WorldWideScience

Sample records for inventory aperiodic blue

  1. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  2. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean

    2015-01-01

    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  3. Aperiodic Volume Optics

    Science.gov (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  4. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang

    2017-09-01

    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  5. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  6. Simulation of aperiodic bipedal sprinting.

    Science.gov (United States)

    Celik, Huseyin; Piazza, Stephen J

    2013-08-01

    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  7. Fjordic Environments of Scotland: A National Inventory of Sedimentary Blue Carbon.

    Science.gov (United States)

    Smeaton, Craig; Austin, William; Davies, Althea; Baltzer, Agnes; Howe, John

    2016-04-01

    Coastal sediments potentially hold a significant store of carbon; yet there has been no comprehensive attempt to quantitatively determine the quantity of carbon in these stores. Using Scottish sea lochs (fjords) we have established a Holocene record of the quantity and type of carbon held within the sediment store of a typical Scottish sea loch. Through the use of both seismic geophysics and geochemical measurements we have developed a methodology to make first-order estimations of the carbon held with the sediment of sea lochs. This methodology was applied to four sea lochs with differing geographical locations, catchments, freshwater inputs to produce the first sedimentary Blue Carbon estimates. The resulting carbon inventories show clearly that these sea lochs hold a significant store of sedimentary carbon; for example, Loch Sunart in Argyll stores an estimated 26.88 ± 0.52 Mt C. A direct comparison of the organic carbon content per unit area suggest sea lochs have a greater OC storage potential between than Scottish peatlands on long, Holocene timescales (Loch Sunart = 0.234 Mt OC km-2; Peatland = 0.093 Mt OC km-2 (Chapman et al. 2009). The carbon values calculated for these sea lochs have been used to estimate the total carbon held within Scotland's 110 sea lochs and these up-scaled estimations are for the first time, reviewed in the context of Scotland's known terrestrial stores. Chapman, S. J., Bell, J., Donnelly, D. and Lilly, A.: Carbon stocks in Scottish peatlands, Soil Use Manag., 25(2), 105-112, doi:10.1111/j.1475-2743.2009.00219.x, 2009.

  8. What is the value of biomass remote sensing data for blue carbon inventories?

    Science.gov (United States)

    Byrd, K. B.; Simard, M.; Crooks, S.; Windham-Myers, L.

    2015-12-01

    The U.S. is testing approaches for accounting for carbon emissions and removals associated with wetland management according to 2013 IPCC Wetlands Supplement guidelines. Quality of reporting is measured from low (Tier 1) to high (Tier 3) depending upon data availability and analytical capacity. The use of satellite remote sensing data to derive carbon stocks and flux provides a practical approach for moving beyond IPCC Tier 1, the global default factor approach, to support Tier 2 or Tier 3 quantification of carbon emissions or removals. We are determining the "price of precision," or the extent to which improved satellite data will continue to increase the accuracy of "blue carbon" accounting. Tidal marsh biomass values are needed to quantify aboveground carbon stocks and stock changes, and to run process-based models of carbon accumulation. Maps of tidal marsh biomass have been produced from high resolution commercial and moderate resolution Landsat satellite data with relatively low error [percent normalized RMSE (%RMSE) from 7 to 14%]. Recently for a brackish marsh in Suisun Bay, California, we used Landsat 8 data to produce a biomass map that applied the Wide Dynamic Range Vegetation Index (WDRVI) (ρNIR*0.2 - ρR)/(ρNIR*0.2+ρR) to fully vegetated pixels and the Simple Ratio index (ρRed/ρGreen) to pixels with a mix of vegetation and water. Overall RMSE was 208 g/m2, while %RMSE = 13.7%. Also, preliminary use of airborne and spaceborne RADAR data in coastal Louisiana produced a marsh biomass map with 30% error. The integration of RADAR and LiDAR with optical remote sensing data has the potential to further reduce error in biomass estimation. In 2017, nations will report back to the U.N. Framework Convention on Climate Change on their experience in applying the Wetlands Supplement guidelines. These remote sensing efforts will mark an important step toward quantifying human impacts to wetlands within the global carbon cycle.

  9. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.

    1997-01-01

    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  10. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

    2011-01-01

    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  11. Periodic and aperiodic synchronization in skilled action

    Directory of Open Access Journals (Sweden)

    Fred eCummins

    2011-12-01

    Full Text Available Synchronized action is considered as a manifestation of shared skill. Most synchronized behaviors in humans and other animals are based on periodic repetition. Aperiodic synchronization of complex action is found in the experimental task of synchronous speaking, in which naive subjects read a common text in lock step. The demonstration of synchronized behavior without a periodic basis is presented as a challenge for theoretical understanding. A unified treatment of periodic and aperiodic synchronization is suggested by replacing the sequential processing model of cognitivist approaches with the more local notion of a task-specific sensorimotor coordination. On this view, skilled action is the imposition of constraints on the co-variation of movement and sensory flux such that the boundary conditions that define the skill are met. This non-cognitivist approach originates in the work of John Dewey. It allows a unification of the treatment of sensorimotor synchronization in simple rhythmic behavior and in complex skilled behavior and it suggests that skill sharing is a uniquely human trait of considerable import.

  12. Robust Optimization of Aperiodic Photonic Structures

    Science.gov (United States)

    Nohadani, Omid; Meng Teo, Kwong; Bertsimas, Dimitris

    2007-03-01

    In engineering design, the physical properties of a system can often only be described by numerical simulation. Optimization of such systems is usually accomplished heuristically without taking into account that there are implementation errors that lead to very suboptimal, and often, infeasible solutions. We present a novel robust optimization method for electromagnetic scattering problems with large degrees of freedom, and report on results when this technique is applied to optimization of aperiodic dielectric structures. The spatial configuration of 50 dielectric scattering cylinders is optimized to match a desired target function such that the optimal arrangement is robust against placement and prototype errors. Our optimization method inherently improves the robustness of the optimized solution with respect to relevant errors and is suitable for real-world design of materials with novel electromagnetic functionalities.

  13. Surface plasmon field enhancements in deterministic aperiodic structures.

    Science.gov (United States)

    Shugayev, Roman

    2010-11-22

    In this paper we analyze optical properties and plasmonic field enhancements in large aperiodic nanostructures. We introduce extension of Generalized Ohm's Law approach to estimate electromagnetic properties of Fibonacci, Rudin-Shapiro, cluster-cluster aggregate and random deterministic clusters. Our results suggest that deterministic aperiodic structures produce field enhancements comparable to random morphologies while offering better understanding of field localizations and improved substrate design controllability. Generalized Ohm's law results for deterministic aperiodic structures are in good agreement with simulations obtained using discrete dipole method.

  14. Aperiodic space-time modulation for pure frequency mixing

    Science.gov (United States)

    Taravati, Sajjad

    2018-03-01

    This paper experimentally demonstrates the effects of inharmonic photonic transition in tailored aperiodic space-time refractive index modulated media. Such effects introduce a pure frequency mixing based on the simultaneous and distinct shifts in the spatial and temporal frequencies. The medium is characterized with a periodic temporal modulation and a tailored aperiodic spatially modulated permittivity and permeability, yielding aperiodic, large and tunable photonic band gaps. Since the medium is time periodic, an infinite number of space-time mixing products are generated with a distance equal to the temporal frequency of the pump wave. However, thanks to the tailored spatial aperiodicity of the medium and associated photonic band gaps, transition to unwanted space-time mixing products is prohibited. Interesting features include tunability of the operation frequencies of the mixer via space-time modulation parameters, high isolation, linear response, and possibility of conversion gain due to the transfer of energy and momentum of the space-time modulation to the input wave. We derive the analytical solution for such mixer with aperiodic space-modulated permittivity and permeability and periodic time modulation, and then provide the synthesis procedure which takes into account the effects of space-time modulation inhomogeneity. Finally, to see the effect of the tailoring of space modulation, we compare the experimental results of the aperiodic space-time modulated pure mixer with those of the conventional periodic uniform space-time modulated medium.

  15. Applications the Lagrangian description in aperiodic flows

    Science.gov (United States)

    Mendoza, Carolina; Mancho, Ana Maria

    2012-11-01

    We use several recently developed Lagrangian tools for describing transport in general aperiodic flows. In our approach the first step is based in a Lagrangian descriptor (the so called function M). It measures the length of particle trajectories on the ocean surface over a given interval of time. We describe its output over satellite altimetry data on the Kuroshio current. The technique is combined with the direct computation of manifolds of Distinguished Hyperbolic trajectories and a very detailed description of transport is achieved across an eddy and a jet on the Kuroshio current,. A second velocity data set is examined with the M function tool. These are obtained from the HYCOM project on the Gulf of Mexico during the time of the oil-spill. We have identified underlying Lagrangian structures and dynamics. We acknowledge to the hospitality of the university of Delaware and the assistance of Bruce Lipphardt and Helga Huntley in accessing the model data sets. We acknowledge to the grants: UPM-AL12-PAC-09, Becas de Movilidad de Caja Madrid 2011, MTM2011-26696 and ILINK-0145.

  16. Simulation Methods for Multiperiodic and Aperiodic Nanostructured Dielectric Waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    , L. Dal Negro, Optical gap formation and localization properties of optical modes in deterministic aperiodic photonic structures, Opt. Express 16, 18813, 2008 [2] E. Maciá, Exploiting aperiodic designs in nanophotonic devices, Rep Prog Phys 75, 036502, 2012 [3] C. Kluge, J. Adam, N. Barié, P. J....... Jakobs, M. Guttmann, M. Gerken, Multiperiodic nanostructures for photon control, Opt. Express 22, A1363-A1371, 2014 [4] L. T. Neustock, S. Jahns, J. Adam, M. Gerken, Optical waveguides with compound grating nanostructures for refractive index sensing, J. of Sensors, 6174527, 2016...

  17. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  18. A method to identify aperiodic disturbances in the ionosphere

    Directory of Open Access Journals (Sweden)

    J.-S. Wang

    2014-05-01

    Full Text Available In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM, a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  19. Aperiodic Multiprocessor Scheduling for Real-Time Stream Processing Applications

    NARCIS (Netherlands)

    Wiggers, M.H.

    2009-01-01

    This thesis is concerned with the computation of buffer capacities that guarantee satisfaction of timing and resource constraints for task graphs with aperiodic task execution rates that are executed on run-time scheduled resources. Stream processing applications such as digital radio baseband

  20. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

    2015-01-01

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  1. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

    Science.gov (United States)

    Kumar, Pawan; Parmananda, P.

    2018-04-01

    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  2. Engineering aperiodic nanostructured surfaces for scattering-based optical devices

    Science.gov (United States)

    Lee, Yuk Kwan Sylvanus

    Novel optical devices such as biosensors, color displays and authentication devices can be obtained from the distinctive light scattering properties of resonant nanoparticles and nanostructured arrays. These arrays can be optimized through the choice of material, particle morphology and array geometry. In this thesis, by engineering the multi-frequency colorimetric responses of deterministic aperiodic nanostructured surfaces (DANS) with various spectral Fourier properties, I designed, fabricated and characterized scattering-based devices for optical biosensing and structural coloration applications. In particular, using analytical and numerical optimization, colorimetric biosensors are designed and fabricated with conventional electron beam lithography, and characterized using dark-field scattering imaging as well as image autocorrelation analysis of scattered intensity in the visible spectral range. These sensors, which consist of aperiodic surfaces ranging from quasi-periodic to pseudo-random structures with flat Fourier spectra, sustain highly complex structural resonances that enable a novel optical sensing approach beyond the traditional Bragg scattering. To this end, I have experimentally demonstrated that DANS with engineered structural colors are capable of detecting nanoscale protein monolayers with significantly enhanced sensitivity over periodic structures. In addition, different aperiodic arrays of gold (Au) nanoparticles are integrated with polydimethylsiloxane (PDMS) microfluidic structures by soft-lithographic micro-imprint techniques. Distinctive scattering spectral shifts and spatial modifications of structural color patterns in response to refractive index variations were simultaneously measured. The successful integration of DANS with microfluidics technology has introduced a novel opto-fluidic sensing platform for label-free and multiplexed lab-on-a-chip applications. Moreover, by studying the isotropic scattering properties of homogenized

  3. Simulation methods for multiperiodic and aperiodic nanostructured dielectric waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    2017-01-01

    on Rudin–Shapiro, Fibonacci, and Thue–Morse binary sequences. The near-field and far-field properties are computed employing the finite-element method (FEM), the finite-difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). The results show that all three methods......, a comparison of experimental results and simulation results obtained with three different simulation methods is presented. We fabricated and characterized multiperiodic nanostructured dielectric waveguides with two and three compound periods as well as deterministic aperiodic nanostructured waveguides based...

  4. Investigation of Aperiodic Time Processes with Autocorrelation and Fourier Analysis

    Science.gov (United States)

    Exner, Marie Luise

    1958-01-01

    Autocorrelation and frequency analyses of a series of aperiodic time events, in particular, filtered noises and sibilant sounds, were made. The position and band width of the frequency ranges are best obtained from the frequency analysis, but the energies contained in the several bands are most easily obtained from the autocorrelation function. The mean number of zero crossings of the time function was determined from the curvature of the latter function in the vicinity of the zero crossing, and also with the aid of a decimal counter. The second method was found to be more exact.

  5. Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

    Science.gov (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

    2017-11-07

    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  6. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    Energy Technology Data Exchange (ETDEWEB)

    Xie Yong E-mail: xie813@263.net; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

    2004-10-01

    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells.

  7. A Meta-Analysis of Aperiodic Noise Stress on Human Performance

    National Research Council Canada - National Science Library

    Saxton, B. M; Ross, J. M; Braczyk, A; Conway, G. E; Szalma, J. L; Hancock, P. A

    2006-01-01

    Aperiodic noise, also known as intermittent noise, is a pervasive and influential source of stress across military environments, and can be defined by the changes in its intensity over a given period of time...

  8. Bias driven coherent carrier dynamics in a two-dimensional aperiodic potential

    NARCIS (Netherlands)

    de Moura, F. A. B. F.; Viana, L. P.; Lyra, M. L.; Malyshev, Victor; Dominguez-Adame, F.

    2008-01-01

    We study the dynamics of an electron wave-packet in a two-dimensional square lattice with an aperiodic site potential in the presence of an external uniform electric field. The aperiodicity is described by epsilon(m) = V cos(pi alpha m(x)(nu x)) cos(pi alpha m(y)(nu y)) at lattice sites (m(x),m(y)),

  9. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

    2014-01-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

  10. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1992-01-01

    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  11. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue

    2011-01-01

    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  12. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure.

    Science.gov (United States)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

    2013-12-01

    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air-cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one.

  13. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

    2012-01-01

    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  14. Asymptotic period of an aperiodic Markov chain and the strong ratio limit property

    NARCIS (Netherlands)

    van Doorn, Erik A.

    We introduce the concept of asymptotic period for an irreducible and aperiodic discrete-time Markov chain on a countable state space. If the chain is transient its asymptotic period may be larger than one. We present some sufficient conditions and, in the more restricted setting of birth-death

  15. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  16. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  17. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li

    2014-04-01

    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  18. Spatial and spectral detection of protein monolayers with deterministic aperiodic arrays of metal nanoparticles

    Science.gov (United States)

    Lee, Sylvanus Y.; Amsden, Jason J.; Boriskina, Svetlana V.; Gopinath, Ashwin; Mitropolous, Alexander; Kaplan, David L.; Omenetto, Fiorenzo G.; Negro, Luca Dal

    2010-01-01

    Light scattering phenomena in periodic systems have been investigated for decades in optics and photonics. Their classical description relies on Bragg scattering, which gives rise to constructive interference at specific wavelengths along well defined propagation directions, depending on illumination conditions, structural periodicity, and the refractive index of the surrounding medium. In this paper, by engineering multifrequency colorimetric responses in deterministic aperiodic arrays of nanoparticles, we demonstrate significantly enhanced sensitivity to the presence of a single protein monolayer. These structures, which can be readily fabricated by conventional Electron Beam Lithography, sustain highly complex structural resonances that enable a unique optical sensing approach beyond the traditional Bragg scattering with periodic structures. By combining conventional dark-field scattering micro-spectroscopy and simple image correlation analysis, we experimentally demonstrate that deterministic aperiodic surfaces with engineered structural color are capable of detecting, in the visible spectral range, protein layers with thickness of a few tens of Angstroms. PMID:20566892

  19. Aperiodicity in one-way Markov cycles and repeat times of large earthquakes in faults

    OpenAIRE

    Tejedor, Alejandro; Gómez, Javier; Pacheco, Amalio F.

    2011-01-01

    A common use of Markov Chains is the simulation of the seismic cycle in a fault, i.e. as a renewal model for the repetition of its characteristic earthquakes. This representation is consistent with Reid's elastic rebound theory. Here it is proved that in {\\it any} one-way Markov cycle, the aperiodicity of the corresponding distribution of cycle lengths is always lower than one. This fact concurs with observations of large earthquakes in faults all over the world.

  20. Blue lesions.

    Science.gov (United States)

    Longo, Caterina; Scope, Alon; Lallas, Aimilios; Zalaudek, Iris; Moscarella, Elvira; Gardini, Stefano; Argenziano, Giuseppe; Pellacani, Giovanni

    2013-10-01

    Blue color is found in a wide range of malignant and benign melanocytic and nonmelanocytic lesions and in lesions that result from penetration of exogenous materials, such as radiation or amalgam tattoo or traumatic penetration of particles. Discriminating between different diagnostic entities that display blue color relies on careful patient examination and lesion assessment. Dermoscopically, the extent, distribution, and patterns created by blue color can help diagnose lesions with specificity and differentiate between benign and malignant entities. This article provides an overview of the main diagnoses whereby blue color can be found, providing simple management rules for these lesions. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Homogenization procedures for the constitutive material modeling and analysis of aperiodic micro-structures

    Science.gov (United States)

    Aghalaya Manjunatha, Preetham

    Composite materials are the well-known substitutes for traditional metals in various industries because of their micro-structural character. Micro-structures provide a high strength-to-weight ratio, which makes them suitable for manufacturing large variety of applications ranging from simple toys to complicated space/aircraft structures. Since, these materials are widely used in high performance structures, their stress/thermal analysis issues are of major concern. Due to the high degree of material heterogeneity, it is extremely difficult to analyze such structures. Homogenization (rigorous averaging) is a process that overcomes the difficulty of modeling each micro-structure. It replaces an individual micro-structure by an equivalent material model representation (unit cell). Periodic micro-structures appear in regular intervals throughout the domain, in contrast aperiodic micro-structures follows an irregular pattern. Further, this method bridges the analysis gap between micro and macro domain of the structures. In this thesis, Homogenization procedure based on anti-periodic displacement fields for aperiodic micro-structures and aperiodic boundary conditions are considered to model the constitutive material matrix. This work could be easily implemented with the traditional finite element packages. In addition, it eventually increases the convergence accuracy and reduces the high computational expenses. Different problems are analyzed by the implementation of digital image processing schemes for the extraction of a unit cell around the Gauss quadrature points and the mesh-generation. In the future, this research defines a new path for the analysis of any random heterogeneous materials by its ease of implementation and the state-of-the-art micro-structure material modeling capabilities and digital image based micro-meshing.

  2. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos

    2015-05-01

    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  3. Rapidly tunable optical parametric oscillator based on aperiodic quasi-phase matching.

    Science.gov (United States)

    Descloux, Delphine; Dherbecourt, Jean-Baptiste; Melkonian, Jean-Michel; Raybaut, Myriam; Lai, Jui-Yu; Drag, Cyril; Godard, Antoine

    2016-05-16

    A new optical parametric oscillator (OPO) architecture with high tuning speed capability is demonstrated. This device exploits the versatility offered by aperiodic quasi-phase matching (QPM) to provide a broad parametric gain spectrum without changing the temperature, angle, or position of the nonlinear crystal. Rapid tuning is then straightforwardly achieved using a fast intracavity spectral filter. This concept is demonstrated here for a picosecond synchronously pumped OPO containing an aperiodically poled MgO-doped LiNbO3 crystal and a rapidly tunable spectral filter based on a diffraction grating. Tuning over 160 nm around 3.86 μm is achieved at fixed temperature and a fast tuning over 30 nm in 40 μs is demonstrated. Different configurations are tested and compared. The cavity length detuning is analyzed and discussed. This device is successfully used to detect N2O by absorption. This approach could be generalized to other spectral ranges (e.g., visible) and temporal regimes (e.g., continuous-wave or nanosecond).

  4. Aperiodic linear networked control considering variable channel delays: application to robots coordination.

    Science.gov (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

    2015-05-27

    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  5. Blue gods, blue oil, and blue people.

    Science.gov (United States)

    Fairbanks, V F

    1994-09-01

    Studies of the composition of coal tar, which began in Prussia in 1834, profoundly affected the economies of Germany, Great Britain, India, and the rest of the world, as well as medicine and surgery. Such effects include the collapse of the profits of the British indigo monopoly, the growth in economic power of Germany based on coal tar chemistry, and an economic crisis in India that led to more humane tax laws and, ultimately, the independence of India and the end of the British Empire. Additional consequences were the development of antiseptic surgery and the synthesis of a wide variety of useful drugs that have eradicated infections and alleviated pain. Many of these drugs, particularly the commonly used analgesics, sulfonamides, sulfones, and local anesthetics, are derivatives of aniline, originally called "blue oil" or "kyanol." Some of these aniline derivatives, however, have also caused aplastic anemia, agranulocytosis, and methemoglobinemia (that is, "blue people"). Exposure to aniline drugs, particularly when two or three aniline drugs are taken concurrently, seems to be the commonest cause of methemoglobinemia today.

  6. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    Science.gov (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  7. Swinging multi-source industrial CT systems for aperiodic dynamic imaging.

    Science.gov (United States)

    Wu, Weiwen; Yu, Hengyong; Gong, Changcheng; Liu, Fenglin

    2017-10-02

    The goal of this paper is to develop a new architecture for industrial computed tomography (ICT) aiming at dynamically imaging an aperiodic changing object. We propose a data acquisition approach with multiple x-ray source/detector pairs targeting a continuously changeable object with corresponding timeframes. In this named swinging multi-source CT (SMCT) structure, each source and its associated detector swing forth and back within a certain angle for CT scanning. In the SMCT system design, we utilize a circular journal bearing based setup to replace the normal CT slip ring by weakening the scanning speed requirement. Inspired by the prior image constrained compressed sensing (PICCS) algorithm, we apply a modified PICCS algorithm for the SMCT (SM-PICCS). Our numerical simulation and realistic specimen experiment studies demonstrate the feasibility of the proposed approach.

  8. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.

    1992-09-01

    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  9. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  10. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

    2012-02-01

    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  11. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...... on the IEEE 14-bus and the Nordic32 test systems where results show that the method can efficiently determine the required active power redispatch to avoid an imminent instability....

  12. Velocity Fluctuations Driven by the Damped, Aperiodic Mode in the Intergalactic Medium

    Science.gov (United States)

    Kolberg, U.; Schlickeiser, R.; Yoon, P. H.

    2017-08-01

    On account of its finite temperature, the unmagnetized intergalactic medium (IGM) is subject to thermal fluctuations. Due to the fundamental coupling between particles and fields in a plasma, the field fluctuations generate current densities by means of the Lorentz force and thereby affect both the density and the velocity fluctuations of the particles. Recently, a new damped, aperiodic mode was discovered that dominates field fluctuations in the IGM. Apart from its impact on the transport properties of the IGM that determine the propagation of cosmic rays, previous research has shown that this mode provides turbulent magnetic seed fields of 6× {10}-18 {{G}} that are an essential ingredient in the generation of cosmic magnetic fields. The current investigation addresses the influence of the mode on the particle motion. In order to describe the corresponding state of the turbulence, both the spectrum and the integrated total value of the mode-driven proton velocity fluctuations are computed. It is found that the latter amounts to 1.16× {10}8{ T}47/2{n}-7-1/2 {cm} {{{s}}}-1 assuming a temperature of {T}e={T}p={10}4{T}4 {{K}} and a density of {n}e={n}p={10}-7{n}-7 {{cm}}-3. This value is two orders of magnitude larger than the thermal velocity. If the IGM neutrals adopt the same velocities as the protons by mutual charge exchange and elastic collisions (ambipolar diffusion), atomic lines propagating through the IGM are expected to display spectral broadening, enhanced by a factor of 90 beyond the thermal level in the case of hydrogen. This opens the window to a first direct observation of the damped aperiodic mode. Other observational techniques such as dispersion measure, rotation measure, and scintillation data are not applicable in this case because the mode is a transverse one, and, as such, it does not induce the required density fluctuations, as is shown here.

  13. Inventory parameters

    CERN Document Server

    Sharma, Sanjay

    2017-01-01

    This book provides a detailed overview of various parameters/factors involved in inventory analysis. It especially focuses on the assessment and modeling of basic inventory parameters, namely demand, procurement cost, cycle time, ordering cost, inventory carrying cost, inventory stock, stock out level, and stock out cost. In the context of economic lot size, it provides equations related to the optimum values. It also discusses why the optimum lot size and optimum total relevant cost are considered to be key decision variables, and uses numerous examples to explain each of these inventory parameters separately. Lastly, it provides detailed information on parameter estimation for different sectors/products. Written in a simple and lucid style, it offers a valuable resource for a broad readership, especially Master of Business Administration (MBA) students.

  14. Posthuman blues

    CERN Document Server

    Tonnies, Mac

    2013-01-01

    Posthuman Blues, Vol. I is first volume of the edited version of the popular weblog maintained by author Mac Tonnies from 2003 until his tragic death in 2009. Tonnies' blog was a pastiche of his original fiction, reflections on his day-to-day life, trenchant observations of current events, and thoughts on an eclectic range of material he culled from the Internet. What resulted was a remarkably broad portrait of a thoughtful man and the complex times in which he lived, rendered with intellige...

  15. Riparian Inventory

    Data.gov (United States)

    Kansas Data Access and Support Center — This dataset is a digital representation of the 1:24,000 Land Use Riparian Areas Inventory for the state of Kansas. The dataset includes a 100 foot buffer around all...

  16. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon

    2009-06-01

    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  17. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

    Science.gov (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

    2018-03-01

    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  18. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    Science.gov (United States)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  19. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

    2011-01-01

    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  20. Aperiodic and randomized dielectric mirrors: alternatives to metallic back reflectors for solar cells.

    Science.gov (United States)

    Lin, Albert; Zhong, Yan-Kai; Fu, Sze-Ming; Tseng, Chi Wei; Yan, Sheng Lun

    2014-05-05

    Dielectric mirrors have recently emerged for solar cells due to the advantages of lower cost, lower temperature processing, higher throughput, and zero plasmonic absorption as compared to conventional metallic counterparts. Nonetheless, in the past, efforts for incorporating dielectric mirrors into photovoltaics were not successful due to limited bandwidth and insufficient light scattering that prevented their wide usage. In this work, it is shown that the key for ultra-broadband dielectric mirrors is aperiodicity, or randomization. In addition, it has been proven that dielectric mirrors can be widely applicable to thin-film and thick wafer-based solar cells to provide for light trapping comparable to conventional metallic back reflectors at their respective optimal geometries. Finally, the near-field angular emission plot of Poynting vectors is conducted, and it further confirms the superior light-scattering property of dielectric mirrors, especially for diffuse medium reflectors, despite the absence of surface plasmon excitation. The preliminary experimental results also confirm the high feasibility of dielectric mirrors for photovoltaics.

  1. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

    Science.gov (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

    2001-04-01

    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  2. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

    Science.gov (United States)

    Koju, Vijay

    Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

  3. [Anaphylaxis to blue dyes].

    Science.gov (United States)

    Langner-Viviani, F; Chappuis, S; Bergmann, M M; Ribi, C

    2014-04-16

    In medicine, vital blue dyes are mainly used for the evaluation of sentinel lymph nodes in oncologic surgery. Perioperative anaphylaxis to blue dyes is a rare but significant complication. Allergic reactions to blue dyes are supposedly IgE-mediated and mainly caused by triarylmethanes (patent blue and isosulfane blue) and less frequently by methylene blue. These substances usually do not feature on the anesthesia record and should not be omitted from the list of suspects having caused the perioperative reaction, in the same manner as latex and chlorhexidine. The diagnosis of hypersensitivity to vital blue dyes can be established by skin test. We illustrate this topic with three clinical cases.

  4. Optimization of Inventory

    OpenAIRE

    PROKOPOVÁ, Nikola

    2017-01-01

    The subject of this thesis is optimization of inventory in selected organization. Inventory optimization is a very important topic in each organization because it reduces storage costs. At the beginning the inventory theory is presented. It shows the meaning and types of inventory, inventory control and also different methods and models of inventory control. Inventory optimization in the enterprise can be reached by using models of inventory control. In the second part the company on which is...

  5. Blue cures blue but be cautious

    Directory of Open Access Journals (Sweden)

    Pranav Sikka

    2011-01-01

    Full Text Available Methemoglobinemia is a disorder characterized by the presence of >1% methemoglobin (metHb in the blood. Spontaneous formation of methemoglobin is normally counteracted by protective enzyme systems, for example, nicotinamide adenine dinucleotide phosphate (NADPH methemoglobin reductase. Methemoglobinemia is treated with supplemental oxygen and methylene blue (1-2 mg/kg administered slow intravenously, which acts by providing an artificial electron acceptor for NADPH methemoglobin reductase. But known or suspected glucose-6-phosphate dehydrogenase (G6PD deficiency is a relative contraindication to the use of methylene blue because G6PD is the key enzyme in the formation of NADPH through pentose phosphate pathway and G6PD-deficient individuals generate insufficient NADPH to efficiently reduce methylene blue to leukomethylene blue, which is necessary for the activation of the NADPH-dependent methemoglobin reductase system. So, we should be careful using methylene blue in methemoglobinemia patient before G6PD levels.

  6. Blue-Green Algae

    Science.gov (United States)

    ... people with hepatitis C or hepatitis B. HIV/AIDS. Research on the effects of blue-green algae in people with HIV/AIDS has been inconsistent. Some early research shows that taking 5 grams of blue-green ...

  7. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

    Science.gov (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

    2017-12-01

    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  8. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

    Science.gov (United States)

    Kato, N.

    2017-12-01

    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  9. On the thickness of accretion curtains on magnetized compact objects from analysis of their fast aperiodic time variability.

    Science.gov (United States)

    Semena, Andrey

    It is widely accepted that accretion onto magnetized compact objects is channelled to some areas close to magnetic poles of the star. Thickness of this channelled accretion flow intimately depends on details of penetration of highly conducting plasma of the flow to the compact object magnetosphere, i.e. on magnetic diffusivity etc. Until now our knowledge of these plasma properties is scarce. In our work we present our attempts to estimate the thickness of the plasma flow on top of the magnetosphere from observations of accreting intermediate polars (magnetized white dwarfs). We show that properties of aperiodic noise of accreting intermediate polars can be used to put constrains on cooling time of hot plasma, heated in the standing shock wave above the WD surface. Estimates of the cooling time and the mass accretion rate provide us a tool to measure the density of post-shock plasma and the cross-sectional area of the accretion funnel at the WD surface. We have studied aperiodic noise of emission of one of the brightest intermediate polar EX Hya with the help of data in optical and X-ray energy bands. We put an upper limit on the plasma cooling timescale tau <0.2-0.5 sec, on the fractional area of the accretion curtain footprint f < 1.6 × 10(-4) . We show that measurements of accretion column footprints, combined with results of the eclipse mapping, can be used to obtain an upper limit on the penetration depth of the accretion disc plasma at the boundary of the magnetosphere, Delta r / r ≈ 10(-3) If the magnetospheres of accreting neutron stars have similar plasma penetration depths at their boundaries, we predict that footprints of their accretion columns should be very small, with fractional areas < 10(-6) .

  10. Blue Ocean Thinking

    Science.gov (United States)

    Orem, Donna

    2016-01-01

    This article describes a concept called the "blue ocean thinking strategy," developed by W. Chan Kim and Renée Mauborgne, professors at INSEAD, an international graduate school of business in France. The "blue ocean" thinking strategy considers opportunities to create new markets for services, rather than focusing solely on…

  11. Analysis and prediction of aperiodic hydrodynamic oscillatory time series by feed-forward neural networks, fuzzy logic, and a local nonlinear predictor

    Energy Technology Data Exchange (ETDEWEB)

    Gentili, Pier Luigi, E-mail: pierluigi.gentili@unipg.it [Department of Chemistry, Biology and Biotechnology, University of Perugia, 06123 Perugia (Italy); Gotoda, Hiroshi [Department of Mechanical Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu-shi, Shiga 525-8577 (Japan); Dolnik, Milos; Epstein, Irving R. [Department of Chemistry, Brandeis University, Waltham, Massachusetts 02454-9110 (United States)

    2015-01-15

    Forecasting of aperiodic time series is a compelling challenge for science. In this work, we analyze aperiodic spectrophotometric data, proportional to the concentrations of two forms of a thermoreversible photochromic spiro-oxazine, that are generated when a cuvette containing a solution of the spiro-oxazine undergoes photoreaction and convection due to localized ultraviolet illumination. We construct the phase space for the system using Takens' theorem and we calculate the Lyapunov exponents and the correlation dimensions to ascertain the chaotic character of the time series. Finally, we predict the time series using three distinct methods: a feed-forward neural network, fuzzy logic, and a local nonlinear predictor. We compare the performances of these three methods.

  12. Analysis and prediction of aperiodic hydrodynamic oscillatory time series by feed-forward neural networks, fuzzy logic, and a local nonlinear predictor.

    Science.gov (United States)

    Gentili, Pier Luigi; Gotoda, Hiroshi; Dolnik, Milos; Epstein, Irving R

    2015-01-01

    Forecasting of aperiodic time series is a compelling challenge for science. In this work, we analyze aperiodic spectrophotometric data, proportional to the concentrations of two forms of a thermoreversible photochromic spiro-oxazine, that are generated when a cuvette containing a solution of the spiro-oxazine undergoes photoreaction and convection due to localized ultraviolet illumination. We construct the phase space for the system using Takens' theorem and we calculate the Lyapunov exponents and the correlation dimensions to ascertain the chaotic character of the time series. Finally, we predict the time series using three distinct methods: a feed-forward neural network, fuzzy logic, and a local nonlinear predictor. We compare the performances of these three methods.

  13. Blue ocean strategy.

    Science.gov (United States)

    Kim, W Chan; Mauborgne, Renée

    2004-10-01

    Despite a long-term decline in the circus industry, Cirque du Soleil profitably increased revenue 22-fold over the last ten years by reinventing the circus. Rather than competing within the confines of the existing industry or trying to steal customers from rivals, Cirque developed uncontested market space that made the competition irrelevant. Cirque created what the authors call a blue ocean, a previously unknown market space. In blue oceans, demand is created rather than fought over. There is ample opportunity for growth that is both profitable and rapid. In red oceans--that is, in all the industries already existing--companies compete by grabbing for a greater share of limited demand. As the market space gets more crowded, prospects for profits and growth decline. Products turn into commodities, and increasing competition turns the water bloody. There are two ways to create blue oceans. One is to launch completely new industries, as eBay did with online auctions. But it's much more common for a blue ocean to be created from within a red ocean when a company expands the boundaries of an existing industry. In studying more than 150 blue ocean creations in over 30 industries, the authors observed that the traditional units of strategic analysis--company and industry--are of limited use in explaining how and why blue oceans are created. The most appropriate unit of analysis is the strategic move, the set of managerial actions and decisions involved in making a major market-creating business offering. Creating blue oceans builds brands. So powerful is blue ocean strategy, in fact, that a blue ocean strategic move can create brand equity that lasts for decades.

  14. Thermodynamically stable blue phases.

    Science.gov (United States)

    Castles, F; Morris, S M; Terentjev, E M; Coles, H J

    2010-04-16

    We show theoretically that flexoelectricity stabilizes blue phases in chiral liquid crystals. Induced internal polarization reduces the elastic energy cost of splay and bend deformations surrounding singular lines in the director field. The energy of regions of double twist is unchanged. This in turn reduces the free energy of the blue phase with respect to that of the chiral nematic phase, leading to stability over a wider temperature range. The theory explains the discovery of large temperature range blue phases in highly flexoelectric "bimesogenic" and "bent-core" materials, and predicts how this range may be increased further.

  15. Blue Ribbon Panel Report

    Science.gov (United States)

    An NCI Cancer Currents blog by the NCI acting director thanking the cancer community for contributing to the Cancer Moonshot Blue Ribbon Panel report, which was presented to the National Cancer Advisory Board on September 7.

  16. New York Blue

    Data.gov (United States)

    Federal Laboratory Consortium — New York Blue is used cooperatively by the Laboratory and Stony Brook University as part of the New York Center for Computation Sciences. Ranked as the 28th fastest...

  17. World Glacier Inventory

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The World Glacier Inventory (WGI) contains information for over 130,000 glaciers. Inventory parameters include geographic location, area, length, orientation,...

  18. Housing Inventory Count

    Data.gov (United States)

    Department of Housing and Urban Development — This report displays the data communities reported to HUD about the nature of their dedicated homeless inventory, referred to as their Housing Inventory Count (HIC)....

  19. HHS Enterprise Data Inventory

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Enterprise Data Inventory (EDI) is the comprehensive inventory listing of agency data resources including public, restricted public, and non-public datasets.

  20. Integrated inventory information system

    Digital Repository Service at National Institute of Oceanography (India)

    Sarupria, J.S.; Kunte, P.D.

    The nature of oceanographic data and the management of inventory level information are described in Integrated Inventory Information System (IIIS). It is shown how a ROSCOPO (report on observations/samples collected during oceanographic programme...

  1. National Wetlands Inventory Polygons

    Data.gov (United States)

    Minnesota Department of Natural Resources — Wetland area features mapped as part of the National Wetlands Inventory (NWI). The National Wetlands Inventory is a national program sponsored by the US Fish and...

  2. Science Inventory | US EPA

    Science.gov (United States)

    The Science Inventory is a searchable database of research products primarily from EPA's Office of Research and Development. Science Inventory records provide descriptions of the product, contact information, and links to available printed material or websites.

  3. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

    2012-01-01

    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  4. Inventory - Dollars and sense

    International Nuclear Information System (INIS)

    Samson, J.R.

    1992-01-01

    Nuclear utilities are becoming more aware of the importance of having an inventory investment that supports two opposing philosophies. The business philosophy wants a minimal inventory investment to support a better return on invested dollars. This increase in return comes from having the dollars available to invest versus having the money tied up in inventory sitting on the shelf. The opposing viewpoint is taken by maintenance/operations organizations, which desire the maximum inventory available on-site to repair any component at any time to keep the units on-line at all times. Financial managers also want to maintain cash flow throughout operations so that plants run without interruptions. Inventory management is therefore a mixture of financial logistics with an operation perspective in mind. A small amount of common sense and accurate perception also help. The challenge to the materials/inventory manager is to optimize effectiveness of the inventory by having high material availability at the lowest possible cost

  5. Natural Blue Food Colour

    DEFF Research Database (Denmark)

    Roda-Serrat, Maria Cinta

    In recent years, there has been a growing tendency to avoid the use of artificial colorants and additives in food products, especially after some studies linked their consumption with behavioural changes in children. However, the incorporation of colorants from natural origin remains a challenge...... for food technologists, as these are typically less vivid and less stable than their synthetic alternatives. Regarding blue colorants, phycocyanins from cyanobacteria are currently in the spotlight as promising new natural blue colorants. Phycocyanins are proteins which blue colour results from...... the presence of the chromophore phycocyanobilin (PCB), a covalently attached linear tetrapyrrole. The applications of phycocyanins as food colorants are however limited, as they show poor stability in certain conditions of pH, light and temperature. Cleavage of PCB from the protein followed by careful product...

