; Benoît, Aurélien; Dauliat, Romain; Leconte, Baptiste; Darwich, Dia; du Jeu, Rémi; Jamier, Raphaël.; Schwuchow, Anka; Schuster, Kay; Roy, Philippe

    2018-02-01

    Over the last decade, significant work has been carried out in order to increase the energy/peak power provided by fiber lasers. Indeed, new microstructured fibers with large (or very large) mode area cores (LMA) such as Distributed Mode Filtering (DMF) fibers and Large-Pitch Fibers (LPF) have been developed to address this concern. These technologies have allowed diffraction-limited emission with core diameters higher than 80 μm, and have state-of-the-art performances in terms of pulse energy or peak power while keeping an excellent spatial beam quality. Although these fibers were designed to reach high power levels while maintaining a single transverse mode propagation, power scaling becomes quickly limited by the onset of transverse modal instabilities (TMI). This effect suddenly arises when a certain average power threshold is exceeded, drastically degrading the emitted beam quality. In this work, we investigate the influence of the core dimensions and the refractive index mismatch between the active core and the background cladding material, on the TMI power threshold in rod-type Fully-Aperiodic-LPF. This fiber structure was specifically designed to enhance the higher-order modes (HOMs) delocalization out of the gain region and thus push further the onset of modal instabilities. Using a 400W pump diode at 976 nm, the power scaling, as well as the spatial beam quality and its temporal behavior were investigated in laser configuration, which theoretically provides a lower TMI power threshold than the amplifier one due to the lack of selective excitation of the fundamental mode.

  8. Vendor-managed inventory

    DEFF Research Database (Denmark)

    Govindan, Kannan

    2013-01-01

    Vendor-managed inventory (VMI) represents the methodology through which the upstream stage of a supply chain (vendor) takes responsibility for managing the inventories at the downstream stage (customer) based on previously agreed limits. VMI is another method by which supply chains can be managed...... review, we have identified six dimensions of VMI: namely, inventory, transportation, manufacturing, general benefits, coordination/collaboration, and information sharing. In addition, there are, three methodological classifications: modelling, simulation, and case studies. Finally, we will consider...

  9. THE TRANSATLANTIC BLUE DIPLOMACY

    Directory of Open Access Journals (Sweden)

    Ioana GUTU

    2016-12-01

    Full Text Available The international diplomatic environment has reached to an unprecedented development, involving one of the newly specialized diplomatic types, namely the economic diplomacy. At the core of the fast movements in the diplomatic spheres across the Globe are the international agreements like the Transatlantic Trade and Investment Partnership (TTIP that determined diplomacy to dissolve into new subtypes, evolving from ground to the ocean and implementing new ways of achieving economic and climate sustainability. One of the newly created diplomatic spheres, is the blue ocean diplomacy that acts mainly in accordance with the rules and regulations that are being applied to the transatlantic economy. Even though TTIP encourages the increase of trade flows across the Atlantic, it will also ease the foreign investment procedures that, under the approach of keeping a sustainable environment, will represent one of the most important initiatives in implementing the blue economy concept within the framework of the transatlantic diplomacy.

  10. National Wetlands Inventory Lines

    Data.gov (United States)

    Minnesota Department of Natural Resources — Linear wetland features (including selected streams, ditches, and narrow wetland bodies) mapped as part of the National Wetlands Inventory (NWI). The National...

  11. Denmark's National Inventory Report

    DEFF Research Database (Denmark)

    Illerup, J. B.; Lyck, E.; Winther, M.

    This report is Denmark's National Inventory Report reported to the Conference of the Parties under the United Nations Framework Convention on Climate Change (UNFCCC) due by 15 April 2001. The report contains information on Denmark's inventories for all years' from 1990 to 1999 for CO2, CH4, N2O, CO...

  12. Uncertainties in emission inventories

    NARCIS (Netherlands)

    Aardenne, van J.A.

    2002-01-01

    Emission inventories provide information about the amount of a pollutant that is emitted to the atmosphere as a result of a specific anthropogenic or natural process at a given time or place. Emission inventories can be used for either policy or scientific purposes. For

  13. Denmark's National Inventory Report

    DEFF Research Database (Denmark)

    Illerup, J. B.; Lyck, E.; Winther, M.

    This report is Denmark's National Inventory Report reported to the Conference of the Parties under the United Nations Framework Convention on Climate Change (UNFCCC) due by 15 April 2001. The report contains information on Denmark's inventories for all years' from 1990 to 1999 for CO2, CH4, N2O, ......, NMVOC, SO2, HFCs, PFCs and SF6....

  14. Inventory control strategies

    International Nuclear Information System (INIS)

    Primrose, D.

    1998-01-01

    Finning International Inc. is in the business of selling, financing and servicing Caterpillar and complementary equipment. Its main markets are in western Canada, Britain and Chile. This paper discusses the parts inventory strategies system for Finning (Canada). The company's territory covers British Columbia, Alberta, the Yukon and the Northwest Territories. Finning's parts inventory consists of 80,000 component units valued at more than $150 M. Distribution centres are located in Langley, British Columbia and Edmonton, Alberta. To make inventory and orders easier to control, Finning has designed a computer-based system, with software written exclusively for Caterpillar dealers. The system makes use of a real time electronic interface with all Finning locations, plus all Caterpillar facilities and other dealers in North America. Details of the system are discussed, including territorial stocking procedures, addition to stock, exhaustion of stock, automatic/suggest order controls, surplus inventory management, and procedures for jointly managed inventory. 3 tabs., 1 fig

  15. Optimal fuel inventory strategies

    International Nuclear Information System (INIS)

    Caspary, P.J.; Hollibaugh, J.B.; Licklider, P.L.; Patel, K.P.

    1990-01-01

    In an effort to maintain their competitive edge, most utilities are reevaluating many of their conventional practices and policies in an effort to further minimize customer revenue requirements without sacrificing system reliability. Over the past several years, Illinois Power has been rethinking its traditional fuel inventory strategies, recognizing that coal supplies are competitive and plentiful and that carrying charges on inventory are expensive. To help the Company achieve one of its strategic corporate goals, an optimal fuel inventory study was performed for its five major coal-fired generating stations. The purpose of this paper is to briefly describe Illinois Power's system and past practices concerning coal inventories, highlight the analytical process behind the optimal fuel inventory study, and discuss some of the recent experiences affecting coal deliveries and economic dispatch

  16. Inventory Control System by Using Vendor Managed Inventory (VMI)

    OpenAIRE

    Dona Sabila Alzena; Mustafid Mustafid; Suryono Suryono

    2018-01-01

    The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI) method on inventory control system provides transparency of sales data an...

  17. The Blue Marble

    Science.gov (United States)

    2002-01-01

    This spectacular Moderate Resolution Imaging Spectroradiometer (MODIS) 'blue marble' image is based on the most detailed collection of true-color imagery of the entire Earth to date. Using a collection of satellite-based observations, scientists and visualizers stitched together months of observations of the land surface, oceans, sea ice, and clouds into a seamless, true-color mosaic of every square kilometer (.386 square mile) of our planet. Most of the information contained in this image came from MODIS, illustrating MODIS' outstanding capacity to act as an integrated tool for observing a variety of terrestrial, oceanic, and atmospheric features of the Earth. The land and coastal ocean portions of this image is based on surface observations collected from June through September 2001 and combined, or composited, every eight days to compensate for clouds that might block the satellite's view on any single day. Global ocean color (or chlorophyll) data was used to simulate the ocean surface. MODIS doesn't measure 3-D features of the Earth, so the surface observations were draped over topographic data provided by the U.S. Geological Survey EROS Data Center. MODIS observations of polar sea ice were combined with observations of Antarctica made by the National Oceanic and Atmospheric Administration's AVHRR sensor-the Advanced Very High Resolution Radiometer. The cloud image is a composite of two days of MODIS imagery collected in visible light wavelengths and a third day of thermal infra-red imagery over the poles. A large collection of imagery based on the blue marble in a variety of sizes and formats, including animations and the full (1 km) resolution imagery, is available at the Blue Marble page. Image by Reto Stockli, Render by Robert Simmon. Based on data from the MODIS Science Team

  18. Interactive Inventory Monitoring

    Science.gov (United States)

    Garud, Sumedha

    2013-01-01

    Method and system for monitoring present location and/or present status of a target inventory item, where the inventory items are located on one or more inventory shelves or other inventory receptacles that communicate with an inventory base station through use of responders such as RFIDs. A user operates a hand held interrogation and display (lAD) module that communicates with, or is part of the base station to provide an initial inquiry. lnformation on location(s) of the larget invenlory item is also indicated visibly and/or audibly on the receptacle(s) for the user. Status information includes an assessment of operation readiness and a time, if known, that the specified inventory item or class was last removed or examined or modified. Presentation of a user access level may be required for access to the target inventgory item. Another embodiment provides inventory informatin for a stack as a sight-impaired or hearing-impaired person adjacent to that stack.

  19. Blue ocean leadership.

    Science.gov (United States)

    Kim, W Chan; Mauborgne, Renée

    2014-05-01

    Ten years ago, two INSEAD professors broke ground by introducing "blue ocean strategy," a new model for discovering uncontested markets that are ripe for growth. In this article, they apply their concepts and tools to what is perhaps the greatest challenge of leadership: closing the gulf between the potential and the realized talent and energy of employees. Research indicates that this gulf is vast: According to Gallup, 70% of workers are disengaged from their jobs. If companies could find a way to convert them into engaged employees, the results could be transformative. The trouble is, managers lack a clear understanding of what changes they could make to bring out the best in everyone. Here, Kim and Mauborgne offer a solution to that problem: a systematic approach to uncovering, at each level of the organization, which leadership acts and activities will inspire employees to give their all, and a process for getting managers throughout the company to start doing them. Blue ocean leadership works because the managers' "customers"-that is, the people managers oversee and report to-are involved in identifying what's effective and what isn't. Moreover, the approach doesn't require leaders to alter who they are, just to undertake a different set of tasks. And that kind of change is much easier to implement and track than changes to values and mind-sets.

  20. SBA Network Components & Software Inventory

    Data.gov (United States)

    Small Business Administration — SBA’s Network Components & Software Inventory contains a complete inventory of all devices connected to SBA’s network including workstations, servers, routers,...

  1. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

    Science.gov (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

    2017-11-01

    A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

  2. [The role of some psychological, psychosocial and obstetrical factors in the intensity of postpartum blues].

    Science.gov (United States)

    Séjourné, N; Denis, A; Theux, G; Chabrol, H

    2008-04-01

    Within days following birth, most women show signs of mood changes, commonly named baby blues. Baby blues can result in postpartum depression. Hence it appears important to explore in more details the clinical background related to the intensity of postpartum blues. The aim of this study is to investigate the contribution of psychological, psychosocial and obstetrical factors to the intensity of postpartum blues. One hundred and forty-eight women participated in the study and completed questionnaires three days after delivery. A questionnaire was built to collect information on psychosocial and obstetrical factors. The Maternity Blues (Kennerley and Gath, 1989) was used to assess postpartum blues. Psychological factors were measured with the Maternal Self-Report Inventory (Shea et Tronick, 1988), the Perceived Stress Scale (Cohen, Kamarch et Mermelstein, 1983) and the Sarason's Social Support Questionnaire (1983). Four multiple regression analyses were conducted to predict the intensity of postpartum blues by entering psychosocial factors, history of depression, obstetrical factors and psychological and relational factors. Significant predictors (maternal self-esteem, marital status, previous psychotherapeutic treatment, previous antidepressant treatment) were entered in a multiple regression analysis predicting the intensity of postpartum blues. This model accounted for 31% of the variance in the intensity of postpartum blues (F(4, 143)=17.9; Pself-esteem (beta=-0.37; Porder to detect women who exhibit risk factors.

  3. National Emission Inventory (NEI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — This data exchange allows states to submit data to the US Environmental Protection Agency's National Emissions Inventory (NEI). NEI is a national database of air...

  4. National Emission Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The National Emission Inventory contains measured, modeled, and estimated data for emissions of all known source categories in the US (stationary sources, fires,...

  5. Toxics Release Inventory (TRI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Toxics Release Inventory (TRI) is a dataset compiled by the U.S. Environmental Protection Agency (EPA). It contains information on the release and waste...

  6. Business Process Inventory

    Data.gov (United States)

    Office of Personnel Management — Inventory of maps and descriptions of the business processes of the U.S. Office of Personnel Management (OPM), with an emphasis on the processes of the Office of the...

  7. National Wetlands Inventory Points

    Data.gov (United States)

    Minnesota Department of Natural Resources — Wetland point features (typically wetlands that are too small to be as area features at the data scale) mapped as part of the National Wetlands Inventory (NWI). The...

  8. Asset Inventory Database

    Data.gov (United States)

    US Agency for International Development — AIDM is used to track USAID assets such as furniture, computers, and equipment. Using portable bar code readers, receiving and inventory personnel can capture...

  9. NCRN Hemlock Inventory Data

    Data.gov (United States)

    Department of the Interior — ​Data associated with the 2015 hemlock inventory project in NCR. Eastern hemlock (Tsuga canadensis) is a coniferous tree native to the NE and Appalachian regions of...

  10. Logistics and Inventory System -

    Data.gov (United States)

    Department of Transportation — The Logistics and Inventory System (LIS) is the agencys primary supply/support automation tool. The LIS encompasses everything from order entry by field specialists...

  11. Public Waters Inventory Maps

    Data.gov (United States)

    Minnesota Department of Natural Resources — This theme is a scanned and rectified version of the Minnesota DNR - Division of Waters "Public Waters Inventory" (PWI) maps. DNR Waters utilizes a small scale...

  12. VA Enterprise Data Inventory

    Data.gov (United States)

    Department of Veterans Affairs — The Department of Veterans Affairs Enterprise Data Inventory accounts for all of the datasets used in the agency's information systems. This entry was approved for...

  13. Instant BlueStacks

    CERN Document Server

    Judge, Gary

    2013-01-01

    Get to grips with a new technology, understand what it is and what it can do for you, and then get to work with the most important features and tasks. A fast-paced, example-based approach guide for learning BlueStacks.This book is for anyone with a Mac or PC who wants to run Android apps on their computer. Whether you want to play games that are freely available for Android but not your computer, or you want to try apps before you install them on a physical device or use it as a development tool, this book will show you how. No previous experience is needed as this is written in plain English

  14. Hydrogen inventory in gallium

    International Nuclear Information System (INIS)

    Mazayev, S.N.; Prokofiev, Yu.G.

    1994-01-01

    Investigations of hydrogen inventory in gallium (99.9%) were carried out after saturation both from molecular phase and from glow discharge plasma at room temperature, 370 and 520 K. Saturation took place during 3000 s under hydrogen pressure of 20 Pa, and ion flux was about 1x10 15 ions/cm 2 s with an energy about 400 eV during discharge. Hydrogen concentration in Ga at room temperature and that for 370 K by the saturation from gaseous phase was (2-3)x10 14 cm -3 Pa -1/2 . Hydrogen concentration at temperature 520 K increased by five times. Inventory at room temperature for irradiation from discharge was 7x10 16 cm -3 at the dose about 3x10 18 ions/cm 2 . It was more than inventory at temperature 520 K by four times and more than maximum inventory from gaseous phase at 520 K by a factor of 10. Inventory increased when temperature decreased. Diffusion coefficient D=0.003 exp(-2300/RT) cm 2 /s, was estimated from temperature dependence. ((orig.))

  15. Nuclear materials inventory plan

    International Nuclear Information System (INIS)

    Doerr, R.W.; Nichols, D.H.

    1982-03-01

    In any processing, manufacturing, or active storage facility it is impractical to assume that any physical security system can prevent the diversion of Special Nuclear Material (SNM). It is, therefore, the responsibility of any DOE Contractor, Licensee, or other holder of SNM to provide assurance that loss or diversion of a significant quantity of SNM is detectable. This ability to detect must be accomplishable within a reasonable time interval and can be accomplished only by taking physical inventories. The information gained and decisions resulting from these inventories can be no better than the SNM accounting system and the quality of measurements performed for each receipt, removal and inventory. Inventories interrupt processing or production operations, increase personnel exposures, and can add significantly to the cost of any operation. Therefore, realistic goals for the inventory must be defined and the relationship of the inherent parameters used in its validation be determined. Purpose of this document is to provide a statement of goals and a plan of action to achieve them

  16. Fukushima Daiichi Radionuclide Inventories

    Energy Technology Data Exchange (ETDEWEB)

    Cardoni, Jeffrey N. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Jankovsky, Zachary Kyle [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-09-01

    Radionuclide inventories are generated to permit detailed analyses of the Fukushima Daiichi meltdowns. This is necessary information for severe accident calculations, dose calculations, and source term and consequence analyses. Inventories are calculated using SCALE6 and compared to values predicted by international researchers supporting the OECD/NEA's Benchmark Study on the Accident at Fukushima Daiichi Nuclear Power Station (BSAF). Both sets of inventory information are acceptable for best-estimate analyses of the Fukushima reactors. Consistent nuclear information for severe accident codes, including radionuclide class masses and core decay powers, are also derived from the SCALE6 analyses. Key nuclide activity ratios are calculated as functions of burnup and nuclear data in order to explore the utility for nuclear forensics and support future decommissioning efforts.

  17. Shortening the Xerostomia Inventory

    Science.gov (United States)

    Thomson, William Murray; van der Putten, Gert-Jan; de Baat, Cees; Ikebe, Kazunori; Matsuda, Ken-ichi; Enoki, Kaori; Hopcraft, Matthew; Ling, Guo Y

    2011-01-01

    Objectives To determine the validity and properties of the Summated Xerostomia Inventory-Dutch Version in samples from Australia, The Netherlands, Japan and New Zealand. Study design Six cross-sectional samples of older people from The Netherlands (N = 50), Australia (N = 637 and N = 245), Japan (N = 401) and New Zealand (N = 167 and N = 86). Data were analysed using the Summated Xerostomia Inventory-Dutch Version. Results Almost all data-sets revealed a single extracted factor which explained about half of the variance, with Cronbach’s alpha values of at least 0.70. When mean scale scores were plotted against a “gold standard” xerostomia question, statistically significant gradients were observed, with the highest score seen in those who always had dry mouth, and the lowest in those who never had it. Conclusion The Summated Xerostomia Inventory-Dutch Version is valid for measuring xerostomia symptoms in clinical and epidemiological research. PMID:21684773

  18. Photometry of faint blue stars

    International Nuclear Information System (INIS)

    Kilkenny, D.; Hill, P.W.; Brown, A.

    1977-01-01

    Photometry on the uvby system is given for 61 faint blue stars. The stars are classified by means of the Stromgren indices, using criteria described in a previous paper (Kilkenny and Hill (1975)). (author)

  19. Ecology of blue straggler stars

    CERN Document Server

    Carraro, Giovanni; Beccari, Giacomo

    2015-01-01

    The existence of blue straggler stars, which appear younger, hotter, and more massive than their siblings, is at odds with a simple picture of stellar evolution. Such stars should have exhausted their nuclear fuel and evolved long ago to become cooling white dwarfs. They are found to exist in globular clusters, open clusters, dwarf spheroidal galaxies of the Local Group, OB associations and as field stars. This book summarises the many advances in observational and theoretical work dedicated to blue straggler stars. Carefully edited extended contributions by well-known experts in the field cover all the relevant aspects of blue straggler stars research: Observations of blue straggler stars in their various environments; Binary stars and formation channels; Dynamics of globular clusters; Interpretation of observational data and comparison with models. The book also offers an introductory chapter on stellar evolution written by the editors of the book.

  20. China Mobile: Expanding "Blue Ocean"

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Driving force is crucial for realizing high-speed growth. The strong driving force from "Blue Ocean Strategy" is an important advantage for China Mobile to realize harmonious and leap-forward development.

  1. Purchasing and inventory management techniques for optimizing inventory investment

    International Nuclear Information System (INIS)

    McFarlane, I.; Gehshan, T.

    1993-01-01

    In an effort to reduce operations and maintenance costs among nuclear plants, many utilities are taking a closer look at their inventory investment. Various approaches for inventory reduction have been used and discussed, but these approaches are often limited to an inventory management perspective. Interaction with purchasing and planning personnel to reduce inventory investment is a necessity in utility efforts to become more cost competitive. This paper addresses the activities that purchasing and inventory management personnel should conduct in an effort to optimize inventory investment while maintaining service-level goals. Other functions within a materials management organization, such as the warehousing and investment recovery functions, can contribute to optimizing inventory investment. However, these are not addressed in this paper because their contributions often come after inventory management and purchasing decisions have been made

  2. Rapid inventory taking system

    International Nuclear Information System (INIS)

    Marsden, P.S.S.F.

    1980-01-01

    A data processing system designed to facilitate inventory taking is described. The process depends upon the earliest possible application of computer techniques and the elimination of manual operations. Data is recorded in optical character recognition (OCR) 'A' form and read by a hand held wand reader. Limited validation checks are applied before recording on mini-tape cassettes. 5 refs

  3. Experimental inventory verification system

    International Nuclear Information System (INIS)

    Steverson, C.A.; Angerman, M.I.

    1991-01-01

    As Low As Reasonably Achievable (ALARA) goals and Department of Energy (DOE) inventory requirements are frequently in conflict at facilities across the DOE complex. The authors wish, on one hand, to verify the presence of correct amounts of nuclear materials that are in storage or in process; yet on the other hand, we wish to achieve ALARA goals by keeping individual and collective exposures as low as social, technical, economic, practical, and public policy considerations permit. The Experimental Inventory Verification System (EIVSystem) is a computer-based, camera-driven system that utilizes image processing technology to detect change in vault areas. Currently in the test and evaluation phase at Idaho National Engineering Laboratory, this system guards personnel. The EIVSystem continually monitors the vault, providing proof of changed status for objects sorted within the vault. This paper reports that these data could provide the basis for reducing inventory requirements when no change has occurred, thus helping implement ALARA policy; the data will also help describe there target area of an inventory when change has been shown to occur

  4. Marine Education Knowledge Inventory.

    Science.gov (United States)

    Hounshell, Paul B.; Hampton, Carolyn

    This 35-item, multiple-choice Marine Education Knowledge Inventory was developed for use in upper elementary/middle schools to measure a student's knowledge of marine science. Content of test items is drawn from oceanography, ecology, earth science, navigation, and the biological sciences (focusing on marine animals). Steps in the construction of…

  5. Calculating Optimal Inventory Size

    Directory of Open Access Journals (Sweden)

    Ruby Perez

    2010-01-01

    Full Text Available The purpose of the project is to find the optimal value for the Economic Order Quantity Model and then use a lean manufacturing Kanban equation to find a numeric value that will minimize the total cost and the inventory size.

  6. Life Cycle Inventory Analysis

    DEFF Research Database (Denmark)

    Bjørn, Anders; Moltesen, Andreas; Laurent, Alexis

    2018-01-01

    of different sources. The output is a compiled inventory of elementary flows that is used as basis of the subsequent life cycle impact assessment phase. This chapter teaches how to carry out this task through six steps: (1) identifying processes for the LCI model of the product system; (2) planning...

  7. The Danish CORINAIR Inventories

    DEFF Research Database (Denmark)

    Winther, M.; Illerup, J. B.; Fenhann, J.

    CORINAIR is the most comprehensive European air emission inventory programme. It consists of a defined emission calculation methodology and software for storing and further data processing. In CORINAIR 28 different emission species are estimated in 11 main sectors which are further sub-divided, a...

  8. Shortening the xerostomia inventory

    NARCIS (Netherlands)

    Thomson, W.M.; Putten, G.J. van der; Baat, C. de; Ikebe, K.; Matsuda, K.; Enoki, K.; Hopcraft, M.S.; Ling, G.Y.

    2011-01-01

    OBJECTIVES: The aim of this study was to determine the validity and properties of the Summated Xerostomia Inventory-Dutch Version in samples from Australia, The Netherlands, Japan, and New Zealand. STUDY DESIGN: Six cross-sectional samples of older people from The Netherlands (n = 50), Australia (n

  9. Student Attitude Inventory - 1971.

    Science.gov (United States)

    Gillmore, Gerald M.; Aleamoni, Lawrence M.

    This 42-item Student Attitude Inventory (SAI) was administered to entering college freshmen at the University of Illinois (see TM 001 015). The SAI items are divided into nine categories on the basis of content as follows: voting behavior, drug usage, financial, Viet Nam war, education, religious behavior, pollution, housing, and alienation. A…

  10. Initial Radionuclide Inventories

    Energy Technology Data Exchange (ETDEWEB)

    H. Miller

    2004-09-19

    The purpose of this analysis is to provide an initial radionuclide inventory (in grams per waste package) and associated uncertainty distributions for use in the Total System Performance Assessment for the License Application (TSPA-LA) in support of the license application for the repository at Yucca Mountain, Nevada. This document is intended for use in postclosure analysis only. Bounding waste stream information and data were collected that capture probable limits. For commercially generated waste, this analysis considers alternative waste stream projections to bound the characteristics of wastes likely to be encountered using arrival scenarios that potentially impact the commercial spent nuclear fuel (CSNF) waste stream. For TSPA-LA, this radionuclide inventory analysis considers U.S. Department of Energy (DOE) high-level radioactive waste (DHLW) glass and two types of spent nuclear fuel (SNF): CSNF and DOE-owned (DSNF). These wastes are placed in two groups of waste packages: the CSNF waste package and the codisposal waste package (CDSP), which are designated to contain DHLW glass and DSNF, or DHLW glass only. The radionuclide inventory for naval SNF is provided separately in the classified ''Naval Nuclear Propulsion Program Technical Support Document'' for the License Application. As noted previously, the radionuclide inventory data presented here is intended only for TSPA-LA postclosure calculations. It is not applicable to preclosure safety calculations. Safe storage, transportation, and ultimate disposal of these wastes require safety analyses to support the design and licensing of repository equipment and facilities. These analyses will require radionuclide inventories to represent the radioactive source term that must be accommodated during handling, storage and disposition of these wastes. This analysis uses the best available information to identify the radionuclide inventory that is expected at the last year of last emplacement

  11. [Acute blue urticaria following subcutaneous injection of patent blue dye].

    Science.gov (United States)

    Hamelin, A; Vial-Dupuy, A; Lebrun-Vignes, B; Francès, C; Soria, A; Barete, S

    2015-11-01

    Patent blue (PB) is a lymphatic vessel dye commonly used in France for sentinel lymph node detection in breast cancer, and less frequently in melanoma, and which may induce hypersensitivity reactions. We report a case of acute blue urticaria occurring within minutes of PB injection. Ten minutes after PB injection for sentinel lymph node detection during breast cancer surgery, a 49-year-old woman developed generalised acute blue urticaria and eyelid angioedema without bronchospasm or haemodynamic disturbance, but requiring discontinuation of surgery. Skin testing using PB and the anaesthetics given were run 6 weeks after the episode and confirmed PB allergy. PB was formally contra-indicated. Immediate hypersensitivity reactions to PB have been reported for between 0.24 and 2.2% of procedures. Such reactions are on occasion severe, chiefly involving anaphylactic shock. Two mechanisms are probably associated: non-specific histamine release and/or an IgE-mediated mechanism. Skin tests are helpful in confirming the diagnosis of PB allergy. Blue acute urticaria is one of the clinical manifestations of immediate hypersensitivity reactions to patent blue dye. Skin tests must be performed 6 weeks after the reaction in order to confirm the diagnosis and formally contra-indicate this substance. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  12. Denmark's National Inventory Report 2010

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Lyck, Erik; Mikkelsen, Mette Hjorth

    2010-01-01

    This report is Denmark's National Inventory Report 2010. The report contains information on Denmark's emission inventories for all years' from 1990 to 2008 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2.......This report is Denmark's National Inventory Report 2010. The report contains information on Denmark's emission inventories for all years' from 1990 to 2008 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2....

  13. Procedure for taking physical inventories

    International Nuclear Information System (INIS)

    Anon.

    1981-01-01

    This session is intended to apprise one of the various aspects of procedures and routines that Exxon Nuclear uses with respect to its nuclear materials physical inventory program. The presentation describes how plant physical inventories are planned and taken. The description includes the planning and preparation for taking the inventory, the clean-out procedures for converting in-process material to measurable items, the administrative procedures for establishing independent inventory teams and for inventorying each inventory area, the verification procedures used to include previously measured tamper-safed items in the inventory, and lastly, procedures used to reconcile the inventory and calculate MUF (materials unaccounted for). The purpose of the session is to enable participants to: (1) understand the planning and pre-inventorty procedures and their importance; (2) understand the need for and the required intensity of clean-out procedures; (3) understand how inventory teams are formed, and how the inventory is conducted; (4) understand the distinction between inventory previously measured tamper-safed items and other materials not so characterized; (5) understand the reconciliation procedures; and (6) calculate a MUF given the book and inventory results

  14. Inventory Control System by Using Vendor Managed Inventory (VMI

    Directory of Open Access Journals (Sweden)

    Dona Sabila Alzena

    2018-01-01

    Full Text Available The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI method on inventory control system provides transparency of sales data and inventory of goods at retailer level to supplier. Inventory control is performed by calculating safety stock and reorder point of goods based on sales data received by the system. Rule-based reasoning is provided on the system to facilitate the monitoring of inventory status information, thereby helping the process of inventory updates appropriately. Utilization of SMS technology is also considered as a medium of collecting sales data in real-time due to the ease of use. The results of this study indicate that inventory control using VMI ensures the availability of goods ± 70% and can reduce the accumulation of goods ± 30% at the retail level.

  15. Inventory Control System by Using Vendor Managed Inventory (VMI)

    Science.gov (United States)

    Sabila, Alzena Dona; Mustafid; Suryono

    2018-02-01

    The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI) method on inventory control system provides transparency of sales data and inventory of goods at retailer level to supplier. Inventory control is performed by calculating safety stock and reorder point of goods based on sales data received by the system. Rule-based reasoning is provided on the system to facilitate the monitoring of inventory status information, thereby helping the process of inventory updates appropriately. Utilization of SMS technology is also considered as a medium of collecting sales data in real-time due to the ease of use. The results of this study indicate that inventory control using VMI ensures the availability of goods ± 70% and can reduce the accumulation of goods ± 30% at the retail level.

  16. National Biological Monitoring Inventory

    International Nuclear Information System (INIS)

    Burgess, R.L.

    1979-01-01

    The National Biological Monitoring Inventory, initiated in 1975, currently consists of four computerized data bases and voluminous manual files. MAIN BIOMON contains detailed information on 1,021 projects, while MINI BIOMON provides skeletal data for over 3,000 projects in the 50 states, Puerto Rico, the Virgin Islands, plus a few in Canada and Mexico. BIBLIO BIOMON and DIRECTORY BIOMON complete the computerized data bases. The structure of the system provides for on-line search capabilities to generate details of agency sponsorship, indications of funding levels, taxonomic and geographic coverage, length of program life, managerial focus or emphasis, and condition of the data. Examples of each of these are discussed and illustrated, and potential use of the Inventory in a variety of situations is emphasized

  17. Resolving inventory differences

    International Nuclear Information System (INIS)

    Weber, J.H.; Clark, J.P.

    1991-01-01

    Determining the cause of an inventory difference (ID) that exceeds warning or alarm limits should not only involve investigation into measurement methods and reexamination of the model assumptions used in the calculation of the limits, but also result in corrective actions that improve the quality of the accountability measurements. An example illustrating methods used by Savannah River Site (SRS) personnel to resolve an ID is presented that may be useful to other facilities faced with a similar problem. After first determining that no theft or diversion of material occurred and correcting any accountability calculation errors, investigation into the IDs focused on volume and analytical measurements, limit of error of inventory difference (LEID) modeling assumptions, and changes in the measurement procedures and methods prior to the alarm. There had been a gradual gain trend in IDs prior to the alarm which was reversed by the alarm inventory. The majority of the NM in the facility was stored in four large tanks which helped identify causes for the alarm. The investigation, while indicating no diversion or theft, resulted in changes in the analytical method and in improvements in the measurement and accountability that produced a 67% improvement in the LEID

  18. Procedure for taking physical inventories

    International Nuclear Information System (INIS)

    Boston, R.A.

    1984-01-01

    Physical inventories are taken periodically to meet Company, State and IAEA requirements. Those physical inventories may be verified by IAEA and/or State inspectors. This presentation describes in an introductory but detailed manner the approaches and procedures used in planning, preparing, conducting, reconciling and reporting physical inventories for the Model Plant. Physical inventories are taken for plant accounting purposes to provide an accurate basis for starting and closing the plant material balance. Physical inventories are also taken for safeguards purposes to provide positive assurance that the nuclear materials of concern are indeed present and accounted for

  19. Crystalline liquids: the blue phases

    Science.gov (United States)

    Wright, David C.; Mermin, N. David

    1989-04-01

    The blue phases of cholesteric liquid crystals are liquids that exhibit orientational order characterized by crystallographic space-group symmetries. We present here a pedagogical introduction to the current understanding of the equilibrium structure of these phases accompanied by a general overview of major experimental results. Using the Ginzburg-Landau free energy appropriate to the system, we first discuss in detail the character and stability of the usual helical phase of cholesterics, showing that for certain parameter ranges the helical phase is unstable to the appearance of one or more blue phases. The two principal models for the blue phases are two limiting cases of the Ginzburg-Landau theory. We explore each limit and conclude with some general considerations of defects in both models and an exact minimization of the free energy in a curved three-dimensional space.

  20. Origin of faint blue stars

    International Nuclear Information System (INIS)

    Tutukov, A.; Iungelson, L.

