WorldWideScience

Sample records for introns

  1. Group I intron ribozymes

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2012-01-01

    Group I intron ribozymes constitute one of the main classes of ribozymes and have been a particularly important model in the discovery of key concepts in RNA biology as well as in the development of new methods. Compared to other ribozyme classes, group I intron ribozymes display considerable...... variation both in their structure and the reactions they catalyze. The best described pathway is the splicing pathway that results in a spliced out intron and ligated exons. This is paralleled by the circularization pathway that leads to full-length circular intron and un-ligated exons. In addition......, the intronic products of these pathways have the potential to integrate into targets and to form various types of circular RNA molecules. Thus, group I intron ribozymes and associated elements found within group I introns is a rich source of biological phenomena. This chapter provides a strategy and protocols...

  2. Origin of introns by 'intronization' of exonic sequences

    DEFF Research Database (Denmark)

    Irimia, Manuel; Rukov, Jakob Lewin; Penny, David

    2008-01-01

    The mechanisms of spliceosomal intron creation have proved elusive. Here we describe a new mechanism: the recruitment of internal exonic sequences ('intronization') in Caenorhabditis species. The numbers of intronization events and introns gained by other mechanisms are similar, suggesting that i...

  3. Intronic variation at the

    NARCIS (Netherlands)

    Trimbos, K.B.; Kentie, R.; van der Velde, M.; Hooijmeijer, J.C.E.W.; Poley, C.; Musters, C.J.M.; de Snoo, G.R.; Piersma, T.

    2013-01-01

    Recently, Schroeder etal. (2010, Ibis 152: 368-377) suggested that intronic variation in the CHD1-Z gene of Black-tailed Godwits breeding in southwest Friesland, The Netherlands, correlated with fitness components. Here we re-examine this surprising result using an expanded dataset (2088 birds

  4. Emergence and loss of spliceosomal twin introns

    OpenAIRE

    Flipphi, Michel; Ág, Norbert; Karaffa, Levente; Kavalecz, Napsugár; Cerqueira, Gustavo; Scazzocchio, Claudio; Fekete, Erzsébet

    2017-01-01

    Background In the primary transcript of nuclear genes, coding sequences—exons—usually alternate with non-coding sequences—introns. In the evolution of spliceosomal intron–exon structure, extant intron positions can be abandoned and new intron positions can be occupied. Spliceosomal twin introns (“stwintrons”) are unconventional intervening sequences where a standard “internal” intron interrupts a canonical splicing motif of a second, “external” intron. The availability of genome sequences of ...

  5. YIDB: the Yeast Intron DataBase

    OpenAIRE

    Lopez, Pascal J.; Séraphin, Bertrand

    2000-01-01

    The Yeast Intron DataBase (YIDB) contains currently available information about all introns encoded in the nuclear and mitochondrial genomes of the yeast Saccharomyces cerevisiae. Introns are divided according to their mechanism of excision: group I and group II introns, pre-mRNA introns, tRNA introns and the HAC1 intron. Information about the host genome, the type of RNA in which they are inserted and their primary structure are provided together with references. For nuclear pre-mRNA introns...

  6. Identification of a family of group II introns encoding LAGLIDADG ORFs typical of group I introns.

    OpenAIRE

    Toor, Navtej; Zimmerly, Steven

    2002-01-01

    Group I and group II introns are unrelated classes of introns that each encode proteins that facilitate intron splicing and intron mobility. Here we describe a new subfamily of nine introns in fungi that are group II introns but encode LAGLIDADG ORFs typical of group I introns. The introns have fairly standard group IIB1 RNA structures and are inserted into three different sites in SSU and LSU rRNA genes. Therefore, introns should not be assumed to be group I introns based solely on the prese...

  7. The Biology of Intron Gain and Loss

    DEFF Research Database (Denmark)

    Jeffares, Daniel C; Mourier, Tobias; Penny, David

    2006-01-01

    eukaryote genomes during their evolution from an intron-poor ancestor. However, recent studies have shown that some eukaryotes lost many introns, whereas others accumulated and/or gained many introns. In this article, we discuss the growing evidence that these differences are subject to selection acting...... on introns depending on the biology of the organism and the gene involved....

  8. Intronic Alus influence alternative splicing.

    Directory of Open Access Journals (Sweden)

    Galit Lev-Maor

    2008-09-01

    Full Text Available Examination of the human transcriptome reveals higher levels of RNA editing than in any other organism tested to date. This is indicative of extensive double-stranded RNA (dsRNA formation within the human transcriptome. Most of the editing sites are located in the primate-specific retrotransposed element called Alu. A large fraction of Alus are found in intronic sequences, implying extensive Alu-Alu dsRNA formation in mRNA precursors. Yet, the effect of these intronic Alus on splicing of the flanking exons is largely unknown. Here, we show that more Alus flank alternatively spliced exons than constitutively spliced ones; this is especially notable for those exons that have changed their mode of splicing from constitutive to alternative during human evolution. This implies that Alu insertions may change the mode of splicing of the flanking exons. Indeed, we demonstrate experimentally that two Alu elements that were inserted into an intron in opposite orientation undergo base-pairing, as evident by RNA editing, and affect the splicing patterns of a downstream exon, shifting it from constitutive to alternative. Our results indicate the importance of intronic Alus in influencing the splicing of flanking exons, further emphasizing the role of Alus in shaping of the human transcriptome.

  9. Origin and evolution of spliceosomal introns

    Directory of Open Access Journals (Sweden)

    Rogozin Igor B

    2012-04-01

    Full Text Available Abstract Evolution of exon-intron structure of eukaryotic genes has been a matter of long-standing, intensive debate. The introns-early concept, later rebranded ‘introns first’ held that protein-coding genes were interrupted by numerous introns even at the earliest stages of life's evolution and that introns played a major role in the origin of proteins by facilitating recombination of sequences coding for small protein/peptide modules. The introns-late concept held that introns emerged only in eukaryotes and new introns have been accumulating continuously throughout eukaryotic evolution. Analysis of orthologous genes from completely sequenced eukaryotic genomes revealed numerous shared intron positions in orthologous genes from animals and plants and even between animals, plants and protists, suggesting that many ancestral introns have persisted since the last eukaryotic common ancestor (LECA. Reconstructions of intron gain and loss using the growing collection of genomes of diverse eukaryotes and increasingly advanced probabilistic models convincingly show that the LECA and the ancestors of each eukaryotic supergroup had intron-rich genes, with intron densities comparable to those in the most intron-rich modern genomes such as those of vertebrates. The subsequent evolution in most lineages of eukaryotes involved primarily loss of introns, with only a few episodes of substantial intron gain that might have accompanied major evolutionary innovations such as the origin of metazoa. The original invasion of self-splicing Group II introns, presumably originating from the mitochondrial endosymbiont, into the genome of the emerging eukaryote might have been a key factor of eukaryogenesis that in particular triggered the origin of endomembranes and the nucleus. Conversely, splicing errors gave rise to alternative splicing, a major contribution to the biological complexity of multicellular eukaryotes. There is no indication that any prokaryote has

  10. Database for mobile group II introns

    OpenAIRE

    Dai, Lixin; Toor, Navtej; Olson, Robert; Keeping, Andrew; Zimmerly, Steven

    2003-01-01

    Group II introns are self-splicing RNAs and retroelements found in bacteria and lower eukaryotic organelles. During the past several years, they have been uncovered in surprising numbers in bacteria due to the genome sequencing projects; however, most of the newly sequenced introns are not correctly identified. We have initiated an ongoing web site database for mobile group II introns in order to provide correct information on the introns, particularly in bacteria. Information in the web site...

  11. Emergence and loss of spliceosomal twin introns.

    Science.gov (United States)

    Flipphi, Michel; Ág, Norbert; Karaffa, Levente; Kavalecz, Napsugár; Cerqueira, Gustavo; Scazzocchio, Claudio; Fekete, Erzsébet

    2017-01-01

    In the primary transcript of nuclear genes, coding sequences-exons-usually alternate with non-coding sequences-introns. In the evolution of spliceosomal intron-exon structure, extant intron positions can be abandoned and new intron positions can be occupied. Spliceosomal twin introns ("stwintrons") are unconventional intervening sequences where a standard "internal" intron interrupts a canonical splicing motif of a second, "external" intron. The availability of genome sequences of more than a thousand species of fungi provides a unique opportunity to study spliceosomal intron evolution throughout a whole kingdom by means of molecular phylogenetics. A new stwintron was encountered in Aspergillus nidulans and Aspergillus niger . It is present across three classes of Leotiomyceta in the transcript of a well-conserved gene encoding a putative lipase ( lipS ). It occupies the same position as a standard intron in the orthologue gene in species of the early divergent classes of the Pezizomycetes and the Orbiliomycetes, suggesting that an internal intron has appeared within a pre-extant intron. On the other hand, the stwintron has been lost from certain taxa in Leotiomycetes and Eurotiomycetes at several occasions, most likely by a mechanism involving reverse transcription and homologous recombination. Another ancient stwintron present across whole Pezizomycotina orders-in the transcript of the bifunctional biotin biosynthesis gene bioDA -occurs at the same position as a standard intron in many species of non-Dikarya. Nevertheless, also the bioDA stwintron has disappeared from certain lineages within the taxa where it occurs, i.e., Sordariomycetes and Botryosphaeriales. Intriguingly, only the internal intron was lost from the Sordariomycetes bioDA stwintron at all but one occasion, leaving a standard intron in the same position, while where the putative lipase stwintron was lost, no intronic sequences remain. Molecular phylogeny of the peptide product was used to monitor

  12. Reenacting the birth of an intron

    Energy Technology Data Exchange (ETDEWEB)

    Hellsten, Uffe; Aspden, Julie L.; Rio, Donald C.; Rokhsar, Daniel S.

    2011-07-01

    An intron is an extended genomic feature whose function requires multiple constrained positions - donor and acceptor splice sites, a branch point, a polypyrimidine tract and suitable splicing enhancers - that may be distributed over hundreds or thousands of nucleotides. New introns are therefore unlikely to emerge by incremental accumulation of functional sub-elements. Here we demonstrate that a functional intron can be created de novo in a single step by a segmental genomic duplication. This experiment recapitulates in vivo the birth of an intron that arose in the ancestral jawed vertebrate lineage nearly half a billion years ago.

  13. The origin of introns and their role in eukaryogenesis: a compromise solution to the introns-early versus introns-late debate?

    Directory of Open Access Journals (Sweden)

    Koonin Eugene V

    2006-08-01

    Full Text Available Abstract Background Ever since the discovery of 'genes in pieces' and mRNA splicing in eukaryotes, origin and evolution of spliceosomal introns have been considered within the conceptual framework of the 'introns early' versus 'introns late' debate. The 'introns early' hypothesis, which is closely linked to the so-called exon theory of gene evolution, posits that protein-coding genes were interrupted by numerous introns even at the earliest stages of life's evolution and that introns played a major role in the origin of proteins by facilitating recombination of sequences coding for small protein/peptide modules. Under this scenario, the absence of spliceosomal introns in prokaryotes is considered to be a result of "genome streamlining". The 'introns late' hypothesis counters that spliceosomal introns emerged only in eukaryotes, and moreover, have been inserted into protein-coding genes continuously throughout the evolution of eukaryotes. Beyond the formal dilemma, the more substantial side of this debate has to do with possible roles of introns in the evolution of eukaryotes. Results I argue that several lines of evidence now suggest a coherent solution to the introns-early versus introns-late debate, and the emerging picture of intron evolution integrates aspects of both views although, formally, there seems to be no support for the original version of introns-early. Firstly, there is growing evidence that spliceosomal introns evolved from group II self-splicing introns which are present, usually, in small numbers, in many bacteria, and probably, moved into the evolving eukaryotic genome from the α-proteobacterial progenitor of the mitochondria. Secondly, the concept of a primordial pool of 'virus-like' genetic elements implies that self-splicing introns are among the most ancient genetic entities. Thirdly, reconstructions of the ancestral state of eukaryotic genes suggest that the last common ancestor of extant eukaryotes had an intron

  14. FGLamide Allatostatin genes in Arthropoda: introns early or late?

    Science.gov (United States)

    Martínez-Pérez, Francisco; Bendena, William G; Chang, Belinda S W; Tobe, Stephen S

    2009-07-01

    FGLamide allatostatins are invertebrate neuropeptides which inhibit juvenile hormone biosynthesis in Dictyoptera and related orders and also show myomodulatory activity. The FGLamide allatostatin (AST) gene structure in Dictyoptera is intronless within the ORF, whereas in 9 species of Diptera, the FGLamide AST ORF has one intron. To investigate the evolutionary history of AST intron structure, (intron early versus intron late hypothesis), all available Arthropoda FGLamide AST gene sequences were examined from genome databases with reference to intron presence and position/phase. Three types of FGLamide AST ORF organization were found: intronless in I. scapularis and P. humanus corporis; one intron in D. pulex, A. pisum, A. mellifera and five Drosophila sp.; two introns in N. vitripennis, B. mori strains, A. aegypti, A. gambiae and C. quinquefasciatus. The literature suggests that for the majority of genes examined, most introns exist between codons (phase 0) which may reflect an ancient function of introns to separate protein modules. 60% of the FGLamide AST ORFs introns were between the first and second base within a codon (phase 1), 28% were between the second and third nucleotides within a codon (phase two) and 12% were phase 0. As would be required for correct intron splicing consensus sequence, 84% of introns were in codons starting with guanine. The positioning of introns was a maximum of 9 codons from a dibasic cleavage site. Our results suggest that the introns in the analyzed species support the intron late model.

  15. Functional characterisation of an intron retaining K+ transporter of barley reveals intron-mediated alternate splicing

    KAUST Repository

    Shahzad, K.

    2015-01-01

    Intron retention in transcripts and the presence of 5 and 3 splice sites within these introns mediate alternate splicing, which is widely observed in animals and plants. Here, functional characterisation of the K+ transporter, HvHKT2;1, with stably retained introns from barley (Hordeum vulgare) in yeast (Saccharomyces cerevisiae), and transcript profiling in yeast and transgenic tobacco (Nicotiana tabacum) is presented. Expression of intron-retaining HvHKT2;1 cDNA (HvHKT2;1-i) in trk1, trk2 yeast strain defective in K+ uptake restored growth in medium containing hygromycin in the presence of different concentrations of K+ and mediated hypersensitivity to Na+. HvHKT2;1-i produces multiple transcripts via alternate splicing of two regular introns and three exons in different compositions. HKT isoforms with retained introns and exon skipping variants were detected in relative expression analysis of (i) HvHKT2;1-i in barley under native conditions, (ii) in transgenic tobacco plants constitutively expressing HvHKT2;1-i, and (iii) in trk1, trk2 yeast expressing HvHKT2;1-i under control of an inducible promoter. Mixed proportions of three HKT transcripts: HvHKT2;1-e (first exon region), HvHKT2;1-i1 (first intron) and HvHKT2;1-i2 (second intron) were observed. The variation in transcript accumulation in response to changing K+ and Na+ concentrations was observed in both heterologous and plant systems. These findings suggest a link between intron-retaining transcripts and different splice variants to ion homeostasis, and their possible role in salt stress.

  16. Functional intron+ and intron- rDNA in the same macronucleus of the ciliate Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    alleles was followed in the total culture and in single cells during their vegetative segregation and it was observed that replication was non-preferential with respect to the two alleles. The diallelic clones were also used to demonstrate that intron-containing rDNA was transcribed and the transcript......Diallelic clones of Tetrahymena pigmentosa containing equal amounts of intron+ and intron- rDNA in the macronucleus were constructed. The macronucleus of the resulting strains divides amitotically during vegetative growth and the diallelic genotype is therefore unstable. The coexistence of the two...

  17. Intron size and genome size in plants.

    Science.gov (United States)

    J. Wendel; R. Cronn; I. Alvarez; B. Liu; R. Small; D. Senchina

    2002-01-01

    It has long been known that genomes vary over a remarkable range of sizes in both plants (Bennett, Cox, and Leitch 1997) and animals (Gregory 2001). It also has become evident that across the broad phylogenetic sweep, genome size may be correlated with intron size (Deutsch and Long 1999; Vinogradov 1999; McLysaght et al. 2000), suggesting that some component of genome...

  18. Evolution of the Exon-Intron Structure in Ciliate Genomes.

    Directory of Open Access Journals (Sweden)

    Vladyslav S Bondarenko

    Full Text Available A typical eukaryotic gene is comprised of alternating stretches of regions, exons and introns, retained in and spliced out a mature mRNA, respectively. Although the length of introns may vary substantially among organisms, a large fraction of genes contains short introns in many species. Notably, some Ciliates (Paramecium and Nyctotherus possess only ultra-short introns, around 25 bp long. In Paramecium, ultra-short introns with length divisible by three (3n are under strong evolutionary pressure and have a high frequency of in-frame stop codons, which, in the case of intron retention, cause premature termination of mRNA translation and consequent degradation of the mis-spliced mRNA by the nonsense-mediated decay mechanism. Here, we analyzed introns in five genera of Ciliates, Paramecium, Tetrahymena, Ichthyophthirius, Oxytricha, and Stylonychia. Introns can be classified into two length classes in Tetrahymena and Ichthyophthirius (with means 48 bp, 69 bp, and 55 bp, 64 bp, respectively, but, surprisingly, comprise three distinct length classes in Oxytricha and Stylonychia (with means 33-35 bp, 47-51 bp, and 78-80 bp. In most ranges of the intron lengths, 3n introns are underrepresented and have a high frequency of in-frame stop codons in all studied species. Introns of Paramecium, Tetrahymena, and Ichthyophthirius are preferentially located at the 5' and 3' ends of genes, whereas introns of Oxytricha and Stylonychia are strongly skewed towards the 5' end. Analysis of evolutionary conservation shows that, in each studied genome, a significant fraction of intron positions is conserved between the orthologs, but intron lengths are not correlated between the species. In summary, our study provides a detailed characterization of introns in several genera of Ciliates and highlights some of their distinctive properties, which, together, indicate that splicing spellchecking is a universal and evolutionarily conserved process in the biogenesis of short

  19. For Group II Introns, More Heat Means More Mobility

    OpenAIRE

    Mohr, Georg; Ghanem, Eman; Lambowitz, Alan M.