  6. A Blue Lagoon Function

    DEFF Research Database (Denmark)

    Markvorsen, Steen

    2007-01-01

    We consider a specific function of two variables whose graph surface resembles a blue lagoon. The function has a saddle point $p$, but when the function is restricted to any given straight line through $p$ it has a {\\em{strict local minimum}} along that line at $p$.......We consider a specific function of two variables whose graph surface resembles a blue lagoon. The function has a saddle point $p$, but when the function is restricted to any given straight line through $p$ it has a {\\em{strict local minimum}} along that line at $p$....

  7. Vendor-managed inventory

    DEFF Research Database (Denmark)

    Govindan, Kannan

    2013-01-01

    Vendor-managed inventory (VMI) represents the methodology through which the upstream stage of a supply chain (vendor) takes responsibility for managing the inventories at the downstream stage (customer) based on previously agreed limits. VMI is another method by which supply chains can be managed...... review, we have identified six dimensions of VMI: namely, inventory, transportation, manufacturing, general benefits, coordination/collaboration, and information sharing. In addition, there are, three methodological classifications: modelling, simulation, and case studies. Finally, we will consider...

  8. The "Blue Banana" Revisited

    NARCIS (Netherlands)

    Faludi, A.K.F.

    2015-01-01

    This essay is about the “Blue Banana”. Banana is the name given subsequently by others to a Dorsale européenne (European backbone) identified empirically by Roger Brunet. In a background study to the Communication of the European Commission ‘Europe 2000’, Klaus Kunzmann and Michael Wegener put

  9. The Blue Baby Syndrome

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 8; Issue 10. The Blue Baby Syndrome - Nitrate Poisoning in Humans. Deepanjan Majumdar. General Article Volume 8 Issue 10 October 2003 pp 20-30. Fulltext. Click here to view fulltext PDF. Permanent link:

  10. National Wetlands Inventory Lines

    Data.gov (United States)

    Minnesota Department of Natural Resources — Linear wetland features (including selected streams, ditches, and narrow wetland bodies) mapped as part of the National Wetlands Inventory (NWI). The National...

  11. [Blue light and eye health].

    Science.gov (United States)

    Zou, Leilei; Dai, Jinhui

    2015-01-01

    Blue light, with the wavelength between 400 nm and 500 nm, has caused public concern because of the injury to the retinal cells. Meanwhile, it is important in circadian rhythm regulation, scotopic vision and ocular growth. Is the blue light safe? Should it be eliminated from the daily life? Here we review the effect and safety of the blue light.

  12. Denmark's National Inventory Report

    DEFF Research Database (Denmark)

    Illerup, J. B.; Lyck, E.; Winther, M.

    This report is Denmark's National Inventory Report reported to the Conference of the Parties under the United Nations Framework Convention on Climate Change (UNFCCC) due by 15 April 2001. The report contains information on Denmark's inventories for all years' from 1990 to 1999 for CO2, CH4, N2O, CO...

  13. Denmark's National Inventory Report

    DEFF Research Database (Denmark)

    Illerup, J. B.; Lyck, E.; Winther, M.

    This report is Denmark's National Inventory Report reported to the Conference of the Parties under the United Nations Framework Convention on Climate Change (UNFCCC) due by 15 April 2001. The report contains information on Denmark's inventories for all years' from 1990 to 1999 for CO2, CH4, N2O, ......, NMVOC, SO2, HFCs, PFCs and SF6....

  14. Integrated inventory and monitoring

    Science.gov (United States)

    George Lightner; Hans T. Schreuder; Barry Bollenbacher; Kerry McMenus

    2001-01-01

    Understanding and inventorying our ecological systems is key to addressing how issues, questions, and management actions will affect the composition, structure, and function of these systems. Taking an ecological systems approach to the inventory and monitoring framework, is one which we feel will allow answers to currently identified management questions and new ones...

  15. Functional continuity: did field-induced oriented aperiodic constraints at Life's origin aid its sequence-based evolution?

    Science.gov (United States)

    Mitra-Delmotte, G.; Mitra, A. N.

    2014-04-01

    A non-biological analog undergoing Darwinian-like evolution could have enhanced the probability of many crucial independent bottom-up emergent steps, engendered within its premises, and smoothen the inanimate-animate transition. Now, the higher-level environment-mutable DNA sequences influence the lower-level pattern of oriented templates (enzymes, lipid membranes, RNA) in the organized cell matrix and hence their associated substrate-dynamics; note how templates are akin to local fields, kinetically constraining reactant orientations. Since the lowerlevel is likely the more primitive of the two (rather than Cairns-Smith's "readily available" rigid clay crystal sequence-based replicators as a memory-like basis for slowly mutating predecessor-patterns enroute to complex RNA-based Darwinian evolution), a gradual thermodynamic-to-kinetic transition in an isotropic medium, is proposed as driven by some order-parameter --via "available" field-responsive dipolar colloid networks, as apart from bio-organics, mineral colloids also can display liquid crystal (LC) phases (see [1]). An access to solid-like orientational order in a fluid matrix suggests how aperiodic patterns can be influenced and sustained (a la homeostasis) via external inhomogeneous fields (e.g. magnetic rocks); this renders these cooperative networks with potential as confining host-media, whose environment-sensitivity can not only influence their sterically-coupled guest-substrates but also their network properties (the latter can enable 'functions' like spontaneous transport under non-equilibrium suggesting a natural basis for their selection by the environment). In turn LC systems could have been preceded by even simpler anisotropic fluid hosts, viz., external field-induced mineral magnetic nanoparticle (MNP) aggregates. Indeed, the capacity of an MNP to couple its magnetic and rotational d.o.f.s suggests how an environment-sensitive field-influenced network of interacting dipolar colloids close to

  16. Inventory control strategies

    International Nuclear Information System (INIS)

    Primrose, D.

    1998-01-01

    Finning International Inc. is in the business of selling, financing and servicing Caterpillar and complementary equipment. Its main markets are in western Canada, Britain and Chile. This paper discusses the parts inventory strategies system for Finning (Canada). The company's territory covers British Columbia, Alberta, the Yukon and the Northwest Territories. Finning's parts inventory consists of 80,000 component units valued at more than $150 M. Distribution centres are located in Langley, British Columbia and Edmonton, Alberta. To make inventory and orders easier to control, Finning has designed a computer-based system, with software written exclusively for Caterpillar dealers. The system makes use of a real time electronic interface with all Finning locations, plus all Caterpillar facilities and other dealers in North America. Details of the system are discussed, including territorial stocking procedures, addition to stock, exhaustion of stock, automatic/suggest order controls, surplus inventory management, and procedures for jointly managed inventory. 3 tabs., 1 fig

  17. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

    Science.gov (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

    2017-11-01

    A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

  18. Managing Air Quality - Emissions Inventories

    Science.gov (United States)

    This page describes the role of emission inventories in the air quality management process, a description of how emission inventories are developed, and where U.S. emission inventory information can be found.

  19. Interactive Inventory Monitoring

    Science.gov (United States)

    Garud, Sumedha

    2013-01-01

    Method and system for monitoring present location and/or present status of a target inventory item, where the inventory items are located on one or more inventory shelves or other inventory receptacles that communicate with an inventory base station through use of responders such as RFIDs. A user operates a hand held interrogation and display (lAD) module that communicates with, or is part of the base station to provide an initial inquiry. lnformation on location(s) of the larget invenlory item is also indicated visibly and/or audibly on the receptacle(s) for the user. Status information includes an assessment of operation readiness and a time, if known, that the specified inventory item or class was last removed or examined or modified. Presentation of a user access level may be required for access to the target inventgory item. Another embodiment provides inventory informatin for a stack as a sight-impaired or hearing-impaired person adjacent to that stack.

  20. SBA Network Components & Software Inventory

    Data.gov (United States)

    Small Business Administration — SBA’s Network Components & Software Inventory contains a complete inventory of all devices connected to SBA’s network including workstations, servers, routers,...

  1. VA Enterprise Data Inventory

    Data.gov (United States)

    Department of Veterans Affairs — The Department of Veterans Affairs Enterprise Data Inventory accounts for all of the datasets used in the agency's information systems. This entry was approved for...

  2. National Emission Inventory (NEI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — This data exchange allows states to submit data to the US Environmental Protection Agency's National Emissions Inventory (NEI). NEI is a national database of air...

  3. National Wetlands Inventory Points

    Data.gov (United States)

    Minnesota Department of Natural Resources — Wetland point features (typically wetlands that are too small to be as area features at the data scale) mapped as part of the National Wetlands Inventory (NWI). The...

  4. Business Process Inventory

    Data.gov (United States)

    Office of Personnel Management — Inventory of maps and descriptions of the business processes of the U.S. Office of Personnel Management (OPM), with an emphasis on the processes of the Office of the...

  5. Asset Inventory Database

    Data.gov (United States)

    US Agency for International Development — AIDM is used to track USAID assets such as furniture, computers, and equipment. Using portable bar code readers, receiving and inventory personnel can capture...

  6. Toxics Release Inventory (TRI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Toxics Release Inventory (TRI) is a dataset compiled by the U.S. Environmental Protection Agency (EPA). It contains information on the release and waste...

  7. National Emission Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The National Emission Inventory contains measured, modeled, and estimated data for emissions of all known source categories in the US (stationary sources, fires,...

  8. NCRN Hemlock Inventory Data

    Data.gov (United States)

    Department of the Interior — ​Data associated with the 2015 hemlock inventory project in NCR. Eastern hemlock (Tsuga canadensis) is a coniferous tree native to the NE and Appalachian regions of...

  9. Public Waters Inventory Maps

    Data.gov (United States)

    Minnesota Department of Natural Resources — This theme is a scanned and rectified version of the Minnesota DNR - Division of Waters "Public Waters Inventory" (PWI) maps. DNR Waters utilizes a small scale...

  10. Logistics and Inventory System -

    Data.gov (United States)

    Department of Transportation — The Logistics and Inventory System (LIS) is the agencys primary supply/support automation tool. The LIS encompasses everything from order entry by field specialists...

  11. Traffic Signs Inventory System

    Directory of Open Access Journals (Sweden)

    J. Ružbarský

    2013-06-01

    Full Text Available The paper is focused on practical application of Cambridge Correlator. The goal is to propose a traffic signs inventory system by using excellent characteristics of correlator in the rapid optical correlation. The proposal of this inventory system includes obtaining of traffic signs to create the database either collecting the GPS coordinates. It is necessary to know the traffic signs position and also to document the entire surface route for later evaluation in offline mode.

  12. Blue ocean leadership.

    Science.gov (United States)

    Kim, W Chan; Mauborgne, Renée

    2014-05-01

    Ten years ago, two INSEAD professors broke ground by introducing "blue ocean strategy," a new model for discovering uncontested markets that are ripe for growth. In this article, they apply their concepts and tools to what is perhaps the greatest challenge of leadership: closing the gulf between the potential and the realized talent and energy of employees. Research indicates that this gulf is vast: According to Gallup, 70% of workers are disengaged from their jobs. If companies could find a way to convert them into engaged employees, the results could be transformative. The trouble is, managers lack a clear understanding of what changes they could make to bring out the best in everyone. Here, Kim and Mauborgne offer a solution to that problem: a systematic approach to uncovering, at each level of the organization, which leadership acts and activities will inspire employees to give their all, and a process for getting managers throughout the company to start doing them. Blue ocean leadership works because the managers' "customers"-that is, the people managers oversee and report to-are involved in identifying what's effective and what isn't. Moreover, the approach doesn't require leaders to alter who they are, just to undertake a different set of tasks. And that kind of change is much easier to implement and track than changes to values and mind-sets.

  13. Instant BlueStacks

    CERN Document Server

    Judge, Gary

    2013-01-01

    Get to grips with a new technology, understand what it is and what it can do for you, and then get to work with the most important features and tasks. A fast-paced, example-based approach guide for learning BlueStacks.This book is for anyone with a Mac or PC who wants to run Android apps on their computer. Whether you want to play games that are freely available for Android but not your computer, or you want to try apps before you install them on a physical device or use it as a development tool, this book will show you how. No previous experience is needed as this is written in plain English

  14. Application of LANDSAT MSS to elk habitat management. [Blue Mountains, Oregon

    Science.gov (United States)

    Schrumpf, B. J.

    1981-01-01

    The utilization of information derived from LANDSAT multispectral scanner data to estimate the impact of proposed timber harvests on potential elk use is briefly discussed. The evaluations were conducted in Northeastern Oregon where several herds of Rocky Mountain elk range in the Blue Mountains. The inventory product is a geographically referenced data base containing land cover types and habitat components (cover/forage).

  15. Fukushima Daiichi Radionuclide Inventories

    Energy Technology Data Exchange (ETDEWEB)

    Cardoni, Jeffrey N. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Jankovsky, Zachary Kyle [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-09-01

    Radionuclide inventories are generated to permit detailed analyses of the Fukushima Daiichi meltdowns. This is necessary information for severe accident calculations, dose calculations, and source term and consequence analyses. Inventories are calculated using SCALE6 and compared to values predicted by international researchers supporting the OECD/NEA's Benchmark Study on the Accident at Fukushima Daiichi Nuclear Power Station (BSAF). Both sets of inventory information are acceptable for best-estimate analyses of the Fukushima reactors. Consistent nuclear information for severe accident codes, including radionuclide class masses and core decay powers, are also derived from the SCALE6 analyses. Key nuclide activity ratios are calculated as functions of burnup and nuclear data in order to explore the utility for nuclear forensics and support future decommissioning efforts.

  16. Shortening the Xerostomia Inventory

    Science.gov (United States)

    Thomson, William Murray; van der Putten, Gert-Jan; de Baat, Cees; Ikebe, Kazunori; Matsuda, Ken-ichi; Enoki, Kaori; Hopcraft, Matthew; Ling, Guo Y

    2011-01-01

    Objectives To determine the validity and properties of the Summated Xerostomia Inventory-Dutch Version in samples from Australia, The Netherlands, Japan and New Zealand. Study design Six cross-sectional samples of older people from The Netherlands (N = 50), Australia (N = 637 and N = 245), Japan (N = 401) and New Zealand (N = 167 and N = 86). Data were analysed using the Summated Xerostomia Inventory-Dutch Version. Results Almost all data-sets revealed a single extracted factor which explained about half of the variance, with Cronbach’s alpha values of at least 0.70. When mean scale scores were plotted against a “gold standard” xerostomia question, statistically significant gradients were observed, with the highest score seen in those who always had dry mouth, and the lowest in those who never had it. Conclusion The Summated Xerostomia Inventory-Dutch Version is valid for measuring xerostomia symptoms in clinical and epidemiological research. PMID:21684773

  17. Blue phases as photonic crystals

    Science.gov (United States)

    Bohley, Christian; Scharf, Toralf

    2003-12-01

    The Liquid Crystalline Blue Phases (LC BPs) and their diffraction patterns were investigated experimentally and theoretically. We stabilized Blue Phases and measured their diffraction pattern for different wavelengths of monochromatic light with the help of a conoscopic setup of a polarization microscope. Moreover, the diffraction patterns were calculated with the help of a 4x4 matrix method which allows amplitude and phase investigations.

  18. National Inventory Report 2002

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-07-01

    The report presents an inventory of greenhouse gas emissions and sinks in Norway from 1990 to 2000. Trends in total greenhouse gas emissions by UNFCCC's sources and gases are described for carbon dioxide (CO{sub 2}), methane (CH{sub 4}), nitrous oxide (N{sub 2}O), tetrafluoromethane (CF{sub 4}), hexafluoroethane (C{sub 2}F{sub 6}), sulphur hexafluoride (SF{sub 6}) and HFCs. Methodology used in the calculation of emissions from key sources in the Norwegian Emission Inventory are presented. Emissions are reported according to UNFCCC/IPCC common reporting format (CRF) (author)

  19. Purchasing and inventory management techniques for optimizing inventory investment

    International Nuclear Information System (INIS)

    McFarlane, I.; Gehshan, T.

    1993-01-01

    In an effort to reduce operations and maintenance costs among nuclear plants, many utilities are taking a closer look at their inventory investment. Various approaches for inventory reduction have been used and discussed, but these approaches are often limited to an inventory management perspective. Interaction with purchasing and planning personnel to reduce inventory investment is a necessity in utility efforts to become more cost competitive. This paper addresses the activities that purchasing and inventory management personnel should conduct in an effort to optimize inventory investment while maintaining service-level goals. Other functions within a materials management organization, such as the warehousing and investment recovery functions, can contribute to optimizing inventory investment. However, these are not addressed in this paper because their contributions often come after inventory management and purchasing decisions have been made

  20. Inventory order crossovers

    NARCIS (Netherlands)

    Riezebos, J.

    2006-01-01

    The control policies that are used in inventory management systems assume that orders arrive in the same sequence as they were ordered. Due to changes in supply chains and markets, this assumption is no longer valid. This paper aims at providing an improved understanding of the phenomenon of order

  1. Single Item Inventory Models

    NARCIS (Netherlands)

    E.M. Bazsa-Oldenkamp; P. den Iseger

    2001-01-01

    textabstractThis paper extends a fundamental result about single-item inventory systems. This approach allows more general performance measures, demand processes and order policies, and leads to easier analysis and implementation, than prior research. We obtain closed form expressions for the

  2. Marine Education Knowledge Inventory.

    Science.gov (United States)

    Hounshell, Paul B.; Hampton, Carolyn

    This 35-item, multiple-choice Marine Education Knowledge Inventory was developed for use in upper elementary/middle schools to measure a student's knowledge of marine science. Content of test items is drawn from oceanography, ecology, earth science, navigation, and the biological sciences (focusing on marine animals). Steps in the construction of…

  3. THE PRESCHOOL INVENTORY.

    Science.gov (United States)

    CALDWELL, BETTYE M.; SOULE, DONALD

    THE PRESCHOOL INVENTORY BEGAN AS AN ANSWER TO THE NEED FOR SOME TYPE OF INSTRUMENT THAT WOULD PROVIDE AN INDICATION OF HOW MUCH A DISADVANTAGED CHILD, PRIOR TO HIS INTRODUCTION TO HEAD START, HAD ACHIEVED IN AREAS REGARDED AS NECESSARY FOUNDATIONS FOR SUBSEQUENT SUCCESS IN SCHOOL. MEASURING BASIC INTELLIGENCE WAS NOT THE GOAL. RATHER, THE…

  4. Rapid inventory taking system

    International Nuclear Information System (INIS)

    Marsden, P.S.S.F.

    1980-01-01

    A data processing system designed to facilitate inventory taking is described. The process depends upon the earliest possible application of computer techniques and the elimination of manual operations. Data is recorded in optical character recognition (OCR) 'A' form and read by a hand held wand reader. Limited validation checks are applied before recording on mini-tape cassettes. 5 refs

  5. Calculating Optimal Inventory Size

    Directory of Open Access Journals (Sweden)

    Ruby Perez

    2010-01-01

    Full Text Available The purpose of the project is to find the optimal value for the Economic Order Quantity Model and then use a lean manufacturing Kanban equation to find a numeric value that will minimize the total cost and the inventory size.

  6. Perishable Inventory Challenges

    DEFF Research Database (Denmark)

    Damgaard, Cecilie Maria; Nguyen, Vivi Thuy; Hvolby, Hans-Henrik

    2012-01-01

    The paper investigates how inventory control of perishable items is managed and line up some possible options of improvement. This includes a review of relevant literature dealing with the challenges of determining ordering policies for perishable products and a study of how the current procedures...

  7. Experimental inventory verification system

    International Nuclear Information System (INIS)

    Steverson, C.A.; Angerman, M.I.

    1991-01-01

    As Low As Reasonably Achievable (ALARA) goals and Department of Energy (DOE) inventory requirements are frequently in conflict at facilities across the DOE complex. The authors wish, on one hand, to verify the presence of correct amounts of nuclear materials that are in storage or in process; yet on the other hand, we wish to achieve ALARA goals by keeping individual and collective exposures as low as social, technical, economic, practical, and public policy considerations permit. The Experimental Inventory Verification System (EIVSystem) is a computer-based, camera-driven system that utilizes image processing technology to detect change in vault areas. Currently in the test and evaluation phase at Idaho National Engineering Laboratory, this system guards personnel. The EIVSystem continually monitors the vault, providing proof of changed status for objects sorted within the vault. This paper reports that these data could provide the basis for reducing inventory requirements when no change has occurred, thus helping implement ALARA policy; the data will also help describe there target area of an inventory when change has been shown to occur

  8. Initial Radionuclide Inventories

    Energy Technology Data Exchange (ETDEWEB)

    H. Miller

    2004-09-19

    The purpose of this analysis is to provide an initial radionuclide inventory (in grams per waste package) and associated uncertainty distributions for use in the Total System Performance Assessment for the License Application (TSPA-LA) in support of the license application for the repository at Yucca Mountain, Nevada. This document is intended for use in postclosure analysis only. Bounding waste stream information and data were collected that capture probable limits. For commercially generated waste, this analysis considers alternative waste stream projections to bound the characteristics of wastes likely to be encountered using arrival scenarios that potentially impact the commercial spent nuclear fuel (CSNF) waste stream. For TSPA-LA, this radionuclide inventory analysis considers U.S. Department of Energy (DOE) high-level radioactive waste (DHLW) glass and two types of spent nuclear fuel (SNF): CSNF and DOE-owned (DSNF). These wastes are placed in two groups of waste packages: the CSNF waste package and the codisposal waste package (CDSP), which are designated to contain DHLW glass and DSNF, or DHLW glass only. The radionuclide inventory for naval SNF is provided separately in the classified ''Naval Nuclear Propulsion Program Technical Support Document'' for the License Application. As noted previously, the radionuclide inventory data presented here is intended only for TSPA-LA postclosure calculations. It is not applicable to preclosure safety calculations. Safe storage, transportation, and ultimate disposal of these wastes require safety analyses to support the design and licensing of repository equipment and facilities. These analyses will require radionuclide inventories to represent the radioactive source term that must be accommodated during handling, storage and disposition of these wastes. This analysis uses the best available information to identify the radionuclide inventory that is expected at the last year of last emplacement

  9. Blue moons and Martian sunsets.

    Science.gov (United States)

    Ehlers, Kurt; Chakrabarty, Rajan; Moosmüller, Hans

    2014-03-20

    The familiar yellow or orange disks of the moon and sun, especially when they are low in the sky, and brilliant red sunsets are a result of the selective extinction (scattering plus absorption) of blue light by atmospheric gas molecules and small aerosols, a phenomenon explainable using the Rayleigh scattering approximation. On rare occasions, dust or smoke aerosols can cause the extinction of red light to exceed that for blue, resulting in the disks of the sun and moon to appear as blue. Unlike Earth, the atmosphere of Mars is dominated by micron-size dust aerosols, and the sky during sunset takes on a bluish glow. Here we investigate the role of dust aerosols in the blue Martian sunsets and the occasional blue moons and suns on Earth. We use the Mie theory and the Debye series to calculate the wavelength-dependent optical properties of dust aerosols most commonly found on Mars. Our findings show that while wavelength selective extinction can cause the sun's disk to appear blue, the color of the glow surrounding the sun as observed from Mars is due to the dominance of near-forward scattering of blue light by dust particles and cannot be explained by a simple, Rayleigh-like selective extinction explanation.

  10. Denmark's National Inventory Report 2010

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Lyck, Erik; Mikkelsen, Mette Hjorth

    2010-01-01

    This report is Denmark's National Inventory Report 2010. The report contains information on Denmark's emission inventories for all years' from 1990 to 2008 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2.......This report is Denmark's National Inventory Report 2010. The report contains information on Denmark's emission inventories for all years' from 1990 to 2008 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2....

  11. Photometry of faint blue stars

    International Nuclear Information System (INIS)

    Kilkenny, D.; Hill, P.W.; Brown, A.

    1977-01-01

    Photometry on the uvby system is given for 61 faint blue stars. The stars are classified by means of the Stromgren indices, using criteria described in a previous paper (Kilkenny and Hill (1975)). (author)

  12. Ecology of blue straggler stars

    CERN Document Server

    Carraro, Giovanni; Beccari, Giacomo

    2015-01-01

    The existence of blue straggler stars, which appear younger, hotter, and more massive than their siblings, is at odds with a simple picture of stellar evolution. Such stars should have exhausted their nuclear fuel and evolved long ago to become cooling white dwarfs. They are found to exist in globular clusters, open clusters, dwarf spheroidal galaxies of the Local Group, OB associations and as field stars. This book summarises the many advances in observational and theoretical work dedicated to blue straggler stars. Carefully edited extended contributions by well-known experts in the field cover all the relevant aspects of blue straggler stars research: Observations of blue straggler stars in their various environments; Binary stars and formation channels; Dynamics of globular clusters; Interpretation of observational data and comparison with models. The book also offers an introductory chapter on stellar evolution written by the editors of the book.

  13. Inventory Control System by Using Vendor Managed Inventory (VMI)

    Science.gov (United States)

    Sabila, Alzena Dona; Mustafid; Suryono

    2018-02-01

    The inventory control system has a strategic role for the business in managing inventory operations. Management of conventional inventory creates problems in the stock of goods that often runs into vacancies and excess goods at the retail level. This study aims to build inventory control system that can maintain the stability of goods availability at the retail level. The implementation of Vendor Managed Inventory (VMI) method on inventory control system provides transparency of sales data and inventory of goods at retailer level to supplier. Inventory control is performed by calculating safety stock and reorder point of goods based on sales data received by the system. Rule-based reasoning is provided on the system to facilitate the monitoring of inventory status information, thereby helping the process of inventory updates appropriately. Utilization of SMS technology is also considered as a medium of collecting sales data in real-time due to the ease of use. The results of this study indicate that inventory control using VMI ensures the availability of goods ± 70% and can reduce the accumulation of goods ± 30% at the retail level.

  14. National Biological Monitoring Inventory

    International Nuclear Information System (INIS)

    Burgess, R.L.

    1979-01-01

    The National Biological Monitoring Inventory, initiated in 1975, currently consists of four computerized data bases and voluminous manual files. MAIN BIOMON contains detailed information on 1,021 projects, while MINI BIOMON provides skeletal data for over 3,000 projects in the 50 states, Puerto Rico, the Virgin Islands, plus a few in Canada and Mexico. BIBLIO BIOMON and DIRECTORY BIOMON complete the computerized data bases. The structure of the system provides for on-line search capabilities to generate details of agency sponsorship, indications of funding levels, taxonomic and geographic coverage, length of program life, managerial focus or emphasis, and condition of the data. Examples of each of these are discussed and illustrated, and potential use of the Inventory in a variety of situations is emphasized

  15. Life Cycle Inventory Analysis

    DEFF Research Database (Denmark)

    Bjørn, Anders; Moltesen, Andreas; Laurent, Alexis

    2017-01-01

    The inventory analysis is the third and often most time-consuming part of an LCA. The analysis is guided by the goal and scope definition, and its core activity is the collection and compilation of data on elementary flows from all processes in the studied product system(s) drawing on a combination...... of different sources. The output is a compiled inventory of elementary flows that is used as basis of the subsequent life cycle impact assessment phase. This chapter teaches how to carry out this task through six steps: (1) identifying processes for the LCI model of the product system; (2) planning...... and collecting data; (3) constructing and quality checking unit processes; (4) constructing LCI model and calculating LCI results; (5) preparing the basis for uncertainty management and sensitivity analysis; and (6) reporting....

  16. Resolving inventory differences

    International Nuclear Information System (INIS)

    Weber, J.H.; Clark, J.P.

    1991-01-01

    Determining the cause of an inventory difference (ID) that exceeds warning or alarm limits should not only involve investigation into measurement methods and reexamination of the model assumptions used in the calculation of the limits, but also result in corrective actions that improve the quality of the accountability measurements. An example illustrating methods used by Savannah River Site (SRS) personnel to resolve an ID is presented that may be useful to other facilities faced with a similar problem. After first determining that no theft or diversion of material occurred and correcting any accountability calculation errors, investigation into the IDs focused on volume and analytical measurements, limit of error of inventory difference (LEID) modeling assumptions, and changes in the measurement procedures and methods prior to the alarm. There had been a gradual gain trend in IDs prior to the alarm which was reversed by the alarm inventory. The majority of the NM in the facility was stored in four large tanks which helped identify causes for the alarm. The investigation, while indicating no diversion or theft, resulted in changes in the analytical method and in improvements in the measurement and accountability that produced a 67% improvement in the LEID

  17. Procedure for taking physical inventories

    International Nuclear Information System (INIS)

    Boston, R.A.

    1984-01-01

    Physical inventories are taken periodically to meet Company, State and IAEA requirements. Those physical inventories may be verified by IAEA and/or State inspectors. This presentation describes in an introductory but detailed manner the approaches and procedures used in planning, preparing, conducting, reconciling and reporting physical inventories for the Model Plant. Physical inventories are taken for plant accounting purposes to provide an accurate basis for starting and closing the plant material balance. Physical inventories are also taken for safeguards purposes to provide positive assurance that the nuclear materials of concern are indeed present and accounted for

  18. [Acute blue urticaria following subcutaneous injection of patent blue dye].

    Science.gov (United States)

    Hamelin, A; Vial-Dupuy, A; Lebrun-Vignes, B; Francès, C; Soria, A; Barete, S

    2015-11-01

    Patent blue (PB) is a lymphatic vessel dye commonly used in France for sentinel lymph node detection in breast cancer, and less frequently in melanoma, and which may induce hypersensitivity reactions. We report a case of acute blue urticaria occurring within minutes of PB injection. Ten minutes after PB injection for sentinel lymph node detection during breast cancer surgery, a 49-year-old woman developed generalised acute blue urticaria and eyelid angioedema without bronchospasm or haemodynamic disturbance, but requiring discontinuation of surgery. Skin testing using PB and the anaesthetics given were run 6 weeks after the episode and confirmed PB allergy. PB was formally contra-indicated. Immediate hypersensitivity reactions to PB have been reported for between 0.24 and 2.2% of procedures. Such reactions are on occasion severe, chiefly involving anaphylactic shock. Two mechanisms are probably associated: non-specific histamine release and/or an IgE-mediated mechanism. Skin tests are helpful in confirming the diagnosis of PB allergy. Blue acute urticaria is one of the clinical manifestations of immediate hypersensitivity reactions to patent blue dye. Skin tests must be performed 6 weeks after the reaction in order to confirm the diagnosis and formally contra-indicate this substance. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  19. Blue-emitting laser diodes

    Science.gov (United States)

    Nakano, K.; Ishibashi, A.

    This paper reviews the recent results of blue-emitting laser diodes. These devices are based on ZnMgSSe alloy II-VI semiconductors. Recently we have achieved room temperature continuous-wave operation of ZnMgSSe blue lasers for the first time. ZnMgSSe alloys offer a wide range of band-gap energy from 2.8 to 4.5 eV, while maintaining lattice matching to GaAs substrates. These characteristics make ZnMgSSe suitable for cladding layers of blue lasers. In this article, the feasibilities of ZnMgSSe will be reviewed. The laser structures and characteristics will be also mentioned.

  20. Energy Education Materials Inventory

    Energy Technology Data Exchange (ETDEWEB)

    1979-08-01

    The two volumes of the Energy Education Materials Inventory (EEMI) comprise an annotated bibliography of widely available energy education materials and reference sources. This systematic listing is designed to provide a source book which will facilitate access to these educational resources and hasten the inclusion of energy-focused learning experiences in kindergarten through grade twelve. EEMI Volume II expands Volume I and contains items that have become available since its completion in May, 1976. The inventory consists of three major parts. A core section entitled Media contains titles and descriptive information on educational materials, categorized according to medium. The other two major sections - Grade Level and Subject - are cross indexes of the items for which citations appear in the Media Section. These contain titles categorized according to grade level and subject and show the page numbers of the full citations. The general subject area covered includes the following: alternative energy sources (wood, fuel from organic wastes, geothermal energy, nuclear power, solar energy, tidal power, wind energy); energy conservation, consumption, and utilization; energy policy and legislation, environmental/social aspects of energy technology; and fossil fuels (coal, natural gas, petroleum). (RWR)

  1. NRC inventory of dams

    International Nuclear Information System (INIS)

    Lear, G.E.; Thompson, O.O.

    1983-01-01

    The NRC Inventory of Dams has been prepared as required by the charter of the NRC Dam Safety Officer. The inventory lists 51 dams associated with nuclear power plant sites and 14 uranium mill tailings dams (licensed by NRC) in the US as of February 1, 1982. Of the 85 listed nuclear power plants (148 units), 26 plants obtain cooling water from impoundments formed by dams. The 51 dams associated with the plants are: located on a plant site (29 dams at 15 plant sites); located off site but provide plant cooling water (18 dams at 11 additional plant sites); and located upstream from a plant (4 dams) - they have been identified as dams whose failure, and ensuing plant flooding, could result in a radiological risk to the public health and safety. The dams that might be considered NRC's responsibility in terms of the federal dam safety program are identified. This group of dams (20 on nuclear power plant sites and 14 uranium mill tailings dams) was obtained by eliminating dams that do not pose a flooding hazard (e.g., submerged dams) and dams that are regulated by another federal agency. The report includes the principal design features of all dams and related useful information

  2. Blue light emitting thiogallate phosphor

    Science.gov (United States)

    Dye, Robert C.; Smith, David C.; King, Christopher N.; Tuenge, Richard T.

    1998-01-01

    A crystalline blue emitting thiogallate phosphor of the formula RGa.sub.2 S.sub.4 :Ce.sub.x where R is selected from the group consisting of calcium, strontium, barium and zinc, and x is from about 1 to 10 atomic percent, the phosphor characterized as having a crystalline microstructure on the size order of from about 100 .ANG. to about 10,000 .ANG. is provided together with a process of preparing a crystalline blue emitting thiogallate phosphor by depositing on a substrate by CVD and resultant thin film electroluminescent devices including a layer of such deposited phosphor on an ordinary glass substrate.

  3. Strategic Inventories in Vertical Contracts

    OpenAIRE

    Krishnan Anand; Ravi Anupindi; Yehuda Bassok

    2008-01-01

    Classical reasons for carrying inventory include fixed (nonlinear) production or procurement costs, lead times, nonstationary or uncertain supply/demand, and capacity constraints. The last decade has seen active research in supply chain coordination focusing on the role of incentive contracts to achieve first-best levels of inventory. An extensive literature in industrial organization that studies incentives for vertical controls largely ignores the effect of inventories. Does the ability to ...

  4. INVENTORY CLASSIFICATION WITH ABC ANALYSIS

    OpenAIRE

    Kıyak, Erkan; Timuş, Oğuz Han; Karayel, Mehmet

    2015-01-01

    For a substantial organization, managing the expansive inventory is a serious problem. One of the methods to solve this problem used widely is classifying the inventory according to some criteria and managing inventory according to this classisifation. In this study, ABC classification methods are researched and Ng's model, which is one of the most widely used, selected for further investigation. An illustrative example is presented to show the usability of the Ng's method.

  5. Hanford inventory program user's manual

    International Nuclear Information System (INIS)

    Hinkelman, K.C.

    1994-01-01

    Provides users with instructions and information about accessing and operating the Hanford Inventory Program (HIP) system. The Hanford Inventory Program is an integrated control system that provides a single source for the management and control of equipment, parts, and material warehoused by Westinghouse Hanford Company in various site-wide locations. The inventory is comprised of spare parts and equipment, shop stock, special tools, essential materials, and convenience storage items. The HIP replaced the following systems; ACA, ASP, PICS, FSP, WSR, STP, and RBO. In addition, HIP manages the catalog maintenance function for the General Supplies inventory stocked in the 1164 building and managed by WIMS

  6. Six ways to reduce inventory.

    Science.gov (United States)

    Lunn, T

    1996-05-01

    The purpose of this presentation is to help you reduce the inventory in your operation. We will accomplish that task by discussing six specific methods that companies have used successfully to reduce their inventory. One common attribute of these successes is that they also build teamwork among the people. Every business operation today is concerned with methods to improve customer service. The real trick is to accomplish that task without increasing inventory. We are all concerned with improving our skills at keeping inventory low.

  7. Denmark's National Inventory Report 2013

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s National Inventory Report 2013. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2011 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2.......This report is Denmark’s National Inventory Report 2013. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2011 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2....

  8. Denmark's National Inventory Report 2014

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s National Inventory Report 2014. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2012 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2014. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2012 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

  9. Denmark's National Inventory Report 2017

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s National Inventory Report 2017. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2015 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2017. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2015 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

  10. Applying inventory classification to a large inventory management system

    Directory of Open Access Journals (Sweden)

    Benjamin Isaac May

    2017-06-01

    Full Text Available Inventory classification aims to ensure that business-driving inventory items are efficiently managed in spite of constrained resources. There are numerous single- and multiple-criteria approaches to it. Our objective is to improve resource allocation to focus on items that can lead to high equipment availability. This concern is typical of many service industries such as military logistics, airlines, amusement parks and public works. Our study tests several inventory prioritization techniques and finds that a modified multi-criterion weighted non-linear optimization (WNO technique is a powerful approach for classifying inventory, outperforming traditional techniques of inventory prioritization such as ABC analysis in a variety of performance objectives.

  11. The Blue Revolution in Asia

    DEFF Research Database (Denmark)

    Ponte, Stefano; Kelling, Ingrid; Jespersen, Karen Sau

    2014-01-01

    In this article, we examine the upgrading trajectories of selected aquaculture value chains in four Asian countries and the links between upgrading and three factors of value chain governance: coordination mechanisms; types of drivers; and domestic regulation. We find instances of improving produ...... of upgrading the "blue revolution" in Asia...

  12. Blue Ocean vs. Five Forces

    NARCIS (Netherlands)

    A.E. Burke (Andrew); A.J. van Stel (André); A.R. Thurik (Roy)

    2010-01-01

    textabstractThe article reports on the authors' research in the Netherlands which focused on a profit model in Dutch retail stores and a so-called blue-ocean approach which requires a new market that attracts consumers and increases profits. Topics include the competitive strategy approach to

  13. Mobilizing investors for blue growth

    NARCIS (Netherlands)

    Burg, van den Sander W.K.; Stuiver, Marian; Bolman, Bas C.; Wijnen, Roland; Selnes, Trond; Dalton, Gordon

    2017-01-01

    The European Union's Blue Growth Strategy is a long term strategy to support sustainable growth in the marine and maritime sectors, aiming to contribute to innovation and economic growth (European Commission, 2012). The EU sees the financial sector as a key partner to bring about transition to

  14. Nobel Prize for blue LEDs

    International Nuclear Information System (INIS)

    Kraftmakher, Yaakov

    2015-01-01

    A brief review of lighting technologies is presented. Unavoidable restrictions for incandescent light bulbs caused by the Planck distribution and properties of the human eye are illustrated. The efficiency and luminous efficacy of thermal radiation are calculated for various temperatures; the results clearly show the limitations for thermal radiators. The only way to overcome these limitations is using non-thermal radiators, such as fluorescent lamps and light-emitting diodes (LEDs). Unique advantages of LEDs undoubtedly made a revolution in this field. A crucial element of this progress is the blue LEDs (Nobel Prize 2014). Some experiments with a blue and a green LED are described: (i) the luminescence triggered in a green-yellow phosphor inside a white LED by the blue LED; (ii) radiant spectra and ‘efficiency droop’ in the LEDs; (iii) modulation of the blue LED up to 4 MHz; and (iv) the h/e ratio from the turn-on voltage of the green LED. The experiments are suitable for undergraduate laboratories and usable as classroom demonstrations. (paper)

  15. Nobel Prize for blue LEDs

    Science.gov (United States)

    Kraftmakher, Yaakov

    2015-05-01

    A brief review of lighting technologies is presented. Unavoidable restrictions for incandescent light bulbs caused by the Planck distribution and properties of the human eye are illustrated. The efficiency and luminous efficacy of thermal radiation are calculated for various temperatures; the results clearly show the limitations for thermal radiators. The only way to overcome these limitations is using non-thermal radiators, such as fluorescent lamps and light-emitting diodes (LEDs). Unique advantages of LEDs undoubtedly made a revolution in this field. A crucial element of this progress is the blue LEDs (Nobel Prize 2014). Some experiments with a blue and a green LED are described: (i) the luminescence triggered in a green-yellow phosphor inside a white LED by the blue LED; (ii) radiant spectra and ‘efficiency droop’ in the LEDs; (iii) modulation of the blue LED up to 4 MHz; and (iv) the h/e ratio from the turn-on voltage of the green LED. The experiments are suitable for undergraduate laboratories and usable as classroom demonstrations.