    1987-01-01

    The origin of field faint blue stars that are placed in the HR diagram to the left of the main sequence is discussed. These include degenerate dwarfs and O and B subdwarfs. Degenerate dwarfs belong to two main populations with helium and carbon-oxygen cores. The majority of the hot subdwarfs most possibly are helium nondegenerate stars that are produced by mass exchange close binaries of moderate mass cores (3-15 solar masses). The theoretical estimates of the numbers of faint blue stars of different types brighter than certain stellar magnitudes agree with star counts based on the Palomar Green Survey. 28 references

  1. Inventory of armourstone

    Directory of Open Access Journals (Sweden)

    Le Turdu Valéry

    2016-01-01

    Full Text Available Natural armourstone is widely used for hydraulic works, both in the coastal domain and in border of rivers and torrents, especially to protect against flood and the effects of waves and currents. To meet the expectations associated with this resource, an inventory of armourstone quarries was realized on a national scale in France. This inventory informs not only about the localization of quarries but also about the quality and the availability of materials. To fully optimize this inventory in a dynamic format, the association of all actors of the sector was preferred to archival research. This partnership approach led to project deliverables that can constitute durably a shared reference. The database can indeed be updated regularly thanks to the contacts established with the professionals of quarries. The access to this database is offered to a wide public: maritime and fluvial ports, local authorities in charge of planning and managing structures that protect against flood and other hydraulic hazards. This new database was organized considering its importance on the operational plan. This led to a hierarchical organization at two levels for each quarry face: first level, a synthesis sheet brings the essential information to realize choices upstream to the operational phases. Second level, a detailed specification sheet presents the technical characteristics observed in the past on the considered face. The atlas has two information broadcasting formats: a pdf file with browsing functions and a geographical information system that allows remote request of the database. These two media have their own updating rhythms, annual for the first and continue for the second.

  2. Perishable Inventory Challenges

    DEFF Research Database (Denmark)

    Damgaard, Cecilie Maria; Nguyen, Vivi Thuy; Hvolby, Hans-Henrik

    2012-01-01

    in the retail supply chains. The goal is to find and evaluate the parameters which affect the decision making process, when finding the optimal order quantity and order time. The paper takes a starting point in the retail industry but links to other industries.......The paper investigates how inventory control of perishable items is managed and line up some possible options of improvement. This includes a review of relevant literature dealing with the challenges of determining ordering policies for perishable products and a study of how the current procedures...

  3. Blue Ocean vs. Five Forces

    NARCIS (Netherlands)

    A.E. Burke (Andrew); A.J. van Stel (André); A.R. Thurik (Roy)

    2010-01-01

    textabstractThe article reports on the authors' research in the Netherlands which focused on a profit model in Dutch retail stores and a so-called blue-ocean approach which requires a new market that attracts consumers and increases profits. Topics include the competitive strategy approach to

  4. Energy Education Materials Inventory

    Energy Technology Data Exchange (ETDEWEB)

    1979-08-01

    The two volumes of the Energy Education Materials Inventory (EEMI) comprise an annotated bibliography of widely available energy education materials and reference sources. This systematic listing is designed to provide a source book which will facilitate access to these educational resources and hasten the inclusion of energy-focused learning experiences in kindergarten through grade twelve. EEMI Volume II expands Volume I and contains items that have become available since its completion in May, 1976. The inventory consists of three major parts. A core section entitled Media contains titles and descriptive information on educational materials, categorized according to medium. The other two major sections - Grade Level and Subject - are cross indexes of the items for which citations appear in the Media Section. These contain titles categorized according to grade level and subject and show the page numbers of the full citations. The general subject area covered includes the following: alternative energy sources (wood, fuel from organic wastes, geothermal energy, nuclear power, solar energy, tidal power, wind energy); energy conservation, consumption, and utilization; energy policy and legislation, environmental/social aspects of energy technology; and fossil fuels (coal, natural gas, petroleum). (RWR)

  5. NRC inventory of dams

    International Nuclear Information System (INIS)

    Lear, G.E.; Thompson, O.O.

    1983-01-01

    The NRC Inventory of Dams has been prepared as required by the charter of the NRC Dam Safety Officer. The inventory lists 51 dams associated with nuclear power plant sites and 14 uranium mill tailings dams (licensed by NRC) in the US as of February 1, 1982. Of the 85 listed nuclear power plants (148 units), 26 plants obtain cooling water from impoundments formed by dams. The 51 dams associated with the plants are: located on a plant site (29 dams at 15 plant sites); located off site but provide plant cooling water (18 dams at 11 additional plant sites); and located upstream from a plant (4 dams) - they have been identified as dams whose failure, and ensuing plant flooding, could result in a radiological risk to the public health and safety. The dams that might be considered NRC's responsibility in terms of the federal dam safety program are identified. This group of dams (20 on nuclear power plant sites and 14 uranium mill tailings dams) was obtained by eliminating dams that do not pose a flooding hazard (e.g., submerged dams) and dams that are regulated by another federal agency. The report includes the principal design features of all dams and related useful information

  6. Strategic Inventories in Vertical Contracts

    OpenAIRE

    Krishnan Anand; Ravi Anupindi; Yehuda Bassok

    2008-01-01

    Classical reasons for carrying inventory include fixed (nonlinear) production or procurement costs, lead times, nonstationary or uncertain supply/demand, and capacity constraints. The last decade has seen active research in supply chain coordination focusing on the role of incentive contracts to achieve first-best levels of inventory. An extensive literature in industrial organization that studies incentives for vertical controls largely ignores the effect of inventories. Does the ability to ...

  7. Denmark's National Inventory Report 2013

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s National Inventory Report 2013. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2011 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2.......This report is Denmark’s National Inventory Report 2013. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2011 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2....

  8. Denmark's National Inventory Report 2017

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s National Inventory Report 2017. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2015 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2017. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2015 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

  9. Denmark's National Inventory Report 2014

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s National Inventory Report 2014. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2012 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2014. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2012 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

  10. Six ways to reduce inventory.

    Science.gov (United States)

    Lunn, T

    1996-05-01

    The purpose of this presentation is to help you reduce the inventory in your operation. We will accomplish that task by discussing six specific methods that companies have used successfully to reduce their inventory. One common attribute of these successes is that they also build teamwork among the people. Every business operation today is concerned with methods to improve customer service. The real trick is to accomplish that task without increasing inventory. We are all concerned with improving our skills at keeping inventory low.

  11. VTrans Small Culvert Inventory - Culverts

    Data.gov (United States)

    Vermont Center for Geographic Information — Vermont Agency of Transportation Small Culvert Inventory: Culverts. This data contains small culverts locations along VTrans maintained roadways. The data was...

  12. Hanford inventory program user's manual

    International Nuclear Information System (INIS)

    Hinkelman, K.C.

    1994-01-01

    Provides users with instructions and information about accessing and operating the Hanford Inventory Program (HIP) system. The Hanford Inventory Program is an integrated control system that provides a single source for the management and control of equipment, parts, and material warehoused by Westinghouse Hanford Company in various site-wide locations. The inventory is comprised of spare parts and equipment, shop stock, special tools, essential materials, and convenience storage items. The HIP replaced the following systems; ACA, ASP, PICS, FSP, WSR, STP, and RBO. In addition, HIP manages the catalog maintenance function for the General Supplies inventory stocked in the 1164 building and managed by WIMS

  13. 75 FR 65525 - Anthem Blue Cross Blue Shield, Claim Management Services, Inc. Operations, a Division of...

    Science.gov (United States)

    2010-10-25

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,327] Anthem Blue Cross Blue Shield, Claim Management Services, Inc. Operations, a Division of Wellpoint, Inc., Green Bay, WI; Notice... former workers of Anthem Blue Cross Blue Shield, Claim Management Services, Inc. Operations, a Division...

  14. Applying inventory classification to a large inventory management system

    Directory of Open Access Journals (Sweden)

    Benjamin Isaac May

    2017-06-01

    Full Text Available Inventory classification aims to ensure that business-driving inventory items are efficiently managed in spite of constrained resources. There are numerous single- and multiple-criteria approaches to it. Our objective is to improve resource allocation to focus on items that can lead to high equipment availability. This concern is typical of many service industries such as military logistics, airlines, amusement parks and public works. Our study tests several inventory prioritization techniques and finds that a modified multi-criterion weighted non-linear optimization (WNO technique is a powerful approach for classifying inventory, outperforming traditional techniques of inventory prioritization such as ABC analysis in a variety of performance objectives.

  15. The Physics of the Blues

    Science.gov (United States)

    Gibson, J. Murray

    2009-03-01

    In looking at the commonalities between music and science, one sees that the musician's palette is based on the principles of physics. The pitch of a musical note is determined by the frequency of the sound wave. The scales that musicians use to create and play music can be viewed as a set of rules. What makes music interesting is how musicians develop those rules and create ambiguity with them. I will discuss the evolution of western musical scales in this context. As a particular example, ``Blue'' notes are very harmonic notes that are missing from the equal temperament scale. The techniques of piano blues and jazz represent the melding of African and Western music into something totally new and exciting. Live keyboard demonstrations will be used. Beyond any redeeming entertainment value the talk will emphasize the serious connections between science and art in music. Nevertheless tips will be accepted.

  16. Blue breath holding is benign.

    OpenAIRE

    Stephenson, J B

    1991-01-01

    In their recent publication in this journal, Southall et al described typical cyanotic breath holding spells, both in otherwise healthy children and in those with brainstem lesions and other malformations. Their suggestions regarding possible autonomic disturbances may require further study, but they have adduced no scientific evidence to contradict the accepted view that in the intact child blue breath holding spells are benign. Those families in which an infant suffers an 'apparently life t...

  17. 21 CFR 1304.11 - Inventory requirements.

    Science.gov (United States)

    2010-04-01

    ... the inventory of the registered location to which they are subject to control or to which the person... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Inventory requirements. 1304.11 Section 1304.11... REGISTRANTS Inventory Requirements § 1304.11 Inventory requirements. (a) General requirements. Each inventory...

  18. Optimization of inventory management in furniture manufacturing

    OpenAIRE

    Karkauskas, Justinas

    2017-01-01

    Aim of research - to present inventory management optimization guidelines for furniture manufacturing company, based on analysis of scientific literature and empirical research. Tasks of the Issue: • Disclose problems of inventory management in furniture manufacturing sector; • To analyze theoretical inventory management decisions; • To develop theoretical inventory management optimization model; • Do empirical research of inventory management and present offers for optimizatio...

  19. Controlling Inventory: Real-World Mathematical Modeling

    Science.gov (United States)

    Edwards, Thomas G.; Özgün-Koca, S. Asli; Chelst, Kenneth R.

    2013-01-01

    Amazon, Walmart, and other large-scale retailers owe their success partly to efficient inventory management. For such firms, holding too little inventory risks losing sales, whereas holding idle inventory wastes money. Therefore profits hinge on the inventory level chosen. In this activity, students investigate a simplified inventory-control…

  20. Denmark's national inventory report 2006

    DEFF Research Database (Denmark)

    Illerup, Jytte Boll; Lyck, Erik; Nielsen, Ole-Kenneth

    This report is Denmark's National Inventory Report reported to the Conference of the Parties under the United Nations Framework Convention on Climate Change (UNFCCC) due by April 2006. The report contains information on Denmark's inventories for all years' from 1990 to 2004 for CO....

  1. Demand differentiation in inventory systems

    NARCIS (Netherlands)

    Kleijn, M.J.

    1998-01-01

    This book deals with inventory systems where customer demand is categorised into different classes. Most inventory systems do not take into account individual customer preferences for a given product, and therefore handle all demand in a similar way. Nowadays, market segmentation has become a

  2. Student-Life Stress Inventory.

    Science.gov (United States)

    Gadzella, Bernadette M.; And Others

    The reliability of the Student-Life Stress Inventory of B. M. Gadzella (1991) was studied. The inventory consists of 51 items listed in 9 sections indicating different types of stressors (frustrations, conflicts, pressures, changes, and self-imposed stressors) and reactions to the stressors (physiological, emotional, behavioral, and cognitive) as…

  3. Automation of Space Inventory Management

    Science.gov (United States)

    Fink, Patrick W.; Ngo, Phong; Wagner, Raymond; Barton, Richard; Gifford, Kevin

    2009-01-01

    This viewgraph presentation describes the utilization of automated space-based inventory management through handheld RFID readers and BioNet Middleware. The contents include: 1) Space-Based INventory Management; 2) Real-Time RFID Location and Tracking; 3) Surface Acoustic Wave (SAW) RFID; and 4) BioNet Middleware.

  4. ANALYSIS MODEL FOR INVENTORY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    CAMELIA BURJA

    2010-01-01

    Full Text Available The inventory represents an essential component for the assets of the enterprise and the economic analysis gives them special importance because their accurate management determines the achievement of the activity object and the financial results. The efficient management of inventory requires ensuring an optimum level for them, which will guarantee the normal functioning of the activity with minimum inventory expenses and funds which are immobilised. The paper presents an analysis model for inventory management based on their rotation speed and the correlation with the sales volume illustrated in an adequate study. The highlighting of the influence factors on the efficient inventory management ensures the useful information needed to justify managerial decisions, which will lead to a balancedfinancial position and to increased company performance.

  5. Recent evidence on the muted inventory cycle

    OpenAIRE

    Andrew J. Filardo

    1995-01-01

    Inventories play an important role in business cycles. Inventory build-ups add momentum to the economy during expansions, while inventory liquidations sap economic strength during recessions. In addition, because inventory fluctuations are notoriously difficult to predict, they present considerable uncertainty in assessing the economic outlook.> The role of inventories in shaping the current outlook for the U.S. economy is particularly uncertain. In the early 1990s, inventory swings appeared ...

  6. INEEL Liquid Effluent Inventory

    Energy Technology Data Exchange (ETDEWEB)

    Major, C.A.

    1997-06-01

    The INEEL contractors and their associated facilities are required to identify all liquid effluent discharges that may impact the environment at the INEEL. This liquid effluent information is then placed in the Liquid Effluent Inventory (LEI) database, which is maintained by the INEEL prime contractor. The purpose of the LEI is to identify and maintain a current listing of all liquid effluent discharge points and to identify which discharges are subject to federal, state, or local permitting or reporting requirements and DOE order requirements. Initial characterization, which represents most of the INEEL liquid effluents, has been performed, and additional characterization may be required in the future to meet regulations. LEI information is made available to persons responsible for or concerned with INEEL compliance with liquid effluent permitting or reporting requirements, such as the National Pollutant Discharge Elimination System, Wastewater Land Application, Storm Water Pollution Prevention, Spill Prevention Control and Countermeasures, and Industrial Wastewater Pretreatment. The State of Idaho Environmental Oversight and Monitoring Program also needs the information for tracking liquid effluent discharges at the INEEL. The information provides a baseline from which future liquid discharges can be identified, characterized, and regulated, if appropriate. The review covered new and removed buildings/structures, buildings/structures which most likely had new, relocated, or removed LEI discharge points, and at least 10% of the remaining discharge points.

  7. Inventory of miscellaneous streams

    International Nuclear Information System (INIS)

    Lueck, K.J.

    1995-09-01

    On December 23, 1991, the US Department of Energy, Richland Operations Office (RL) and the Washington State Department of Ecology (Ecology) agreed to adhere to the provisions of the Department of Ecology Consent Order. The Consent Order lists the regulatory milestones for liquid effluent streams at the Hanford Site to comply with the permitting requirements of Washington Administrative Code. The RL provided the US Congress a Plan and Schedule to discontinue disposal of contaminated liquid effluent into the soil column on the Hanford Site. The plan and schedule document contained a strategy for the implementation of alternative treatment and disposal systems. This strategy included prioritizing the streams into two phases. The Phase 1 streams were considered to be higher priority than the Phase 2 streams. The actions recommended for the Phase 1 and 2 streams in the two reports were incorporated in the Hanford Federal Facility Agreement and Consent Order. Miscellaneous Streams are those liquid effluents streams identified within the Consent Order that are discharged to the ground but are not categorized as Phase 1 or Phase 2 Streams. This document consists of an inventory of the liquid effluent streams being discharged into the Hanford soil column

  8. Evaluation of Code Blue Implementation Outcomes

    Directory of Open Access Journals (Sweden)

    Bengü Özütürk

    2015-09-01

    Full Text Available Aim: In this study, we aimed to emphasize the importance of Code Blue implementation and to determine deficiencies in this regard. Methods: After obtaining the ethics committee approval, 225 patient’s code blue call data between 2012 and 2014 January were retrospectively analyzed. Age and gender of the patients, date and time of the call and the clinics giving Code Blue, the time needed for the Code Blue team to arrive, the rates of false Code Blue calls, reasons for Code Blue calls and patient outcomes were investigated. Results: A total of 225 patients (149 male, 76 female were evaluated in the study. The mean age of the patients was 54.1 years. 142 (67.2% Code Blue calls occurred after hours and by emergency unit. The mean time for the Code Blue team to arrive was 1.10 minutes. Spontaneous circulation was provided in 137 patients (60.8%; 88 (39.1% died. The most commonly identified possible causes were of cardiac origin. Conclusion: This study showed that Code Blue implementation with a professional team within an efficient and targeted time increase the survival rate. Therefore, we conclude that the application of Code Blue carried out by a trained team is an essential standard in hospitals. (The Medical Bulletin of Haseki 2015; 53:204-8

  9. Fusion program research materials inventory

    International Nuclear Information System (INIS)

    Roche, T.K.; Wiffen, F.W.; Davis, J.W.; Lechtenberg, T.A.

    1984-01-01

    Oak Ridge National Laboratory maintains a central inventory of research materials to provide a common supply of materials for the Fusion Reactor Materials Program. This will minimize unintended material variations and provide for economy in procurement and for centralized record keeping. Initially this inventory is to focus on materials related to first-wall and structural applications and related research, but various special purpose materials may be added in the future. The use of materials from this inventory for research that is coordinated with or otherwise related technically to the Fusion Reactor Materials Program of DOE is encouraged

  10. Liquid biofuels from blue biomass

    DEFF Research Database (Denmark)

    Kádár, Zsófia; Jensen, Annette Eva; Bangsø Nielsen, Henrik

    2011-01-01

    Marine (blue) biomasses, such as macroalgaes, represent a huge unexploited amount of biomass. With their various chemical compositions, macroalgaes can be a potential substrate for food, feed, biomaterials, pharmaceuticals, health care products and also for bioenergy. Algae use seawater as a growth...... medium, light as energy source and they capture CO2 for the synthesis of new organic material, thus can grow on non-agricultural land, without increasing food prices, or using fresh water. Due to all these advantages in addition to very high biomass yield with high carbohydrate content, macroalgaes can...

  11. Markkinointisuunnitelma Case: Ringetteseura Blue Rings

    OpenAIRE

    Seppälä, Minna

    2012-01-01

    Tämän opinnäytetyön tarkoituksena on markkinointisuunnitelman laatiminen ringetteseura Blue Ringsin edustusjoukkueelle. Lähtökohtana on pidetty suunnitelman toteutuskelpoisuutta käytännössä sekä suunnitelman reaalisuutta. Opinnäytetyö on toteutettu projektityönä, jossa on käytetty benchmarkkauksen lisäksi sekä kvalitatiivisia että empiirisiä tutkimusmenetelmiä. Opinnäytetyö koostuu kahdesta osiosta; teoreettinen viitekehys sekä empiirinen osio. Teoriana opinnäytetyössä on käytetty markkinoinn...

  12. Biogenic Emission Inventory System (BEIS)

    Science.gov (United States)

    Biogenic Emission Inventory System (BEIS) estimates volatile organic compound (VOC) emissions from vegetation and nitric oxide (NO) emission from soils. Recent BEIS development has been restricted to the SMOKE system

  13. Severe Weather Data Inventory (SWDI)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Severe Weather Data Inventory (SWDI) is an integrated database of severe weather records for the United States. SWDI enables a user to search through a variety...

  14. FEMA Flood Insurance Studies Inventory

    Data.gov (United States)

    Kansas Data Access and Support Center — This digital data set provides an inventory of Federal Emergency Management Agency (FEMA) Flood Insurance Studies (FIS) that have been conducted for communities and...

  15. Clinical Decision Support (CDS) Inventory

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Clinical Decision Support (CDS) Inventory contains descriptions of past and present CDS projects across the Federal Government. It includes Federal projects,...

  16. COMPUTER ASSISTED INVENTORY CONTROL SYSTEM ...

    African Journals Online (AJOL)

    issue in supply chain inventory manugement is to coordinate .... A supply chain is a network of organizations that are involved in the ... make decisions, which result in sub-optimization. ... same time reduce the ultimate cost of finished goods.

  17. Allegheny County Toxics Release Inventory

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — The Toxics Release Inventory (TRI) data provides information about toxic substances released into the environment or managed through recycling, energy recovery, and...

  18. Inventory differences: An evaluation methodology

    International Nuclear Information System (INIS)

    Heinberg, C.L.; Roberts, N.J.

    1987-01-01

    This paper discusses an evaluation methodology which is used for inventory differences at the Los Alamos National Laboratory. It is recognized that there are various methods which can be, and are being, used to evaluate process inventory differences at DOE facilities. The purpose of this paper is to share our thoughts on the subject and our techniques with those who are responsible for the evaluation of inventory differences at their facility. One of the most dangerous aspects of any evaluation technique, especially one as complex as most inventory difference evaluations tend to be, is to fail to look at the tools being used as indicators. There is a tendency to look at the results of an evaluation by one technique as an absolute. At the Los Alamos National Laboratory, several tools are used and the final evaluation is based on a combination of the observed results of a many-faceted evaluation. The tools used and some examples are presented

  19. National Greenhouse Gas Emission Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The National Greenhouse Gas Emission Inventory contains information on direct emissions of greenhouse gases as well as indirect or potential emissions of greenhouse...

  20. Title V Permitting Statistics Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Title V Permitting Statistics Inventory contains measured and estimated nationwide statistical data, consisting of counts of permitted sources, types of permits...

  1. Travel reliability inventory for Chicago.

    Science.gov (United States)

    2013-04-01

    The overarching goal of this research project is to enable state DOTs to document and monitor the reliability performance : of their highway networks. To this end, a computer tool, TRIC, was developed to produce travel reliability inventories from : ...

  2. Electronic properties of blue phosphorene/graphene and blue phosphorene/graphene-like gallium nitride heterostructures.

    Science.gov (United States)

    Sun, Minglei; Chou, Jyh-Pin; Yu, Jin; Tang, Wencheng

    2017-07-05

    Blue phosphorene (BlueP) is a graphene-like phosphorus nanosheet which was synthesized very recently for the first time [Nano Lett., 2016, 16, 4903-4908]. The combination of electronic properties of two different two-dimensional materials in an ultrathin van der Waals (vdW) vertical heterostructure has been proved to be an effective approach to the design of novel electronic and optoelectronic devices. Therefore, we used density functional theory to investigate the structural and electronic properties of two BlueP-based heterostructures - BlueP/graphene (BlueP/G) and BlueP/graphene-like gallium nitride (BlueP/g-GaN). Our results showed that the semiconducting nature of BlueP and the Dirac cone of G are well preserved in the BlueP/G vdW heterostructure. Moreover, by applying a perpendicular electric field, it is possible to tune the position of the Dirac cone of G with respect to the band edge of BlueP, resulting in the ability to control the Schottky barrier height. For the BlueP/g-GaN vdW heterostructure, BlueP forms an interface with g-GaN with a type-II band alignment, which is a promising feature for unipolar electronic device applications. Furthermore, we discovered that both G and g-GaN can be used as an active layer for BlueP to facilitate charge injection and enhance the device performance.

  3. An investigation of Inventory Differences

    International Nuclear Information System (INIS)

    Harvel, C.

    1993-01-01

    The derivation of applicable Limits of Error for Inventory Differences (LEIDs) has been a long-term challenge for some material storage tanks at the Savannah River Site. Several investigations have been unsuccessful in producing usable estimates of the LEIDs. An investigation conducted in November of 1991 revealed some significant inventory characteristics. The corrective action involved the implementation of a multi-case LEID based on historical information and a correction in the use of the tank calibration charts for two storage tanks

  4. Denmark's National Inventory Report 2009

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Lyck, Erik; Mikkelsen, Mette Hjorth

    This report is Denmark's National Inventory Report 2009. The report contains information on Denmark's emission inventories for all years' from 1990 to 2007 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2. The report documents the methodology as well as presents activity data and emissi...... factors for energy, industrial processes, sovent and other product use, agriculture, LULUCF (Land-Use, Land-Use Change and Forestry) and waste....

  5. Starbursts in Blue compact dwarf galaxies

    International Nuclear Information System (INIS)

    Thuan, T.X.

    1987-01-01

    We summarize all the arguments for a bursting mode of star formation in blue compact dwarf galaxies. We show in particular how spectral synthesis of far ultraviolet spectra of Blue compact dwarf galaxy constitutes a powerful way for studying the star formation history in these galaxies. Blue compact dwarf galaxy luminosity functions show jumps and discontinuities. These jumps act like fossil records of the star-forming bursts, helping us to count and date the bursts

  6. Geothermal Technologies Program Blue Ribbon Panel Recommendations

    Energy Technology Data Exchange (ETDEWEB)

    none,

    2011-06-17

    The Geothermal Technologies Program assembled a geothermal Blue Ribbon Panel on March 22-23, 2011 in Albuquerque, New Mexico for a guided discussion on the future of geothermal energy in the United States and the role of the DOE Program. The Geothermal Blue Ribbon Panel Report captures the discussions and recommendations of the experts. An addendum is available here: http://www.eere.energy.gov/geothermal/pdfs/gtp_blue_ribbon_panel_report_addendum10-2011.pdf

  7. Variable blue straggler stars in NGC 5466

    International Nuclear Information System (INIS)

    Harris, H.C.; Mateo, M.; Olszewski, E.W.; Nemec, J.M.

    1990-01-01

    Nine variable blue stragglers have been found in the globular cluster NGC 5466. The six dwarf Cepheids in this cluster coexist in the instability strip with other nonvariable stars. The three eclipsing binaries are among the hottest of the blue stragglers. The hypothesis is discussed that all blue stragglers in this cluster have undergone mass transfer in close binaries. Under this hypothesis, rotation and spin-down play important roles in controlling the evolution of blue stragglers in old clusters and in affecting some of their observational properties. 14 refs

  8. Why Blue-Collar Blacks Help Less

    OpenAIRE

    Smith, Sandra Susan; Young, Kara Alexis

    2013-01-01

    Why are blue-collar blacks less likely to help jobseekers than jobholders from other ethnoracial groups or even than more affluent blacks? Drawing from in-depth, semi-structured interviews with 97 black and Latino workers at one large, public sector employer, we find that blue-collar black workers both helped less proactively and rejected more requests for assistance than did blue-collar Latino and white-collar black workers. We attribute blue-collar blacks’ more passive engagement to their...

  9. The Fictional Black Blues Figure: Blues Music and the Art of Narrative Self-Invention

    OpenAIRE

    Mack, Kimberly

    2015-01-01

    The Fictional Black Blues Figure: Blues Music and the Art of Narrative Self-Invention, Kimberly MackMy dissertation examines representations of black American blues musicians in contemporary American fiction, drama, and popular music, and it argues that blues music can be examined as a narrative art rooted in the tradition of fictionalized autobiographical self-fashioning. I contend that the contemporary, multi-racial, literary and musical characters in my project who participate in so-called...

  10. 10 CFR 39.37 - Physical inventory.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Physical inventory. 39.37 Section 39.37 Energy NUCLEAR... inventory. Each licensee shall conduct a semi-annual physical inventory to account for all licensed material received and possessed under the license. The licensee shall retain records of the inventory for 3 years...

  11. 27 CFR 20.170 - Physical inventory.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Physical inventory. 20.170... Users of Specially Denatured Spirits Inventory and Records § 20.170 Physical inventory. Once in each... physical inventory of each formula of new and recovered specially denatured spirits. (Approved by the...

  12. Projecting Timber Inventory at the Product Level

    Science.gov (United States)

    Lawrence Teeter; Xiaoping Zhou

    1999-01-01

    Current timber inventory projections generally lack information on inventory by product classes. Most models available for inventory projection and linked to supply analyses are limited to projecting aggregate softwood and hardwood. The research presented describes a methodology for distributing the volume on each FIA (USDA Forest Service Forest Inventory and Analysis...

  13. Base-age invariance and inventory projections

    Science.gov (United States)

    C. J. Cieszewski; R. L. Bailey; B. E. Borders; G. H. Brister; B. D. Shiver

    2000-01-01

    One of the most important functions of forest inventory is to facilitate management decisions towards forest sustainability based on inventory projections into the future. Therefore, most forest inventories are used for predicting future states of the forests, in modern forestry the most common methods used in inventory projections are based on implicit functions...

  14. 27 CFR 40.201 - Inventories.

    Science.gov (United States)

    2010-04-01

    ... PROCESSED TOBACCO Operations by Manufacturers of Tobacco Products Inventories and Reports § 40.201 Inventories. Every manufacturer of tobacco products shall make true and accurate inventories on Form 5210.9... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Inventories. 40.201...

  15. Optimal ABC inventory classification using interval programming

    NARCIS (Netherlands)

    Rezaei, J.; Salimi, N.

    2015-01-01

    Inventory classification is one of the most important activities in inventory management, whereby inventories are classified into three or more classes. Several inventory classifications have been proposed in the literature, almost all of which have two main shortcomings in common. That is, the

  16. Reduction of blue tungsten oxide

    International Nuclear Information System (INIS)

    Wilken, T.; Wert, C.; Woodhouse, J.; Morcom, W.

    1975-01-01

    A significant portion of commercial tungsten is produced by hydrogen reduction of oxides. Although several modes of reduction are possible, hydrogen reduction is used where high purity tungsten is required and where the addition of other elements or compounds is desired for modification of the metal, as is done for filaments in the lamp industry. Although several investigations of the reduction of oxides have been reported (1 to 5), few principles have been developed which can aid in assessment of current commercial practice. The reduction process was examined under conditions approximating commercial practice. The specific objectives were to determine the effects of dopants, of water vapor in the reducing atmosphere, and of reduction temperature upon: (1) the rate of the reaction by which blue tungsten oxide is reduced to tungsten metal, (2) the intermediate oxides associated with reduction, and (3) the morphology of the resulting tungsten powder

  17. Annual Danish emissions inventory report to UNECE. Inventory 1990 - 2002

    Energy Technology Data Exchange (ETDEWEB)

    Illerup, J.B.; Nielsen, M.; Winther, M.; Hjort Mikkelsen, M.; Lyck, E.; Hoffmann, L.; Fauser, P.

    2004-05-01

    This report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2004. The report contains information on Denmark's emission inventories regarding emissions of (1) SOx for the years 1980-2002, (2) NOx, CO, NMVOC and NH{sub 3} for the years 1985-2002; (3) Particulate matter: TSP, PM10, PM2.5 for the years 2000-2002, (4) Heavy Metals: Pb, Cd, Hg, As, Cr, Cu, Ni, Se and Zn for the years 1990-2002, and (5) Polyaromatic hydrocarbons (PAH): Benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene and indeno(1,2,3-cd)pyrene for the years 1990-2002. Furthermore, the report contains information on background data for emissions inventory. (au)

  18. Annual Danish emissions inventory report to UNECE. Inventory 1990 - 2002

    Energy Technology Data Exchange (ETDEWEB)

    Illerup, J B; Nielsen, M; Winther, M; Hjort Mikkelsen, M; Lyck, E; Hoffmann, L; Fauser, P

    2004-05-01

    This report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2004. The report contains information on Denmark's emission inventories regarding emissions of (1) SOx for the years 1980-2002, (2) NOx, CO, NMVOC and NH{sub 3} for the years 1985-2002; (3) Particulate matter: TSP, PM10, PM2.5 for the years 2000-2002, (4) Heavy Metals: Pb, Cd, Hg, As, Cr, Cu, Ni, Se and Zn for the years 1990-2002, and (5) Polyaromatic hydrocarbons (PAH): Benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene and indeno(1,2,3-cd)pyrene for the years 1990-2002. Furthermore, the report contains information on background data for emissions inventory. (au)

  19. Quirks of dye nomenclature. 1. Evans blue.

    Science.gov (United States)

    Cooksey, C J

    2014-02-01

    The history, origin, identity, chemistry and use of Evans blue dye are described along with the first application to staining by Herbert McLean Evans in 1914. In the 1930s, the dye was marketed under the name, Evans blue dye, which was profoundly more acceptable than the ponderous chemical name.

  20. Blue jay attacks and consumes cedar waxwing

    Science.gov (United States)

    Daniel Saenz; Joshua B. Pierce

    2009-01-01

    Blue Jays (Cyanocitta cristata) are known to be common predators on bird nests (Wilcove 1985, Picman and Schriml 1994). In addition to predation on eggs and nestlings, Blue Jays occasionally prey on fledgling and adult birds (Johnson and Johnson 1976, Dubowy 1985). A majority of reports involve predation on House Sparrows (Passer domesticus) and other small birds (...

  1. The secret of the blue fog

    Science.gov (United States)

    Henrich, Oliver; Marenduzzo, Davide

    2017-04-01

    Why certain liquids turn blue when cooled was a mystery that stumped scientists for more than a century. As Oliver Henrich and Davide Marenduzzo explain, solving the secret of the “blue fog” proved to be an intellectual tour de force - and one that could lead to new types of display devices

  2. Balancing flexibility and inventory in repair inventory systems

    NARCIS (Netherlands)

    Haas, de H.F.M.; Martin, H.H.

    1995-01-01

    In repair inventory systems, failed units are exchanged for serviceable units upon failure. The probability that serviceable units are available to support the exchange process can be used as a measure for the performance of the system. This measure is commonly called the expected fill rate. The

  3. Tapered photonic crystal fibers for blue-enhanced supercontinuum generation

    DEFF Research Database (Denmark)

    Møller, Uffe; Sørensen, Simon Toft; Larsen, Casper

    2012-01-01

    Tapering of photonic crystal fibers is an effective way of shifting the blue edge of a supercontinuum spectrum down in the deep-blue. We discuss the optimum taper profile for enhancing the power in the blue edge....