    2010-01-01

    Mobile group II introns, which are found in bacterial and organellar genomes, are site-specific retroelements hypothesized to be evolutionary ancestors of spliceosomal introns and retrotransposons in higher organisms. Most bacteria, however, contain no more than one or a few group II introns, making it unclear how introns could have proliferated to higher copy numbers in eukaryotic genomes. An exception is the thermophilic cyanobacterium Thermosynechococcus elongatus, which contains 28 closel...

  20. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  1. The ability to form full-length intron RNA circles is a general property of nuclear group I introns

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Fiskaa, Tonje; Birgisdottir, Asa Birna

    2003-01-01

    in which the intron terminal guanosine attacks the 5' splice site presented in a structure analogous to that of the first step of splicing. The products of the reactions are full-length circular intron and unligated exons. For this reason, the circularization reaction is to the benefit of the intron...

  2. Ancient nature of alternative splicing and functions of introns

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Kemin; Salamov, Asaf; Kuo, Alan; Aerts, Andrea; Grigoriev, Igor

    2011-03-21

    Using four genomes: Chamydomonas reinhardtii, Agaricus bisporus, Aspergillus carbonarius, and Sporotricum thermophile with EST coverage of 2.9x, 8.9x, 29.5x, and 46.3x respectively, we identified 11 alternative splicing (AS) types that were dominated by intron retention (RI; biased toward short introns) and found 15, 35, 52, and 63percent AS of multiexon genes respectively. Genes with AS were more ancient, and number of AS correlated with number of exons, expression level, and maximum intron length of the gene. Introns with tendency to be retained had either stop codons or length of 3n+1 or 3n+2 presumably triggering nonsense-mediated mRNA decay (NMD), but introns retained in major isoforms (0.2-6percent of all introns) were biased toward 3n length and stop codon free. Stopless introns were biased toward phase 0, but 3n introns favored phase 1 that introduced more flexible and hydrophilic amino acids on both ends of introns which would be less disruptive to protein structure. We proposed a model in which minor RI intron could evolve into major RI that could facilitate intron loss through exonization.

  3. A high density of ancient spliceosomal introns in oxymonad excavates

    Directory of Open Access Journals (Sweden)

    Keeling Patrick J

    2006-04-01

    Full Text Available Abstract Background Certain eukaryotic genomes, such as those of the amitochondriate parasites Giardia and Trichomonas, have very low intron densities, so low that canonical spliceosomal introns have only recently been discovered through genome sequencing. These organisms were formerly thought to be ancient eukaryotes that diverged before introns originated, or at least became common. Now however, they are thought to be members of a supergroup known as excavates, whose members generally appear to have low densities of canonical introns. Here we have used environmental expressed sequence tag (EST sequencing to identify 17 genes from the uncultivable oxymonad Streblomastix strix, to survey intron densities in this most poorly studied excavate group. Results We find that Streblomastix genes contain an unexpectedly high intron density of about 1.1 introns per gene. Moreover, over 50% of these are at positions shared between a broad spectrum of eukaryotes, suggesting theyare very ancient introns, potentially present in the last common ancestor of eukaryotes. Conclusion The Streblomastix data show that the genome of the ancestor of excavates likely contained many introns and the subsequent evolution of introns has proceeded very differently in different excavate lineages: in Streblomastix there has been much stasis while in Trichomonas and Giardia most introns have been lost.

  4. Functional Analysis of Deep Intronic SNP rs13438494 in Intron 24 of PCLO Gene

    Science.gov (United States)

    Seo, Seunghee; Takayama, Kanako; Uno, Kyosuke; Ohi, Kazutaka; Hashimoto, Ryota; Nishizawa, Daisuke; Ikeda, Kazutaka; Ozaki, Norio; Nabeshima, Toshitaka; Miyamoto, Yoshiaki; Nitta, Atsumi

    2013-01-01

    The single nucleotide polymorphism (SNP) rs13438494 in intron 24 of PCLO was significantly associated with bipolar disorder in a meta-analysis of genome-wide association studies. In this study, we performed functional minigene analysis and bioinformatics prediction of splicing regulatory sequences to characterize the deep intronic SNP rs13438494. We constructed minigenes with A and C alleles containing exon 24, intron 24, and exon 25 of PCLO to assess the genetic effect of rs13438494 on splicing. We found that the C allele of rs13438494 reduces the splicing efficiency of the PCLO minigene. In addition, prediction analysis of enhancer/silencer motifs using the Human Splice Finder web tool indicated that rs13438494 induces the abrogation or creation of such binding sites. Our results indicate that rs13438494 alters splicing efficiency by creating or disrupting a splicing motif, which functions by binding of splicing regulatory proteins, and may ultimately result in bipolar disorder in affected people. PMID:24167553

  5. Intron retention as a component of regulated gene expression programs.

    Science.gov (United States)

    Jacob, Aishwarya G; Smith, Christopher W J

    2017-09-01

    Intron retention has long been an exemplar of regulated splicing with case studies of individual events serving as models that provided key mechanistic insights into the process of splicing control. In organisms such as plants and budding yeast, intron retention is well understood as a major mechanism of gene expression regulation. In contrast, in mammalian systems, the extent and functional significance of intron retention have, until recently, remained greatly underappreciated. Technical challenges to the global detection and quantitation of transcripts with retained introns have often led to intron retention being overlooked or dismissed as "noise". Now, however, with the wealth of information available from high-throughput deep sequencing, combined with focused computational and statistical analyses, we are able to distinguish clear intron retention patterns in various physiological and pathological contexts. Several recent studies have demonstrated intron retention as a central component of gene expression programs during normal development as well as in response to stress and disease. Furthermore, these studies revealed various ways in which intron retention regulates protein isoform production, RNA stability and translation efficiency, and rapid induction of expression via post-transcriptional splicing of retained introns. In this review, we highlight critical findings from these transcriptomic studies and discuss commonalties in the patterns prevalent in intron retention networks at the functional and regulatory levels.

  6. Patterns of intron gain and conservation in eukaryotic genes

    Directory of Open Access Journals (Sweden)

    Wolf Yuri I

    2007-10-01

    Full Text Available Abstract Background: The presence of introns in protein-coding genes is a universal feature of eukaryotic genome organization, and the genes of multicellular eukaryotes, typically, contain multiple introns, a substantial fraction of which share position in distant taxa, such as plants and animals. Depending on the methods and data sets used, researchers have reached opposite conclusions on the causes of the high fraction of shared introns in orthologous genes from distant eukaryotes. Some studies conclude that shared intron positions reflect, almost entirely, a remarkable evolutionary conservation, whereas others attribute it to parallel gain of introns. To resolve these contradictions, it is crucial to analyze the evolution of introns by using a model that minimally relies on arbitrary assumptions. Results: We developed a probabilistic model of evolution that allows for variability of intron gain and loss rates over branches of the phylogenetic tree, individual genes, and individual sites. Applying this model to an extended set of conserved eukaryotic genes, we find that parallel gain, on average, accounts for only ~8% of the shared intron positions. However, the distribution of parallel gains over the phylogenetic tree of eukaryotes is highly non-uniform. There are, practically, no parallel gains in closely related lineages, whereas for distant lineages, such as animals and plants, parallel gains appear to contribute up to 20% of the shared intron positions. In accord with these findings, we estimated that ancestral introns have a high probability to be retained in extant genomes, and conversely, that a substantial fraction of extant introns have retained their positions since the early stages of eukaryotic evolution. In addition, the density of sites that are available for intron insertion is estimated to be, approximately, one in seven basepairs. Conclusion: We obtained robust estimates of the contribution of parallel gain to the observed

  7. The evolution of an intron: Analysis of a long, deletion-prone intron in the human dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    McNaughton, J.C.; Hughes, G.; Jones, W.A. [Univ. of Otago, Dunedin (New Zealand)] [and others

    1997-03-01

    The sequence of a 112-kb region of the human dystrophin (DMD/BMD) gene encompassing the deletion prone intron 7 (110 kb) and the much shorter intron 8 (1.1 kb) has been determined. Recognizable insertion sequences account for approximately 40% of intron 7. LINE-1 and THE-1/LTR sequences occur in intron 7 with significantly higher frequency than would be expected statistically while Alu sequences are underrepresented. Intron 7 also contains numerous mammalian-wide interspersed repeats, a diverse range of medium reiteration repeats of unknown origin, and a sequence derived from a mariner transposon. By contrast, the shorter intron 8 contains no detectable insertion sequences. Dating of the L1 and Alu sequences suggests that intron 7 has approximately doubled in size within the past 130 million years, and comparison with the corresponding intron from the pufferfish (Fugu rubripes) suggests that the intron has expanded some 44-fold over a period of 400 million years. The possible contribution of the insertion elements to the instability of intron 7 is discussed. 66 refs., 2 figs., 2 tabs.

  8. Detained introns are a novel, widespread class of post-transcriptionally spliced introns.

    Science.gov (United States)

    Boutz, Paul L; Bhutkar, Arjun; Sharp, Phillip A

    2015-01-01

    Deep sequencing of embryonic stem cell RNA revealed many specific internal introns that are significantly more abundant than the other introns within polyadenylated transcripts; we classified these as "detained" introns (DIs). We identified thousands of DIs, many of which are evolutionarily conserved, in human and mouse cell lines as well as the adult mouse liver. DIs can have half-lives of over an hour yet remain in the nucleus and are not subject to nonsense-mediated decay (NMD). Drug inhibition of Clk, a stress-responsive kinase, triggered rapid splicing changes for a specific subset of DIs; half showed increased splicing, and half showed increased intron detention, altering transcript pools of >300 genes. Srsf4, which undergoes a dramatic phosphorylation shift in response to Clk kinase inhibition, regulates the splicing of some DIs, particularly in genes encoding RNA processing and splicing factors. The splicing of some DIs-including those in Mdm4, a negative regulator of p53-was also altered following DNA damage. After 4 h of Clk inhibition, the expression of >400 genes changed significantly, and almost one-third of these are p53 transcriptional targets. These data suggest a widespread mechanism by which the rate of splicing of DIs contributes to the level of gene expression. © 2015 Boutz et al.; Published by Cold Spring Harbor Laboratory Press.

  9. Epigenetic Regulation of Intronic Transgenes in Arabidopsis.

    Science.gov (United States)

    Osabe, Kenji; Harukawa, Yoshiko; Miura, Saori; Saze, Hidetoshi

    2017-03-24

    Defense mechanisms of plant genomes can epigenetically inactivate repetitive sequences and exogenous transgenes. Loss of mutant phenotypes in intronic T-DNA insertion lines by interaction with another T-DNA locus, termed T-DNA suppression, has been observed in Arabidopsis thaliana, although the molecular basis of establishment and maintenance of T-DNA suppression is poorly understood. Here we show that maintenance of T-DNA suppression requires heterochromatinisation of T-DNA sequences and the nuclear proteins, INCREASED IN BONSAI METHYLATION 2 (IBM2) and ENHANCED DOWNY MILDEW 2 (EDM2), which prevent ectopic 3' end processing of mRNA in atypically long introns containing T-DNA sequences. Initiation of T-DNA suppression is mediated by the canonical RdDM pathway after hybridisation of two T-DNA strains, accompanied by DNA hypermethylation of T-DNA sequences in the F1 generation. Our results reveal the presence of a genome surveillance mechanism through genome hybridisation that masks repetitive DNAs intruding into transcription units.

  10. Sequence features responsible for intron retention in human

    Directory of Open Access Journals (Sweden)

    Sakabe Noboru

    2007-02-01

    Full Text Available Abstract Background One of the least common types of alternative splicing is the complete retention of an intron in a mature transcript. Intron retention (IR is believed to be the result of intron, rather than exon, definition associated with failure of the recognition of weak splice sites flanking short introns. Although studies on individual retained introns have been published, few systematic surveys of large amounts of data have been conducted on the mechanisms that lead to IR. Results TTo understand how sequence features are associated with or control IR, and to produce a generalized model that could reveal previously unknown signals that regulate this type of alternative splicing, we partitioned intron retention events observed in human cDNAs into two groups based on the relative abundance of both isoforms and compared relevant features. We found that a higher frequency of IR in human is associated with individual introns that have weaker splice sites, genes with shorter intron lengths, higher expression levels and lower density of both a set of exon splicing silencers (ESSs and the intronic splicing enhancer GGG. Both groups of retained introns presented events conserved in mouse, in which the retained introns were also short and presented weaker splice sites. Conclusion Although our results confirmed that weaker splice sites are associated with IR, they showed that this feature alone cannot explain a non-negligible fraction of events. Our analysis suggests that cis-regulatory elements are likely to play a crucial role in regulating IR and also reveals previously unknown features that seem to influence its occurrence. These results highlight the importance of considering the interplay among these features in the regulation of the relative frequency of IR.

  11. Intronic alternative splicing regulators identified by comparative genomics in nematodes.

    Directory of Open Access Journals (Sweden)

    Jennifer L Kabat

    2006-07-01

    Full Text Available Many alternative splicing events are regulated by pentameric and hexameric intronic sequences that serve as binding sites for splicing regulatory factors. We hypothesized that intronic elements that regulate alternative splicing are under selective pressure for evolutionary conservation. Using a Wobble Aware Bulk Aligner genomic alignment of Caenorhabditis elegans and Caenorhabditis briggsae, we identified 147 alternatively spliced cassette exons that exhibit short regions of high nucleotide conservation in the introns flanking the alternative exon. In vivo experiments on the alternatively spliced let-2 gene confirm that these conserved regions can be important for alternative splicing regulation. Conserved intronic element sequences were collected into a dataset and the occurrence of each pentamer and hexamer motif was counted. We compared the frequency of pentamers and hexamers in the conserved intronic elements to a dataset of all C. elegans intron sequences in order to identify short intronic motifs that are more likely to be associated with alternative splicing. High-scoring motifs were examined for upstream or downstream preferences in introns surrounding alternative exons. Many of the high-scoring nematode pentamer and hexamer motifs correspond to known mammalian splicing regulatory sequences, such as (TGCATG, indicating that the mechanism of alternative splicing regulation is well conserved in metazoans. A comparison of the analysis of the conserved intronic elements, and analysis of the entire introns flanking these same exons, reveals that focusing on intronic conservation can increase the sensitivity of detecting putative splicing regulatory motifs. This approach also identified novel sequences whose role in splicing is under investigation and has allowed us to take a step forward in defining a catalog of splicing regulatory elements for an organism. In vivo experiments confirm that one novel high-scoring sequence from our analysis

  12. Identifying the mechanisms of intron gain: progress and trends

    Directory of Open Access Journals (Sweden)

    Yenerall Paul

    2012-09-01

    Full Text Available Abstract Continued improvements in Next-Generation DNA/RNA sequencing coupled with advances in gene annotation have provided researchers access to a plethora of annotated genomes. Subsequent analyses of orthologous gene structures have identified numerous intron gain and loss events that have occurred both recently and in the very distant past. This research has afforded exceptional insight into the temporal and lineage-specific rates of intron gain and loss among various species throughout evolution. Numerous studies have also attempted to identify the molecular mechanisms of intron gain and loss. However, even after considerable effort, very little is known about these processes. In particular, the mechanism(s of intron gain have proven exceptionally enigmatic and remain topics of considerable debate. Currently, there exists no definitive consensus as to what mechanism(s may generate introns. Because many introns are known to affect gene expression, it is necessary to understand the molecular process(es by which introns may be gained. Here we review the seven most commonly purported mechanisms of intron gain and, when possible, summarize molecular evidence for or against the occurrence of each of these mechanisms. Furthermore, we catalogue indirect evidence that supports the occurrence of each mechanism. Finally, because these proposed mechanisms fail to explain the mechanistic origin of many recently gained introns, we also look at trends that may aid researchers in identifying other potential mechanism(s of intron gain. Reviewers This article was reviewed by Eugene Koonin, Scott Roy (nominated by W. Ford Doolittle, and John Logsdon.

  13. Group I introns in the liverwort mitochondrial genome: the gene coding for subunit 1 of cytochrome oxidase shares five intron positions with its fungal counterparts.

    OpenAIRE

    Ohta, E; Oda, K; Yamato, K; Nakamura, Y; Takemura, M; Nozato, N; Akashi, K; Ohyama, K; Michel, F

    1993-01-01

    The complete nucleotide sequence of the mitochondrial DNA (mtDNA) from a liverwort, Marchantia polymorpha, contains thirty-two introns. Twenty-five of these introns possess the characteristic secondary structures and consensus sequences of group II introns. The remaining seven are group I introns, six of which happen to interrupt the gene coding for subunit 1 of cytochrome oxidase (cox1). Interestingly, the insertion sites of one group II and four group I introns in the cox1 gene coincide wit...

  14. Distribution of Conventional and Nonconventional Introns in Tubulin (α and β) Genes of Euglenids

    OpenAIRE

    Milanowski, Rafał; Karnkowska, Anna; Ishikawa, Takao; Zakryś, Bożena

    2013-01-01

    The nuclear genomes of euglenids contain three types of introns: conventional spliceosomal introns, nonconventional introns for which a splicing mechanism is unknown (variable noncanonical borders, RNA secondary structure bringing together intron ends), and so-called intermediate introns, which combine features of conventional and nonconventional introns. Analysis of two genes, tubA and tubB, from 20 species of euglenids reveals contrasting distribution patterns of conventional and nonconvent...

  15. Drosophila polytene chromosome bands formed by gene introns.

    Science.gov (United States)

    Zhimulev, I F; Boldyreva, L V; Demakova, O V; Poholkova, G V; Khoroshko, V A; Zykova, T Yu; Lavrov, S A; Belyaeva, E S

    2016-01-01

    Genetic organization of bands and interbands in polytene chromosomes has long remained a puzzle for geneticists. It has been recently demonstrated that interbands typically correspond to the 5'-ends of house-keeping genes, whereas adjacent loose bands tend to be composed of coding sequences of the genes. In the present work, we made one important step further and mapped two large introns of ubiquitously active genes on the polytene chromosome map. We show that alternative promoter regions of these genes map to interbands, whereas introns and coding sequences found between those promoters correspond to loose grey bands. Thus, a gene having its long intron "sandwiched" between to alternative promoters and a common coding sequence may occupy two interbands and one band in the context of polytene chromosomes. Loose, partially decompacted bands appear to host large introns.