  16. Controlling Inventory: Real-World Mathematical Modeling

    Science.gov (United States)

    Edwards, Thomas G.; Özgün-Koca, S. Asli; Chelst, Kenneth R.

    2013-01-01

    Amazon, Walmart, and other large-scale retailers owe their success partly to efficient inventory management. For such firms, holding too little inventory risks losing sales, whereas holding idle inventory wastes money. Therefore profits hinge on the inventory level chosen. In this activity, students investigate a simplified inventory-control…

  17. 21 CFR 1304.11 - Inventory requirements.

    Science.gov (United States)

    2010-04-01

    ... the inventory of the registered location to which they are subject to control or to which the person... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Inventory requirements. 1304.11 Section 1304.11... REGISTRANTS Inventory Requirements § 1304.11 Inventory requirements. (a) General requirements. Each inventory...

  18. Denmark's National Inventory Report 2009

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Lyck, Erik; Mikkelsen, Mette Hjorth

    This report is Denmark's National Inventory Report 2009. The report contains information on Denmark's emission inventories for all years' from 1990 to 2007 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2. The report documents the methodology as well as presents activity data and emissi...

  19. Automation of Space Inventory Management

    Science.gov (United States)

    Fink, Patrick W.; Ngo, Phong; Wagner, Raymond; Barton, Richard; Gifford, Kevin

    2009-01-01

    This viewgraph presentation describes the utilization of automated space-based inventory management through handheld RFID readers and BioNet Middleware. The contents include: 1) Space-Based INventory Management; 2) Real-Time RFID Location and Tracking; 3) Surface Acoustic Wave (SAW) RFID; and 4) BioNet Middleware.

  20. Michigan's Fourth Forest Inventory: Area.

    Science.gov (United States)

    John S. Jr. Spencer

    1983-01-01

    The fourth inventory of Michigan's forest resources found 17.5 million acres of commercial forest, down 7% from the 18.9 million found in 1966. This bulletin analyzes findings from the inventory and presents detailed tables of forest area.

  1. Denmark's national inventory report 2006

    DEFF Research Database (Denmark)

    Illerup, Jytte Boll; Lyck, Erik; Nielsen, Ole-Kenneth

    This report is Denmark's National Inventory Report reported to the Conference of the Parties under the United Nations Framework Convention on Climate Change (UNFCCC) due by April 2006. The report contains information on Denmark's inventories for all years' from 1990 to 2004 for CO....

  2. Student-Life Stress Inventory.

    Science.gov (United States)

    Gadzella, Bernadette M.; And Others

    The reliability of the Student-Life Stress Inventory of B. M. Gadzella (1991) was studied. The inventory consists of 51 items listed in 9 sections indicating different types of stressors (frustrations, conflicts, pressures, changes, and self-imposed stressors) and reactions to the stressors (physiological, emotional, behavioral, and cognitive) as…

  3. ANALYSIS MODEL FOR INVENTORY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    CAMELIA BURJA

    2010-01-01

    Full Text Available The inventory represents an essential component for the assets of the enterprise and the economic analysis gives them special importance because their accurate management determines the achievement of the activity object and the financial results. The efficient management of inventory requires ensuring an optimum level for them, which will guarantee the normal functioning of the activity with minimum inventory expenses and funds which are immobilised. The paper presents an analysis model for inventory management based on their rotation speed and the correlation with the sales volume illustrated in an adequate study. The highlighting of the influence factors on the efficient inventory management ensures the useful information needed to justify managerial decisions, which will lead to a balancedfinancial position and to increased company performance.

  4. 21 CFR 133.106 - Blue cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Blue cheese. 133.106 Section 133.106 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.106 Blue cheese. (a) Description. (1) Blue cheese is the food prepared by the procedure set...

  5. 75 FR 65525 - Anthem Blue Cross Blue Shield, Claim Management Services, Inc. Operations, a Division of...

    Science.gov (United States)

    2010-10-25

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,327] Anthem Blue Cross Blue Shield, Claim Management Services, Inc. Operations, a Division of Wellpoint, Inc., Green Bay, WI; Notice... former workers of Anthem Blue Cross Blue Shield, Claim Management Services, Inc. Operations, a Division...

  6. SPECIAL ISSUE DEVOTED TO THE 80TH BIRTHDAY OF S.A. AKHMANOV: Peculiarities of periodic and aperiodic energy-exchange regimes in the cascade quasi-synchronous parametric frequency conversion

    Science.gov (United States)

    Petnikova, V. M.; Shuvalov, Vladimir V.

    2009-07-01

    The domains of existence and peculiarities of exact analytic solutions of the problem of quasi-synchronous interaction of four plane collinear monochromatic waves — modes in a quadratically nonlinear medium during cascade frequency conversion are analysed. It is shown that the unusual types of multicomponent cnoidal and solitary soliton-like waves (of periodic and aperiodic energy-exchange regimes) are realised. Two of the four components of the latter are proportional to the real and imaginary parts of the well-known Lorentzian dependence, which is commonly used to describe the dispersion of contributions from resonance transitions to the complex permittivity in the case of homogeneous line broadening.

  7. The Physics of the Blues

    Science.gov (United States)

    Gibson, J. Murray

    2009-03-01

    In looking at the commonalities between music and science, one sees that the musician's palette is based on the principles of physics. The pitch of a musical note is determined by the frequency of the sound wave. The scales that musicians use to create and play music can be viewed as a set of rules. What makes music interesting is how musicians develop those rules and create ambiguity with them. I will discuss the evolution of western musical scales in this context. As a particular example, ``Blue'' notes are very harmonic notes that are missing from the equal temperament scale. The techniques of piano blues and jazz represent the melding of African and Western music into something totally new and exciting. Live keyboard demonstrations will be used. Beyond any redeeming entertainment value the talk will emphasize the serious connections between science and art in music. Nevertheless tips will be accepted.

  8. Thermoluminescence (TL) of Egyptian Blue

    Energy Technology Data Exchange (ETDEWEB)

    Schvoerer, M.; Delavergne, M.-C.; Chapoulie, R.

    1988-01-01

    Egyptian Blue is a synthesized crystalline pictorial pigment with formula CaCuSi/sub 4/O/sub 10/. It has been used in Egypt and Mesopotamia from the 3rd millenium B.C. A preliminary experiment on a recently synthesized sample showed that this pigment is thermoluminescent after ..beta.. irradiation (/sup 90/Sr). As the signal intensity grows linearly with the administered dose within the temperature range commonly used in TL dating, we have been looking for this phenomenon from archaeological pigments. It was encountered with two samples found in excavation. From its intensity and stability we concluded that Egyptian Blue can be dated using TL. This first and positive result encouraged us to extend the method to other types of mineral pigments synthesized by early man, and to suggest that it may be used for direct dating of ancient murals.

  9. INEEL Liquid Effluent Inventory

    Energy Technology Data Exchange (ETDEWEB)

    Major, C.A.

    1997-06-01

    The INEEL contractors and their associated facilities are required to identify all liquid effluent discharges that may impact the environment at the INEEL. This liquid effluent information is then placed in the Liquid Effluent Inventory (LEI) database, which is maintained by the INEEL prime contractor. The purpose of the LEI is to identify and maintain a current listing of all liquid effluent discharge points and to identify which discharges are subject to federal, state, or local permitting or reporting requirements and DOE order requirements. Initial characterization, which represents most of the INEEL liquid effluents, has been performed, and additional characterization may be required in the future to meet regulations. LEI information is made available to persons responsible for or concerned with INEEL compliance with liquid effluent permitting or reporting requirements, such as the National Pollutant Discharge Elimination System, Wastewater Land Application, Storm Water Pollution Prevention, Spill Prevention Control and Countermeasures, and Industrial Wastewater Pretreatment. The State of Idaho Environmental Oversight and Monitoring Program also needs the information for tracking liquid effluent discharges at the INEEL. The information provides a baseline from which future liquid discharges can be identified, characterized, and regulated, if appropriate. The review covered new and removed buildings/structures, buildings/structures which most likely had new, relocated, or removed LEI discharge points, and at least 10% of the remaining discharge points.

  10. Inventory of miscellaneous streams

    International Nuclear Information System (INIS)

    Lueck, K.J.

    1995-09-01

    On December 23, 1991, the US Department of Energy, Richland Operations Office (RL) and the Washington State Department of Ecology (Ecology) agreed to adhere to the provisions of the Department of Ecology Consent Order. The Consent Order lists the regulatory milestones for liquid effluent streams at the Hanford Site to comply with the permitting requirements of Washington Administrative Code. The RL provided the US Congress a Plan and Schedule to discontinue disposal of contaminated liquid effluent into the soil column on the Hanford Site. The plan and schedule document contained a strategy for the implementation of alternative treatment and disposal systems. This strategy included prioritizing the streams into two phases. The Phase 1 streams were considered to be higher priority than the Phase 2 streams. The actions recommended for the Phase 1 and 2 streams in the two reports were incorporated in the Hanford Federal Facility Agreement and Consent Order. Miscellaneous Streams are those liquid effluents streams identified within the Consent Order that are discharged to the ground but are not categorized as Phase 1 or Phase 2 Streams. This document consists of an inventory of the liquid effluent streams being discharged into the Hanford soil column

  11. Recent evidence on the muted inventory cycle

    OpenAIRE

    Andrew J. Filardo

    1995-01-01

    Inventories play an important role in business cycles. Inventory build-ups add momentum to the economy during expansions, while inventory liquidations sap economic strength during recessions. In addition, because inventory fluctuations are notoriously difficult to predict, they present considerable uncertainty in assessing the economic outlook.> The role of inventories in shaping the current outlook for the U.S. economy is particularly uncertain. In the early 1990s, inventory swings appeared ...

  12. Blue breath holding is benign.

    OpenAIRE

    Stephenson, J B

    1991-01-01

    In their recent publication in this journal, Southall et al described typical cyanotic breath holding spells, both in otherwise healthy children and in those with brainstem lesions and other malformations. Their suggestions regarding possible autonomic disturbances may require further study, but they have adduced no scientific evidence to contradict the accepted view that in the intact child blue breath holding spells are benign. Those families in which an infant suffers an 'apparently life t...

  13. Galaxies on the Blue Edge

    OpenAIRE

    Cabanela, J. E.; Dickey, J. M.

    2002-01-01

    We have successfully constructed a catalog of HI-rich galaxies selected from the Minnesota Automated Plate Scanner Catalog of the Palomar Observatory Sky Survey (POSS I) based solely on optical criteria. We identify HI-rich candidates by selecting the bluest galaxies at a given apparent magnitude, those galaxies on the "blue edge" of POSS I color-magnitude parameter space. Subsequent 21-cm observations on the upgraded Arecibo 305m dish detected over 50% of the observed candidates. The detecte...

  14. Blue light regulated shade avoidance.

    Science.gov (United States)

    Keuskamp, Diederik H; Keller, Mercedes M; Ballaré, Carlos L; Pierik, Ronald

    2012-04-01

    Most plants grow in dense vegetation with the risk of being out-competed by neighboring plants. These neighbors can be detected not only through the depletion in light quantity that they cause, but also through the change in light quality, which plants perceive using specific photoreceptors. Both the reduction of the red:far-red ratio and the depletion of blue light are signals that induce a set of phenotypic traits, such as shoot elongation and leaf hyponasty, which increase the likelihood of light capture in dense plant stands. This set of phenotypic responses are part of the so called shade avoidance syndrome (SAS). This addendum discusses recent findings on the regulation of the SAS of Arabidopsis thaliana upon blue light depletion. Keller et al. and Keuskamp et al. show that the low blue light attenuation induced shade avoidance response of seedling and rosette-stage A. thaliana plants differ in their hormonal regulation. These studies also show there is a regulatory overlap with the R:FR-regulated SAS.

  15. Case Study on Inventory Management Improvement

    Directory of Open Access Journals (Sweden)

    Plinere Darya

    2015-12-01

    Full Text Available Inventory management is a challenging problem area in supply chain management. Companies need to have inventories in warehouses in order to fulfil customer demand, meanwhile these inventories have holding costs and this is frozen fund that can be lost. Therefore, the task of inventory management is to find the quantity of inventories that will fulfil the demand, avoiding overstocks. This paper presents a case study for the assembling company on inventory management. It is proposed to use inventory management in order to decrease stock levels and to apply an agent system for automation of inventory management processes.

  16. Fusion program research materials inventory

    International Nuclear Information System (INIS)

    Roche, T.K.; Wiffen, F.W.; Davis, J.W.; Lechtenberg, T.A.

    1984-01-01

    Oak Ridge National Laboratory maintains a central inventory of research materials to provide a common supply of materials for the Fusion Reactor Materials Program. This will minimize unintended material variations and provide for economy in procurement and for centralized record keeping. Initially this inventory is to focus on materials related to first-wall and structural applications and related research, but various special purpose materials may be added in the future. The use of materials from this inventory for research that is coordinated with or otherwise related technically to the Fusion Reactor Materials Program of DOE is encouraged

  17. Clinical Decision Support (CDS) Inventory

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Clinical Decision Support (CDS) Inventory contains descriptions of past and present CDS projects across the Federal Government. It includes Federal projects,...

  18. Inventory differences: An evaluation methodology

    International Nuclear Information System (INIS)

    Heinberg, C.L.; Roberts, N.J.

    1987-01-01

    This paper discusses an evaluation methodology which is used for inventory differences at the Los Alamos National Laboratory. It is recognized that there are various methods which can be, and are being, used to evaluate process inventory differences at DOE facilities. The purpose of this paper is to share our thoughts on the subject and our techniques with those who are responsible for the evaluation of inventory differences at their facility. One of the most dangerous aspects of any evaluation technique, especially one as complex as most inventory difference evaluations tend to be, is to fail to look at the tools being used as indicators. There is a tendency to look at the results of an evaluation by one technique as an absolute. At the Los Alamos National Laboratory, several tools are used and the final evaluation is based on a combination of the observed results of a many-faceted evaluation. The tools used and some examples are presented

  19. Title V Permitting Statistics Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Title V Permitting Statistics Inventory contains measured and estimated nationwide statistical data, consisting of counts of permitted sources, types of permits...

  20. Travel reliability inventory for Chicago.

    Science.gov (United States)

    2013-04-01

    The overarching goal of this research project is to enable state DOTs to document and monitor the reliability performance : of their highway networks. To this end, a computer tool, TRIC, was developed to produce travel reliability inventories from : ...

  1. Severe Weather Data Inventory (SWDI)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Severe Weather Data Inventory (SWDI) is an integrated database of severe weather records for the United States. SWDI enables a user to search through a variety...

  2. Colorado statewide historic bridge inventory.

    Science.gov (United States)

    2011-05-01

    The purpose of the Colorado statewide historic bridge inventory was to document and evaluate the National : Register of Historic Places eligibility all on-system highway bridges and grade separation structures built in : Colorado between 1959 and 196...

  3. NPS national transit inventory, 2013

    Science.gov (United States)

    2014-07-31

    This document summarizes key highlights from the National Park Service (NPS) 2013 National Transit Inventory, and presents data for NPS transit systems system-wide. The document discusses statistics related to ridership, business models, fleet charac...

  4. Allegheny County Toxics Release Inventory

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — The Toxics Release Inventory (TRI) data provides information about toxic substances released into the environment or managed through recycling, energy recovery, and...

  5. FEMA Flood Insurance Studies Inventory

    Data.gov (United States)

    Kansas Data Access and Support Center — This digital data set provides an inventory of Federal Emergency Management Agency (FEMA) Flood Insurance Studies (FIS) that have been conducted for communities and...

  6. National Greenhouse Gas Emission Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The National Greenhouse Gas Emission Inventory contains information on direct emissions of greenhouse gases as well as indirect or potential emissions of greenhouse...

  7. Biogenic Emission Inventory System (BEIS)

    Science.gov (United States)

    Biogenic Emission Inventory System (BEIS) estimates volatile organic compound (VOC) emissions from vegetation and nitric oxide (NO) emission from soils. Recent BEIS development has been restricted to the SMOKE system

  8. Adsorption of Methylene Blue, Bromophenol Blue, and Coomassie Brilliant Blue by α-chitin nanoparticles

    Directory of Open Access Journals (Sweden)

    Solairaj Dhananasekaran

    2016-01-01

    Full Text Available Expelling of dyestuff into water resource system causes major thread to the environment. Adsorption is the cost effective and potential method to remove the dyes from the effluents. Therefore, an attempt was made to study the adsorption of dyestuff (Methylene Blue (MB, Bromophenol Blue (BPB and Coomassie Brilliant Blue (CBB by α-chitin nanoparticles (CNP prepared from Penaeus monodon (Fabricius, 1798 shell waste. On contrary to the most recognizable adsorption studies using chitin, this is the first study using unique nanoparticles of ⩽50 nm used for the dye adsorption process. The results showed that the adsorption process increased with increase in the concentration of CNP, contact time and temperature with the dyestuff, whereas the adsorption process decreased with increase in the initial dye concentration and strong acidic pH. The results from Fourier transform infrared (FTIR spectroscopy confirmed that the interaction between dyestuff and CNP involved physical adsorption. The adsorption process obeys Langmuir isotherm (R2 values were 0.992, 0.999 and 0.992 for MB, BPB and CBB, and RL value lies between 0 and 1 for all the three dyes and pseudo second order kinetics (R2 values were 0.996, 0.999 and 0.996 for MB, BPB and CBB more effectively. The isotherm and kinetic models confirmed that CNP can be used as a suitable adsorbent material for the removal of dyestuff from effluents.

  9. The Finnish national forest inventory

    Science.gov (United States)

    Erkki Tomppo

    2009-01-01

    The National Forest Inventory (NFI) of Finland has produced large-area forest resource information since the beginning of 1920s (Ilvessalo 1927). When the 10th inventory (NFI10) started in 2004, the design was changed and the rotation shortened to 5 years. Measurements are done in the entire country each year through measuring one-fifth of the plots. About one-fifth of...

  10. Value-Based Inventory Management

    OpenAIRE

    Michalski, Grzegorz

    2008-01-01

    The basic financial purpose of a firm is to maximize its value. An inventory management system should also contribute to realization of this basic aim. Many current asset management models currently found in financial management literature were constructed with the assumption of book profit maximization as basic aim. However these models could lack what relates to another aim, i.e., maximization of enterprise value. This article presents a modified value-based inventory management model.

  11. Peru Mercury Inventory 2006

    Science.gov (United States)

    Brooks, William E.; Sandoval, Esteban; Yepez, Miguel A.; Howard, Howell

    2007-01-01

    In 2004, a specific need for data on mercury use in South America was indicated by the United Nations Environmental Programme-Chemicals (UNEP-Chemicals) at a workshop on regional mercury pollution that took place in Buenos Aires, Argentina. Mercury has long been mined and used in South America for artisanal gold mining and imported for chlor-alkali production, dental amalgam, and other uses. The U.S. Geological Survey (USGS) provides information on domestic and international mercury production, trade, prices, sources, and recycling in its annual Minerals Yearbook mercury chapter. Therefore, in response to UNEP-Chemicals, the USGS, in collaboration with the Economic Section of the U.S. Embassy, Lima, has herein compiled data on Peru's exports, imports, and byproduct production of mercury. Peru was selected for this inventory because it has a 2000-year history of mercury production and use, and continues today as an important source of mercury for the global market, as a byproduct from its gold mines. Peru is a regional distributor of imported mercury and user of mercury for artisanal gold mining and chlor-alkali production. Peruvian customs data showed that 22 metric tons (t) of byproduct mercury was exported to the United States in 2006. Transshipped mercury was exported to Brazil (1 t), Colombia (1 t), and Guyana (1 t). Mercury was imported from the United States (54 t), Spain (19 t), and Kyrgyzstan (8 t) in 2006 and was used for artisanal gold mining, chlor-alkali production, dental amalgam, or transshipment to other countries in the region. Site visits and interviews provided information on the use and disposition of mercury for artisanal gold mining and other uses. Peru also imports mercury-containing batteries, electronics and computers, fluorescent lamps, and thermometers. In 2006, Peru imported approximately 1,900 t of a wide variety of fluorescent lamps; however, the mercury contained in these lamps, a minimum of approximately 76 kilograms (kg), and in

  12. Blue breath holding is benign.

    Science.gov (United States)

    Stephenson, J B

    1991-01-01

    In their recent publication in this journal, Southall et al described typical cyanotic breath holding spells, both in otherwise healthy children and in those with brainstem lesions and other malformations. Their suggestions regarding possible autonomic disturbances may require further study, but they have adduced no scientific evidence to contradict the accepted view that in the intact child blue breath holding spells are benign. Those families in which an infant suffers an 'apparently life threatening event' deserve immense understanding and help, and it behoves investigators to exercise extreme care and self criticism in the presentation of new knowledge which may bear upon their management and their morale. PMID:2001115

  13. Projecting Timber Inventory at the Product Level

    Science.gov (United States)

    Lawrence Teeter; Xiaoping Zhou

    1999-01-01

    Current timber inventory projections generally lack information on inventory by product classes. Most models available for inventory projection and linked to supply analyses are limited to projecting aggregate softwood and hardwood. The research presented describes a methodology for distributing the volume on each FIA (USDA Forest Service Forest Inventory and Analysis...

  14. 76 FR 62327 - Retail Inventory Method

    Science.gov (United States)

    2011-10-07

    ... Internal Revenue Service 26 CFR Part 1 RIN 1545-BJ64 Retail Inventory Method AGENCY: Internal Revenue... regulations relating to the retail inventory method of accounting. The regulations restate and clarify the computation of ending inventory values under the retail inventory method and provide a special rule for...

  15. 10 CFR 39.37 - Physical inventory.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Physical inventory. 39.37 Section 39.37 Energy NUCLEAR... inventory. Each licensee shall conduct a semi-annual physical inventory to account for all licensed material received and possessed under the license. The licensee shall retain records of the inventory for 3 years...

  16. 27 CFR 20.170 - Physical inventory.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Physical inventory. 20.170... Users of Specially Denatured Spirits Inventory and Records § 20.170 Physical inventory. Once in each... physical inventory of each formula of new and recovered specially denatured spirits. (Approved by the...

  17. Base-age invariance and inventory projections

    Science.gov (United States)

    C. J. Cieszewski; R. L. Bailey; B. E. Borders; G. H. Brister; B. D. Shiver

    2000-01-01

    One of the most important functions of forest inventory is to facilitate management decisions towards forest sustainability based on inventory projections into the future. Therefore, most forest inventories are used for predicting future states of the forests, in modern forestry the most common methods used in inventory projections are based on implicit functions...

  18. Electronic properties of blue phosphorene/graphene and blue phosphorene/graphene-like gallium nitride heterostructures.

    Science.gov (United States)

    Sun, Minglei; Chou, Jyh-Pin; Yu, Jin; Tang, Wencheng

    2017-07-05

    Blue phosphorene (BlueP) is a graphene-like phosphorus nanosheet which was synthesized very recently for the first time [Nano Lett., 2016, 16, 4903-4908]. The combination of electronic properties of two different two-dimensional materials in an ultrathin van der Waals (vdW) vertical heterostructure has been proved to be an effective approach to the design of novel electronic and optoelectronic devices. Therefore, we used density functional theory to investigate the structural and electronic properties of two BlueP-based heterostructures - BlueP/graphene (BlueP/G) and BlueP/graphene-like gallium nitride (BlueP/g-GaN). Our results showed that the semiconducting nature of BlueP and the Dirac cone of G are well preserved in the BlueP/G vdW heterostructure. Moreover, by applying a perpendicular electric field, it is possible to tune the position of the Dirac cone of G with respect to the band edge of BlueP, resulting in the ability to control the Schottky barrier height. For the BlueP/g-GaN vdW heterostructure, BlueP forms an interface with g-GaN with a type-II band alignment, which is a promising feature for unipolar electronic device applications. Furthermore, we discovered that both G and g-GaN can be used as an active layer for BlueP to facilitate charge injection and enhance the device performance.

  19. Annual Danish emissions inventory report to UNECE. Inventory 1990 - 2002

    Energy Technology Data Exchange (ETDEWEB)

    Illerup, J.B.; Nielsen, M.; Winther, M.; Hjort Mikkelsen, M.; Lyck, E.; Hoffmann, L.; Fauser, P.

    2004-05-01

    This report is a documentation report on the emission inventories for Denmark as reported to the UNECE Secretariat under the Convention on Long Range Transboundary Air Pollution due by 15 February 2004. The report contains information on Denmark's emission inventories regarding emissions of (1) SOx for the years 1980-2002, (2) NOx, CO, NMVOC and NH{sub 3} for the years 1985-2002; (3) Particulate matter: TSP, PM10, PM2.5 for the years 2000-2002, (4) Heavy Metals: Pb, Cd, Hg, As, Cr, Cu, Ni, Se and Zn for the years 1990-2002, and (5) Polyaromatic hydrocarbons (PAH): Benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene and indeno(1,2,3-cd)pyrene for the years 1990-2002. Furthermore, the report contains information on background data for emissions inventory. (au)

  20. EARLY DOWNHOME BLUES IN AMERICAN CULTURE

    OpenAIRE

    Muhni, Djuhertati Imam

    2012-01-01

    People's traditional music and the way people behave when performing it are symbolic expressions of broad cultural pattern and social organization . In other words music is a part of men's learned heritage . Hence this study is about music in a given culture, specifically blues in American culture . Allen Trachtenberg stated that blues songs are inheritance from the American past for negotiating black people's lives as Americans . In the experience of blues the African-Americans find themselv...

  1. The Red-Blue Transportation Problem

    OpenAIRE

    Vancroonenburg, Wim; Della Croce, Federico; Goossens, Dries; Spieksma, Frits

    2014-01-01

    This paper considers the Red-Blue Transportation Problem (Red-Blue TP), a generalization of the transportation problem where supply nodes are partitioned into two sets and so-called exclusionary constraints are imposed. We encountered a special case of this problem in a hospital context, where patients need to be assigned to rooms. We establish the problem's complexity, and we compare two integer programming formulations. Furthermore, a maximization variant of Red-Blue TP is presented, for...

  2. Variable blue straggler stars in NGC 5466

    International Nuclear Information System (INIS)

    Harris, H.C.; Mateo, M.; Olszewski, E.W.; Nemec, J.M.

    1990-01-01

    Nine variable blue stragglers have been found in the globular cluster NGC 5466. The six dwarf Cepheids in this cluster coexist in the instability strip with other nonvariable stars. The three eclipsing binaries are among the hottest of the blue stragglers. The hypothesis is discussed that all blue stragglers in this cluster have undergone mass transfer in close binaries. Under this hypothesis, rotation and spin-down play important roles in controlling the evolution of blue stragglers in old clusters and in affecting some of their observational properties. 14 refs

  3. Morphological responses of wheat to blue light

    Science.gov (United States)

    Barnes, C.; Bugbee, B.

    1992-01-01

    Blue light significantly increased tillering in wheat (Triticum aestivum L.) plants grown at the same photosynthetic photon flux (PPF). Plants were grown under two levels of blue light (400-500 nm) in a controlled environment with continuous irradiation. Plants received either 50 micromoles m-2 s-1 of blue light or 2 micromoles m-2 s-1 blue light from filtered metal halide lamps at a total irradiance of 200 micromoles m-2 s-1 PPF (400-700 nm). Plants tillered an average of 25% more under the higher level of blue light. Blue light also caused a small, but consistent, increase in main culm development, measured as Haun stage. Leaf length was reduced by higher levels of blue light, while plant dry-mass was not significantly affected by blue light. Applying the principle of equivalent light action, the results suggest that tillering and leaf elongation are mediated by the blue-UV light receptor(s) because phytochrome photoequilibrium for each treatment were nearly identical.

  4. Why Blue-Collar Blacks Help Less

    OpenAIRE

    Smith, Sandra Susan; Young, Kara Alexis

    2013-01-01

    Why are blue-collar blacks less likely to help jobseekers than jobholders from other ethnoracial groups or even than more affluent blacks? Drawing from in-depth, semi-structured interviews with 97 black and Latino workers at one large, public sector employer, we find that blue-collar black workers both helped less proactively and rejected more requests for assistance than did blue-collar Latino and white-collar black workers. We attribute blue-collar blacks’ more passive engagement to their...

  5. Prehistory of the Little Blue River Valley, Western Missouri: Archaeological Investigations at Blue Springs Lake.

    Science.gov (United States)

    1989-01-01

    Lake project. The report discusses the geomorphology and vegetation of the Little Blue River valley, Late Quaternary bioclimatic change in Western...54 Aquatic Communities ............................... 58 IV. LATE QUATERNARY BIOCLIMATIC CHANGE IN WESTERN MISSOURI by Rolfe D...City District is presently constructing Blue Springs Lake on the East Fork of the Little Blue River in Jackson County, Missouri. The location of the

  6. TMI-2 isotopic inventory calculations

    Energy Technology Data Exchange (ETDEWEB)

    Schnitzler, B G; Briggs, J B

    1985-08-01

    Point isotopic depletion methods are used to develop spatially dependent fission product and heavy metal inventories for the TMI-2 core. Burnup data from 1239 fuel nodes (177 elements, 7 axial nodes per element) are utilized to preserve the core axial and radial power distributions. A full-core inventory is calculated utilizing 12 fuel groups (four burnup ranges for each of three initial enrichments). Calculated isotopic ratios are also presented as a function of burnup for selected nuclides. Specific applications of the isotopic ratio data include correlation of fuel debris samples with core location and estimates of fission product release fractions. 24 figs., 25 tabs.

  7. National Inventory Report 2006 - Norway

    Energy Technology Data Exchange (ETDEWEB)

    2006-07-01

    The report presents an inventory of greenhouse gas emissions and sinks in Norway from 1990 to 2004. Trends in total greenhouse gas emissions by UNFCCC's sources and gases are described for carbon dioxide (CO{sub 2}), methane (CH{sub 4}), nitrous oxide (N{sub 2}O), tetrafluoromethane (CF{sub 4}), hexafluoroethane (C{sub 2}F{sub 6}), sulphur hexafluoride (SF{sub 6}) and HFCs. Methodology used in the calculation of emissions from key sources in the Norwegian Emission Inventory are presented. Emissions are reported according to UNFCCC/IPCC common reporting format (CRF)

  8. National Inventory Report 2006 - Norway

    International Nuclear Information System (INIS)

    2006-01-01

    The report presents an inventory of greenhouse gas emissions and sinks in Norway from 1990 to 2004. Trends in total greenhouse gas emissions by UNFCCC's sources and gases are described for carbon dioxide (CO 2 ), methane (CH 4 ), nitrous oxide (N 2 O), tetrafluoromethane (CF 4 ), hexafluoroethane (C 2 F 6 ), sulphur hexafluoride (SF 6 ) and HFCs. Methodology used in the calculation of emissions from key sources in the Norwegian Emission Inventory are presented. Emissions are reported according to UNFCCC/IPCC common reporting format (CRF)

  9. National Inventory Report 2005 Norway

    Energy Technology Data Exchange (ETDEWEB)

    2005-07-01

    The report presents an inventory of greenhouse gas emissions and sinks in Norway from 1990 to 2003. Trends in total greenhouse gas emissions by UNFCCC's sources and gases are described for carbon dioxide (CO{sub 2}), methane (CH{sub 4}), nitrous oxide (N{sub 2}O), tetrafluoromethane (CF{sub 4}), hexafluoroethane (C{sub 2}F{sub 6}), sulphur hexafluoride (SF{sub 6}) and HFCs. Methodology used in the calculation of emissions from key sources in the Norwegian Emission Inventory are presented. Emissions are reported according to UNFCCC/IPCC common reporting format (CRF)

  10. Blue rubber bleb nevus syndrome

    Directory of Open Access Journals (Sweden)

    Rodrigues Daleth

    2000-01-01

    Full Text Available The blue rubber nevus syndrome consists of multiple venous malformations in the skin and gastrointestinal tract associated with intestinal hemorrhage and iron deficiency anemia. Other organs may be involved. The causes of this syndrome are unknown. Its most common presentation is in the form of sporadic cases, but dominant autosomal inheritance has been described. It is a condition that affects both sexes equally, and its occurrence is rare in the black race. We present a case of this syndrome diagnosed in a 11-year-old patient. He had severe anemia and a venous swelling on the trunk. Similar lesions were found in the stomach, bowel, and on his foot. We emphasize the main clinical aspects: intestine, eyes, nasopharynx, parotids, lungs, liver, spleen, heart, brain, pleura, peritoneum, pericardium, skeletal muscles, bladder, and penis lesions, systemic complications that may occur to these patients which are thrombosis and calcification, as well as consumptive coagulopathy and thrombocytopenia that may occur within the nevi.

  11. Blue enhanced light sources: opportunities and risks

    Science.gov (United States)

    Lang, Dieter

    2012-03-01

    Natural daylight is characterized by high proportions of blue light. By proof of a third type of photoreceptor in the human eye which is only sensitive in this spectral region and by subsequent studies it has become obvious that these blue proportions are essential for human health and well being. In various studies beneficial effects of indoor lighting with higher blue spectral proportions have been proven. On the other hand with increasing use of light sources having enhanced blue light for indoor illumination questions are arising about potential health risks attributed to blue light. Especially LED are showing distinct emission characteristics in the blue. Recently the French agency for food, environmental and occupational health & safety ANSES have raised the question on health issues related to LED light sources and have claimed to avoid use of LED for lighting in schools. In this paper parameters which are relevant for potential health risks will be shown and their contribution to risk factors will quantitatively be discussed. It will be shown how to differentiate between photometric parameters for assessment of beneficial as well as hazardous effects. Guidelines will be discussed how blue enhanced light sources can be used in applications to optimally support human health and well being and simultaneously avoid any risks attributed to blue light by a proper design of lighting parameters. In the conclusion it will be shown that no inherent health risks are related to LED lighting with a proper lighting design.

  12. Blue Skies, Coffee Creamer, and Rayleigh Scattering

    Science.gov (United States)

    Liebl, Michael

    2010-01-01

    The first physical explanation of Earths blue sky was fashioned in 1871 by Lord Rayleigh. Many discussions of Rayleigh scattering and approaches to studying it both in and out of the classroom are available. Rayleigh scattering accounts for the blue color of the sky and the orange/red color of the Sun near sunset and sunrise, and a number of…

  13. Blue jay attacks and consumes cedar waxwing

    Science.gov (United States)

    Daniel Saenz; Joshua B. Pierce

    2009-01-01

    Blue Jays (Cyanocitta cristata) are known to be common predators on bird nests (Wilcove 1985, Picman and Schriml 1994). In addition to predation on eggs and nestlings, Blue Jays occasionally prey on fledgling and adult birds (Johnson and Johnson 1976, Dubowy 1985). A majority of reports involve predation on House Sparrows (Passer domesticus) and other small birds (...

  14. Developing an Action Concept Inventory

    Science.gov (United States)

    McGinness, Lachlan P.; Savage, C. M.

    2016-01-01

    We report on progress towards the development of an Action Concept Inventory (ACI), a test that measures student understanding of action principles in introductory mechanics and optics. The ACI also covers key concepts of many-paths quantum mechanics, from which classical action physics arises. We used a multistage iterative development cycle for…

  15. Wisconsin's fourth forest inventory, 1983.

    Science.gov (United States)

    John S. Jr. Spencer; W. Brad Smith; Jerold T. Hahn; Gerhard K. Raile

    1988-01-01

    The fourth inventory of the timber resource of Wisconsin shows that growing-stock volume increased from 11.2 to 15.5 billion cubic feet between 1968 and 1983, and area of timberland increased from 14.5 to 14.8 million acres. Presented are analysis and statistics on forest area and timber volume, growth, mortality, removals, and projections.

  16. COMPUTER ASSISTED INVENTORY CONTROL SYSTEM ...

    African Journals Online (AJOL)

    supply chain actions. This includes integration of information coming from vendors. manufacturers and distributors, so as to smooth up the flow of materials in, through and out of a manufacturing firm. in a more responsive way to customer's demand. The main drawback for effective inventory management is the lack.

  17. Sourcing Life Cycle Inventory Data

    Science.gov (United States)

    The collection and validation of quality lifecycle inventory (LCI) data can be the most difficult and time-consuming aspect of developing a life cycle assessment (LCA). Large amounts of process and production data are needed to complete the LCI. For many studies, the LCA analyst ...

  18. Tapered photonic crystal fibers for blue-enhanced supercontinuum generation

    DEFF Research Database (Denmark)

    Møller, Uffe; Sørensen, Simon Toft; Larsen, Casper

    2012-01-01

    Tapering of photonic crystal fibers is an effective way of shifting the blue edge of a supercontinuum spectrum down in the deep-blue. We discuss the optimum taper profile for enhancing the power in the blue edge....

  19. Assessing removals for North Central forest inventories.

    Science.gov (United States)

    W. Brad Smith

    1991-01-01

    Discusses method used by the Forest Inventory and Analysis Unit for estimating timber removals. Presents the relationship of timber utilization studies, primary lumber mill studies, and forest inventory data.

  20. Inventory on cleaner production education and training

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Pöyry, Sirkka; Huisingh, Donald

    Analysis and presentation of the data from an international inventory on cleaner production education and training......Analysis and presentation of the data from an international inventory on cleaner production education and training...

  1. CoC Housing Inventory Count Reports

    Data.gov (United States)

    Department of Housing and Urban Development — Continuum of Care (CoC) Homeless Assistance Programs Housing Inventory Count Reports are a snapshot of a CoC’s housing inventory, available at the national and state...

  2. Ottawa National Wildlife Refuge : Wildlife Inventory Plan

    Data.gov (United States)

    Department of the Interior — This Wildlife Inventory Plan for Ottawa NWR describes the inventory program’s relation to Refuge objectives and outlines the program’s policies and administration....

  3. Phytotoxicity of methylene blue to rice seedlings

    Directory of Open Access Journals (Sweden)

    X.Z. Yu

    2015-07-01

    Full Text Available Methylene blue is widely used in various industrial branches. Due to insufficient treatment, its occurrence in wastewater is frequently detected, which may result in serious environment problems to aquatic organisms. Hydroponic experiments were conducted with rice seedlings (Oryza sativa L. cv. XZX 45 exposed to methylene blue to determine the effective concentration using relative growth rate and water use efficiency as response endpoints. Results showed that acute toxicity of methylene blue to rice seedlings was evident. Although a linear decrease in relative growth rate and water use efficiency was observed in rice seedlings with increasing methylene blue concentrations, relative growth rate of rice seedlings was more sensitive to change of methylene blue than water use efficiency. Using non-linear regression, EC-48 h values for 10%, 20% and 50% inhibition of the relative growth rate were estimated to be 1.54, 3.22 and 10.13 mg MB/L for rice seedlings exposed to methylene blue, respectively, while smaller EC were obtained for 96 h exposure. In conclusion, the toxic response of young rice seedlings to methylene blue is obvious and inhibitory effects are highly dependent on response endpoints and the duration of exposure period.

  4. Can greening of aquaculture sequester blue carbon?

    Science.gov (United States)

    Ahmed, Nesar; Bunting, Stuart W; Glaser, Marion; Flaherty, Mark S; Diana, James S

    2017-05-01

    Globally, blue carbon (i.e., carbon in coastal and marine ecosystems) emissions have been seriously augmented due to the devastating effects of anthropogenic pressures on coastal ecosystems including mangrove swamps, salt marshes, and seagrass meadows. The greening of aquaculture, however, including an ecosystem approach to Integrated Aquaculture-Agriculture (IAA) and Integrated Multi-Trophic Aquaculture (IMTA) could play a significant role in reversing this trend, enhancing coastal ecosystems, and sequestering blue carbon. Ponds within IAA farming systems sequester more carbon per unit area than conventional fish ponds, natural lakes, and inland seas. The translocation of shrimp culture from mangrove swamps to offshore IMTA could reduce mangrove loss, reverse blue carbon emissions, and in turn increase storage of blue carbon through restoration of mangroves. Moreover, offshore IMTA may create a barrier to trawl fishing which in turn could help restore seagrasses and further enhance blue carbon sequestration. Seaweed and shellfish culture within IMTA could also help to sequester more blue carbon. The greening of aquaculture could face several challenges that need to be addressed in order to realize substantial benefits from enhanced blue carbon sequestration and eventually contribute to global climate change mitigation.