  4. Can greening of aquaculture sequester blue carbon?

    Science.gov (United States)

    Ahmed, Nesar; Bunting, Stuart W; Glaser, Marion; Flaherty, Mark S; Diana, James S

    2017-05-01

    Globally, blue carbon (i.e., carbon in coastal and marine ecosystems) emissions have been seriously augmented due to the devastating effects of anthropogenic pressures on coastal ecosystems including mangrove swamps, salt marshes, and seagrass meadows. The greening of aquaculture, however, including an ecosystem approach to Integrated Aquaculture-Agriculture (IAA) and Integrated Multi-Trophic Aquaculture (IMTA) could play a significant role in reversing this trend, enhancing coastal ecosystems, and sequestering blue carbon. Ponds within IAA farming systems sequester more carbon per unit area than conventional fish ponds, natural lakes, and inland seas. The translocation of shrimp culture from mangrove swamps to offshore IMTA could reduce mangrove loss, reverse blue carbon emissions, and in turn increase storage of blue carbon through restoration of mangroves. Moreover, offshore IMTA may create a barrier to trawl fishing which in turn could help restore seagrasses and further enhance blue carbon sequestration. Seaweed and shellfish culture within IMTA could also help to sequester more blue carbon. The greening of aquaculture could face several challenges that need to be addressed in order to realize substantial benefits from enhanced blue carbon sequestration and eventually contribute to global climate change mitigation.

  5. Infiltrating giant cellular blue naevus.

    Science.gov (United States)

    Bittencourt, A L; Monteiro, D A; De Pretto, O J

    2007-01-01

    Cellular blue naevi (CBN) measure 1-2 cm in diameter and affect the dermis, occasionally extending into the subcutaneous fat. The case of a 14-year-old boy with a giant CBN (GCBN) involving the right half of the face, the jugal mucosa and the lower eyelid with a tumour that had infiltrated the bone and the maxillary and ethmoidal sinuses is reported. Biopsies were taken from the skin, jugal mucosa and maxillary sinus. The following markers were used in the immunohistochemical evaluation: CD34, CD56, HMB-45, anti-S100, A-103, Melan A and MIB-1. The biopsy specimens showed a biphasic pattern affecting the lower dermis, subcutaneous fat, skeletal muscle, bone, jugal mucosa and maxillary sinus, but there was no histological evidence of malignancy. The tumour cells were CD34-, CD56-, HMB45+, anti-S100+ and A-103+. Melan A was focally expressed. No positive MIB-1 cells were identified. The present case shows that GCBN may infiltrate deeply, with no evidence of malignancy.

  6. Corneal edema and permanent blue discoloration of a silicone intraocular lens by methylene blue.

    Science.gov (United States)

    Stevens, Scott; Werner, Liliana; Mamalis, Nick

    2007-01-01

    To report a silicone intraocular lens (IOL) stained blue by inadvertent intraoperative use of methylene blue instead of trypan blue and the results of experimental staining of various lens materials with different concentrations of the same dye. A "blue dye" was used to enhance visualization during capsulorhexis in a patient undergoing phacoemulsification with implantation of a three-piece silicone lens. Postoperatively, the patient presented with corneal edema and a discolored IOL. Various IOL materials were experimentally stained using methylene blue. Sixteen lenses (4 silicone, 4 hydrophobic acrylic, 4 hydrophilic acrylic, and 4 polymethylmethacrylate) were immersed in 0.5 mL of methylene blue at concentrations of 1%, 0.1%, 0.01%, and 0.001%. These lenses were grossly and microscopically evaluated for discoloration 6 and 24 hours after immersion. The corneal edema resolved within 1 month after the initial surgical procedure. After explantation, gross and microscopic analyses of the explanted silicone lens revealed that its surface and internal substance had been permanently stained blue. In the experimental study, all of the lenses except the polymethylmethacrylate lenses were permanently stained by methylene blue. The hydrophilic acrylic lenses showed the most intense blue staining in all dye concentrations. This is the first clinicopathological report of IOL discoloration due to intraocular use of methylene blue. This and other tissue dyes may be commonly found among surgical supplies in the operating room and due diligence is necessary to avoid mistaking these dyes for those commonly used during ocular surgery.

  7. Sourcing Life Cycle Inventory Data

    Science.gov (United States)

    The collection and validation of quality lifecycle inventory (LCI) data can be the most difficult and time-consuming aspect of developing a life cycle assessment (LCA). Large amounts of process and production data are needed to complete the LCI. For many studies, the LCA analyst ...

  8. Distribution method optimization : inventory flexibility

    NARCIS (Netherlands)

    Asipko, D.

    2010-01-01

    This report presents the outcome of the Logistics Design Project carried out for Nike Inc. This project has two goals: create a model to measure a flexibility aspect of the inventory usage in different Nike distribution channels, and analyze opportunities of changing the decision model of splitting

  9. Wisconsin's fourth forest inventory, 1983.

    Science.gov (United States)

    John S. Jr. Spencer; W. Brad Smith; Jerold T. Hahn; Gerhard K. Raile

    1988-01-01

    The fourth inventory of the timber resource of Wisconsin shows that growing-stock volume increased from 11.2 to 15.5 billion cubic feet between 1968 and 1983, and area of timberland increased from 14.5 to 14.8 million acres. Presented are analysis and statistics on forest area and timber volume, growth, mortality, removals, and projections.

  10. Stable isotope research pool inventory

    International Nuclear Information System (INIS)

    1980-12-01

    This report contains a listing of electromagnetically separated stable isotopes which are available for distribution within the United States for non-destructive research use from the Oak Ridge National Laboratory on a loan basis. This inventory includes all samples of stable isotopes in the Materials Research Collection and does not designate whether a sample is out on loan or in reprocessing

  11. Automated Interactive Storeroom Inventory System.

    Science.gov (United States)

    Sapp, Albert L.; Hess, Larry G.

    1989-01-01

    The inventory system designed for six storerooms in three buildings at the University of Illinois at Urbana-Champaign's School of Chemical Sciences replaced an issue-slip and transactions record system with barcode technology. Data collection error reductions have been significant, making it easier to determine stock levels and plan purchases.…

  12. Substantial Research Secures the Blue Future for our Blue Plant

    Directory of Open Access Journals (Sweden)

    Moustafa Abdel Maksoud

    2016-06-01

    Full Text Available Earth, the blue planet, is our home, and seas and oceans cover more than 70% of its surface. As the earth’s population rapidly increases and available resources decrease, seas and oceans can play a key role in assuring the long-term survival of humankind. Renewable maritime energy has huge potential to provide a considerable part of the earth’s population with decarbonised electricity generation systems. Renewable maritime energy is very flexible and can be harvested above the water’s free surface by using offshore wind turbines, on the water’s surface by using wave energy converters or below the water’s surface by using current or tidal turbines. The supposed conflict between environmental protection measures and economic interests is neither viable nor reasonable. Renewable maritime energy can be the motor for considerable substantial economic growth for many maritime regions and therefore for society at large. The fastest growing sector of renewable maritime energy is offshore wind. The annual report of the European Wind Energy Association from the year 2015 confirms the growing relevance of the offshore wind industry. In 2015, the total installed and grid-connected capacity of wind power was 12,800 MW in the EU and 6,013.4 MW in Germany. 38% of the 2015 annual installation in Germany was offshore, accounting for a capacity of 2,282.4 MW. However, there are a limited number of available installation sites in shallow water, meaning that there is an urgent need to develop new offshore structures for water depths greater than 50m. The persistent trend towards deeper waters has encouraged the offshore wind industry to look for floating wind turbine structures and larger turbines. Floating wind turbine technologies are at an early stage of development and many technical and economic challenges will still need to be faced. Nonetheless, intensive research activities and the employment of advanced technologies are the key factors in

  13. Inventory on cleaner production education and training

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Pöyry, Sirkka; Huisingh, Donald

    Analysis and presentation of the data from an international inventory on cleaner production education and training......Analysis and presentation of the data from an international inventory on cleaner production education and training...

  14. Ottawa National Wildlife Refuge : Wildlife Inventory Plan

    Data.gov (United States)

    Department of the Interior — This Wildlife Inventory Plan for Ottawa NWR describes the inventory program’s relation to Refuge objectives and outlines the program’s policies and administration....

  15. CoC Housing Inventory Count Reports

    Data.gov (United States)

    Department of Housing and Urban Development — Continuum of Care (CoC) Homeless Assistance Programs Housing Inventory Count Reports are a snapshot of a CoC’s housing inventory, available at the national and state...

  16. High-luminosity blue and blue-green gallium nitride light-emitting diodes.

    Science.gov (United States)

    Morkoç, H; Mohammad, S N

    1995-01-06

    Compact and efficient sources of blue light for full color display applications and lighting eluded and tantalized researchers for many years. Semiconductor light sources are attractive owing to their reliability and amenability to mass manufacture. However, large band gaps are required to achieve blue color. A class of compound semiconductors formed by metal nitrides, GaN and its allied compounds AIGaN and InGaN, exhibits properties well suited for not only blue and blue-green emitters, but also for ultraviolet emitters and detectors. What thwarted engineers and scientists from fabricating useful devices from these materials in the past was the poor quality of material and lack of p-type doping. Both of these obstacles have recently been overcome to the point where highluminosity blue and blue-green light-emitting diodes are now available in the marketplace.

  17. The Biology of blue-green algae

    National Research Council Canada - National Science Library

    Carr, Nicholas G; Whitton, B. A

    1973-01-01

    .... Their important environmental roles, their part in nitrogen fixation and the biochemistry of phototrophic metabolism are some of the attractions of blue-geen algae to an increasing number of biologists...

  18. BLUES function method in computational physics

    Science.gov (United States)

    Indekeu, Joseph O.; Müller-Nedebock, Kristian K.

    2018-04-01

    We introduce a computational method in physics that goes ‘beyond linear use of equation superposition’ (BLUES). A BLUES function is defined as a solution of a nonlinear differential equation (DE) with a delta source that is at the same time a Green’s function for a related linear DE. For an arbitrary source, the BLUES function can be used to construct an exact solution to the nonlinear DE with a different, but related source. Alternatively, the BLUES function can be used to construct an approximate piecewise analytical solution to the nonlinear DE with an arbitrary source. For this alternative use the related linear DE need not be known. The method is illustrated in a few examples using analytical calculations and numerical computations. Areas for further applications are suggested.

  19. Nanotubes based on monolayer blue phosphorus

    KAUST Repository

    Montes Muñ oz, Enrique; Schwingenschlö gl, Udo

    2016-01-01

    We demonstrate structural stability of monolayer zigzag and armchair blue phosphorus nanotubes by means of molecular dynamics simulations. The vibrational spectrum and electronic band structure are determined and analyzed as functions of the tube

  20. Inventory Investment and the Real Interest Rate

    OpenAIRE

    Junayed, Sadaquat; Khan, Hashmat

    2009-01-01

    The relationship between inventory investment and the real interest rate has been difficult to assess empirically. Recent work has proposed a linear-quadratic inventory model with time-varying discount factor to identify the effects of the real interest rate on inventory investment. The authors show that this framework does not separately identify the effects of real interest rate on inventory investment from variables that determine the expected marginal cost of production. In other words, t...

  1. The geographic concentration of blue carbon in the continental US

    Science.gov (United States)

    Feagin, R. A.; Hinson, A.

    2014-12-01

    Salt water wetlands have the potential to be bought and sold as relatively rich reservoirs of carbon in the context of sequestration projects. However, little is known about the geographic distribution of this potential, and no coarse scale investigation has addressed this ecosystem service at the continental scale. Our objective was to determine blue carbon stocks and flux in coastal wetland soils in the United States and categorize the potential for projects by estuarine basin, state, and wetland type. We linked National Wetlands Inventory (NWI) data with the Soil Survey Geographic Database (SSURGO) through spatial analysis within a Geographic Information System (GIS). We then calculated and mapped soil organic carbon across the continental US. Results were filtered by state, estuarine basin, wetland type, and accumulation rate, and ranking lists for each categorization were produced. The results showed that belowground carbon accumulation is concentrated in specific regions, with the richest and largest reservoirs in the Gulf and Atlantic southeastern estuaries, for example mangrove zones in Florida. Salt marshes on the southern Pacific Coast were relatively low in carbon due to small areas of coverage and the presence of sandy and inorganic soil. The geomorphic position of a wetland within a given estuary, for example on an exposed barrier island versus recessed towards inflowing headwaters, accounted for a greater degree of soil carbon variation than the wetland type, for example woody mangroves versus herbaceous marshes. The potential of a blue carbon sequestration project in relation to its location could be influential in determining wetland policy, conservation, and restoration in the coming decades.

  2. Blue space geographies: Enabling health in place.

    Science.gov (United States)

    Foley, Ronan; Kistemann, Thomas

    2015-09-01

    Drawing from research on therapeutic landscapes and relationships between environment, health and wellbeing, we propose the idea of 'healthy blue space' as an important new development Complementing research on healthy green space, blue space is defined as; 'health-enabling places and spaces, where water is at the centre of a range of environments with identifiable potential for the promotion of human wellbeing'. Using theoretical ideas from emotional and relational geographies and critical understandings of salutogenesis, the value of blue space to health and wellbeing is recognised and evaluated. Six individual papers from five different countries consider how health can be enabled in mixed blue space settings. Four sub-themes; embodiment, inter-subjectivity, activity and meaning, document multiple experiences within a range of healthy blue spaces. Finally, we suggest a considerable research agenda - theoretical, methodological and applied - for future work within different forms of blue space. All are suggested as having public health policy relevance in social and public space. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. 42 CFR 35.41 - Inventory.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Inventory. 35.41 Section 35.41 Public Health PUBLIC... STATION MANAGEMENT Disposal of Money and Effects of Deceased Patients § 35.41 Inventory. Promptly after the death of a patient in a station or hospital of the Service, an inventory of his money and effects...

  4. 7 CFR 984.21 - Handler inventory.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Handler inventory. 984.21 Section 984.21 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Regulating Handling Definitions § 984.21 Handler inventory. Handler inventory as of any date means all...

  5. 26 CFR 1.1374-7 - Inventory.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Inventory. 1.1374-7 Section 1.1374-7 Internal... TAXES Small Business Corporations and Their Shareholders § 1.1374-7 Inventory. (a) Valuation. The fair market value of the inventory of an S corporation on the first day of the recognition period equals the...

  6. 10 CFR 34.29 - Quarterly inventory.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Quarterly inventory. 34.29 Section 34.29 Energy NUCLEAR... RADIOGRAPHIC OPERATIONS Equipment § 34.29 Quarterly inventory. (a) Each licensee shall conduct a quarterly physical inventory to account for all sealed sources and for devices containing depleted uranium received...

  7. 77 FR 5280 - Service Contracts Inventory

    Science.gov (United States)

    2012-02-02

    ... NUCLEAR REGULATORY COMMISSION [NRC-2012-0023] Service Contracts Inventory AGENCY: Nuclear...) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2011. The inventory includes service contract actions over $25,000 that were awarded in FY 2011. ADDRESSES...

  8. 75 FR 82095 - Service Contracts Inventory

    Science.gov (United States)

    2010-12-29

    ... NUCLEAR REGULATORY COMMISSION [NRC-2010-0394] Service Contracts Inventory AGENCY: U.S. Nuclear...) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2010. The inventory includes service contract actions over $25,000 that were awarded in FY 2010. ADDRESSES...

  9. 78 FR 10642 - Service Contracts Inventory

    Science.gov (United States)

    2013-02-14

    ... NUCLEAR REGULATORY COMMISSION [NRC-2013-0029] Service Contracts Inventory AGENCY: Nuclear...) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2012. The inventory includes service contract actions over $25,000 that were awarded in FY 2012. ADDRESSES...

  10. 27 CFR 24.266 - Inventory losses.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Inventory losses. 24.266... OF THE TREASURY LIQUORS WINE Losses of Wine § 24.266 Inventory losses. (a) General. The proprietor... reported as required by § 24.313. (b) Bulk wine losses. The physical inventory of bulk wine will determine...

  11. 27 CFR 40.523 - Inventories.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Inventories. 40.523... PROCESSED TOBACCO Manufacture of Processed Tobacco Operations by Manufacturers of Processed Tobacco § 40.523 Inventories. Every manufacturer of processed tobacco must provide a true and accurate inventory on TTB F 5210...

  12. 30 CFR 220.032 - Inventories.

    Science.gov (United States)

    2010-07-01

    ... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... physical inventory that has not been credited to NPSL operations under § 220.015(a)(2) shall be credited to... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral...

  13. EXPERIMENTAL RESEARCHES OF ELECTRO-THERMAL RESISTIBILITY OF SEND-OFFS AND CABLES TO ACTION RATIONED ON THE INTERNATIONAL STANDARD OF IEC 62305-1-2010 OF APERIODIC IMPULSE OF CURRENT OF ARTIFICIAL LIGHTNING

    Directory of Open Access Journals (Sweden)

    M.I. Baranov

    2016-03-01

    Full Text Available Purpose. Experimental researches of electro-thermal resistibility of cable-explorer products, applied in the power electric circuits of objects of electric-power industry, to action on its copper and aluminum parts bearings a current rationed on the International Standard of IEC 62305-1-2010 aperiodic impulse 10/350 μs of current of artificial lightning. Methodology. Electrophysics bases of technique of high tensions and high pulsed currents (HPC, and also scientific and technical bases of planning of devices of high-voltage impulsive technique and measuring HPC in them. Results. Experimental a way the quantitative levels of maximal values maximum of possible and critical closenesses of aperiodic impulse 10/350 μs of current of artificial lightning with rationed on the international standard of IEC 62305-1-2010 peak-temporal parameters and admittances on them in copper (aluminum parts bearings a current of send-offs and cables with a polyethylene (PET and polyvinylchloride (PVCH isolation. Originality. First in world practice on the unique powerful high-voltage generator of HPC of artificial lightning experimental researches of resistibility to lightning of pre-production models of send-offs (cables are conducted with copper (aluminum tendons, PET and PVCH by an isolation, in-use in power electric circuits of electric-power industry objects. Practical value. The use in practice of protecting from lightning of the got results will allow substantially to promote functional and fire-prevention safety of engineering communications of objects of industrial electroenergy in the conditions of action on them of short shots of linear lightning.

  14. TFTR tritium inventory accountability system

    International Nuclear Information System (INIS)

    Saville, C.; Ascione, G.; Elwood, S.; Nagy, A.; Raftopoulos, S.; Rossmassler, R.; Stencel, J.; Voorhees, D.; Tilson, C.

    1995-01-01

    This paper discusses the program, PPPL (Princeton Plasma Physics Laboratory) Material Control and Accountability Plan, that has been implemented to track US Department of Energy's tritium and all other accountable source material. Specifically, this paper details the methods used to measure tritium in various systems at the Tokamak Fusion Test Reactor; resolve inventory differences; perform inventory by difference inside the Tokamak; process and measure plasma exhaust and other effluent gas streams; process, measure and ship scrap or waste tritium on molecular sieve beds; and detail organizational structure of the Material Control and Accountability group. In addition, this paper describes a Unix-based computerized software system developed at PPPL to account for all tritium movements throughout the facility. 5 refs., 2 figs

  15. Stable isotope research pool inventory

    International Nuclear Information System (INIS)

    1984-03-01

    This report contains a listing of electromagnetically separated stable isotopes which are available at the Oak Ridge National Laboratory for distribution for nondestructive research use on a loan basis. This inventory includes all samples of stable isotopes in the Research Materials Collection and does not designate whether a sample is out on loan or is in reprocessing. For some of the high abundance naturally occurring isotopes, larger amounts can be made available; for example, Ca-40 and Fe-56

  16. Waste management and chemical inventories

    Energy Technology Data Exchange (ETDEWEB)

    Gleckler, B.P.

    1995-06-01

    This section of the 1994 Hanford Site Environmental Report summarizes the classification and handling of waste at the Hanford Site. Waste produced at the Hanford Site is classified as either radioactive, nonradioactive, or mixed waste. Radioactive wastes are further categorized as transuranic, high-level, and low-level. Mixed waste may contain both radioactive and hazardous nonradioactive substances. This section describes waste management practices and chemical inventories at the site.

  17. Radioactive wastes - inventories and classification

    International Nuclear Information System (INIS)

    Brennecke, P.; Hollmann, A.

    1992-01-01

    A survey is given of the origins, types, conditioning, inventories, and expected abundance of radioactive wastes in the future in the Federal Republic of Germany. The Federal Government's radioactive waste disposal scheme provides that radioactive wastes be buried in deep geological formations which are expected to ensure a maintenance-free, unlimited and safe disposal without intentional excavation of the wastes at a later date. (orig./BBR) [de

  18. Waste management and chemical inventories

    International Nuclear Information System (INIS)

    Gleckler, B.P.

    1995-01-01

    This section of the 1994 Hanford Site Environmental Report summarizes the classification and handling of waste at the Hanford Site. Waste produced at the Hanford Site is classified as either radioactive, nonradioactive, or mixed waste. Radioactive wastes are further categorized as transuranic, high-level, and low-level. Mixed waste may contain both radioactive and hazardous nonradioactive substances. This section describes waste management practices and chemical inventories at the site

  19. Radioactive waste inventories and projections

    International Nuclear Information System (INIS)

    McLaren, L.H.

    1982-11-01

    This bibliography contains information on radioactive waste inventories and projections included in the Department of Energy's Energy Data Base from January 1981 through September 1982. The arrangement is by report number for reports, followed by nonreports in reverse chronological order. These citations are to research reports, journal articles, books, patents, theses, and conference papers from worldwide sources. Five indexes, each preceded by a brief description, are provided: Corporate Author, Personal Author, Subject, Contract Number, and Report Number. (25 abstracts)

  20. Stable isotope research pool inventory

    International Nuclear Information System (INIS)

    1982-01-01

    This report contains a listing of electromagnetically separated stable isotopes which are available for distribution within the United States for nondestructive research use from the Oak Ridge National Laboratory on a loan basis. This inventory includes all samples of stable isotopes in the Material Research Collection and does not designate whether a sample is out on loan or in reprocessing. For some of the high abundance naturally occurring isotopes, larger amounts can be made available; for example, Ca-40 and Fe-56

  1. National inventory of radioactive wastes

    International Nuclear Information System (INIS)

    1997-01-01

    There are in France 1064 sites corresponding to radioactive waste holders that appear in this radioactive waste inventory. We find the eighteen sites of E.D.F. nuclear power plants, The Cogema mine sites, the Cogema reprocessing plants, The Cea storages, the different factories and enterprises of nuclear industry, the sites of non nuclear industry, the Andra centers, decommissioned installations, disposals with low level radioactive wastes, sealed sources distributors, national defence. (N.C.)

  2. 78 FR 17205 - Notice of Availability of Service Contract Inventories

    Science.gov (United States)

    2013-03-20

    ... FEDERAL MARITIME COMMISSION Notice of Availability of Service Contract Inventories AGENCY: Federal Maritime Commission. ACTION: Notice of availability of service contract inventories. FOR FURTHER... Service Contract Inventory Analysis, the FY 2012 Service Contract Inventory, and the FY 2012 Service...

  3. Danish emission inventory for particular matter (PM)

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, M; Winther, M; Illerup, J B; Hjort Mikkelsen, M

    2003-11-01

    The first Danish emission inventory that was reported in 2002 was a provisional-estimate based on data presently available. This report documents methodology, emission factors and references used for an improved Danish emission inventory for particulate matter. Further results of the improved emission inventory for the year 2000 are shown. The particulate matter emission inventory includes TSP, PM,, and PM, The report covers emission inventories for transport and stationary combustion. An appendix covering emissions from agriculture is also included. For the transport sector, both exhaust and non-exhaust emission such as tyre and break wear and road abrasion are included. (au)

  4. "Blue-Collar Blues" uurib töösuhteid uutes oludes / Janar Ala

    Index Scriptorium Estoniae

    Ala, Janar, 1979-

    2009-01-01

    Tööproblemaatikat käsitlev näitus "Blue-Collar Blues" Tallinna Kunstihoones ja Tallinna Kunstihoone galeriis 31. jaanuarini 2010, kuraator Anders Härm. Lähemalt belgia-mehhiko kunstniku Francis Alys'e videost, austria kunstniku Oliver Ressleri ning venetsueela-saksa politoloogi Dario Azzelini videost "Viis tehast. Tööliste kontroll Venezuelas"

  5. 2009 National inventory of radioactive material and wastes. Geographical inventory

    International Nuclear Information System (INIS)

    2009-01-01

    A geographical inventory of the radioactive wastes present on the French territory (as recorded until the 31 of december, 2007) is presented, region by region. The various types of waste sites (production, processing, conditioning and storage sites, Uranium mines, ANDRA storage centers, historical storage sites and polluted sites where wastes are stored) are listed and located on maps. Details are given on the nature and origin of these wastes (nuclear industry, medical domain, scientific research, conventional industry, Defense...). A total of 1121 sites have been recorded, among which 163 are presented with details and charts

  6. The Structure of the Blue Whirl

    Science.gov (United States)

    Hariharan, Sriram Bharath; Hu, Yu; Xiao, Huahua; Gollner, Michael; Oran, Elaine

    2017-11-01

    Recent experiments have led to the discovery of the blue whirl, a small, stable regime of the fire whirl that burns typically sooty liquid hydrocarbons without producing soot. The physical structure consists of three regions - the blue cone, the vortex rim and the purple haze. The physical nature of the flame was further investigated through digital imaging techniques, which suggest that the transition (from the fire whirl to the blue whirl) and shape of the flame may be influenced by vortex breakdown. The flame was found to develop over a variety of surfaces, which indicates that the formation of the blue whirl is strongly influenced by the flow structure over the incoming boundary layer. The thermal structure was investigated using micro-thermocouples, thin-filament pyrometry and OH* spectroscopy. These revealed a peak temperature around 2000 K, and that most of the combustion occurs in the relatively small, visibly bright vortex rim. The results of these investigations provide a platform to develop a theory on the structure of the blue whirl, a deeper understanding of which may affirm potential for applications in the energy industry. This work was supported by an NSF EAGER award and Minta Martin Endowment Funds in the Department of Aerospace Engineering at the University of Maryland.

  7. Dyes adsorption blue vegetable and blue watercolor by natural zeolites modified with surfactants

    International Nuclear Information System (INIS)

    Jardon S, C. C.; Olguin G, M. T.; Diaz N, M. C.

    2009-01-01

    In this work was carried out the dyes removal blue vegetable and blue watercolor of aqueous solutions, to 20 C, at different times and using a zeolite mineral of Parral (Chihuahua, Mexico) modified with hexadecyl trimethyl ammonium bromide or dodecyl trimethyl ammonium bromide. The zeolite was characterized before and after of its adaptation with NaCl and later with HDTMABr and DTMABr. For the materials characterization were used the scanning electron microscopy of high vacuum; elementary microanalysis by X-ray spectroscopy of dispersed energy and X-ray diffraction techniques. It was found that the surfactant type absorbed in the zeolite material influences on the adsorption process of the blue dye. Likewise, the chemical structure between the vegetable blue dye and the blue watercolor, determines the efficiency of the color removal of the water, by the zeolites modified with the surfactants. (Author)

  8. Origin of colour stability in blue/orange/blue stacked phosphorescent white organic light-emitting diodes

    International Nuclear Information System (INIS)

    Kim, Sung Hyun; Jang, Jyongsik; Yook, Kyoung Soo; Lee, Jun Yeob

    2009-01-01

    The origin of colour stability in phosphorescent white organic light-emitting diodes (PHWOLEDs) with a blue/orange/blue stacked emitting structure was studied by monitoring the change in a recombination zone. A balanced recombination zone shift between the blue and the orange light-emitting layers was found to be responsible for the colour stability in the blue/orange/blue stacked PHWOLEDs.

  9. Joint inventory control and pricing in a service-inventory system

    DEFF Research Database (Denmark)

    Marand, Ata Jalili; Li, Hongyan Jenny; Thorstenson, Anders

    2017-01-01

    This study addresses joint inventory control and pricing decisions for a service-inventory system. In such a system both an on-hand inventory item and a positive service time are required to fulfill customer demands. The service-inventory system also captures main features of the classical...... inventory systems with a positive processing time, e.g., make-to-order systems. In this study, the service-inventory system is modeled as an M/M/1 queue in which the customer arrival rate is price dependent. The inventory of an individual item is continuously reviewed under an (r,Q) policy....... The replenishment lead times of the inventory are exponentially distributed. Furthermore, customers arriving during stock-out periods are lost. The stochastic customer inter-arrival times, service times, and inventory replenishment lead times cause the high complexity of the problem and the difficulty in solving it...

  10. Considering inventory distributions in a stochastic periodic inventory routing system

    Science.gov (United States)

    Yadollahi, Ehsan; Aghezzaf, El-Houssaine

    2017-07-01

    Dealing with the stochasticity of parameters is one of the critical issues in business and industry nowadays. Supply chain planners have difficulties in forecasting stochastic parameters of a distribution system. Demand rates of customers during their lead time are one of these parameters. In addition, holding a huge level of inventory at the retailers is costly and inefficient. To cover the uncertainty of forecasting demand rates, researchers have proposed the usage of safety stock to avoid stock-out. However, finding the precise level of safety stock depends on forecasting the statistical distribution of demand rates and their variations in different settings among the planning horizon. In this paper the demand rate distributions and its parameters are taken into account for each time period in a stochastic periodic IRP. An analysis of the achieved statistical distribution of the inventory and safety stock level is provided to measure the effects of input parameters on the output indicators. Different values for coefficient of variation are applied to the customers' demand rate in the optimization model. The outcome of the deterministic equivalent model of SPIRP is simulated in form of an illustrative case.

  11. Blue Water Footprint Management in a UK Poultry Supply Chain under Environmental Regulatory Constraints

    Directory of Open Access Journals (Sweden)

    Naoum Tsolakis

    2018-02-01

    Full Text Available Chicken is the most consumed meat in the UK, accounting for 40% of meat consumption, while national production sufficiency reaches about 80%. As a farmed animal product, chicken meat is responsible for significant freshwater appropriation volumes during its production cycle. In this context, this research aims at exploring freshwater dynamics in the UK processed poultry industry. Specifically, we develop a System Dynamics model to capture the blue water footprint, as a key sustainability performance indicator of a poultry supply chain, in the case that relevant environmental and regulatory constraints are applied. The model contributes towards investigating the impact of two potential policy-making scenarios, namely, the “water penalty” and the “water tax”, on the nexus between profitability and water usage across the poultry supply chain. Responding to the regulatory constraints, the food processor either reconfigures the supply chain through rethinking desired inventory levels or implements a water management intervention. The results indicate that investing in water-friendly production technologies could offer a greater advantage to sustainable supply chains in terms of blue water efficiency and profitability, compared to employing inventory management strategies. Overall, our analysis highlights that effective policy-making and technology-driven interventions could provide potential towards ensuring economic growth and environmental sustainability of the UK poultry sector.

  12. Intraoral blue (Jadassohn-Tieche) nevus.

    Science.gov (United States)

    Hasse, C D; Zoutendam, G L; Gombas, O F

    1978-05-01

    Blue nevus of the oral mucosa is a distinctly uncommon clincial entity. Careful review of the literature yielded thirty-one previously reported cases. The present article reports the occurrence of a blue nevus of the hard palate in a 58-year-old man. It is of interest since it is the smallest (1 by 1 mm.) intraoral blue nevus to be reported. A clinicopathologic study of the previous thirty-one cases and of our case suggests that this lesion has no age or sex predilection. The most common site of occurrence was the hard palate. There appears to be no tendency toward recurrence. A brief review of the historical background, clinical features, theories of possible origin, and differential diagnosis is presented. Excisional biopsy of localized areas of oral pibmentation, together with histopathologic study, is indicated to rule out melanoma.

  13. Tritium inventory tracking and management

    International Nuclear Information System (INIS)

    Eichenberg, T.W.; Klein, A.C.