  16. Genomewide analysis of intronic microRNAs in rice and Arabidopsis

    Indian Academy of Sciences (India)

    Here we report a comprehensive computational analysis to characterize intronic miRNAs in rice and Arabidopsis. RT-PCR analysis confirmed that the identified intronic miRNAs were derived from the real introns of host genes. Interestingly, 13 intronic miRNAs in rice and two in Arabidopsis were located within seven clusters ...

  17. Phylogenetic analyses suggest reverse splicing spread of group I introns in fungal ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Simon Dawn M

    2005-11-01

    Full Text Available Abstract Background Group I introns have spread into over 90 different sites in nuclear ribosomal DNA (rDNA with greater than 1700 introns reported in these genes. These ribozymes generally spread through endonuclease-mediated intron homing. Another putative pathway is reverse splicing whereby a free group I intron inserts into a homologous or heterologous RNA through complementary base-pairing between the intron and exon RNA. Reverse-transcription of the RNA followed by general recombination results in intron spread. Here we used phylogenetics to test for reverse splicing spread in a taxonomically broadly sampled data set of fungal group I introns including 9 putatively ancient group I introns in the rDNA of the yeast-like symbiont Symbiotaphrina buchneri. Results Our analyses reveal a complex evolutionary history of the fungal introns with many cases of vertical inheritance (putatively for the 9 introns in S. buchneri and intron lateral transfer. There are several examples in which introns, many of which are still present in S. buchneri, may have spread through reverse splicing into heterologous rDNA sites. If the S. buchneri introns are ancient as we postulate, then group I intron loss was widespread in fungal rDNA evolution. Conclusion On the basis of these results, we suggest that the extensive distribution of fungal group I introns is at least partially explained by the reverse splicing movement of existing introns into ectopic rDNA sites.

  18. Host Factors Influencing the Retrohoming Pathway of Group II Intron RmInt1, Which Has an Intron-Encoded Protein Naturally Devoid of Endonuclease Activity.

    Directory of Open Access Journals (Sweden)

    Rafael Nisa-Martínez

    Full Text Available Bacterial group II introns are self-splicing catalytic RNAs and mobile retroelements that have an open reading frame encoding an intron-encoded protein (IEP with reverse transcriptase (RT and RNA splicing or maturase activity. Some IEPs carry a DNA endonuclease (En domain, which is required to cleave the bottom strand downstream from the intron-insertion site for target DNA-primed reverse transcription (TPRT of the inserted intron RNA. Host factors complete the insertion of the intron. By contrast, the major retrohoming pathway of introns with IEPs naturally lacking endonuclease activity, like the Sinorhizobium meliloti intron RmInt1, is thought to involve insertion of the intron RNA into the template for lagging strand DNA synthesis ahead of the replication fork, with possible use of the nascent strand to prime reverse transcription of the intron RNA. The host factors influencing the retrohoming pathway of such introns have not yet been described. Here, we identify key candidates likely to be involved in early and late steps of RmInt1 retrohoming. Some of these host factors are common to En+ group II intron retrohoming, but some have different functions. Our results also suggest that the retrohoming process of RmInt1 may be less dependent on the intracellular free Mg2+ concentration than those of other group II introns.

  19. Tertiary architecture of the Oceanobacillus iheyensis group II intron

    Energy Technology Data Exchange (ETDEWEB)

    Toor, Navtej; Keating, Kevin S.; Fedorova, Olga; Rajashankar, Kanagalaghatta; Wang, Jimin; Pyle, Anna Marie (Yale); (Cornell)

    2010-05-03

    Group II introns are large ribozymes that act as self-splicing and retrotransposable RNA molecules. They are of great interest because of their potential evolutionary relationship to the eukaryotic spliceosome, their continued influence on the organization of many genomes in bacteria and eukaryotes, and their potential utility as tools for gene therapy and biotechnology. One of the most interesting features of group II introns is their relative lack of nucleobase conservation and covariation, which has long suggested that group II intron structures are stabilized by numerous unusual tertiary interactions and backbone-mediated contacts. Here, we provide a detailed description of the tertiary interaction networks within the Oceanobacillus iheyensis group IIC intron, for which a crystal structure was recently solved to 3.1 {angstrom} resolution. The structure can be described as a set of several intricately constructed tertiary interaction nodes, each of which contains a core of extended stacking networks and elaborate motifs. Many of these nodes are surrounded by a web of ribose zippers, which appear to further stabilize local structure. As predicted from biochemical and genetic studies, the group II intron provides a wealth of new information on strategies for RNA folding and tertiary structural organization.

  20. 50/50 Expressional Odds of Retention Signifies the Distinction between Retained Introns and Constitutively Spliced Introns in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Rui Mao

    2017-10-01

    Full Text Available Intron retention, one of the most prevalent alternative splicing events in plants, can lead to introns retained in mature mRNAs. However, in comparison with constitutively spliced introns (CSIs, the relevantly distinguishable features for retained introns (RIs are still poorly understood. This work proposes a computational pipeline to discover novel RIs from multiple next-generation RNA sequencing (RNA-Seq datasets of Arabidopsis thaliana. Using this pipeline, we detected 3,472 novel RIs from 18 RNA-Seq datasets and re-confirmed 1,384 RIs which are currently annotated in the TAIR10 database. We also use the expression of intron-containing isoforms as a new feature in addition to the conventional features. Based on these features, RIs are highly distinguishable from CSIs by machine learning methods, especially when the expressional odds of retention (i.e., the expression ratio of the RI-containing isoforms relative to the isoforms without RIs for the same gene reaches to or larger than 50/50. In this case, the RIs and CSIs can be clearly separated by the Random Forest with an outstanding performance of 0.95 on AUC (the area under a receiver operating characteristics curve. The closely related characteristics to the RIs include the low strength of splice sites, high similarity with the flanking exon sequences, low occurrence percentage of YTRAY near the acceptor site, existence of putative intronic splicing silencers (ISSs, i.e., AG/GA-rich motifs and intronic splicing enhancers (ISEs, i.e., TTTT-containing motifs, and enrichment of Serine/Arginine-Rich (SR proteins and heterogeneous nuclear ribonucleoparticle proteins (hnRNPs.

  1. Intronic L1 retrotransposons and nested genes cause transcriptional interference by inducing intron retention, exonization and cryptic polyadenylation.

    Directory of Open Access Journals (Sweden)

    Kristel Kaer

    Full Text Available Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown.Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3' ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals.Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression.

  2. Alternative splicing mechanisms orchestrating post-transcriptional gene expression: intron retention and the intron-rich genome of apicomplexan parasites.

    Science.gov (United States)

    Lunghi, Matteo; Spano, Furio; Magini, Alessandro; Emiliani, Carla; Carruthers, Vern B; Di Cristina, Manlio

    2016-02-01

    Apicomplexan parasites including Toxoplasma gondii and Plasmodium species have complex life cycles that include multiple hosts and differentiation through several morphologically distinct stages requiring marked changes in gene expression. This review highlights emerging evidence implicating regulation of mRNA splicing as a mechanism to prime these parasites for rapid gene expression upon differentiation. We summarize the most important insights in alternative splicing including its role in regulating gene expression by decreasing mRNA abundance via 'Regulated Unproductive Splicing and Translation'. As a related but less well-understood mechanism, we discuss also our recent work suggesting a role for intron retention for precluding translation of stage specific isoforms of T. gondii glycolytic enzymes. We additionally provide new evidence that intron retention might be a widespread mechanism during parasite differentiation. Supporting this notion, recent genome-wide analysis of Toxoplasma and Plasmodium suggests intron retention is more pervasive than heretofore thought. These findings parallel recent emergence of intron retention being more prevalent in mammals than previously believed, thereby adding to the established roles in plants, fungi and unicellular eukaryotes. Deeper mechanistic studies of intron retention will provide important insight into its role in regulating gene expression in apicomplexan parasites and more general in eukaryotic organisms.

  3. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock

    DEFF Research Database (Denmark)

    Andersen, Kasper L.; Beckert, Bertrand; Masquida, Benoit

    2016-01-01

    Group I introns in nuclear ribosomal RNA of eukaryotic microorganisms are processed by splicing or circularization. The latter results in formation of full-length circular introns without ligation of the exons and has been proposed to be active in intron mobility. We applied qRT-PCR to estimate...... the copy number of circular intron RNA from the myxomycete Didymium iridis. In exponentially growing amoebae, the circular introns are nuclear and found in 70 copies per cell. During heat-shock, the circular form is up-regulated to more than 500 copies per cell. The intron harbours two ribozymes that have...

  4. Intron evolution in Neurospora: the role of mutational bias and selection.

    Science.gov (United States)

    Sun, Yu; Whittle, Carrie A; Corcoran, Pádraic; Johannesson, Hanna

    2015-01-01

    We used comparative and population genomics to study intron evolutionary dynamics in the fungal model genus Neurospora. For our investigation, we used well-annotated genomes of N. crassa, N. discreta, and N. tetrasperma, and 92 resequenced genomes of N. tetrasperma from natural populations. By analyzing the four well-annotated genomes, we identified 9495 intron sites in 7619 orthologous genes. Our data supports nonhomologous end joining (NHEJ) and tandem duplication as mechanisms for intron gains in the genus and the RT-mRNA process as a mechanism for intron loss. We found a moderate intron gain rate (5.78-6.89 × 10(-13) intron gains per nucleotide site per year) and a high intron loss rate (7.53-13.76 × 10(-10) intron losses per intron sites per year) as compared to other eukaryotes. The derived intron gains and losses are skewed to high frequencies, relative to neutral SNPs, in natural populations of N. tetrasperma, suggesting that selection is involved in maintaining a high intron turnover. Furthermore, our analyses of the association between intron population-level frequency and genomic features suggest that selection is involved in shaping a 5' intron position bias and a low intron GC content. However, intron sequence analyses suggest that the gained introns were not exposed to recent selective sweeps. Taken together, this work contributes to our understanding of the importance of mutational bias and selection in shaping the intron distribution in eukaryotic genomes. © 2015 Sun et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Frequent gain and loss of introns in fungal cytochrome b genes.

    Directory of Open Access Journals (Sweden)

    Liang-Fen Yin

    Full Text Available In this study, all available cytochrome b (Cyt b genes from the GOBASE database were compiled and the evolutionary dynamics of the Cyt b gene introns was assessed. Cyt b gene introns were frequently present in the fungal kingdom and some lower plants, but generally absent or rare in Chromista, Protozoa, and Animalia. Fungal Cyt b introns were found at 35 positions in Cyt b genes and the number of introns varied at individual positions from a single representative to 32 different introns at position 131, showing a wide and patchy distribution. Many homologous introns were present at the same position in distantly related species but absent in closely related species, suggesting that introns of the Cyt b genes were frequently lost. On the other hand, highly similar intron sequences were observed in some distantly related species rather than in closely related species, suggesting that these introns were gained independently, likely through lateral transfers. The intron loss-and-gain events could be mediated by transpositions that might have occurred between nuclear and mitochondria. Southern hybridization analysis confirmed that some introns contained repetitive sequences and might be transposable elements. An intron gain in Botryotinia fuckeliana prevented the development of QoI fungicide resistance, suggesting that intron loss-and-gain events were not necessarily beneficial to their host organisms.

  6. Frequent Gain and Loss of Introns in Fungal Cytochrome b Genes

    Science.gov (United States)

    Yin, Liang-Fen; Hu, Meng-Jun; Wang, Fei; Kuang, Hanhui; Zhang, Yu; Schnabel, Guido; Li, Guo-Qing; Luo, Chao-Xi

    2012-01-01

    In this study, all available cytochrome b (Cyt b) genes from the GOBASE database were compiled and the evolutionary dynamics of the Cyt b gene introns was assessed. Cyt b gene introns were frequently present in the fungal kingdom and some lower plants, but generally absent or rare in Chromista, Protozoa, and Animalia. Fungal Cyt b introns were found at 35 positions in Cyt b genes and the number of introns varied at individual positions from a single representative to 32 different introns at position 131, showing a wide and patchy distribution. Many homologous introns were present at the same position in distantly related species but absent in closely related species, suggesting that introns of the Cyt b genes were frequently lost. On the other hand, highly similar intron sequences were observed in some distantly related species rather than in closely related species, suggesting that these introns were gained independently, likely through lateral transfers. The intron loss-and-gain events could be mediated by transpositions that might have occurred between nuclear and mitochondria. Southern hybridization analysis confirmed that some introns contained repetitive sequences and might be transposable elements. An intron gain in Botryotinia fuckeliana prevented the development of QoI fungicide resistance, suggesting that intron loss-and-gain events were not necessarily beneficial to their host organisms. PMID:23145081

  7. Limited MHC class I intron 2 repertoire variation in bonobos.

    Science.gov (United States)

    de Groot, Natasja G; Heijmans, Corrine M C; Helsen, Philippe; Otting, Nel; Pereboom, Zjef; Stevens, Jeroen M G; Bontrop, Ronald E

    2017-10-01

    Common chimpanzees (Pan troglodytes) experienced a selective sweep, probably caused by a SIV-like virus, which targeted their MHC class I repertoire. Based on MHC class I intron 2 data analyses, this selective sweep took place about 2-3 million years ago. As a consequence, common chimpanzees have a skewed MHC class I repertoire that is enriched for allotypes that are able to recognise conserved regions of the SIV proteome. The bonobo (Pan paniscus) shared an ancestor with common chimpanzees approximately 1.5 to 2 million years ago. To investigate whether the signature of this selective sweep is also detectable in bonobos, the MHC class I gene repertoire of two bonobo panels comprising in total 29 animals was investigated by Sanger sequencing. We identified 14 Papa-A, 20 Papa-B and 11 Papa-C alleles, of which eight, five and eight alleles, respectively, have not been reported previously. Within this pool of MHC class I variation, we recovered only 2 Papa-A, 3 Papa-B and 6 Papa-C intron 2 sequences. As compared to humans, bonobos appear to have an even more diminished MHC class I intron 2 lineage repertoire than common chimpanzees. This supports the notion that the selective sweep may have predated the speciation of common chimpanzees and bonobos. The further reduction of the MHC class I intron 2 lineage repertoire observed in bonobos as compared to the common chimpanzee may be explained by a founding effect or other subsequent selective processes.

  8. Identification of novel intronic BRCA1 variants of uncertain ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... [Ratanaphan A., Panomwan P., Canyuk B. and Maipang T. 2011 Identification of novel intronic BRCA1 variants of uncertain significance in a Thai hereditary ... DNA structures, possibly through a slipped strand mispairing mechanism during .... have been related to inherited human disease as in genetic.

  9. Identification of novel intronic BRCA1 variants of uncertain ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... with an asterisk. proband was transmitted to the proband's unaffected daugh- ter. In order to confirm these genetic variations, the exon– intron 7 boundary sequences of the remaining breast cancer patients were amplified, screened by SSCP and subsequently sequenced. Five oligonucleotide primer pairs ...

  10. Naturally occuring nucleosome positioning signals in human exons and introns

    DEFF Research Database (Denmark)

    Baldi, Pierre; Brunak, Søren; Chauvin, Yves

    1996-01-01

    We describe the structural implications of a periodic pattern found in human exons and introns by hidden Markov models. We show that exons (besides the reading frame) have a specific sequential structure in the form of a pattern with triplet consensus non-T(A/T)G, and a minimal periodicity...

  11. Identification of novel intronic BRCA1 variants of uncertain ...

    Indian Academy of Sciences (India)

    in a Thai hereditary breast cancer family. Adisorn Ratanaphan, Pornpen Panomwan, Bhutorn Canyuk and Tanaphon Maipang. J. Genet. 90, 327–331. Table 1. Oligodeoxyribonucleotide primers used for PCR amplification of BRCA1 exon–intron 7 boundary sequences. Primers. Nucleotide position. Primer sequence (5 –3 ).

  12. Intron V, not intron I of human thrombopoietin, improves expression in the milk of transgenic mice regulated by goat beta-casein promoter.

    Science.gov (United States)

    Li, Yan; Hao, Hu; Zhou, Mingqian; Zhou, Hongwei; Ye, Jianbin; Ning, Lijun; Ning, Yunshan

    2015-11-03

    Introns near 5' end of genes generally enhance gene expression because of an enhancer /a promoter within their sequence or as intron-mediated enhancement. Surprisingly, our previous experiments found that the vector containing the last intron (intron V) of human thromobopoietin (hTPO) expressed higher hTPO in cos-1 cell than the vector containing intron I regulated by cytomegalovirus promoter. Moreover, regulated by 1.0 kb rat whey acidic protein promoter, hTPO expression was higher in transgenic mice generated by intron V-TPOcDNA than in transgenic mice generated by TPOcDNA and TPOgDNA. However, it is unknown whether the enhancement of hTPO expression by intron I is decreased by uAUG7 at 5'-UTR of hTPO in vivo. Currently, we constructed vectors regulated by stronger 6.5 kb β-casein promoter, including pTPOGA (containing TPOcDNA), pTPOGB (containing TUR-TPOcDNA, TUR including exon1, intron I and non-coding exon2 of hTPO gene), pTPOGC (containing ΔTUR-TPOcDNA, nucleotides of TUR from uAUG7 to physiological AUG were deleted), pTPOGD (containing intron V-TPOcDNA) and pTPOGE (containing TPOgDNA), to evaluate the effect of intron I on hTPO expression and to further verify whether intron V enhances hTPO expression in the milk of transgenic mice. The results demonstrated that intron V, not intron I improved hTPO expression.

  13. Multiple gains of spliceosomal introns in a superfamily of vertebrate protease inhibitor genes

    Directory of Open Access Journals (Sweden)

    Frese Marc-André

    2009-08-01

    Full Text Available Abstract Background Intron gains reportedly are very rare during evolution of vertebrates, and the mechanisms underlying their creation are largely unknown. Previous investigations have shown that, during metazoan radiation, the exon-intron patterns of serpin superfamily genes were subject to massive changes, in contrast to many other genes. Results Here we investigated intron dynamics in the serpin superfamily in lineages pre- and postdating the split of vertebrates. Multiple intron gains were detected in a group of ray-finned fishes, once the canonical groups of vertebrate serpins had been established. In two genes, co-occurrence of non-standard introns was observed, implying that intron gains in vertebrates may even happen concomitantly or in a rapidly consecutive manner. DNA breakage/repair processes associated with genome compaction are introduced as a novel factor potentially favoring intron gain, since all non-canonical introns were found in a lineage of ray-finned fishes that experienced genomic downsizing. Conclusion Multiple intron acquisitions were identified in serpin genes of a lineage of ray-finned fishes, but not in any other vertebrates, suggesting that insertion rates for introns may be episodically increased. The co-occurrence of non-standard introns within the same gene discloses the possibility that introns may be gained simultaneously. The sequences flanking the intron insertion points correspond to the proto-splice site consensus sequence MAG↑N, previously proposed to serve as intron insertion site. The association of intron gains in the serpin superfamily with a group of fishes that underwent genome compaction may indicate that DNA breakage/repair processes might foster intron birth.