  5. Infiltrating giant cellular blue naevus.

    Science.gov (United States)

    Bittencourt, A L; Monteiro, D A; De Pretto, O J

    2007-01-01

    Cellular blue naevi (CBN) measure 1-2 cm in diameter and affect the dermis, occasionally extending into the subcutaneous fat. The case of a 14-year-old boy with a giant CBN (GCBN) involving the right half of the face, the jugal mucosa and the lower eyelid with a tumour that had infiltrated the bone and the maxillary and ethmoidal sinuses is reported. Biopsies were taken from the skin, jugal mucosa and maxillary sinus. The following markers were used in the immunohistochemical evaluation: CD34, CD56, HMB-45, anti-S100, A-103, Melan A and MIB-1. The biopsy specimens showed a biphasic pattern affecting the lower dermis, subcutaneous fat, skeletal muscle, bone, jugal mucosa and maxillary sinus, but there was no histological evidence of malignancy. The tumour cells were CD34-, CD56-, HMB45+, anti-S100+ and A-103+. Melan A was focally expressed. No positive MIB-1 cells were identified. The present case shows that GCBN may infiltrate deeply, with no evidence of malignancy.

  6. 30 CFR 220.032 - Inventories.

    Science.gov (United States)

    2010-07-01

    ... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral... Inventories. (a) The lessee is responsible for NPSL materiel and shall make proper and timely cost and credit...

  7. 10 CFR 34.29 - Quarterly inventory.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Quarterly inventory. 34.29 Section 34.29 Energy NUCLEAR... RADIOGRAPHIC OPERATIONS Equipment § 34.29 Quarterly inventory. (a) Each licensee shall conduct a quarterly physical inventory to account for all sealed sources and for devices containing depleted uranium received...

  8. 23 CFR 650.315 - Inventory.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Inventory. 650.315 Section 650.315 Highways FEDERAL..., STRUCTURES, AND HYDRAULICS National Bridge Inspection Standards § 650.315 Inventory. (a) Each State or Federal agency must prepare and maintain an inventory of all bridges subject to the NBIS. Certain...

  9. 78 FR 10642 - Service Contracts Inventory

    Science.gov (United States)

    2013-02-14

    ... COMMISSION Service Contracts Inventory AGENCY: Nuclear Regulatory Commission. ACTION: Notice of availability. SUMMARY: The U.S. Nuclear Regulatory Commission (NRC) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2012. The inventory includes service contract actions over $25...

  10. 7 CFR 984.21 - Handler inventory.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Handler inventory. 984.21 Section 984.21 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Regulating Handling Definitions § 984.21 Handler inventory. Handler inventory as of any date means all...

  11. 77 FR 5280 - Service Contracts Inventory

    Science.gov (United States)

    2012-02-02

    ... COMMISSION Service Contracts Inventory AGENCY: Nuclear Regulatory Commission. ACTION: Notice of availability. SUMMARY: The U.S. Nuclear Regulatory Commission (NRC) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2011. The inventory includes service contract actions over $25...

  12. 75 FR 82095 - Service Contracts Inventory

    Science.gov (United States)

    2010-12-29

    ... Doc No: 2010-32828] NUCLEAR REGULATORY COMMISSION [NRC-2010-0394] Service Contracts Inventory AGENCY... Regulatory Commission (NRC) is providing for public information its Inventory of Contracts for Services for Fiscal Year (FY) 2010. The inventory includes service contract actions over $25,000 that were awarded in...

  13. 26 CFR 1.1374-7 - Inventory.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Inventory. 1.1374-7 Section 1.1374-7 Internal... TAXES Small Business Corporations and Their Shareholders § 1.1374-7 Inventory. (a) Valuation. The fair market value of the inventory of an S corporation on the first day of the recognition period equals the...

  14. 42 CFR 35.41 - Inventory.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Inventory. 35.41 Section 35.41 Public Health PUBLIC... STATION MANAGEMENT Disposal of Money and Effects of Deceased Patients § 35.41 Inventory. Promptly after the death of a patient in a station or hospital of the Service, an inventory of his money and effects...

  15. An annualized forest inventory for Nebraska

    Science.gov (United States)

    Hans T. Schreuder; Tom D. Wardle

    2000-01-01

    This paper addresses opportunities presented to states by an annualized forest inventory system, to be conducted by the Forest Inventory and Analysis program of the USDA Forest Service, and concerns about these inventories. The importance of a balanced approach in assessing timber and nontimber attributes is emphasized, and the paramount importance of maintaining and...

  16. TFTR tritium inventory accountability system

    International Nuclear Information System (INIS)

    Saville, C.; Ascione, G.; Elwood, S.; Nagy, A.; Raftopoulos, S.; Rossmassler, R.; Stencel, J.; Voorhees, D.; Tilson, C.

    1995-01-01

    This paper discusses the program, PPPL (Princeton Plasma Physics Laboratory) Material Control and Accountability Plan, that has been implemented to track US Department of Energy's tritium and all other accountable source material. Specifically, this paper details the methods used to measure tritium in various systems at the Tokamak Fusion Test Reactor; resolve inventory differences; perform inventory by difference inside the Tokamak; process and measure plasma exhaust and other effluent gas streams; process, measure and ship scrap or waste tritium on molecular sieve beds; and detail organizational structure of the Material Control and Accountability group. In addition, this paper describes a Unix-based computerized software system developed at PPPL to account for all tritium movements throughout the facility. 5 refs., 2 figs

  17. TFTR tritium inventory accountability system

    Energy Technology Data Exchange (ETDEWEB)

    Saville, C.; Ascione, G.; Elwood, S.; Nagy, A.; Raftopoulos, S.; Rossmassler, R.; Stencel, J.; Voorhees, D.; Tilson, C. [Plasma Physics Lab., Princeton, NJ (United States)

    1995-10-01

    This paper discusses the program, PPPL (Princeton Plasma Physics Laboratory) Material Control and Accountability Plan, that has been implemented to track US Department of Energy`s tritium and all other accountable source material. Specifically, this paper details the methods used to measure tritium in various systems at the Tokamak Fusion Test Reactor; resolve inventory differences; perform inventory by difference inside the Tokamak; process and measure plasma exhaust and other effluent gas streams; process, measure and ship scrap or waste tritium on molecular sieve beds; and detail organizational structure of the Material Control and Accountability group. In addition, this paper describes a Unix-based computerized software system developed at PPPL to account for all tritium movements throughout the facility. 5 refs., 2 figs.

  18. Ghana Youth Employment Program Inventory

    OpenAIRE

    Ulzen-Appiah, Ato; Avura, Francis Babongte

    2016-01-01

    This youth employment inventory has been compiled to improve the evidence base for making decisions about how to address the problem of youth unemployment or youth who are not in education and not participating in the labor market in Ghana. Policy makers who are considering measures to help young people make the transition into the labor market and obtain decent work are hampered by a lack ...

  19. Radioactive waste inventories and projections

    International Nuclear Information System (INIS)

    McLaren, L.H.

    1982-11-01

    This bibliography contains information on radioactive waste inventories and projections included in the Department of Energy's Energy Data Base from January 1981 through September 1982. The arrangement is by report number for reports, followed by nonreports in reverse chronological order. These citations are to research reports, journal articles, books, patents, theses, and conference papers from worldwide sources. Five indexes, each preceded by a brief description, are provided: Corporate Author, Personal Author, Subject, Contract Number, and Report Number. (25 abstracts)

  20. Stable isotope research pool inventory

    International Nuclear Information System (INIS)

    1984-03-01

    This report contains a listing of electromagnetically separated stable isotopes which are available at the Oak Ridge National Laboratory for distribution for nondestructive research use on a loan basis. This inventory includes all samples of stable isotopes in the Research Materials Collection and does not designate whether a sample is out on loan or is in reprocessing. For some of the high abundance naturally occurring isotopes, larger amounts can be made available; for example, Ca-40 and Fe-56

  1. National inventory of radioactive wastes

    International Nuclear Information System (INIS)

    1997-01-01

    There are in France 1064 sites corresponding to radioactive waste holders that appear in this radioactive waste inventory. We find the eighteen sites of E.D.F. nuclear power plants, The Cogema mine sites, the Cogema reprocessing plants, The Cea storages, the different factories and enterprises of nuclear industry, the sites of non nuclear industry, the Andra centers, decommissioned installations, disposals with low level radioactive wastes, sealed sources distributors, national defence. (N.C.)

  2. Inventory Dynamics under Transaction Costs

    OpenAIRE

    Jean-Paul Chavas; Paula M. Despins; T. Randy Fortenbery

    2000-01-01

    A conceptual model of storage behavior is developed. Optimal intertemporal pricing is derived to analyze the effects of transaction costs on storage andarbitrage pricing. It is shown how transaction costs can rationalize the existence of an inverse carrying charge for inventory. The model is applied to U.S. soybeans stocks for the period 1960–95. The empirical results suggest that transaction costs have a significant influence on storage behavior andintertemporal arbitrage pricing. Copyright ...

  3. 78 FR 17205 - Notice of Availability of Service Contract Inventories

    Science.gov (United States)

    2013-03-20

    ... FEDERAL MARITIME COMMISSION Notice of Availability of Service Contract Inventories AGENCY: Federal Maritime Commission. ACTION: Notice of availability of service contract inventories. FOR FURTHER... Service Contract Inventory Analysis, the FY 2012 Service Contract Inventory, and the FY 2012 Service...

  4. Danish emission inventory for particular matter (PM)

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, M.; Winther, M.; Illerup, J.B.; Hjort Mikkelsen, M.

    2003-11-01

    The first Danish emission inventory that was reported in 2002 was a provisional-estimate based on data presently available. This report documents methodology, emission factors and references used for an improved Danish emission inventory for particulate matter. Further results of the improved emission inventory for the year 2000 are shown. The particulate matter emission inventory includes TSP, PM,, and PM, The report covers emission inventories for transport and stationary combustion. An appendix covering emissions from agriculture is also included. For the transport sector, both exhaust and non-exhaust emission such as tyre and break wear and road abrasion are included. (au)

  5. Physical inventory taking at Lucas Heights

    International Nuclear Information System (INIS)

    Quealy, K.J.

    1989-01-01

    Physical inventory planning and implementation at the Lucas Heights research reactor as the model facility are described. The description includes the computer-based records system used and the steps to ensure its accuracy, the labelling of separate items of nuclear material, the clean-out procedures for converting in-process material to measurable items, the administrative procedures for inventorying each inventory area, the verification procedures used to include previously measured tamper-safe items in the inventory, and lastly, procedures used to reconcile the inventory and calculate MUF (material unaccounted for). 2 figs

  6. The Biology of blue-green algae

    National Research Council Canada - National Science Library

    Carr, Nicholas G; Whitton, B. A

    1973-01-01

    .... Their important environmental roles, their part in nitrogen fixation and the biochemistry of phototrophic metabolism are some of the attractions of blue-geen algae to an increasing number of biologists...

  7. Random lasing in blue phase liquid crystals.

    Science.gov (United States)

    Chen, Chun-Wei; Jau, Hung-Chang; Wang, Chun-Ta; Lee, Chun-Hong; Khoo, I C; Lin, Tsung-Hsien

    2012-10-08

    Random lasing actions have been observed in optically isotropic pure blue-phase and polymer-stabilized blue-phase liquid crystals containing laser dyes. Scattering, interferences and recurrent multiple scatterings arising from disordered platelet texture as well as index mismatch between polymer and mesogen in these materials provide the optical feedbacks for lasing action. In polymer stabilized blue-phase liquid crystals, coherent random lasing could occur in the ordered blue phase with an extended temperature interval as well as in the isotropic liquid state. The dependence of lasing wavelength range, mode characteristics, excitation threshold and other pertinent properties on temperature and detailed make-up of the crystals platelets were obtained. Specifically, lasing wavelengths and mode-stability were found to be determined by platelet size, which can be set by controlling the cooling rate; lasing thresholds and emission spectrum are highly dependent on, and therefore can be tuned by temperature.

  8. SUPPLEMENTARY INFORMATION Protonation of Patented Blue V ...

    Indian Academy of Sciences (India)

    XTreme.ws

    SUPPLEMENTARY INFORMATION. Protonation of Patented Blue V in aqueous solutions: Theoretical and experimental studies. KATERYNA BEVZIUKa, ALEXANDER CHEBOTAREVa, MAKSYM FIZERb,. ANASTASIIA KLOCHKOVAa, KONSTANTIN PLIUTAa and DENYS SNIGURa*. aDepartment of Analytical Chemistry, ...

  9. Substantial Research Secures the Blue Future for our Blue Plant

    Directory of Open Access Journals (Sweden)

    Moustafa Abdel Maksoud

    2016-06-01

    Full Text Available Earth, the blue planet, is our home, and seas and oceans cover more than 70% of its surface. As the earth’s population rapidly increases and available resources decrease, seas and oceans can play a key role in assuring the long-term survival of humankind. Renewable maritime energy has huge potential to provide a considerable part of the earth’s population with decarbonised electricity generation systems. Renewable maritime energy is very flexible and can be harvested above the water’s free surface by using offshore wind turbines, on the water’s surface by using wave energy converters or below the water’s surface by using current or tidal turbines. The supposed conflict between environmental protection measures and economic interests is neither viable nor reasonable. Renewable maritime energy can be the motor for considerable substantial economic growth for many maritime regions and therefore for society at large. The fastest growing sector of renewable maritime energy is offshore wind. The annual report of the European Wind Energy Association from the year 2015 confirms the growing relevance of the offshore wind industry. In 2015, the total installed and grid-connected capacity of wind power was 12,800 MW in the EU and 6,013.4 MW in Germany. 38% of the 2015 annual installation in Germany was offshore, accounting for a capacity of 2,282.4 MW. However, there are a limited number of available installation sites in shallow water, meaning that there is an urgent need to develop new offshore structures for water depths greater than 50m. The persistent trend towards deeper waters has encouraged the offshore wind industry to look for floating wind turbine structures and larger turbines. Floating wind turbine technologies are at an early stage of development and many technical and economic challenges will still need to be faced. Nonetheless, intensive research activities and the employment of advanced technologies are the key factors in

  10. Constructing a biodiversity terminological inventory.

    Directory of Open Access Journals (Sweden)

    Nhung T H Nguyen

    Full Text Available The increasing growth of literature in biodiversity presents challenges to users who need to discover pertinent information in an efficient and timely manner. In response, text mining techniques offer solutions by facilitating the automated discovery of knowledge from large textual data. An important step in text mining is the recognition of concepts via their linguistic realisation, i.e., terms. However, a given concept may be referred to in text using various synonyms or term variants, making search systems likely to overlook documents mentioning less known variants, which are albeit relevant to a query term. Domain-specific terminological resources, which include term variants, synonyms and related terms, are thus important in supporting semantic search over large textual archives. This article describes the use of text mining methods for the automatic construction of a large-scale biodiversity term inventory. The inventory consists of names of species, amongst which naming variations are prevalent. We apply a number of distributional semantic techniques on all of the titles in the Biodiversity Heritage Library, to compute semantic similarity between species names and support the automated construction of the resource. With the construction of our biodiversity term inventory, we demonstrate that distributional semantic models are able to identify semantically similar names that are not yet recorded in existing taxonomies. Such methods can thus be used to update existing taxonomies semi-automatically by deriving semantically related taxonomic names from a text corpus and allowing expert curators to validate them. We also evaluate our inventory as a means to improve search by facilitating automatic query expansion. Specifically, we developed a visual search interface that suggests semantically related species names, which are available in our inventory but not always in other repositories, to incorporate into the search query. An assessment of

  11. Blue emitting organic semiconductors under high pressure

    DEFF Research Database (Denmark)

    Knaapila, Matti; Guha, Suchismita

    2016-01-01

    This review describes essential optical and emerging structural experiments that use high GPa range hydrostatic pressure to probe physical phenomena in blue-emitting organic semiconductors including π-conjugated polyfluorene and related compounds. The work emphasizes molecular structure and inter......This review describes essential optical and emerging structural experiments that use high GPa range hydrostatic pressure to probe physical phenomena in blue-emitting organic semiconductors including π-conjugated polyfluorene and related compounds. The work emphasizes molecular structure...

  12. Blue Flag: a Symbol of Environmental Protection

    Directory of Open Access Journals (Sweden)

    Ioan Petroman

    2010-10-01

    Full Text Available Blue Flag is a high standard symbol of environmental protection and it is awarded to the beaches and agreement ports by the Foundation of Education for the Environment. The beaches having been awarded this distinction warrant particular protection for their visitors, which is a particular point of tourism attractiveness: the result, they are preferred by tourists and, therefore, by tour operators selling tourism packages for the littoral. In 2009, Romanian beaches were not awarded any Blue Flags.

  13. 2009 National inventory of radioactive material and wastes. Geographical inventory

    International Nuclear Information System (INIS)

    2009-01-01

    A geographical inventory of the radioactive wastes present on the French territory (as recorded until the 31 of december, 2007) is presented, region by region. The various types of waste sites (production, processing, conditioning and storage sites, Uranium mines, ANDRA storage centers, historical storage sites and polluted sites where wastes are stored) are listed and located on maps. Details are given on the nature and origin of these wastes (nuclear industry, medical domain, scientific research, conventional industry, Defense...). A total of 1121 sites have been recorded, among which 163 are presented with details and charts

  14. Considering inventory distributions in a stochastic periodic inventory routing system

    Science.gov (United States)

    Yadollahi, Ehsan; Aghezzaf, El-Houssaine

    2017-07-01

    Dealing with the stochasticity of parameters is one of the critical issues in business and industry nowadays. Supply chain planners have difficulties in forecasting stochastic parameters of a distribution system. Demand rates of customers during their lead time are one of these parameters. In addition, holding a huge level of inventory at the retailers is costly and inefficient. To cover the uncertainty of forecasting demand rates, researchers have proposed the usage of safety stock to avoid stock-out. However, finding the precise level of safety stock depends on forecasting the statistical distribution of demand rates and their variations in different settings among the planning horizon. In this paper the demand rate distributions and its parameters are taken into account for each time period in a stochastic periodic IRP. An analysis of the achieved statistical distribution of the inventory and safety stock level is provided to measure the effects of input parameters on the output indicators. Different values for coefficient of variation are applied to the customers' demand rate in the optimization model. The outcome of the deterministic equivalent model of SPIRP is simulated in form of an illustrative case.

  15. Comparison of Alcian Blue, Trypan Blue, and Toluidine Blue for Visualization of the Primo Vascular System Floating in Lymph Ducts

    Directory of Open Access Journals (Sweden)

    Da-Un Kim

    2015-01-01

    Full Text Available The primo vascular system (PVS, floating in lymph ducts, was too transparent to be observed by using a stereomicroscope. It was only detectable with the aid of staining dyes, for instance, Alcian blue, which was injected into the lymph nodes. Some dyes were absorbed preferentially by the PVS than the lymph wall. It remains a standing problem to know what dyes are absorbed better by the PVS than the lymph walls. Such information would be useful to unravel the biochemical properties of the PVS that are badly in need for obtaining large amount of PVS specimens. In the current work we tried two other familiar dyes which were used in PVS research before. We found that Trypan blue and toluidine blue did not visualize the PVS. Trypan blue was cleared by the natural washing. Toluidine blue did not stain the PVS, but it did leave stained spots in the lymph wall and its surrounding tissues, and it leaked out of the lymph wall to stain surrounding connective tissues. These completely different behaviors of the three dyes were found for the first time in the current work and provide valuable information to elucidate the mechanism through which some special dyes stained the PVS preferentially compared to the lymphatic wall.

  16. Tritium inventory tracking and management

    International Nuclear Information System (INIS)

    Eichenberg, T.W.; Klein, A.C.

    1990-01-01

    This investigation has identified a number of useful applications of the analysis of the tracking and management of the tritium inventory in the various subsystems and components in a DT fusion reactor system. Due to the large amounts of tritium that will need to be circulated within such a plant, and the hazards of dealing with the tritium an electricity generating utility may not wish to also be in the tritium production and supply business on a full time basis. Possible scenarios for system operation have been presented, including options with zero net increase in tritium inventory, annual maintenance and blanket replacement, rapid increases in tritium creation for the production of additional tritium supplies for new plant startup, and failures in certain system components. It has been found that the value of the tritium breeding ratio required to stabilize the storage inventory depends strongly on the value and nature of other system characteristics. The real operation of a DT fusion reactor power plant will include maintenance and blanket replacement shutdowns which will affect the operation of the tritium handling system. It was also found that only modest increases in the tritium breeding ratio are needed in order to produce sufficient extra tritium for the startup of new reactors in less than two years. Thus, the continuous operation of a reactor system with a high tritium breeding ratio in order to have sufficient supplies for other plants is not necessary. Lastly, the overall operation and reliability of the power plant is greatly affected by failures in the fuel cleanup and plasma exhaust systems

  17. Variations on the "Blue-Bottle" Demonstration Using Food Items That Contain FD&C Blue #1

    Science.gov (United States)

    Staiger, Felicia A.; Peterson, Joshua P.; Campbell, Dean J.

    2015-01-01

    Erioglaucine dye (FD&C Blue #1) can be used instead of methylene blue in the classic "blue-bottle" demonstration. Food items containing FD&C Blue #1 and reducing species such as sugars can therefore be used at the heart of this demonstration, which simply requires the addition of strong base such as sodium hydroxide lye.

  18. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...

  19. "Blue-Collar Blues" uurib töösuhteid uutes oludes / Janar Ala

    Index Scriptorium Estoniae

    Ala, Janar, 1979-

    2009-01-01

    Tööproblemaatikat käsitlev näitus "Blue-Collar Blues" Tallinna Kunstihoones ja Tallinna Kunstihoone galeriis 31. jaanuarini 2010, kuraator Anders Härm. Lähemalt belgia-mehhiko kunstniku Francis Alys'e videost, austria kunstniku Oliver Ressleri ning venetsueela-saksa politoloogi Dario Azzelini videost "Viis tehast. Tööliste kontroll Venezuelas"

  20. A Genetic Algorithm on Inventory Routing Problem

    Directory of Open Access Journals (Sweden)

    Nevin Aydın

    2014-03-01

    Full Text Available Inventory routing problem can be defined as forming the routes to serve to the retailers from the manufacturer, deciding on the quantity of the shipment to the retailers and deciding on the timing of the replenishments. The difference of inventory routing problems from vehicle routing problems is the consideration of the inventory positions of retailers and supplier, and making the decision accordingly. Inventory routing problems are complex in nature and they can be solved either theoretically or using a heuristics method. Metaheuristics is an emerging class of heuristics that can be applied to combinatorial optimization problems. In this paper, we provide the relationship between vendor-managed inventory and inventory routing problem. The proposed genetic for solving vehicle routing problem is described in detail.

  1. Dyes adsorption blue vegetable and blue watercolor by natural zeolites modified with surfactants

    International Nuclear Information System (INIS)

    Jardon S, C. C.; Olguin G, M. T.; Diaz N, M. C.

    2009-01-01

    In this work was carried out the dyes removal blue vegetable and blue watercolor of aqueous solutions, to 20 C, at different times and using a zeolite mineral of Parral (Chihuahua, Mexico) modified with hexadecyl trimethyl ammonium bromide or dodecyl trimethyl ammonium bromide. The zeolite was characterized before and after of its adaptation with NaCl and later with HDTMABr and DTMABr. For the materials characterization were used the scanning electron microscopy of high vacuum; elementary microanalysis by X-ray spectroscopy of dispersed energy and X-ray diffraction techniques. It was found that the surfactant type absorbed in the zeolite material influences on the adsorption process of the blue dye. Likewise, the chemical structure between the vegetable blue dye and the blue watercolor, determines the efficiency of the color removal of the water, by the zeolites modified with the surfactants. (Author)

  2. Deteriorating Inventory Model for Chilled Food

    OpenAIRE

    Yang, Ming-Feng; Tseng, Wei-Chung

    2015-01-01

    With many aspects that affect inventory policy, product perishability is a critical aspect of inventory policy. Most goods will deteriorate during storage and their original value will decline or be lost. Therefore, deterioration should be taken into account in inventory practice. Chilled food products are very common consumer goods that are, in fact, perishable. If the chilled food quality declines over time customers are less likely to buy it. The value the chilled food retains is, however,...

  3. How Does Collaborative Inventory Management Make Progress?

    OpenAIRE

    Simatupang, Togar Mangihut

    2003-01-01

    Collaborative inventory management (CIM) has revolutionized electronics, textile, apparel, and grocery industries. An intriguing question is how far does the movement of CIM challenge the traditional practice of inventory management? This paper illustrates how to expose and challenge flawed assumptions of traditional inventory management. It also proposes a collaborative replenishment process that consists of a cyclic process of tactical planning, execution, and control. The proposed scheme m...

  4. Data Driven Tuning of Inventory Controllers

    DEFF Research Database (Denmark)

    Huusom, Jakob Kjøbsted; Santacoloma, Paloma Andrade; Poulsen, Niels Kjølstad

    2007-01-01

    A systematic method for criterion based tuning of inventory controllers based on data-driven iterative feedback tuning is presented. This tuning method circumvent problems with modeling bias. The process model used for the design of the inventory control is utilized in the tuning...... as an approximation to reduce time required on experiments. The method is illustrated in an application with a multivariable inventory control implementation on a four tank system....

  5. Blue Water Footprint Management in a UK Poultry Supply Chain under Environmental Regulatory Constraints

    Directory of Open Access Journals (Sweden)

    Naoum Tsolakis

    2018-02-01

    Full Text Available Chicken is the most consumed meat in the UK, accounting for 40% of meat consumption, while national production sufficiency reaches about 80%. As a farmed animal product, chicken meat is responsible for significant freshwater appropriation volumes during its production cycle. In this context, this research aims at exploring freshwater dynamics in the UK processed poultry industry. Specifically, we develop a System Dynamics model to capture the blue water footprint, as a key sustainability performance indicator of a poultry supply chain, in the case that relevant environmental and regulatory constraints are applied. The model contributes towards investigating the impact of two potential policy-making scenarios, namely, the “water penalty” and the “water tax”, on the nexus between profitability and water usage across the poultry supply chain. Responding to the regulatory constraints, the food processor either reconfigures the supply chain through rethinking desired inventory levels or implements a water management intervention. The results indicate that investing in water-friendly production technologies could offer a greater advantage to sustainable supply chains in terms of blue water efficiency and profitability, compared to employing inventory management strategies. Overall, our analysis highlights that effective policy-making and technology-driven interventions could provide potential towards ensuring economic growth and environmental sustainability of the UK poultry sector.

  6. Denmark’s National Inventory Report 2012

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Mikkelsen, Mette Hjorth; Hoffmann, Leif

    This report is Denmark’s National Inventory Report 2012. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2010 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2......This report is Denmark’s National Inventory Report 2012. The report contains information on Denmark’s emission inventories for all years’ from 1990 to 2010 for CO2, CH4, N2O, HFCs, PFCs and SF6, NOx, CO, NMVOC, SO2...

  7. Defense Business Operations Fund Inventory Record Accuracy

    National Research Council Canada - National Science Library

    1998-01-01

    .... The overall objective of the audit was to determine whether inventory amounts on the FY 1996 Defense Business Operations Fund Consolidated Financial Statements were presented fairly in accordance...

  8. Blood inventory management: hospital best practice.

    Science.gov (United States)

    Stanger, Sebastian H W; Yates, Nicola; Wilding, Richard; Cotton, Sue

    2012-04-01

    Blood is a perishable product, and hence good management of inventories is crucial. Blood inventory management is a trade-off between shortage and wastage. The challenge is to keep enough stock to ensure a 100% supply of blood while keeping time expiry losses at a minimum. This article focuses on inventory management of red blood cells in hospital transfusion laboratories to derive principles of best practice and makes recommendations that will ensure losses due to time expiry are kept to a minimum. The literature was reviewed to identify available models for perishable inventory management. Historical data from the UK blood supply chain was analyzed to identify hospitals with good inventory management practice and low wastage levels. Transfusion laboratory managers in the selected hospitals were interviewed in 7 case studies with the aim of identifying drivers for low wastage and good inventory management practice. The findings from the case studies were compared with the literature. The extant literature asserts that the drivers for good inventory performance are the use of complex inventory models and algorithms. This study has found this not to be the case. Instead, good performance is driven by the quality of transfusion laboratory staff, who must be skilled, regularly trained, and experienced. Electronic crossmatching, transparency of the inventory, and simple management procedures also facilitate good performance. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Danish emission inventories for stationary combustion plants. Inventories until 2008

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, Malene; Nielsen, Ole-Kenneth; Plejdrup, M.; Hjelgaard, K.

    2010-10-15

    Emission inventories for stationary combustion plants are presented and the methodologies and assumptions used for the inventories are described. The pollutants considered are SO{sub 2}, NO{sub x}, NMVOC, CH{sub 4}, CO, CO{sub 2}, N{sub 2}O, NH{sub 3}, particulate matter, heavy metals, dioxins, HCB and PAH. The CO{sub 2} emission in 2008 was 16 % lower than in 1990. However, fluctuations in the emission level are large as a result of electricity import/export. The emission of CH{sub 4} has increased due to increased use of lean-burn gas engines in combined heating and power (CHP) plants. However, the emission has decreased in recent years due to structural changes in the Danish electricity market. The N{sub 2}O emission was higher in 2008 than in 1990 but the fluctuations in the time-series are significant. A considerable decrease of the SO{sub 2}, NO{sub x} and heavy metal emissions is mainly a result of decreased emissions from large power plants and waste incineration plants. The combustion of wood in residential plants has increased considerably in recent years resulting in increased emission of PAH, particulate matter and CO. The emission of NMVOC has increased since 1990 as a result of both the increased combustion of wood in residential plants and the increased emission from lean-burn gas engines. The dioxin emission decreased since 1990 due to flue gas cleaning on waste incineration plants. However in recent years the emission has increased as a result of the increased combustion of wood in residential plants. (Author)

  10. INCAP - Applying short-term flexibility to control inventories

    OpenAIRE

    Lödding , Hermann; Lohmann , Steffen

    2011-01-01

    Abstract Inventory Based Capacity Control (INCAP) is a very simple method that allows inventory levels to be effectively controlled by using short-term capacity flexibility in make-to-stock settings. Moreover, INCAP can be used for finished goods inventories as well as for semi-finished goods inventories. The basic idea is to define upper and lower inventory limits and to adjust capacities if the inventory level reaches either limit. Should the inventory fall below the lower limit,...

  11. Teknologi penyamakan kulit wet blue buaya

    Directory of Open Access Journals (Sweden)

    Bambang Oetojo

    1992-08-01

    Full Text Available For this study it was used 12 pieces of grain salted crocodile skin of 11 up to 14 inch width. All of the crocodile skin were process up to pickling with the same way. Furthermore pickled crocodile skins were process up to pickling with the same way. Furthermore pickled crocodile skins and was done twice. The wet blue output from the research was visual investigated for the coulor using staning scale method. For comparition it was used pickled crocodile skins. Statistical analysis pints out that there is unsignify difference (P<0.05 the influence of the used of basic chrome sulphate to the colour of wet blue crocodile skins. Practical meaning of the research is, for tanning of crocodile skins to the wet blue, it is used 1.5% basic chromium sulphate.

  12. Intraoral blue (Jadassohn-Tieche) nevus.

    Science.gov (United States)

    Hasse, C D; Zoutendam, G L; Gombas, O F

    1978-05-01

    Blue nevus of the oral mucosa is a distinctly uncommon clincial entity. Careful review of the literature yielded thirty-one previously reported cases. The present article reports the occurrence of a blue nevus of the hard palate in a 58-year-old man. It is of interest since it is the smallest (1 by 1 mm.) intraoral blue nevus to be reported. A clinicopathologic study of the previous thirty-one cases and of our case suggests that this lesion has no age or sex predilection. The most common site of occurrence was the hard palate. There appears to be no tendency toward recurrence. A brief review of the historical background, clinical features, theories of possible origin, and differential diagnosis is presented. Excisional biopsy of localized areas of oral pibmentation, together with histopathologic study, is indicated to rule out melanoma.

  13. Blue light inhibits proliferation of melanoma cells

    Science.gov (United States)

    Becker, Anja; Distler, Elisabeth; Klapczynski, Anna; Arpino, Fabiola; Kuch, Natalia; Simon-Keller, Katja; Sticht, Carsten; van Abeelen, Frank A.; Gretz, Norbert; Oversluizen, Gerrit

    2016-03-01

    Photobiomodulation with blue light is used for several treatment paradigms such as neonatal jaundice, psoriasis and back pain. However, little is known about possible side effects concerning melanoma cells in the skin. The aim of this study was to assess the safety of blue LED irradiation with respect to proliferation of melanoma cells. For that purpose we used the human malignant melanoma cell line SK-MEL28. Cell proliferation was decreased in blue light irradiated cells where the effect size depended on light irradiation dosage. Furthermore, with a repeated irradiation of the melanoma cells on two consecutive days the effect could be intensified. Fluorescence-activated cell sorting with Annexin V and Propidium iodide labeling did not show a higher number of dead cells after blue light irradiation compared to non-irradiated cells. Gene expression analysis revealed down-regulated genes in pathways connected to anti-inflammatory response, like B cell signaling and phagosome. Most prominent pathways with up-regulation of genes were cytochrome P450, steroid hormone biosynthesis. Furthermore, even though cells showed a decrease in proliferation, genes connected to the cell cycle were up-regulated after 24h. This result is concordant with XTT test 48h after irradiation, where irradiated cells showed the same proliferation as the no light negative control. In summary, proliferation of melanoma cells can be decreased using blue light irradiation. Nevertheless, the gene expression analysis has to be further evaluated and more studies, such as in-vivo experiments, are warranted to further assess the safety of blue light treatment.

  14. The Cambridge Behavioural Inventory revised.

    Science.gov (United States)

    Wear, Helen J; Wedderburn, Catherine J; Mioshi, Eneida; Williams-Gray, Caroline H; Mason, Sarah L; Barker, Roger A; Hodges, John R

    2008-01-01

    Neurobehavioural and psychiatric symptoms are common in a range of neurodegenerative disorders with distinct profiles which are helpful in the diagnosis and monitoring of these disorders. The Cambridge Behavioural Inventory (CBI) has been shown to distinguish frontotemporal dementia (FTD), Alzheimer's disease (AD), Huntington's disease (HD) and Parkinson's disease (PD), but it is lengthy. To develop a shorter version of the 81 item CBI. CBI data from 450 participants with behavioural variant frontotemporal dementia (bv-FTD) (64), AD (96), PD (215) and HD (75) were analysed using Principal Components Analysis and measures of internal consistency (Cronbach alpha). A reduced 45-item questionnaire was developed. The instrument identified distinct behavioural profiles and performed as well as the original version. A shorter (45 item) version of the CBI is capable of differentiating bv-FTD and AD from PD and HD. It may be useful in delineating the type and extent of problems in these disorders as well as monitoring therapeutic interventions.

  15. Evaluation of process inventory uncertainties

    International Nuclear Information System (INIS)

    Roberts, N.J.

    1980-01-01

    This paper discusses the determination of some of the process inventory uncertainties in the Fast Flux Test Facility (FFTF) process line at the Los Alamos Scientific Laboratory (LASL) Plutonium Processing Facility (TA-55). A brief description of the FFTF process is given, along with a more detailed look at the peroxide precipitation and re-dissolution (PR) process. Emphasis is placed on the identification of the product and sidestreams from the unit processes, as they have application to the accountability measurements. The method of measurement of each of the product and sidestreams and their associated uncertainties are discussed. Some typical data for the PR process are presented, along with a discussion of the data. The data presented are based on our operating experience, and data on file in the TA-55 Nuclear Material Accountability System (PF/LASS/

  16. THEORY OF SPARE PARTS INVENTORY MANAGEMENT FOR PRODUCTION EQUIPMENT

    OpenAIRE

    KATARZYNA GRONDYS

    2013-01-01

    This article presents theoretical basis of spare parts inventory management in manufacturing company. Basis definitions, allocation and differences in spare parts inventory management were compared with other manufacturing inventories. The issue of spare parts inventory management is emphasized in aspect of maintaining continuity of production and generated costs of maintaining inventory.

  17. Inventory processes for HANDI 2000 business management system

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, D.

    1998-08-24

    Inventory records are maintained in the following inventory systems: HIP, (Spare Parts), WIM, (General Supplies): Convenient Storage, Shop Stock, Essential Materials, Special Tools, ESP (Excess Inventory). Requisitions for replenishment of inventory items are initiated in the respective inventory system and then forwarded to the purchasing system.

  18. 26 CFR 1.1013-1 - Property included in inventory.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Property included in inventory. 1.1013-1 Section... inventory. The basis of property required to be included in inventory is the last inventory value of such property in the hands of the taxpayer. The requirements with respect to the valuation of an inventory are...

  19. 10 CFR 300.6 - Emissions inventories.

    Science.gov (United States)

    2010-01-01

    ... reporting entity (although a reporting entity often makes these types of adjustments when calculating... without also reporting an inventory of the total emissions, but such entities should inventory and report... with the entity's initial entity statement. (2) After starting to report, each reporting entity that...

  20. 43 CFR 10.9 - Inventories.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Inventories. 10.9 Section 10.9 Public... Museums and Federal Collections § 10.9 Inventories. (a) General. This section carries out section 5 of the Act. Under section 5 of the Act, each museum or Federal agency that has possession or control over...

  1. A Validation of the Emotional Intelligence Inventory.

    Science.gov (United States)

    Tapia, Martha; Marsh, George E., II

    This study examined the concurrent validity of the Emotional Intelligence Inventory (M. Tapia, 2001) and the Emotional Intelligence Scale (N. Schutte and others, 1998). The responses to the inventories of 234 college students, 84 males and 250 females, were analyzed. Correlations between the total score on the two scales were significant.…

  2. B Plant exhaust filter inventory analysis

    International Nuclear Information System (INIS)

    Lan, J.S.; Wootan, D.W.; Carter, L.L.; Bunch, W.L.; Covey, L.I.; Greenborg, J.

    1994-10-01

    This paper describes a method for determining radionuclide inventories in filters using measurements of radiation fields that determine photon dose rates and photon-plus-electron dose rates between filter banks. The mathematical approach quantifies the curie inventories of filter banks by using the measured dose rates and the calculated Green's functions involving detector responses per unit source

  3. Clean Lead Facility Inventory System user's manual

    International Nuclear Information System (INIS)

    Garcia, J.F.

    1994-12-01

    The purpose of this user's manual is to provide instruction and guidance needed to enter and maintain inventory information for the Clean Lead Facility (CLF), PER-612. Individuals responsible for maintaining and using the system should study and understand the information provided. The user's manual describes how to properly use and maintain the CLF Inventory System. Annual, quarterly, monthly, and current inventory reports may be printed from the Inventory System for reporting purposes. Profile reports of each shipment of lead may also be printed for verification and documentation of lead transactions. The CLF Inventory System was designed on Microsoft Access version 2.0. Similar inventory systems are in use at the Idaho National Engineering Laboratory (INEL) to facilitate site-wide compilations of mixed waste data. The CLF Inventory System was designed for inventorying the clean or non-radioactive contaminated lead stored at the CLF. This data, along with the mixed waste data, will be compiled into the Idaho Mixed Waste Information (IMWI) system for reporting to the Department of Energy Idaho Office, Department of Energy Headquarters, and/or the State of Idaho

  4. Texas, 2008 forest inventory and analysis factsheet

    Science.gov (United States)

    James Bentley

    2011-01-01

    This science update summarizes the findings of the first statewide annual inventory conducted by the Southern Forest Inventory and Analysis (FIA) Program in cooperation with the Texas Forest Service of the forest resource attributes in Texas. The 254 counties of Texas are consolidated into seven FIA survey units—southeast (unit 1), the northeast (unit 2), the north...