    1990-01-01

    This investigation has identified a number of useful applications of the analysis of the tracking and management of the tritium inventory in the various subsystems and components in a DT fusion reactor system. Due to the large amounts of tritium that will need to be circulated within such a plant, and the hazards of dealing with the tritium an electricity generating utility may not wish to also be in the tritium production and supply business on a full time basis. Possible scenarios for system operation have been presented, including options with zero net increase in tritium inventory, annual maintenance and blanket replacement, rapid increases in tritium creation for the production of additional tritium supplies for new plant startup, and failures in certain system components. It has been found that the value of the tritium breeding ratio required to stabilize the storage inventory depends strongly on the value and nature of other system characteristics. The real operation of a DT fusion reactor power plant will include maintenance and blanket replacement shutdowns which will affect the operation of the tritium handling system. It was also found that only modest increases in the tritium breeding ratio are needed in order to produce sufficient extra tritium for the startup of new reactors in less than two years. Thus, the continuous operation of a reactor system with a high tritium breeding ratio in order to have sufficient supplies for other plants is not necessary. Lastly, the overall operation and reliability of the power plant is greatly affected by failures in the fuel cleanup and plasma exhaust systems

  14. The spectrum of dermatoscopic patterns in blue nevi.

    Science.gov (United States)

    Di Cesare, Antonella; Sera, Francesco; Gulia, Andrea; Coletti, Gino; Micantonio, Tamara; Fargnoli, Maria Concetta; Peris, Ketty

    2012-08-01

    Blue nevi are congenital or acquired, dermal dendritic melanocytic proliferations that can simulate melanocytic and nonmelanocytic lesions including melanoma, cutaneous metastasis of melanoma, Spitz/Reed nevi, and basal cell carcinoma. We sought to investigate global and local dermatoscopic patterns of blue nevi compared with melanomas and basal cell carcinomas. We retrospectively analyzed global and local features in 95 dermatoscopic images of blue nevi and in 190 melanomas and basal cell carcinomas that were selected as control lesions on the basis of similar pigmentation. Lesion pigmentation was classified as monochromatic, dichromatic, or multichromatic. A global pattern characterized by homogeneous pigmentation was observed in all of 95 (100%) blue nevi. Eighty of 95 (84.2%) blue nevi presented a homogeneous pattern consisting of one color (blue, black, or brown) or two colors (blue-brown, blue-gray, or blue-black). Fifteen of 95 (15.8%) blue nevi had a multichromatic (blue, gray, black, brown, and/or red) pigmentation. In all, 47 of 95 (49.5%) blue nevi were characterized by pigmentation in the absence of pigment network or any other local dermatoscopic features. And 48 of 95 (50.5%) blue nevi showed local dermatoscopic patterns including whitish scarlike depigmentation, dots/globules, vascular pattern, streaks, and networklike pattern. The study was retrospective and involved only Caucasian people of Italian origin. The characteristic feature of blue nevi is a homogeneous pigmentation that is blue, blue-gray, blue-brown, or blue-black. We showed that a wide spectrum of local dermatoscopic features (whitish scarlike depigmentation, dots/globules, peripheral streaks or vessels) may also be present. In such cases, clinical and dermatoscopic distinction from melanoma or nonmelanocytic lesions may be difficult or impossible, and surgical excision is necessary. Copyright © 2011 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  15. A Genetic Algorithm on Inventory Routing Problem

    Directory of Open Access Journals (Sweden)

    Nevin Aydın

    2014-03-01

    Full Text Available Inventory routing problem can be defined as forming the routes to serve to the retailers from the manufacturer, deciding on the quantity of the shipment to the retailers and deciding on the timing of the replenishments. The difference of inventory routing problems from vehicle routing problems is the consideration of the inventory positions of retailers and supplier, and making the decision accordingly. Inventory routing problems are complex in nature and they can be solved either theoretically or using a heuristics method. Metaheuristics is an emerging class of heuristics that can be applied to combinatorial optimization problems. In this paper, we provide the relationship between vendor-managed inventory and inventory routing problem. The proposed genetic for solving vehicle routing problem is described in detail.

  16. Inventory Centralization Decision Framework for Spare Parts

    DEFF Research Database (Denmark)

    Gregersen, Nicklas; Herbert-Hansen, Zaza Nadja Lee

    2018-01-01

    Within the current literature, there is a lack of a holistic and multidisciplinary approach to managing spare parts and their inventory configuration. This paper addresses this research gap by examining the key contextual factors which influence the degree of inventory centralization and proposes...... a novel holistic theoretical framework, the Inventory Centralization Decision Framework (ICDF), useful for practitioners. Through an extensive review of inventory management literature, six contextual factors influencing the degree of inventory centralization have been identified. Using the ICDF...... practitioners can assess the most advantageous inventory configuration of spare parts. The framework is tested on a large global company which, as a result, today actively uses the ICDF; thus showing its practical applicability....

  17. Inventory estimation for nuclear fuel reprocessing systems

    International Nuclear Information System (INIS)

    Beyerlein, A.L.; Geldard, J.F.

    1987-01-01

    The accuracy of nuclear material accounting methods for nuclear fuel reprocessing facilities is limited by nuclear material inventory variations in the solvent extraction contactors, which affect the separation and purification of uranium and plutonium. Since in-line methods for measuring contactor inventory are not available, simple inventory estimation models are being developed for mixer-settler contactors operating at steady state with a view toward improving the accuracy of nuclear material accounting methods for reprocessing facilities. The authors investigated the following items: (1) improvements in the utility of the inventory estimation models, (2) extension of improvements to inventory estimation for transient nonsteady-state conditions during, for example, process upset or throughput variations, and (3) development of simple inventory estimation models for reprocessing systems using pulsed columns

  18. Hidden inventory and safety considerations

    International Nuclear Information System (INIS)

    Anderson, A.R.; James, R.H.; Morgan, F.

    1976-01-01

    Preliminary results are described of the evaluation of residual plutonium in a process line used for the production of experimental fast reactor fuel. Initial attention has been focussed on a selection of work boxes used for processing powders and solutions. Amounts of material measured as ''hidden inventory'' are generally less than 0.1 percent of throughput but in one box containing very complex equipment the amount was exceptionally about 0.5 percent. The total surface area of the box and the installed equipment appears to be the most significant factor in determining the amount of plutonium held-up as ''hidden inventory,'' representing an average of about 4 x 10 -4 g cm -2 . Present results are based on gamma spectrometer measurements but neutron techniques are being developed to overcome some of the inherent uncertainties in the gamma method. It is suggested that the routine use of sample plates of known surface area would be valuable in monitoring the deposition of plutonium in work boxes

  19. Estimating dead wood during national forest inventories: a review of inventory methodologies and suggestions for harmonization.

    Science.gov (United States)

    Woodall, Christopher W; Rondeux, Jacques; Verkerk, Pieter J; Ståhl, Göran

    2009-10-01

    Efforts to assess forest ecosystem carbon stocks, biodiversity, and fire hazards have spurred the need for comprehensive assessments of forest ecosystem dead wood (DW) components around the world. Currently, information regarding the prevalence, status, and methods of DW inventories occurring in the world's forested landscapes is scattered. The goal of this study is to describe the status, DW components measured, sample methods employed, and DW component thresholds used by national forest inventories that currently inventory DW around the world. Study results indicate that most countries do not inventory forest DW. Globally, we estimate that about 13% of countries inventory DW using a diversity of sample methods and DW component definitions. A common feature among DW inventories was that most countries had only just begun DW inventories and employ very low sample intensities. There are major hurdles to harmonizing national forest inventories of DW: differences in population definitions, lack of clarity on sample protocols/estimation procedures, and sparse availability of inventory data/reports. Increasing database/estimation flexibility, developing common dimensional thresholds of DW components, publishing inventory procedures/protocols, releasing inventory data/reports to international peer review, and increasing communication (e.g., workshops) among countries inventorying DW are suggestions forwarded by this study to increase DW inventory harmonization.

  20. Inventories in the Australian business cycle

    OpenAIRE

    Chindamo, Phillip

    2010-01-01

    This Economics Research Note examines inventories in the business cycle for Australia covering the period since the mid 1980s. The Australian Bureau of Statistics (ABS) defines inventories as all materials etc., work in progress and finished goods owned by a business, whether held at locations of the business or elsewhere. These items are usually held by businesses in anticipation of a product’s sale. Inventory investment is counted as an additional contribution to gross domestic product (...

  1. Data Driven Tuning of Inventory Controllers

    DEFF Research Database (Denmark)

    Huusom, Jakob Kjøbsted; Santacoloma, Paloma Andrade; Poulsen, Niels Kjølstad

    2007-01-01

    A systematic method for criterion based tuning of inventory controllers based on data-driven iterative feedback tuning is presented. This tuning method circumvent problems with modeling bias. The process model used for the design of the inventory control is utilized in the tuning...... as an approximation to reduce time required on experiments. The method is illustrated in an application with a multivariable inventory control implementation on a four tank system....

  2. Annual Danish Informative Inventory Report to UNECE

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Winther, Morten; Mikkelsen, Mette Hjorth

    The report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2013. The report contains information on Denmark’s emission inventories regarding emissions of (1) SOX......(k)fluoranthene and indeno(1,2,3-cd)pyrene, PCDD/F and HCB for the years 1990-2011. Further, the report contains information on background data for emissions inventory....

  3. Annual Danish Informative Inventory Report to UNECE

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Winther, Morten; Mikkelsen, Mette Hjorth

    2012-01-01

    This report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2012. The report contains information on Denmark’s emission inventories regarding emissions of (1) SOX......(k)fluoranthene and indeno(1,2,3-cd)pyrene, PCDD/F and HCB for the years 1990-2010. Further, the report contains information on background data for emissions inventory....

  4. Inventories and sales uncertainty\\ud

    OpenAIRE

    Caglayan, M.; Maioli, S.; Mateut, S.

    2011-01-01

    We investigate the empirical linkages between sales uncertainty and firms´ inventory investment behavior while controlling for firms´ financial strength. Using large panels of manufacturing firms from several European countries we find that higher sales uncertainty leads to larger stocks of inventories. We also identify an indirect effect of sales uncertainty on inventory accumulation through the financial strength of firms. Our results provide evidence that financial strength mitigates the a...

  5. Deteriorating Inventory Model for Chilled Food

    OpenAIRE

    Yang, Ming-Feng; Tseng, Wei-Chung

    2015-01-01

    With many aspects that affect inventory policy, product perishability is a critical aspect of inventory policy. Most goods will deteriorate during storage and their original value will decline or be lost. Therefore, deterioration should be taken into account in inventory practice. Chilled food products are very common consumer goods that are, in fact, perishable. If the chilled food quality declines over time customers are less likely to buy it. The value the chilled food retains is, however,...

  6. Denmark’s National Inventory Report 2012

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Mikkelsen, Mette Hjorth; Hoffmann, Leif

    This report is Denmark’s National Inventory Report 2012. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2010 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2012. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2010 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

  7. Defense Business Operations Fund Inventory Record Accuracy

    National Research Council Canada - National Science Library

    1998-01-01

    .... The overall objective of the audit was to determine whether inventory amounts on the FY 1996 Defense Business Operations Fund Consolidated Financial Statements were presented fairly in accordance...

  8. Blood inventory management: hospital best practice.

    Science.gov (United States)

    Stanger, Sebastian H W; Yates, Nicola; Wilding, Richard; Cotton, Sue

    2012-04-01

    Blood is a perishable product, and hence good management of inventories is crucial. Blood inventory management is a trade-off between shortage and wastage. The challenge is to keep enough stock to ensure a 100% supply of blood while keeping time expiry losses at a minimum. This article focuses on inventory management of red blood cells in hospital transfusion laboratories to derive principles of best practice and makes recommendations that will ensure losses due to time expiry are kept to a minimum. The literature was reviewed to identify available models for perishable inventory management. Historical data from the UK blood supply chain was analyzed to identify hospitals with good inventory management practice and low wastage levels. Transfusion laboratory managers in the selected hospitals were interviewed in 7 case studies with the aim of identifying drivers for low wastage and good inventory management practice. The findings from the case studies were compared with the literature. The extant literature asserts that the drivers for good inventory performance are the use of complex inventory models and algorithms. This study has found this not to be the case. Instead, good performance is driven by the quality of transfusion laboratory staff, who must be skilled, regularly trained, and experienced. Electronic crossmatching, transparency of the inventory, and simple management procedures also facilitate good performance. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Danish emission inventories for stationary combustion plants. Inventories until 2008

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, Malene; Nielsen, Ole-Kenneth; Plejdrup, M.; Hjelgaard, K.

    2010-10-15

    Emission inventories for stationary combustion plants are presented and the methodologies and assumptions used for the inventories are described. The pollutants considered are SO{sub 2}, NO{sub x}, NMVOC, CH{sub 4}, CO, CO{sub 2}, N{sub 2}O, NH{sub 3}, particulate matter, heavy metals, dioxins, HCB and PAH. The CO{sub 2} emission in 2008 was 16 % lower than in 1990. However, fluctuations in the emission level are large as a result of electricity import/export. The emission of CH{sub 4} has increased due to increased use of lean-burn gas engines in combined heating and power (CHP) plants. However, the emission has decreased in recent years due to structural changes in the Danish electricity market. The N{sub 2}O emission was higher in 2008 than in 1990 but the fluctuations in the time-series are significant. A considerable decrease of the SO{sub 2}, NO{sub x} and heavy metal emissions is mainly a result of decreased emissions from large power plants and waste incineration plants. The combustion of wood in residential plants has increased considerably in recent years resulting in increased emission of PAH, particulate matter and CO. The emission of NMVOC has increased since 1990 as a result of both the increased combustion of wood in residential plants and the increased emission from lean-burn gas engines. The dioxin emission decreased since 1990 due to flue gas cleaning on waste incineration plants. However in recent years the emission has increased as a result of the increased combustion of wood in residential plants. (Author)

  10. Coomassie Brilliant Blue G is a more potent antagonist of P2 purinergic responses than Reactive Blue 2 (Cibacron Blue 3GA) in rat parotid acinar cells

    International Nuclear Information System (INIS)

    Soltoff, S.P.; McMillian, M.K.; Talamo, B.R.

    1989-01-01

    The ability of Brilliant Blue G (Coomassie Brilliant Blue G) and Reactive Blue 2 (Cibacron Blue 3GA) to block the effects of extracellular ATP on rat parotid acinar cells was examined by evaluating their effects on ATP-stimulated 45Ca 2+ entry and the elevation of [Ca 2+ ]i (Fura 2 fluorescence). ATP (300 microM) increased the rate of Ca 2+ entry to more than 25-times the basal rate and elevated [Ca 2+ ]i to levels more than three times the basal value. Brilliant Blue G and Reactive Blue 2 greatly reduced the entry of 45 Ca 2+ into parotid cells, but the potency of Brilliant Blue G (IC50 approximately 0.4 microM) was about 100-times that of Reactive Blue 2. Fura 2 studies demonstrated that inhibitory concentrations of these compounds did not block the cholinergic response of these cells, thus demonstrating the selectivity of the dye compounds for purinergic receptors. Unlike Reactive Blue 2, effective concentrations of Brilliant Blue G did not substantially quench Fura 2 fluorescence. The greater potency of Brilliant Blue G suggests that it may be very useful in identifying P2-type purinergic receptors, especially in studies which utilize fluorescent probes

  11. INCAP - Applying short-term flexibility to control inventories

    OpenAIRE

    Lödding , Hermann; Lohmann , Steffen

    2011-01-01

    Abstract Inventory Based Capacity Control (INCAP) is a very simple method that allows inventory levels to be effectively controlled by using short-term capacity flexibility in make-to-stock settings. Moreover, INCAP can be used for finished goods inventories as well as for semi-finished goods inventories. The basic idea is to define upper and lower inventory limits and to adjust capacities if the inventory level reaches either limit. Should the inventory fall below the lower limit,...

  12. Spectra and ages of blue stragglers

    International Nuclear Information System (INIS)

    Abt, H.A.

    1985-01-01

    A mechanism similar to Wheeler's quasi-homogeneous evolution and Finzi and Wolf's proposal for blue stragglers is proposed as the origin of the blue stragglers in intermediate-age clusters. Blue stragglers are stars whose positions in color-magnitude diagrams of open and globular clusters are significantly above the turn-off points and in the region of the (former) main sequence; they seem to represent a conflict with the general conclusion that all stars in a cluster originated at about the same time. It is concluded that there are at least two kinds of blue stragglers: (1) those stars of types about B3-A2 are primarily Ap stars and slow rotators, occur in the intermediate age clusters and remain in the main sequence region probably through magnetic mixing; and (2) the stars of type O6-B2 frequently have emission lines, are rapid rotators, occur in the young cluster, and remain in the main sequence region probably by rotational mixing. 30 references

  13. Prussian Blue Analogues of Reduced Dimensionality

    NARCIS (Netherlands)

    Gengler, Regis Y. N.; Toma, Luminita M.; Pardo, Emilio; Lloret, Francesc; Ke, Xiaoxing; Van Tendeloo, Gustaaf; Gournis, Dimitrios; Rudolf, Petra

    2012-01-01

    Mixed-valence polycyanides (Prussian Blue analogues) possess a rich palette of properties spanning from room-temperature ferromagnetism to zero thermal expansion, which can be tuned by chemical modifications or the application of external stimuli (temperature, pressure, light irradiation). While

  14. Blue whales respond to anthropogenic noise.

    Directory of Open Access Journals (Sweden)

    Mariana L Melcón

    Full Text Available Anthropogenic noise may significantly impact exposed marine mammals. This work studied the vocalization response of endangered blue whales to anthropogenic noise sources in the mid-frequency range using passive acoustic monitoring in the Southern California Bight. Blue whales were less likely to produce calls when mid-frequency active sonar was present. This reduction was more pronounced when the sonar source was closer to the animal, at higher sound levels. The animals were equally likely to stop calling at any time of day, showing no diel pattern in their sensitivity to sonar. Conversely, the likelihood of whales emitting calls increased when ship sounds were nearby. Whales did not show a differential response to ship noise as a function of the time of the day either. These results demonstrate that anthropogenic noise, even at frequencies well above the blue whales' sound production range, has a strong probability of eliciting changes in vocal behavior. The long-term implications of disruption in call production to blue whale foraging and other behaviors are currently not well understood.

  15. African Retentions in Blues and Jazz.

    Science.gov (United States)

    Meadows, Eddie S.

    1979-01-01

    The perseverance of African musical characteristics among American Blacks is an historic reality. African retentions have been recorded in Black music of the antebellum period. Various African scales and rhythms permeate Black American music today as evidenced in the retentions found in blues and jazz. (RLV)

  16. Nanotubes based on monolayer blue phosphorus

    KAUST Repository

    Montes Muñoz, Enrique

    2016-07-08

    We demonstrate structural stability of monolayer zigzag and armchair blue phosphorus nanotubes by means of molecular dynamics simulations. The vibrational spectrum and electronic band structure are determined and analyzed as functions of the tube diameter and axial strain. The nanotubes are found to be semiconductors with a sensitive indirect band gap that allows flexible tuning.

  17. Statistical thermodynamics of supercapacitors and blue engines

    NARCIS (Netherlands)

    van Roij, R.H.H.G.

    2013-01-01

    We study the thermodynamics of electrode-electrolyte systems, for instance supercapacitors filled with an ionic liquid or blue-energy devices filled with river- or sea water. By a suitable mapping of thermodynamic variables, we identify a strong analogy with classical heat engines. We introduce

  18. Improper, Blue-Shifting Hydrogen Bond

    Czech Academy of Sciences Publication Activity Database

    Hobza, Pavel; Havlas, Zdeněk

    2002-01-01

    Roč. 108, - (2002), s. 325-334 ISSN 1432-881X R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4055905; CEZ:AV0Z4040901 Keywords : improper, blue-shifting hydrogen bond * properties * nature Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.421, year: 2002

  19. Blue laser phase change recording system

    International Nuclear Information System (INIS)

    Hofmann, Holger; Dambach, S.Soeren; Richter, Hartmut

    2002-01-01

    The migration paths from DVD phase change recording with red laser to the next generation optical disk formats with blue laser and high NA optics are discussed with respect to optical aberration margins and disc capacities. A test system for the evaluation of phase change disks with more than 20 GB capacity is presented and first results of the recording performance are shown

  20. The Blue Compact Dwarf Galaxy IZw18

    NARCIS (Netherlands)

    Musella, I.; Marconi, M.; Fiorentino, G.; Clementini, G.; Aloisi, A.; Annibali, F.; Contreras, R.; Saha, A.; Tosi, M.; van der Marel, R. P.

    2012-01-01

    We present the results obtained for the Blue compact galaxy IZw18 on the basis of ACS HST data obtained from our group. In particular, we discuss the stellar population and the variable stars content of this galaxy to get information about its star formation history and distance.

  1. Biodecolorization and biodegradation of Reactive Blue by ...

    African Journals Online (AJOL)

    SERVER

    2007-06-18

    Jun 18, 2007 ... Aspergillus sp. effectively decolorized Reactive Blue and other structurally different synthetic dyes. Agitation was found to be an important ... Few chemically different dyes such as Reactive Black (75%), Reactive Yellow (70%),. Reactive Red (33%) and ..... Degradation of azo dyes by the lignin degrading ...

  2. T's and Blues. Specialized Information Service.

    Science.gov (United States)

    Do It Now Foundation, Phoenix, AZ.

    This compilation of journal articles provides basic information on abuse of Talwin, a mild prescription painkiller (T's), and Pyribenzamine, a nonprescription antihistimine (Blues). These two drugs, taken in combination, produce an effect similar to that produced by heroin. Stories from "Drug Survival News,""Emergency…

  3. [The dangers of blue light: True story!].

    Science.gov (United States)

    Renard, G; Leid, J

    2016-05-01

    The dangers of the blue light are the object of numerous publications, for both the scientific community and the general public. The new prolific development of light sources emitting potentially toxic blue light (415-455nm) ranges from LED (Light Emitting Diodes) lamps for interior lighting to television screens, computers, digital tablets and smartphones using OLED (Organic Light Emitting Diode) or AMOLED (Active-Matrix Organic Light Emitting Diode) technology. First we will review some technical terms and the main characteristics of light perceived by the human eye. Then we will discuss scientific proof of the toxicity of blue light to the eye, which may cause cataract or macular degeneration. Analysis of the light spectra of several light sources, from natural light to LED lamps, will allow us to specify even better the dangers related to each light source. LED lamps, whether used as components for interior lighting or screens, are of concern if they are used for extended viewing times and at short distance. While we can protect ourselves from natural blue light by wearing colored glasses which filter out, on both front and back surfaces, the toxic wavelengths, it is more difficult to protect oneself from LED lamps in internal lighting, the use of which should be restricted to "white warmth" lamps (2700K). As far as OLED or AMOLED screens are concerned, the only effective protection consists of using them occasionally and only for a short period of time. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. Blue LED irradiation to hydration of skin

    Science.gov (United States)

    Menezes, Priscila F. C.; Requena, Michelle B.; Lizarelli, Rosane F., Z.; Bagnato, Vanderlei S.

    2015-06-01

    Blue LED system irradiation shows many important properties on skin as: bacterial decontamination, degradation of endogenous skin chromophores and biostimulation. In this clinical study we prove that the blue light improves the skin hydration. In the literature none authors reports this biological property on skin. Then this study aims to discuss the role of blue light in the skin hydration. Twenty patients were selected to this study with age between 25-35 years old and phototype I, II and III. A defined area from forearm was pre determined (A = 4.0 cm2). The study was randomized in two treatment groups using one blue light device (power of 5.3mW and irradiance of 10.8mW/cm2). The first treatment group was irradiated with 3J/cm2 (277seconds) and the second with 6J/cm2 (555 seconds). The skin hydration evaluations were done using a corneometer. The measurements were collected in 7, 14, 21 and 30 days, during the treatment. Statistical test of ANOVA, Tukey and T-Student were applied considering 5% of significance. In conclusion, both doses were able to improve the skin hydration; however, 6J/cm2 has kept this hydration for 30 days.

  5. Biodecolorization and biodegradation of Reactive Blue by ...

    African Journals Online (AJOL)

    Aspergillus sp. effectively decolorized Reactive Blue and other structurally different synthetic dyes. Agitation was found to be an important parameter, while glucose (99%), sucrose (97%) and mannitol (98%) were the best carbon sources for the decolorization. Decolorization was effective in an acidic environment (pH 3).

  6. Biological Inventory Cape La Croix Creek Watershed, Cape Girardeau County, Missouri.

    Science.gov (United States)

    1977-01-01

    abundant are toads and, in moist meadows, leopard frogs. Twenty-one species of reptiles are known or likely to occur in agricul- tural and old field...inventory. Snakes represent the remaining reptiles from these habitats, especially the genus Natrix, having six species. Snakes also comprise the bulk...duck 6 3,730 11 3 0.02 Pintail 7 2,546 41 198 2.12 Blue & Snow geese 8 1,064 9 10 0.26 Common goldeneye 9 1,036 - - - Ring-necked duck 10 1,033 7 29

  7. The lithium abundance of M67 blue stragglers - A constraint on the blue straggler phenomenon

    International Nuclear Information System (INIS)

    Pritchet, C.J.; Glaspey, J.W.

    1991-01-01

    Upper limits have been placed on the line strength of the 6707 A Li I resonance doublet in seven blue stragglers in M67. The corresponding upper limits on abundances range from log N(Li) less than about 1.3 to less than about 2.3. This result is significantly below the level of log N(Li) about 3.1 + or - 0.1 found in field main-sequence stars of comparable temperature. It is concluded that some form of mixing has affected the outer envelopes of blue stragglers. (Such mixing has been proposed as the mechanism needed to prolong the lifetimes of blue stragglers relative to normal main-sequence stars at the same luminosity). Virtually all mechanisms for the production of blue stragglers other than mixing, binary mass transfer, or binary coalescence appear to be ruled out by the present observations. 45 refs

  8. Hubble's View of Little Blue Dots

    Science.gov (United States)

    Kohler, Susanna

    2018-02-01

    The recent discovery of a new type of tiny, star-forming galaxy is the latest in a zoo of detections shedding light on our early universe. What can we learn from the unique little blue dots found in archival Hubble data?Peas, Berries, and DotsGreen pea galaxies identified by citizen scientists with Galaxy Zoo. [Richard Nowell Carolin Cardamone]As telescope capabilities improve and we develop increasingly deeper large-scale surveys of our universe, we continue to learn more about small, faraway galaxies. In recent years, increasing sensitivity first enabled the detection of green peas luminous, compact, low-mass (10 billion solar masses; compare this to the Milky Ways 1 trillion solar masses!) galaxies with high rates of star formation.Not long thereafter, we discovered galaxies that form stars similarly rapidly, but are even smaller only 330 million solar masses, spanning less than 3,000 light-years in size. These tiny powerhouses were termed blueberries for their distinctive color.Now, scientists Debra and Bruce Elmegreen (of Vassar College and IBM Research Division, respectively) report the discovery of galaxies that have even higher star formation rates and even lower masses: little blue dots.Exploring Tiny Star FactoriesThe Elmegreens discovered these unique galaxies by exploring archival Hubble data. The Hubble Frontier Fields data consist of deep images of six distant galaxy clusters and the parallel fields next to them. It was in the archival data for two Frontier Field Parallels, those for clusters Abell 2744 and MAS J0416.1-2403, that the authors noticed several galaxies that stand out as tiny, bright, blue objects that are nearly point sources.Top: a few examples of the little blue dots recently identified in two Hubble Frontier Field Parallels. Bottom: stacked images for three different groups of little blue dots. [Elmegreen Elmegreen 2017]The authors performed a search through the two Frontier Field Parallels, discovering a total of 55 little blue dots

  9. Stable isotope research pool inventory

    International Nuclear Information System (INIS)

    1986-08-01

    This report contains a listing of electromagnetically separated stable isotopes which are available at the Oak Ridge National Laboratory for distribution for nondestructive research use on a loan basis. This inventory includes all samples of stable isotopes in the Research Materials Collection and does not designate whether a sample is out on loan or is in reprocessing. For some of the high-abundance, naturally occurring isotopes, larger amounts can be made available; for example, Ca-40 and Fe-56. All requests for the loan of samples should be submitted with a summary of the purpose of the loan to: Iotope Distribution Office, Oak Ridge National Laboratory, P.O. Box X, Oak Ridge, Tennessee 37831. Requests from non-DOE contractors and from foreign institutions require DOE approval

  10. Tritium inventory measurements using calorimetry

    International Nuclear Information System (INIS)

    Kapulla, H.; Kraemer, R.; Heine, R.

    1992-01-01

    In the past calorimetry has been developed as a powerful tool in radiometrology. Calorimetric methods have been applied for the determination of activities, half lives and mean energies released during the disintegration of radioactive isotopes. The fundamental factors and relations which determine the power output of radioactive samples are presented and some basic calorimeter principles are discussed in this paper. At the Kernforschungszentrum Karlsruhe (KfK) a family of 3 calorimeters has been developed to measure the energy release from radiative waste products arising from reprocessing operations. With these calorimeters, radiative samples with sizes from a few cm 3 to 2 ·10 5 cm 3 and heat ratings ranging from a few nW to kW can be measured. After modifications of tits inner part the most sensitive calorimeter among the three calorimeters mentioned above would be best suited for measuring the tritium inventory in T-getters of the Amersham-type

  11. Pacer processing: cavity inventory relationships

    International Nuclear Information System (INIS)

    Dietz, R.J.; Gritzo, L.A.

    1975-09-01

    The pacer cavity and its associated primary power loop comprise a recirculating system in which materials are introduced by a series of thermonuclear explosions while debris is continuously removed by radioactive decay, sorption phenomena, and deliberate processing. Safe, reliable, and economical realization of the Pacer concept depends on the removal and control of both noxious and valuable by-products of the fusion reaction. Mathematical relationships are developed that describe the quantities of materials that are introduced into the Pacer cavity by a series of discrete events and are removed continuously by processing and decay. An iterative computer program based on these relationships is developed that allows both the total cavity inventory and the amounts of important individual species to be determined at any time during the lifetime of the cavity in order to establish the effects of the thermonuclear event, the cavity, the flow, and various processing parameters on Pacer design requirements

  12. The Cambridge Behavioural Inventory revised.

    Science.gov (United States)

    Wear, Helen J; Wedderburn, Catherine J; Mioshi, Eneida; Williams-Gray, Caroline H; Mason, Sarah L; Barker, Roger A; Hodges, John R

    2008-01-01

    Neurobehavioural and psychiatric symptoms are common in a range of neurodegenerative disorders with distinct profiles which are helpful in the diagnosis and monitoring of these disorders. The Cambridge Behavioural Inventory (CBI) has been shown to distinguish frontotemporal dementia (FTD), Alzheimer's disease (AD), Huntington's disease (HD) and Parkinson's disease (PD), but it is lengthy. To develop a shorter version of the 81 item CBI. CBI data from 450 participants with behavioural variant frontotemporal dementia (bv-FTD) (64), AD (96), PD (215) and HD (75) were analysed using Principal Components Analysis and measures of internal consistency (Cronbach alpha). A reduced 45-item questionnaire was developed. The instrument identified distinct behavioural profiles and performed as well as the original version. A shorter (45 item) version of the CBI is capable of differentiating bv-FTD and AD from PD and HD. It may be useful in delineating the type and extent of problems in these disorders as well as monitoring therapeutic interventions.

  13. Blue-light emitting triazolopyridinium and triazoloquinolinium salts

    KAUST Repository

    Carboni, Valentina; Su, Xin; Qian, Hai; Aprahamian, Ivan; Credi, Alberto

    2017-01-01

    Compounds that emit blue light are of interest for applications that include optoelectronic devices and chemo/biosensing and imaging. The design and synthesis of small organic molecules that can act as high-efficiency deep-blue-light emitters

  14. Unraveling the Mystery of the Blue Fog: Structure, Properties, and Applications of Amorphous Blue Phase III.

    Science.gov (United States)

    Gandhi, Sahil Sandesh; Chien, Liang-Chy

    2017-12-01

    The amorphous blue phase III of cholesteric liquid crystals, also known as the "blue fog," are among the rising stars in materials science that can potentially be used to develop next-generation displays with the ability to compete toe-to-toe with disruptive technologies like organic light-emitting diodes. The structure and properties of the practically unobservable blue phase III have eluded scientists for more than a century since it was discovered. This progress report reviews the developments in this field from both fundamental and applied research perspectives. The first part of this progress report gives an overview of the 130-years-long scientific tour-de-force that very recently resulted in the revelation of the mysterious structure of blue phase III. The second part reviews progress made in the past decade in developing electrooptical, optical, and photonic devices based on blue phase III. The strong and weak aspects of the development of these devices are underlined and criticized, respectively. The third- and-final part proposes ideas for further improvement in blue phase III technology to make it feasible for commercialization and widespread use. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. The Blue Coma: The Role of Methylene Blue in Unexplained Coma After Cardiac Surgery.

    Science.gov (United States)

    Martino, Enrico Antonio; Winterton, Dario; Nardelli, Pasquale; Pasin, Laura; Calabrò, Maria Grazia; Bove, Tiziana; Fanelli, Giovanna; Zangrillo, Alberto; Landoni, Giovanni

    2016-04-01

    Methylene blue commonly is used as a dye or an antidote, but also can be used off label as a vasopressor. Serotonin toxicity is a potentially lethal and often misdiagnosed condition that can result from drug interaction. Mild serotonin toxicity previously was reported in settings in which methylene blue was used as a dye. The authors report 3 cases of life-threatening serotonin toxicity in patients undergoing chronic selective serotonin reuptake inhibitor (SSRI) therapy who also underwent cardiac surgery and received methylene blue to treat vasoplegic syndrome. An observational study. A cardiothoracic intensive care unit (ICU) in a teaching hospital. Three patients who received methylene blue after cardiac surgery, later discovered to be undergoing chronic SSRI therapy. None. All 3 patients received high doses of fentanyl during general anesthesia. They all developed vasoplegic syndrome and consequently were given methylene blue in the ICU. All 3 patients developed serotonin toxicity, including coma, after this administration and diagnostic tests were negative for acute intracranial pathology. Coma lasted between 1 and 5 days. Two patients were discharged from the ICU shortly after awakening, whereas the third patient experienced a complicated postoperative course for concomitant refractory low-cardiac-output syndrome. Patients undergoing chronic SSRI therapy should not be administered methylene blue to treat vasoplegic syndrome. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. 26 CFR 1.1013-1 - Property included in inventory.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Property included in inventory. 1.1013-1 Section... inventory. The basis of property required to be included in inventory is the last inventory value of such property in the hands of the taxpayer. The requirements with respect to the valuation of an inventory are...

  17. Emission Inventory for Fugitive Emissions in Denmark

    DEFF Research Database (Denmark)

    Plejdrup, Marlene Schmidt; Nielsen, Ole-Kenneth; Nielsen, Malene

    This report presents the methodology and data used in the Danish inventory of fugitive emissions from fuels for the years until 2007. The inventory of fugitive emissions includes CO2, CH4, N2O, NOx, CO, NMVOC, SO2, dioxin, PAH and particulate matter. In 2007 the total Danish emission of greenhouse...