  14. Mitochondrial group I and group II introns in the sponge orders Agelasida and Axinellida

    OpenAIRE

    Huchon, Doroth?e; Szitenberg, Amir; Shefer, Sigal; Ilan, Micha; Feldstein, Tamar

    2015-01-01

    Background Self-splicing introns are present in the mitochondria of members of most eukaryotic lineages. They are divided into Group I and Group II introns, according to their secondary structure and splicing mechanism. Being rare in animals, self-splicing introns were only described in a few sponges, cnidarians, placozoans and one annelid species. In sponges, three types of mitochondrial Group I introns were previously described in two demosponge families (Tetillidae, and Aplysinellidae) and...

  15. How complex an intron may be? The example of the first intron of the CTP synthase gene of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Roberto Piergentili

    2013-02-01

    Full Text Available In eukaryotes, maturation of primary transcripts into mature messenger RNAs involves the elimination of parts of the gene called ‘introns’. The biological significance of introns is not yet completely understood. It has been demonstrated that introns may contain other genes, or regulatory sequences that may be involved in transcriptional control, or also being involved in alternative splicing mechanisms. However, these functions explain the role of only a small number of them, and it is very difficult to formulate any generalization. The CTP synthase gene of Drosophila melanogaster is characterized by the presence of a long first intron (approximately 7.2 kilobases whose role is currently unknown. In the present report we analyzed in silico the content of this intron, and found that it contains at least three interesting sub-sequences. Two of them are homologous to the CTP synthase itself and to a putative nucleotide pyrophosphatase, respectively. The third is a short stretch of DNA able to fold into a thermodynamically stable hairpin and showing homology with other 19 sequences from 21 genes inside the D. melanogaster genome. These findings suggest a complex yet very accurate way of controlling gene expression inside the fruit fly.

  16. Molecular characterization of a new member of the lariat capping twin-ribozyme introns

    DEFF Research Database (Denmark)

    Tang, Yunjia; Nielsen, Henrik; Masquida, Benoît

    2014-01-01

    BACKGROUND: Twin-ribozyme introns represent a complex class of mobile group I introns that harbour a lariat capping (LC) ribozyme and a homing endonuclease gene embedded in a conventional self-splicing group I ribozyme (GIR2). Twin-ribozyme introns have so far been confined to nucleolar DNA in Na...

  17. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1992-01-01

    We have previously argued from phylogenetic sequence data that the group I intron in the rRNA genes of Tetrahymena was acquired by different Tetrahymena species at different times during evolution. We have now approached the question of intron mobility experimentally by crossing intron+ and intro...

  18. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Directory of Open Access Journals (Sweden)

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  19. Both size and GC-content of minimal introns are selected in human populations.

    Directory of Open Access Journals (Sweden)

    Dapeng Wang

    Full Text Available BACKGROUND: We previously have studied the insertion and deletion polymorphism by sequencing no more than one hundred introns in a mixed human population and found that the minimal introns tended to maintain length at an optimal size. Here we analyzed re-sequenced 179 individual genomes (from African, European, and Asian populations from the data released by the 1000 Genome Project to study the size dynamics of minimal introns. PRINCIPAL FINDINGS: We not only confirmed that minimal introns in human populations are selected but also found two major effects in minimal intron evolution: (i Size-effect: minimal introns longer than an optimal size (87 nt tend to have a higher ratio of deletion to insertion than those that are shorter than the optimal size; (ii GC-effect: minimal introns with lower GC content tend to be more frequently deleted than those with higher GC content. The GC-effect results in a higher GC content in minimal introns than their flanking exons as opposed to larger introns (≥125 nt that always have a lower GC content than that of their flanking exons. We also observed that the two effects are distinguishable but not completely separable within and between populations. CONCLUSIONS: We validated the unique mutation dynamics of minimal introns in keeping their near-optimal size and GC content, and our observations suggest potentially important functions of human minimal introns in transcript processing and gene regulation.

  20. Universal PCR primers for ribosomal protein gene introns of fish

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2016-01-01

    Full Text Available Abstract Human ribosomal protein (RP gene sequences with respect to intron/exon structures and corresponding cDNA or genomic data of fish species were obtained from the GenBank database. Based on conserved exon sequences, 128 primer pairs for 41 genes were designed for exon-primed intron-crossing (EPIC polymerase chain reaction (PCR. In reference to the draft genome sequences of the Pacific bluefin tuna (Thunnus orientalis, 12 primer pairs expected to amplify introns of the bluefin tuna with lengths of 500–1000 bp were selected and applied to six distantly related fish species belonging to the Orders Clupeiformes, Tetraodontiformes, Pleuronectiformes, Perciformes, Scorpaeniformes, and Anguilliformes. PCR amplification was observed for at least four species in each primer pair, and all fragments were larger than those expected for intronless amplification. Single fragment amplification was observed for at least seven primer pairs per species. Fragment sizes of the bluefin tuna for nine primer pairs corresponded to those expected from the genomic data. Thus, our primer pairs are potentially applicable to a wide variety of fish species and serve as an initial step for isolating single-copy nuclear DNA sequences.

  1. Diversity of sponge mitochondrial introns revealed by cox 1 sequences of Tetillidae

    Directory of Open Access Journals (Sweden)

    Rot Chagai

    2010-09-01

    Full Text Available Abstract Background Animal mitochondrial introns are rare. In sponges and cnidarians they have been found in the cox 1 gene of some spirophorid and homosclerophorid sponges, as well as in the cox 1 and nad 5 genes of some Hexacorallia. Their sporadic distribution has raised a debate as to whether these mobile elements have been vertically or horizontally transmitted among their hosts. The first sponge found to possess a mitochondrial intron was a spirophorid sponge from the Tetillidae family. To better understand the mode of transmission of mitochondrial introns in sponges, we studied cox 1 intron distribution among representatives of this family. Results Seventeen tetillid cox 1 sequences were examined. Among these sequences only six were found to possess group I introns. Remarkably, three different forms of introns were found, named introns 714, 723 and 870 based on their different positions in the cox 1 alignment. These introns had distinct secondary structures and encoded LAGLIDADG ORFs belonging to three different lineages. Interestingly, sponges harboring the same intron form did not always form monophyletic groups, suggesting that their introns might have been transferred horizontally. To evaluate whether the introns were vertically or horizontally transmitted in sponges and cnidarians we used a host parasite approach. We tested for co-speciation between introns 723 (the introns with the highest number of sponge representatives and their nesting cox 1 sequences. Reciprocal AU tests indicated that the intron and cox 1 tree are significantly different, while a likelihood ratio test was not significant. A global test of co-phylogeny had significant results; however, when cnidarian sequences were analyzed separately the results were not significant. Conclusions The co-speciation analyses thus suggest that a vertical transmission of introns in the ancestor of sponges and cnidarians, followed by numerous independent losses, cannot solely

  2. Single nucleotide polymorphisms in intron 1 and intron 2 of Larimichthys crocea growth hormone gene are correlated with growth traits

    Science.gov (United States)

    Ni, Jing; You, Feng; Xu, Jianhe; Xu, Dongdong; Wen, Aiyun; Wu, Zhihao; Xu, Yongli; Zhang, Peijun

    2012-03-01

    The growth hormone gene ( GH) affects animal growth and is a potential target for genetic studies of variation related to growth traits. In this study, we analyzed single nucleotide polymorphisms (SNPs) in GH intron regions and their associations with growth traits in large yellow croaker, Larimichthys crocea, from Zhejiang and Fujian stocks. The results of PCR-single strand conformation polymorphism showed two haplotypes of intron 1, named AA and AB genotypes, in Zhejiang stock. AB exhibited an SNP at position 196 (G→A) that was negatively correlated with body height and positively correlated with standard length/body height ( P≤0.05). Two different genotypes, CC and CD, were identified in intron 2 in Fujian stock, with CD showing an SNP at position 692 (T→C). The CD genotype had a significantly positive correlation with both weight and total length ( P≤0.01). These basic data highlight the potential for using GH as a genetic marker of fish growth in marker assisted selection.

  3. Differential GC Content between Exons and Introns Establishes Distinct Strategies of Splice-Site Recognition

    Directory of Open Access Journals (Sweden)

    Maayan Amit

    2012-05-01

    Full Text Available During evolution segments of homeothermic genomes underwent a GC content increase. Our analyses reveal that two exon-intron architectures have evolved from an ancestral state of low GC content exons flanked by short introns with a lower GC content. One group underwent a GC content elevation that abolished the differential exon-intron GC content, with introns remaining short. The other group retained the overall low GC content as well as the differential exon-intron GC content, and is associated with longer introns. We show that differential exon-intron GC content regulates exon inclusion level in this group, in which disease-associated mutations often lead to exon skipping. This group's exons also display higher nucleosome occupancy compared to flanking introns and exons of the other group, thus “marking” them for spliceosomal recognition. Collectively, our results reveal that differential exon-intron GC content is a previously unidentified determinant of exon selection and argue that the two GC content architectures reflect the two mechanisms by which splicing signals are recognized: exon definition and intron definition.

  4. Discovery of group I introns in the nuclear small subunit ribosomal RNA genes of Acanthamoeba.

    Science.gov (United States)

    Gast, R J; Fuerst, P A; Byers, T J

    1994-01-01

    The discovery of group I introns in small subunit nuclear rDNA (nsrDNA) is becoming more common as the effort to generate phylogenies based upon nsrDNA sequences grows. In this paper we describe the discovery of the first two group I introns in the nsrDNA from the genus Acanthamoeba. The introns are in different locations in the genes, and have no significant primary sequence similarity to each other. They are identified as group I introns by the conserved P, Q, R and S sequences (1), and the ability to fit the sequences to a consensus secondary structure model for the group I introns (1, 2). Both introns are absent from the mature srRNA. A BLAST search (3) of nucleic acid sequences present in GenBank and EMBL revealed that the A. griffini intron was most similar to the nsrDNA group I intron of the green alga Dunaliella parva. A similar search found that the A. lenticulata intron was not similar to any of the other reported group I introns. Images PMID:8127708

  5. Structural and functional characterization of ribosomal protein gene introns in sponges.

    Science.gov (United States)

    Perina, Drago; Korolija, Marina; Mikoč, Andreja; Roller, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with "higher" metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales.

  6. Isolation and characterization of functional tripartite group II introns using a Tn5-based genetic screen.

    Directory of Open Access Journals (Sweden)

    Christine Ritlop

    Full Text Available BACKGROUND: Group II introns are RNA enzymes that splice themselves from pre-mRNA transcripts. Most bacterial group II introns harbour an open reading frame (ORF, coding for a protein with reverse transcriptase, maturase and occasionally DNA binding and endonuclease activities. Some ORF-containing group II introns were shown to be mobile retroelements that invade new DNA target sites. From an evolutionary perspective, group II introns are hypothesized to be the ancestors of the spliceosome-dependent nuclear introns and the small nuclear RNAs (snRNAs--U1, U2, U4, U5 and U6 that are important functional elements of the spliceosome machinery. The ability of some group II introns fragmented in two or three pieces to assemble and undergo splicing in trans supports the theory that spliceosomal snRNAs evolved from portions of group II introns. METHODOLOGY/PRINCIPAL FINDINGS: We used a transposon-based genetic screen to explore the ability of the Ll.LtrB group II intron from the Gram-positive bacterium Lactococcus lactis to be fragmented into three pieces in vivo. Trans-splicing tripartite variants of Ll.LtrB were selected using a highly efficient and sensitive trans-splicing/conjugation screen. We report that numerous fragmentation sites located throughout Ll.LtrB support tripartite trans-splicing, showing that this intron is remarkably tolerant to fragmentation. CONCLUSIONS/SIGNIFICANCE: This work unveils the great versatility of group II intron fragments to assemble and accurately trans-splice their flanking exons in vivo. The selected introns represent the first evidence of functional tripartite group II introns in bacteria and provide experimental support for the proposed evolutionary relationship between group II introns and snRNAs.

  7. Evidence for the late origin of introns in chloroplast genes from an evolutionary analysis of the genus Euglena.

    Science.gov (United States)

    Thompson, M D; Copertino, D W; Thompson, E; Favreau, M R; Hallick, R B

    1995-01-01

    The origin of present day introns is a subject of spirited debate. Any intron evolution theory must account for not only nuclear spliceosomal introns but also their antecedents. The evolution of group II introns is fundamental to this debate, since group II introns are the proposed progenitors of nuclear spliceosomal introns and are found in ancient genes from modern organisms. We have studied the evolution of chloroplast introns and twintrons (introns within introns) in the genus Euglena. Our hypothesis is that Euglena chloroplast introns arose late in the evolution of this lineage and that twintrons were formed by the insertion of one or more introns into existing introns. In the present study we find that 22 out of 26 introns surveyed in six different photosynthesis-related genes from the plastid DNA of Euglena gracilis are not present in one or more basally branching Euglena spp. These results are supportive of a late origin for Euglena chloroplast group II introns. The psbT gene in Euglena viridis, a basally branching Euglena species, contains a single intron in the identical position to a psbT twintron from E.gracilis, a derived species. The E.viridis intron, when compared with 99 other Euglena group II introns, is most similar to the external intron of the E.gracilis psbT twintron. Based on these data, the addition of introns to the ancestral psbT intron in the common ancester of E.viridis and E.gracilis gave rise to the psbT twintron in E.gracilis. Images PMID:8532514

  8. Unexpected abundance of self-splicing introns in the genome of bacteriophage Twort: Introns in multiple genes, a single gene with three introns, and exon skipping by group I ribozymes

    OpenAIRE

    Landthaler, Markus; Shub, David A.

    1999-01-01

    Analysis of RNA that can be labeled with GTP indicates the existence of group I introns in genes of at least three transcriptional classes in the genome of Staphylococcus aureus bacteriophage Twort. A single ORF of 142 amino acids (Orf142) is interrupted by three self-splicing group I introns, providing the first example of a phage gene with multiple intron insertions. Twort Orf142 is encoded in a message that is abundant 15–20 min after infection and is highly similar to a late gene product ...

  9. Parallel loss of plastid introns and their maturase in the genus Cuscuta.

    Directory of Open Access Journals (Sweden)

    Joel R McNeal

    2009-06-01

    Full Text Available Plastid genome content and arrangement are highly conserved across most land plants and their closest relatives, streptophyte algae, with nearly all plastid introns having invaded the genome in their common ancestor at least 450 million years ago. One such intron, within the transfer RNA trnK-UUU, contains a large open reading frame that encodes a presumed intron maturase, matK. This gene is missing from the plastid genomes of two species in the parasitic plant genus Cuscuta but is found in all other published land plant and streptophyte algal plastid genomes, including that of the nonphotosynthetic angiosperm Epifagus virginiana and two other species of Cuscuta. By examining matK and plastid intron distribution in Cuscuta, we add support to the hypothesis that its normal role is in splicing seven of the eight group IIA introns in the genome. We also analyze matK nucleotide sequences from Cuscuta species and relatives that retain matK to test whether changes in selective pressure in the maturase are associated with intron deletion. Stepwise loss of most group IIA introns from the plastid genome results in substantial change in selective pressure within the hypothetical RNA-binding domain of matK in both Cuscuta and Epifagus, either through evolution from a generalist to a specialist intron splicer or due to loss of a particular intron responsible for most of the constraint on the binding region. The possibility of intron-specific specialization in the X-domain is implicated by evidence of positive selection on the lineage leading to C. nitida in association with the loss of six of seven introns putatively spliced by matK. Moreover, transfer RNA gene deletion facilitated by parasitism combined with an unusually high rate of intron loss from remaining functional plastid genes created a unique circumstance on the lineage leading to Cuscuta subgenus Grammica that allowed elimination of matK in the most species-rich lineage of Cuscuta.

  10. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  11. Diversity, mobility, and structural and functional evolution of group II introns carrying an unusual 3' extension

    OpenAIRE

    Tourasse, Nicolas J; Stabell, Fredrik B; Kolstø, Anne-Brit

    2011-01-01

    Background Group II introns are widespread genetic elements endowed with a dual functionality. They are catalytic RNAs (ribozymes) that are able of self-splicing and they are also mobile retroelements that can invade genomic DNA. The group II intron RNA secondary structure is typically made up of six domains. However, a number of unusual group II introns carrying a unique extension of 53-56 nucleotides at the 3' end have been identified previously in bacteria of the Bacillu...

  12. Variation in intron length in caffeic acid O-methyltransferase (COMT) in Vanilla species (Orchidaceae).

    Science.gov (United States)

    Besse, Pascale; Da Silva, Denis; Bory, Séverine; Noirot, Michel; Grisoni, Michel

    2009-04-01

    Variation in intron length in caffeic acid O-methyltransferase (COMT) in Vanilla was studied and demonstrated that COMT genes in Vanilla are organized with four exons and three introns. At least two to four different versions (either allelic or paralogous) of the COMT multigenic family in the genus Vanilla (in terms of intron sizes) were detected. The three introns were differentially variable, with intron-1 being the most length-polymorphic. Patterns of variations were in accordance with known phylogenetic relationships in the genus obtained with neutral markers. In particular, the genus displayed a strong Old World versus New World differentiation with American fragrant species being characterized by a specific 99bp intron-1 size-variant and a unique 226bp intron-3 variant. Conversely, leafless species of the genus displayed unexpected variations in intron lengths. Due to their role in primary (lignin) and secondary (phenolics, e.g., vanillin, alkaloids) metabolisms, COMT genes might not be neutral markers, and represent candidate functional markers for resistance, aromatic or medicinal properties of Vanilla species. Investigating the orthologous/paralogous status of the different genes revealed (in terms of intron size) will allow the evolution of the COMT genes to be studied. Copyright © 2009 Elsevier Ireland Ltd. All rights reserved.