  5. Texas, 2010 forest inventory and analysis factsheet

    Science.gov (United States)

    James W. Bentley

    2012-01-01

    This science update summarizes the findings of the statewide annual inventory conducted by the Southern Forest Inventory and Analysis (FIA) Program in cooperation with the Texas Forest Service of the forest resource attributes in Texas. The 254 counties of Texas are consolidated into seven FIA survey units – southeast (unit 1), northeast (unit 2), north central (unit 3...

  6. Relativity Concept Inventory: Development, Analysis, and Results

    Science.gov (United States)

    Aslanides, J. S.; Savage, C. M.

    2013-01-01

    We report on a concept inventory for special relativity: the development process, data analysis methods, and results from an introductory relativity class. The Relativity Concept Inventory tests understanding of relativistic concepts. An unusual feature is confidence testing for each question. This can provide additional information; for example,…

  7. 27 CFR 24.266 - Inventory losses.

    Science.gov (United States)

    2010-04-01

    ... period, in which case the percentage will be calculated on the aggregate volume. Wine removed immediately... OF THE TREASURY LIQUORS WINE Losses of Wine § 24.266 Inventory losses. (a) General. The proprietor shall take a physical inventory of all untaxpaid wine on-hand on bonded wine premises as of the close of...

  8. 27 CFR 24.313 - Inventory record.

    Science.gov (United States)

    2010-04-01

    ... designate as a white, rose or red table or dessert wine; or (2) Wine intended to be marketed with a vintage... OF THE TREASURY LIQUORS WINE Records and Reports § 24.313 Inventory record. A proprietor who files monthly or quarterly reports shall prepare a record of the physical inventory of all wine and spirits in...

  9. A two-commodity perishable inventory system

    African Journals Online (AJOL)

    (1993) considered an inventory management system at a service facility using one item of inventory for each service. They assumed that both the demand and service time are deterministic and that queues may occur only during stock-outs. They determined the optimal order quantity that minimizes the total cost rate.

  10. Lost-sales inventory theory : A review

    NARCIS (Netherlands)

    Bijvank, Marco; Vis, Iris F. A.

    2011-01-01

    In classic inventory models it is common to assume that excess demand is backordered. However, studies analyzing customer behavior in practice show that most unfulfilled demand is lost or an alternative item/location is looked for in many retail environments. Inventory systems that include this

  11. Inventory management systems : Control and information issues

    NARCIS (Netherlands)

    Janssen, F.B.S.L.P.

    1998-01-01

    This dissertation addresses the management of inventory systems. The thesis starts with an exposition on mathematical models that can be used in inventory theory. Then we deal with some information issues related to the demand process. Namely, how to control products that have intermittent demand.

  12. Inventory Management Practices and Business Performance for ...

    African Journals Online (AJOL)

    Inventory constitutes much of the working capital held by SSEs and poor working capital management has been identified as one of the major causes of SSE failures. With this backdrop, this study investigated the relationship between inventory management practices and the business performance of SSEs in Kisii ...

  13. Construct Validation of the Physics Metacognition Inventory

    Science.gov (United States)

    Taasoobshirazi, Gita; Farley, John

    2013-01-01

    The 24-item Physics Metacognition Inventory was developed to measure physics students' metacognition for problem solving. Items were classified into eight subcomponents subsumed under two broader components: knowledge of cognition and regulation of cognition. The students' scores on the inventory were found to be reliable and related to students'…

  14. Assessment of Caregiver Inventory for Rett Syndrome

    Science.gov (United States)

    Lane, Jane B.; Salter, Amber R.; Jones, Nancy E.; Cutter, Gary; Horrigan, Joseph; Skinner, Steve A.; Kaufmann, Walter E.; Glaze, Daniel G.; Neul, Jeffrey L.; Percy, Alan K.

    2017-01-01

    Rett syndrome (RTT) requires total caregiver attention and leads to potential difficulties throughout life. The Caregiver Burden Inventory, designed for Alzheimer disease, was modified to a RTT Caregiver Inventory Assessment (RTT CIA). Reliability and face, construct, and concurrent validity were assessed in caregivers of individuals with RTT. Chi…

  15. Improving the Greenlandic Greenhouse Gas Inventory

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Baunbæk, Lene; Gyldenkærne, Steen

    The project to improve the Greenlandic greenhouse gas (GHG) inventory was undertaken due to the recommendations made by the UNFCCC review team in connection with the 2008 and 2009 submissions by the Kingdom of Denmark. The improvements made to the Greenlandic GHG emission inventory were substantial...

  16. Biodecolorization and biodegradation of Reactive Blue by ...

    African Journals Online (AJOL)

    Aspergillus sp. effectively decolorized Reactive Blue and other structurally different synthetic dyes. Agitation was found to be an important parameter, while glucose (99%), sucrose (97%) and mannitol (98%) were the best carbon sources for the decolorization. Decolorization was effective in an acidic environment (pH 3).

  17. Geographical Study of American Blues Culture

    Science.gov (United States)

    Strait, John B.

    2010-01-01

    Music is not often utilized in teaching geography, despite the fact that many scholars orient their research around analyzing both the historical and spatial dimensions of musical expression. This article reports on the use of a teaching module that utilizes blues culture as a lens to understand the geographical history of the United States. The…

  18. Nanotubes based on monolayer blue phosphorus

    KAUST Repository

    Montes Muñoz, Enrique

    2016-07-08

    We demonstrate structural stability of monolayer zigzag and armchair blue phosphorus nanotubes by means of molecular dynamics simulations. The vibrational spectrum and electronic band structure are determined and analyzed as functions of the tube diameter and axial strain. The nanotubes are found to be semiconductors with a sensitive indirect band gap that allows flexible tuning.

  19. Blue whales respond to anthropogenic noise.

    Directory of Open Access Journals (Sweden)

    Mariana L Melcón

    Full Text Available Anthropogenic noise may significantly impact exposed marine mammals. This work studied the vocalization response of endangered blue whales to anthropogenic noise sources in the mid-frequency range using passive acoustic monitoring in the Southern California Bight. Blue whales were less likely to produce calls when mid-frequency active sonar was present. This reduction was more pronounced when the sonar source was closer to the animal, at higher sound levels. The animals were equally likely to stop calling at any time of day, showing no diel pattern in their sensitivity to sonar. Conversely, the likelihood of whales emitting calls increased when ship sounds were nearby. Whales did not show a differential response to ship noise as a function of the time of the day either. These results demonstrate that anthropogenic noise, even at frequencies well above the blue whales' sound production range, has a strong probability of eliciting changes in vocal behavior. The long-term implications of disruption in call production to blue whale foraging and other behaviors are currently not well understood.

  20. Prussian Blue Analogues of Reduced Dimensionality

    NARCIS (Netherlands)

    Gengler, Regis Y. N.; Toma, Luminita M.; Pardo, Emilio; Lloret, Francesc; Ke, Xiaoxing; Van Tendeloo, Gustaaf; Gournis, Dimitrios; Rudolf, Petra

    2012-01-01

    Mixed-valence polycyanides (Prussian Blue analogues) possess a rich palette of properties spanning from room-temperature ferromagnetism to zero thermal expansion, which can be tuned by chemical modifications or the application of external stimuli (temperature, pressure, light irradiation). While

  1. African Retentions in Blues and Jazz.

    Science.gov (United States)

    Meadows, Eddie S.

    1979-01-01

    The perseverance of African musical characteristics among American Blacks is an historic reality. African retentions have been recorded in Black music of the antebellum period. Various African scales and rhythms permeate Black American music today as evidenced in the retentions found in blues and jazz. (RLV)

  2. A Discography of the Real Blues

    Science.gov (United States)

    Tudor, Dean

    1972-01-01

    A short account of the rise and decline of the Blues and a discussion of the artists who performed it is followed by an annotated bibliography of periodicals, books, records and tapes related to this form of Black" music. (184 references) (NH)

  3. Blue laser phase change recording system

    International Nuclear Information System (INIS)

    Hofmann, Holger; Dambach, S.Soeren; Richter, Hartmut

    2002-01-01

    The migration paths from DVD phase change recording with red laser to the next generation optical disk formats with blue laser and high NA optics are discussed with respect to optical aberration margins and disc capacities. A test system for the evaluation of phase change disks with more than 20 GB capacity is presented and first results of the recording performance are shown

  4. The Blue Compact Dwarf Galaxy IZw18

    NARCIS (Netherlands)

    Musella, I.; Marconi, M.; Fiorentino, G.; Clementini, G.; Aloisi, A.; Annibali, F.; Contreras, R.; Saha, A.; Tosi, M.; van der Marel, R. P.

    2012-01-01

    We present the results obtained for the Blue compact galaxy IZw18 on the basis of ACS HST data obtained from our group. In particular, we discuss the stellar population and the variable stars content of this galaxy to get information about its star formation history and distance.

  5. [The dangers of blue light: True story!].

    Science.gov (United States)

    Renard, G; Leid, J

    2016-05-01

    The dangers of the blue light are the object of numerous publications, for both the scientific community and the general public. The new prolific development of light sources emitting potentially toxic blue light (415-455nm) ranges from LED (Light Emitting Diodes) lamps for interior lighting to television screens, computers, digital tablets and smartphones using OLED (Organic Light Emitting Diode) or AMOLED (Active-Matrix Organic Light Emitting Diode) technology. First we will review some technical terms and the main characteristics of light perceived by the human eye. Then we will discuss scientific proof of the toxicity of blue light to the eye, which may cause cataract or macular degeneration. Analysis of the light spectra of several light sources, from natural light to LED lamps, will allow us to specify even better the dangers related to each light source. LED lamps, whether used as components for interior lighting or screens, are of concern if they are used for extended viewing times and at short distance. While we can protect ourselves from natural blue light by wearing colored glasses which filter out, on both front and back surfaces, the toxic wavelengths, it is more difficult to protect oneself from LED lamps in internal lighting, the use of which should be restricted to "white warmth" lamps (2700K). As far as OLED or AMOLED screens are concerned, the only effective protection consists of using them occasionally and only for a short period of time. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  6. Biodecolorization and biodegradation of Reactive Blue by ...

    African Journals Online (AJOL)

    SERVER

    2007-06-18

    Jun 18, 2007 ... Aspergillus sp. effectively decolorized Reactive Blue and other structurally different synthetic dyes. Agitation was found to be an important ... Few chemically different dyes such as Reactive Black (75%), Reactive Yellow (70%),. Reactive Red (33%) and ..... Degradation of azo dyes by the lignin degrading ...

  7. Pulse electrodeposition of Prussian Blue thin films

    International Nuclear Information System (INIS)

    Najafisayar, P.; Bahrololoom, M.E.

    2013-01-01

    The effects of pulse electrodeposition parameters like peak current density and frequency on the electrochemical properties of Prussian Blue thin films were investigated. Electrochemical Impedance Spectroscopy, Cyclic Voltammetry and Chronoamperometry tests were carried out on Prussian Blue thin films which were pulse electrodeposited on Indium Tin Oxide coated glass substrates. The results showed that increase in the peak current densities and using higher pulsating frequencies during electrodeposition decreases the charge transfer resistance of the thin films while the diffusion coefficient of electroactive species in the films is increased as a consequence of using the same pulsating parameters. In addition, pulse electrodeposition technique does not alter deposition mechanism and morphology of the Prussian Blue thin films. - Highlights: • Prussian Blue thin films were pulse electrodeposited onto the ITO coated glass. • Pulse current condition affected thin films' electrochemical properties. • High pulsating current and frequency lower thin films' charge transfer resistance. • High pulsating current and frequency increase diffusion coefficient in thin films

  8. Characterization of dough baked via blue laser

    NARCIS (Netherlands)

    Blutinger, Jonathan David; Meijers, Yorán; Chen, Peter Yichen; Zheng, Changxi; Grinspun, Eitan; Lipson, Hod

    2018-01-01

    Depth of heat penetration and temperature must be precisely controlled to optimize nutritional value, appearance, and taste of food products. These objectives can be achieved with the use of a high-resolution blue diode laser—which operates at 445 nm—by adjusting the water content of the dough and

  9. Blue LED irradiation to hydration of skin

    Science.gov (United States)

    Menezes, Priscila F. C.; Requena, Michelle B.; Lizarelli, Rosane F., Z.; Bagnato, Vanderlei S.

    2015-06-01

    Blue LED system irradiation shows many important properties on skin as: bacterial decontamination, degradation of endogenous skin chromophores and biostimulation. In this clinical study we prove that the blue light improves the skin hydration. In the literature none authors reports this biological property on skin. Then this study aims to discuss the role of blue light in the skin hydration. Twenty patients were selected to this study with age between 25-35 years old and phototype I, II and III. A defined area from forearm was pre determined (A = 4.0 cm2). The study was randomized in two treatment groups using one blue light device (power of 5.3mW and irradiance of 10.8mW/cm2). The first treatment group was irradiated with 3J/cm2 (277seconds) and the second with 6J/cm2 (555 seconds). The skin hydration evaluations were done using a corneometer. The measurements were collected in 7, 14, 21 and 30 days, during the treatment. Statistical test of ANOVA, Tukey and T-Student were applied considering 5% of significance. In conclusion, both doses were able to improve the skin hydration; however, 6J/cm2 has kept this hydration for 30 days.

  10. KINETICS AND MECHANISM OF PRUSSIAN BLUE FORMATION ...

    African Journals Online (AJOL)

    Preferred Customer

    This intense blue colored pigment is used in the preparation of paints, printing inks, laundry dye, etc. [1]. The micro-porous character of PB and its analogues find ... industrial applications such as in removal of heavy metal ions in wine production [4], electrochemical application as battery building [5], electronic switching and ...

  11. Statistical thermodynamics of supercapacitors and blue engines

    NARCIS (Netherlands)

    van Roij, R.H.H.G.

    2013-01-01

    We study the thermodynamics of electrode-electrolyte systems, for instance supercapacitors filled with an ionic liquid or blue-energy devices filled with river- or sea water. By a suitable mapping of thermodynamic variables, we identify a strong analogy with classical heat engines. We introduce

  12. The Biology of blue-green algae

    National Research Council Canada - National Science Library

    Carr, Nicholas G; Whitton, B. A

    1973-01-01

    .... This book, extensively illustrated and thoroughly referenced, will provide the source material for students, and experienced as well as new research workers should find it of great value. A series of short appendices summarize details of culture collections, media and some specialized aspects of growing blue-green algae.

  13. METHYLENE BLUE ADSORPTION FROM GLYCEROL SOLUTION ...

    African Journals Online (AJOL)

    Preferred Customer

    ABSTRACT. The mechanism of methylene blue adsorption onto the surface of synthetic acicular habit of α- goethite from glycerol solution has been studied through batch experiment at 25, 30 and 35 0C in a glass cell of minimal dead volume. To describe the adsorption results, an attempt was made to fit the data to the ...

  14. The 1993-1994 Blue Ribbon Schools.

    Science.gov (United States)

    Schaefer, Christine M.

    1994-01-01

    This year's 276 Blue Ribbon schools, including 220 public and 56 private schools, are in 45 states and the District of Columbia, with a Department of Defense school in Honshu, Japan. About 70% are headed by women principals. In 89 schools, students from low-income families comprise at least a quarter of the enrollment. Schools are listed by state.…

  15. Activity based costing model for inventory valuation

    Directory of Open Access Journals (Sweden)

    Vineet Chouhan

    2017-03-01

    Full Text Available Activity-Based-Model (ABC is used for the purpose of significant improvement for overhead accounting systems by providing the best information required for managerial decision. This pa-per discusses implacability of ABC technique on inventory valuation as a management account-ing innovation. In order to prove the applicability of ABC for inventory control a material driven medium-sized and privately owned company from engineering (iron and steel industry is select-ed and by analysis of its production process and its material dependency and use of indirect in-ventory, an ABC model is explored for better inventory control. The case revealed that the ne-cessity of ABC in the area of inventory control is significant. The company is not only able to increase its quality of decision but also it can significantly analyze its cost of direct material cost, valuation of direct material and use its implications for better decision making.

  16. SISTEM INVENTORI BARANG DENGAN TEKNOLOGI AJAX

    Directory of Open Access Journals (Sweden)

    Anna Fitriya

    2015-11-01

    Full Text Available ABSTRAK Sistem inventori barang pada pertokoan telah banyak dikembangkan untuk meningkatkan efektivitas dan efisiensi. Pada Toko Karya Indah, kegiatan yang berkaitan dengan inventori barang masih dilakukan secara manual sehingga pihak toko kesulitan untuk mengetahui data barang yang masih tersedia, habis, atau hampir habis. Selain itu, proses yang dilakukan membutuhkan waktu yang relatif lama. Oleh karena itu, diperlukan sistem inventori barang. Sistem dibangun dengan bahasa pemrograman PHP dan database MySQL. Sistem disertai teknologi AJAX (Asynchronous JavaScript And XML, khususnya AJAX autocomplete dan AJAX validasi. Hasil yang diperoleh adalah pengolahan data pada sistem inventori barang dengan menggunakan AJAX dapat dilakukan dengan lebih cepat dari pada tanpa AJAX. Kata kunci: sistem inventori, AJAX.

  17. Optimal Control Inventory Stochastic With Production Deteriorating

    Science.gov (United States)

    Affandi, Pardi

    2018-01-01

    In this paper, we are using optimal control approach to determine the optimal rate in production. Most of the inventory production models deal with a single item. First build the mathematical models inventory stochastic, in this model we also assume that the items are in the same store. The mathematical model of the problem inventory can be deterministic and stochastic models. In this research will be discussed how to model the stochastic as well as how to solve the inventory model using optimal control techniques. The main tool in the study problems for the necessary optimality conditions in the form of the Pontryagin maximum principle involves the Hamilton function. So we can have the optimal production rate in a production inventory system where items are subject deterioration.

  18. Inventory Data Package for Hanford Assessments

    Energy Technology Data Exchange (ETDEWEB)

    Kincaid, Charles T.; Eslinger, Paul W.; Aaberg, Rosanne L.; Miley, Terri B.; Nelson, Iral C.; Strenge, Dennis L.; Evans, John C.

    2006-06-01

    This document presents the basis for a compilation of inventory for radioactive contaminants of interest by year for all potentially impactive waste sites on the Hanford Site for which inventory data exist in records or could be reasonably estimated. This document also includes discussions of the historical, current, and reasonably foreseeable (1944 to 2070) future radioactive waste and waste sites; the inventories of radionuclides that may have a potential for environmental impacts; a description of the method(s) for estimating inventories where records are inadequate; a description of the screening method(s) used to select those sites and contaminants that might make a substantial contribution to impacts; a listing of the remedial actions and their completion dates for waste sites; and tables showing the best estimate inventories available for Hanford assessments.

  19. Inventory transparency for agricultural produce through IOT

    Science.gov (United States)

    Srinivasan, S. P.; Sorna Shanthi, D.; Anand, Aashish V.

    2017-06-01

    Re-structuring the practices of traditional inventory management is becoming more essential to optimize the supply chain transparency and accuracy of agricultural produce. A flexible and transparent inventory management system is becoming the need of any agricultural commodity. It was noticed that the major setback for the farmers who are the suppliers of the farm produce is due to poor supply chain integration. The recent advent technologies and IT explosion can bring up a greater impact in the process of storing, tracking, distributing and monitoring perishable agriculture produce of day to day life. The primary focus of this paper is to integrate IoT into inventory management and other inbound logistics management of agriculture produce. The unique features of agricultural produce like a prediction of supply, demand, the location of warehouses, distribution and tracking of inventory can be integrated through IoT. This paper proposes a conceptual framework for inventory management transparency involved in the supply chain of agriculture produce.

  20. Approaches to blue light emitting polymers

    International Nuclear Information System (INIS)

    Taylor, R.M.

    2000-01-01

    Blue-light emitting polymers are important for full colour displays. Blue- light emitting polymers, such as poly(fluorene)s have been reported, but tend to be soluble in the conjugated form. The aim of the project was to produce insoluble polymers, prepared via processible soluble precursor polymers, so that multilayer devices could be easily fabricated. Multilayer devices are often required for more efficient light emission. The target materials were derivatives of poly(p-phenylenevinylene) (PPV), a green-yellow emitting polymer. To blue shift the emission of PPV, bulky substituents, namely chloro, phenyl and alkyl, were attached to the vinylic linkage. These bulky substituents were incorporated to introduce steric interactions between the side group and the backbone phenyl protons, to shorten the effective conjugation length and increase the HOMO-LUMO energy gap. Chloro substituents quenched the fluorescence. Phenyl substituents resulted in highly conjugated precursor polymers with low molecular weights, showing blue- green to green emission in the conjugated form. Alkyl substituted PPV derivatives, prepared via chloro or xanthate precursors, were blue-light emitting conjugated polymers, which were electroluminescent in ITO/polymer/AI devices. The PL quantum yields were found to be up to 38%. The incorporation of electron withdrawing groups into the polymers was attempted, to lower the barrier to electron injection. Chloro groups quenched fluorescence and methylsulfone substituents resulted in insoluble polymers, probably due to cross-linking. However a copolymer containing methylsulfone electron withdrawing groups could be prepared. Phenylsulfone substituents were found to give fluorescent polymers which were soluble in the precursor form. (author)

  1. Joint inventory control and pricing in a service-inventory system

    DEFF Research Database (Denmark)

    Marand, Ata Jalili; Li, Hongyan Jenny; Thorstenson, Anders

    2017-01-01

    This study addresses joint inventory control and pricing decisions for a service-inventory system. In such a system both an on-hand inventory item and a positive service time are required to fulfill customer demands. The service-inventory system also captures main features of the classical....... The aim of this study is to formulate the problem and solve it to optimality. We make three main contributions: (1) We integrate inventory control and pricing in the service-inventory system. The problem is formulated and analyzed as a fractional programming problem, and structural properties are explored...... for the model. (2) Two solution algorithms are proposed. The first one provides optimal solutions, while the second one is more efficient. (3) The impact of the integrated inventory control and pricing decisions on the overall system performance is investigated. We compare the solutions of the models both...

  2. Pianure Blues: From the Dialect of the Plains to the English of the Blues

    Directory of Open Access Journals (Sweden)

    Giovanni Nadiani

    2016-06-01

    Full Text Available In this article the authors describe a joint performance project called Pianure Blues, in which poems in Romagnolo dialect are transposed into English and performed as blues songs, and in which songs from the Anglo-American blues/roots/folk tradition are transposed and performed as poems in Romagnolo dialect – a process they have called ‘trans-staging’. A process in which they are writers and performers and, especially, translators; translators of each other’s voices, stories, landscapes, rhythms and sounds as they look for the bond between places, languages and traditions that seem very distant from each other but which find a common mood and poetic language, a common aesthetic, in their performances. The authors reflect on the creative process involved and on the significance of establishing an intersemiotic dialogue between a ‘minority’ dialect such as Romagnolo and a ‘global’ language such as English, and the blues, have become.

  3. Hubble's View of Little Blue Dots

    Science.gov (United States)

    Kohler, Susanna

    2018-02-01

    The recent discovery of a new type of tiny, star-forming galaxy is the latest in a zoo of detections shedding light on our early universe. What can we learn from the unique little blue dots found in archival Hubble data?Peas, Berries, and DotsGreen pea galaxies identified by citizen scientists with Galaxy Zoo. [Richard Nowell Carolin Cardamone]As telescope capabilities improve and we develop increasingly deeper large-scale surveys of our universe, we continue to learn more about small, faraway galaxies. In recent years, increasing sensitivity first enabled the detection of green peas luminous, compact, low-mass (10 billion solar masses; compare this to the Milky Ways 1 trillion solar masses!) galaxies with high rates of star formation.Not long thereafter, we discovered galaxies that form stars similarly rapidly, but are even smaller only 330 million solar masses, spanning less than 3,000 light-years in size. These tiny powerhouses were termed blueberries for their distinctive color.Now, scientists Debra and Bruce Elmegreen (of Vassar College and IBM Research Division, respectively) report the discovery of galaxies that have even higher star formation rates and even lower masses: little blue dots.Exploring Tiny Star FactoriesThe Elmegreens discovered these unique galaxies by exploring archival Hubble data. The Hubble Frontier Fields data consist of deep images of six distant galaxy clusters and the parallel fields next to them. It was in the archival data for two Frontier Field Parallels, those for clusters Abell 2744 and MAS J0416.1-2403, that the authors noticed several galaxies that stand out as tiny, bright, blue objects that are nearly point sources.Top: a few examples of the little blue dots recently identified in two Hubble Frontier Field Parallels. Bottom: stacked images for three different groups of little blue dots. [Elmegreen Elmegreen 2017]The authors performed a search through the two Frontier Field Parallels, discovering a total of 55 little blue dots

  4. Change in avian abundance predicted from regional forest inventory data

    Science.gov (United States)

    Twedt, Daniel J.; Tirpak, John M.; Jones-Farrand, D. Todd; Thompson, Frank R.; Uihlein, William B.; Fitzgerald, Jane A.

    2010-01-01

    An inability to predict population response to future habitat projections is a shortcoming in bird conservation planning. We sought to predict avian response to projections of future forest conditions that were developed from nationwide forest surveys within the Forest Inventory and Analysis (FIA) program. To accomplish this, we evaluated the historical relationship between silvicolous bird populations and FIA-derived forest conditions within 25 ecoregions that comprise the southeastern United States. We aggregated forest area by forest ownership, forest type, and tree size-class categories in county-based ecoregions for 5 time periods spanning 1963-2008. We assessed the relationship of forest data with contemporaneous indices of abundance for 24 silvicolous bird species that were obtained from Breeding Bird Surveys. Relationships between bird abundance and forest inventory data for 18 species were deemed sufficient as predictive models. We used these empirically derived relationships between regional forest conditions and bird populations to predict relative changes in abundance of these species within ecoregions that are anticipated to coincide with projected changes in forest variables through 2040. Predicted abundances of these 18 species are expected to remain relatively stable in over a quarter (27%) of the ecoregions. However, change in forest area and redistribution of forest types will likely result in changed abundance of some species within many ecosystems. For example, abundances of 11 species, including pine warbler (Dendroica pinus), brown-headed nuthatch (Sitta pusilla), and chuckwills- widow (Caprimulgus carolinensis), are projected to increase within more ecoregions than ecoregions where they will decrease. For 6 other species, such as blue-winged warbler (Vermivora pinus), Carolina wren (Thryothorus ludovicianus), and indigo bunting (Passerina cyanea), we projected abundances will decrease within more ecoregions than ecoregions where they will

  5. 48 CFR 645.608 - Screening of contractor inventory.

    Science.gov (United States)

    2010-10-01

    ... inventory. 645.608 Section 645.608 Federal Acquisition Regulations System DEPARTMENT OF STATE CONTRACT MANAGEMENT GOVERNMENT PROPERTY Reporting, Redistribution, and Disposal of Contractor Inventory 645.608 Screening of contractor inventory. ...

  6. The Blue Coma: The Role of Methylene Blue in Unexplained Coma After Cardiac Surgery.

    Science.gov (United States)

    Martino, Enrico Antonio; Winterton, Dario; Nardelli, Pasquale; Pasin, Laura; Calabrò, Maria Grazia; Bove, Tiziana; Fanelli, Giovanna; Zangrillo, Alberto; Landoni, Giovanni

    2016-04-01

    Methylene blue commonly is used as a dye or an antidote, but also can be used off label as a vasopressor. Serotonin toxicity is a potentially lethal and often misdiagnosed condition that can result from drug interaction. Mild serotonin toxicity previously was reported in settings in which methylene blue was used as a dye. The authors report 3 cases of life-threatening serotonin toxicity in patients undergoing chronic selective serotonin reuptake inhibitor (SSRI) therapy who also underwent cardiac surgery and received methylene blue to treat vasoplegic syndrome. An observational study. A cardiothoracic intensive care unit (ICU) in a teaching hospital. Three patients who received methylene blue after cardiac surgery, later discovered to be undergoing chronic SSRI therapy. None. All 3 patients received high doses of fentanyl during general anesthesia. They all developed vasoplegic syndrome and consequently were given methylene blue in the ICU. All 3 patients developed serotonin toxicity, including coma, after this administration and diagnostic tests were negative for acute intracranial pathology. Coma lasted between 1 and 5 days. Two patients were discharged from the ICU shortly after awakening, whereas the third patient experienced a complicated postoperative course for concomitant refractory low-cardiac-output syndrome. Patients undergoing chronic SSRI therapy should not be administered methylene blue to treat vasoplegic syndrome. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Unraveling the Mystery of the Blue Fog: Structure, Properties, and Applications of Amorphous Blue Phase III.

    Science.gov (United States)

    Gandhi, Sahil Sandesh; Chien, Liang-Chy

    2017-12-01

    The amorphous blue phase III of cholesteric liquid crystals, also known as the "blue fog," are among the rising stars in materials science that can potentially be used to develop next-generation displays with the ability to compete toe-to-toe with disruptive technologies like organic light-emitting diodes. The structure and properties of the practically unobservable blue phase III have eluded scientists for more than a century since it was discovered. This progress report reviews the developments in this field from both fundamental and applied research perspectives. The first part of this progress report gives an overview of the 130-years-long scientific tour-de-force that very recently resulted in the revelation of the mysterious structure of blue phase III. The second part reviews progress made in the past decade in developing electrooptical, optical, and photonic devices based on blue phase III. The strong and weak aspects of the development of these devices are underlined and criticized, respectively. The third- and-final part proposes ideas for further improvement in blue phase III technology to make it feasible for commercialization and widespread use. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Concepts for inventory verification in critical facilities

    International Nuclear Information System (INIS)

    Cobb, D.D.; Sapir, J.L.; Kern, E.A.; Dietz, R.J.

    1978-12-01

    Materials measurement and inventory verification concepts for safeguarding large critical facilities are presented. Inspection strategies and methods for applying international safeguards to such facilities are proposed. The conceptual approach to routine inventory verification includes frequent visits to the facility by one inspector, and the use of seals and nondestructive assay (NDA) measurements to verify the portion of the inventory maintained in vault storage. Periodic verification of the reactor inventory is accomplished by sampling and NDA measurement of in-core fuel elements combined with measurements of integral reactivity and related reactor parameters that are sensitive to the total fissile inventory. A combination of statistical sampling and NDA verification with measurements of reactor parameters is more effective than either technique used by itself. Special procedures for assessment and verification for abnormal safeguards conditions are also considered. When the inspection strategies and inventory verification methods are combined with strict containment and surveillance methods, they provide a high degree of assurance that any clandestine attempt to divert a significant quantity of fissile material from a critical facility inventory will be detected. Field testing of specific hardware systems and procedures to determine their sensitivity, reliability, and operational acceptability is recommended. 50 figures, 21 tables

  9. Interdependence between Inventory Management and Employees’ Satisfaction

    Directory of Open Access Journals (Sweden)

    Dubravko Tomašić

    2013-06-01

    Full Text Available The study determines the correlation between the application of advanced models and methods of inventory optimisation in the supply chain in relation to the satisfaction of employees who are responsible for managing the inventory optimisation processes. The previous studies confirm that the optimisation of inventory management in the supply chain insures competitive advantages on the market. There is space for further research of impact of the achieved inventory optimisation in the supply chain on the change of the employees’ satisfaction. The paper establishes the interrelation of the interdependence of the achieved inventory optimisations on the satisfaction of the employees and the related synergy effects of acquiring added value of the companies on the market oriented to the satisfaction of the buyers and service users. The research has defined new knowledge in interdependence of inventory management optimisation on the change of indicators of employees’ satisfaction. Based on the performed research an assumption has been created for the design of an application package (so-called XaaS-based services for the management of interaction processes of inventory optimization in the supply chain, satisfaction of service users and employees.

  10. Inventory in a Brazilian Sample

    Directory of Open Access Journals (Sweden)

    Taciano L. Milfont

    2008-01-01

    Full Text Available Éste artículo evalúa la validez de constructo y la validez discriminante del Inventario de Perspectiva Temporal de Zimbardo (Zimbardo Time Perspective Inventory, ZTPI de una muestra de 247 estudiantes brasileños. La estructura de cinco-factores de ZTPI, definidos por Pasado-Negativo, Presente-Hedonístico, Futuro, Pasado- Positivo y Presente-Fatalista, provee un ajuste aceptable de los datos, y pareció ser mejor estadísticamente que el ajuste de los modelos alternativos. El Presente-Hedonístico fue positivamente correlacionado con el consumo de alcohol y negativamente con la religiosidad, el Futuro fue correlacionado positivamente con la preocupación por la salud y negativamente con el consumo de alcohol, y el Pasado-Positivo fue positivamente correlacionado con el uso del reloj. Los resultados encontrados concuerdan con los estudios anteriores, indicando que las cinco dimensiones de perspectiva del tiempo pueden ser identificadas cognitivamente. Además los patrones de correlación con otras variables son comparables a través de otras culturas.

  11. Inventory of state energy models

    Energy Technology Data Exchange (ETDEWEB)

    Melcher, A.G.; Gist, R.L.; Underwood, R.G.; Weber, J.C.

    1980-03-31

    These models address a variety of purposes, such as supply or demand of energy or of certain types of energy, emergency management of energy, conservation in end uses of energy, and economic factors. Fifty-one models are briefly described as to: purpose; energy system; applications;status; validation; outputs by sector, energy type, economic and physical units, geographic area, and time frame; structure and modeling techniques; submodels; working assumptions; inputs; data sources; related models; costs; references; and contacts. Discussions in the report include: project purposes and methods of research, state energy modeling in general, model types and terminology, and Federal legislation to which state modeling is relevant. Also, a state-by-state listing of modeling efforts is provided and other model inventories are identified. The report includes a brief encylopedia of terms used in energy models. It is assumed that many readers of the report will not be experienced in the technical aspects of modeling. The project was accomplished by telephone conversations and document review by a team from the Colorado School of Mines Research Institute and the faculty of the Colorado School of Mines. A Technical Committee (listed in the report) provided advice during the course of the project.

  12. National Coal Quality Inventory (NACQI)

    Energy Technology Data Exchange (ETDEWEB)

    Robert Finkelman

    2005-09-30

    The U.S. Geological Survey (USGS) conducted the National Coal Quality Inventory (NaCQI) between 1999 and 2005 to address a need for quality information on coals that will be mined during the next 20-30 years. Collaboration between the USGS, State geological surveys, universities, coal burning utilities, and the coal mining industry plus funding support from the Electric Power Research Institute (EPRI) and the U.S. Department of Energy (DOE) permitted collection and submittal of coal samples for analysis. The chemical data (proximate and ultimate analyses; major, minor and trace element concentrations) for 729 samples of raw or prepared coal, coal associated shale, and coal combustion products (fly ash, hopper ash, bottom ash and gypsum) from nine coal producing States are included. In addition, the project identified a new coal reference analytical standard, to be designated CWE-1 (West Elk Mine, Gunnison County, Colorado) that is a high-volatile-B or high-volatile-A bituminous coal with low contents of ash yield and sulfur, and very low, but detectable contents of chlorine, mercury and other trace elements.

  13. Danish emission inventory for agriculture. Inventories 1985 - 2009

    Energy Technology Data Exchange (ETDEWEB)

    Hjorth Mikkelsen, M.; Albrektsen, R.; Gyldenkaerne, S.

    2011-02-15

    By regulations given in international conventions Denmark is obliged to work out an annual emission inventory and document the methodology. The National Environmental Research Institute (NERI) at Aarhus University (AU) in Denmark is responsible for calculating and reporting the emissions. This report contains a description of the emissions from the agricultural sector from 1985 to 2009. Furthermore, the report includes a detailed description of methods and data used to calculate the emissions, which is based on national methodologies as well as international guidelines. For the Danish emissions calculations and data management an Integrated Database model for Agricultural emissions (IDA) is used. The emission from the agricultural sector includes emission of the greenhouse gases methane (CH{sub 4}), nitrous oxide (N{sub 2}O), ammonia (NH{sub 3}), particulate matter (PM), non-methane volatile organic compounds (NMVOC) and other pollutants related to the field burning of agricultural residue such as NO{sub x}, CO{sub 2}, CO, SO{sub 2}, heavy metals, dioxin and PAH. The ammonia emission from 1985 to 2009 has decreased from 119 300 tonnes of NH{sub 3} to 73 800 tonnes NH{sub 3}, corresponding to a 38 % reduction. The emission of greenhouse gases has decreased by 25 % from 12.9 M tonnes CO{sub 2} equivalents to 9.6 M tonnes CO{sub 2} equivalents from 1985 to 2009. Improvements in feed efficiency and utilisation of nitrogen in livestock manure are the most important reasons for the reduction of both the ammonia and greenhouse gas emissions. (Author)

  14. 77 FR 55895 - Permanent Closure of Cincinnati Blue Ash Airport

    Science.gov (United States)

    2012-09-11

    ... Federal Aviation Administration Permanent Closure of Cincinnati Blue Ash Airport AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of permanent closure of Cincinnati Blue Ash Airport (ISZ). SUMMARY: The... Cincinnati advising that on August 29, 2012, it was permanently closing Cincinnati Blue Ash Airport (ISZ...

  15. Aspen biology, community classification, and management in the Blue Mountains

    Science.gov (United States)

    David K. Swanson; Craig L. Schmitt; Diane M. Shirley; Vicky Erickson; Kenneth J. Schuetz; Michael L. Tatum; David C. Powell

    2010-01-01

    Quaking aspen (Populus tremuloides Michx.) is a valuable species that is declining in the Blue Mountains of northeastern Oregon. This publication is a compilation of over 20 years of aspen management experience by USDA Forest Service workers in the Blue Mountains. It includes a summary of aspen biology and occurrence in the Blue Mountains, and a...

  16. Alcian blue-stained particles in a eutrophic lake

    DEFF Research Database (Denmark)

    Worm, J.; Søndergaard, Morten

    1998-01-01

    We used a neutral solution of Alcian Blue to stain transparent particles in eutrophic Lake Frederiksborg Slotss0, Denmark. Alcian Blue-stained particles (ABSP) appeared to be similar to the so-called transparent exopolymer particles (TEP) identified with an acidic solution of Alcian Blue. Our...

  17. 49 CFR 173.216 - Asbestos, blue, brown or white.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Asbestos, blue, brown or white. 173.216 Section... Class 7 § 173.216 Asbestos, blue, brown or white. (a) Asbestos, blue, brown or white, includes each of the following hydrated mineral silicates: chrysolite, crocidolite, amosite, anthophyllite asbestos...

  18. Poporodní blues – česká adaptace dotazníku „Maternity blues questionnaire“

    Czech Academy of Sciences Publication Activity Database

    Takács, L.; Smolík, Filip; Mlíková Seidlerová, J.; Čepický, P.; Hoskovcová, S.

    2016-01-01

    Roč. 81, č. 5 (2016), s. 355-368 ISSN 1210-7832 Institutional support: RVO:68081740 Keywords : EPDS postpartum mood * Maternity Blues Questionnaire * postnatal depression * postpartum blues * postpartum depression Subject RIV: AN - Psychology

  19. Strategic Inventory Positioning of Navy Depot Level Repairable

    National Research Council Canada - National Science Library

    Burton, Larry

    2005-01-01

    ... the benefits in modifying their current inventory positioning policy for repairable items. NAVICP wishes to incorporate a strategic inventory positioning policy that reduces transportation costs...

  20. Accounting concept of inventories in postindustrial economy

    Directory of Open Access Journals (Sweden)

    Pravdyuk N.L.