  18. Inventory management systems : Control and information issues

    NARCIS (Netherlands)

    Janssen, F.B.S.L.P.

    1998-01-01

    This dissertation addresses the management of inventory systems. The thesis starts with an exposition on mathematical models that can be used in inventory theory. Then we deal with some information issues related to the demand process. Namely, how to control products that have intermittent demand.

  19. Lost-sales inventory theory : A review

    NARCIS (Netherlands)

    Bijvank, Marco; Vis, Iris F. A.

    2011-01-01

    In classic inventory models it is common to assume that excess demand is backordered. However, studies analyzing customer behavior in practice show that most unfulfilled demand is lost or an alternative item/location is looked for in many retail environments. Inventory systems that include this

  20. Wisconsin's forest statistics, 1987: an inventory update.

    Science.gov (United States)

    W. Brad Smith; Jerold T. Hahn

    1989-01-01

    The Wisconsin 1987 inventory update, derived by using tree growth models, reports 14.7 million acres of timberland, a decline of less than 1% since 1983. This bulletin presents findings from the inventory update in tables detailing timberland area, volume, and biomass.

  1. Validation of the Classroom Behavior Inventory

    Science.gov (United States)

    Blunden, Dale; And Others

    1974-01-01

    Factor-analytic methods were used toassess contruct validity of the Classroom Behavior Inventory, a scale for rating behaviors associated with hyperactivity. The Classroom Behavior Inventory measures three dimensions of behavior: Hyperactivity, Hostility, and Sociability. Significant concurrent validity was obtained for only one Classroom Behavior…

  2. Retail inventory management with lost sales

    NARCIS (Netherlands)

    Curseu - Stefanut, A.

    2012-01-01

    The inventory control problem of traditional store-based grocery retailers has several challenging features. Demand for products is stochastic, and is typically lost when no inventory is available on the shelves. As the consumer behavior studies reveal, only a small percentage of customers are

  3. B Plant exhaust filter inventory analysis

    International Nuclear Information System (INIS)

    Lan, J.S.; Wootan, D.W.; Carter, L.L.; Bunch, W.L.; Covey, L.I.; Greenborg, J.

    1994-10-01

    This paper describes a method for determining radionuclide inventories in filters using measurements of radiation fields that determine photon dose rates and photon-plus-electron dose rates between filter banks. The mathematical approach quantifies the curie inventories of filter banks by using the measured dose rates and the calculated Green's functions involving detector responses per unit source

  4. Minnesota's forest statistics, 1987: an inventory update.

    Science.gov (United States)

    Jerold T. Hahn; W. Brad Smith

    1987-01-01

    The Minnesota 1987 inventory update, derived by using tree growth models, reports 13.5 million acres of timberland, a decline of less than 1% since 1977. This bulletin presents findings from the inventory update in tables detailing timer land area, volume, and biomass.

  5. Dynamic pricing and learning with finite inventories

    NARCIS (Netherlands)

    den Boer, A.V.; Zwart, Bert

    2013-01-01

    We study a dynamic pricing problem with finite inventory and parametric uncertainty on the demand distribution. Products are sold during selling seasons of finite length, and inventory that is unsold at the end of a selling season, perishes. The goal of the seller is to determine a pricing strategy

  6. Dynamic pricing and learning with finite inventories

    NARCIS (Netherlands)

    den Boer, A.V.; Zwart, Bert

    We study a dynamic pricing problem with finite inventory and parametric uncertainty on the demand distribution. Products are sold during selling seasons of finite length, and inventory that is unsold at the end of a selling season perishes. The goal of the seller is to determine a pricing strategy

  7. Dynamic Pricing and Learning with Finite Inventories

    NARCIS (Netherlands)

    A.P. Zwart (Bert); A.V. den Boer (Arnoud)

    2015-01-01

    htmlabstractWe study a dynamic pricing problem with finite inventory and parametric uncertainty on the demand distribution. Products are sold during selling seasons of finite length, and inventory that is unsold at the end of a selling season perishes. The goal of the seller is to determine a

  8. Dynamic pricing and learning with finite inventories

    NARCIS (Netherlands)

    Boer, den A.V.; Zwart, B.

    2015-01-01

    We study a dynamic pricing problem with finite inventory and parametric uncertainty on the demand distribution. Products are sold during selling seasons of finite length, and inventory that is unsold at the end of a selling season perishes. The goal of the seller is to determine a pricing strategy

  9. 76 FR 62327 - Retail Inventory Method

    Science.gov (United States)

    2011-10-07

    ... accounting. The regulations restate and clarify the computation of ending inventory values under the retail... method of accounting for inventories must clearly reflect income. Section 1.471-2(c) provides that the...-retail ratio, or cost complement. The numerator of the cost complement is the value of beginning...

  10. Texas, 2008 forest inventory and analysis factsheet

    Science.gov (United States)

    James Bentley

    2011-01-01

    This science update summarizes the findings of the first statewide annual inventory conducted by the Southern Forest Inventory and Analysis (FIA) Program in cooperation with the Texas Forest Service of the forest resource attributes in Texas. The 254 counties of Texas are consolidated into seven FIA survey units—southeast (unit 1), the northeast (unit 2), the north...

  11. Texas, 2010 forest inventory and analysis factsheet

    Science.gov (United States)

    James W. Bentley

    2012-01-01

    This science update summarizes the findings of the statewide annual inventory conducted by the Southern Forest Inventory and Analysis (FIA) Program in cooperation with the Texas Forest Service of the forest resource attributes in Texas. The 254 counties of Texas are consolidated into seven FIA survey units – southeast (unit 1), northeast (unit 2), north central (unit 3...

  12. Handbook for inventorying downed woody material

    Science.gov (United States)

    James K. Brown

    1974-01-01

    To facilitate debris management, procedures for inventorying downed woody material are presented. Instructions show how to estimate weights and volumes of downed woody material, fuel depth, and duff depth. Using the planar intersect technique, downed material is inventoried by 0- to 0.25-inch, 0.25- to 1-inch, and 1- to 3-inch diameter classes; and by 1-inch classes...

  13. Improving the Greenlandic Greenhouse Gas Inventory

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Baunbæk, Lene; Gyldenkærne, Steen

    The project to improve the Greenlandic greenhouse gas (GHG) inventory was undertaken due to the recommendations made by the UNFCCC review team in connection with the 2008 and 2009 submissions by the Kingdom of Denmark. The improvements made to the Greenlandic GHG emission inventory were substantial...

  14. 40 CFR 52.2086 - Emission inventories.

    Science.gov (United States)

    2010-07-01

    ... area is classified as serious and includes the entire state of Rhode Island. (d) Minor revisions to the... inventory for the Providence ozone nonattainment area on January 12, 1993 as a revision to the State... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Emission inventories. 52.2086 Section...

  15. Inventory Management Practices and Business Performance for ...

    African Journals Online (AJOL)

    Inventory constitutes much of the working capital held by SSEs and poor working capital management has been identified as one of the major causes of SSE failures. With this backdrop, this study investigated the relationship between inventory management practices and the business performance of SSEs in Kisii ...

  16. Relativity Concept Inventory: Development, Analysis, and Results

    Science.gov (United States)

    Aslanides, J. S.; Savage, C. M.

    2013-01-01

    We report on a concept inventory for special relativity: the development process, data analysis methods, and results from an introductory relativity class. The Relativity Concept Inventory tests understanding of relativistic concepts. An unusual feature is confidence testing for each question. This can provide additional information; for example,…

  17. Clean Lead Facility Inventory System user's manual

    International Nuclear Information System (INIS)

    Garcia, J.F.

    1994-12-01

    The purpose of this user's manual is to provide instruction and guidance needed to enter and maintain inventory information for the Clean Lead Facility (CLF), PER-612. Individuals responsible for maintaining and using the system should study and understand the information provided. The user's manual describes how to properly use and maintain the CLF Inventory System. Annual, quarterly, monthly, and current inventory reports may be printed from the Inventory System for reporting purposes. Profile reports of each shipment of lead may also be printed for verification and documentation of lead transactions. The CLF Inventory System was designed on Microsoft Access version 2.0. Similar inventory systems are in use at the Idaho National Engineering Laboratory (INEL) to facilitate site-wide compilations of mixed waste data. The CLF Inventory System was designed for inventorying the clean or non-radioactive contaminated lead stored at the CLF. This data, along with the mixed waste data, will be compiled into the Idaho Mixed Waste Information (IMWI) system for reporting to the Department of Energy Idaho Office, Department of Energy Headquarters, and/or the State of Idaho

  18. Aspen biology, community classification, and management in the Blue Mountains

    Science.gov (United States)

    David K. Swanson; Craig L. Schmitt; Diane M. Shirley; Vicky Erickson; Kenneth J. Schuetz; Michael L. Tatum; David C. Powell

    2010-01-01

    Quaking aspen (Populus tremuloides Michx.) is a valuable species that is declining in the Blue Mountains of northeastern Oregon. This publication is a compilation of over 20 years of aspen management experience by USDA Forest Service workers in the Blue Mountains. It includes a summary of aspen biology and occurrence in the Blue Mountains, and a...

  19. Alcian blue-stained particles in a eutrophic lake

    DEFF Research Database (Denmark)

    Worm, J.; Søndergaard, Morten

    1998-01-01

    We used a neutral solution of Alcian Blue to stain transparent particles in eutrophic Lake Frederiksborg Slotss0, Denmark. Alcian Blue-stained particles (ABSP) appeared to be similar to the so-called transparent exopolymer particles (TEP) identified with an acidic solution of Alcian Blue. Our...

  20. Blue whales Balaenoptera musculus off Angola: recent sightings ...

    African Journals Online (AJOL)

    Further survey work is required to better clarify the status of blue whales in Angolan waters, particularly with regard to population structure and potential calving grounds. Keywords: Antarctic blue whale, calving, catch data, pygmy blue whale, South-East Atlantic, stomach contents. African Journal of Marine Science 2014, ...

  1. Blue light phototherapy for Psoriasis from a systems biology perspective

    NARCIS (Netherlands)

    Félix Garza, Z.C.; Liebmann, J.; Hilbers, P.A.J.; Riel, van N.A.W.

    2014-01-01

    This work analyses the effect of UV-free blue light (BL) irradiation of the skin using mathematical modelling. Prior research has shown that blue light reduces the proliferation of keratinocytes by inducing their differentiation, and causes apoptosis of lymphocytes. The effects of blue light on

  2. FIXED-BED COLUMN ADSORPTION OF METHYL BLUE USING ...

    African Journals Online (AJOL)

    userpc

    Axle Wood Carbon (AWC) was used to study the removal of Methyl Blue (MB) from ... height, initial methyl blue (MB) concentration, .... colour from blue to dark purple- .... Environ. Earth Sci. 13; 1–13. Yagub, M. T., Sen, T. K., Afroze, S., and Ang,.

  3. Poporodní blues – česká adaptace dotazníku „Maternity blues questionnaire“

    Czech Academy of Sciences Publication Activity Database

    Takács, L.; Smolík, Filip; Mlíková Seidlerová, J.; Čepický, P.; Hoskovcová, S.

    2016-01-01

    Roč. 81, č. 5 (2016), s. 355-368 ISSN 1210-7832 Institutional support: RVO:68081740 Keywords : EPDS postpartum mood * Maternity Blues Questionnaire * postnatal depression * postpartum blues * postpartum depression Subject RIV: AN - Psychology

  4. Inventory transparency for agricultural produce through IOT

    Science.gov (United States)

    Srinivasan, S. P.; Sorna Shanthi, D.; Anand, Aashish V.

    2017-06-01

    Re-structuring the practices of traditional inventory management is becoming more essential to optimize the supply chain transparency and accuracy of agricultural produce. A flexible and transparent inventory management system is becoming the need of any agricultural commodity. It was noticed that the major setback for the farmers who are the suppliers of the farm produce is due to poor supply chain integration. The recent advent technologies and IT explosion can bring up a greater impact in the process of storing, tracking, distributing and monitoring perishable agriculture produce of day to day life. The primary focus of this paper is to integrate IoT into inventory management and other inbound logistics management of agriculture produce. The unique features of agricultural produce like a prediction of supply, demand, the location of warehouses, distribution and tracking of inventory can be integrated through IoT. This paper proposes a conceptual framework for inventory management transparency involved in the supply chain of agriculture produce.

  5. Double shell tanks plutonium inventory assessment

    International Nuclear Information System (INIS)

    Tusler, L.A.

    1995-01-01

    This report provides an evaluation that establishes plutonium inventory estimates for all DSTs based on known tank history information, the DST plutonium inventory tracking system, tank characterization measurements, tank transfer records, and estimated average concentration values for the various types of waste. These estimates use data through December 31, 1994, and give plutonium estimates as of January 1, 1995. The plutonium inventory values for the DSTs are given in Section 31. The plutonium inventory estimate is 224 kg for the DSTs and 854 kg for the SSTs for a total of 1078 kg. This value compares favorably with the total plutonium inventory value of 981 kg obtained from the total plutonium production minus plutonium recovery analysis estimates

  6. SISTEM INVENTORI BARANG DENGAN TEKNOLOGI AJAX

    Directory of Open Access Journals (Sweden)

    Anna Fitriya

    2015-11-01

    Full Text Available ABSTRAK Sistem inventori barang pada pertokoan telah banyak dikembangkan untuk meningkatkan efektivitas dan efisiensi. Pada Toko Karya Indah, kegiatan yang berkaitan dengan inventori barang masih dilakukan secara manual sehingga pihak toko kesulitan untuk mengetahui data barang yang masih tersedia, habis, atau hampir habis. Selain itu, proses yang dilakukan membutuhkan waktu yang relatif lama. Oleh karena itu, diperlukan sistem inventori barang. Sistem dibangun dengan bahasa pemrograman PHP dan database MySQL. Sistem disertai teknologi AJAX (Asynchronous JavaScript And XML, khususnya AJAX autocomplete dan AJAX validasi. Hasil yang diperoleh adalah pengolahan data pada sistem inventori barang dengan menggunakan AJAX dapat dilakukan dengan lebih cepat dari pada tanpa AJAX. Kata kunci: sistem inventori, AJAX.

  7. Inventory Data Package for Hanford Assessments

    Energy Technology Data Exchange (ETDEWEB)

    Kincaid, Charles T.; Eslinger, Paul W.; Aaberg, Rosanne L.; Miley, Terri B.; Nelson, Iral C.; Strenge, Dennis L.; Evans, John C.

    2006-06-01

    This document presents the basis for a compilation of inventory for radioactive contaminants of interest by year for all potentially impactive waste sites on the Hanford Site for which inventory data exist in records or could be reasonably estimated. This document also includes discussions of the historical, current, and reasonably foreseeable (1944 to 2070) future radioactive waste and waste sites; the inventories of radionuclides that may have a potential for environmental impacts; a description of the method(s) for estimating inventories where records are inadequate; a description of the screening method(s) used to select those sites and contaminants that might make a substantial contribution to impacts; a listing of the remedial actions and their completion dates for waste sites; and tables showing the best estimate inventories available for Hanford assessments.

  8. Optimal Control Inventory Stochastic With Production Deteriorating

    Science.gov (United States)

    Affandi, Pardi

    2018-01-01

    In this paper, we are using optimal control approach to determine the optimal rate in production. Most of the inventory production models deal with a single item. First build the mathematical models inventory stochastic, in this model we also assume that the items are in the same store. The mathematical model of the problem inventory can be deterministic and stochastic models. In this research will be discussed how to model the stochastic as well as how to solve the inventory model using optimal control techniques. The main tool in the study problems for the necessary optimality conditions in the form of the Pontryagin maximum principle involves the Hamilton function. So we can have the optimal production rate in a production inventory system where items are subject deterioration.

  9. Activity based costing model for inventory valuation

    Directory of Open Access Journals (Sweden)

    Vineet Chouhan

    2017-03-01

    Full Text Available Activity-Based-Model (ABC is used for the purpose of significant improvement for overhead accounting systems by providing the best information required for managerial decision. This pa-per discusses implacability of ABC technique on inventory valuation as a management account-ing innovation. In order to prove the applicability of ABC for inventory control a material driven medium-sized and privately owned company from engineering (iron and steel industry is select-ed and by analysis of its production process and its material dependency and use of indirect in-ventory, an ABC model is explored for better inventory control. The case revealed that the ne-cessity of ABC in the area of inventory control is significant. The company is not only able to increase its quality of decision but also it can significantly analyze its cost of direct material cost, valuation of direct material and use its implications for better decision making.

  10. Change in avian abundance predicted from regional forest inventory data

    Science.gov (United States)

    Twedt, Daniel J.; Tirpak, John M.; Jones-Farrand, D. Todd; Thompson, Frank R.; Uihlein, William B.; Fitzgerald, Jane A.

    2010-01-01

    An inability to predict population response to future habitat projections is a shortcoming in bird conservation planning. We sought to predict avian response to projections of future forest conditions that were developed from nationwide forest surveys within the Forest Inventory and Analysis (FIA) program. To accomplish this, we evaluated the historical relationship between silvicolous bird populations and FIA-derived forest conditions within 25 ecoregions that comprise the southeastern United States. We aggregated forest area by forest ownership, forest type, and tree size-class categories in county-based ecoregions for 5 time periods spanning 1963-2008. We assessed the relationship of forest data with contemporaneous indices of abundance for 24 silvicolous bird species that were obtained from Breeding Bird Surveys. Relationships between bird abundance and forest inventory data for 18 species were deemed sufficient as predictive models. We used these empirically derived relationships between regional forest conditions and bird populations to predict relative changes in abundance of these species within ecoregions that are anticipated to coincide with projected changes in forest variables through 2040. Predicted abundances of these 18 species are expected to remain relatively stable in over a quarter (27%) of the ecoregions. However, change in forest area and redistribution of forest types will likely result in changed abundance of some species within many ecosystems. For example, abundances of 11 species, including pine warbler (Dendroica pinus), brown-headed nuthatch (Sitta pusilla), and chuckwills- widow (Caprimulgus carolinensis), are projected to increase within more ecoregions than ecoregions where they will decrease. For 6 other species, such as blue-winged warbler (Vermivora pinus), Carolina wren (Thryothorus ludovicianus), and indigo bunting (Passerina cyanea), we projected abundances will decrease within more ecoregions than ecoregions where they will

  11. Blue green component and integrated urban design

    Directory of Open Access Journals (Sweden)

    Stanković Srđan M.

    2016-01-01

    Full Text Available This paper aims to demonstrate the hidden potential of blue green components, in a synergetic network, not as separate systems, like used in past. The innovative methodology of the project Blue Green Dream is presented through examples of good practice. A new approach in the project initiate thoughtful planning and remodeling of the settlement for the modern man. Professional and scientific public is looking for way to create more healthy and stimulating place for living. However, offered integrative solutions still remain out of urban and architectural practice. Tested technologies in current projects confirmed measurability of innovative approaches and lessons learned. Scientific and professional contributions are summarized in master's and doctoral theses that have been completed or are in process of writing.

  12. BD+43° 3654 - a blue straggler?

    Science.gov (United States)

    Gvaramadze, V. V.; Bomans, D. J.

    2008-07-01

    The astrometric data on the runaway star BD+43° 3654 are consistent with the origin of this O4If star in the center of the Cyg OB2 association, while BD+43° 3654 is younger than the association. To reconcile this discrepancy, we suggest that BD+43° 3654 is a blue straggler formed via a close encounter between two tight massive binaries in the core of Cyg OB2. A possible implication of this suggestion is that the very massive (and therefore apparently very young) stars in Cyg OB2 could be blue stragglers as well. We also suggest that the binary-binary encounter producing BD+43° 3654 might be responsible for ejection of two high-velocity stars (the stripped helium cores of massive stars) - the progenitors of the pulsars B2020+28 and B2021+51.

  13. Measuring Blue Space Visibility and 'Blue Recreation' in the Everyday Lives of Children in a Capital City.

    Science.gov (United States)

    Pearson, Amber L; Bottomley, Ross; Chambers, Tim; Thornton, Lukar; Stanley, James; Smith, Moira; Barr, Michelle; Signal, Louise

    2017-05-26

    Blue spaces (water bodies) may promote positive mental and physical health through opportunities for relaxation, recreation, and social connections. However, we know little about the nature and extent of everyday exposure to blue spaces, particularly in settings outside the home or among children, nor whether exposure varies by individual or household characteristics. Wearable cameras offer a novel, reliable method for blue space exposure measurement. In this study, we used images from cameras worn over two days by 166 children in Wellington, New Zealand, and conducted content and blue space quantification analysis on each image ( n = 749,389). Blue space was identified in 24,721 images (3.6%), with a total of 23 blue recreation events. Visual exposure and participation in blue recreation did not differ by ethnicity, weight status, household deprivation, or residential proximity to the coastline. Significant differences in both visual exposure to blue space and participation in blue recreation were observed, whereby children from the most deprived schools had significantly higher rates of blue space exposure than children from low deprivation schools. Schools may be important settings to promote equitable blue space exposures. Childhood exposures to blue space may not follow the expected income inequality trends observed among adults.

  14. 76 FR 22923 - Wellpoint, Inc. D/B/A/Anthem Blue Cross & Blue Shield Enterprise Provider Data Management Team...

    Science.gov (United States)

    2011-04-25

    .../B/A/Anthem Blue Cross & Blue Shield Enterprise Provider Data Management Team Including On-Site... & Blue Shield, Enterprise Provider Data Management Team, Including On-Site Leased Workers From Kelly... Of Kentucky, Enterprise Provider Data Management Team, Louisville, Kentucky TA-W-74,895B Wellpoint...

  15. Statistical thermodynamics of supercapacitors and blue engines

    OpenAIRE

    van Roij, René

    2012-01-01

    We study the thermodynamics of electrode-electrolyte systems, for instance supercapacitors filled with an ionic liquid or blue-energy devices filled with river- or sea water. By a suitable mapping of thermodynamic variables, we identify a strong analogy with classical heat engines. We introduce several Legendre transformations and Maxwell relations. We argue that one should distinguish between the differential capacity at constant ion number and at constant ion chemical potential, and derive ...

  16. Radiolysis of methylene blue studied by ESR

    International Nuclear Information System (INIS)

    Contineau, M.; Iliescu, C.; Ciureanu, M.

    1983-01-01

    Electron spin resonance spectra have been used to gain information on the mechanism of radiolysis of aqueous solutions of methylene blue. The identity and behaviour of the semiquinone radicals formed as intermediate reduction products were discussed for strongly acid and for alcaline solutions. In order to obtain information on the radiolytic mechanism in strongly acidic media, irradiation was performed in the presence of various types of scavengers: sodium formate, glucose, succinic acid, hydroquinone and D,L-α alanine. (author)

  17. FROM CIRCULAR ECONOMY TO BLUE ECONOMY

    Directory of Open Access Journals (Sweden)

    Iustin-Emanuel, ALEXANDRU

    2014-11-01

    Full Text Available Addressing the subject of this essay is based on the background ideas generated by a new branch of science - Biomimicry. According to European Commissioner for the Environment, "Nature is the perfect model of circular economy". Therefore, by imitating nature, we are witnessing a process of cycle redesign: production-consumption-recycling. The authors present some reflections on the European Commission's decision to adopt after July 1, 2014 new measures concerning the development of more circular economies. Starting from the principles of Ecolonomy, which is based on the whole living paradigm, this paper argues for the development within each economy of entrepreneurial policies related to the Blue economy. In its turn, Blue economy is based on scientific analyses that identify the best solutions in a business. Thus, formation of social capital will lead to healthier and cheaper products, which will stimulate entrepreneurship. Blue economy is another way of thinking economic practice and is a new model of business design. It is a healthy, sustainable business, designed for people. In fact, it is the core of the whole living paradigm through which, towards 2020, circular economy will grow more and more.

  18. 'Blue Whale Challenge': A Game or Crime?

    Science.gov (United States)

    Mukhra, Richa; Baryah, Neha; Krishan, Kewal; Kanchan, Tanuj

    2017-11-11

    A bewildering range of games are emerging every other day with newer elements of fun and entertainment to woo youngsters. Games are meant to reduce stress and enhance the cognitive development of children as well as adults. Teenagers are always curious to indulge in newer games; and e-gaming is one such platform providing an easy access and quicker means of entertainment. The particular game challenge which has taken the world by storm is the dangerous "Blue Whale Challenge" often involving vulnerable teenagers. The Blue Whale Challenge is neither an application nor internet based game but the users get a link through social media chat groups to enter this "deadly" challenge game. This probably is the only game where the participant has to end his/her life to complete the game. The innocent teenagers are being targeted based on their depressed psychology and are coercively isolated from their social milieux on the pretext of keeping the challenges confidential. To add to the woes, no option is offered to quit the challenge even if the contender is unable to complete the challenge. Blue Whale Challenge in its sheer form could be seen as an illegal, unethical and inhumane endeavor in our present society. The present communication discusses the severe effects of the game on teenagers, the ethical concerns involved and the preventive measures necessary to curb it.

  19. Synchrotron powder diffraction on Aztec blue pigments

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez del Rio, M. [European Synchrotron Radiation Facility, B.P. 220, Grenoble Cedex (France); Gutierrez-Leon, A.; Castro, G.R.; Rubio-Zuazo, J. [Spanish CRG Beamline at the European Synchrotron Radiation Facility, SpLine, B.P. 220, Grenoble Cedex (France); Solis, C. [Universidad Nacional Autonoma de Mexico, Instituto de Fisica, Mexico, D.F. (Mexico); Sanchez-Hernandez, R. [INAH Subdireccion de Laboratorios y Apoyo Academico, Mexico, D.F. (Mexico); Robles-Camacho, J. [INAH Centro Regional Michoacan, Morelia, Michoacan (Mexico); Rojas-Gaytan, J. [INAH Direccion de Salvamento Arqueologico, Naucalpan de Juarez (Mexico)

    2008-01-15

    Some samples of raw blue pigments coming from an archaeological rescue mission in downtown Mexico City have been characterized using different techniques. The samples, some recovered as a part of a ritual offering, could be assigned to the late Aztec period (XVth century). The striking characteristic of these samples is that they seem to be raw pigments prior to any use in artworks, and it was possible to collect a few {mu}g of pigment after manual grain selection under a microscopy monitoring. All pigments are made of indigo, an organic colorant locally known as anil or xiuhquilitl. The colorant is always found in combination with an inorganic matrix, studied by powder diffraction. In one case the mineral base is palygorskite, a rare clay mineral featuring micro-channels in its structure, well known as the main ingredient of the Maya blue pigment. However, other samples present the minerals sepiolite (a clay mineral of the palygorskite family) and calcite. Another sample contains barite, a mineral never reported in prehispanic paints. We present the results of characterization using high resolution powder diffraction recorded at the European Synchrotron Radiation Facility (BM25A, SpLine beamline) complemented with other techniques. All of them gave consistent results on the composition. A chemical test on resistance to acids was done, showing a high resistance for the palygorskite and eventually sepiolite compounds, in good agreement with the excellent resistance of the Maya blue. (orig.)

  20. Synchrotron powder diffraction on Aztec blue pigments

    Science.gov (United States)

    Sánchez Del Río, M.; Gutiérrez-León, A.; Castro, G. R.; Rubio-Zuazo, J.; Solís, C.; Sánchez-Hernández, R.; Robles-Camacho, J.; Rojas-Gaytán, J.

    2008-01-01

    Some samples of raw blue pigments coming from an archaeological rescue mission in downtown Mexico City have been characterized using different techniques. The samples, some recovered as a part of a ritual offering, could be assigned to the late Aztec period (XVth century). The striking characteristic of these samples is that they seem to be raw pigments prior to any use in artworks, and it was possible to collect a few μg of pigment after manual grain selection under a microscopy monitoring. All pigments are made of indigo, an organic colorant locally known as añil or xiuhquilitl. The colorant is always found in combination with an inorganic matrix, studied by powder diffraction. In one case the mineral base is palygorskite, a rare clay mineral featuring micro-channels in its structure, well known as the main ingredient of the Maya blue pigment. However, other samples present the minerals sepiolite (a clay mineral of the palygorskite family) and calcite. Another sample contains barite, a mineral never reported in prehispanic paints. We present the results of characterization using high resolution powder diffraction recorded at the European Synchrotron Radiation Facility (BM25A, SpLine beamline) complemented with other techniques. All of them gave consistent results on the composition. A chemical test on resistance to acids was done, showing a high resistance for the palygorskite and eventually sepiolite compounds, in good agreement with the excellent resistance of the Maya blue.

  1. Networked inventory management systems: materializing supply chain management

    NARCIS (Netherlands)

    Verwijmeren, M.A.A.P.; Vlist, van der P.; Donselaar, van K.H.

    1996-01-01

    Aims to explain the driving forces for networked inventory management. Discusses major developments with respect to customer requirements, networked organizations and networked inventory management. Presents high level specifications of networked inventory management information systems (NIMISs).

  2. 48 CFR 645.608 - Screening of contractor inventory.

    Science.gov (United States)

    2010-10-01

    ... inventory. 645.608 Section 645.608 Federal Acquisition Regulations System DEPARTMENT OF STATE CONTRACT MANAGEMENT GOVERNMENT PROPERTY Reporting, Redistribution, and Disposal of Contractor Inventory 645.608 Screening of contractor inventory. ...

  3. A single product perishing inventory model with demand interaction

    African Journals Online (AJOL)

    The paper describes a single perishing product inventory model in which ... continuous review inventory models have been studied recently by Yadavalli et al ...... stochastic inventory system with lost sales, Stochastic Analysis and Applications ...

  4. Nature's palette: the search for natural blue colorants.

    Science.gov (United States)

    Newsome, Andrew G; Culver, Catherine A; van Breemen, Richard B

    2014-07-16

    The food and beverage industry is seeking to broaden the palette of naturally derived colorants. Although considerable effort has been devoted to the search for new blue colorants in fruits and vegetables, less attention has been directed toward blue compounds from other sources such as bacteria and fungi. The current work reviews known organic blue compounds from natural plant, animal, fungal, and microbial sources. The scarcity of blue-colored metabolites in the natural world relative to metabolites of other colors is discussed, and structural trends common among natural blue compounds are identified. These compounds are grouped into seven structural classes and evaluated for their potential as new color additives.

  5. Inventory Optimization through Safety Stock Schemata

    Directory of Open Access Journals (Sweden)

    Abdul Aleem

    2013-04-01

    Full Text Available In the complex business environment and stiff competition, inventory optimization in an industry's supply chain has gained tremendous significance. It has become business imperative to optimally tune the supply chain and save lot of working capital by reducing inventory levels; this can surely be done while increasing the customer service level and utilizing the internal capacities optimally. Stock out costs and stock surplus costs both impact businesses badly, the former in the form of opportunity loss and resultantly causing customer annoyance and later in high financial markups and increasing cost and reducing margins accordingly. So inventory optimization can essentially help to reduce costs, which results in a considerable improvement of the company performance indicators. Traditional IMS (Inventory Management System followed in a selected manufacturing industry has been examined for all types of inventories, i.e. raw materials; WIP (Work In Process, and finished goods as a case study. The paper suggests an optimized inventory model for an organization to provide the best possible customer service within the restraint of the lowest practical inventory costs. The safety stock optimization was implemented in a complex business environment and considerable savings were realized thereof

  6. Concepts for inventory verification in critical facilities

    International Nuclear Information System (INIS)

    Cobb, D.D.; Sapir, J.L.; Kern, E.A.; Dietz, R.J.

    1978-12-01

    Materials measurement and inventory verification concepts for safeguarding large critical facilities are presented. Inspection strategies and methods for applying international safeguards to such facilities are proposed. The conceptual approach to routine inventory verification includes frequent visits to the facility by one inspector, and the use of seals and nondestructive assay (NDA) measurements to verify the portion of the inventory maintained in vault storage. Periodic verification of the reactor inventory is accomplished by sampling and NDA measurement of in-core fuel elements combined with measurements of integral reactivity and related reactor parameters that are sensitive to the total fissile inventory. A combination of statistical sampling and NDA verification with measurements of reactor parameters is more effective than either technique used by itself. Special procedures for assessment and verification for abnormal safeguards conditions are also considered. When the inspection strategies and inventory verification methods are combined with strict containment and surveillance methods, they provide a high degree of assurance that any clandestine attempt to divert a significant quantity of fissile material from a critical facility inventory will be detected. Field testing of specific hardware systems and procedures to determine their sensitivity, reliability, and operational acceptability is recommended. 50 figures, 21 tables

  7. National Coal Quality Inventory (NACQI)

    Energy Technology Data Exchange (ETDEWEB)

    Robert Finkelman

    2005-09-30

    The U.S. Geological Survey (USGS) conducted the National Coal Quality Inventory (NaCQI) between 1999 and 2005 to address a need for quality information on coals that will be mined during the next 20-30 years. Collaboration between the USGS, State geological surveys, universities, coal burning utilities, and the coal mining industry plus funding support from the Electric Power Research Institute (EPRI) and the U.S. Department of Energy (DOE) permitted collection and submittal of coal samples for analysis. The chemical data (proximate and ultimate analyses; major, minor and trace element concentrations) for 729 samples of raw or prepared coal, coal associated shale, and coal combustion products (fly ash, hopper ash, bottom ash and gypsum) from nine coal producing States are included. In addition, the project identified a new coal reference analytical standard, to be designated CWE-1 (West Elk Mine, Gunnison County, Colorado) that is a high-volatile-B or high-volatile-A bituminous coal with low contents of ash yield and sulfur, and very low, but detectable contents of chlorine, mercury and other trace elements.