  13. An overabundance of phase 0 introns immediately after the start codon in eukaryotic genes

    Directory of Open Access Journals (Sweden)

    Wernersson Rasmus

    2006-10-01

    Full Text Available Abstract Background A knowledge of the positions of introns in eukaryotic genes is important for understanding the evolution of introns. Despite this, there has been relatively little focus on the distribution of intron positions in genes. Results In proteins with signal peptides, there is an overabundance of phase 1 introns around the region of the signal peptide cleavage site. This has been described before. But in proteins without signal peptides, a novel phenomenon is observed: There is a sharp peak of phase 0 intron positions immediately following the start codon, i.e. between codons 1 and 2. This effect is seen in a wide range of eukaryotes: Vertebrates, arthropods, fungi, and flowering plants. Proteins carrying this start codon intron are found to comprise a special class of relatively short, lysine-rich and conserved proteins with an overrepresentation of ribosomal proteins. In addition, there is a peak of phase 0 introns at position 5 in Drosophila genes with signal peptides, predominantly representing cuticle proteins. Conclusion There is an overabundance of phase 0 introns immediately after the start codon in eukaryotic genes, which has been described before only for human ribosomal proteins. We give a detailed description of these start codon introns and the proteins that contain them.

  14. An overabundance of phase 0 introns immediately after the start codon in eukaryotic genes.

    Science.gov (United States)

    Nielsen, Henrik; Wernersson, Rasmus

    2006-10-11

    A knowledge of the positions of introns in eukaryotic genes is important for understanding the evolution of introns. Despite this, there has been relatively little focus on the distribution of intron positions in genes. In proteins with signal peptides, there is an overabundance of phase 1 introns around the region of the signal peptide cleavage site. This has been described before. But in proteins without signal peptides, a novel phenomenon is observed: There is a sharp peak of phase 0 intron positions immediately following the start codon, i.e. between codons 1 and 2. This effect is seen in a wide range of eukaryotes: Vertebrates, arthropods, fungi, and flowering plants. Proteins carrying this start codon intron are found to comprise a special class of relatively short, lysine-rich and conserved proteins with an overrepresentation of ribosomal proteins. In addition, there is a peak of phase 0 introns at position 5 in Drosophila genes with signal peptides, predominantly representing cuticle proteins. There is an overabundance of phase 0 introns immediately after the start codon in eukaryotic genes, which has been described before only for human ribosomal proteins. We give a detailed description of these start codon introns and the proteins that contain them.

  15. The Chloroplast Genome of Euglena mutabilis-Cluster Arrangement, Intron Analysis, and Intrageneric Trends.

    Science.gov (United States)

    Dabbagh, Nadja; Preisfeld, Angelika

    2017-01-01

    A comparative analysis of the chloroplast genome of Euglena mutabilis underlined a high diversity in the evolution of plastids in euglenids. Gene clusters in more derived Euglenales increased in complexity with only a few, but remarkable changes in the genus Euglena. Euglena mutabilis differed from other Euglena species in a mirror-inverted arrangement of 12 from 15 identified clusters, making it very likely that the emergence at the base of the genus Euglena, which has been considered a long branch artifact, is truly a probable position. This was corroborated by many similarities in gene arrangement and orientation with Strombomonas and Monomorphina, rendering the genome organization of E. mutabilis in certain clusters as plesiomorphic feature. By RNA analysis exact exon-intron boundaries and the type of the 77 introns identified were mostly determined unambiguously. A detailed intron study of psbC pointed at two important issues: First, the number of introns varied even between species, and no trend from few to many introns could be observed. Second, mat1 was localized in Eutreptiales exclusively in intron 1, and mat2 was not identified. With the emergence of Euglenaceae in most species, a new intron containing mat2 inserted in front of the previous intron 1 and thereby became intron 2 with mat1. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  16. A maturase-encoding group IIA intron of yeast mitochondria self-splices in vitro.

    OpenAIRE

    Hebbar, S K; Belcher, S M; Perlman, P S

    1992-01-01

    Intron 1 of the coxI gene of yeast mitochondrial DNA (aI1) is a group IIA intron that encodes a maturase function required for its splicing in vivo. It is shown here to self-splice in vitro under some reaction conditions reported earlier to yield efficient self-splicing of group IIB introns of yeast mtDNA that do not encode maturase functions. Unlike the group IIB introns, aI1 is inactive in 10 mM Mg2+ (including spermidine) and requires much higher levels of Mg2+ and added salts (1M NH4Cl or...

  17. Group-II intron splicing factors in higher-plants mitochondria

    Directory of Open Access Journals (Sweden)

    Gregory G. Brown

    2014-02-01

    Full Text Available Group-II introns are large catalytic RNAs (ribozymes which are found in bacteria and organellar genomes of several lower eukaryotes, but are particularly prevalent within the mitochondrial genomes (mtDNA in plants, where they reside in numerous critical genes. Their excision is therefore essential for mitochondria biogenesis and respiratory functions, and is facilitated in vivo by various protein cofactors. Typical group-II introns are classified as mobile genetic elements, consisting of the self-splicing ribozyme and its intron-encoded maturase protein. A hallmark of maturases is that they are intron specific, acting as cofactors which bind their own cognate containing pre-mRNAs to facilitate splicing. However, the plant organellar introns have diverged considerably from their bacterial ancestors, such as they lack many regions which are necessary for splicing and also lost their evolutionary related maturase ORFs. In fact, only a single maturase has retained in the mtDNA of angiosperms: matR encoded in the fourth intron of the NADH-dehydrogenase subunit 1 (nad1 intron 4. Their degeneracy and the absence of cognate ORFs suggest that the splicing of plant mitochondria introns is assisted by trans-acting cofactors. Interestingly, in addition to MatR, the nuclear genomes of angiosperms also harbor four genes (nMat 1-4, which are closely related to maturases and contain N-terminal mitochondrial localization signals. Recently, we established the roles of two of these paralogs in Arabidopsis, nMAT1 and nMAT2, in the splicing of mitochondrial introns. In addition to the nMATs, genetic screens led to the identification of other genes encoding various factors, which are required for the splicing and processing of mitochondrial introns in plants. In this review we will summarize recent data on the splicing and processing of mitochondrial introns and their implication in plant development and physiology, with a focus on maturases and their accessory

  18. Genomewide analysis of intronic microRNAs in rice and Arabidopsis

    Indian Academy of Sciences (India)

    Keywords. rice; Arabidopsis; intronic miRNA; host gene; bioinformatics; function. Abstract. MicroRNAs (miRNAs) are potent regulators of gene transcription and posttranscriptional processes. The majority of miRNAs are localized within intronic regions of protein-coding genes (host genes) and have diverse functions in ...

  19. Two CRM protein subfamilies cooperate in the splicing of group IIB introns in chloroplasts.

    Science.gov (United States)

    Asakura, Yukari; Bayraktar, Omer Ali; Barkan, Alice

    2008-11-01

    Chloroplast genomes in angiosperms encode approximately 20 group II introns, approximately half of which are classified as subgroup IIB. The splicing of all but one of the subgroup IIB introns requires a heterodimer containing the peptidyl-tRNA hydrolase homolog CRS2 and one of two closely related proteins, CAF1 or CAF2, that harbor a recently recognized RNA binding domain called the CRM domain. Two CRS2/CAF-dependent introns require, in addition, a CRM domain protein called CFM2 that is only distantly related to CAF1 and CAF2. Here, we show that CFM3, a close relative of CFM2, associates in vivo with those CRS2/CAF-dependent introns that are not CFM2 ligands. Mutant phenotypes in rice and Arabidopsis support a role for CFM3 in the splicing of most of the introns with which it associates. These results show that either CAF1 or CAF2 and either CFM2 or CFM3 simultaneously bind most chloroplast subgroup IIB introns in vivo, and that the CAF and CFM subunits play nonredundant roles in splicing. These results suggest that the expansion of the CRM protein family in plants resulted in two subfamilies that play different roles in group II intron splicing, with further diversification within a subfamily to accommodate multiple intron ligands.

  20. U12 type introns were lost at multiple occasions during evolution

    Directory of Open Access Journals (Sweden)

    Bartschat Sebastian

    2010-02-01

    Full Text Available Abstract Background Two categories of introns are known, a common U2 type and a rare U12 type. These two types of introns are removed by distinct spliceosomes. The phylogenetic distribution of spliceosomal RNAs that are characteristic of the U12 spliceosome, i.e. the U11, U12, U4atac and U6atac RNAs, suggest that U12 spliceosomes were lost in many phylogenetic groups. We have now examined the distribution of U2 and U12 introns in many of these groups. Results U2 and U12 introns were predicted by making use of available EST and genomic sequences. The results show that in species or branches where U12 spliceosomal components are missing, also U12 type of introns are lacking. Examples are the choanoflagellate Monosiga brevicollis, Entamoeba histolytica, green algae, diatoms, and the fungal lineage Basidiomycota. Furthermore, whereas U12 splicing does not occur in Caenorhabditis elegans, U12 introns as well as U12 snRNAs are present in Trichinella spiralis, which is deeply branching in the nematode tree. A comparison of homologous genes in T. spiralis and C. elegans revealed different mechanisms whereby U12 introns were lost. Conclusions The phylogenetic distribution of U12 introns and spliceosomal RNAs give further support to an early origin of U12 dependent splicing. In addition, this distribution identifies a large number of instances during eukaryotic evolution where such splicing was lost.

  1. The strength of intron donor splice sites in human genes displays a bell-shaped pattern

    DEFF Research Database (Denmark)

    Wang, Kai; Wernersson, Rasmus; Brunak, Søren

    2011-01-01

    introns. Interestingly, when analysing the intron containing gene pool from mouse consisting of >15 000 genes, we found the convex pattern to be conserved despite >75 million years of evolutionary divergence between the two organisms. We also analysed an interesting, novel class of chimeric genes which...

  2. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase

    Directory of Open Access Journals (Sweden)

    Ming-Yue Ma

    2016-07-01

    Full Text Available The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3′ splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals.

  3. Insertion of a self-splicing intron into the mtDNA of atriploblastic animal

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Y.; Halanych, K.; Boore, J.L.

    2006-04-14

    Nephtys longosetosa is a carnivorous polychaete worm that lives in the intertidal and subtidal zones with worldwide distribution (pleijel&rouse2001). Its mitochondrial genome has the characteristics typical of most metazoans: 37 genes; circular molecule; almost no intergenic sequence; and no significant gene rearrangements when compared to other annelid mtDNAs (booremoritz19981995). Ubiquitous features as small intergenic regions and lack of introns suggested that metazoan mtDNAs are under strong selective pressures to reduce their genome size allowing for faster replication requirements (booremoritz19981995Lynch2005). Yet, in 1996 two type I introns were found in the mtDNA of the basal metazoan Metridium senile (FigureX). Breaking a long-standing rule (absence of introns in metazoan mtDNA), this finding was later supported by the further presence of group I introns in other cnidarians. Interestingly, only the class Anthozoa within cnidarians seems to harbor such introns. Although several hundreds of triploblastic metazoan mtDNAs have been sequenced, this study is the first evidence of mitochondrial introns in triploblastic metazoans. The cox1 gene of N. longosetosa has an intron of almost 2 kbs in length. This finding represents as well the first instance of a group II intron (anthozoans harbor group I introns) in all metazoan lineages. Opposite trends are observed within plants, fungi and protist mtDNAs, where introns (both group I and II) and other non-coding sequences are widespread. Plant, fungal and protist mtDNA structure and organization differ enormously from that of metazoan mtDNA. Both, plant and fungal mtDNA are dynamic molecules that undergo high rates of recombination, contain long intergenic spacer regions and harbor both group I and group II introns. However, as metazoans they have a conserved gene content. Protists, on the other hand have a striking variation of gene content and introns that account for the genome size variation. In contrast to

  4. Phylogenetic distribution of intron positions in alpha-amylase genes of bilateria suggests numerous gains and losses.

    Directory of Open Access Journals (Sweden)

    Jean-Luc Da Lage

    Full Text Available Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that "resets" of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures.

  5. Phylogenetic Distribution of Intron Positions in Alpha-Amylase Genes of Bilateria Suggests Numerous Gains and Losses

    Science.gov (United States)

    Da Lage, Jean-Luc; Maczkowiak, Frédérique; Cariou, Marie-Louise

    2011-01-01

    Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that “resets” of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures. PMID:21611157

  6. Phylogenetic Distribution of Intron Positions in Alpha-Amylase Genes of Bilateria Suggests Numerous Gains and Losses

    OpenAIRE

    Da Lage, Jean-Luc; Maczkowiak, Frédérique; Cariou, Marie-Louise

    2011-01-01

    Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, al...

  7. Conservation of intron and intein insertion sites: implications for life histories of parasitic genetic elements

    Directory of Open Access Journals (Sweden)

    Senejani Alireza G

    2009-12-01

    Full Text Available Abstract Background Inteins and introns are genetic elements that are removed from proteins and RNA after translation or transcription, respectively. Previous studies have suggested that these genetic elements are found in conserved parts of the host protein. To our knowledge this type of analysis has not been done for group II introns residing within a gene. Here we provide quantitative statistical support from an analyses of proteins that host inteins, group I introns, group II introns and spliceosomal introns across all three domains of life. Results To determine whether or not inteins, group I, group II, and spliceosomal introns are found preferentially in conserved regions of their respective host protein, conservation profiles were generated and intein and intron positions were mapped to the profiles. Fisher's combined probability test was used to determine the significance of the distribution of insertion sites across the conservation profile for each protein. For a subset of studied proteins, the conservation profile and insertion positions were mapped to protein structures to determine if the insertion sites correlate to regions of functional activity. All inteins and most group I introns were found to be preferentially located within conserved regions; in contrast, a bacterial intein-like protein, group II and spliceosomal introns did not show a preference for conserved sites. Conclusions These findings demonstrate that inteins and group I introns are found preferentially in conserved regions of their respective host proteins. Homing endonucleases are often located within inteins and group I introns and these may facilitate mobility to conserved regions. Insertion at these conserved positions decreases the chance of elimination, and slows deletion of the elements, since removal of the elements has to be precise as not to disrupt the function of the protein. Furthermore, functional constrains on the targeted site make it more difficult

  8. Diversity, mobility, and structural and functional evolution of group II introns carrying an unusual 3' extension

    Directory of Open Access Journals (Sweden)

    Tourasse Nicolas J

    2011-12-01

    Full Text Available Abstract Background Group II introns are widespread genetic elements endowed with a dual functionality. They are catalytic RNAs (ribozymes that are able of self-splicing and they are also mobile retroelements that can invade genomic DNA. The group II intron RNA secondary structure is typically made up of six domains. However, a number of unusual group II introns carrying a unique extension of 53-56 nucleotides at the 3' end have been identified previously in bacteria of the Bacillus cereus group. Methods In the present study, we conducted combined sequence comparisons and phylogenetic analyses of introns, host gene, plasmid and chromosome of host strains in order to gain insights into mobility, dispersal, and evolution of the unusual introns and their extension. We also performed in vitro mutational and kinetic experiments to investigate possible functional features related to the extension. Results We report the identification of novel copies of group II introns carrying a 3' extension including the first two copies in bacteria not belonging to the B. cereus group, Bacillus pseudofirmus OF4 and Bacillus sp. 2_A_57_CT2, an uncharacterized species phylogenetically close to B. firmus. Interestingly, the B. pseudofirmus intron has a longer extension of 70 bases. From sequence comparisons and phylogenetic analyses, several possible separate events of mobility involving the atypical introns could be identified, including both retrohoming and retrotransposition events. In addition, identical extensions were found in introns that otherwise exhibit little sequence conservation in the rest of their structures, with the exception of the conserved and catalytically critical domains V and VI, suggesting either separate acquisition of the extra segment by different group II introns or a strong selection pressure acting on the extension. Furthermore, we show by in vitro splicing experiments that the 3' extension affects the splicing properties differently in

  9. The mitochondrial LSU rRNA group II intron of Ustilago maydis encodes an active homing endonuclease likely involved in intron mobility.

    Directory of Open Access Journals (Sweden)

    Anja Pfeifer

    Full Text Available BACKGROUND: The a2 mating type locus gene lga2 is critical for uniparental mitochondrial DNA inheritance during sexual development of Ustilago maydis. Specifically, the absence of lga2 results in biparental inheritance, along with efficient transfer of intronic regions in the large subunit rRNA gene between parental molecules. However, the underlying role of the predicted LAGLIDADG homing endonuclease gene I-UmaI located within the group II intron LRII1 has remained unresolved. METHODOLOGY/PRINCIPAL FINDINGS: We have investigated the enzymatic activity of I-UmaI in vitro based on expression of a tagged full-length and a naturally occurring mutant derivative, which harbors only the N-terminal LAGLIDADG domain. This confirmed Mg²⁺-dependent endonuclease activity and cleavage at the LRII1 insertion site to generate four base pair extensions with 3' overhangs. Specifically, I-UmaI recognizes an asymmetric DNA sequence with a minimum length of 14 base pairs (5'-GACGGGAAGACCCT-3' and tolerates subtle base pair substitutions within the homing site. Enzymatic analysis of the mutant variant indicated a correlation between the activity in vitro and intron homing. Bioinformatic analyses revealed that putatively functional or former functional I-UmaI homologs are confined to a few members within the Ustilaginales and Agaricales, including the phylogenetically distant species Lentinula edodes, and are linked to group II introns inserted into homologous positions in the LSU rDNA. CONCLUSIONS/SIGNIFICANCE: The present data provide strong evidence that intron homing efficiently operates under conditions of biparental inheritance in U. maydis. Conversely, uniparental inheritance may be critical to restrict the transmission of mobile introns. Bioinformatic analyses suggest that I-UmaI-associated introns have been acquired independently in distant taxa and are more widespread than anticipated from available genomic data.

  10. Variations of SSU rDNA group I introns in different isolates of Cordyceps militaris and the loss of an intron during cross-mating.