    2017-06-01

    Full Text Available The accounting of inventories has undergone significant changes over a relatively short period of time. It has changed the scientific picture of their definition and classification, measurement and write-offs reflected in the financial statements. However, these changes happen without proper interpretation and system analysis. And, at least in general terms the inventories are conducted in Ukraine according to IFRS; this causes some obstacles to the objective reflection of working capital of enterprises, and the transparency of disclosure and is not conducive to the formation of a proper investment climate. It is established that the information provision inventory control must meet the requirements of the postindustrial economy by the complicating and deepening the complexity of accounting, the introduction of new forms and their synthesis with the current one, a gradual reorganization to ensure the needs of consumers and enterprise evaluation. The results of the study have substantiated the fundamentals of accounting concepts in the postindustrial economy in the part of the circulating capital, which forms inventories. The information support of inventory management should be implemented in a hierarchical way, when it first and foremost analyzes the working capital, and further deals with inventories and stocks as its subordinate components. The author considers the material goods to be a broader concept than reserves, because they have a dual nature both estimated as the share of negotiable assets, and as the physical component of material costs. The paper gives the definition of this category of symbiosis, which is based on P(CBU 9. The general structure of the current inventories are of significant importance, which has differences in industries, the dominant of which is agriculture, industry, construction, trade, material production. The postindustrial economy caused the questions of differentiation of concepts "production" and "material

  1. The nuclide inventory in SFR-1

    International Nuclear Information System (INIS)

    Ingemansson, Tor

    2001-10-01

    This report is an account for a project carried out on behalf of the Swedish Radiation Protection Authority (SSI): 'Nuclide inventory in SFR-1' (The Swedish underground disposal facility for low and intermediate level reactor waste). The project comprises the following five sub-projects: 1) Measuring methods for nuclides, difficult to measure, 2) The nuclide inventory in SFR-1, 3) Proposal for nuclide library for SFR-1 and ground disposal, 4) Nuclide library for exemption, and 5) Characterising of the nuclide inventory and documentation for SFL waste. In all five sub-projects long-lived activity, including Cl-36, has been considered

  2. Blue-Detuned Magneto-Optical Trap

    Science.gov (United States)

    Jarvis, K. N.; Devlin, J. A.; Wall, T. E.; Sauer, B. E.; Tarbutt, M. R.

    2018-02-01

    We present the properties and advantages of a new magneto-optical trap (MOT) where blue-detuned light drives "type-II" transitions that have dark ground states. Using 87Rb, we reach a radiation-pressure-limited density exceeding 1 011 cm-3 and a temperature below 30 μ K . The phase-space density is higher than in normal atomic MOTs and a million times higher than comparable red-detuned type-II MOTs, making the blue-detuned MOT particularly attractive for molecular MOTs, which rely on type-II transitions. The loss of atoms from the trap is dominated by ultracold collisions between Rb atoms. For typical trapping conditions, we measure a loss rate of 1.8 (4 )×10-10 cm3 s-1 .

  3. Blue green component and integrated urban design

    Directory of Open Access Journals (Sweden)

    Stanković Srđan M.

    2016-01-01

    Full Text Available This paper aims to demonstrate the hidden potential of blue green components, in a synergetic network, not as separate systems, like used in past. The innovative methodology of the project Blue Green Dream is presented through examples of good practice. A new approach in the project initiate thoughtful planning and remodeling of the settlement for the modern man. Professional and scientific public is looking for way to create more healthy and stimulating place for living. However, offered integrative solutions still remain out of urban and architectural practice. Tested technologies in current projects confirmed measurability of innovative approaches and lessons learned. Scientific and professional contributions are summarized in master's and doctoral theses that have been completed or are in process of writing.

  4. 76 FR 22923 - Wellpoint, Inc. D/B/A/Anthem Blue Cross & Blue Shield Enterprise Provider Data Management Team...

    Science.gov (United States)

    2011-04-25

    .../B/A/Anthem Blue Cross & Blue Shield Enterprise Provider Data Management Team Including On-Site... & Blue Shield, Enterprise Provider Data Management Team, Including On-Site Leased Workers From Kelly... Of Kentucky, Enterprise Provider Data Management Team, Louisville, Kentucky TA-W-74,895B Wellpoint...

  5. Measuring Blue Space Visibility and ‘Blue Recreation’ in the Everyday Lives of Children in a Capital City

    Science.gov (United States)

    Pearson, Amber L.; Bottomley, Ross; Chambers, Tim; Thornton, Lukar; Stanley, James; Smith, Moira; Barr, Michelle; Signal, Louise

    2017-01-01

    Blue spaces (water bodies) may promote positive mental and physical health through opportunities for relaxation, recreation, and social connections. However, we know little about the nature and extent of everyday exposure to blue spaces, particularly in settings outside the home or among children, nor whether exposure varies by individual or household characteristics. Wearable cameras offer a novel, reliable method for blue space exposure measurement. In this study, we used images from cameras worn over two days by 166 children in Wellington, New Zealand, and conducted content and blue space quantification analysis on each image (n = 749,389). Blue space was identified in 24,721 images (3.6%), with a total of 23 blue recreation events. Visual exposure and participation in blue recreation did not differ by ethnicity, weight status, household deprivation, or residential proximity to the coastline. Significant differences in both visual exposure to blue space and participation in blue recreation were observed, whereby children from the most deprived schools had significantly higher rates of blue space exposure than children from low deprivation schools. Schools may be important settings to promote equitable blue space exposures. Childhood exposures to blue space may not follow the expected income inequality trends observed among adults. PMID:28587134

  6. Measuring Blue Space Visibility and 'Blue Recreation' in the Everyday Lives of Children in a Capital City.

    Science.gov (United States)

    Pearson, Amber L; Bottomley, Ross; Chambers, Tim; Thornton, Lukar; Stanley, James; Smith, Moira; Barr, Michelle; Signal, Louise

    2017-05-26

    Blue spaces (water bodies) may promote positive mental and physical health through opportunities for relaxation, recreation, and social connections. However, we know little about the nature and extent of everyday exposure to blue spaces, particularly in settings outside the home or among children, nor whether exposure varies by individual or household characteristics. Wearable cameras offer a novel, reliable method for blue space exposure measurement. In this study, we used images from cameras worn over two days by 166 children in Wellington, New Zealand, and conducted content and blue space quantification analysis on each image ( n = 749,389). Blue space was identified in 24,721 images (3.6%), with a total of 23 blue recreation events. Visual exposure and participation in blue recreation did not differ by ethnicity, weight status, household deprivation, or residential proximity to the coastline. Significant differences in both visual exposure to blue space and participation in blue recreation were observed, whereby children from the most deprived schools had significantly higher rates of blue space exposure than children from low deprivation schools. Schools may be important settings to promote equitable blue space exposures. Childhood exposures to blue space may not follow the expected income inequality trends observed among adults.

  7. Austrian emission inventory for dust

    International Nuclear Information System (INIS)

    Winiwarter, W.; Trenker, C.; Hoeflinger, W.

    2001-09-01

    For the first time, Austrian emissions of anthropogenic particulate matter emissions to the atmosphere have been estimated. Results have been reported as total suspended particles (TSP) as well as for the fractions of particles smaller than 10 μm or 2.5 μm aerodynamic diameter (PM 10 , PM 2.5 ), respectively. Base years for the inventory were 1990, 1995 and 1999. Excluded from this assessment is wind blown dust, which has been considered a natural source here. National statistics have been applied, specifically those also used previously in the Austrian air pollution inventory (OLI). Emission factors have been taken from literature compilations, only for exceptional cases specific Austrian assessments were performed or original literature on emission measurements was consulted. Resuspension of dust by road traffic emerged as the most important source. For the size fraction of PM 10 this source contributed about half of the emissions, when applying the calculation scheme by the U.S. EPA. While this scheme is widely used and well documented, its validity is currently subject of intense scientific debate. As these results do not seem to coincide with ambient air measurements, resuspension of road dust is considered separately and not now included in the national total. The sum of all other sources increases from 75,000 t of TSP in 1990 and 1995 to 77,000 t in 1999, while both PM 10 and PM 2.5 exhibit decreasing tendency (at 45,000 t and 26,000 t in 1999, respectively). The increase in TSP derives from increasing traffic and friction related emissions (tire wear, break wear), decrease of the finer particulate matter is due to reductions in firewood consumption for domestic heating. Most important source sectors are fugitive emissions from material transfer in industry as well as the building industry and the tilling of agricultural land. Common to these sources is the high uncertainty of available data. Wood combustion is the most important of the non

  8. Industrial processes inventory. Sector 2

    International Nuclear Information System (INIS)

    1994-01-01

    The work objective is to conduct a greenhouse gas emission inventory of the industrial processes in Lebanon for the year 1994. The Lebanese industry has emitted 1924.063 Gg (1.924.063 tons) of Carbon dioxide CO 2 ; 0.0003 Gg (0.3 tons) of carbon monoxide CO; 0.01112 Gg of nitrogen oxide NO; 273.888 tons of non-methane volatile organic compounds and 3.382 Gg (3.382 tons) of sulphur dioxide SO 2 . The cement industry is the major source of CO 2 emissions among the industrial processes in Lebanon. The cement industry is responsible for 76.1% of the total emissions followed by the iron and steel industry which produces 21.68% of the total CO 2 emissions from industrial processes. The NMVOC emissions are mainly produced by the use of asphalt for road paving (98.5% of total emissions by industry) followed by the food and beverage industry (1.2%). The emissions of sulphur dioxide SO 2 come from three industrial sources: the first come from the production of sulphuric acid (69.9% of total industrial emissions), the second from the cement industry (26.4% of total industrial emissions) and the third from the iron and steel mills (3.7% of total industrial emissions). Figures are presented to show the percentage distribution of various industrial sources contributions to CO 2 , NMVOC and SO 2 emissions in Lebanon. Carbon monoxide CO emissions in the industrial sector are very small. The major source is iron and steel mills and the minor source is asphalt-roofing production

  9. PCDD/PCDF release inventories

    Energy Technology Data Exchange (ETDEWEB)

    Fiedler, H. [UNEP Chemicals, Chatelaine (Switzerland)

    2004-09-15

    The Stockholm Convention on Persistent Organic Pollutants (POPs) entered into force on 17 May 2004 with 50 Parties. In May 2004, 59 countries had ratified or acceded the Convention. The objective of the Convention is ''to protect human health and the environment from persistent organic pollutants''. For intentionally produced POPs, e.g., pesticides and industrial chemicals such as hexachlorobenzene and polychlorinated biphenyls, this will be achieved by stop of production and use. For unintentionally generated POPs, such as polychlorinated dibenzo-pdioxins (PCDD) and polychlorinated dibenzofurans (PCDF), measures have to be taken to ''reduce the total releases derived from anthropogenic sources''; the final goal is ultimate elimination, where feasible. Under the Convention, Parties have to establish and maintain release inventories to prove the continuous release reduction. Since many countries do not have the technical and financial capacity to measure all releases from all potential PCDD/PCDF sources, UNEP Chemicals has developed the ''Standardized Toolkit for the Identification of Quantification of Dioxin and Furan Releases'' (''Toolkit'' for short), a methodology to estimate annual releases from a number of sources. With this methodology, annual releases can be estimated by multiplying process-specific default emission factors provided in the Toolkit with national activity data. At the seventh session of the Intergovernmental Negotiating Committee, the Toolkit was recommended to be used by countries when reporting national release data to the Conference of the Parties. The Toolkit is especially used by developing countries and countries with economies in transition where no measured data are available. Results from Uruguay, Thailand, Jordan, Philippines, and Brunei Darussalam have been published.

  10. Wildlife Inventory, Craig Mountain, Idaho.

    Energy Technology Data Exchange (ETDEWEB)

    Cassirer, E. Frances

    1995-06-01

    Wildlife distribution/abundance were studied at this location during 1993 and 1994 to establish the baseline as part of the wildlife mitigation agreement for construction of Dworshak reservoir. Inventory efforts were designed to (1) document distribution/abundance of 4 target species: pileated woodpecker, yellow warbler, black-capped chickadee, and river otter, (2) determine distribution/abundance of rare animals, and (3) determine presence and relative abundance of all other species except deer and elk. 201 wildlife species were observed during the survey period; most were residents or used the area seasonally for breeding or wintering. New distribution or breeding records were established for at least 6 species. Pileated woodpeckers were found at 35% of 134 survey points in upland forests; estimated densities were 0-0.08 birds/ha, averaging 0.02 birds/ha. Yellow warblers were found in riparian areas and shrubby draws below 3500 ft elev., and were most abundant in white alder plant communities (ave. est. densities 0.2-2. 1 birds/ha). Black-capped chickadees were found in riparian and mixed tall shrub vegetation at all elevations (ave. est. densities 0-0.7 birds/ha). River otters and suitable otter denning and foraging habitat were observed along the Snake and Salmon rivers. 15 special status animals (threatened, endangered, sensitive, state species of special concern) were observed at Craig Mt: 3 amphibians, 1 reptile, 8 birds, 3 mammals. Another 5 special status species potentially occur (not documented). Ecosystem-based wildlife management issues are identified. A monitoring plant is presented for assessing effects of mitigation activities.

  11. Nature's palette: the search for natural blue colorants.

    Science.gov (United States)

    Newsome, Andrew G; Culver, Catherine A; van Breemen, Richard B

    2014-07-16

    The food and beverage industry is seeking to broaden the palette of naturally derived colorants. Although considerable effort has been devoted to the search for new blue colorants in fruits and vegetables, less attention has been directed toward blue compounds from other sources such as bacteria and fungi. The current work reviews known organic blue compounds from natural plant, animal, fungal, and microbial sources. The scarcity of blue-colored metabolites in the natural world relative to metabolites of other colors is discussed, and structural trends common among natural blue compounds are identified. These compounds are grouped into seven structural classes and evaluated for their potential as new color additives.

  12. Blue light does not inhibit nodulation in Sesbania rostrata.

    Science.gov (United States)

    Shimomura, Aya; Arima, Susumu; Hayashi, Makoto; Maymon, Maskit; Hirsch, Ann M; Suzuki, Akihiro

    2017-01-02

    Earlier, we reported that root nodulation was inhibited by blue light irradiation of Lotus japonicus. Because some legumes do not establish nodules exclusively on underground roots, we investigated whether nodule formation in Sesbania rostrata, which forms both root and "stem" nodules following inoculation with Azorhizobium caulinodans, is inhibited by blue light as are L. japonicus nodules. We found that neither S. rostrata nodulation nor nitrogen fixation was inhibited by blue light exposure. Moreover, although A. caulinodans proliferation was not affected by blue light irradiation, bacterial survival was decreased. Therefore, blue light appears to impose different responses depending on the legume-rhizobial symbiosis.

  13. FROM CIRCULAR ECONOMY TO BLUE ECONOMY

    Directory of Open Access Journals (Sweden)

    Iustin-Emanuel, ALEXANDRU

    2014-11-01

    Full Text Available Addressing the subject of this essay is based on the background ideas generated by a new branch of science - Biomimicry. According to European Commissioner for the Environment, "Nature is the perfect model of circular economy". Therefore, by imitating nature, we are witnessing a process of cycle redesign: production-consumption-recycling. The authors present some reflections on the European Commission's decision to adopt after July 1, 2014 new measures concerning the development of more circular economies. Starting from the principles of Ecolonomy, which is based on the whole living paradigm, this paper argues for the development within each economy of entrepreneurial policies related to the Blue economy. In its turn, Blue economy is based on scientific analyses that identify the best solutions in a business. Thus, formation of social capital will lead to healthier and cheaper products, which will stimulate entrepreneurship. Blue economy is another way of thinking economic practice and is a new model of business design. It is a healthy, sustainable business, designed for people. In fact, it is the core of the whole living paradigm through which, towards 2020, circular economy will grow more and more.

  14. 'Blue Whale Challenge': A Game or Crime?

    Science.gov (United States)

    Mukhra, Richa; Baryah, Neha; Krishan, Kewal; Kanchan, Tanuj

    2017-11-11

    A bewildering range of games are emerging every other day with newer elements of fun and entertainment to woo youngsters. Games are meant to reduce stress and enhance the cognitive development of children as well as adults. Teenagers are always curious to indulge in newer games; and e-gaming is one such platform providing an easy access and quicker means of entertainment. The particular game challenge which has taken the world by storm is the dangerous "Blue Whale Challenge" often involving vulnerable teenagers. The Blue Whale Challenge is neither an application nor internet based game but the users get a link through social media chat groups to enter this "deadly" challenge game. This probably is the only game where the participant has to end his/her life to complete the game. The innocent teenagers are being targeted based on their depressed psychology and are coercively isolated from their social milieux on the pretext of keeping the challenges confidential. To add to the woes, no option is offered to quit the challenge even if the contender is unable to complete the challenge. Blue Whale Challenge in its sheer form could be seen as an illegal, unethical and inhumane endeavor in our present society. The present communication discusses the severe effects of the game on teenagers, the ethical concerns involved and the preventive measures necessary to curb it.

  15. Synchrotron powder diffraction on Aztec blue pigments

    International Nuclear Information System (INIS)

    Sanchez del Rio, M.; Gutierrez-Leon, A.; Castro, G.R.; Rubio-Zuazo, J.; Solis, C.; Sanchez-Hernandez, R.; Robles-Camacho, J.; Rojas-Gaytan, J.

    2008-01-01

    Some samples of raw blue pigments coming from an archaeological rescue mission in downtown Mexico City have been characterized using different techniques. The samples, some recovered as a part of a ritual offering, could be assigned to the late Aztec period (XVth century). The striking characteristic of these samples is that they seem to be raw pigments prior to any use in artworks, and it was possible to collect a few μg of pigment after manual grain selection under a microscopy monitoring. All pigments are made of indigo, an organic colorant locally known as anil or xiuhquilitl. The colorant is always found in combination with an inorganic matrix, studied by powder diffraction. In one case the mineral base is palygorskite, a rare clay mineral featuring micro-channels in its structure, well known as the main ingredient of the Maya blue pigment. However, other samples present the minerals sepiolite (a clay mineral of the palygorskite family) and calcite. Another sample contains barite, a mineral never reported in prehispanic paints. We present the results of characterization using high resolution powder diffraction recorded at the European Synchrotron Radiation Facility (BM25A, SpLine beamline) complemented with other techniques. All of them gave consistent results on the composition. A chemical test on resistance to acids was done, showing a high resistance for the palygorskite and eventually sepiolite compounds, in good agreement with the excellent resistance of the Maya blue. (orig.)

  16. Biota - 2011 Vegetation Inventory - Marsh Lake, MN

    Data.gov (United States)

    Army Corps of Engineers, Department of the Army, Department of Defense — 2011 Vegetation Classification for Marsh Lake, MN Vegetation Project Report, OMBIL Environmental Stewardship - Level 1 Inventory. Marsh Lake is located on the...

  17. Clearinghouse for Inventories and Emissions Factors

    Science.gov (United States)

    Emissions inventories, modeling, and monitoring are the basis for understanding, controlling and tracking stationary sources of air pollution. This technical site provides access to tools and data to support those efforts.

  18. Toxic Release Inventory Chemicals by Groupings

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Toxics Release Inventory (TRI) makes available information for more than 600 toxic chemicals that are being used, manufactured, treated, transported, or released...

  19. Hydro energetic inventory study from Chapecozinho river

    International Nuclear Information System (INIS)

    Pimenta, S.C.; Sureck, M.A.A.; Nascimento, P.R.; Kawasaki, M.; Silva Felipe, R. da.

    1990-01-01

    The Hydro energetic Inventory Study in Chapecozinho River Basin, Brazil is described, comparing the proposed results in 1979 with the actual review in 1989. An analysis for solution the socio-economic and environment problems is also presented. (author)

  20. Allowance Holdings and Transfers Data Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Allowance Holdings and Transfers Data Inventory contains measured data on holdings and transactions of allowances under the NOx Budget Trading Program (NBP), a...

  1. Developing the GHG inventory for South Africa

    CSIR Research Space (South Africa)

    Taviv, R

    2008-10-01

    Full Text Available will be used for the Second National Communication to the UNFCCC. Furthermore, the GHG inventory will be a critical source of information for air quality management and climate change mitigation in South Africa...

  2. Design considerations for tropical forest inventories

    Directory of Open Access Journals (Sweden)

    Ronald Edward McRoberts

    2013-06-01

    Full Text Available Forests contribute substantially to maintaining the global greenhouse gas balance, primarily because among the five economic sectors identified by the United Nations Framework Convention on Climate Change, only the forestry sector has the potential to remove greenhouse gas emissions from the atmosphere. In this context, development of national forest carbon accounting systems, particularly in countries with tropical forests, has emerged as an international priority. Because these systems are often developed as components of or in parallel with national forest inventories, a brief review of statistical issues related to the development of forest ground sampling designs is provided. This overview addresses not only the primary issues of plot configurations and sampling designs, but also to a lesser extent the emerging roles of remote sensing and uncertainty assessment. Basic inventory principles are illustrated for two case studies, the national forest inventory of Brazil with special emphasis on the state of Santa Catarina, and an inventory for Tanzania.

  3. Asset management inventory and data collection.

    Science.gov (United States)

    2009-10-01

    An efficient and accurate inventory of a state highway agencys assets, along with the means to assess the condition : of those assets and model their performance, is critical to enabling an agency to make informed investment decisions : in a Trans...

  4. More accurate determination of coal stockpile inventories

    Energy Technology Data Exchange (ETDEWEB)

    Wright, P.L.; Hernadi, N.

    1978-08-01

    The coal density within a 12 m high stockpile can range from 836 kg/m/SUP/3 to 948 kg/m/SUP/3. Thus the use of a constant density to calculate the stockpile inventory could lead to a variation on a nominal 100,000 tonne stockpile of 12,500 tonnes. At present day metallurgical coal prices, this represents a range in inventory value of over 600,000 dollars. A more accurate evaluation of the stockpile inventory can easily be achieved by the simple expedient of including the density variations in the calculations. Laboratory compression tests at different moisture contents have been used to simulate the coal compaction, and to derive practical densities for coal at various heights within the stockpile. The resulting graphs of density variation with stockpile height at different moisture contents can be combined with accurate cross sections to volumetric surveys to produce on accurate quantification of the stockpile for inventory purposes.

  5. Louisiana traffic sign inventory and management system.

    Science.gov (United States)

    2003-09-01

    The Louisiana Department of Transportation and Development (DOTD), like many state highway agencies in the United States, lacks a comprehensive system for inventorying and maintaining records of traffic signs. To address this problem, state highway d...

  6. Mobile Source Emissions Regulatory Compliance Data Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Mobile Source Emissions Regulatory Compliance Data Inventory data asset contains measured summary compliance information on light-duty, heavy-duty, and non-road...

  7. Inventory of Owned and Leased Properties (IOLP)

    Data.gov (United States)

    General Services Administration — The Inventory of Owned and Leased Properties (IOLP) allows users to search properties owned and leased by the General Services Administration (GSA) across the United...

  8. Components of Inventory Change (CINCH) Reports

    Data.gov (United States)

    Department of Housing and Urban Development — The Components of Inventory Change (CINCH) report measures changes in the characteristics of the housing stock of the United States. Using data collected from the...

  9. Minnesota DNR Forest Stand Inventory Version 2

    Data.gov (United States)

    Minnesota Department of Natural Resources — This layer is a digital inventory of individual forest stands. The data is collected by DNR Foresters in each DNR Forestry Administrative Area, and is updated on a...

  10. Coal Mines, Abandoned - AML Inventory Sites 201601

    Data.gov (United States)

    NSGIC Education | GIS Inventory — This data set portrays the approximate location of Abandoned Mine Land Problem Areas containing public health, safety, and public welfare problems created by past...

  11. Historical Ambient Air Quality Data Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Historical Ambient Air Quality Data Inventory contains measured and estimated data on ambient air pollution for use in assessing air quality, assisting in...

  12. Experimental validation of pulsed column inventory estimators

    International Nuclear Information System (INIS)

    Beyerlein, A.L.; Geldard, J.F.; Weh, R.; Eiben, K.; Dander, T.; Hakkila, E.A.

    1991-01-01

    Near-real-time accounting (NRTA) for reprocessing plants relies on the timely measurement of all transfers through the process area and all inventory in the process. It is difficult to measure the inventory of the solvent contractors; therefore, estimation techniques are considered. We have used experimental data obtained at the TEKO facility in Karlsruhe and have applied computer codes developed at Clemson University to analyze this data. For uranium extraction, the computer predictions agree to within 15% of the measured inventories. We believe this study is significant in demonstrating that using theoretical models with a minimum amount of process data may be an acceptable approach to column inventory estimation for NRTA. 15 refs., 7 figs

  13. Inventory verification measurements using neutron multiplicity counting

    International Nuclear Information System (INIS)

    Ensslin, N.; Foster, L.A.; Harker, W.C.; Krick, M.S.; Langner, D.G.

    1998-01-01

    This paper describes a series of neutron multiplicity measurements of large plutonium samples at the Los Alamos Plutonium Facility. The measurements were corrected for bias caused by neutron energy spectrum shifts and nonuniform multiplication, and are compared with calorimetry/isotopics. The results show that multiplicity counting can increase measurement throughput and yield good verification results for some inventory categories. The authors provide recommendations on the future application of the technique to inventory verification

  14. ABC Inventory classification application: Özdemirler

    OpenAIRE

    Duru, Mehmet

    1989-01-01

    Ankara : The Department of Management and the Institute of Management Sciences of Bilkent Univ. , 1989. Thesis (Master's) -- Bilkent University, 1989. Includes bibliographical references leaves 37. ABC inventory classification can result in more effective control of business. In this work, ABC method is applied to Ozdemirler to examine the inventory profile of the store, and to be able to aid the management in allocating control effort among items more effectively. Dur...

  15. Cost Comparisons of Selected Inventory Policies.

    Science.gov (United States)

    1979-06-01

    REQUIREMENTS for the degree MASTER OF SCIENCE in TRANSP0ORTAT ION Lu Evanston, Illinois __ -loi44 󈨔 07 14 10 UNC LAS S SECURITY CLASSIFICATION OF THIS...through receipts and issues invoices. A centralized inventory replenishment section reviews every warehouse location’s inventory status once each week... 6380 39160 B15 .4304 -- -- 37200 B16 .2490 .35 5290 30330 B17 .2204 .43 1100 4850 B18 .4634 -- -- 77 C1 .4154 --- 72350 C2 .4544 --- 71350 C3 .6870

  16. Factor Structure of the Anorexia Bulimia Inventory

    OpenAIRE

    Dobmeyer, Anne C.

    1997-01-01

    The Anorexia Bulimia Inventory, a recently developed self-report questionnaire for the assessment of eating disorders, addresses two major limitations found in existing self-report eating disorder inventories. First, it comprehensively assesses the diagnostic symptoms of both bulimia and anorexia nervosa; and second, it assesses the frequently cooccurring problem areas (e.g., depression, anergia) that may be targeted in treatment planning for eating disorders. Although initial research on the...

  17. Blue Light Protects Against Temporal Frequency Sensitive Refractive Changes.

    Science.gov (United States)

    Rucker, Frances; Britton, Stephanie; Spatcher, Molly; Hanowsky, Stephan

    2015-09-01

    Time spent outdoors is protective against myopia. The outdoors allows exposure to short-wavelength (blue light) rich sunlight, while indoor illuminants can be deficient at short-wavelengths. In the current experiment, we investigate the role of blue light, and temporal sensitivity, in the emmetropization response. Five-day-old chicks were exposed to sinusoidal luminance modulation of white light (with blue; N = 82) or yellow light (without blue; N = 83) at 80% contrast, at one of six temporal frequencies: 0, 0.2, 1, 2, 5, 10 Hz daily for 3 days. Mean illumination was 680 lux. Changes in ocular components and corneal curvature were measured. Refraction, eye length, and choroidal changes were dependent on the presence of blue light (P blue light, refraction did not change across frequencies (mean change -0.24 [diopters] D), while in the absence of blue light, we observed a hyperopic shift (>1 D) at high frequencies, and a myopic shift (>-0.6 D) at low frequencies. With blue light there was little difference in eye growth across frequencies (77 μm), while in the absence of blue light, eyes grew more at low temporal frequencies and less at high temporal frequencies (10 vs. 0.2 Hz: 145 μm; P blue light. Illuminants rich in blue light can protect against myopic eye growth when the eye is exposed to slow changes in luminance contrast as might occur with near work.

  18. Blue Light Protects Against Temporal Frequency Sensitive Refractive Changes

    Science.gov (United States)

    Rucker, Frances; Britton, Stephanie; Spatcher, Molly; Hanowsky, Stephan

    2015-01-01

    Purpose Time spent outdoors is protective against myopia. The outdoors allows exposure to short-wavelength (blue light) rich sunlight, while indoor illuminants can be deficient at short-wavelengths. In the current experiment, we investigate the role of blue light, and temporal sensitivity, in the emmetropization response. Methods Five-day-old chicks were exposed to sinusoidal luminance modulation of white light (with blue; N = 82) or yellow light (without blue; N = 83) at 80% contrast, at one of six temporal frequencies: 0, 0.2, 1, 2, 5, 10 Hz daily for 3 days. Mean illumination was 680 lux. Changes in ocular components and corneal curvature were measured. Results Refraction, eye length, and choroidal changes were dependent on the presence of blue light (P blue light, refraction did not change across frequencies (mean change −0.24 [diopters] D), while in the absence of blue light, we observed a hyperopic shift (>1 D) at high frequencies, and a myopic shift (>−0.6 D) at low frequencies. With blue light there was little difference in eye growth across frequencies (77 μm), while in the absence of blue light, eyes grew more at low temporal frequencies and less at high temporal frequencies (10 vs. 0.2 Hz: 145 μm; P blue light. Conclusions Illuminants rich in blue light can protect against myopic eye growth when the eye is exposed to slow changes in luminance contrast as might occur with near work. PMID:26393671

  19. Technical Basis for PNNL Beryllium Inventory

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Michelle Lynn

    2014-07-09

    The Department of Energy (DOE) issued Title 10 of the Code of Federal Regulations Part 850, “Chronic Beryllium Disease Prevention Program” (the Beryllium Rule) in 1999 and required full compliance by no later than January 7, 2002. The Beryllium Rule requires the development of a baseline beryllium inventory of the locations of beryllium operations and other locations of potential beryllium contamination at DOE facilities. The baseline beryllium inventory is also required to identify workers exposed or potentially exposed to beryllium at those locations. Prior to DOE issuing 10 CFR 850, Pacific Northwest Nuclear Laboratory (PNNL) had documented the beryllium characterization and worker exposure potential for multiple facilities in compliance with DOE’s 1997 Notice 440.1, “Interim Chronic Beryllium Disease.” After DOE’s issuance of 10 CFR 850, PNNL developed an implementation plan to be compliant by 2002. In 2014, an internal self-assessment (ITS #E-00748) of PNNL’s Chronic Beryllium Disease Prevention Program (CBDPP) identified several deficiencies. One deficiency is that the technical basis for establishing the baseline beryllium inventory when the Beryllium Rule was implemented was either not documented or not retrievable. In addition, the beryllium inventory itself had not been adequately documented and maintained since PNNL established its own CBDPP, separate from Hanford Site’s program. This document reconstructs PNNL’s baseline beryllium inventory as it would have existed when it achieved compliance with the Beryllium Rule in 2001 and provides the technical basis for the baseline beryllium inventory.

  20. Blue-Green Solutions in Urban Development

    Science.gov (United States)

    Karlsson, Caroline; Kalantari, Zahra

    2017-04-01

    With the ongoing urbanisation and increasing pressure for new housing and infrastructure, the nexus of developing compact, energy-efficient and yet liveable and sustainable cities is urgent to address. In this context, blue-green spaces and related ecosystem services (ES) are critical resources that need to be integrated in policy and planning of urban. Among the ES provided by blue-green spaces, regulating ES such as water retention and purification are particularly important in urban areas, affecting water supply and quality, related cultural ES and biodiversity, as well as cities potential to adapt to climate change. Blue-green infrastructure management is considered a sustainable way to reducing negative effects of urbanisation, such as decreasing flood risks, as well as adapting to climate change for example by controlling increasing flood and drought risks. Blue-green infrastructure management can for example create multifunctional surfaces with valuable environmental and social functions and generally handle greenways and ecological networks as important ecosystem service components, for example for stormwater regulation in a sustainable urban drainage system. The Norrström drainage basin (22,000 km2) is a large demonstrator for Blue-green infrastructure management. Both urbanisation and agriculture are extensive within this basin, which includes the Swedish capital Stockholm and is part of the fertile Swedish belt. Together, the relatively high population density combined with agricultural and industrial activities in this region imply large eutrophication and pollution pressures, not least transferred through storm runoff to both inland surface waters and the coastal waters of the Baltic Sea. The ecosystems of this basin provide highly valued but also threatened services. For example, Lake Mälaren is the single main freshwater supply for the Swedish capital Stockholm, as well as a key nutrient retention system that strongly mitigates waterborne nutrient

  1. Book Out! An Inventory Story

    Science.gov (United States)

    Panait, Claudia M.

    2004-01-01

    The NASA Glenn Library is a science and engineering research library providing the most current books, journals, CD-ROM's and documents to support the study of aeronautics, space propulsion and power, communications technology, materials and structures and microgravity science. The GRC technical library also supports the research and development efforts of all scientists and engineers on site via full text electronic files, literature searching, technical reports, etc. As an intern in the NASA Glenn Library, I attempt to support these objectives through efficiently and effectively fulfilling the assignment that was given to me. The assignment that was relegated to me was to catalog National Advisory Committee for Aeronautics, NASA Technical Documents into NASA Galaxie. This process consists of holdings being added to existing Galaxie records, upgrades and editing done to the bibliographic records when needed, adding URL's into Galaxie when they were missing from the record. NASA ASAP and Digidoc was used to locate URL's of PDF's that were not in Galaxie. A spreadsheet of documents with no URL's were maintained. Also, a subject channel of web, fill-text, paid and free, journal and other subject specific pages were developed and expanded fiom current content of intranet pages. To expand upon the second half of my assignment, I was given the project of taking inventory of the library s book collection. I kept record of the books that were not accounted for on a master list I was given to work fiom and submitted them for correction and addition. I also made sure the books were placed in the appropriate order and made corrections to any discrepancies that existed between the master list and what was on the shelf. Upon completion of this assignment, I will have verified that 21,113 books were in the correct location, order and have the correct corresponding serial number and barcode. In conclusion, as of this date I have input around 750 documents into NASA Galaxie

  2. Adaptation of foreign experience of inventory accounting in domestic practice

    Directory of Open Access Journals (Sweden)

    Ірина Анатоліївна Карабаза

    2015-03-01

    Full Text Available This article provides a comparison of foreign and domestic experience in inventory accounting. Advantages and disadvantages of perpetual and periodic inventory systems were defined. The viability of periodic inventory system practice was investigated in the context of Ukrainian accounting system. The methodology for store accounting procedure in accordance with periodic inventory system was proposed for domestic accounts

  3. 7 CFR 930.57 - Secondary inventory reserve.

    Science.gov (United States)

    2010-01-01

    ... shall retain control over the release of any cherries from the secondary inventory reserve. No cherries... 7 Agriculture 8 2010-01-01 2010-01-01 false Secondary inventory reserve. 930.57 Section 930.57... Handling Regulations § 930.57 Secondary inventory reserve. (a) In the event the inventory reserve...

  4. 10 CFR 850.20 - Baseline beryllium inventory.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Baseline beryllium inventory. 850.20 Section 850.20 Energy... Baseline beryllium inventory. (a) The responsible employer must develop a baseline inventory of the... inventory, the responsible employer must: (1) Review current and historical records; (2) Interview workers...

  5. Raman analysis of cobalt blue pigment in blue and white porcelain: A reassessment

    Science.gov (United States)

    Jiang, Xiaochenyang; Ma, Yanying; Chen, Yue; Li, Yuanqiu; Ma, Qinglin; Zhang, Zhaoxia; Wang, Changsui; Yang, Yimin

    2018-02-01

    Cobalt blue is a famous pigment in human history. In the past decade it is widely reported that the cobalt aluminate has been detected in ancient ceramics as blue colorant in glaze, yet the acquired Raman spectra are incredibly different from that of synthesised references, necessitating a reassessment of such contradictory scenario with more accurate analytic strategies. In this study, micro-Raman spectroscopy (MRS) and scanning electron microscopy (SEM) in association with energy dispersive spectrometry (EDS) were performed on under-glaze cobalt pigments from one submerged blue and white porcelain shard dated from Wanli reign (1573-1620 CE) of Ming dynasty (1365-1644 CE) excavated at Nan'ao I shipwreck off the southern coast of China. The micro-structural inspection reveals that the pigment particles have characteristics of small account, tiny size, heterogeneously distribution, and more importantly, been completely enwrapped by well-developed anorthite crystals in the glaze, indicating that the signals recorded in previous publications are probably not from cobalt pigments themselves but from outside thickset anorthite shell. The further spectromicroscopic analyses confirm this presumption when the accurate spectra of cobalt aluminate pigment and surrounding anorthite were obtained separately with precise optical positioning. Accordingly, we reassess and clarify the previous Raman studies dedicated to cobalt blue pigment in ancient ceramics, e.g. cobalt blue in celadon glaze, and in turn demonstrate the superiority and necessity of coupling spectroscopic analysis with corresponding structure observation, especially in the characterization of pigments from complicated physico-chemical environment like antiquities. Thus, this study promotes a better understanding of Raman spectroscopy study of cobalt blue pigments in art and archaeology field.

  6. National dam inventory provides data for analysis

    International Nuclear Information System (INIS)

    Spragens, L.

    1992-01-01

    The Association of State Dam Safety Officials completed a dam inventory this fall. Information on approximately 90,000 state-regulated dams in the US collected during the four-year inventory is being used to build a database managed by the Federal Emergency Management Agency. In addition to ASDSO's work, the federal government conducted an inventory of federal dams. This data will be added to the state information to form one national database. The database will feature 35 data fields for each entry, including the name of the dam, its size, the name of the nearest downstream community, maximum discharge and storage volume, the date of the last inspection, and details about the emergency action plan. The program is an update of the nation's first dam inventory, required by the Dam Safety Act of 1972. The US Army Corps of Engineers completed the original inventory in 1981. The Water Resources Development Act of 1986 authorized appropriations of $2.5 million for the Corps to update the inventory. FEMA and the Corps entered into an agreement for FEMA to undertake the task for the Corps and to coordinate work on both the federal and state inventories. ASDSO compiles existing information on state-regulated dams into a common format for the database, added missing information, and established a process for continually updating data. ASDSO plans to analyze the information collected for the database. It will look at statistics for the number of dams regulated, communities that could be affected, and the number of high-hazard dams. FEMA is preparing reports for Congress on the project. The reports, which are expected to be ready by May 1993, will include information on the methodology used and facts about regulated dams under state jurisdiction

  7. Unified Communications for Space Inventory Management

    Science.gov (United States)

    Gifford, Kevin K.; Fink, Patrick W.; Barton, Richard; Ngo, Phong H.

    2009-01-01

    To help assure mission success for long-duration exploration activities, NASA is actively pursuing wireless technologies that promote situational awareness and autonomy. Wireless technologies are typically extensible, offer freedom from wire tethers, readily support redundancy, offer potential for decreased wire weight, and can represent dissimilar implementation for increased reliability. In addition, wireless technologies can enable additional situational awareness that otherwise would be infeasible. For example, addition of wired sensors, the need for which might not have been apparent at the outset of a program, night be extremely costly due in part to the necessary routing of cables through the vehicle. RFID, or radio frequency identification, is a wireless technology with the potential for significant savings and increased reliability and safety in space operations. Perhaps the most obvious savings relate to the application of inventory management. A fully automated inventory management system is highly desirable for long-term sustaining operations in space environments. This assertion is evidenced by inventory activities on the International Space Station, which represents the most extensive inventory tracking experience base in the history of space operations. In the short tern, handheld RFID readers offer substantial savings owing to reduced crew time for inventory audits. Over the long term, a combination of improved RFID technology and operational concepts modified to fully utilize the technology should result in space based inventory management that is highly reliable and requires very little crew time. In addition to inventory management, RFID is likely to find space applications in real-time location and tracking systems. These could vary from coarse-resolution RFID portals to the high resolution afforded by ultra-wideband (UWB) RFID. Longer range RFID technologies that leverage passive surface acoustic wave (SAW) devices are being investigated to

  8. Benefits of a strategic national forest inventory to science and society: the USDA Forest Service Forest Inventory and Analysis program

    Science.gov (United States)

    J. D. Shaw

    2006-01-01

    Benefits of a strategic national forest inventory to science and society: the USDA Forest Service Forest Inventory and Analysis program. Forest Inventory and Analysis, previously known as Forest Survey, is one of the oldest research and development programs in the USDA Forest Service. Statistically-based inventory efforts that started in Scandinavian countries in the...