  8. Inventory in a Brazilian Sample

    Directory of Open Access Journals (Sweden)

    Taciano L. Milfont

    2008-01-01

    Full Text Available Éste artículo evalúa la validez de constructo y la validez discriminante del Inventario de Perspectiva Temporal de Zimbardo (Zimbardo Time Perspective Inventory, ZTPI de una muestra de 247 estudiantes brasileños. La estructura de cinco-factores de ZTPI, definidos por Pasado-Negativo, Presente-Hedonístico, Futuro, Pasado- Positivo y Presente-Fatalista, provee un ajuste aceptable de los datos, y pareció ser mejor estadísticamente que el ajuste de los modelos alternativos. El Presente-Hedonístico fue positivamente correlacionado con el consumo de alcohol y negativamente con la religiosidad, el Futuro fue correlacionado positivamente con la preocupación por la salud y negativamente con el consumo de alcohol, y el Pasado-Positivo fue positivamente correlacionado con el uso del reloj. Los resultados encontrados concuerdan con los estudios anteriores, indicando que las cinco dimensiones de perspectiva del tiempo pueden ser identificadas cognitivamente. Además los patrones de correlación con otras variables son comparables a través de otras culturas.

  9. Jagua blue derived from Genipa americana L. fruit: A natural alternative to commonly used blue food colorants?

    Science.gov (United States)

    Brauch, J E; Zapata-Porras, S P; Buchweitz, M; Aschoff, J K; Carle, R

    2016-11-01

    Due to consumers' increasing health awareness, food industry aims at replacing synthetic dyes by natural counterparts. The substitution of blue synthetic dyes is particularly challenging since current natural alternatives such as phycocyanin (Spirulina) suffer from poor stability. Jagua blue (produced from Genipa americana L. fruit) might represent a potential novel blue pigment source. However, only little is known about its color properties, and application in food systems. Therefore, the blue color and the stability of Jagua blue were assessed for the first time and compared to commonly used colorants, namely, Spirulina, brilliant blue FCF (Blue no. 1), and indigo carmine (Blue no. 2). The reaction rate of Jagua blue was independent of its concentration, confirming thermal degradation to follow first-order kinetics. Between pH 3.6 and 5.0, the color hue of Jagua blue solutions was similar to that of Blue no. 2. However, Jagua blue revealed markedly higher storage stabilities (t 1/2 =86-105days) than Blue no. 2 (t 1 /2 ≤9days) and was less susceptible to acidic pH of 3.6 (t 1 /2 =86days) than Spirulina (t 1 /2 =70days). High negative b* values (blueness) of colored gelatin gels were only obtained for Jagua blue and Spirulina, and the former exhibited higher light stabilities (t 1 /2 =15days) than Spirulina gels (t 1 /2 =4days). Our findings indicate Jagua blue to be a most promising alternative to synthetic dyes, providing relevant information regarding potential food applications. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Blue-Green Solutions in Urban Development

    Science.gov (United States)

    Karlsson, Caroline; Kalantari, Zahra

    2017-04-01

    With the ongoing urbanisation and increasing pressure for new housing and infrastructure, the nexus of developing compact, energy-efficient and yet liveable and sustainable cities is urgent to address. In this context, blue-green spaces and related ecosystem services (ES) are critical resources that need to be integrated in policy and planning of urban. Among the ES provided by blue-green spaces, regulating ES such as water retention and purification are particularly important in urban areas, affecting water supply and quality, related cultural ES and biodiversity, as well as cities potential to adapt to climate change. Blue-green infrastructure management is considered a sustainable way to reducing negative effects of urbanisation, such as decreasing flood risks, as well as adapting to climate change for example by controlling increasing flood and drought risks. Blue-green infrastructure management can for example create multifunctional surfaces with valuable environmental and social functions and generally handle greenways and ecological networks as important ecosystem service components, for example for stormwater regulation in a sustainable urban drainage system. The Norrström drainage basin (22,000 km2) is a large demonstrator for Blue-green infrastructure management. Both urbanisation and agriculture are extensive within this basin, which includes the Swedish capital Stockholm and is part of the fertile Swedish belt. Together, the relatively high population density combined with agricultural and industrial activities in this region imply large eutrophication and pollution pressures, not least transferred through storm runoff to both inland surface waters and the coastal waters of the Baltic Sea. The ecosystems of this basin provide highly valued but also threatened services. For example, Lake Mälaren is the single main freshwater supply for the Swedish capital Stockholm, as well as a key nutrient retention system that strongly mitigates waterborne nutrient

  11. Danish emission inventory for agriculture. Inventories 1985 - 2009

    Energy Technology Data Exchange (ETDEWEB)

    Hjorth Mikkelsen, M; Albrektsen, R; Gyldenkaerne, S

    2011-02-15

    By regulations given in international conventions Denmark is obliged to work out an annual emission inventory and document the methodology. The National Environmental Research Institute (NERI) at Aarhus University (AU) in Denmark is responsible for calculating and reporting the emissions. This report contains a description of the emissions from the agricultural sector from 1985 to 2009. Furthermore, the report includes a detailed description of methods and data used to calculate the emissions, which is based on national methodologies as well as international guidelines. For the Danish emissions calculations and data management an Integrated Database model for Agricultural emissions (IDA) is used. The emission from the agricultural sector includes emission of the greenhouse gases methane (CH{sub 4}), nitrous oxide (N{sub 2}O), ammonia (NH{sub 3}), particulate matter (PM), non-methane volatile organic compounds (NMVOC) and other pollutants related to the field burning of agricultural residue such as NO{sub x}, CO{sub 2}, CO, SO{sub 2}, heavy metals, dioxin and PAH. The ammonia emission from 1985 to 2009 has decreased from 119 300 tonnes of NH{sub 3} to 73 800 tonnes NH{sub 3}, corresponding to a 38 % reduction. The emission of greenhouse gases has decreased by 25 % from 12.9 M tonnes CO{sub 2} equivalents to 9.6 M tonnes CO{sub 2} equivalents from 1985 to 2009. Improvements in feed efficiency and utilisation of nitrogen in livestock manure are the most important reasons for the reduction of both the ammonia and greenhouse gas emissions. (Author)

  12. 76 FR 5431 - Publication of FY 2010 Service Contract Inventory

    Science.gov (United States)

    2011-01-31

    ... DEPARTMENT OF THE TREASURY Publication of FY 2010 Service Contract Inventory AGENCY: Departmental Offices, Treasury. ACTION: Notice of publication of Fiscal Year 2010 Service Contract Inventory. [[Page 5432

  13. Strategic Inventory Positioning of Navy Depot Level Repairable

    National Research Council Canada - National Science Library

    Burton, Larry

    2005-01-01

    ... the benefits in modifying their current inventory positioning policy for repairable items. NAVICP wishes to incorporate a strategic inventory positioning policy that reduces transportation costs...

  14. Effective inventory management for nuclear power plants

    International Nuclear Information System (INIS)

    MacFarlane, I.S.

    1985-01-01

    Effective inventory management plays a major role at nuclear power plants toward achieving a high level of availability in a cost-effective manner. It enables maintenance personnel to obtain the correct parts easily, when needed, and in satisfactory condition to perform as intended. In addition, appropriate controls and documentation ensure parts are being used in the correct equipment application. The following elements of inventory management will help achieve plant availability goals: (1) appropriate inventory levels, (2) preapproved procurement requirements, (3) storage maintenance, (4) documentation of parts, and (5) control of computer data base

  15. Accounting concept of inventories in postindustrial economy

    Directory of Open Access Journals (Sweden)

    Pravdyuk N.L.

    2017-06-01

    Full Text Available The accounting of inventories has undergone significant changes over a relatively short period of time. It has changed the scientific picture of their definition and classification, measurement and write-offs reflected in the financial statements. However, these changes happen without proper interpretation and system analysis. And, at least in general terms the inventories are conducted in Ukraine according to IFRS; this causes some obstacles to the objective reflection of working capital of enterprises, and the transparency of disclosure and is not conducive to the formation of a proper investment climate. It is established that the information provision inventory control must meet the requirements of the postindustrial economy by the complicating and deepening the complexity of accounting, the introduction of new forms and their synthesis with the current one, a gradual reorganization to ensure the needs of consumers and enterprise evaluation. The results of the study have substantiated the fundamentals of accounting concepts in the postindustrial economy in the part of the circulating capital, which forms inventories. The information support of inventory management should be implemented in a hierarchical way, when it first and foremost analyzes the working capital, and further deals with inventories and stocks as its subordinate components. The author considers the material goods to be a broader concept than reserves, because they have a dual nature both estimated as the share of negotiable assets, and as the physical component of material costs. The paper gives the definition of this category of symbiosis, which is based on P(CBU 9. The general structure of the current inventories are of significant importance, which has differences in industries, the dominant of which is agriculture, industry, construction, trade, material production. The postindustrial economy caused the questions of differentiation of concepts "production" and "material

  16. The nuclide inventory in SFR-1

    International Nuclear Information System (INIS)

    Ingemansson, Tor

    2001-10-01

    This report is an account for a project carried out on behalf of the Swedish Radiation Protection Authority (SSI): 'Nuclide inventory in SFR-1' (The Swedish underground disposal facility for low and intermediate level reactor waste). The project comprises the following five sub-projects: 1) Measuring methods for nuclides, difficult to measure, 2) The nuclide inventory in SFR-1, 3) Proposal for nuclide library for SFR-1 and ground disposal, 4) Nuclide library for exemption, and 5) Characterising of the nuclide inventory and documentation for SFL waste. In all five sub-projects long-lived activity, including Cl-36, has been considered

  17. Raman analysis of cobalt blue pigment in blue and white porcelain: A reassessment

    Science.gov (United States)

    Jiang, Xiaochenyang; Ma, Yanying; Chen, Yue; Li, Yuanqiu; Ma, Qinglin; Zhang, Zhaoxia; Wang, Changsui; Yang, Yimin

    2018-02-01

    Cobalt blue is a famous pigment in human history. In the past decade it is widely reported that the cobalt aluminate has been detected in ancient ceramics as blue colorant in glaze, yet the acquired Raman spectra are incredibly different from that of synthesised references, necessitating a reassessment of such contradictory scenario with more accurate analytic strategies. In this study, micro-Raman spectroscopy (MRS) and scanning electron microscopy (SEM) in association with energy dispersive spectrometry (EDS) were performed on under-glaze cobalt pigments from one submerged blue and white porcelain shard dated from Wanli reign (1573-1620 CE) of Ming dynasty (1365-1644 CE) excavated at Nan'ao I shipwreck off the southern coast of China. The micro-structural inspection reveals that the pigment particles have characteristics of small account, tiny size, heterogeneously distribution, and more importantly, been completely enwrapped by well-developed anorthite crystals in the glaze, indicating that the signals recorded in previous publications are probably not from cobalt pigments themselves but from outside thickset anorthite shell. The further spectromicroscopic analyses confirm this presumption when the accurate spectra of cobalt aluminate pigment and surrounding anorthite were obtained separately with precise optical positioning. Accordingly, we reassess and clarify the previous Raman studies dedicated to cobalt blue pigment in ancient ceramics, e.g. cobalt blue in celadon glaze, and in turn demonstrate the superiority and necessity of coupling spectroscopic analysis with corresponding structure observation, especially in the characterization of pigments from complicated physico-chemical environment like antiquities. Thus, this study promotes a better understanding of Raman spectroscopy study of cobalt blue pigments in art and archaeology field.

  18. Austrian emission inventory for dust

    International Nuclear Information System (INIS)

    Winiwarter, W.; Trenker, C.; Hoeflinger, W.

    2001-09-01

    For the first time, Austrian emissions of anthropogenic particulate matter emissions to the atmosphere have been estimated. Results have been reported as total suspended particles (TSP) as well as for the fractions of particles smaller than 10 μm or 2.5 μm aerodynamic diameter (PM 10 , PM 2.5 ), respectively. Base years for the inventory were 1990, 1995 and 1999. Excluded from this assessment is wind blown dust, which has been considered a natural source here. National statistics have been applied, specifically those also used previously in the Austrian air pollution inventory (OLI). Emission factors have been taken from literature compilations, only for exceptional cases specific Austrian assessments were performed or original literature on emission measurements was consulted. Resuspension of dust by road traffic emerged as the most important source. For the size fraction of PM 10 this source contributed about half of the emissions, when applying the calculation scheme by the U.S. EPA. While this scheme is widely used and well documented, its validity is currently subject of intense scientific debate. As these results do not seem to coincide with ambient air measurements, resuspension of road dust is considered separately and not now included in the national total. The sum of all other sources increases from 75,000 t of TSP in 1990 and 1995 to 77,000 t in 1999, while both PM 10 and PM 2.5 exhibit decreasing tendency (at 45,000 t and 26,000 t in 1999, respectively). The increase in TSP derives from increasing traffic and friction related emissions (tire wear, break wear), decrease of the finer particulate matter is due to reductions in firewood consumption for domestic heating. Most important source sectors are fugitive emissions from material transfer in industry as well as the building industry and the tilling of agricultural land. Common to these sources is the high uncertainty of available data. Wood combustion is the most important of the non

  19. Industrial processes inventory. Sector 2

    International Nuclear Information System (INIS)

    1994-01-01

    The work objective is to conduct a greenhouse gas emission inventory of the industrial processes in Lebanon for the year 1994. The Lebanese industry has emitted 1924.063 Gg (1.924.063 tons) of Carbon dioxide CO 2 ; 0.0003 Gg (0.3 tons) of carbon monoxide CO; 0.01112 Gg of nitrogen oxide NO; 273.888 tons of non-methane volatile organic compounds and 3.382 Gg (3.382 tons) of sulphur dioxide SO 2 . The cement industry is the major source of CO 2 emissions among the industrial processes in Lebanon. The cement industry is responsible for 76.1% of the total emissions followed by the iron and steel industry which produces 21.68% of the total CO 2 emissions from industrial processes. The NMVOC emissions are mainly produced by the use of asphalt for road paving (98.5% of total emissions by industry) followed by the food and beverage industry (1.2%). The emissions of sulphur dioxide SO 2 come from three industrial sources: the first come from the production of sulphuric acid (69.9% of total industrial emissions), the second from the cement industry (26.4% of total industrial emissions) and the third from the iron and steel mills (3.7% of total industrial emissions). Figures are presented to show the percentage distribution of various industrial sources contributions to CO 2 , NMVOC and SO 2 emissions in Lebanon. Carbon monoxide CO emissions in the industrial sector are very small. The major source is iron and steel mills and the minor source is asphalt-roofing production

  20. PCDD/PCDF release inventories

    Energy Technology Data Exchange (ETDEWEB)

    Fiedler, H. [UNEP Chemicals, Chatelaine (Switzerland)

    2004-09-15

    The Stockholm Convention on Persistent Organic Pollutants (POPs) entered into force on 17 May 2004 with 50 Parties. In May 2004, 59 countries had ratified or acceded the Convention. The objective of the Convention is ''to protect human health and the environment from persistent organic pollutants''. For intentionally produced POPs, e.g., pesticides and industrial chemicals such as hexachlorobenzene and polychlorinated biphenyls, this will be achieved by stop of production and use. For unintentionally generated POPs, such as polychlorinated dibenzo-pdioxins (PCDD) and polychlorinated dibenzofurans (PCDF), measures have to be taken to ''reduce the total releases derived from anthropogenic sources''; the final goal is ultimate elimination, where feasible. Under the Convention, Parties have to establish and maintain release inventories to prove the continuous release reduction. Since many countries do not have the technical and financial capacity to measure all releases from all potential PCDD/PCDF sources, UNEP Chemicals has developed the ''Standardized Toolkit for the Identification of Quantification of Dioxin and Furan Releases'' (''Toolkit'' for short), a methodology to estimate annual releases from a number of sources. With this methodology, annual releases can be estimated by multiplying process-specific default emission factors provided in the Toolkit with national activity data. At the seventh session of the Intergovernmental Negotiating Committee, the Toolkit was recommended to be used by countries when reporting national release data to the Conference of the Parties. The Toolkit is especially used by developing countries and countries with economies in transition where no measured data are available. Results from Uruguay, Thailand, Jordan, Philippines, and Brunei Darussalam have been published.

  1. Wildlife Inventory, Craig Mountain, Idaho.

    Energy Technology Data Exchange (ETDEWEB)

    Cassirer, E. Frances

    1995-06-01

    Wildlife distribution/abundance were studied at this location during 1993 and 1994 to establish the baseline as part of the wildlife mitigation agreement for construction of Dworshak reservoir. Inventory efforts were designed to (1) document distribution/abundance of 4 target species: pileated woodpecker, yellow warbler, black-capped chickadee, and river otter, (2) determine distribution/abundance of rare animals, and (3) determine presence and relative abundance of all other species except deer and elk. 201 wildlife species were observed during the survey period; most were residents or used the area seasonally for breeding or wintering. New distribution or breeding records were established for at least 6 species. Pileated woodpeckers were found at 35% of 134 survey points in upland forests; estimated densities were 0-0.08 birds/ha, averaging 0.02 birds/ha. Yellow warblers were found in riparian areas and shrubby draws below 3500 ft elev., and were most abundant in white alder plant communities (ave. est. densities 0.2-2. 1 birds/ha). Black-capped chickadees were found in riparian and mixed tall shrub vegetation at all elevations (ave. est. densities 0-0.7 birds/ha). River otters and suitable otter denning and foraging habitat were observed along the Snake and Salmon rivers. 15 special status animals (threatened, endangered, sensitive, state species of special concern) were observed at Craig Mt: 3 amphibians, 1 reptile, 8 birds, 3 mammals. Another 5 special status species potentially occur (not documented). Ecosystem-based wildlife management issues are identified. A monitoring plant is presented for assessing effects of mitigation activities.

  2. Hydro energetic inventory study from Chapecozinho river

    International Nuclear Information System (INIS)

    Pimenta, S.C.; Sureck, M.A.A.; Nascimento, P.R.; Kawasaki, M.; Silva Felipe, R. da.

    1990-01-01

    The Hydro energetic Inventory Study in Chapecozinho River Basin, Brazil is described, comparing the proposed results in 1979 with the actual review in 1989. An analysis for solution the socio-economic and environment problems is also presented. (author)

  3. Denmark's National Inventory Report 2015 and 2016

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s annual documentation report of the greenhouse gas inventory submitted to the United Nations Framework Convention on Climate Change (UNFCCC) and the Kyoto Protocol. The report is prepared in accordance with the UNFCCC reporting guidelines and CMP decisions and contains all...... the mandatory information related to the Danish greenhouse gas inventory. The report contains information on emissions of CO2, CH4, N2O, HFCs, PFCs and SF6 and removals of CO2. The report describes among other aspects the data underpinning the inventory, the methodologies to estimate emissions....../removals and the quality control procedures in place. The main sectoral chapters of the report refer to Denmark, while information on the emission inventory of Greenland and the Faroe Islands is included in Chapter 16 and Annex 7, respectively....

  4. Coal Mines, Abandoned - AML Inventory Sites 201601

    Data.gov (United States)

    NSGIC Education | GIS Inventory — This data set portrays the approximate location of Abandoned Mine Land Problem Areas containing public health, safety, and public welfare problems created by past...

  5. United States Interagency Elevation Inventory (USIEI)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The U.S. Interagency Elevation Inventory displays high-accuracy topographic and bathymetric data for the United States and its territories. The project is a...

  6. A Methodology Inventory for Composition Education.

    Science.gov (United States)

    Donlan, Dan

    1979-01-01

    Illustrates one method for describing changes in classroom behavior of composition teachers: a methodology inventory that may be used as an indicator of expertise, a needs assessment, and a summative self-evaluation. (DD)

  7. Inventory of Owned and Leased Properties (IOLP)

    Data.gov (United States)

    General Services Administration — The Inventory of Owned and Leased Properties (IOLP) allows users to search properties owned and leased by the General Services Administration (GSA) across the United...

  8. Components of Inventory Change (CINCH) Reports

    Data.gov (United States)

    Department of Housing and Urban Development — The Components of Inventory Change (CINCH) report measures changes in the characteristics of the housing stock of the United States. Using data collected from the...

  9. Toxic Release Inventory Chemicals by Groupings

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Toxics Release Inventory (TRI) makes available information for more than 600 toxic chemicals that are being used, manufactured, treated, transported, or released...

  10. Minnesota DNR Forest Stand Inventory Version 2

    Data.gov (United States)

    Minnesota Department of Natural Resources — This layer is a digital inventory of individual forest stands. The data is collected by DNR Foresters in each DNR Forestry Administrative Area, and is updated on a...

  11. Design considerations for tropical forest inventories

    Directory of Open Access Journals (Sweden)

    Ronald Edward McRoberts

    2013-06-01

    Full Text Available Forests contribute substantially to maintaining the global greenhouse gas balance, primarily because among the five economic sectors identified by the United Nations Framework Convention on Climate Change, only the forestry sector has the potential to remove greenhouse gas emissions from the atmosphere. In this context, development of national forest carbon accounting systems, particularly in countries with tropical forests, has emerged as an international priority. Because these systems are often developed as components of or in parallel with national forest inventories, a brief review of statistical issues related to the development of forest ground sampling designs is provided. This overview addresses not only the primary issues of plot configurations and sampling designs, but also to a lesser extent the emerging roles of remote sensing and uncertainty assessment. Basic inventory principles are illustrated for two case studies, the national forest inventory of Brazil with special emphasis on the state of Santa Catarina, and an inventory for Tanzania.

  12. Biota - 2009 Vegetation Inventory - Lake Ashtabula, ND

    Data.gov (United States)

    Army Corps of Engineers, Department of the Army, Department of Defense — 2009 Vegetation Classification for Lake Ashtabula, ND Vegetation Project Report, OMBIL Environmental Stewardship - Level 1 Inventory, U.S. Army Corps of Engineers...

  13. Highway-Rail Crossings Inventory Data

    Data.gov (United States)

    Department of Transportation — The entire National Highway-Rail Crossing Inventory is available in three separate downloadble files. There is a file of all current Public-at-Grade crossings. There...

  14. Historical Ambient Air Quality Data Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Historical Ambient Air Quality Data Inventory contains measured and estimated data on ambient air pollution for use in assessing air quality, assisting in...

  15. Navy Inventory Management Decision-Making

    National Research Council Canada - National Science Library

    MacDonald, Steven

    1997-01-01

    .... This thesis asserts that Navy inventory managers do not have a general tendency to overbuy items, but rather make rational purchasing decisions influenced and motivated by the environment of rewards...

  16. Mobile Source Emissions Regulatory Compliance Data Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Mobile Source Emissions Regulatory Compliance Data Inventory data asset contains measured summary compliance information on light-duty, heavy-duty, and non-road...

  17. Canada`s greenhouse gas emissions inventory

    Energy Technology Data Exchange (ETDEWEB)

    Jaques, A. [Environment Canada, Ottawa, ON (Canada)

    1998-09-01

    In 1994, Canada was the seventh largest global emitter of CO{sub 2}. The Kyoto Protocol has made it necessary to continue to improve methods for developing emissions inventories. An emissions inventory was defined as `a comprehensive account of air pollutant emissions and associated data from sources within the inventory area over a specified time frame that can be used to determine the effect of emissions on the environment`. The general approach is to compile large-scale emission estimates under averaged conditions for collective sources and sectors, using data that is available on a sectoral, provincial and national basis. Ideally, continuous emission monitors should be used to develop emissions inventories. Other needed improvements include additional research on emissions data, and increased support for international negotiations on reporting policies and related methodologies, verification procedures and adjustments. 1 ref., 5 figs.

  18. Clearinghouse for Inventories and Emissions Factors

    Science.gov (United States)

    Emissions inventories, modeling, and monitoring are the basis for understanding, controlling and tracking stationary sources of air pollution. This technical site provides access to tools and data to support those efforts.

  19. Asset management inventory and data collection.

    Science.gov (United States)

    2009-10-01

    An efficient and accurate inventory of a state highway agencys assets, along with the means to assess the condition : of those assets and model their performance, is critical to enabling an agency to make informed investment decisions : in a Trans...

  20. Allowance Holdings and Transfers Data Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Allowance Holdings and Transfers Data Inventory contains measured data on holdings and transactions of allowances under the NOx Budget Trading Program (NBP), a...

  1. Experimental validation of pulsed column inventory estimators

    International Nuclear Information System (INIS)

    Beyerlein, A.L.; Geldard, J.F.; Weh, R.; Eiben, K.; Dander, T.; Hakkila, E.A.

    1991-01-01

    Near-real-time accounting (NRTA) for reprocessing plants relies on the timely measurement of all transfers through the process area and all inventory in the process. It is difficult to measure the inventory of the solvent contractors; therefore, estimation techniques are considered. We have used experimental data obtained at the TEKO facility in Karlsruhe and have applied computer codes developed at Clemson University to analyze this data. For uranium extraction, the computer predictions agree to within 15% of the measured inventories. We believe this study is significant in demonstrating that using theoretical models with a minimum amount of process data may be an acceptable approach to column inventory estimation for NRTA. 15 refs., 7 figs

  2. Biota - 2011 Vegetation Inventory - Marsh Lake, MN

    Data.gov (United States)

    Army Corps of Engineers, Department of the Army, Department of Defense — 2011 Vegetation Classification for Marsh Lake, MN Vegetation Project Report, OMBIL Environmental Stewardship - Level 1 Inventory. Marsh Lake is located on the...

  3. MOCK OBSERVATIONS OF BLUE STRAGGLERS IN GLOBULAR CLUSTER MODELS

    International Nuclear Information System (INIS)

    Sills, Alison; Glebbeek, Evert; Chatterjee, Sourav; Rasio, Frederic A.

    2013-01-01

    We created artificial color-magnitude diagrams of Monte Carlo dynamical models of globular clusters and then used observational methods to determine the number of blue stragglers in those clusters. We compared these blue stragglers to various cluster properties, mimicking work that has been done for blue stragglers in Milky Way globular clusters to determine the dominant formation mechanism(s) of this unusual stellar population. We find that a mass-based prescription for selecting blue stragglers will select approximately twice as many blue stragglers than a selection criterion that was developed for observations of real clusters. However, the two numbers of blue stragglers are well-correlated, so either selection criterion can be used to characterize the blue straggler population of a cluster. We confirm previous results that the simplified prescription for the evolution of a collision or merger product in the BSE code overestimates their lifetimes. We show that our model blue stragglers follow similar trends with cluster properties (core mass, binary fraction, total mass, collision rate) as the true Milky Way blue stragglers as long as we restrict ourselves to model clusters with an initial binary fraction higher than 5%. We also show that, in contrast to earlier work, the number of blue stragglers in the cluster core does have a weak dependence on the collisional parameter Γ in both our models and in Milky Way globular clusters

  4. Inventory verification measurements using neutron multiplicity counting

    International Nuclear Information System (INIS)

    Ensslin, N.; Foster, L.A.; Harker, W.C.; Krick, M.S.; Langner, D.G.

    1998-01-01

    This paper describes a series of neutron multiplicity measurements of large plutonium samples at the Los Alamos Plutonium Facility. The measurements were corrected for bias caused by neutron energy spectrum shifts and nonuniform multiplication, and are compared with calorimetry/isotopics. The results show that multiplicity counting can increase measurement throughput and yield good verification results for some inventory categories. The authors provide recommendations on the future application of the technique to inventory verification

  5. Dynamic Pricing and Learning with Finite Inventories

    OpenAIRE

    Zwart, Bert; Boer, Arnoud

    2015-01-01

    We study a dynamic pricing problem with finite inventory and parametric uncertainty on the demand distribution. Products are sold during selling seasons of finite length, and inventory that is unsold at the end of a selling season, perishes. The goal of the seller is to determine a pricing strategy that maximizes the expected revenue. Inference on the unknown parameters is made by maximum likelihood estimation. We propose a pricing strategy for this problem, and show that the Regret - which i...

  6. National Inventory of Radioactive Wastes, Edition 1998

    International Nuclear Information System (INIS)

    Pallard, Bernard; Vervialle, Jean Pierre; Voizard, Patrice

    1998-01-01

    The National Radioactive Waste Inventory is an annual report of French National Agency for Radioactive Waste Management (ANDRA). The issue on 1998 has the following content: 1. General presentation; 2. Location of radioactive wastes in France; 3. Regional file catalogue; 4. Address directory; 5. Annexes. The inventory establishes the producer and owner categories, the French overseas waste sources, location of pollutant sides, spread wastes (hospitals, universities and industrial sector), railways terminals

  7. On Inventory Control For Perishable Inventory Systems Subject To Uncertainties On Customer Demands

    OpenAIRE

    Abbou , Rosa; Loiseau , Jean-Jacques; Khaldi , Hajer; Farraa , Berna ,

    2017-01-01

    International audience; This paper deals with the inventory controller design for constrained production systems subject to uncertainties on the customer demands. The case study focuses on the inventory regulation problem in production systems where contain perishable finite products. Such systems are characterized by the presence of delays due to production processes, and constraints from the instantaneous inventory level, production level and the finite capacities of stocks. To do that, we ...

  8. Technical Basis for PNNL Beryllium Inventory

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Michelle Lynn

    2014-07-09

    The Department of Energy (DOE) issued Title 10 of the Code of Federal Regulations Part 850, “Chronic Beryllium Disease Prevention Program” (the Beryllium Rule) in 1999 and required full compliance by no later than January 7, 2002. The Beryllium Rule requires the development of a baseline beryllium inventory of the locations of beryllium operations and other locations of potential beryllium contamination at DOE facilities. The baseline beryllium inventory is also required to identify workers exposed or potentially exposed to beryllium at those locations. Prior to DOE issuing 10 CFR 850, Pacific Northwest Nuclear Laboratory (PNNL) had documented the beryllium characterization and worker exposure potential for multiple facilities in compliance with DOE’s 1997 Notice 440.1, “Interim Chronic Beryllium Disease.” After DOE’s issuance of 10 CFR 850, PNNL developed an implementation plan to be compliant by 2002. In 2014, an internal self-assessment (ITS #E-00748) of PNNL’s Chronic Beryllium Disease Prevention Program (CBDPP) identified several deficiencies. One deficiency is that the technical basis for establishing the baseline beryllium inventory when the Beryllium Rule was implemented was either not documented or not retrievable. In addition, the beryllium inventory itself had not been adequately documented and maintained since PNNL established its own CBDPP, separate from Hanford Site’s program. This document reconstructs PNNL’s baseline beryllium inventory as it would have existed when it achieved compliance with the Beryllium Rule in 2001 and provides the technical basis for the baseline beryllium inventory.

  9. Blue Marble Space Institute essay contest

    Science.gov (United States)

    Wendel, JoAnna

    2014-04-01

    The Blue Marble Space Institute of Science, based in Seattle, Wash., is inviting college students to participate in its essay contest. Essays need to address the question, "In the next 100 years, how can human civilization prepare for the long-term changes to the Earth system that will occur over the coming millennium?" According to the institute, the purpose of the contest is "to stimulate creative thinking relating to space exploration and global issues by exploring how changes in the Earth system will affect humanity's future."

  10. Anomalous Cepheids and population II blue stragglers

    Science.gov (United States)

    Nemec, James M.

    Recent studies of anomalous Cepheids (ACs) and population II blue stragglers (BSs), including photometrically variable BSs (VBSs), are reviewed. The VBSs represent about 25 percent of the BSs, the majority of which are SX Phe short-period variables in the Cepheid instability strip. Mass estimates derived using various techniques suggest that both ACs and BSs are relatively massive (about 1.0-1.6 solar mass). The recent discovery that two BSs in the globular cluster NGC 5466 are contact binaries, and the earlier discovery that one of the BSs in Omega Cen is an eclipsing binary, provide direct evidence that at least some BSs are binary systems.

  11. Book Out! An Inventory Story

    Science.gov (United States)

    Panait, Claudia M.

    2004-01-01

    The NASA Glenn Library is a science and engineering research library providing the most current books, journals, CD-ROM's and documents to support the study of aeronautics, space propulsion and power, communications technology, materials and structures and microgravity science. The GRC technical library also supports the research and development efforts of all scientists and engineers on site via full text electronic files, literature searching, technical reports, etc. As an intern in the NASA Glenn Library, I attempt to support these objectives through efficiently and effectively fulfilling the assignment that was given to me. The assignment that was relegated to me was to catalog National Advisory Committee for Aeronautics, NASA Technical Documents into NASA Galaxie. This process consists of holdings being added to existing Galaxie records, upgrades and editing done to the bibliographic records when needed, adding URL's into Galaxie when they were missing from the record. NASA ASAP and Digidoc was used to locate URL's of PDF's that were not in Galaxie. A spreadsheet of documents with no URL's were maintained. Also, a subject channel of web, fill-text, paid and free, journal and other subject specific pages were developed and expanded fiom current content of intranet pages. To expand upon the second half of my assignment, I was given the project of taking inventory of the library s book collection. I kept record of the books that were not accounted for on a master list I was given to work fiom and submitted them for correction and addition. I also made sure the books were placed in the appropriate order and made corrections to any discrepancies that existed between the master list and what was on the shelf. Upon completion of this assignment, I will have verified that 21,113 books were in the correct location, order and have the correct corresponding serial number and barcode. In conclusion, as of this date I have input around 750 documents into NASA Galaxie

  12. Global monthly water scarcity: Blue water footprints versus blue water availability

    NARCIS (Netherlands)

    Hoekstra, Arjen Ysbert; Mekonnen, Mesfin; Chapagain, Ashok; Mathews, R.E.; Richter, B.D.

    2012-01-01

    Freshwater scarcity is a growing concern, placing considerable importance on the accuracy of indicators used to characterize and map water scarcity worldwide. We improve upon past efforts by using estimates of blue water footprints (consumptive use of ground- and surface water flows) rather than

  13. 48 CFR 49.602-2 - Inventory forms.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Inventory forms. 49.602-2... TERMINATION OF CONTRACTS Contract Termination Forms and Formats 49.602-2 Inventory forms. Standard Form (SF) 1428, Inventory Disposal Schedule, and SF 1429, Inventory Disposal Schedule—Continuation Sheet, shall...