    Science.gov (United States)

    Lian, Tiantian; Yang, Tao; Sun, Junde; Guo, Suping; Yang, Huaijun; Dong, Caihong

    2014-08-01

    Cordyceps militaris, the type species of genus Cordyceps, is one of the most popular mushrooms and a nutraceutical in eastern Asia. It is considered a model organism for the study of Cordyceps species because it can complete its life cycle when cultured in vitro. In the present study, the occurrence and sequence variation of SSU rDNA group I introns, Cmi.S943 and Cmi.S1199, among different isolates of C. militaris were analyzed. Based on the secondary structure predictions, the Cmi.S943 intron has been placed in subgroup IC1, and the Cmi.S1199 intron has been placed in subgroup IE. No significant similarity between Cmi.S943 and Cmi.S1199 suggested different origins. Three genotypes, based on the frequency and distribution of introns, were described to discriminate the 57 surveyed C. militaris strains. It was found that the genotype was related to the stroma characteristics. The stromata of all of the genotype II strains, which possessed only Cmi.S943, could produce perithecium. In contrast, the stromata of all genotype III strains, which had both Cmi.S943 and Cmi.S1199, could not produce perithecium. Cmi.S1199 showed the lowest level of intra-specific variation among the tested strains. Group I introns can be lost during strain cross-mating. Therefore, we presumed that during cross-mating and recombination, intron loss could be driven by positive Darwinian selection due to the energetic cost of transcribing long introns.

  11. The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.

    Science.gov (United States)

    Jay, Zackary J; Inskeep, William P

    2015-07-09

    Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.

  12. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Directory of Open Access Journals (Sweden)

    Madeleine Zerbato

    Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  13. Comparison of mitochondrial genomes provides insights into intron dynamics and evolution in the caterpillar fungus Cordyceps militaris.

    Science.gov (United States)

    Zhang, Yongjie; Zhang, Shu; Zhang, Guozhen; Liu, Xingzhong; Wang, Chengshu; Xu, Jianping

    2015-04-01

    Intra-specific comparison of mitochondrial genomes can help elucidate the evolution of a species, however it has not been performed for hypocrealean fungi that form diverse symbiotic associations with other organisms. In this study, comparative analyses of three completely sequenced mitochondrial genomes of a hypocrealean fungus, Cordyceps militaris, the type species of Cordyceps genus, revealed that the introns were the main contributors to mitochondrial genome size variations among strains. Mitochondrial genes in C. militaris have been invaded by group I introns in at least eight positions. PCR assays of various C. militaris isolates showed abundant variations of intron presence/absence among strains at seven of the eight intronic loci. Although the ancestral intron pattern was inferred to contain all eight introns, loss and/or gain events occurred for seven of the eight introns. These introns invaded the C. militaris mitochondrial genome probably by horizontal transfer from other fungi, and intron insertions into intronless genes in C. militaris were accompanied by co-conversions of upstream exon sequences especially for those introns targeting protein-coding genes. We also detected phylogenetic congruence between the intron and exon trees at each individual locus, consistent with the ancestral mitochondria of C. militaris as having all eight introns. This study helps to explain the evolution of C. militaris mitochondrial genomes and will facilitate population genetic studies of this medicinally important fungus. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Alternative splicing of a group II intron in a surface layer protein gene in Clostridium tetani.

    Science.gov (United States)

    McNeil, Bonnie A; Simon, Dawn M; Zimmerly, Steven

    2014-02-01

    Group II introns are ribozymes and retroelements found in bacteria, and are thought to have been the ancestors of nuclear pre-mRNA introns. Whereas nuclear introns undergo prolific alternative splicing in some species, group II introns are not known to carry out equivalent reactions. Here we report a group II intron in the human pathogen Clostridium tetani, which undergoes four alternative splicing reactions in vivo. Together with unspliced transcript, five mRNAs are produced, each encoding a distinct surface layer protein isoform. Correct fusion of exon reading frames requires a shifted 5' splice site located 8 nt upstream of the canonical boundary motif. The shifted junction is accomplished by an altered IBS1-EBS1 pairing between the intron and 5' exon. Growth of C. tetani under a variety of conditions did not result in large changes in alternative splicing levels, raising the possibility that alternative splicing is constitutive. This work demonstrates a novel type of gene organization and regulation in bacteria, and provides an additional parallel between group II and nuclear pre-mRNA introns.

  15. Origin and evolution of chloroplast group I introns in lichen algae.

    Science.gov (United States)

    Del Hoyo, Alicia; Álvarez, Raquel; Gasulla, Francisco; Casano, Leonardo Mario; Del Campo, Eva María

    2018-02-01

    The history of group I introns is characterized by repeated horizontal transfers, even among phylogenetically distant species. The symbiogenetic thalli of lichens are good candidates for the horizontal transfer of genetic material among distantly related organisms, such as fungi and green algae. The main goal of this study was to determine whether there were different trends in intron distribution and properties among Chlorophyte algae based on their phylogenetic relationships and living conditions. Therefore, we investigated the occurrence, distribution and properties of group I introns within the chloroplast LSU rDNA in 87 Chlorophyte algae including lichen and free-living Trebouxiophyceae compared to free-living non-Trebouxiophyceae species. Overall, our findings showed that there was high diversity of group I introns and homing endonucleases (HEs) between Trebouxiophyceae and non-Trebouxiophyceae Chlorophyte algae, with divergence in their distribution patterns, frequencies and properties. However, the differences between lichen Trebouxiophyceae and free-living Trebouxiophyceae were smaller. An exception was the cL2449 intron, which was closely related to ω elements in yeasts. Such introns seem to occur more frequently in lichen Trebouxiophyceae compared to free-living Trebouxiophyceae. Our data suggest that lichenization and maintenance of lichen symbiosis for millions of years of evolution may have facilitated horizontal transfers of specific introns/HEs between symbionts. The data also suggest that sequencing of more chloroplast genes harboring group I introns in diverse algal groups may help us to understand the group I intron/HE transmission process within these organisms. © 2017 Phycological Society of America.

  16. Did group II intron proliferation in an endosymbiont-bearing archaeon create eukaryotes?

    Directory of Open Access Journals (Sweden)

    Poole Anthony M

    2006-12-01

    Full Text Available Abstract Martin & Koonin recently proposed that the eukaryote nucleus evolved as a quality control mechanism to prevent ribosome readthrough into introns. In their scenario, the bacterial ancestor of mitochondria was resident in an archaeal cell, and group II introns (carried by the fledgling mitochondrion inserted into coding regions in the archaeal host genome. They suggest that if transcription and translation were coupled, and because splicing is expected to have been slower than translation, the effect of insertion would have been ribosome readthrough into introns, resulting in production of aberrant proteins. The emergence of the nuclear compartment would thus have served to separate transcription and splicing from translation, thereby alleviating this problem. In this article, I argue that Martin & Koonin's model is not compatible with current knowledge. The model requires that group II introns would spread aggressively through an archaeal genome. It is well known that selfish elements can spread through an outbreeding sexual population despite a substantial fitness cost to the host. The same is not true for asexual lineages however, where both theory and observation argue that such elements will be under pressure to reduce proliferation, and may be lost completely. The recent introduction of group II introns into archaea by horizontal transfer provides a natural test case with which to evaluate Martin & Koonin's model. The distribution and behaviour of these introns fits prior theoretical expectations, not the scenario of aggressive proliferation advocated by Martin & Koonin. I therefore conclude that the mitochondrial seed hypothesis for the origin of eukaryote introns, on which their model is based, better explains the early expansion of introns in eukaryotes. The mitochondrial seed hypothesis has the capacity to separate the origin of eukaryotes from the origin of introns, leaving open the possibility that the cell that engulfed the

  17. In vivo expression of the nucleolar group I intron-encoded I-dirI homing endonuclease involves the removal of a spliceosomal intron

    DEFF Research Database (Denmark)

    Vader, A; Nielsen, Henrik; Johansen, S

    1999-01-01

    as truncation and polyadenylation downstream of the ORF 3' end. A spliceosomal intron, the first to be reported within a group I intron and the rDNA, is removed before the I-DirI mRNA associates with the polysomes. Taken together, our results imply that DiSSU1 uses a unique combination of intron......The Didymium iridis DiSSU1 intron is located in the nuclear SSU rDNA and has an unusual twin-ribozyme organization. One of the ribozymes (DiGIR2) catalyses intron excision and exon ligation. The other ribozyme (DiGIR1), which along with the endonuclease-encoding I-DirI open reading frame (ORF......) is inserted in DiGIR2, carries out hydrolysis at internal processing sites (IPS1 and IPS2) located at its 3' end. Examination of the in vivo expression of DiSSU1 shows that after excision, DiSSU1 is matured further into the I-DirI mRNA by internal DiGIR1-catalysed cleavage upstream of the ORF 5' end, as well...

  18. Intron Retention and TE Exonization Events in ZRANB2

    Directory of Open Access Journals (Sweden)

    Sang-Je Park

    2012-01-01

    Full Text Available The Zinc finger, RAN-binding domain-containing protein 2 (ZRANB2, contains arginine/serine-rich (RS domains that mediate its function in the regulation of alternative splicing. The ZRANB2 gene contains 2 LINE elements (L3b, Plat_L3 between the 9th and 10th exons. We identified the exonization event of a LINE element (Plat_L3. Using genomic PCR, RT-PCR amplification, and sequencing of primate DNA and RNA samples, we analyzed the evolutionary features of ZRANB2 transcripts. The results indicated that 2 of the LINE elements were integrated in human and all of the tested primate samples (hominoids: 3 species; Old World monkey: 8 species; New World monkey: 6 species; prosimian: 1 species. Human, rhesus monkey, crab-eating monkey, African-green monkey, and marmoset harbor the exon derived from LINE element (Plat_L3. RT-PCR amplification revealed the long transcripts and their differential expression patterns. Intriguingly, these long transcripts were abundantly expressed in Old World monkey lineages (rhesus, crab-eating, and African-green monkeys and were expressed via intron retention (IR. Thus, the ZRANB2 gene produces 3 transcript variants in which the Cterminus varies by transposable elements (TEs exonization and IR mechanisms. Therefore, ZRANB2 is valuable for investigating the evolutionary mechanisms of TE exonization and IR during primate evolution.

  19. Genetic Manipulation of Lactococcus lactis by Using Targeted Group II Introns: Generation of Stable Insertions without Selection

    Science.gov (United States)

    Frazier, Courtney L.; San Filippo, Joseph; Lambowitz, Alan M.; Mills, David A.

    2003-01-01

    Despite their commercial importance, there are relatively few facile methods for genomic manipulation of the lactic acid bacteria. Here, the lactococcal group II intron, Ll.ltrB, was targeted to insert efficiently into genes encoding malate decarboxylase (mleS) and tetracycline resistance (tetM) within the Lactococcus lactis genome. Integrants were readily identified and maintained in the absence of a selectable marker. Since splicing of the Ll.ltrB intron depends on the intron-encoded protein, targeted invasion with an intron lacking the intron open reading frame disrupted TetM and MleS function, and MleS activity could be partially restored by expressing the intron-encoded protein in trans. Restoration of splicing from intron variants lacking the intron-encoded protein illustrates how targeted group II introns could be used for conditional expression of any gene. Furthermore, the modified Ll.ltrB intron was used to separately deliver a phage resistance gene (abiD) and a tetracycline resistance marker (tetM) into mleS, without the need for selection to drive the integration or to maintain the integrant. Our findings demonstrate the utility of targeted group II introns as a potential food-grade mechanism for delivery of industrially important traits into the genomes of lactococci. PMID:12571038

  20. Recent mobility of plastid encoded group II introns and twintrons in five strains of the unicellular red alga Porphyridium

    Directory of Open Access Journals (Sweden)

    Marie-Mathilde Perrineau

    2015-06-01

    Full Text Available Group II introns are closely linked to eukaryote evolution because nuclear spliceosomal introns and the small RNAs associated with the spliceosome are thought to trace their ancient origins to these mobile elements. Therefore, elucidating how group II introns move, and how they lose mobility can potentially shed light on fundamental aspects of eukaryote biology. To this end, we studied five strains of the unicellular red alga Porphyridium purpureum that surprisingly contain 42 group II introns in their plastid genomes. We focused on a subset of these introns that encode mobility-conferring intron-encoded proteins (IEPs and found them to be distributed among the strains in a lineage-specific manner. The reverse transcriptase and maturase domains were present in all lineages but the DNA endonuclease domain was deleted in vertically inherited introns, demonstrating a key step in the loss of mobility. P. purpureum plastid intron RNAs had a classic group IIB secondary structure despite variability in the DIII and DVI domains. We report for the first time the presence of twintrons (introns-within-introns, derived from the same mobile element in Rhodophyta. The P. purpureum IEPs and their mobile introns provide a valuable model for the study of mobile retroelements in eukaryotes and offer promise for biotechnological applications.

  1. Comparative analysis of information contents relevant to recognition of introns in many species

    Directory of Open Access Journals (Sweden)

    Gotoh Osamu

    2011-01-01

    Full Text Available Abstract Background The basic process of RNA splicing is conserved among eukaryotic species. Three signals (5' and 3' splice sites and branch site are commonly used to directly conduct splicing, while other features are also related to the recognition of an intron. Although there is experimental evidence pointing to the significant species specificities in the features of intron recognition, a quantitative evaluation of the divergence of these features among a wide variety of eukaryotes has yet to be conducted. Results To better understand the splicing process from the viewpoints of evolution and information theory, we collected introns from 61 diverse species of eukaryotes and analyzed the properties of the nucleotide sequences relevant to splicing. We found that trees individually constructed from the five features (the three signals, intron length, and nucleotide composition within an intron roughly reflect the phylogenetic relationships among the species but sometimes extensively deviate from the species classification. The degree of topological deviation of each feature tree from the reference trees indicates the lowest discordance for the 5' splicing signal, followed by that for the 3' splicing signal, and a considerably greater discordance for the other three features. We also estimated the relative contributions of the five features to short intron recognition in each species. Again, moderate correlation was observed between the similarities in pattern of short intron recognition and the genealogical relationships among the species. When mammalian introns were categorized into three subtypes according to their terminal dinucleotide sequences, each subtype segregated into a nearly monophyletic group, regardless of the host species, with respect to the 5' and 3' splicing signals. It was also found that GC-AG introns are extraordinarily abundant in some species with high genomic G + C contents, and that the U12-type spliceosome might make a

  2. Novel intron markers to study the phylogeny of closely related mammalian species

    Directory of Open Access Journals (Sweden)

    Castresana Jose

    2010-11-01

    Full Text Available Abstract Background Multilocus phylogenies can be used to infer the species tree of a group of closely related species. In species trees, the nodes represent the actual separation between species, thus providing essential information about their evolutionary history. In addition, multilocus phylogenies can help in analyses of species delimitation, gene flow and genetic differentiation within species. However, few adequate markers are available for such studies. Results In order to develop nuclear markers that can be useful in multilocus studies of mammals, we analyzed the mammalian genomes of human, chimpanzee, macaque, dog and cow. Rodents were excluded due to their unusual genomic features. Introns were extracted from the mammalian genomes because of their greater genetic variability and ease of amplification from the flanking exons. To an initial set of more than 10,000 one-to-one orthologous introns we applied several filters to select introns that belong to single-copy genes, show neutral evolutionary rates and have an adequate length for their amplification. This analysis led to a final list of 224 intron markers randomly distributed along the genome. To experimentally test their validity, we amplified twelve of these introns in a panel of six mammalian species. The result was that seven of these introns gave rise to a PCR band of the expected size in all species. In addition, we sequenced these bands and analyzed the accumulation of substitutions in these introns in five pairs of closely related species. The results showed that the estimated genetic distances in the five species pairs was quite variable among introns and that this divergence cannot be directly predicted from the overall intron divergence in mammals. Conclusions We have designed a new set of 224 nuclear introns with optimal features for the phylogeny of closely related mammalian species. A large proportion of the introns tested experimentally showed a perfect amplification

  3. Asthma and COPD in cystic fibrosis intron-8 5T carriers. A population-based study

    DEFF Research Database (Denmark)

    Dahl, Morten; Tybjaerg-Hansen, Anne; Lange, Peter

    2005-01-01

    Carriers of cystic fibrosis intron-8 5T alleles with high exon-9 skipping could have increased annual lung function decline and increased risk for asthma or chronic obstructive pulmonary disease (COPD).......Carriers of cystic fibrosis intron-8 5T alleles with high exon-9 skipping could have increased annual lung function decline and increased risk for asthma or chronic obstructive pulmonary disease (COPD)....

  4. Unusual group II introns in bacteria of the Bacillus cereus group.

    Science.gov (United States)

    Tourasse, Nicolas J; Stabell, Fredrik B; Reiter, Lillian; Kolstø, Anne-Brit

    2005-08-01

    A combination of sequence and structure analysis and reverse transcriptase PCR experiments was used to characterize the group II introns in the complete genomes of two strains of the pathogen Bacillus cereus. While B. cereus ATCC 14579 harbors a single intron element in the chromosome, B. cereus ATCC 10987 contains three introns in the chromosome and four in its 208-kb pBc10987 plasmid. The most striking finding is the presence in B. cereus ATCC 10987 of an intron [B.c.I2(a)] located on the reverse strand of a gene encoding a putative cell surface protein which appears to be correlated to strains of clinical origin. Because of the opposite orientation of B.c.I2(a), the gene is disrupted. Even more striking is that B.c.I2(a) splices out of an RNA transcript corresponding to the opposite DNA strand. All other intragenic introns studied here are inserted in the same orientation as their host genes and splice out of the mRNA in vivo, setting the flanking exons in frame. Noticeably, B.c.I3 in B. cereus ATCC 10987 represents the first example of a group II intron entirely included within a conserved replication gene, namely, the alpha subunit of DNA polymerase III. Another striking finding is that the observed 3' splice site of B.c.I4 occurs 56 bp after the predicted end of the intron. This apparently unusual splicing mechanism may be related to structural irregularities in the 3' terminus. Finally, we also show that the intergenic introns of B. cereus ATCC 10987 are transcribed with their upstream genes and do splice in vivo.