  9. Vendor Managed Inventory:Retail Industry Perspective of Malaysia

    OpenAIRE

    Madjlesi Taklimi, Zahra

    2011-01-01

    The concept of Vendor Managed Inventory (VMI) radically changes a traditional inventory management. Under the typical business model, the buyer or retailer is in total control of the timing and volume of the order, in order placing and managing the inventory plan. Whereas VMI is a supply chain initiative where the supplier is responsible for all decisions regarding inventories at the retailers, i.e. under VMI program the supplier is authorized to manage inventories of agreed-upon stock-keepin...

  10. The role of inventory management in Canadian economic fluctuations

    OpenAIRE

    Hung-Hay Lau

    1996-01-01

    Swings in inventory investment have traditionally played a major role in Canadian business cycles. However, advances in inventory-control techniques and the reduced uncertainty associated with lower inflation have enabled firms to manage their inventories much more tightly and effectively. This article examines recent developments in the management of non-farm business inventories in Canada at both the aggregate and the sectoral level and looks at implications for the role of inventories as a...

  11. Anomalous Cepheids and population II blue stragglers

    Science.gov (United States)

    Nemec, James M.

    Recent studies of anomalous Cepheids (ACs) and population II blue stragglers (BSs), including photometrically variable BSs (VBSs), are reviewed. The VBSs represent about 25 percent of the BSs, the majority of which are SX Phe short-period variables in the Cepheid instability strip. Mass estimates derived using various techniques suggest that both ACs and BSs are relatively massive (about 1.0-1.6 solar mass). The recent discovery that two BSs in the globular cluster NGC 5466 are contact binaries, and the earlier discovery that one of the BSs in Omega Cen is an eclipsing binary, provide direct evidence that at least some BSs are binary systems.

  12. Taxonomy Icon Data: blue whale [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available blue whale Balaenoptera musculus Chordata/Vertebrata/Mammalia/Theria/Eutheria/Cetacea Balaenoptera..._musculus_L.png Balaenoptera_musculus_NL.png Balaenoptera_musculus_S.png Balaenoptera_musculu...s_NS.png http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Balaenoptera+musculus&t=L http://biosciencedbc.jp/...taxonomy_icon/icon.cgi?i=Balaenoptera+musculus&t=NL http://biosciencedbc.jp/taxon...omy_icon/icon.cgi?i=Balaenoptera+musculus&t=S http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Balaenoptera+musculus&t=NS ...

  13. Evaluating Global Emission Inventories of Biogenic Bromocarbons

    Science.gov (United States)

    Hossaini, Ryan; Mantle, H.; Chipperfield, M. P.; Montzka, S. A.; Hamer, P.; Ziska, F.; Quack, B.; Kruger, K.; Tegtmeier, S.; Atlas, E.; hide

    2013-01-01

    Emissions of halogenated very short-lived substances (VSLS) are poorly constrained. However, their inclusion in global models is required to simulate a realistic inorganic bromine (Bry) loading in both the troposphere, where bromine chemistry perturbs global oxidizing capacity, and in the stratosphere, where it is a major sink for ozone (O3). We have performed simulations using a 3-D chemical transport model (CTM) including three top-down and a single bottom-up derived emission inventory of the major brominated VSLS bromoform (CHBr3) and dibromomethane (CH2Br2). We perform the first concerted evaluation of these inventories, comparing both the magnitude and spatial distribution of emissions. For a quantitative evaluation of each inventory, model output is compared with independent long-term observations at National Oceanic and Atmospheric Administration (NOAA) ground-based stations and with aircraft observations made during the NSF (National Science Foundation) HIAPER Pole-to-Pole Observations (HIPPO) project. For CHBr3, the mean absolute deviation between model and surface observation ranges from 0.22 (38 %) to 0.78 (115 %) parts per trillion (ppt) in the tropics, depending on emission inventory. For CH2Br2, the range is 0.17 (24 %) to 1.25 (167 %) ppt. We also use aircraft observations made during the 2011 Stratospheric Ozone: Halogen Impacts in a Varying Atmosphere (SHIVA) campaign, in the tropical western Pacific. Here, the performance of the various inventories also varies significantly, but overall the CTM is able to reproduce observed CHBr3 well in the free troposphere using an inventory based on observed sea-to-air fluxes. Finally, we identify the range of uncertainty associated with these VSLS emission inventories on stratospheric bromine loading due to VSLS (Br(VSLS/y)). Our simulations show Br(VSLS/y) ranges from approximately 4.0 to 8.0 ppt depending on the inventory. We report an optimized estimate at the lower end of this range (approximately 4 ppt

  14. A Perishable Inventory Model with Return

    Science.gov (United States)

    Setiawan, S. W.; Lesmono, D.; Limansyah, T.

    2018-04-01

    In this paper, we develop a mathematical model for a perishable inventory with return by assuming deterministic demand and inventory dependent demand. By inventory dependent demand, it means that demand at certain time depends on the available inventory at that time with certain rate. In dealing with perishable items, we should consider deteriorating rate factor that corresponds to the decreasing quality of goods. There are also costs involved in this model such as purchasing, ordering, holding, shortage (backordering) and returning costs. These costs compose the total costs in the model that we want to minimize. In the model we seek for the optimal return time and order quantity. We assume that after some period of time, called return time, perishable items can be returned to the supplier at some returning costs. The supplier will then replace them in the next delivery. Some numerical experiments are given to illustrate our model and sensitivity analysis is performed as well. We found that as the deteriorating rate increases, returning time becomes shorter, the optimal order quantity and total cost increases. When considering the inventory-dependent demand factor, we found that as this factor increases, assuming a certain deteriorating rate, returning time becomes shorter, optimal order quantity becomes larger and the total cost increases.

  15. Optimal ABC inventory classification using interval programming

    Science.gov (United States)

    Rezaei, Jafar; Salimi, Negin

    2015-08-01

    Inventory classification is one of the most important activities in inventory management, whereby inventories are classified into three or more classes. Several inventory classifications have been proposed in the literature, almost all of which have two main shortcomings in common. That is, the previous methods mainly rely on an expert opinion to derive the importance of the classification criteria which results in subjective classification, and they need precise item parameters before implementing the classification. While the problem has been predominantly considered as a multi-criteria, we examine the problem from a different perspective, proposing a novel optimisation model for ABC inventory classification in the form of an interval programming problem. The proposed interval programming model has two important features compared to the existing methods: it provides optimal results instead of an expert-based classification and it does not require precise values of item parameters, which are not almost always available before classification. Finally, by illustrating the proposed classification model in the form of numerical example, conclusion and suggestions for future works are presented.

  16. INVENTORIES MEASUREMENT – BETWEEN PRUDENCE AND NONPRUDENCE

    Directory of Open Access Journals (Sweden)

    Iulia JIANU

    2010-12-01

    Full Text Available In accounting, measurement is the process used to determine the value at which the items of financial statements are recognized in accounting and presented in the balance sheet and in the profit and loss account. Starting from the importance of measurement in accounting, the first study objective in this paper brings in the center of discussion the inventories measurement with the purpose to identify the main methods for inventories measurement at exit used by the economic entities listed on EuroNext Paris Exchange Stock. In the present context, when the financial crisis is still felt in the EU countries is important to note the extent to which economic entities demonstrate prudence in accounting by taking into consideration the inventories impairment at balance sheet date. Compliance with the prudence principle to integrate uncertainty in accounting measurement has the purpose to avoid the risk to transfer in the future periods the present uncertainties that are likely to strike the economic entity. One of the main consequences of this principle is to make impairments for inventories. Therefore the second objective of the present paper is to reflect the extent to which the entities under study record impairments for inventories at balance sheet date, as well as to highlight the manner in which is disclosed the information regarding the way the net realizable value can be calculated.

  17. Denmark's National Inventory Report 2015 and 2016

    DEFF Research Database (Denmark)

    Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt; Winther, Morten

    This report is Denmark’s annual documentation report of the greenhouse gas inventory submitted to the United Nations Framework Convention on Climate Change (UNFCCC) and the Kyoto Protocol. The report is prepared in accordance with the UNFCCC reporting guidelines and CMP decisions and contains all....../removals and the quality control procedures in place. The main sectoral chapters of the report refer to Denmark, while information on the emission inventory of Greenland and the Faroe Islands is included in Chapter 16 and Annex 7, respectively.......This report is Denmark’s annual documentation report of the greenhouse gas inventory submitted to the United Nations Framework Convention on Climate Change (UNFCCC) and the Kyoto Protocol. The report is prepared in accordance with the UNFCCC reporting guidelines and CMP decisions and contains all...... the mandatory information related to the Danish greenhouse gas inventory. The report contains information on emissions of CO2, CH4, N2O, HFCs, PFCs and SF6 and removals of CO2. The report describes among other aspects the data underpinning the inventory, the methodologies to estimate emissions...

  18. Clinical learning environment inventory: factor analysis.

    Science.gov (United States)

    Newton, Jennifer M; Jolly, Brian C; Ockerby, Cherene M; Cross, Wendy M

    2010-06-01

    This paper is a report of the psychometric testing of the Clinical Learning Environment Inventory. The clinical learning environment is a complex socio-cultural entity that offers a variety of opportunities to engage or disengage in learning. The Clinical Learning Environment Inventory is a self-report instrument consisting of 42 items classified into six scales: personalization, student involvement, task orientation, innovation, satisfaction and individualization. It was developed to examine undergraduate nursing students' perceptions of the learning environment whilst on placement in clinical settings. As a component of a longitudinal project, Bachelor of Nursing students (n = 659) from two campuses of a university in Australia, completed the Clinical Learning Environment Inventory from 2006 to 2008. Principal components analysis using varimax rotation was conducted to explore the factor structure of the inventory. Data for 513 students (77%) were eligible for inclusion. Constraining data to a 6-factor solution explained 51% of the variance. The factors identified were: student-centredness, affordances and engagement, individualization, fostering workplace learning, valuing nurses' work, and innovative and adaptive workplace culture. These factors were reviewed against recent theoretical developments in the literature. The study offers an empirically based and theoretically informed extension of the original Clinical Learning Environment Inventory, which had previously relied on ad hoc clustering of items and the use of internal reliability of its sub-scales. Further research is required to establish the consistency of these new factors.

  19. Optoelectronic inventory system for special nuclear material

    International Nuclear Information System (INIS)

    Sieradzki, F.H.

    1994-01-01

    In support of the Department of Energy's Dismantlement Program, the Optoelectronics Characterization and Sensor Development Department 2231 at Sandia National Laboratories/New Mexico has developed an in situ nonintrusive Optoelectronic Inventory System (OIS) that has the potential for application wherever periodic inventory of selected material is desired. Using a network of fiber-optic links, the OIS retrieves and stores inventory signatures from data storage devices (which are permanently attached to material storage containers) while inherently providing electromagnetic pulse immunity and electrical noise isolation. Photovoltaic cells (located within the storage facility) convert laser diode optic power from a laser driver to electrical energy. When powered and triggered, the data storage devices sequentially output their digital inventory signatures through light-emitting diode/photo diode data links for retrieval and storage in a mobile data acquisition system. An item's exact location is determined through fiber-optic network and software design. The OIS provides an on-demand method for obtaining acceptable inventory reports while eliminating the need for human presence inside the material storage facility. By using modularization and prefabricated construction with mature technologies and components, an OIS installation with virtually unlimited capacity can be tailored to the customer's requirements

  20. An anion channel in Arabidopsis hypocotyls activated by blue light

    Science.gov (United States)

    Cho, M. H.; Spalding, E. P.; Evans, M. L. (Principal Investigator)

    1996-01-01

    A rapid, transient depolarization of the plasma membrane in seedling stems is one of the earliest effects of blue light detected in plants. It appears to play a role in transducing blue light into inhibition of hypocotyl (stem) elongation, and perhaps other responses. The possibility that activation of a Cl- conductance is part of the depolarization mechanism was raised previously and addressed here. By patch clamping hypocotyl cells isolated from dark-grown (etiolated) Arabidopsis seedlings, blue light was found to activate an anion channel residing at the plasma membrane. An anion-channel blocker commonly known as NPPB 15-nitro-2-(3-phenylpropylamino)-benzoic acid] potently and reversibly blocked this anion channel. NPPB also blocked the blue-light-induced depolarization in vivo and decreased the inhibitory effect of blue light on hypocotyl elongation. These results indicate that activation of this anion channel plays a role in transducing blue light into growth inhibition.

  1. Fuzzy logic color detection: Blue areas in melanoma dermoscopy images.

    Science.gov (United States)

    Lingala, Mounika; Stanley, R Joe; Rader, Ryan K; Hagerty, Jason; Rabinovitz, Harold S; Oliviero, Margaret; Choudhry, Iqra; Stoecker, William V

    2014-07-01

    Fuzzy logic image analysis techniques were used to analyze three shades of blue (lavender blue, light blue, and dark blue) in dermoscopic images for melanoma detection. A logistic regression model provided up to 82.7% accuracy for melanoma discrimination for 866 images. With a support vector machines (SVM) classifier, lower accuracy was obtained for individual shades (79.9-80.1%) compared with up to 81.4% accuracy with multiple shades. All fuzzy blue logic alpha cuts scored higher than the crisp case. Fuzzy logic techniques applied to multiple shades of blue can assist in melanoma detection. These vector-based fuzzy logic techniques can be extended to other image analysis problems involving multiple colors or color shades. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Strategic blue-green communication filters

    Science.gov (United States)

    Rosenberg, W. J.

    1984-04-01

    The project began as an effort to construct narrowband, wide-field-of-view, large-aperture, plastic, birefringent filters suitable for blue-green communications. During the course of the study we investigated the use of crystalline materials in addition to plastic films, and we studied filter design theory in order to find designs more suitable to the blue-green system requirements. In addition, we constructed a quartz, 2A filter for the 1981 SLCAIR experiment. In this report we have included an introduction to the principles of narrowband, wide-field-of-view, birefringent filters. This section is included since the subject matter is not readily available except piecemeal in technical journals. Section 3 is a discussion of the materials which were considered during this study. It contains subsections devoted to crystals, plastics and analog element, respectively. A class of new lossless filter designs is described in Section 4. These designs are expected to provide a basis for high-transmission filters in the future. The operational SLCAIR-81 filter is described in Section 5. It was part of the successful experiment which demonstrated communication to the USN Dolphin, a research submarine. Finally, in Section 6 we describe the non-vignetting filter design which was discovered during this study. It represents a significant throughput advantage for crystal filters used in non-imaging applications.

  3. Grassy Silica Nanoribbons and Strong Blue Luminescence

    Science.gov (United States)

    Wang, Shengping; Xie, Shuang; Huang, Guowei; Guo, Hongxuan; Cho, Yujin; Chen, Jun; Fujita, Daisuke; Xu, Mingsheng

    2016-09-01

    Silicon dioxide (SiO2) is one of the key materials in many modern technological applications such as in metal oxide semiconductor transistors, photovoltaic solar cells, pollution removal, and biomedicine. We report the accidental discovery of free-standing grassy silica nanoribbons directly grown on SiO2/Si platform which is commonly used for field-effect transistors fabrication without other precursor. We investigate the formation mechanism of this novel silica nanostructure that has not been previously documented. The silica nanoribbons are flexible and can be manipulated by electron-beam. The silica nanoribbons exhibit strong blue emission at about 467 nm, together with UV and red emissions as investigated by cathodoluminescence technique. The origins of the luminescence are attributed to various defects in the silica nanoribbons; and the intensity change of the blue emission and green emission at about 550 nm is discussed in the frame of the defect density. Our study may lead to rational design of the new silica-based materials for a wide range of applications.

  4. The Safeguards Active Response Inventory System (SARIS)

    International Nuclear Information System (INIS)

    Carlson, R.L.

    1985-04-01

    The Safeguards Active Response Inventory System (SARIS) was developed by Westinghouse Hanford Company (WHC) to perform material control and accountability on all the nuclear material under WHC's jurisdiction. SARIS has been in operation for four and one-half years. It has reduced physical inventory plant shutdown time from several days to a few hours. The user-friendly interface has proven successful, as the training time for a new operator is only two to three hours; also errors have been dramatically reduced. The modeling features of SARIS have reduced the reported inventory difference and provide better information for measurement of scrap and waste. The audit files have been usefull in resolving data entry errors and the backup features have averted several potential problems. SARIS as a computerized accountability system has replaced manual record keeping with a consequent increase in productivity. 4 refs

  5. Relativity concept inventory: Development, analysis, and results

    Directory of Open Access Journals (Sweden)

    J. S. Aslanides

    2013-05-01

    Full Text Available We report on a concept inventory for special relativity: the development process, data analysis methods, and results from an introductory relativity class. The Relativity Concept Inventory tests understanding of relativistic concepts. An unusual feature is confidence testing for each question. This can provide additional information; for example, high confidence correlated with incorrect answers suggests a misconception. A novel aspect of our data analysis is the use of Monte Carlo simulations to determine the significance of correlations. This approach is particularly useful for small sample sizes, such as ours. Our results show a gender bias that was not present in course assessment, similar to that reported for the Force Concept Inventory.

  6. Heterogeneous fundamentalists and market maker inventories

    International Nuclear Information System (INIS)

    Carraro, Alessandro; Ricchiuti, Giorgio

    2015-01-01

    In this paper, we develop a heterogeneous agents model of asset price and inventory with a market maker who considers the excess demand of two groups of agents that employ the same trading rule (i.e. fundamentalists) with different beliefs on the fundamental value. The dynamics of our model is driven by a bi-dimensional discrete non-linear map. We show that the market maker has a destabilizing role when she actively manages the inventory. Moreover, inventory share and the distance between agents’ beliefs strongly influence the results: market instability and periodic, or even, chaotic price fluctuations can be generated. Finally, we show through simulations that endogenous fluctuations of the fractions of agents may trigger instability for a larger set of parameters.

  7. Manajemen Strategi Pengembangan Pariwisata dengan Pendekatan Blue Ocean Strategy

    OpenAIRE

    Muzha, Vianda Kushardianti

    2015-01-01

    Persaingan industri pariwisata di Indonesia saat ini sangatlah ketat, setiap daerah berlomba untuk menonjolkan keunikannya tersendiri. Dengan adanya persaingan yang sangat ketat tersebut, Kota Batu berusaha keluar dari persaingan (red ocean) dengan menciptkan inovasi baru melalui konsep Blue Ocean Strategy. Blue Ocean Strategy adalah istilah dalam ilmu manajemen strategi yang merujuk pada siasat untuk menciptakan pasar baru yang belum dipenuhi persaingan yang ketat. Blue Ocean Strategy pada d...

  8. A Survey of Blue-Noise Sampling and Its Applications

    KAUST Repository

    Yan, Dongming

    2015-05-05

    In this paper, we survey recent approaches to blue-noise sampling and discuss their beneficial applications. We discuss the sampling algorithms that use points as sampling primitives and classify the sampling algorithms based on various aspects, e.g., the sampling domain and the type of algorithm. We demonstrate several well-known applications that can be improved by recent blue-noise sampling techniques, as well as some new applications such as dynamic sampling and blue-noise remeshing.

  9. Large Scale Density Estimation of Blue and Fin Whales (LSD)

    Science.gov (United States)

    2015-09-30

    1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Large Scale Density Estimation of Blue and Fin Whales ...sensors, or both. The goal of this research is to develop and implement a new method for estimating blue and fin whale density that is effective over...develop and implement a density estimation methodology for quantifying blue and fin whale abundance from passive acoustic data recorded on sparse

  10. The Return of the Blue Butterfly

    Science.gov (United States)

    Santos, Anabela

    2014-05-01

    The Return of the Blue Butterfly The English writer Charles Dickens once wrote: "I only ask to be free. The butterflies are free". But are they really? The work that I performed with a group of students from 8th grade, had a starting point of climate change and the implications it has on ecosystems. Joining the passion I have for butterflies, I realized that they are also in danger of extinction due to these climatic effects. Thus, it was easy to seduce my students wanting to know more. Luckily I found Dr. Paula Seixas Arnaldo, a researcher at the University of Trás-os-Montes and Alto Douro, who has worked on butterflies and precisely investigated this issue. Portugal is the southern limit of butterfly-blue (Phengaris alcon), and has been many years in the red book of endangered species. Butterfly-blue is very demanding of their habitat, and disappears very easily if ideal conditions are not satisfied. Increased fragmentation of landscapes and degradation of suitable habitats, are considered the greatest challenges of the conservation of Phengaris butterfly in Portugal. In recent decades, climate change has also changed butterfly-blue spatial distribution with a movement of the species northward to colder locations, and dispersion in latitude. Butterflies of Europe must escape to the North because of the heat. Dr. Paula Seixas Arnaldo and her research team began a project, completed in December 2013, wanted to preserve and restore priority habitats recognized by the European Union to help species in danger of disappearing with increasing temperature. The blue butterfly is extremely important because it is a key indicator of the quality of these habitats. In the field, the butterflies are monitored to collect all possible data in order to identify the key species. Butterflies start flying in early July and cease in late August. Mating takes about an hour and occurs in the first days of life. The gentian-peat (Gentiana pneumonanthe) serves as the host plant for

  11. Phototherapy with blue and green mixed-light is as effective against unconjugated jaundice as blue light and reduces oxidative stress in the Gunn rat model.

    Science.gov (United States)

    Uchida, Yumiko; Morimoto, Yukihiro; Uchiike, Takao; Kamamoto, Tomoyuki; Hayashi, Tamaki; Arai, Ikuyo; Nishikubo, Toshiya; Takahashi, Yukihiro

    2015-07-01

    Phototherapy using blue light-emitting diodes (LED) is effective against neonatal jaundice. However, green light phototherapy also reduces unconjugated jaundice. We aimed to determine whether mixed blue and green light can relieve jaundice with minimal oxidative stress as effectively as either blue or green light alone in a rat model. Gunn rats were exposed to phototherapy with blue (420-520 nm), filtered blue (FB; 440-520 nm without 1.00), respectively. Blue plus green phototherapy is as effective as blue phototherapy and it attenuates irradiation-induced oxidative stress. Combined blue and green spectra might be effective against neonatal hyperbilirubinemia. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  12. Primary orbital melanoma in association with cellular blue nevus.

    Science.gov (United States)

    El-Sawy, Tarek; Bakhoum, Mathieu F; Tetzlaff, Michael; Nasser, Qasiem J; Prieto, Victor G; Ivan, Doina; Sniegowski, Matthew C; Yin, Vivian T; Pan, Caroline; Durairaj, Vikram; Esmaeli, Bita

    2014-01-01

    To describe 3 cases of primary orbital melanoma associated with either known or subsequently discovered cellular blue nevus. The clinical records and surgical specimens of 3 patients who underwent orbital exenteration for primary orbital melanoma and who had a cellular blue nevus diagnosed before or after detection of the melanoma were retrospectively reviewed. All 3 patients presented with signs and symptoms of an orbital mass. Subsequent biopsy revealed invasive melanoma. One patient had a known history of congenital cellular blue nevus of the eyelid from which the orbital melanoma originated. The other 2 patients had no known history of cutaneous pigmentation or blue nevus. In these 2 patients, the cellular blue nevus was detected on pathologic review of the orbital exenteration specimen (1 patient) or surgical biopsy specimen (1 patient). All 3 patients underwent total body positron emission tomography/computed tomography, and in all 3 results were negative for other sites of disease involvement. In the 2 patients without a previously known nevus a total body skin check was negative for other primary melanoma lesions. All 3 patients underwent orbital exenteration followed by postoperative radiation therapy. Thorough evaluation of biopsy specimens of "primary" orbital melanoma is warranted to ensure identification of any associated blue nevus because blue nevi are precursor lesions for orbital melanoma, and the presence of a blue nevus would support a primary orbital melanoma rather than a metastatic lesion. Patients with a known blue nevus of the periocular skin and ocular adnexa should be monitored closely for signs of malignant transformation.

  13. Tooth whitening evaluation of blue covarine containing toothpastes.

    Science.gov (United States)

    Tao, Danying; Smith, Richard N; Zhang, Qiong; Sun, Jianing N; Philpotts, Carole J; Ricketts, Stephen R; Naeeni, Mojgan; Joiner, Andrew

    2017-12-01

    To measure the tooth whitening effects delivered immediately after brushing with silica-based toothpastes containing blue covarine in vitro and in vivo. Salivary pellicle coated human extracted teeth were brushed with either a slurry of a toothpaste containing blue covarine (BC), a formulation containing an increased level of blue covarine (BC+) or a negative control toothpaste containing no blue covarine. The colour of the specimens were measured in vitro using either a Minolta chromameter or a VITA Easyshade spectrophotometer, before and after brushing and changes in CIELAB values and tooth Whiteness Index (WIO) values calculated. In a double-blind cross-over clinical study, subjects brushed with either BC or BC+ toothpaste and tooth colour changes were measured with a digital image analysis system. The in vitro studies demonstrated that toothpastes containing blue covarine gave a significantly (pbrushing with the BC+ toothpaste than with the BC toothpaste (WIO p=0.006; b* p=0.013). Toothpastes containing blue covarine gave a statistically significant reduction in tooth yellowness and improvement in tooth whiteness immediately after brushing in both in vitro and clinical studies. In addition, the higher concentration blue covarine toothpaste gave statistically significant greater tooth whitening benefits than the lower concentration blue covarine toothpaste. The silica-based toothpastes containing blue covarine evaluated in the current study gave tooth whitening benefits immediately after one brush. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Radwaste inventories and projections: an overview

    International Nuclear Information System (INIS)

    Notz, K.J.

    1982-07-01

    The Integrated Data Base program was set up to provide fully integrated and reconciled inventories, characteristics, and projections for spent nuclear fuel and all categories of radioactive waste. Eight summary papers, six of which were presented at an ANS special session in Los Angeles in June 1982, are included in this report: data base needs and functions: national planning; integrated data base for spent fuel and radwaste: inventories; integrated data base projections; RAWSYM: radioactive waste management system; NWTS program waste projection data needs; low-level waste management data base system; waste sludge composition at the Savannah River Plant; and summary of characteristics of transuranic waste found at DOE sites

  15. Dealer Inventory and the Cost of Immediacy

    DEFF Research Database (Denmark)

    Dick-Nielsen, Jens

    This study shows that the recent 80% decrease in dealer inventories of corporate bonds has increased the cost of immediacy. For safe bonds which are quickly turned over again by dealers the increase is up to 15%, while for risky bonds which are kept on inventory by dealers the increase is up to 100......% on average. The time series of transaction costs is estimated using the natural experiment of corporate bond index exclusions. The exclusions are monthly and information-free events where index trackers seeking to minimize tracking error request immediacy in order to sell close to the exclusion date...

  16. Orchids inventory in Sintang Regency, West Kalimantan

    Directory of Open Access Journals (Sweden)

    ESTI ENDAH ARIYANTI

    2008-10-01

    Full Text Available Orchid is one of ornamental plants which have commercial value. Therefore most species are becoming threatened or even endangered because of over exploitation. In addition, its natural habitat is also decreasing. Conservation must be done urgently, both by in situ and ex situ conservation, which can be started by orchid inventory. The orchid inventory was done in TWA Bukit Kelam, TWA Baning and several places in Regency of Sintang, West Kalimantan. The result showed that there were 40 species belonged to 27 genera, which 32 species of them (20 genera were epiphytic orchids and 8 species (7 genera were terrestrial orchids.

  17. INVENTORY MANAGEMENT IN THE ENTERPRISE THROUGH THE APPLICATION OF IFRS 2 INVENTORIES

    Directory of Open Access Journals (Sweden)

    Svetlozar Stefanov

    2016-07-01

    Full Text Available The focus in the article is on the issues of valuation and presentation of the inventories under the meaning on the International Accounting Standard 2 Inventories. The Standard provides guidance on the determination of costs of finished products and its recognition as and expense in the production and sale finished products, including guidance for determination of the net realizable value. The latter is defined as the estimated selling price less the estimated costs of completion and estimated costs necessary to make the sale. The cost of inventories comprises all costs of purchase, cost of conversion and other costs incurred in bringing the inventories to a condition suitable for subsequent use. The amount of the cost for materials used or products sold and the finished product is determined using one of the following methods: a specifically defined value, first-in � first out or weighted average cost of lots delivered. When inventories are sold, the carrying amount of those inventories is recognized as an expense in the period in which the related sales revenue is recognized. The amount of any write-down of inventories to net realizable value is recorded as a current expense and is recognized as an expense in the period the write-down occurs.

  18. KENDALI OPTIMAL DARI SISTEM INVENTORI DENGAN PENINGKATAN DAN PENURUNAN BARANG

    Directory of Open Access Journals (Sweden)

    P Affandi

    2016-03-01

    Full Text Available Terdapat banyak permasalahan yang melibatkan teori sistem dan teori kontrol serta aplikasinya. Contohnya, beberapa referensi teori  yang mengaplikasikan teori kontrol ke dalam masalah inventori. Masalah klasik dalam masalah inventori adalah bagaimana mengatur perubahan permintaan konsumen pada sebuah produk barang jadi. Selain mengalami penurunan yang disebabkan kerusakan dan kemerosotan, ternyata inventori juga bisa mengalami peningkatan. Biasanya, inventori yang mengalami peningkatan terjadi pada inventori yang melakukan proses produksi yang berlangsung secara terus menerus; Sedangkan permintaan sedikit juga terjadi pada inventori makhluk hidup yang mengalami perkembangbiakan. Selanjutnya, hal ini mengakibatkan terjadinya peningkatan jumlah inventori. Dapat disimpulkan bahwa secara teori, sistem Inventori dapat mengalami peningkatan dan penurunan. Masalah ini dapat dimodelkan dan diselesaikan dengan menggunakan teknik kontrol optimal, sehingga akan diperoleh nilai optimal tingkat inventori dan rata-rata produksi optimal.There are many problems involving the theory of systems, control theory and its application. For example, some reference theories apply control theory to the inventory problems. The classical problem in the inventory problem was how to manage changes in consumer demand in a finished product. Besides it declines caused by damage and deterioration, evidently inventory can also increase. Typically, inventories that increased were inventories have production process continues over time; While little demand also occurred in inventories of living beings who have breeding. evidently, this led to an increasing in the amount of inventory. It can be concluded that, in theory, inventory system can be increased and decreased. This problem can be modeled and solved using optimal control techniques, so it will be obtained an optimum value of inventory levels and the average optimal production.

  19. Endogenous Business Cycle Dynamics within Metzlers Inventory Model: Adding an Inventory Floor.

    Science.gov (United States)

    Sushko, Irina; Wegener, Michael; Westerhoff, Frank; Zaklan, Georg

    2009-04-01

    Metzlers inventory model may produce dampened fluctuations in economic activity, thus contributing to our understanding of business cycle dynamics. For some parameter combinations, however, the model generates oscillations with increasing amplitude, implying that the inventory stock of firms eventually turns negative. Taking this observation into account, we reformulate Metzlers model by simply putting a floor to the inventory level. Within the new piecewise linear model, endogenous business cycle dynamics may now be triggered via a center bifurcation, i.e. for certain parameter combinations production changes are (quasi-)periodic.

  20. Savannah River Plant's Accountability Inventory Management System (AIMS) (Nuclear materials inventory control)

    International Nuclear Information System (INIS)

    Croom, R.G.

    1976-06-01

    The Accountability Inventory Management System (AIMS) is a new computer inventory control system for nuclear materials at the Savannah River Plant, Aiken, South Carolina. The system has two major components, inventory files and system parameter files. AIMS, part of the overall safeguards program, maintains an up-to-date record of nuclear material by location, produces reports required by ERDA in addition to onplant reports, and is capable of a wide range of response to changing input/output requirements through use of user-prepared parameter cards, as opposed to basic system reprogramming

  1. The Blue Ribbon Commission and siting radioactive waste disposal facilities

    International Nuclear Information System (INIS)

    Pescatore, C.

    2010-01-01

    On 21 September 2010, the NEA Secretariat was invited to address the Blue Ribbon Commission on America's Nuclear Future. This paper is a summary of the remarks made. The successful siting of radioactive waste disposal facilities implies creating the conditions for continued ownership of the facility over time. Acceptance of the facility at a single point in time is not good enough. Continued ownership implies the creation of conscious, constructive and durable relationships between the (most affected) communities and the waste management facility. Being comfortable about the technical safety of the facility requires a degree of familiarity and control . Having peace of mind about the safety of the facility requires trust in the waste management system and its actors as well as some control over the decision making. Regulators are especially important players who need to be visible in the community. The ideal site selection process should be step- wise, combining procedures for excluding sites that do not meet pre-identified criteria with those for identifying sites where nearby and more distant residents are willing to discuss acceptance of the facility. The regional authorities are just as important as the local authorities. Before approaching a potential siting region or community, there should be clear results of national (and state) debates establishing the role of nuclear power in the energy mix, as well as information on the magnitude of the ensuing waste commitment and its management end-points, and the allocation of the financial and legal responsibilities until the closure of the project. Once the waste inventories and type of facilities have been decided upon, there should be agreement that all significant changes will require a new decision-making process. Any proposed project has a much better chance to move forward positively if the affected populations can participate in its definition, including, at the appropriate time, its technical details. A

  2. New possibilities of greenhouse gases emission inventory

    OpenAIRE

    Radkevich Maria Viktorovna; Salokhiddinov Abdulkhakim Temirhuzhaevich

    2015-01-01

    A method of inventory of greenhouse gas emissions from “road-car” complex depending on road cover evenness is offered. Calculations by IPCC methodology and offered methods give similar results, therefore worked out methods may serve as an alternative to IPCC methods and be used in stating the reasons of excess emissions by car-road complex.

  3. Inventory of radioactive waste disposals at sea

    International Nuclear Information System (INIS)

    1999-08-01

    The IAEA was requested by the Contracting Parties to the Convention on the Prevention of Marine Pollution by Dumping of Wastes and Other Matter (London Convention 1972) to develop and maintain an inventory of radioactive material entering the marine environment from all sources. The rationale for having such an inventory is related to its use as an information base with which the impact of radionuclides from different sources entering the marine environment can be assessed and compared. To respond to the request of the London Convention, the IAEA has undertaken the development of the inventory to include: disposal at sea of radioactive wastes, and accidents and losses at sea involving radioactive materials. This report addresses disposal at sea of radioactive waste, a practice which continued from 1946 to 1993. It is a revision of IAEA-TECDOC-588, Inventory of Radioactive Material Entering the Marine Environment: Sea Disposal of Radioactive Waste, published in 1991. In addition to the data already published in IAEA-TECDOC-588, the present publication includes detailed official information on sea disposal operations carried out by the former Soviet Union and the Russian Federation provided in 1993 as well as additional information provided by Sweden in 1992 and the United Kingdom in 1997 and 1998

  4. Validity of the Parenting Inventory: Young Children.

    Science.gov (United States)

    Fox, Robert A.; Bentley, Kathleen S.

    1992-01-01

    Examined Parenting Inventory: Young Children (PI), rating scale measuring developmental expectations and behaviors of parents of young children. Data from 1,056 mothers revealed PI discriminated successfully between parents with children of different ages and had substantial content validity. PI was not strongly related to Adult-Adolescent…

  5. Evaluation of hospital medication inventory policies.

    Science.gov (United States)

    Gebicki, Marek; Mooney, Ed; Chen, Shi-Jie Gary; Mazur, Lukasz M

    2014-09-01

    As supply chain costs constitute a large portion of hospitals' operating expenses and with $27.7 billion spent by the US hospitals on drugs alone in 2009, improving medication inventory management provides a great opportunity to decrease the cost of healthcare. This study investigates different management approaches for a system consisting of one central storage location, the main pharmacy, and multiple dispensing machines located in each department. Each medication has a specific unit cost, availability from suppliers, criticality level, and expiration date. Event-driven simulation is used to evaluate the performance of several inventory policies based on the total cost and patient safety (service level) under various arrangements of the system defined by the number of drugs and departments, and drugs' criticality, availability, and expiration levels. Our results show that policies that incorporate drug characteristics in ordering decisions can address the tradeoff between patient safety and cost. Indeed, this study shows that such policies can result in higher patient safety and lower overall cost when compared to traditional approaches. Additional insights from this study allow for better understanding of the medication inventory system's dynamics and suggest several directions for future research in this topic. Findings of this study can be applied to help hospital pharmacies with managing their inventory.

  6. Erikson Psychosocial Stage Inventory: A Factor Analysis

    Science.gov (United States)

    Gray, Mary McPhail; And Others

    1986-01-01

    The 72-item Erikson Psychosocial Stage Inventory (EPSI) was factor analyzed for a group of 534 university freshmen and sophomore students. Seven factors emerged, which were labeled Initiative, Industry, Identity, Friendship, Dating, Goal Clarity, and Self-Confidence. Item's representing Erikson's factors, Trust and Autonomy, were dispersed across…

  7. State-of-the-art inventory

    NARCIS (Netherlands)

    Verhagen, H.J.; Van Gerven, K.A.J.; Akkerman, G.J.

    2005-01-01

    The present report provides a state-of-the-art inventory of relevant information and technical concepts for the ComCoast project, being the first phase of the research stages of Work Package 3 (WP3). This project was assigned to Royal Haskoning by CUR. The information scan was set-up in a systematic

  8. Shrink stope design using an inventory model

    Directory of Open Access Journals (Sweden)

    D. Taylor

    2003-12-01

    Full Text Available This paper addresses the fact that current practice in shrink-stoping in hard rock mining invariably ignores the inventory holding cost of the blasted ore. We believe, and show by example, that ignoring this cost could make the difference between profit and loss in an industry that, at present, needs all the help it can get.

  9. The new Brazilian national forest inventory

    Science.gov (United States)

    Joberto V. de Freitas; Yeda M. M. de Oliveira; Doadi A. Brena; Guilherme L.A. Gomide; Jose Arimatea Silva; < i> et al< /i>

    2009-01-01

    The new Brazilian national forest inventory (NFI) is being planned to be carried out through five components: (1) general coordination, led by the Brazilian Forest Service; (2) vegetation mapping, which will serve as the basis for sample plot location; (3) field data collection; (4) landscape data collection of 10 x 10-km sample plots, based on high-resolution...

  10. Inventories and upstream gasoline price dynamics

    NARCIS (Netherlands)

    Kuper, Gerard H.

    This paper sheds new light on the asymmetric dynamics in upstream U.S. gasoline prices. The model is based on Pindyck's inventory model of commodity price dynamics. We show that asymmetry in gasoline price dynamics is caused by changes in the net marginal convenience yield: higher costs of marketing

  11. ABC classification : service levels and inventory costs

    NARCIS (Netherlands)

    Teunter, R.H.; Babai, M.; Syntetos, A.

    2010-01-01

    ABC inventory classifications are widely used in practice, with demand value and demand volume as the most common ranking criteria. The standard approach in ABC applications is to set the same service level for all stock keeping units (SKUs) in a class. In this paper, we show (for three large real

  12. Inventory routing for dynamic waste collection

    NARCIS (Netherlands)

    Mes, Martijn R.K.; Schutten, Johannes M.J.; Perez Rivera, Arturo Eduardo

    2014-01-01

    We consider the problem of collecting waste from sensor equipped underground containers. These sensors enable the use of a dynamic collection policy. The problem, which is known as a reverse inventory routing problem, involves decisions regarding routing and container selection. In more dense

  13. Construction of a Physician Skills Inventory

    Science.gov (United States)

    Richard, George V.; Zarconi, Joseph; Savickas, Mark L.