  14. 10 CFR 850.20 - Baseline beryllium inventory.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Baseline beryllium inventory. 850.20 Section 850.20 Energy... Baseline beryllium inventory. (a) The responsible employer must develop a baseline inventory of the... inventory, the responsible employer must: (1) Review current and historical records; (2) Interview workers...

  15. 27 CFR 19.464 - Denatured spirits inventories.

    Science.gov (United States)

    2010-04-01

    ... of Articles Inventories § 19.464 Denatured spirits inventories. Each proprietor shall take a physical inventory of all denatured spirits in the processing account at the close of each calendar quarter and at... inventories. 19.464 Section 19.464 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE...

  16. 40 CFR 710.4 - Scope of the inventory.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Scope of the inventory. 710.4 Section... ACT TSCA CHEMICAL INVENTORY REGULATIONS General Provisions § 710.4 Scope of the inventory. (a... is extracted from air by any means, will automatically be included in the inventory under the...

  17. 27 CFR 46.203 - Record (book) inventory requirements.

    Science.gov (United States)

    2010-04-01

    ... quantities of articles actually on hand as if a physical inventory had taken place on April 1, 2009. See the... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Record (book) inventory... Cigarette Tubes Held for Sale on April 1, 2009 Inventories § 46.203 Record (book) inventory requirements. (a...

  18. Teaching Accounting for Inventory by Calling on Students' Personal Experiences

    Science.gov (United States)

    Briginshaw, John

    2010-01-01

    This essay seeks to give practical guidance to accounting instructors seeking to convey the difficult concepts of accounting for inventory. Techniques to convey the concepts of assumed inventory flow, inventory valuation under inflation and deflation, impairment of inventories, LIFO [Last In, First Out] liquidations and the concept of the periodic…

  19. 7 CFR 930.57 - Secondary inventory reserve.

    Science.gov (United States)

    2010-01-01

    ... shall retain control over the release of any cherries from the secondary inventory reserve. No cherries... 7 Agriculture 8 2010-01-01 2010-01-01 false Secondary inventory reserve. 930.57 Section 930.57... Handling Regulations § 930.57 Secondary inventory reserve. (a) In the event the inventory reserve...

  20. Grassy Silica Nanoribbons and Strong Blue Luminescence

    Science.gov (United States)

    Wang, Shengping; Xie, Shuang; Huang, Guowei; Guo, Hongxuan; Cho, Yujin; Chen, Jun; Fujita, Daisuke; Xu, Mingsheng

    2016-09-01

    Silicon dioxide (SiO2) is one of the key materials in many modern technological applications such as in metal oxide semiconductor transistors, photovoltaic solar cells, pollution removal, and biomedicine. We report the accidental discovery of free-standing grassy silica nanoribbons directly grown on SiO2/Si platform which is commonly used for field-effect transistors fabrication without other precursor. We investigate the formation mechanism of this novel silica nanostructure that has not been previously documented. The silica nanoribbons are flexible and can be manipulated by electron-beam. The silica nanoribbons exhibit strong blue emission at about 467 nm, together with UV and red emissions as investigated by cathodoluminescence technique. The origins of the luminescence are attributed to various defects in the silica nanoribbons; and the intensity change of the blue emission and green emission at about 550 nm is discussed in the frame of the defect density. Our study may lead to rational design of the new silica-based materials for a wide range of applications.

  1. High-power pure blue laser diodes

    Energy Technology Data Exchange (ETDEWEB)

    Ohta, M.; Ohizumi, Y.; Hoshina, Y.; Tanaka, T.; Yabuki, Y.; Goto, S.; Ikeda, M. [Development Center, Sony Shiroishi Semiconductor Inc., Miyagi (Japan); Funato, K. [Materials Laboratories, Sony Corporation, Kanagawa (Japan); Tomiya, S. [Materials Analysis Laboratory, Sony Corporation, Kanagawa (Japan)

    2007-06-15

    We successfully developed high-power and long-lived pure blue laser diodes (LDs) having an emission wavelength of 440-450 nm. The pure-blue LDs were grown by metalorganic chemical vapor deposition (MOCVD) on GaN substrates. The dislocation density was successfully reduced to {proportional_to}10{sup 6} cm{sup -2} by optimizing the MOCVD growth conditions and the active layer structure. The vertical layer structure was designed to have an absorption loss of 4.9 cm{sup -1} and an internal quantum efficiency of 91%. We also reduced the operating current density to 6 kA/cm{sup 2} under 750 mW continuous-wave operation at 35 C by optimizing the stripe width to 12 {mu}m and the cavity length to 2000 {mu}m. The half lifetimes in constant current mode are estimated to be longer than 10000 h. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  2. Blue emitting organic semiconductors under high pressure

    DEFF Research Database (Denmark)

    Knaapila, Matti; Guha, Suchismita

    2016-01-01

    This review describes essential optical and emerging structural experiments that use high GPa range hydrostatic pressure to probe physical phenomena in blue-emitting organic semiconductors including π-conjugated polyfluorene and related compounds. The work emphasizes molecular structure and inter......This review describes essential optical and emerging structural experiments that use high GPa range hydrostatic pressure to probe physical phenomena in blue-emitting organic semiconductors including π-conjugated polyfluorene and related compounds. The work emphasizes molecular structure...... and intermolecular self-organization that typically determine transport and optical emission in π-conjugated oligomers and polymers. In this context, hydrostatic pressure through diamond anvil cells has proven to be an elegant tool to control structure and interactions without chemical intervention. This has been...... and intermolecular interactions on optical excitations, electron–phonon interaction, and changes in backbone conformations. This picture is connected to the optical high pressure studies of other π-conjugated systems and emerging x-ray scattering experiments from polyfluorenes which provides a structure-property map...

  3. Kinetics and mechanism of Prussian blue formation

    Directory of Open Access Journals (Sweden)

    R.K. Adhikamsetty

    2009-04-01

    Full Text Available The kinetics of reaction between ferrocyanide and ferric ions under acidic conditions was studied at fixed ionic strength (0.1 M and (25 plus or minus 0.1 oC by using the stopped flow technique, under limiting conditions of [ferrocyanide] and with other reactants in excess. The reaction had first-order dependence on ferrocyanide, Fe(III and H+ ion concentrations and had negative salt effect. On the basis of the experimental findings, a plausible mechanism for the formation of soluble form of Prussian blue (KFe{Fe(CN6}x H2O and rate law are proposed. The activation parameters for the title reaction are estimated. A relatively low energy of activation (23 kJ mol-1 and high negative entropy of activation (-231 J K-1 mol-1 agree well with the proposed mechanism and configuration of complex ion leading to the formation of insoluble Prussian blue, Fe4{Fe(CN6}3 y H2O.

  4. Physical properties of natural blue Brazilian sodalite

    International Nuclear Information System (INIS)

    Pizani, P.S.

    1983-01-01

    The aim of this work is the study of some physical properties of natural blue Brazilian sodalite (Itabuna, BA), whose ideal formula is Na 8 Al6Si 6 O 24 Cl 2 . For this purpose, we made use of electron paramagnetic resonance, nuclear magnetic resonance, ionic thermocurrent, optical absorption and electrical conductivity technics in natural, bleached and irradiated samples. We have detected three paramagnetic centers: a) an isotropic line with g = 2.011, related to the blue color of natural samples, that is, with the optical absorption bands at 600 nm and 645 nm; b) a set of thirteen lines of hyperfine interaction with g = 2.001 and A = 3.5 gauss, related to an electric dipole center responsible for two bands of dielectric relaxation at 19.9 0 K and 49.3 0 K, with activation energy of 30 MeV and 121 MeV, respectively; c) we have also detected an F center with a EPR spectrum composed of thirteen isotropic lines of hyperfine interaction with g = 2.001 and A= 32.5 gauss, related to the pink color. (Author) [pt

  5. DNA Electrochemistry with Tethered Methylene Blue

    Science.gov (United States)

    Pheeney, Catrina G.

    2012-01-01

    Methylene blue (MB′), covalently attached to DNA through a flexible C12 alkyl linker, provides a sensitive redox reporter in DNA electrochemistry measurements. Tethered, intercalated MB′ is reduced through DNA-mediated charge transport; the incorporation of a single base mismatch at position 3, 10, or 14 of a 17-mer causes an attenuation of the signal to 62 ± 3% of the well-matched DNA, irrespective of position in the duplex. The redox signal intensity for MB′–DNA is found to be least 3-fold larger than that of Nile blue (NB)–DNA, indicating that MB′ is even more strongly coupled to the π-stack. The signal attenuation due to an intervening mismatch does, however, depend on DNA film density and the backfilling agent used to passivate the surface. These results highlight two mechanisms for reduction of MB′ on the DNA-modified electrode: reduction mediated by the DNA base pair stack and direct surface reduction of MB′ at the electrode. These two mechanisms are distinguished by their rates of electron transfer that differ by 20-fold. The extent of direct reduction at the surface can be controlled by assembly and buffer conditions. PMID:22512327

  6. A Survey of Blue-Noise Sampling and Its Applications

    KAUST Repository

    Yan, Dongming

    2015-05-05

    In this paper, we survey recent approaches to blue-noise sampling and discuss their beneficial applications. We discuss the sampling algorithms that use points as sampling primitives and classify the sampling algorithms based on various aspects, e.g., the sampling domain and the type of algorithm. We demonstrate several well-known applications that can be improved by recent blue-noise sampling techniques, as well as some new applications such as dynamic sampling and blue-noise remeshing.

  7. Blue Pseudoazulene-Skeleton Pigments of Natural Origin

    OpenAIRE

    井上, 謙一郎; イノウエ, ケンイチロウ; KENICHIRO, INOUE

    1993-01-01

    Genipin, an iridoid constituent of Genipa americana, readily reacts with amino acids in the presence of oxygen to give a mixture of polymeric blue pigments whose structures are not determined. In the basic studies to elucidate the structure and formation mechnism of blue pigments, the reaction of genipin with methylamine in the absence of oxygen yielded 9 red compounds leading to blue pigments. In this article, the structures and spectroscopic properties of these red compounds were described....

  8. A Survey of Blue-Noise Sampling and Its Applications

    KAUST Repository

    Yan, Dongming; Guo, Jian-Wei; Wang, Bin; Zhang, Xiao-Peng; Wonka, Peter

    2015-01-01

    In this paper, we survey recent approaches to blue-noise sampling and discuss their beneficial applications. We discuss the sampling algorithms that use points as sampling primitives and classify the sampling algorithms based on various aspects, e.g., the sampling domain and the type of algorithm. We demonstrate several well-known applications that can be improved by recent blue-noise sampling techniques, as well as some new applications such as dynamic sampling and blue-noise remeshing.

  9. Service design as an approach for recognizing blue ocean

    OpenAIRE

    Koskelo, Minna

    2013-01-01

    This thesis aims to show that service design as an approach can be utilized for discovering new market space, referred as blue ocean and new business opportunities, and thus to show that service design can be seen as an approach for bringing the new logic for value creation into strategic level. From the field of strategic management the theory of blue ocean strategy was chosen for presenting the strategic outcome and further since there are similarities be-tween blue ocean strategy approach ...

  10. Liquid crystal blue phases: stability, field effects and alignment

    OpenAIRE

    Gleeson, HF; Miller, RJ; Tian, L; Görtz, V; Goodby, JW

    2015-01-01

    The blue phases are fascinating structures in liquid crystals, fluids that exhibit cubic structures that have true crystalline order. The blue phases were discovered in the 1970s and were the subject of extensive research in the 1980s, when a deep understanding of many of their properties was established. The discovery that the blue phases could be stabilised to exist over wide temperature ranges meant that they became more than scientific curiosities and led to a recent resurgence in researc...

  11. Manajemen Strategi Pengembangan Pariwisata dengan Pendekatan Blue Ocean Strategy

    OpenAIRE

    Muzha, Vianda Kushardianti

    2015-01-01

    Persaingan industri pariwisata di Indonesia saat ini sangatlah ketat, setiap daerah berlomba untuk menonjolkan keunikannya tersendiri. Dengan adanya persaingan yang sangat ketat tersebut, Kota Batu berusaha keluar dari persaingan (red ocean) dengan menciptkan inovasi baru melalui konsep Blue Ocean Strategy. Blue Ocean Strategy adalah istilah dalam ilmu manajemen strategi yang merujuk pada siasat untuk menciptakan pasar baru yang belum dipenuhi persaingan yang ketat. Blue Ocean Strategy pada d...

  12. Twisted bilayer blue phosphorene: A direct band gap semiconductor

    Science.gov (United States)

    Ospina, D. A.; Duque, C. A.; Correa, J. D.; Suárez Morell, Eric

    2016-09-01

    We report that two rotated layers of blue phosphorene behave as a direct band gap semiconductor. The optical spectrum shows absorption peaks in the visible region of the spectrum and in addition the energy of these peaks can be tuned with the rotational angle. These findings makes twisted bilayer blue phosphorene a strong candidate as a solar cell or photodetection device. Our results are based on ab initio calculations of several rotated blue phosphorene layers.

  13. The Return of the Blue Butterfly

    Science.gov (United States)

    Santos, Anabela

    2014-05-01

    The Return of the Blue Butterfly The English writer Charles Dickens once wrote: "I only ask to be free. The butterflies are free". But are they really? The work that I performed with a group of students from 8th grade, had a starting point of climate change and the implications it has on ecosystems. Joining the passion I have for butterflies, I realized that they are also in danger of extinction due to these climatic effects. Thus, it was easy to seduce my students wanting to know more. Luckily I found Dr. Paula Seixas Arnaldo, a researcher at the University of Trás-os-Montes and Alto Douro, who has worked on butterflies and precisely investigated this issue. Portugal is the southern limit of butterfly-blue (Phengaris alcon), and has been many years in the red book of endangered species. Butterfly-blue is very demanding of their habitat, and disappears very easily if ideal conditions are not satisfied. Increased fragmentation of landscapes and degradation of suitable habitats, are considered the greatest challenges of the conservation of Phengaris butterfly in Portugal. In recent decades, climate change has also changed butterfly-blue spatial distribution with a movement of the species northward to colder locations, and dispersion in latitude. Butterflies of Europe must escape to the North because of the heat. Dr. Paula Seixas Arnaldo and her research team began a project, completed in December 2013, wanted to preserve and restore priority habitats recognized by the European Union to help species in danger of disappearing with increasing temperature. The blue butterfly is extremely important because it is a key indicator of the quality of these habitats. In the field, the butterflies are monitored to collect all possible data in order to identify the key species. Butterflies start flying in early July and cease in late August. Mating takes about an hour and occurs in the first days of life. The gentian-peat (Gentiana pneumonanthe) serves as the host plant for

  14. Preparing US community greenhouse gas inventories for climate action plans

    International Nuclear Information System (INIS)

    Blackhurst, Michael; Scott Matthews, H; Hendrickson, Chris T; Sharrard, Aurora L; Azevedo, Ines Lima

    2011-01-01

    This study illustrates how alternative and supplemental community-level greenhouse gas (GHG) inventory techniques could improve climate action planning. Eighteen US community GHG inventories are reviewed for current practice. Inventory techniques could be improved by disaggregating the sectors reported, reporting inventory uncertainty and variability, and aligning inventories with local organizations that could facilitate emissions reductions. The potential advantages and challenges of supplementing inventories with comparative benchmarks are also discussed. While GHG inventorying and climate action planning are nascent fields, these techniques can improve CAP design, help communities set more meaningful emission reduction targets, and facilitate CAP implementation and progress monitoring.

  15. Preparing US community greenhouse gas inventories for climate action plans

    Energy Technology Data Exchange (ETDEWEB)

    Blackhurst, Michael [Department of Civil, Architectural and Environmental Engineering, The University of Texas at Austin, 1 University Station C1752, Austin, TX 78712-0276 (United States); Scott Matthews, H; Hendrickson, Chris T [Department of Civil and Environmental Engineering, Carnegie Mellon University, 119 Porter Hall, Pittsburgh, PA 15213 (United States); Sharrard, Aurora L [Green Building Alliance, 333 East Carson Street, Suite 331, Pittsburgh, PA 15219 (United States); Azevedo, Ines Lima, E-mail: mblackhurst@gmail.com, E-mail: hsm@cmu.edu, E-mail: auroras@gbapgh.org, E-mail: cth@andrew.cmu.edu, E-mail: iazevedo@cmu.edu [Department of Engineering and Public Policy, Carnegie Mellon University, 119 Porter Hall, Pittsburgh, PA 15213 (United States)

    2011-07-15

    This study illustrates how alternative and supplemental community-level greenhouse gas (GHG) inventory techniques could improve climate action planning. Eighteen US community GHG inventories are reviewed for current practice. Inventory techniques could be improved by disaggregating the sectors reported, reporting inventory uncertainty and variability, and aligning inventories with local organizations that could facilitate emissions reductions. The potential advantages and challenges of supplementing inventories with comparative benchmarks are also discussed. While GHG inventorying and climate action planning are nascent fields, these techniques can improve CAP design, help communities set more meaningful emission reduction targets, and facilitate CAP implementation and progress monitoring.

  16. National dam inventory provides data for analysis

    International Nuclear Information System (INIS)

    Spragens, L.

    1992-01-01

    The Association of State Dam Safety Officials completed a dam inventory this fall. Information on approximately 90,000 state-regulated dams in the US collected during the four-year inventory is being used to build a database managed by the Federal Emergency Management Agency. In addition to ASDSO's work, the federal government conducted an inventory of federal dams. This data will be added to the state information to form one national database. The database will feature 35 data fields for each entry, including the name of the dam, its size, the name of the nearest downstream community, maximum discharge and storage volume, the date of the last inspection, and details about the emergency action plan. The program is an update of the nation's first dam inventory, required by the Dam Safety Act of 1972. The US Army Corps of Engineers completed the original inventory in 1981. The Water Resources Development Act of 1986 authorized appropriations of $2.5 million for the Corps to update the inventory. FEMA and the Corps entered into an agreement for FEMA to undertake the task for the Corps and to coordinate work on both the federal and state inventories. ASDSO compiles existing information on state-regulated dams into a common format for the database, added missing information, and established a process for continually updating data. ASDSO plans to analyze the information collected for the database. It will look at statistics for the number of dams regulated, communities that could be affected, and the number of high-hazard dams. FEMA is preparing reports for Congress on the project. The reports, which are expected to be ready by May 1993, will include information on the methodology used and facts about regulated dams under state jurisdiction

  17. Unified Communications for Space Inventory Management

    Science.gov (United States)

    Gifford, Kevin K.; Fink, Patrick W.; Barton, Richard; Ngo, Phong H.

    2009-01-01

    To help assure mission success for long-duration exploration activities, NASA is actively pursuing wireless technologies that promote situational awareness and autonomy. Wireless technologies are typically extensible, offer freedom from wire tethers, readily support redundancy, offer potential for decreased wire weight, and can represent dissimilar implementation for increased reliability. In addition, wireless technologies can enable additional situational awareness that otherwise would be infeasible. For example, addition of wired sensors, the need for which might not have been apparent at the outset of a program, night be extremely costly due in part to the necessary routing of cables through the vehicle. RFID, or radio frequency identification, is a wireless technology with the potential for significant savings and increased reliability and safety in space operations. Perhaps the most obvious savings relate to the application of inventory management. A fully automated inventory management system is highly desirable for long-term sustaining operations in space environments. This assertion is evidenced by inventory activities on the International Space Station, which represents the most extensive inventory tracking experience base in the history of space operations. In the short tern, handheld RFID readers offer substantial savings owing to reduced crew time for inventory audits. Over the long term, a combination of improved RFID technology and operational concepts modified to fully utilize the technology should result in space based inventory management that is highly reliable and requires very little crew time. In addition to inventory management, RFID is likely to find space applications in real-time location and tracking systems. These could vary from coarse-resolution RFID portals to the high resolution afforded by ultra-wideband (UWB) RFID. Longer range RFID technologies that leverage passive surface acoustic wave (SAW) devices are being investigated to

  18. Phototherapy with blue and green mixed-light is as effective against unconjugated jaundice as blue light and reduces oxidative stress in the Gunn rat model.

    Science.gov (United States)

    Uchida, Yumiko; Morimoto, Yukihiro; Uchiike, Takao; Kamamoto, Tomoyuki; Hayashi, Tamaki; Arai, Ikuyo; Nishikubo, Toshiya; Takahashi, Yukihiro

    2015-07-01

    Phototherapy using blue light-emitting diodes (LED) is effective against neonatal jaundice. However, green light phototherapy also reduces unconjugated jaundice. We aimed to determine whether mixed blue and green light can relieve jaundice with minimal oxidative stress as effectively as either blue or green light alone in a rat model. Gunn rats were exposed to phototherapy with blue (420-520 nm), filtered blue (FB; 440-520 nm without 1.00), respectively. Blue plus green phototherapy is as effective as blue phototherapy and it attenuates irradiation-induced oxidative stress. Combined blue and green spectra might be effective against neonatal hyperbilirubinemia. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Compact and efficient blue laser sheet for measurement

    Science.gov (United States)

    Qi, Yan; Wang, Yu; Wu, Bin; Wang, Yanwei; Yan, Boxia

    2017-10-01

    Compact and efficient blue laser sheet has important applications in the field of measurement, with laser diode end pumped Nd:YAG directly and LBO intracavity frequency doubling, a compact and efficient CW 473nm blue laser sheet composed of dual path liner blue laser is realized. At an incident pump power of 12.4W, up to 1.4W output power of the compound blue laser is achieved, the optical-to-optical conversion efficiency is as high as 11.3%.

  20. Blue Light Protects Against Temporal Frequency Sensitive Refractive Changes.

    Science.gov (United States)

    Rucker, Frances; Britton, Stephanie; Spatcher, Molly; Hanowsky, Stephan

    2015-09-01

    Time spent outdoors is protective against myopia. The outdoors allows exposure to short-wavelength (blue light) rich sunlight, while indoor illuminants can be deficient at short-wavelengths. In the current experiment, we investigate the role of blue light, and temporal sensitivity, in the emmetropization response. Five-day-old chicks were exposed to sinusoidal luminance modulation of white light (with blue; N = 82) or yellow light (without blue; N = 83) at 80% contrast, at one of six temporal frequencies: 0, 0.2, 1, 2, 5, 10 Hz daily for 3 days. Mean illumination was 680 lux. Changes in ocular components and corneal curvature were measured. Refraction, eye length, and choroidal changes were dependent on the presence of blue light (P light, refraction did not change across frequencies (mean change -0.24 [diopters] D), while in the absence of blue light, we observed a hyperopic shift (>1 D) at high frequencies, and a myopic shift (>-0.6 D) at low frequencies. With blue light there was little difference in eye growth across frequencies (77 μm), while in the absence of blue light, eyes grew more at low temporal frequencies and less at high temporal frequencies (10 vs. 0.2 Hz: 145 μm; P light. Illuminants rich in blue light can protect against myopic eye growth when the eye is exposed to slow changes in luminance contrast as might occur with near work.

  1. Vendor Managed Inventory:Retail Industry Perspective of Malaysia

    OpenAIRE

    Madjlesi Taklimi, Zahra

    2011-01-01

    The concept of Vendor Managed Inventory (VMI) radically changes a traditional inventory management. Under the typical business model, the buyer or retailer is in total control of the timing and volume of the order, in order placing and managing the inventory plan. Whereas VMI is a supply chain initiative where the supplier is responsible for all decisions regarding inventories at the retailers, i.e. under VMI program the supplier is authorized to manage inventories of agreed-upon stock-keepin...

  2. The role of inventory management in Canadian economic fluctuations

    OpenAIRE

    Hung-Hay Lau

    1996-01-01

    Swings in inventory investment have traditionally played a major role in Canadian business cycles. However, advances in inventory-control techniques and the reduced uncertainty associated with lower inflation have enabled firms to manage their inventories much more tightly and effectively. This article examines recent developments in the management of non-farm business inventories in Canada at both the aggregate and the sectoral level and looks at implications for the role of inventories as a...

  3. Validation of Schema Coping Inventory and Schema Mode Inventory in Adolescents

    NARCIS (Netherlands)

    van Wijk-Herbrink, M.F.; Roelofs, J.; Broers, N.J.; Rijkeboer, M.M.; Arntz, A.; Bernstein, D.P.

    2018-01-01

    This study investigated whether the schema therapy constructs of schema coping and schema modes have validity in adolescents. We examined the validity and reliability of the Schema Coping Inventory (SCI) and an 80-item version of the Schema Mode Inventory (SMI) in a mixed sample of adolescents.

  4. A single-item inventory model for expected inventory order crossovers

    NARCIS (Netherlands)

    Riezebos, J.; Gaalman, G.J.C.

    2009-01-01

    Expected inventory order crossovers Occur if at the moment of ordering it is expected that orders will not arrive in the sequence they are ordered. Recent research has shown that (it) expected inventory order crossovers will be encountered more frequently in future, and that (b) use of a myopic

  5. Evaluating Global Emission Inventories of Biogenic Bromocarbons

    Science.gov (United States)

    Hossaini, Ryan; Mantle, H.; Chipperfield, M. P.; Montzka, S. A.; Hamer, P.; Ziska, F.; Quack, B.; Kruger, K.; Tegtmeier, S.; Atlas, E.; hide

    2013-01-01

    Emissions of halogenated very short-lived substances (VSLS) are poorly constrained. However, their inclusion in global models is required to simulate a realistic inorganic bromine (Bry) loading in both the troposphere, where bromine chemistry perturbs global oxidizing capacity, and in the stratosphere, where it is a major sink for ozone (O3). We have performed simulations using a 3-D chemical transport model (CTM) including three top-down and a single bottom-up derived emission inventory of the major brominated VSLS bromoform (CHBr3) and dibromomethane (CH2Br2). We perform the first concerted evaluation of these inventories, comparing both the magnitude and spatial distribution of emissions. For a quantitative evaluation of each inventory, model output is compared with independent long-term observations at National Oceanic and Atmospheric Administration (NOAA) ground-based stations and with aircraft observations made during the NSF (National Science Foundation) HIAPER Pole-to-Pole Observations (HIPPO) project. For CHBr3, the mean absolute deviation between model and surface observation ranges from 0.22 (38 %) to 0.78 (115 %) parts per trillion (ppt) in the tropics, depending on emission inventory. For CH2Br2, the range is 0.17 (24 %) to 1.25 (167 %) ppt. We also use aircraft observations made during the 2011 Stratospheric Ozone: Halogen Impacts in a Varying Atmosphere (SHIVA) campaign, in the tropical western Pacific. Here, the performance of the various inventories also varies significantly, but overall the CTM is able to reproduce observed CHBr3 well in the free troposphere using an inventory based on observed sea-to-air fluxes. Finally, we identify the range of uncertainty associated with these VSLS emission inventories on stratospheric bromine loading due to VSLS (Br(VSLS/y)). Our simulations show Br(VSLS/y) ranges from approximately 4.0 to 8.0 ppt depending on the inventory. We report an optimized estimate at the lower end of this range (approximately 4 ppt

  6. A Perishable Inventory Model with Return

    Science.gov (United States)

    Setiawan, S. W.; Lesmono, D.; Limansyah, T.

    2018-04-01

    In this paper, we develop a mathematical model for a perishable inventory with return by assuming deterministic demand and inventory dependent demand. By inventory dependent demand, it means that demand at certain time depends on the available inventory at that time with certain rate. In dealing with perishable items, we should consider deteriorating rate factor that corresponds to the decreasing quality of goods. There are also costs involved in this model such as purchasing, ordering, holding, shortage (backordering) and returning costs. These costs compose the total costs in the model that we want to minimize. In the model we seek for the optimal return time and order quantity. We assume that after some period of time, called return time, perishable items can be returned to the supplier at some returning costs. The supplier will then replace them in the next delivery. Some numerical experiments are given to illustrate our model and sensitivity analysis is performed as well. We found that as the deteriorating rate increases, returning time becomes shorter, the optimal order quantity and total cost increases. When considering the inventory-dependent demand factor, we found that as this factor increases, assuming a certain deteriorating rate, returning time becomes shorter, optimal order quantity becomes larger and the total cost increases.

  7. Optoelectronic inventory system for special nuclear material

    International Nuclear Information System (INIS)

    Sieradzki, F.H.

    1994-01-01

    In support of the Department of Energy's Dismantlement Program, the Optoelectronics Characterization and Sensor Development Department 2231 at Sandia National Laboratories/New Mexico has developed an in situ nonintrusive Optoelectronic Inventory System (OIS) that has the potential for application wherever periodic inventory of selected material is desired. Using a network of fiber-optic links, the OIS retrieves and stores inventory signatures from data storage devices (which are permanently attached to material storage containers) while inherently providing electromagnetic pulse immunity and electrical noise isolation. Photovoltaic cells (located within the storage facility) convert laser diode optic power from a laser driver to electrical energy. When powered and triggered, the data storage devices sequentially output their digital inventory signatures through light-emitting diode/photo diode data links for retrieval and storage in a mobile data acquisition system. An item's exact location is determined through fiber-optic network and software design. The OIS provides an on-demand method for obtaining acceptable inventory reports while eliminating the need for human presence inside the material storage facility. By using modularization and prefabricated construction with mature technologies and components, an OIS installation with virtually unlimited capacity can be tailored to the customer's requirements

  8. Development of a Solar System Concept Inventory

    Science.gov (United States)

    Hornstein, Seth D.; Duncan, D.; S, C. A. T.

    2009-01-01

    Concept inventories can provide useful insight into students’ understanding of key physical concepts. Knowing what your students have learned during a course is a valuable tool for improving your own teaching. Unfortunately, current astronomy concept inventories are not suitable for an introductory solar system course because they either cover too broad of a range of topics (e.g. Astronomy Diagnostic Test) or are too narrowly focused (e.g. Greenhouse Effect Concept Inventory, Lunar Phase Concept Inventory). We have developed the Solar System Concept Inventory (SSCI) to cover those topics commonly taught in an introductory solar system course. The topics included on the SSCI were selected by having faculty identify the key concepts they address when teaching about the solar system. SSCI topics include formation mechanisms, planetary interiors, atmospheric effects, and small solar system bodies. Student interviews were conducted to identify common naive ideas and reasoning difficulties relating to these key topics. Preliminary development of the SSCI was completed at the University of Colorado and involved over 400 students. A larger, national, multi-institutional field test is planned for Spring 2009 as a Collaboration of Astronomy Teaching Scholars (CATS) research project. We present here the results from the preliminary development and proposed changes for the next stage of research. We would like to thank the NSF for funding under Grant No. 0715517, a CCLI Phase III Grant for the Collaboration of Astronomy Teaching Scholars (CATS) Program.

  9. Development of the Solar System Concept Inventory

    Science.gov (United States)

    Hornstein, S.; Prather, E.

    2009-12-01

    Concept inventories can provide useful insight into students’ understanding of key physical concepts. Knowing what your students have learned during a course is a valuable tool for improving your own teaching. Unfortunately, current astronomy concept inventories are not suitable for an introductory solar system course because they either cover too broad of a range of topics (e.g. Astronomy Diagnostic Test) or are too narrowly focused (e.g. Greenhouse Effect Concept Inventory, Lunar Phase Concept Inventory). We have developed the Solar System Concept Inventory (SSCI) to cover those topics commonly taught in an introductory solar system course. The topics included on the SSCI were selected by having faculty identify the key concepts they address when teaching about the solar system. SSCI topics include formation mechanisms, planetary interiors, atmospheric effects, and small solar system bodies. Student interviews were conducted to identify common naive ideas and reasoning difficulties relating to these key topics. The SSCI has been through two semesters of national, multi-institutional field-testing, involving over 1500 students. After the first semester of testing, question statistics were used to flag ineffective questions and flagged questions were revised or eliminated. We will present an overall outline of the SSCI development as well as our question-flagging criteria and question analyses from the latest round of field-testing. We would like to thank the NSF for funding under Grant No. 0715517, a CCLI Phase III Grant for the Collaboration of Astronomy Teaching Scholars (CATS) Program.

  10. INVENTORIES MEASUREMENT – BETWEEN PRUDENCE AND NONPRUDENCE

    Directory of Open Access Journals (Sweden)

    Iulia JIANU

    2010-12-01

    Full Text Available In accounting, measurement is the process used to determine the value at which the items of financial statements are recognized in accounting and presented in the balance sheet and in the profit and loss account. Starting from the importance of measurement in accounting, the first study objective in this paper brings in the center of discussion the inventories measurement with the purpose to identify the main methods for inventories measurement at exit used by the economic entities listed on EuroNext Paris Exchange Stock. In the present context, when the financial crisis is still felt in the EU countries is important to note the extent to which economic entities demonstrate prudence in accounting by taking into consideration the inventories impairment at balance sheet date. Compliance with the prudence principle to integrate uncertainty in accounting measurement has the purpose to avoid the risk to transfer in the future periods the present uncertainties that are likely to strike the economic entity. One of the main consequences of this principle is to make impairments for inventories. Therefore the second objective of the present paper is to reflect the extent to which the entities under study record impairments for inventories at balance sheet date, as well as to highlight the manner in which is disclosed the information regarding the way the net realizable value can be calculated.

  11. The Blue Ribbon Commission and siting radioactive waste disposal facilities

    International Nuclear Information System (INIS)

    Pescatore, C.