  5. Clinical significance of intronic variants in BRAF inhibitor resistant melanomas with altered BRAF transcript splicing

    OpenAIRE

    Pupo, Gulietta M.; Boyd, Suzanah C.; Fung, Carina; Carlino, Matteo S.; Menzies, Alexander M.; Pedersen, Bernadette; Johansson, Peter; Hayward, Nicholas K.; Kefford, Richard F.; Scolyer, Richard A.; Long, Georgina V.; Rizos, Helen

    2017-01-01

    Alternate BRAF splicing is the most common mechanism of acquired resistance to BRAF inhibitor treatment in melanoma. Recently, alternate BRAF exon 4?8 splicing was shown to involve an intronic mutation, located 51 nucleotides upstream of BRAF exon 9 within a predicted splicing branch point. This intronic mutation was identified in a single cell line but has not been examined in vivo. Herein we demonstrate that in three melanomas biopsied from patients with acquired resistance to BRAF inhibito...

  6. tRNA-like recognition of group I introns by a tyrosyl-tRNA synthetase.

    Science.gov (United States)

    Myers, Christopher A; Kuhla, Birte; Cusack, Stephen; Lambowitz, Alan M

    2002-03-05

    The Neurospora crassa mitochondrial tyrosyl-tRNA synthetase (CYT-18 protein) functions in splicing group I introns by promoting the formation of the catalytically active RNA structure. Previous work suggested that CYT-18 recognizes a conserved tRNA-like structure of the group I intron catalytic core. Here, directed hydroxyl-radical cleavage assays show that the nucleotide-binding fold and C-terminal domains of CYT-18 interact with the expected group I intron cognates of the aminoacyl-acceptor stem and D-anticodon arms, respectively. Further, three-dimensional graphic modeling, supported by biochemical data, shows that conserved regions of group I introns can be superimposed over interacting regions of the tRNA in a Thermus thermophilus TyrRS/tRNA(Tyr) cocrystal structure. Our results support the hypothesis that CYT-18 and other aminoacyl-tRNA synthetases interact with group I introns by recognizing conserved tRNA-like structural features of the intron RNAs.

  7. Characterization of the molecular basis of group II intron RNA recognition by CRS1-CRM domains.

    Science.gov (United States)

    Keren, Ido; Klipcan, Liron; Bezawork-Geleta, Ayenachew; Kolton, Max; Shaya, Felix; Ostersetzer-Biran, Oren

    2008-08-22

    CRM (chloroplast RNA splicing and ribosome maturation) is a recently recognized RNA-binding domain of ancient origin that has been retained in eukaryotic genomes only within the plant lineage. Whereas in bacteria CRM domains exist as single domain proteins involved in ribosome maturation, in plants they are found in a family of proteins that contain between one and four repeats. Several members of this family with multiple CRM domains have been shown to be required for the splicing of specific plastidic group II introns. Detailed biochemical analysis of one of these factors in maize, CRS1, demonstrated its high affinity and specific binding to the single group II intron whose splicing it facilitates, the plastid-encoded atpF intron RNA. Through its association with two intronic regions, CRS1 guides the folding of atpF intron RNA into its predicted "catalytically active" form. To understand how multiple CRM domains cooperate to achieve high affinity sequence-specific binding to RNA, we analyzed the RNA binding affinity and specificity associated with each individual CRM domain in CRS1; whereas CRM3 bound tightly to the RNA, CRM1 associated specifically with a unique region found within atpF intron domain I. CRM2, which demonstrated only low binding affinity, also seems to form specific interactions with regions localized to domains I, III, and IV. We further show that CRM domains share structural similarities and RNA binding characteristics with the well known RNA recognition motif domain.

  8. Evidence for intron length conservation in a set of mammalian genes associated with embryonic development

    LENUS (Irish Health Repository)

    2011-10-05

    Abstract Background We carried out an analysis of intron length conservation across a diverse group of nineteen mammalian species. Motivated by recent research suggesting a role for time delays associated with intron transcription in gene expression oscillations required for early embryonic patterning, we searched for examples of genes that showed the most extreme conservation of total intron content in mammals. Results Gene sets annotated as being involved in pattern specification in the early embryo or containing the homeobox DNA-binding domain, were significantly enriched among genes with highly conserved intron content. We used ancestral sequences reconstructed with probabilistic models that account for insertion and deletion mutations to distinguish insertion and deletion events on lineages leading to human and mouse from their last common ancestor. Using a randomization procedure, we show that genes containing the homeobox domain show less change in intron content than expected, given the number of insertion and deletion events within their introns. Conclusions Our results suggest selection for gene expression precision or the existence of additional development-associated genes for which transcriptional delay is functionally significant.

  9. Structural Metals in the Group I Intron: A Ribozyme with a Multiple Metal Ion Core

    Energy Technology Data Exchange (ETDEWEB)

    Stahley,M.; Adams, P.; Wang, J.; Strobel, S.

    2007-01-01

    Metal ions play key roles in the folding and function for many structured RNAs, including group I introns. We determined the X-ray crystal structure of the Azoarcus bacterial group I intron in complex with its 5' and 3' exons. In addition to 222 nucleotides of RNA, the model includes 18 Mg2+ and K+ ions. Five of the metals bind within 12 Angstroms of the scissile phosphate and coordinate the majority of the oxygen atoms biochemically implicated in conserved metal-RNA interactions. The metals are buried deep within the structure and form a multiple metal ion core that is critical to group I intron structure and function. Eight metal ions bind in other conserved regions of the intron structure, and the remaining five interact with peripheral structural elements. Each of the 18 metals mediates tertiary interactions, facilitates local bends in the sugar-phosphate backbone or binds in the major groove of helices. The group I intron has a rich history of biochemical efforts aimed to identify RNA-metal ion interactions. The structural data are correlated to the biochemical results to further understand the role of metal ions in group I intron structure and function.

  10. Group II introns break new boundaries: presence in a bilaterian's genome.

    Directory of Open Access Journals (Sweden)

    Yvonne Vallès

    Full Text Available Group II introns are ribozymes, removing themselves from their primary transcripts, as well as mobile genetic elements, transposing via an RNA intermediate, and are thought to be the ancestors of spliceosomal introns. Although common in bacteria and most eukaryotic organelles, they have never been reported in any bilaterian animal genome, organellar or nuclear. Here we report the first group II intron found in the mitochondrial genome of a bilaterian worm. This location is especially surprising, since animal mitochondrial genomes are generally distinct from those of plants, fungi, and protists by being small and compact, and so are viewed as being highly streamlined, perhaps as a result of strong selective pressures for fast replication while establishing germ plasm during early development. This intron is found in the mtDNA of an annelid worm, (an undescribed species of Nephtys, where the complete sequence revealed a 1819 bp group II intron inside the cox1 gene. We infer that this intron is the result of a recent horizontal gene transfer event from a viral or bacterial vector into the mitochondrial genome of Nephtys sp. Our findings hold implications for understanding mechanisms, constraints, and selective pressures that account for patterns of animal mitochondrial genome evolution.

  11. Protecting exons from deleterious R-loops: a potential advantage of having introns

    Directory of Open Access Journals (Sweden)

    Niu Deng-Ke

    2007-04-01

    Full Text Available Abstract Background Accumulating evidence indicates that the nascent RNA can invade and pair with one strand of DNA, forming an R-loop structure that threatens the stability of the genome. In addition, the cost and benefit of introns are still in debate. Results At least three factors are likely required for the R-loop formation: 1 sequence complementarity between the nascent RNA and the target DNA, 2 spatial juxtaposition between the nascent RNA and the template DNA, and 3 accessibility of the template DNA and the nascent RNA. The removal of introns from pre-mRNA reduces the complementarity between RNA and the template DNA and avoids the spatial juxtaposition between the nascent RNA and the template DNA. In addition, the secondary structures of group I and group II introns may act as spatial obstacles for the formation of R-loops between nearby exons and the genomic DNA. Conclusion Organisms may benefit from introns by avoiding deleterious R-loops. The potential contribution of this benefit in driving intron evolution is discussed. I propose that additional RNA polymerases may inhibit R-loop formation between preceding nascent RNA and the template DNA. This idea leads to a testable prediction: intermittently transcribed genes and genes with frequently prolonged transcription should have higher intron density. Reviewers This article was reviewed by Dr. Eugene V. Koonin, Dr. Alexei Fedorov (nominated by Dr. Laura F Landweber, and Dr. Scott W. Roy (nominated by Dr. Arcady Mushegian.

  12. Exon sequence requirements for excision in vivo of the bacterial group II intron RmInt1

    Directory of Open Access Journals (Sweden)

    Toro Nicolás

    2011-05-01

    Full Text Available Abstract Background Group II intron splicing proceeds through two sequential transesterification reactions in which the 5' and 3'-exons are joined together and the lariat intron is released. The intron-encoded protein (IEP assists the splicing of the intron in vivo and remains bound to the excised intron lariat RNA in a ribonucleoprotein particle (RNP that promotes intron mobility. Exon recognition occurs through base-pairing interactions between two guide sequences on the ribozyme domain dI known as EBS1 and EBS2 and two stretches of sequence known as IBS1 and IBS2 on the 5' exon, whereas the 3' exon is recognized through interaction with the sequence immediately upstream from EBS1 [(δ-δ' interaction (subgroup IIA] or with a nucleotide [(EBS3-IBS3 interaction (subgroup IIB and IIC] located in the coordination-loop of dI. The δ nucleotide is involved in base pairing with another intron residue (δ' in subgroup IIB introns and this interaction facilitates base pairing between the 5' exon and the intron. Results In this study, we investigated nucleotide requirements in the distal 5'- and 3' exon regions, EBS-IBS interactions and δ-δ' pairing for excision of the group IIB intron RmInt1 in vivo. We found that the EBS1-IBS1 interaction was required and sufficient for RmInt1 excision. In addition, we provide evidence for the occurrence of canonical δ-δ' pairing and its importance for the intron excision in vivo. Conclusions The excision in vivo of the RmInt1 intron is a favored process, with very few constraints for sequence recognition in both the 5' and 3'-exons. Our results contribute to understand how group II introns spread in nature, and might facilitate the use of RmInt1 in gene targeting.

  13. The Agaricus bisporus cox1 gene: the longest mitochondrial gene and the largest reservoir of mitochondrial group i introns.

    Directory of Open Access Journals (Sweden)

    Cyril Férandon

    Full Text Available In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a "Homing Endonuclease Gene" (heg encoding a DNA endonuclease acting in transfer and site-specific integration ("homing" and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote.

  14. Self-splicing of a group IIC intron: 5? exon recognition and alternative 5? splicing events implicate the stem?loop motif of a transcriptional terminator

    OpenAIRE

    Toor, Navtej; Robart, Aaron R.; Christianson, Joshua; Zimmerly, Steven

    2006-01-01

    Bacterial IIC introns are a newly recognized subclass of group II introns whose ribozyme properties have not been characterized in detail. IIC introns are typically located downstream of transcriptional terminator motifs (inverted repeat followed by T's) or other inverted repeats in bacterial genomes. Here we have characterized the self-splicing activity of a IIC intron, B.h.I1, from Bacillus halodurans. B.h.I1 self-splices in vitro through hydrolysis to produce linear intron, but interesting...

  15. GRK5 intronic (CAn polymorphisms associated with type 2 diabetes in Chinese Hainan Island.

    Directory of Open Access Journals (Sweden)

    Zhenfang Xia

    Full Text Available A genome-wide association study had showed G-protein-coupled receptor kinase 5 (GRK5 rs10886471 was related to the risk of type 2 diabetes mellitus (T2DM through upregulated GRK5 mRNA expression. Rs10886471 is located in the intron region of GRK5. However, the mechanism by which intronic SNP affects gene expression remains unclear, whether the effect on gene expression depends on the intronic short tandem repeat (STR (CAn splicing regulator or not. Here we investigated the STR (CAn polymorphism in rs10886471 and further discussed its role in the T2DM risk of Chinese Hainan Island individuals. A total of 1164 subjects were recruited and classified into a normal fasting glucose (NFG group, an impaired fasting glucose (IFG group, an impaired glucose tolerance (IGT group, and a T2DM group. STR (CAn polymorphisms were detected through polymerase chain reaction and sequencing. Five intronic (CAn alleles, (CA15 to (CA19, were identified in GRK5 rs10886471. Only the (CA16 allele was significantly associated with increased prediabetes and T2DM risk [odds ratio (OR>1, P<0.05]. Conversely, multiple alleles without any (CA16 protected against prediabetes and T2DM (0intronic SNP causes GRK5 overexpression the subsequent risk of T2DM may be due to the rs10886471 intronic STR (CAn splicing enhancer. Further studies should focus on verifying these finding using a large sample size and analyzing the splicing mechanism of intronic (CAn in rs10886471.

  16. Multiple recent horizontal transfers of the cox1 intron in Solanaceae and extended co-conversion of flanking exons.

    Science.gov (United States)

    Sanchez-Puerta, Maria V; Abbona, Cinthia C; Zhuo, Shi; Tepe, Eric J; Bohs, Lynn; Olmstead, Richard G; Palmer, Jeffrey D

    2011-09-27

    The most frequent case of horizontal transfer in plants involves a group I intron in the mitochondrial gene cox1, which has been acquired via some 80 separate plant-to-plant transfer events among 833 diverse angiosperms examined. This homing intron encodes an endonuclease thought to promote the intron's promiscuous behavior. A promising experimental approach to study endonuclease activity and intron transmission involves somatic cell hybridization, which in plants leads to mitochondrial fusion and genome recombination. However, the cox1 intron has not yet been found in the ideal group for plant somatic genetics - the Solanaceae. We therefore undertook an extensive survey of this family to find members with the intron and to learn more about the evolutionary history of this exceptionally mobile genetic element. Although 409 of the 426 species of Solanaceae examined lack the cox1 intron, it is uniformly present in three phylogenetically disjunct clades. Despite strong overall incongruence of cox1 intron phylogeny with angiosperm phylogeny, two of these clades possess nearly identical intron sequences and are monophyletic in intron phylogeny. These two clades, and possibly the third also, contain a co-conversion tract (CCT) downstream of the intron that is extended relative to all previously recognized CCTs in angiosperm cox1. Re-examination of all published cox1 genes uncovered additional cases of extended co-conversion and identified a rare case of putative intron loss, accompanied by full retention of the CCT. We infer that the cox1 intron was separately and recently acquired by at least three different lineages of Solanaceae. The striking identity of the intron and CCT from two of these lineages suggests that one of these three intron captures may have occurred by a within-family transfer event. This is consistent with previous evidence that horizontal transfer in plants is biased towards phylogenetically local events. The discovery of extended co

  17. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters.

    Science.gov (United States)

    Zhang, Ning; McHale, Leah K; Finer, John J

    2016-01-01

    Introns, especially the first intron in the 5' untranslated region (5'UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement.

  18. Two self-splicing group I introns in the ribonucleotide reductase large subunit gene of Staphylococcus aureus phage Twort

    OpenAIRE

    Landthaler, Markus; Begley, Ulrike; Lau, Nelson C.; Shub, David A.

    2002-01-01

    We have recently described three group I introns inserted into a single gene, orf142, of the staphylococcal bacteriophage Twort and suggested the presence of at least two additional self-splicing introns in this phage genome. Here we report that two previously uncharacterized introns, 429 and 1087 nt in length, interrupt the Twort gene coding for the large subunit of ribonucleotide reductase (nrdE). Reverse transcription-polymerase chain reaction (RT-PCR) of RNA isolated from Staphylococcus a...

  19. Short-term sequence evolution and vertical inheritance of the Naegleria twin-ribozyme group I intron

    Directory of Open Access Journals (Sweden)

    De Jonckheere Johan F

    2006-05-01

    Full Text Available Abstract Background Ribosomal DNA of several species of the free-living Naegleria amoeba harbors an optional group I intron within the nuclear small subunit ribosomal RNA gene. The intron (Nae.S516 has a complex organization of two ribozyme domains (NaGIR1 and NaGIR2 and a homing endonuclease gene (NaHEG. NaGIR2 is responsible for intron excision, exon ligation, and full-length intron RNA circularization, reactions typical for nuclear group I intron ribozymes. NaGIR1, however, is essential for NaHEG expression by generating the 5' end of the homing endonuclease messenger RNA. Interestingly, this unusual class of ribozyme adds a lariat-cap at the mRNA. Results To elucidate the evolutionary history of the Nae.S516 twin-ribozyme introns we have analyzed 13 natural variants present in distinct Naegleria isolates. Structural variabilities were noted within both the ribozyme domains and provide strong comparative support to the intron secondary structure. One of the introns, present in N. martinezi NG872, contains hallmarks of a degenerated NaHEG. Phylogenetic analyses performed on separate data sets representing NaGIR1, NaGIR2, NaHEG, and ITS1-5.8S-ITS2 ribosomal DNA are consistent with an overall vertical inheritance pattern of the intron within the Naegleria genus. Conclusion The Nae.S516 twin-ribozyme intron was gained early in the Naegleria evolution with subsequent vertical inheritance. The intron was lost in the majority of isolates (70%, leaving a widespread but scattered distribution pattern. Why the apparent asexual Naegleria amoebae harbors active intron homing endonucleases, dependent on sexual reproduction for its function, remains a puzzle.

  20. Evolution of small putative group I introns in the SSU rRNA gene locus of Phialophora species

    Directory of Open Access Journals (Sweden)

    Harris Lorena B

    2011-07-01

    Full Text Available Abstract Background Group I introns (specifically subgroup IC1 are common in the nuclear ribosomal RNA genes of fungi. While most range in length from more than 200 to nearly 1800 nucleotides (nt in length, several small putative (or degenerate group I introns have been described that are between 56 and 81 nt. Although small, previously we demonstrated that the PaSSU intron in the rRNA small subunit gene of Phialophora americana isolate Wang 1046 is capable of in vitro splicing using a standard group I intron pathway, thus qualifying it as a functional ribozyme. Findings Here, we describe eight short putative group I introns, ranging in length from 63 to 75 nt, in the rRNA small subunit genes of Phialophora isolates, a fungal genus that ranges from saprobic to pathogenic on plants and animals. All contain putative pairing regions P1, P7, and P10, as well as a pairing region formed between the middle of the intron and part of the 3' exon. The other pairing regions common in the core of standard group I introns are absent. However, parts of the 3' exon may aid in the stabilization of these small introns. Although the eight putative group I introns were from at least three species of Phialophora, phylogenetic analysis indicated that the eight are monophyletic. They are also monophyletic with the small introns of two lichen-forming fungi, Porpidia crustulata and Arthonia lapidicola. Conclusions The small putative group I introns in Phialophora have common features that may represent group I introns at their minima. They appear to have a single origin as indicated by their monophyly in phylogenetic analyses.