    2012-01-01

    The current study applied Holland's RIASEC typology to develop a "Physician Skills Inventory". We identified the transferable skills and abilities that are critical to effective performance in medicine and had 140 physicians in 25 different specialties rate the importance of those skills. Principal component analysis of their responses produced…

  14. FIREMON: Fire effects monitoring and inventory system

    Science.gov (United States)

    Duncan C. Lutes; Robert E. Keane; John F. Caratti; Carl H. Key; Nathan C. Benson; Steve Sutherland; Larry J. Gangi

    2006-01-01

    Monitoring and inventory to assess the effects of wildland fire is critical for 1) documenting fire effects, 2) assessing ecosystem damage and benefit, 3) evaluating the success or failure of a burn, and 4) appraising the potential for future treatments. However, monitoring fire effects is often difficult because data collection requires abundant funds, resources, and...

  15. 47 CFR 32.1220 - Inventories.

    Science.gov (United States)

    2010-10-01

    ...) This account shall include the cost of materials and supplies held in stock and inventories of goods.... (c) 1220.1 Material and supplies. This subaccount shall include cost of material and supplies held in... articles of the company in process of manufacture for supply stock. (Note also § 32.2000(c)(2)(iii) of this...

  16. JIT: A Strategic Tool of Inventory Management

    Science.gov (United States)

    Singh, D. K.; Singh, Satyendra

    2012-03-01

    Investment in inventory absorbs a large portion of the working capital of a company and often it represents a large portion of the total assets of a business. By improving return on investment by increasing the rate of inventory turnover, management often wants to ensure economic efficiency. Effective inventory management enables a firm to provide lower costs, rapid response and flexibility for its customers. Just-in-time (JIT) philosophy is most widely adopted and practices in the recent years worldwide. It aims at reducing total production costs by producing only what is immediately needed and eliminates wastes. It is based on a radically different concept, deviating substantially from the existing manufacturing practices in many respects. It is a very effective tool to reduce the wastage of inventory and manage it effectively. It has the potential to bring substantial changes in the existing setup of a company; can give it a new face, broaden its acceptability and ensure a longer life. It can strategically change the atmosphere needed for longer survival. JIT is radically different from MRP and goes beyond materials management. The new outlook acquired by the company can meet global expectations of the cust

  17. Gender Fairness within the Force Concept Inventory

    Science.gov (United States)

    Traxler, Adrienne; Henderson, Rachel; Stewart, John; Stewart, Gay; Papak, Alexis; Lindell, Rebecca

    2018-01-01

    Research on the test structure of the Force Concept Inventory (FCI) has largely ignored gender, and research on FCI gender effects (often reported as "gender gaps") has seldom interrogated the structure of the test. These rarely crossed streams of research leave open the possibility that the FCI may not be structurally valid across…

  18. A Critique of Shostrom's Personal Orientation Inventory

    Science.gov (United States)

    Oakland, James A.; And Others

    1978-01-01

    Everett Shostrom's Personal Orientation Inventory is a significant and widely used contribution to humanistic psychology and personality assessment. W. S. Zimmerman (1969) evaluated the POI and his observations led to the development of a complementary form, the POD (Personal Orientation Dimensions) and to a new test, the DOSAB (Dimensions of…

  19. 27 CFR 19.981 - Inventories.

    Science.gov (United States)

    2010-04-01

    ... fuel alcohol) on bonded premises at least once during each period for which a report is required by... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Inventories. 19.981 Section 19.981 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT...

  20. Gerontological research in the Netherlands: An inventory

    NARCIS (Netherlands)

    Haaijman, J.J.; Borne, H.W. van den

    1978-01-01

    An inventory of the recently concluded, current and planned gerontological research in the Netherlands has been made. About 160 investigators are committed to this kind of research, on which they spend 71 man years. In terms of manpower, the most effort is spent in social gerontology (76

  1. Getting Inside the EQA Inventory: Grade 11.

    Science.gov (United States)

    Russell, Nolan F.

    The Secondary Form of the Educational Quality Assessment (EQA) Inventory is designed for 11th grade students in Commonwealth public schools. Test scales are designed to measure some facet of state quality assessment goals. Along with basic skills, the various instruments examine: (1) social and health habits, (2) feelings toward self and others,…

  2. Getting Inside the EQA Inventory: Grade 8.

    Science.gov (United States)

    Russell, Nolan F.

    Although it is difficult both to determine educational goals and to measure goal attainment, the Educational Quality Assessment Inventory (EQAI) has ambitiously tackled both problems. During a five-year period 45 separate instruments containing over 2000 items were constructed, revised, rejected, and accepted in preparation for the present…

  3. Biomass energy inventory and mapping system

    Energy Technology Data Exchange (ETDEWEB)

    Kasile, J.D. [Ohio State Univ., Columbus, OH (United States)

    1993-12-31

    A four-stage biomass energy inventory and mapping system was conducted for the entire State of Ohio. The product is a set of maps and an inventory of the State of Ohio. The set of amps and an inventory of the State`s energy biomass resource are to a one kilometer grid square basis on the Universal Transverse Mercator (UTM) system. Each square kilometer is identified and mapped showing total British Thermal Unit (BTU) energy availability. Land cover percentages and BTU values are provided for each of nine biomass strata types for each one kilometer grid square. LANDSAT satellite data was used as the primary stratifier. The second stage sampling was the photointerpretation of randomly selected one kilometer grid squares that exactly corresponded to the LANDSAT one kilometer grid square classification orientation. Field sampling comprised the third stage of the energy biomass inventory system and was combined with the fourth stage sample of laboratory biomass energy analysis using a Bomb calorimeter and was then used to assign BTU values to the photointerpretation and to adjust the LANDSAT classification. The sampling error for the whole system was 3.91%.

  4. Aspects concerning the internal audit of inventories

    Directory of Open Access Journals (Sweden)

    Cristina IOVU

    2017-05-01

    In the second section, an analysis of the potential solutions for optimising the costs incurred with the consumptions of inventories from the point of view of the accounting/fiscal regulations, as well as their impact upon the accounting/fiscal results are presented.

  5. AUTOMATION OF INVENTORY PROCESS OF PERSONAL COMPUTERS

    Directory of Open Access Journals (Sweden)

    A. I. Zaharenko

    2013-01-01

    Full Text Available The modern information infrastructure of a large or medium-sized enterprise is inconceivable without an effective system of the computer equipment and fictitious assets inventory. An example of creation of such system which is simple for implementation and has low cost of possession is considered in this article.

  6. Inventory of alloy composition, microstructures and mechanical ...

    African Journals Online (AJOL)

    Inventory of alloy composition, microstructures and mechanical properties of automobile engine parts. ... Journal of Applied Science, Engineering and Technology ... This research work investigated the chemical compositions, microstructures and mechanical properties of the ferrous and non-ferrous auto engine parts such ...

  7. The Social Awareness Inventory: Development and Applications.

    Science.gov (United States)

    Sheldon, Kennon M.

    1996-01-01

    The Social Awareness Inventory (SAI), which assesses individual differences in eight social-perceptual styles, is introduced and applied in three studies. The model is derived by crossing the three binary dimensions of target (self or other), perspective (own or other's), and content (overt appearance or covert experience). The SAI appears to…

  8. Eysenck Personality Inventory Item Factor Structure.

    Science.gov (United States)

    Comrey, Andrew L.; And Others

    1988-01-01

    Three methods were used to test the factor structure of the Eysenck Personality Inventory administered to 583 Australians. The preferred method was to extract factors by the minimum residual method, use the Tandem Criteria Method, and then rotate that number of factors by the Tandem Criteria I method. (SLD)

  9. Pakistan: Preliminary National Greenhouse Gas Inventory | KHAN ...

    African Journals Online (AJOL)

    ... acceding trend in the GHGs emission graph in near future. Inventory also addresses Mitigating options to cut down emissions pace of GHGs, which are not only feasible for country local environment, but based on domestic technology too. Journal of Applied Sciences and Environmental Management Vol. 7(2) 2003: 49-54 ...

  10. Decentralized Procurement in Light of Strategic Inventories

    DEFF Research Database (Denmark)

    Arya, Anil; Frimor, Hans; Mittendorf, Brian

    2014-01-01

    and confirmed to be a multifaceted choice. This paper complements existing studies by detailing the trade-offs in the centralization versus decentralization decision in light of firm's decision to cede procurement choices to its individual devisions can help moderate inventory levels and provide a natural salve...

  11. Computer Science Concept Inventories: Past and Future

    Science.gov (United States)

    Taylor, C.; Zingaro, D.; Porter, L.; Webb, K. C.; Lee, C. B.; Clancy, M.

    2014-01-01

    Concept Inventories (CIs) are assessments designed to measure student learning of core concepts. CIs have become well known for their major impact on pedagogical techniques in other sciences, especially physics. Presently, there are no widely used, validated CIs for computer science. However, considerable groundwork has been performed in the form…

  12. Composition of ending inventory, November 1966

    Energy Technology Data Exchange (ETDEWEB)

    Budd, R.O.

    1966-12-14

    Submitted herewith are source and special nuclear material composition of ending inventory reports for the month of November 1966. The depleted uranium, enriched uranium, plutonium, enriched lithium, U-233, normal uranium, neptunium 237, plutonium 238, deuterium, tritium, and thorium compositions are all broken down.

  13. Annual Forest Inventory: An Industry Perspective

    Science.gov (United States)

    Roger Lord

    2000-01-01

    The Forest Inventory and Analysis Program serves important public interests by providing credible data for informed public forest policy debates as well as feedback to the forest-based economic market. This feedback, which affects timber price expectations, helps ensure resource sustainability by promoting better investment decision making within the forest products...

  14. Ragweed (Ambrosia) pollen source inventory for Austria.

    Science.gov (United States)

    Karrer, G; Skjøth, C A; Šikoparija, B; Smith, M; Berger, U; Essl, F

    2015-08-01

    This study improves the spatial coverage of top-down Ambrosia pollen source inventories for Europe by expanding the methodology to Austria, a country that is challenging in terms of topography and the distribution of ragweed plants. The inventory combines annual ragweed pollen counts from 19 pollen-monitoring stations in Austria (2004-2013), 657 geographical observations of Ambrosia plants, a Digital Elevation Model (DEM), local knowledge of ragweed ecology and CORINE land cover information from the source area. The highest mean annual ragweed pollen concentrations were generally recorded in the East of Austria where the highest densities of possible growth habitats for Ambrosia were situated. Approximately 99% of all observations of Ambrosia populations were below 745m. The European infection level varies from 0.1% at Freistadt in Northern Austria to 12.8% at Rosalia in Eastern Austria. More top-down Ambrosia pollen source inventories are required for other parts of Europe. A method for constructing top-down pollen source inventories for invasive ragweed plants in Austria, a country that is challenging in terms of topography and ragweed distribution. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  15. Virginia, 2011 forest inventory and analysis factsheet

    Science.gov (United States)

    Anita K. Rose

    2013-01-01

    This science update is a brief look at some of the basic metrics that describe the status and trends of forest resources in Virginia. Estimates presented here are for the measurement year 2011. Information for the factsheets is updated by means of the Forest Inventory and Analysis (FIA) annualized sample design. Each year 20 percent of the sample plots (one panel) in...

  16. Arkansas, 2010 forest inventory and analysis factsheet

    Science.gov (United States)

    James F. Rosson

    2011-01-01

    This annual factsheet is a brief look at some of the basic metrics that describe forest resources in Arkansas. Estimates presented here are for the measurement year 2010 with resource changes compared against the 2009 survey year. Factsheet information is updated every year by means of the Forest Inventory and Analysis (FIA) annualized sample design. Arkansas has about...

  17. Virginia, 2009 forest inventory and analysis factsheet

    Science.gov (United States)

    Anita K. Rose

    2011-01-01

    This science update is a brief look at some of the basic metrics that describe forest resources in Virginia. Estimates presented here are for the measurement year 2009. Information for the factsheet is updated by means of the Forest Inventory and Analysis (FIA) annualized sample design. Virginia has about 4,600 sample plots across the State, and each year 20 percent of...

  18. Virginia, 2012 - forest inventory and analysis factsheet

    Science.gov (United States)

    Anita K. Rose

    2014-01-01

    This science update is a brief look at some of the basic metrics that describe the status of and changes in forest resources in Virginia. Estimates presented here are for the measurement year 2012. Information for the factsheets is updated by means of the Forest Inventory and Analysis (FIA) annualized sample design. Each year 20 percent of the sample plots (one panel)...

  19. Virginia, 2010 forest inventory and analysis factsheet

    Science.gov (United States)

    Anita K. Rose

    2012-01-01

    This science update is a brief look at some of the basic metrics that describe the status of forest resources in Virginia. Estimates presented here are for the measurement year 2010. Information for this factsheet is updated by means of the Forest Inventory and Analysis (FIA) annualized sample design. Virginia has about 4,600 sample plots across the State and each year...

  20. Calendar Year 2016 Stationary Source Emissions Inventory

    Energy Technology Data Exchange (ETDEWEB)

    Evelo, Stacie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-01-01

    The City of Albuquerque (COA) Environmental Health Department Air Quality Program has issued stationary source permits and registrations the Department of Energy/Sandia Field Office for operations at the Sandia National Laboratories/New Mexico. This emission inventory report meets the annual reporting compliance requirements for calendar year (CY) 2016 as required by the COA.

  1. A clock reaction based on molybdenum blue.

    Science.gov (United States)

    Neuenschwander, Ulrich; Negron, Arnaldo; Jensen, Klavs F

    2013-05-30

    Clock reactions are rare kinetic phenomena, so far limited mostly to systems with ionic oxoacids and oxoanions in water. We report a new clock reaction in cyclohexanol that forms molybdenum blue from a noncharged, yellow molybdenum complex as precursor, in the presence of hydrogen peroxide. Interestingly, the concomitant color change is reversible, enabling multiple clock cycles to be executed consecutively. The kinetics of the clock reaction were experimentally characterized, and by adding insights from quantum chemical calculations, a plausible reaction mechanism was postulated. Key elementary reaction steps comprise sigmatropic rearrangements with five-membered or bicyclo[3.1.0] transition states. Importantly, numerical kinetic modeling demonstrated the mechanism's ability to reproduce the experimental findings. It also revealed that clock behavior is intimately connected to the sudden exhaustion of hydrogen peroxide. Due to the stoichiometric coproduction of ketone, the reaction bears potential for application in alcohol oxidation catalysis.

  2. Blue Marble: Remote Characterization of Habitable Planets

    Science.gov (United States)

    Woolf, Neville; Lewis, Brian; Chartres, James; Genova, Anthony

    2009-01-01

    The study of the nature and distribution of habitable environments beyond the Solar System is a key area for Astrobiology research. At the present time, our Earth is the only habitable planet that can be characterized in the same way that we might characterize planets beyond the Solar System. Due to limitations in our current and near-future technology, it is likely that extra-solar planets will be observed as single-pixel objects. To understand this data, we must develop skills in analyzing and interpreting the radiation obtained from a single pixel. These skills must include the study of the time variation of the radiation, and the range of its photometric, spectroscopic and polarimetric properties. In addition, to understand whether we are properly analyzing the single pixel data, we need to compare it with a ground truth of modest resolution images in key spectral bands. This paper discusses the concept for a mission called Blue Marble that would obtain data of the Earth using a combination of spectropolarimetry, spectrophotometry, and selected band imaging. To obtain imagery of the proper resolution, it is desirable to place the Blue Marble spacecraft no closer than the outer region of cis-lunar space. This paper explores a conceptual mission design that takes advantage of low-cost launchers, bus designs and mission elements to provide a cost effective observing platform located at one of the stable Earth-moon Lagrangian points (L4, L5). The mission design allows for the development and use of novel technologies, such as a spinning moon sensor for attitude control, and leverages lessons-learned from previous low-cost spacecraft such as Lunar Prospector to yield a low-risk mission concept.

  3. French contribution to develop Prussian blue.

    Science.gov (United States)

    Besse Bardot, Isabelle; Bardot, Sebastien; Menetrier, Florence; Leiterer, Alexandra; Pech, Annick

    2014-11-01

    Prussian blue is an antidote indicated for the treatment of internal cesium radioisotope contamination. The French armed forces develop and manufacture some antidotal drugs meeting regulatory, analytical and pharmaceutical requirements in order to submit marketing authorization documentation. Prior to an initial meeting with the French National Agency for Medicines and Health Products Safety (ANSM) in 2011, the authors were following regulatory developments in free cyanide release, active pharmaceutical ingredient (API) synthesis, API specifications, ability of cesium/Prussian blue binding products and collection of pre-clinical data. Free cyanide release was assessed by ultraviolet-visible (UV-Vis) spectrometry at 615 nm. The kinetics of cesium were evaluated in vitro by flame atomic absorption. Good laboratory practice (GLP) and mutagenic assays were examined in rat studies to assess 'no absorption'. A validated method makes it possible to assess the free cyanide in API according to the published tolerability in humans. The French synthesizer meets good manufacturing practice (GMP) to give a drug that is compliant with all specifications, ensuring its high quality. Two standard mutagenic assays showed mutagenic potential, leading to further tests to obtain more information on any induced chromosomal aberrations. Absorption could be an important factor in determining the risk posed by the drug. The French health service provides the country with several antidotal drugs reducing Chemical, Biological, Radiological and Nuclear (CBRN) risks. Using their GMP manufacturing facilities and pharmaceutical expertise, the French armed forces have contributed to developing drugs with marketing authorization, such as pentetate calcium trisodium (Ca-DTPA) for infusion, or under development with the French Alternative Energies and Atomic Energy Commission (CEA), such as Ca-DTPA by inhalation.

  4. Inventory of Library Collections: Introductory Overview

    Directory of Open Access Journals (Sweden)

    Marijana Abe

    2015-03-01

    Full Text Available IzvlečekV članku je prikazan pomen inventure knjižničnega gradiva v knjižnicah. Navedeni so razlogiza izvajanje inventure. Obdelane so metode in vrste inventure ter opisana navodila za izvajanjeinventure. Posebno pozornost članek namenja izvajanju inventure s pomočjo tehnologije RFID.Število člankov, ki obravnavajo tehnologijo RFID, se je z nekaj deset na začetku leta 1990 do leta 2005 povzpelo na skoraj 9000. Pri pregledu literature je zaslediti, da je bilo o sami tehnologiji RFID napisanega veliko, toda empiričnih raziskav, narejenih o samem vrednotenju RFID oziroma izvajanju inventure s pomočjo črtnih kod, je zelo malo. V članku so predstavljene nekatere raziskave,ki so bile objavljene v zvezi z avtomatizirano inventuro knjižničnega gradiva.AbstractThe article shows the importance of collection inventory in a library. The reasons for conducting an inventory, the review of methods and types of an inventory are given. Instructions for conducting an inventory with special emphasis on the RFID technology are described. A lot has been written about RFID so far but there is only a small number of empirical studies of the evaluation of RFID and barcode technology. The number of articles dealing with RFID technology, from the early 1990s to 2005, increased from almost none to almost 9,000. Some published studies on automated inventory of library collection are presented.

  5. Yellow taxis have fewer accidents than blue taxis because yellow is more visible than blue.

    Science.gov (United States)

    Ho, Teck-Hua; Chong, Juin Kuan; Xia, Xiaoyu

    2017-03-21

    Is there a link between the color of a taxi and how many accidents it has? An analysis of 36 mo of detailed taxi, driver, and accident data (comprising millions of data points) from the largest taxi company in Singapore suggests that there is an explicit link. Yellow taxis had 6.1 fewer accidents per 1,000 taxis per month than blue taxis, a 9% reduction in accident probability. We rule out driver difference as an explanatory variable and empirically show that because yellow taxis are more noticeable than blue taxis-especially when in front of another vehicle, and in street lighting-other drivers can better avoid hitting them, directly reducing the accident rate. This finding can play a significant role when choosing colors for public transportation and may save lives as well as millions of dollars.

  6. A model for aperiodicity in earthquakes

    Directory of Open Access Journals (Sweden)

    B. Erickson

    2008-01-01

    Full Text Available Conditions under which a single oscillator model coupled with Dieterich-Ruina's rate and state dependent friction exhibits chaotic dynamics is studied. Properties of spring-block models are discussed. The parameter values of the system are explored and the corresponding numerical solutions presented. Bifurcation analysis is performed to determine the bifurcations and stability of stationary solutions and we find that the system undergoes a Hopf bifurcation to a periodic orbit. This periodic orbit then undergoes a period doubling cascade into a strange attractor, recognized as broadband noise in the power spectrum. The implications for earthquakes are discussed.

  7. Renormalization transformation of periodic and aperiodic lattices

    International Nuclear Information System (INIS)

    Macia, Enrique; Rodriguez-Oliveros, Rogelio

    2006-01-01

    In this work we introduce a similarity transformation acting on transfer matrices describing the propagation of elementary excitations through either periodic or Fibonacci lattices. The proposed transformation can act at two different scale lengths. At the atomic scale the transformation allows one to express the systems' global transfer matrix in terms of an equivalent on-site model one. Correlation effects among different hopping terms are described by a series of local phase factors in that case. When acting on larger scale lengths, corresponding to short segments of the original lattice, the similarity transformation can be properly regarded as describing an effective renormalization of the chain. The nature of the resulting renormalized lattice significantly depends on the kind of order (i.e., periodic or quasiperiodic) of the original lattice, expressing a delicate balance between chemical complexity and topological order as a consequence of the renormalization process

  8. No effect of blue on winning contests in judo

    NARCIS (Netherlands)

    Dijkstra, Peter D.; Preenen, Paul T. Y.

    2008-01-01

    A study by Rowe et al. reported a winning bias for judo athletes wearing a blue outfit relative to those wearing a white one during the 2004 Olympics. It was suggested that blue is associated with a higher likelihood of winning through differential effects of colour on opponent visibility and/or an

  9. Isolation and Characterization of Blue Green Algae from Egyptian ...

    African Journals Online (AJOL)

    meldemellawy

    2014-02-20

    Feb 20, 2014 ... aminotransferase (AMT) domains of the mycE and ndaF genes (Jungblut et al., 2006) allowing detection of microcystin and nodularin-producing cyanobacteria. MATERIALS AND METHODS. Isolation and cultivation of blue green algae. Blue green algae had been isolated from soil of Rice field in river.

  10. Designing green and blue infrastructure to support healthy urban living

    NARCIS (Netherlands)

    Gehrels, H.; Meulen, van der Suzanne; Schasfoort, F.; Bosch, Peter; Brolsma, R.; Dinther, van D.; Geerling, G.J.; Goossens, M.; Jacobs, C.M.J.; jong, de Merijn; Kok, Sien; Massop, H.T.L.

    2016-01-01

    This report focuses on developing concepts and design principles for blue and green infrastructure that not only support climate resilience but also contribute to a healthy and liveable urban environment. We will first assess the effectiveness of blue and green infrastructure on the basis of

  11. Effects of fire and browsing on regeneration of blue oak

    Science.gov (United States)

    James W. Bartolome; Mitchel P. McClaran; Barbara H. Allen-Diaz; Jim Dunne; Lawrence D. Ford; Richard B. Standiford; Neil K. McDougald; Larry C. Forero

    2002-01-01

    Blue oaks (Quercus douglasii) are not regenerating well over much of California. The roles of fire and browsing in regeneration are probably significant, but poorly understood. We burned two foothill blue oak woodland sites which contained significant numbers of small trees between 40 and 70 cm tall, then compared height growth over 14 years among 48...

  12. QCD on the BlueGene/L Supercomputer

    Science.gov (United States)

    Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

    2005-03-01

    In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented.

  13. QCD on the BlueGene/L Supercomputer

    International Nuclear Information System (INIS)

    Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

    2005-01-01

    In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented

  14. Blue superradiance from neat semiconducting alternating copolymer films

    NARCIS (Netherlands)

    Brouwer, H.J; Krasnikov, V.V.; Hilberer, A; Hadziioannou, G

    1996-01-01

    Blue superradiant emission in thin polymer films with a low energy threshold, as reported here, offers hope for the possible development of solid-state electrically pumped polymer lasers The absorbance, emission, and fluorescence spectra of the blue-light emitting copolymer

  15. Trypan Blue Dye In Extra-Capsular Cataract Surgery: Initial ...

    African Journals Online (AJOL)

    The two groups had incidence of striate keratitis, anterior capsule remnants, unplanned anterior chamber (A/C) lens implants and average increase in surgery time compared. The trypan blue group had better results than the non-trypan group. The trypan blue group had an incidence of 40.7% striate keratitis as against ...

  16. POSTPARTUM BLUES PADA PERSALINAN DIBAWAH USIA DUA PULUH TAHUN

    Directory of Open Access Journals (Sweden)

    Kurniasari Pratiwi

    2017-05-01

    Full Text Available Postpartum blues or baby blues is a feeling of sadness experienced by mothers after childbirth related to the baby. Postpartum blues is like an iceberg that is difficult to detect because there are still many people who do not understand about the event. Nevertheless, postpartum blues not being handled properly is one of the factors precipitating the occurrence of postpartum depression,  can be fatal for mother and baby. Postpartum blues more common in women who marry in their early age. Indonesia has high percentage of early age marriage in the world (ranked 37 and is the second highest in ASEAN after Cambodia. Based on data, there was increasing number of woman cases delivering labor and having children in the village Panggungharjo Sewon Bantul from year 2013 to 2015. Research objectives are to determine the postpartum blues in labor under the age of 20 years. This study is a descriptive study with retrospective design. The study population consists of women who gave birth  under the age of 20 years in the village of Panggungharjo, Sewon, Bantul using total sampling (33 subjects. The result showed that 45.5% of respondents who experienced postpartum blues and 54.5% did not experience postpartum blues.

  17. nonlinear kinetics and mechanism of nile blue reaction

    African Journals Online (AJOL)

    Prof. S.B. Jonnalagadda

    A 11-step mechanism, consistent with the overall reaction dynamics and supported by simulations, is ... been designed based on the chemistry of BZ reactions, the role of bromide ion under various concentration ... dynamics of nile blue - acidic bromate reaction arises from the extremely slow depletion rate of nile blue in the ...

  18. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  19. Blue Genes : Sharing and Conserving the World's Aquatic Biodiversity

    International Development Research Centre (IDRC) Digital Library (Canada)

    Blue Genes : Sharing and Conserving the World's Aquatic Biodiversity. Couverture du livre Blue Genes: Sharing and Conserving the World's Aquatic Biodiversity. Auteur(s) : David Greer et Brian Harvey. Maison(s) d'édition : Earthscan, CRDI. 31 août 2004. ISBN : 1844071065. 246 pages. e-ISBN : 1552501574.

  20. Soluble or insoluble prussian blue for radiocesium and thallium poisoning?

    Science.gov (United States)

    Thompson, Dennis F; Callen, Erin D

    2004-09-01

    To review the available English-language literature concerning the efficacy of soluble and insoluble Prussian blue used as a therapeutic agent in radiocesium and thallium poisoning. A thorough search of MEDLINE, Toxline, and EMBASE databases (1960s-August 2003) was performed. Search terms included Prussian blue, thallium, and radiocesium poisoning. Bibliographies of relevant papers were reviewed for additional citations. study selection AND DATA EXTRACTION: Reports and studies of human trials and cases, along with animal and relevant in vitro data, were sought. Data were categorized as insoluble and soluble Prussian blue and by thallium and radiocesium poisoning. The majority of evidence describing the efficacy of Prussian blue for radiocesium poisoning is based on the use of the insoluble form. In contrast, the majority of data supporting the efficacy of Prussian blue in thallium poisoning involves the use of the soluble form. Insoluble Prussian blue has recently been approved in the US for treatment of both thallium and radiocesium poisoning. While there is sufficient evidence that the insoluble form of Prussian blue is effective in radiocesium poisoning, there is a paucity of analogous data supporting its use in thallium poisoning. Whether the physicochemical differences between soluble and insoluble Prussian blue have any effect on outcomes in human poisoning is not known.

  1. Fluctuating and Directional Asymmetry of the Blue Mussel (

    NARCIS (Netherlands)

    Lajus, D.; Katolikova, M.; Strelkov, P.; Hummel, H.

    2015-01-01

    In this work we examined morphological variation at different levels to study performance and population structuring of the blue mussel Mytilus edulis. Our objectives were: (i) to develop an integrated technique for analyzing morphological variation in blue mussels and, based on this technique; (ii)

  2. Blue whales Balaenoptera musculus off Angola: recent sightings ...

    African Journals Online (AJOL)

    The population of blue whales Balaenoptera musculus inhabiting the South-East Atlantic (Gabon to South Africa) was heavily depleted by commercial whaling. We report four photographically-verified sightings, and one probable sighting, of blue whales in deep waters (>1 000 m) off central Angola (11° S to 12°30′S) ...

  3. Protonation of Patented Blue V in aqueous solutions: theoretical and ...

    Indian Academy of Sciences (India)

    The acid-base properties of the Patented Blue V dye were studied by spectrophotometry and tristimulus colourimetry. The mechanism of protonation of Patented Blue V has been investigated with semiempirical and DFT methods.The quantum chemical calculations of total energy defined the most stable isomer foreach ...

  4. Current distribution and population size of the Blue Swallow Hirundo ...

    African Journals Online (AJOL)

    Two surveys of Blue Swallows were conducted in the southern Tanzanian highland grasslands in order to determine the habitat preferences and estimate the size of this subpopulation. During the 2008/09 and 2012 surveys, a total distance of 3 635 km was travelled in search of Blue Swallows (at an altitude of above 1 400 ...

  5. OBSTACLES TO BLUE-COLLAR PARTICIPATION IN ADULT EDUCATION.

    Science.gov (United States)

    LONDON, JACK; WENKERT, ROBERT

    WITH THE INCREASING LEISURE TIME OF BLUE-COLLAR WORKERS, CONCERN IS GROWING OVER THEIR LOW PARTICIPATION IN ADULT EDUCATION PROGRAMS. MYTHS ABOUT BLUE-COLLAR WORKERS WHICH STAND IN THEIR WAY INCLUDE--LOWER CLASS APATHY, INCAPABILITY OF SUSTAINED INTELLECTUAL EFFORT, AND LACK OF APPRECIATION OF THE VALUE OF EDUCATION. OBSTACLES INHERING IN SOCIAL…

  6. Conservation priorities for the Blue Crane (Anthropoides paradiseus ...

    African Journals Online (AJOL)

    Detailed knowledge on population numbers, habitat preferences and threats is lacking for the Blue Crane (Anthropoides paradiseus), which is endemic to southern Africa and is South Africa's national bird. Using the South African Bird Atlas Project Blue Crane distribution as the accepted distribution of the species, this ...

  7. Blue whales Balaenoptera musculus in offshore waters of Kenya ...

    African Journals Online (AJOL)

    Observations of blue whales were made in Kenyan offshore waters during a seismic survey from September 2014 to January 2015. These represent the first live at-sea sightings of blue whales reported from Kenyan waters. All 30 sightings occurred between September and October in waters ranging from 2 990 to 4 705 m ...

  8. Blue Oak Canopy Effect on Seasonal Forage Production and Quality

    Science.gov (United States)

    William E. Frost; Neil K. McDougald; Montague W. Demment

    1991-01-01

    Forage production and forage quality were measured seasonally beneath the canopy of blue oak (Quercus douglasii) and in open grassland at the San Joaquin Experimental Range. At the March and peak standing crop sampling dates forage production was significantly greater (p=.05) beneath blue oak compared to open grassland. At most sampling dates, the...

  9. The Implementation of Vendor Managed Inventory In the Supply Chain with Simple Probabilistic Inventory Model

    Directory of Open Access Journals (Sweden)

    Anna Ika Deefi

    2016-01-01

    Full Text Available Numerous studies show that the implementation of Vendor Managed Inventory (VMI benefits all members of the supply chain. This research develops model to prove the benefits obtained from implementing VMI to supplier-buyer partnership analytically. The model considers a two-level supply chain which consists of a single supplier and a single buyer. The analytical model is developed to supply chain inventory with probabilistic demand which follows normal distribution. The model also incorporates lead time as a decision variable and investigates the impacts of inventory management before and after the implementation of the VMI. The result shows that the analytical model has the ability to reduce the supply chain expected cost, improve the service level and increase the inventory replenishment. Numerical examples are given to prove them.

  10. BLUE OCEAN STRATEGY (BOS SEBAGAI PARADIGMA BARU MANAJEMEN PENDIDIKAN ISLAM

    Directory of Open Access Journals (Sweden)

    Ikhwan Fuad

    2016-08-01

    Full Text Available The focus of this article is to describe the Blue Ocean Strategy as a new paradigm of Islamic education management. the author seeks to elaborate on how the adoption of the Blue Ocean strategy of the business world to the world of education and answered the principles of what is accepted and rejected away from the theory. Adoption of blue ocean strategy is done by applying the universal principles are : among others reconstruct market boundaries, focus on the big picture rather than numbers, reach beyond existing demand, perform a series of strategies with appropriate, efforts to overcome organizational constraints and integrate execution into strategy. The principles of Blue Ocean Strategy Indicators that can be absorbed is an indicator that focuses gave excellent service and were not absorbed is a strong indicator of economic motivation. Generally, Blue Ocean Strategy quite well applied as a management paradigm of Islamic education.

  11. A Rare Case of Multifocal Prostatic Blue Nevus

    Directory of Open Access Journals (Sweden)

    Elias J. Farran

    2018-01-01

    Full Text Available Prostatic blue nevus is a rare benign pathologic diagnosis most commonly diagnosed incidentally on many different types of prostate specimens. Blue nevus is the deposition of stromal melanin characterized by spindle cells within the fibromuscular stroma which stains positive for melanin-specific stains Fontana-Masson and S100 and stains negative for CD68, HMB45, and iron stains. We report the case of a multifocal and bilateral blue nevus in a 52-year-old Hispanic male who presented with an elevated prostate-specific antigen of 4.3 and mild obstructive lower urinary tract symptoms, found by transrectal ultrasound-guided prostate needle biopsy. The biopsy also revealed benign prostatic tissue with postatrophic hyperplasia and chronic inflammation. This is the 35th reported case of prostatic blue nevus and the third to show multifocal blue nevus.

  12. Methylene blue promotes quiescence of rat neural progenitor cells

    Directory of Open Access Journals (Sweden)

    LUOKUN eXIE

    2014-10-01

    Full Text Available Neural stem cell-based treatment holds a new therapeutic opportunity for neurodegenerative disorders. Here, we investigated the effect of methylene blue on proliferation and differentiation of rat neural progenitor cells (NPCs both in vitro and in vivo. We found that methylene blue inhibited proliferation and promoted quiescence of NPCs in vitro without affecting committed neuronal differentiation. Consistently, intracerebroventricular infusion of methylene blue significantly inhibited neural progenitor cell proliferation at the subventricular zone (SVZ. Methylene blue inhibited mTOR signaling along with down-regulation of cyclins in NPCs in vitro and in vivo. In summary, our study indicates that methylene blue may delay NPC senescence through enhancing NPCs quiescence.

  13. Growth stimulation produced by methylene blue treatment in sweet potato

    International Nuclear Information System (INIS)

    Lage, C.L.S.; Esquibel, M.A.

    1997-01-01

    Methylene blue as an alternative treatment to gamma rays to stimulate growth in sweet potato tissue cultures, was applied in two different ways: – pre-incubation of nodal explants with methylene blue for 1 h using urea as a permeabilizer; – methylene blue directly incorporated into the culture medium. Both treatments stimulated growth, but the better performance being obtained with the second treatment, which had no toxic effect. The activity and electrophoresis pattern of peroxidase after treatment of Ipomoea batatas plantlets with methylene blue or gamma rays did not show similar results for the two treatments. Peroxidase activity was greater in leaves of gamma ray treated plants compared to the non-treated control. The results obtained with the Methylene blue treatment did not significantly change the peroxidase activity relative to the control. (author)

  14. A national range inventory for the Kingdom of Lesotho. | Martin ...

    African Journals Online (AJOL)

    Keywords: classification; Colour aerial photography; Ecological sites; ecology; inventory; lesotho; management; management plan; mapping; National range inventories; photo interpretation; photography; plant communities; Plant community relationships; range; range management; rangeland; rangelands; remote sensing; ...

  15. Study of Intelligent Secure Chemical Inventory Management System

    Science.gov (United States)

    Shukran, Mohd Afizi Mohd; Naim Abdullah, Muhammad; Nazri Ismail, Mohd; Maskat, Kamaruzaman; Isa, Mohd Rizal Mohd; Shahfee Ishak, Muhammad; Adib Khairuddin, Muhamad

    2017-08-01

    Chemical inventory management system has been experiencing a new revolution from traditional inventory system which is manual to an automated inventory management system. In this paper, some review of the classic and modern approaches to chemical inventory management system has been discussed. This paper also describe about both type of inventory management. After a comparative analysis of the traditional method and automated method, it can be said that both methods have some distinctive characteristics. Moreover, the automated inventory management method has higher accuracy of calculation because the calculations are handled by software, eliminating possible errors and saving time. The automated inventory system also allows users and administrators to track the availability, location and consumption of chemicals. The study of this paper can provide forceful review analysis support for the chemical inventory management related research.

  16. Designing Intelligent Secure Android Application for Effective Chemical Inventory

    Science.gov (United States)

    Shukran, Mohd Afizi Mohd; Naim Abdullah, Muhammad; Nazri Ismail, Mohd; Maskat, Kamaruzaman; Isa, Mohd Rizal Mohd; Shahfee Ishak, Muhammad; Adib Khairuddin, Muhamad

    2017-08-01

    Mobile services support various situations in everyday life and with the increasing sophistication of phone functions, the daily life is much more easier and better especially in term of managing tools and apparatus. Since chemical inventory management system has been experiencing a new revolution from antiquated to an automated inventory management system, some additional features should be added in current chemical inventory system. Parallel with the modern technologies, chemical inventory application using smart phone has been developed. Several studies about current related chemical inventory management using smart phone application has been done in this paper in order to obtain an overview on recent studies in smartphone application for chemical inventory system which are needed in schools, universities or other education institutions. This paper also discuss about designing the proposed secure mobile chemical inventory system. The study of this paper can provide forceful review analysis support for the chemical inventory management system related research.

  17. Inventory Accuracy at the Defense Depot, Columbus, Ohio

    National Research Council Canada - National Science Library

    Lane, F

    1997-01-01

    We identified issues on the accuracy of inventory reporting for materiel stored at the Defense Depot, Columbus, Ohio during our overall audit of the inventory accounts in the FY 1996 Defense Business...

  18. Proceedings of the sixth annual forest inventory and analysis symposium

    Science.gov (United States)

    Ronald E. McRoberts; Gregory A. Reams; Paul C. Van Duesen; William H., eds. McWilliams

    2006-01-01

    Documents contributions to forest inventory in the area of sampling, remote sensing, modeling, information management, and analysis for the Forest Inventory and Analysis program of the USDA Forest Service.

  19. 78 FR 47273 - Information Collection; Inventory Property Management

    Science.gov (United States)

    2013-08-05

    ... collection that supports Inventory Property Management. The information is used to evaluate applicant... DEPARTMENT OF AGRICULTURE Farm Service Agency Information Collection; Inventory Property Management AGENCY: Farm Service Agency, USDA. ACTION: Notice; request for comments. SUMMARY: In accordance...

  20. 75 FR 23218 - Information Collection; Inventory Property Management

    Science.gov (United States)

    2010-05-03

    ... supports Inventory Property Management. The information is used to evaluate applicant requests to purchase... Affairs, Office of Management and Budget, Washington, DC 20503. Copies of the information collection may... DEPARTMENT OF AGRICULTURE Farm Service Agency Information Collection; Inventory Property...