    2010-01-01

    On 21 September 2010, the NEA Secretariat was invited to address the Blue Ribbon Commission on America's Nuclear Future. This paper is a summary of the remarks made. The successful siting of radioactive waste disposal facilities implies creating the conditions for continued ownership of the facility over time. Acceptance of the facility at a single point in time is not good enough. Continued ownership implies the creation of conscious, constructive and durable relationships between the (most affected) communities and the waste management facility. Being comfortable about the technical safety of the facility requires a degree of familiarity and control . Having peace of mind about the safety of the facility requires trust in the waste management system and its actors as well as some control over the decision making. Regulators are especially important players who need to be visible in the community. The ideal site selection process should be step- wise, combining procedures for excluding sites that do not meet pre-identified criteria with those for identifying sites where nearby and more distant residents are willing to discuss acceptance of the facility. The regional authorities are just as important as the local authorities. Before approaching a potential siting region or community, there should be clear results of national (and state) debates establishing the role of nuclear power in the energy mix, as well as information on the magnitude of the ensuing waste commitment and its management end-points, and the allocation of the financial and legal responsibilities until the closure of the project. Once the waste inventories and type of facilities have been decided upon, there should be agreement that all significant changes will require a new decision-making process. Any proposed project has a much better chance to move forward positively if the affected populations can participate in its definition, including, at the appropriate time, its technical details. A

  12. RADIOISOTOPE INVENTORY FOR TSPA-SR

    International Nuclear Information System (INIS)

    Leigh, C.; Rechard, R.

    2001-01-01

    The total system performance assessment for site recommendation (TSPA-SR), on Yucca Mountain, as a site (if suitable) for disposal of radioactive waste, consists of several models. The Waste Form Degradation Model (i.e, source term) of the TSPA-SR, in turn, consists of several components. The Inventory Component, discussed here, defines the inventory of 26 radioisotopes for three representative waste categories: (1) commercial spent nuclear fuel (CSNF), (2) US Department of Energy (DOE) spent nuclear fuel (DSNF), and (3) high-level waste (HLW). These three categories are contained and disposed of in two types of waste packages (WPs)--CSNF WPs and co-disposal WPs, with the latter containing both DSNF and HLW. Three topics are summarized in this paper: first, the transport of radioisotopes evaluated in the past; second, the development of the inventory for the two WP types; and third, the selection of the most important radioisotopes to track in TSPA-SR

  13. Heterogeneous fundamentalists and market maker inventories

    International Nuclear Information System (INIS)

    Carraro, Alessandro; Ricchiuti, Giorgio

    2015-01-01

    In this paper, we develop a heterogeneous agents model of asset price and inventory with a market maker who considers the excess demand of two groups of agents that employ the same trading rule (i.e. fundamentalists) with different beliefs on the fundamental value. The dynamics of our model is driven by a bi-dimensional discrete non-linear map. We show that the market maker has a destabilizing role when she actively manages the inventory. Moreover, inventory share and the distance between agents’ beliefs strongly influence the results: market instability and periodic, or even, chaotic price fluctuations can be generated. Finally, we show through simulations that endogenous fluctuations of the fractions of agents may trigger instability for a larger set of parameters.

  14. Measurement of inventories with mixed fissile materials

    International Nuclear Information System (INIS)

    Rinard, P.M.; Krick, M.S.; Kelley, T.; Schneider, C.M.

    1997-01-01

    An inventory with a large number of diverse items containing mixtures of uranium and plutonium has been measured with two nondestructive assay (NDA) instruments used in four modes. A segmented gamma scanner (SGS) was used to find the number of cans and the positions of the fissile materials by scanning each item in front of a transmissions source; at each position, uranium and plutonium isotopics were measured with the passive gamma rays emitted. A shuffler was then used in both the passive and active modes to measure the masses of the two elements. The measured masses for the inventory items were generally in agreement with the declared values, but anomalies were identified for a small fraction of the inventory

  15. Dealer Inventory and the Cost of Immediacy

    DEFF Research Database (Denmark)

    Dick-Nielsen, Jens

    This study shows that the recent 80% decrease in dealer inventories of corporate bonds has increased the cost of immediacy. For safe bonds which are quickly turned over again by dealers the increase is up to 15%, while for risky bonds which are kept on inventory by dealers the increase is up to 100......% on average. The time series of transaction costs is estimated using the natural experiment of corporate bond index exclusions. The exclusions are monthly and information-free events where index trackers seeking to minimize tracking error request immediacy in order to sell close to the exclusion date....... The drop in dealer inventories, and thus the rise in transaction costs, is a side-eect of anticipated tighter regulation, primarily Basel III and the Volcker Rule....

  16. Relativity concept inventory: Development, analysis, and results

    Directory of Open Access Journals (Sweden)

    J. S. Aslanides

    2013-05-01

    Full Text Available We report on a concept inventory for special relativity: the development process, data analysis methods, and results from an introductory relativity class. The Relativity Concept Inventory tests understanding of relativistic concepts. An unusual feature is confidence testing for each question. This can provide additional information; for example, high confidence correlated with incorrect answers suggests a misconception. A novel aspect of our data analysis is the use of Monte Carlo simulations to determine the significance of correlations. This approach is particularly useful for small sample sizes, such as ours. Our results show a gender bias that was not present in course assessment, similar to that reported for the Force Concept Inventory.

  17. The Safeguards Active Response Inventory System (SARIS)

    International Nuclear Information System (INIS)

    Carlson, R.L.

    1985-04-01

    The Safeguards Active Response Inventory System (SARIS) was developed by Westinghouse Hanford Company (WHC) to perform material control and accountability on all the nuclear material under WHC's jurisdiction. SARIS has been in operation for four and one-half years. It has reduced physical inventory plant shutdown time from several days to a few hours. The user-friendly interface has proven successful, as the training time for a new operator is only two to three hours; also errors have been dramatically reduced. The modeling features of SARIS have reduced the reported inventory difference and provide better information for measurement of scrap and waste. The audit files have been usefull in resolving data entry errors and the backup features have averted several potential problems. SARIS as a computerized accountability system has replaced manual record keeping with a consequent increase in productivity. 4 refs

  18. A new interpretation of luminous blue stars

    International Nuclear Information System (INIS)

    Stothers, R.

    1976-01-01

    A major revision of current theoretical ideas about the brightest blue stars must be made if Carson's new radiative opacities are adopted in stellar models. Unlike earlier opacities, the new opacities exhibit a large ''bump'' due to CNO ionization, which leads to very strong central condensation, convective instability, and pulsational instability in hot, diffuse stellar envelopes (typically those in which L/M>10 3 solar units). Despite a number of theoretical uncertainties, the new picture of the structure of very luminous stars is reasonably successful in accounting for a variety of previously unexplained observations. Thus, the new stellar models for the phase of core hydrogen burning predict large radii and rather cool effective temperatures (which are yet to be observationally confirmed) for O stars, and a spreading out of the main-sequence band in the H-R diagram toward luminous cool supergiants for masses higher than approx.20 M/sub sun/, beginning at M/sub v/=-4.5 and Sp=B1. They also predict slower surface rotations for O stars compared with B stars; and, in binary systems, slower apsidal motions, closer rotational-revolutional synchronism, and smaller orbital eccentricities. In massive X-ray binary systems, circular orbits and supergiant-like visual companions are expected to be quite common. Radial pulsations of the models have been calculated by employing linearized nonadiabatic pulsation theory. Long-period variability is predicted to exist for massive blue supergiants of luminosity class Ia. The new models for helium stars predict large radii and rather cool effective temperatures for Wolf-Rayet stars, as well as multimodal pulsational instability and, possibly, surface turbulence for these stars. Ultrashort-period variability, observed in many classes of hot luminous stars, may be due, in part, to high radial overtone pulsations (or, possibly, to nonradial pulsation or convective modes)

  19. Blue Marble: Remote Characterization of Habitable Planets

    Science.gov (United States)

    Woolf, Neville; Lewis, Brian; Chartres, James; Genova, Anthony

    2009-01-01

    The study of the nature and distribution of habitable environments beyond the Solar System is a key area for Astrobiology research. At the present time, our Earth is the only habitable planet that can be characterized in the same way that we might characterize planets beyond the Solar System. Due to limitations in our current and near-future technology, it is likely that extra-solar planets will be observed as single-pixel objects. To understand this data, we must develop skills in analyzing and interpreting the radiation obtained from a single pixel. These skills must include the study of the time variation of the radiation, and the range of its photometric, spectroscopic and polarimetric properties. In addition, to understand whether we are properly analyzing the single pixel data, we need to compare it with a ground truth of modest resolution images in key spectral bands. This paper discusses the concept for a mission called Blue Marble that would obtain data of the Earth using a combination of spectropolarimetry, spectrophotometry, and selected band imaging. To obtain imagery of the proper resolution, it is desirable to place the Blue Marble spacecraft no closer than the outer region of cis-lunar space. This paper explores a conceptual mission design that takes advantage of low-cost launchers, bus designs and mission elements to provide a cost effective observing platform located at one of the stable Earth-moon Lagrangian points (L4, L5). The mission design allows for the development and use of novel technologies, such as a spinning moon sensor for attitude control, and leverages lessons-learned from previous low-cost spacecraft such as Lunar Prospector to yield a low-risk mission concept.

  20. Construct Validation of the Physics Metacognition Inventory

    Science.gov (United States)

    Taasoobshirazi, Gita; Farley, John

    2013-02-01

    The 24-item Physics Metacognition Inventory was developed to measure physics students' metacognition for problem solving. Items were classified into eight subcomponents subsumed under two broader components: knowledge of cognition and regulation of cognition. The students' scores on the inventory were found to be reliable and related to students' physics motivation and physics grade. An exploratory factor analysis provided evidence of construct validity, revealing six components of students' metacognition when solving physics problems including: knowledge of cognition, planning, monitoring, evaluation, debugging, and information management. Although women and men differed on the components, they had equivalent overall metacognition for problem solving. The implications of these findings for future research are discussed.

  1. Radwaste inventories and projections: an overview

    International Nuclear Information System (INIS)

    Notz, K.J.

    1982-07-01

    The Integrated Data Base program was set up to provide fully integrated and reconciled inventories, characteristics, and projections for spent nuclear fuel and all categories of radioactive waste. Eight summary papers, six of which were presented at an ANS special session in Los Angeles in June 1982, are included in this report: data base needs and functions: national planning; integrated data base for spent fuel and radwaste: inventories; integrated data base projections; RAWSYM: radioactive waste management system; NWTS program waste projection data needs; low-level waste management data base system; waste sludge composition at the Savannah River Plant; and summary of characteristics of transuranic waste found at DOE sites

  2. Orchids inventory in Sintang Regency, West Kalimantan

    Directory of Open Access Journals (Sweden)

    ESTI ENDAH ARIYANTI

    2008-10-01

    Full Text Available Orchid is one of ornamental plants which have commercial value. Therefore most species are becoming threatened or even endangered because of over exploitation. In addition, its natural habitat is also decreasing. Conservation must be done urgently, both by in situ and ex situ conservation, which can be started by orchid inventory. The orchid inventory was done in TWA Bukit Kelam, TWA Baning and several places in Regency of Sintang, West Kalimantan. The result showed that there were 40 species belonged to 27 genera, which 32 species of them (20 genera were epiphytic orchids and 8 species (7 genera were terrestrial orchids.

  3. Designing green and blue infrastructure to support healthy urban living

    NARCIS (Netherlands)

    Gehrels, H.; Meulen, van der Suzanne; Schasfoort, F.; Bosch, Peter; Brolsma, R.; Dinther, van D.; Geerling, G.J.; Goossens, M.; Jacobs, C.M.J.; jong, de Merijn; Kok, Sien; Massop, H.T.L.

    2016-01-01

    This report focuses on developing concepts and design principles for blue and green infrastructure that not only support climate resilience but also contribute to a healthy and liveable urban environment. We will first assess the effectiveness of blue and green infrastructure on the basis of

  4. Microscopic origin of the optical processes in blue sapphire.

    Science.gov (United States)

    Bristow, Jessica K; Parker, Stephen C; Catlow, C Richard A; Woodley, Scott M; Walsh, Aron

    2013-06-11

    Al2O3 changes from transparent to a range of intense colours depending on the chemical impurities present. In blue sapphire, Fe and Ti are incorporated; however, the chemical process that gives rise to the colour has long been debated. Atomistic modelling identifies charge transfer from Ti(III) to Fe(III) as being responsible for the characteristic blue appearance.

  5. Microscopic origin of the optical processes in blue sapphire

    OpenAIRE

    Bristow, JK; Parker, SC; Catlow, CRA; Woodley, SM; Walsh, A

    2013-01-01

    Al2O3 changes from transparent to a range of intense colours depending on the chemical impurities present. In blue sapphire, Fe and Ti are incorporated; however, the chemical process that gives rise to the colour has long been debated. Atomistic modelling identifies charge transfer from Ti(III) to Fe(III) as being responsible for the characteristic blue appearance.

  6. Fluctuating and Directional Asymmetry of the Blue Mussel (

    NARCIS (Netherlands)

    Lajus, D.; Katolikova, M.; Strelkov, P.; Hummel, H.

    2015-01-01

    In this work we examined morphological variation at different levels to study performance and population structuring of the blue mussel Mytilus edulis. Our objectives were: (i) to develop an integrated technique for analyzing morphological variation in blue mussels and, based on this technique; (ii)

  7. QCD on the BlueGene/L Supercomputer

    International Nuclear Information System (INIS)

    Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

    2005-01-01

    In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented

  8. QCD on the BlueGene/L Supercomputer

    Science.gov (United States)

    Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

    2005-03-01

    In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented.

  9. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  10. Isolation and Characterization of Blue Green Algae from Egyptian ...

    African Journals Online (AJOL)

    meldemellawy

    2014-02-20

    Feb 20, 2014 ... aminotransferase (AMT) domains of the mycE and ndaF genes (Jungblut et al., 2006) allowing detection of microcystin and nodularin-producing cyanobacteria. MATERIALS AND METHODS. Isolation and cultivation of blue green algae. Blue green algae had been isolated from soil of Rice field in river.

  11. Effects of fire and browsing on regeneration of blue oak

    Science.gov (United States)

    James W. Bartolome; Mitchel P. McClaran; Barbara H. Allen-Diaz; Jim Dunne; Lawrence D. Ford; Richard B. Standiford; Neil K. McDougald; Larry C. Forero

    2002-01-01

    Blue oaks (Quercus douglasii) are not regenerating well over much of California. The roles of fire and browsing in regeneration are probably significant, but poorly understood. We burned two foothill blue oak woodland sites which contained significant numbers of small trees between 40 and 70 cm tall, then compared height growth over 14 years among 48...

  12. Blue-shifted photoluminescence of Alq3 dispersed in PMMA

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Alq3 is known to emit bright green light under UV excitation. Blue shift of the emission was reported in recent literature. This was ascribed to the presence of various isomers/crystallographic modifica- tions obtained through train sublimation. Here a blue shift was reported for Alq3 dispersed in PMMA. No iso-.

  13. Current distribution and population size of the Blue Swallow Hirundo ...

    African Journals Online (AJOL)

    , the crops, natural pastures, livestock and their dung possibly provide the food source for the aerial arthropods on which the Blue Swallows feed. In total, 151 Blue Swallows were recorded consisting of 62 males, 68 females and 21 unsexed ...

  14. No effect of blue on winning contests in judo

    NARCIS (Netherlands)

    Dijkstra, Peter D.; Preenen, Paul T. Y.

    2008-01-01

    A study by Rowe et al. reported a winning bias for judo athletes wearing a blue outfit relative to those wearing a white one during the 2004 Olympics. It was suggested that blue is associated with a higher likelihood of winning through differential effects of colour on opponent visibility and/or an

  15. Blue Oak Canopy Effect on Seasonal Forage Production and Quality

    Science.gov (United States)

    William E. Frost; Neil K. McDougald; Montague W. Demment

    1991-01-01

    Forage production and forage quality were measured seasonally beneath the canopy of blue oak (Quercus douglasii) and in open grassland at the San Joaquin Experimental Range. At the March and peak standing crop sampling dates forage production was significantly greater (p=.05) beneath blue oak compared to open grassland. At most sampling dates, the...

  16. Design of inventory pools in spare part support operation systems

    Science.gov (United States)

    Mo, Daniel Y.; Tseng, Mitchell M.; Cheung, Raymond K.

    2014-06-01

    The objective of a spare part support operation is to fulfill the part request order with different service contracts in the agreed response time. With this objective to achieve different service targets for multiple service contracts and the considerations of inventory investment, it is not only important to determine the inventory policy but also to design the structure of inventory pools and the order fulfilment strategies. In this research, we focused on two types of inventory pools: multiple inventory pool (MIP) and consolidated inventory pool (CIP). The idea of MIP is to maintain separated inventory pools based on the types of service contract, while CIP solely maintains a single inventory pool regardless of service contract. Our research aims to design the inventory pool analytically and propose reserve strategies to manage the order fulfilment risks in CIP. Mathematical models and simulation experiments would be applied for analysis and evaluation.

  17. How does the blue-ringed octopus (Hapalochlaena lunulata) flash its blue rings?

    Science.gov (United States)

    Mäthger, Lydia M; Bell, George R R; Kuzirian, Alan M; Allen, Justine J; Hanlon, Roger T

    2012-11-01

    The blue-ringed octopus (Hapalochlaena lunulata), one of the world's most venomous animals, has long captivated and endangered a large audience: children playing at the beach, divers turning over rocks, and biologists researching neurotoxins. These small animals spend much of their time in hiding, showing effective camouflage patterns. When disturbed, the octopus will flash around 60 iridescent blue rings and, when strongly harassed, bite and deliver a neurotoxin that can kill a human. Here, we describe the flashing mechanism and optical properties of these rings. The rings contain physiologically inert multilayer reflectors, arranged to reflect blue-green light in a broad viewing direction. Dark pigmented chromatophores are found beneath and around each ring to enhance contrast. No chromatophores are above the ring; this is unusual for cephalopods, which typically use chromatophores to cover or spectrally modify iridescence. The fast flashes are achieved using muscles under direct neural control. The ring is hidden by contraction of muscles above the iridophores; relaxation of these muscles and contraction of muscles outside the ring expose the iridescence. This mechanism of producing iridescent signals has not previously been reported in cephalopods and we suggest that it is an exceptionally effective way to create a fast and conspicuous warning display.

  18. INVENTORY MANAGEMENT IN THE ENTERPRISE THROUGH THE APPLICATION OF IFRS 2 INVENTORIES

    Directory of Open Access Journals (Sweden)

    Svetlozar Stefanov

    2016-07-01

    Full Text Available The focus in the article is on the issues of valuation and presentation of the inventories under the meaning on the International Accounting Standard 2 Inventories. The Standard provides guidance on the determination of costs of finished products and its recognition as and expense in the production and sale finished products, including guidance for determination of the net realizable value. The latter is defined as the estimated selling price less the estimated costs of completion and estimated costs necessary to make the sale. The cost of inventories comprises all costs of purchase, cost of conversion and other costs incurred in bringing the inventories to a condition suitable for subsequent use. The amount of the cost for materials used or products sold and the finished product is determined using one of the following methods: a specifically defined value, first-in � first out or weighted average cost of lots delivered. When inventories are sold, the carrying amount of those inventories is recognized as an expense in the period in which the related sales revenue is recognized. The amount of any write-down of inventories to net realizable value is recorded as a current expense and is recognized as an expense in the period the write-down occurs.

  19. BLUE OCEAN STRATEGY (BOS SEBAGAI PARADIGMA BARU MANAJEMEN PENDIDIKAN ISLAM

    Directory of Open Access Journals (Sweden)

    Ikhwan Fuad

    2016-08-01

    Full Text Available The focus of this article is to describe the Blue Ocean Strategy as a new paradigm of Islamic education management. the author seeks to elaborate on how the adoption of the Blue Ocean strategy of the business world to the world of education and answered the principles of what is accepted and rejected away from the theory. Adoption of blue ocean strategy is done by applying the universal principles are : among others reconstruct market boundaries, focus on the big picture rather than numbers, reach beyond existing demand, perform a series of strategies with appropriate, efforts to overcome organizational constraints and integrate execution into strategy. The principles of Blue Ocean Strategy Indicators that can be absorbed is an indicator that focuses gave excellent service and were not absorbed is a strong indicator of economic motivation. Generally, Blue Ocean Strategy quite well applied as a management paradigm of Islamic education.

  20. A Rare Case of Multifocal Prostatic Blue Nevus

    Directory of Open Access Journals (Sweden)

    Elias J. Farran

    2018-01-01

    Full Text Available Prostatic blue nevus is a rare benign pathologic diagnosis most commonly diagnosed incidentally on many different types of prostate specimens. Blue nevus is the deposition of stromal melanin characterized by spindle cells within the fibromuscular stroma which stains positive for melanin-specific stains Fontana-Masson and S100 and stains negative for CD68, HMB45, and iron stains. We report the case of a multifocal and bilateral blue nevus in a 52-year-old Hispanic male who presented with an elevated prostate-specific antigen of 4.3 and mild obstructive lower urinary tract symptoms, found by transrectal ultrasound-guided prostate needle biopsy. The biopsy also revealed benign prostatic tissue with postatrophic hyperplasia and chronic inflammation. This is the 35th reported case of prostatic blue nevus and the third to show multifocal blue nevus.

  1. Degradation of phosphorescent blue organic light-emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Chiu, Chien-Shu [Department of Electrical Engineering and Information Technology, Technical University of Braunschweig (Germany); Siemens AG, CT MM 1, Erlangen (Germany); Steinbacher, Frank [Department of Materials Science VI, University of Erlangen-Nuernberg (Germany); Siemens AG, CT MM 1, Erlangen (Germany); Krause, Ralf; Hunze, Arvid [Siemens AG, CT MM 1, Erlangen (Germany); Kowalsky, Wolfgang [Department of Electrical Engineering and Information Technology, Technical University of Braunschweig (Germany)

    2009-07-01

    Development of phosphorescent materials has significantly improved the efficiency of organic light-emitting diodes (OLEDs). By using efficient red, green and blue phosphorescent emitter materials high efficient white OLEDs can be achieved. However, due to low stability of blue phosphorescent materials the lifetime of phosphorescent white OLEDs remains an issue. As a result, degradation of blue phosphorescent materials needs to be further investigated and improved. In this work, blue OLED devices based on the phosphorescent emitter FIrpic were investigated. Single-carrier hole-only as well as electron-only devices were fabricated. For investigation of degradation process the devices were stressed with electrical current and UV-light to study the impact of charge carriers as well as excitons and exciton-polaron quenching on the stability of the blue dye.

  2. KENDALI OPTIMAL DARI SISTEM INVENTORI DENGAN PENINGKATAN DAN PENURUNAN BARANG

    Directory of Open Access Journals (Sweden)

    P Affandi

    2016-03-01

    Full Text Available Terdapat banyak permasalahan yang melibatkan teori sistem dan teori kontrol serta aplikasinya. Contohnya, beberapa referensi teori  yang mengaplikasikan teori kontrol ke dalam masalah inventori. Masalah klasik dalam masalah inventori adalah bagaimana mengatur perubahan permintaan konsumen pada sebuah produk barang jadi. Selain mengalami penurunan yang disebabkan kerusakan dan kemerosotan, ternyata inventori juga bisa mengalami peningkatan. Biasanya, inventori yang mengalami peningkatan terjadi pada inventori yang melakukan proses produksi yang berlangsung secara terus menerus; Sedangkan permintaan sedikit juga terjadi pada inventori makhluk hidup yang mengalami perkembangbiakan. Selanjutnya, hal ini mengakibatkan terjadinya peningkatan jumlah inventori. Dapat disimpulkan bahwa secara teori, sistem Inventori dapat mengalami peningkatan dan penurunan. Masalah ini dapat dimodelkan dan diselesaikan dengan menggunakan teknik kontrol optimal, sehingga akan diperoleh nilai optimal tingkat inventori dan rata-rata produksi optimal.There are many problems involving the theory of systems, control theory and its application. For example, some reference theories apply control theory to the inventory problems. The classical problem in the inventory problem was how to manage changes in consumer demand in a finished product. Besides it declines caused by damage and deterioration, evidently inventory can also increase. Typically, inventories that increased were inventories have production process continues over time; While little demand also occurred in inventories of living beings who have breeding. evidently, this led to an increasing in the amount of inventory. It can be concluded that, in theory, inventory system can be increased and decreased. This problem can be modeled and solved using optimal control techniques, so it will be obtained an optimum value of inventory levels and the average optimal production.

  3. Endogenous Business Cycle Dynamics within Metzlers Inventory Model: Adding an Inventory Floor.

    Science.gov (United States)

    Sushko, Irina; Wegener, Michael; Westerhoff, Frank; Zaklan, Georg

    2009-04-01

    Metzlers inventory model may produce dampened fluctuations in economic activity, thus contributing to our understanding of business cycle dynamics. For some parameter combinations, however, the model generates oscillations with increasing amplitude, implying that the inventory stock of firms eventually turns negative. Taking this observation into account, we reformulate Metzlers model by simply putting a floor to the inventory level. Within the new piecewise linear model, endogenous business cycle dynamics may now be triggered via a center bifurcation, i.e. for certain parameter combinations production changes are (quasi-)periodic.

  4. Savannah River Plant's Accountability Inventory Management System (AIMS) (Nuclear materials inventory control)

    International Nuclear Information System (INIS)

    Croom, R.G.

    1976-06-01

    The Accountability Inventory Management System (AIMS) is a new computer inventory control system for nuclear materials at the Savannah River Plant, Aiken, South Carolina. The system has two major components, inventory files and system parameter files. AIMS, part of the overall safeguards program, maintains an up-to-date record of nuclear material by location, produces reports required by ERDA in addition to onplant reports, and is capable of a wide range of response to changing input/output requirements through use of user-prepared parameter cards, as opposed to basic system reprogramming

  5. Molecular evidence for the subspecific differentiation of blue sheep (Pseudois nayaur) and polyphyletic origin of dwarf blue sheep (Pseudois schaeferi).

    Science.gov (United States)

    Tan, Shuai; Zou, Dandan; Tang, Lei; Wang, Gaochao; Peng, Quekun; Zeng, Bo; Zhang, Chen; Zou, Fangdong

    2012-06-01

    Blue sheep (Pseudois nayaur), a Central Asian ungulate with restricted geographic distribution, exhibits unclear variation in morphology and phylogeographic structure. The composition of species and subspecies in the genus Pseudois is controversial, particularly with respect to the taxonomic designation of geographically restricted populations. Here, 26 specimens including 5 dwarf blue sheep (Pseudois schaeferi), which were collected from a broad geographic region in China, were analyzed for 2 mitochondrial DNA fragments (cytochrome b and control region sequences). In a pattern consistent with geographically defined subspecies, we found three deeply divergent mitochondrial lineages restricted to different geographic regions. The currently designated two subspecies of blue sheep, Pseudois nayaur nayaur and Pseudois nayaur szechuanensis, were recognized in the phylogenetic trees. In addition, the Helan Mountain population showed distinct genetic characteristics from other geographic populations, and thus should be classified as a new subspecies. In contrast, dwarf blue sheep clustered closely with some blue sheep from Sichuan Province in the phylogenetic trees. Therefore, dwarf blue sheep appear to be a subset of Pseudois nayaur szechuanensis. After considering both population genetic information and molecular clock analysis, we obtained some relevant molecular phylogeographic information concerning the historical biogeography of blue sheep. These results also indicate that western Sichuan was a potential refugium for blue sheep during the Quaternary period.

  6. "Blue-Collar Blues" : kõigi maade töötud, ühinege! / Ants Juske

    Index Scriptorium Estoniae

    Juske, Ants, 1956-2016

    2009-01-01

    Rahvusvaheline näitus "Blue-Collar Blues" Tallinna Kunstihoones ja Kunstihoone galeriis 31. jaanuarini 2010. Kuraator Anders Härm. Näituse ajendiks on 1. juulist 2009 Eestis kehtima hakanud töölepinguseadus, näituse fookus on töösuhetel

  7. Inventories and upstream gasoline price dynamics

    NARCIS (Netherlands)

    Kuper, Gerard H.

    This paper sheds new light on the asymmetric dynamics in upstream U.S. gasoline prices. The model is based on Pindyck's inventory model of commodity price dynamics. We show that asymmetry in gasoline price dynamics is caused by changes in the net marginal convenience yield: higher costs of marketing

  8. Aspects concerning the internal audit of inventories

    Directory of Open Access Journals (Sweden)

    Cristina IOVU

    2017-05-01

    In the second section, an analysis of the potential solutions for optimising the costs incurred with the consumptions of inventories from the point of view of the accounting/fiscal regulations, as well as their impact upon the accounting/fiscal results are presented.

  9. Forest inventory with terrestrial LiDAR

    NARCIS (Netherlands)

    Bauwens, Sébastien; Bartholomeus, Harm; Calders, Kim; Lejeune, Philippe

    2016-01-01

    The application of static terrestrial laser scanning (TLS) in forest inventories is becoming more effective. Nevertheless, the occlusion effect is still limiting the processing efficiency to extract forest attributes. The use of a mobile laser scanner (MLS) would reduce this occlusion. In this

  10. Personality Inventory Selection for Understanding Leadership Styles.

    Science.gov (United States)

    1987-06-05

    justifies using personality inventories to identify leadership styles and it compares the Sixteen Personality Factor Questionnaire and the Myers-Briggs Type...Indicator for consideration by the ACSC. The study concludes the MBTI has better interpretive value for the understanding of leadership styles .

  11. Development of the HD-Teen Inventory.

    Science.gov (United States)

    Driessnack, Martha; Williams, Janet K; Barnette, J Jackson; Sparbel, Kathleen J; Paulsen, Jane S

    2012-05-01

    Adolescents, who have a parent with Huntington Disease (HD), not only are at genetic risk for HD but also are witness to its onset and devastating clinical progression as their parent declines. To date, no mechanism has been developed to direct health care providers to the atypical adolescent experiences of these teens. The purpose of this report is to describe the process of developing the HD-Teen Inventory clinical assessment tool. Forty-eight teens and young adults from 19 U.S. states participated in the evaluation of the HD-Teen Inventory tool. Following item analysis, the number of items was reduced and item frequency and reaction scales were combined, based on the strong correlation (r = .94). The resultant tool contains 15 inventory and 2 open-ended response items. The HD-Teen Inventory emerged as a more compact and efficient tool for identifying the most salient concerns of at-risk teens in HD families in research and/or clinical practice.

  12. Inventory strategies for systems with fast remanufacturing

    NARCIS (Netherlands)

    R.H. Teunter (Ruud); E.A. van der Laan (Erwin); D. Vlachos (Dimitrios)

    2002-01-01

    textabstractWe describe hybrid manufacturing/remanufacturing systems with a long lead time for manufacturing and a short lead time for remanufacturing. We review the classes of inventory strategies for hybrid systems in the literature. These are all based on equal lead times. For systems with slow

  13. Optimal inventory management with supply backordering

    NARCIS (Netherlands)

    Jaksic, M.; Fransoo, J.C.

    2015-01-01

    We study the inventory control problem of a retailer working under stochastic demand and stochastic limited supply. We assume that the unfilled part of the retailer¿s order is fully backordered at the supplier and replenished with certainty in the following period. As it may not always be optimal

  14. Inventory of alloy composition, microstructures and mechanical ...

    African Journals Online (AJOL)

    Inventory of alloy composition, microstructures and mechanical properties of automobile engine parts. ... Journal of Applied Science, Engineering and Technology ... This research work investigated the chemical compositions, microstructures and mechanical properties of the ferrous and non-ferrous auto engine parts such ...

  15. Incomplete convolutions in production and inventory models

    NARCIS (Netherlands)

    Houtum, van G.J.J.A.N.; Zijm, W.H.M.

    1997-01-01

    In this paper, we study incomplete convolutions of continuous distribution functions, as they appear in the analysis of (multi-stage) production and inventory systems. Three example systems are discussed where these incomplete convolutions naturally arise. We derive explicit, nonrecursive formulae

  16. The Social Awareness Inventory: Development and Applications.

    Science.gov (United States)

    Sheldon, Kennon M.

    1996-01-01

    The Social Awareness Inventory (SAI), which assesses individual differences in eight social-perceptual styles, is introduced and applied in three studies. The model is derived by crossing the three binary dimensions of target (self or other), perspective (own or other's), and content (overt appearance or covert experience). The SAI appears to…

  17. Development of a Meiosis Concept Inventory

    Science.gov (United States)

    Kalas, Pamela; O'Neill, Angie; Pollock, Carol; Birol, Gulnur

    2013-01-01

    We have designed, developed, and validated a 17-question Meiosis Concept Inventory (Meiosis CI) to diagnose student misconceptions on meiosis, which is a fundamental concept in genetics. We targeted large introductory biology and genetics courses and used published methodology for question development, which included the validation of questions by…

  18. Shrink stope design using an inventory model

    Directory of Open Access Journals (Sweden)

    D. Taylor

    2003-12-01

    Full Text Available This paper addresses the fact that current practice in shrink-stoping in hard rock mining invariably ignores the inventory holding cost of the blasted ore. We believe, and show by example, that ignoring this cost could make the difference between profit and loss in an industry that, at present, needs all the help it can get.

  19. 23 CFR 650.315 - Inventory.

    Science.gov (United States)

    2010-04-01

    ... for collection by the FHWA as requested. A tabulation of this data is contained in the SI&A sheet distributed by the FHWA as part of the “Recording and Coding Guide for the Structure Inventory and Appraisal... version. Report the data using FHWA established procedures as outlined in the “Recording and Coding Guide...

  20. Inventory control with multiple setup costs

    NARCIS (Netherlands)

    Alp, O.; Huh, W.T.; Tan, T.

    2014-01-01

    We consider an infinite-horizon, periodic-review, single-item production/inventory system with random demand and backordering, where multiple setups are allowed in any period and a separate fixed cost is associated for each setup. Contrary to the majority of the literature on this topic, we do not