  1. Whole exon 5 and intron 5 replaced by RHCE in DVa(Hus).

    Science.gov (United States)

    Shao, Chaopeng; Xiong, Wen; Wang, Wei

    2004-01-01

    The DVa(Hus) was previously investigated through cDNA analysis, which revealed an RHD-CE(5)-D hybrid allele. However, the 5' and 3' breakpoints remain unknown. In this article, gene recombinations between the RHD and RHCE alleles were investigated by a combination approach of a sequence-specific primer PCR (PCR-SSP) and an RHD full-length coding region sequencing method on two Chinese subjects with weak D phenotypes. The hybrid Rhesus box of each individual was also investigated through an established PCR-based method. As a result, two partial D phenotypes, DVa(Hus) and DVI type III, were identified, each carrying one hybrid RHD-CE-D allele. The two samples were also serotyped with Rh phontypes of DccEe and DCcee, respectively. Other sequencing analyses of the DVaHus sample showed that the sequence of intron 4 is identical with RHD, whereas the whole sequence of exon 5 and intron 5 is identical with RHCE except for seven polymorphisms in the intron 5. We may concluded that in the case of this Chinese DVa(Hus), the whole exon 5 and complete intron 5 of a total segment of 1801 nucleotides were replaced by RHCE suggesting that the breakpoints of the replaced region are the 5' end of the exon 5 and the 3' end of the intron 5.

  2. Introns regulate gene expression in Cryptococcus neoformans in a Pab2p dependent pathway.

    Directory of Open Access Journals (Sweden)

    Carolin Goebels

    Full Text Available Most Cryptococccus neoformans genes are interrupted by introns, and alternative splicing occurs very often. In this study, we examined the influence of introns on C. neoformans gene expression. For most tested genes, elimination of introns greatly reduces mRNA accumulation. Strikingly, the number and the position of introns modulate the gene expression level in a cumulative manner. A screen for mutant strains able to express functionally an intronless allele revealed that the nuclear poly(A binding protein Pab2 modulates intron-dependent regulation of gene expression in C. neoformans. PAB2 deletion partially restored accumulation of intronless mRNA. In addition, our results demonstrated that the essential nucleases Rrp44p and Xrn2p are implicated in the degradation of mRNA transcribed from an intronless allele in C. neoformans. Double mutant constructions and over-expression experiments suggested that Pab2p and Xrn2p could act in the same pathway whereas Rrp44p appears to act independently. Finally, deletion of the RRP6 or the CID14 gene, encoding the nuclear exosome nuclease and the TRAMP complex associated poly(A polymerase, respectively, has no effect on intronless allele expression.

  3. Introns Regulate Gene Expression in Cryptococcus neoformans in a Pab2p Dependent Pathway

    Science.gov (United States)

    Goebels, Carolin; Thonn, Aline; Gonzalez-Hilarion, Sara; Rolland, Olga; Moyrand, Frederique; Beilharz, Traude H.; Janbon, Guilhem

    2013-01-01

    Most Cryptococccus neoformans genes are interrupted by introns, and alternative splicing occurs very often. In this study, we examined the influence of introns on C. neoformans gene expression. For most tested genes, elimination of introns greatly reduces mRNA accumulation. Strikingly, the number and the position of introns modulate the gene expression level in a cumulative manner. A screen for mutant strains able to express functionally an intronless allele revealed that the nuclear poly(A) binding protein Pab2 modulates intron-dependent regulation of gene expression in C. neoformans. PAB2 deletion partially restored accumulation of intronless mRNA. In addition, our results demonstrated that the essential nucleases Rrp44p and Xrn2p are implicated in the degradation of mRNA transcribed from an intronless allele in C. neoformans. Double mutant constructions and over-expression experiments suggested that Pab2p and Xrn2p could act in the same pathway whereas Rrp44p appears to act independently. Finally, deletion of the RRP6 or the CID14 gene, encoding the nuclear exosome nuclease and the TRAMP complex associated poly(A) polymerase, respectively, has no effect on intronless allele expression. PMID:23966870

  4. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  5. Long-term evolution of the S788 fungal nuclear small subunit rRNA group I introns

    OpenAIRE

    HAUGEN, PEIK; RUNGE, HENRY JOSEPH; BHATTACHARYA, DEBASHISH

    2004-01-01

    More than 1000 group I introns have been identified in fungal rDNA. Little is known, however, of the splicing and secondary structure evolution of these ribozymes. Here, we use a combination of comparative and biochemical methods to address the evolution and splicing of a vertically inherited group I intron found at position 788 in the fungal small subunit (S) rRNA. The ancestral state of the S788 intron contains a highly conserved core and an extended P5 domain typical of IC1 introns. In con...

  6. AtnMat2, a nuclear-encoded maturase required for splicing of group-II introns in Arabidopsis mitochondria

    OpenAIRE

    Keren, Ido; Bezawork-Geleta, Ayenachew; Kolton, Max; Maayan, Inbar; Belausov, Eduard; Levy, Maggie; Mett, Anahit; Gidoni, David; Shaya, Felix; Ostersetzer-Biran, Oren

    2009-01-01

    Mitochondria (mt) in plants house about 20 group-II introns, which lie within protein-coding genes required in both organellar genome expression and respiration activities. While in nonplant systems the splicing of group-II introns is mediated by proteins encoded within the introns themselves (known as “maturases”), only a single maturase ORF (matR) has retained in the mitochondrial genomes in plants; however, its putative role(s) in the splicing of organellar introns is yet to be established...

  7. tRNALeu intron (UAA) of Ficus carica L.: genetic diversity and evolutionary patterns.

    Science.gov (United States)

    Baraket, G; Abdelkrim, A B; Salhi-Hannachi, A

    2015-04-22

    Cytoplasmic chloroplast DNA was explored to establish genetic relationships among Ficus carica cultivars and elucidate the molecular evolution of the species. The results suggest the occurrence of haplotype and nucleotide diversity. Conserved group I intron sequence motifs were detected and showed a common secondary structure, despite the presence of some mutations on their sequences. The neighbor-joining dendrogram showed a continuous diversity that characterizes local resources. The maximum parsimony tree, with an RI index of 0.507, indicated minimal homoplasy within the data set. Furthermore, our results demonstrate that the trnL intron is the seat of numerous substitutions. Herein, new insight on the mechanism involved in the evolution of the trnL intron in the fig is presented. From the study, it appears that there is an explicit rejection of the null hypothesis in F. carica. A scenario of positive selection and recent expansion of F. carica genotypes across Tunisia seems to be retained.

  8. Novel RNA structural features of an alternatively splicing group II intron from Clostridium tetani.

    Science.gov (United States)

    McNeil, Bonnie A; Zimmerly, Steven

    2014-06-01

    Group II introns are ribozymes in bacterial and organellar genomes that function as self-splicing introns and as retroelements. Previously, we reported that the group II intron C.te.I1 of Clostridium tetani alternatively splices in vivo to produce five distinct coding mRNAs. Accurate fusion of upstream and downstream reading frames requires a shifted 5' splice site located 8 nt upstream of the usual 5' GUGYG motif. This site is specified by the ribozyme through an altered intron/exon-binding site 1 (IBS1-EBS1) pairing. Here we use mutagenesis and self-splicing assays to investigate in more detail the significance of the structural features of the C.te.I1 ribozyme. The shifted 5' splice site is shown to be affected by structures in addition to IBS1-EBS1, and unlike other group II introns, C.te.I1 appears to require a spacer between IBS1 and the GUGYG motif. In addition, the mechanism of 3' exon recognition is modified from the ancestral IIB mechanism to a IIA-like mechanism that appears to be longer than the typical single base-pair interaction and may extend up to 4 bp. The novel ribozyme properties that have evolved for C.te.I1 illustrate the plasticity of group II introns in adapting new structural and catalytic properties that can be utilized to affect gene expression. © 2014 McNeil and Zimmerly; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  9. Macronuclear genome structure of the ciliate Nyctotherus ovalis: Single-gene chromosomes and tiny introns

    Directory of Open Access Journals (Sweden)

    Landweber Laura F

    2008-12-01

    Full Text Available Abstract Background Nyctotherus ovalis is a single-celled eukaryote that has hydrogen-producing mitochondria and lives in the hindgut of cockroaches. Like all members of the ciliate taxon, it has two types of nuclei, a micronucleus and a macronucleus. N. ovalis generates its macronuclear chromosomes by forming polytene chromosomes that subsequently develop into macronuclear chromosomes by DNA elimination and rearrangement. Results We examined the structure of these gene-sized macronuclear chromosomes in N. ovalis. We determined the telomeres, subtelomeric regions, UTRs, coding regions and introns by sequencing a large set of macronuclear DNA sequences (4,242 and cDNAs (5,484 and comparing them with each other. The telomeres consist of repeats CCC(AAAACCCCn, similar to those in spirotrichous ciliates such as Euplotes, Sterkiella (Oxytricha and Stylonychia. Per sequenced chromosome we found evidence for either a single protein-coding gene, a single tRNA, or the complete ribosomal RNAs cluster. Hence the chromosomes appear to encode single transcripts. In the short subtelomeric regions we identified a few overrepresented motifs that could be involved in gene regulation, but there is no consensus polyadenylation site. The introns are short (21–29 nucleotides, and a significant fraction (1/3 of the tiny introns is conserved in the distantly related ciliate Paramecium tetraurelia. As has been observed in P. tetraurelia, the N. ovalis introns tend to contain in-frame stop codons or have a length that is not dividable by three. This pattern causes premature termination of mRNA translation in the event of intron retention, and potentially degradation of unspliced mRNAs by the nonsense-mediated mRNA decay pathway. Conclusion The combination of short leaders, tiny introns and single genes leads to very minimal macronuclear chromosomes. The smallest we identified contained only 150 nucleotides.

  10. Plant siRNAs from introns mediate DNA methylation of host genes.

    Science.gov (United States)

    Chen, Dijun; Meng, Yijun; Yuan, Chunhui; Bai, Lin; Huang, Donglin; Lv, Shaolei; Wu, Ping; Chen, Ling-Ling; Chen, Ming

    2011-06-01

    Small RNAs (sRNAs), largely known as microRNAs (miRNAs) and short interfering RNAs (siRNAs), emerged as the critical components of genetic and epigenetic regulation in eukaryotic genomes. In animals, a sizable portion of miRNAs reside within the introns of protein-coding genes, designated as mirtron genes. Recently, high-throughput sequencing (HTS) revealed a huge amount of sRNAs that derived from introns in plants, such as the monocot rice (Oryza sativa). However, the biogenesis and the biological functions of this kind of sRNAs remain elusive. Here, we performed a genome-scale survey of intron-derived sRNAs in rice based on HTS data. Several introns were found to have great potential to form internal hairpin structures, and the short hairpins could generate miRNAs while the larger ones could produce siRNAs. Furthermore, 22 introns, termed "sirtrons," were identified from the rice protein-coding genes. The single-stranded sirtrons produced a diverse set of siRNAs from long hairpin structures. These sirtron-derived siRNAs are dominantly 21 nt, 22 nt, and 24 nt in length, whose production relied on DCL4, DCL2, and DCL3, respectively. We also observed a strong tendency for the sirtron-derived siRNAs to be coexpressed with their host genes. Finally, the 24-nt siRNAs incorporated with Argonaute 4 (AGO4) could direct DNA methylation on their host genes. In this regard, homeostatic self-regulation between intron-derived siRNAs and their host genes was proposed.

  11. Regulation of Retention of FosB Intron 4 by PTB

    OpenAIRE

    Marinescu, Victor; Loomis, Patricia A.; Ehmann, Svetlana; Beales, Mitchell; Potashkin, Judith A.

    2007-01-01

    One effect of stressors such as chronic drug administration is that sequence within the terminal exon of the transcription factor FosB is recognized as intronic and removed by alternative splicing. This results in an open-reading-frame shift that produces a translation stop codon and ultimately a truncated protein, termed DeltaFosB. In vitro splicing assays with control and mutated transcripts generated from a fosB mini-gene construct indicated a CU-rich sequence at the 3' end of intron 4 (I4...

  12. Evidence for transitional stages in the evolution of euglenid group II introns and twintrons in the Monomorphina aenigmatica plastid genome.

    Directory of Open Access Journals (Sweden)

    Jean-François Pombert

    Full Text Available Photosynthetic euglenids acquired their plastid by secondary endosymbiosis of a prasinophyte-like green alga. But unlike its prasinophyte counterparts, the plastid genome of the euglenid Euglena gracilis is riddled with introns that interrupt almost every protein-encoding gene. The atypical group II introns and twintrons (introns-within-introns found in the E. gracilis plastid have been hypothesized to have been acquired late in the evolution of euglenids, implying that massive numbers of introns may be lacking in other taxa. This late emergence was recently corroborated by the plastid genome sequences of the two basal euglenids, Eutreptiella gymnastica and Eutreptia viridis, which were found to contain fewer introns.To gain further insights into the proliferation of introns in euglenid plastids, we have characterized the complete plastid genome sequence of Monomorphina aenigmatica, a freshwater species occupying an intermediate phylogenetic position between early and late branching euglenids. The M. aenigmatica UTEX 1284 plastid genome (74,746 bp, 70.6% A+T, 87 genes contains 53 intron insertion sites, of which 41 were found to be shared with other euglenids including 12 of the 15 twintron insertion sites reported in E. gracilis.The pattern of insertion sites suggests an ongoing but uneven process of intron gain in the lineage, with perhaps a minimum of two bursts of rapid intron proliferation. We also identified several sites that represent intermediates in the process of twintron evolution, where the external intron is in place, but not the internal one, offering a glimpse into how these convoluted molecular contraptions originate.

  13. An intronic (A/U)GGG repeat enhances the splicing of an alternative intron of the chicken beta-tropomyosin pre-mRNA.

    Science.gov (United States)

    Sirand-Pugnet, P; Durosay, P; Brody, E; Marie, J

    1995-09-11

    Computer analysis of human intron sequences have revealed a 50 nucleotide (nt) GC-rich region downstream of the 5' splice site; the trinucleotide GGG occurs almost four times as frequently as it would in a random sequence. The 5' part of a beta-tropomyosin intron exhibits six repetitions of the motif (A/U)GGG. In order to test whether these motifs play a role in the splicing process we have mutated some or all of them. Mutated RNAs show a lower in vitro splicing efficiency when compared with the wild-type, especially when all six motifs are mutated (> 70% inhibition). Assembly of the spliceosome complex B and, to a lesser extent, of the pre-spliceosome complex A also appears to be strongly affected by this mutation. A 55 kDa protein within HeLa cell nuclear extract is efficiently cross-linked to the G-rich region. This protein is present in the splicing complexes and its cross-linking to the pre-mRNA requires the presence of one or several snRNP. Altogether our results suggest that the G-rich sequences present in the 5' part of introns may act as an enhancer of the splicing reaction at the level of spliceosome assembly.

  14. A CRM domain protein functions dually in group I and group II intron splicing in land plant chloroplasts.

    Science.gov (United States)

    Asakura, Yukari; Barkan, Alice

    2007-12-01

    The CRM domain is a recently recognized RNA binding domain found in three group II intron splicing factors in chloroplasts, in a bacterial protein that associates with ribosome precursors, and in a family of uncharacterized proteins in plants. To elucidate the functional repertoire of proteins with CRM domains, we studied CFM2 (for CRM Family Member 2), which harbors four CRM domains. RNA coimmunoprecipitation assays showed that CFM2 in maize (Zea mays) chloroplasts is associated with the group I intron in pre-trnL-UAA and group II introns in the ndhA and ycf3 pre-mRNAs. T-DNA insertions in the Arabidopsis thaliana ortholog condition a defective-seed phenotype (strong allele) or chlorophyll-deficient seedlings with impaired splicing of the trnL group I intron and the ndhA, ycf3-int1, and clpP-int2 group II introns (weak alleles). CFM2 and two previously described CRM proteins are bound simultaneously to the ndhA and ycf3-int1 introns and act in a nonredundant fashion to promote their splicing. With these findings, CRM domain proteins are implicated in the activities of three classes of catalytic RNA: group I introns, group II introns, and 23S rRNA.

  15. DNA-methylation effect on cotranscriptional splicing is dependent on GC architecture of the exon-intron structure.

    Science.gov (United States)

    Gelfman, Sahar; Cohen, Noa; Yearim, Ahuvi; Ast, Gil

    2013-05-01

    DNA methylation is known to regulate transcription and was recently found to be involved in exon recognition via cotranscriptional splicing. We recently observed that exon-intron architectures can be grouped into two classes: one with higher GC content in exons compared to the flanking introns, and the other with similar GC content in exons and introns. The first group has higher nucleosome occupancy on exons than introns, whereas the second group exhibits weak nucleosome marking of exons, suggesting another type of epigenetic marker distinguishes exons from introns when GC content is similar. We find different and specific patterns of DNA methylation in each of the GC architectures; yet in both groups, DNA methylation clearly marks the exons. Exons of the leveled GC architecture exhibit a significantly stronger DNA methylation signal in relation to their flanking introns compared to exons of the differential GC architecture. This is accentuated by a reduction of the DNA methylation level in the intronic sequences in proximity to the splice sites and shows that different epigenetic modifications mark the location of exons already at the DNA level. Also, lower levels of methylated CpGs on alternative exons can successfully distinguish alternative exons from constitutive ones. Three positions at the splice sites show high CpG abundance and accompany elevated nucleosome occupancy in a leveled GC architecture. Overall, these results suggest that DNA methylation affects exon recognition and is influenced by the GC architecture of the exon and flanking introns.

  16. Comprehensive phylogenetic analysis of bacterial group II intron-encoded ORFs lacking the DNA endonuclease domain reveals new varieties.

    Directory of Open Access Journals (Sweden)

    Nicolás Toro

    Full Text Available Group II introns are self-splicing RNAs that act as mobile retroelements in the organelles of plants, fungi and protists. They are also widely distributed in bacteria, and are generally assumed to be the ancestors of nuclear spliceosomal introns. Most bacterial group II introns have a multifunctional intron-encoded protein (IEP ORF within the ribozyme domain IV (DIV. This ORF encodes an N-terminal reverse transcriptase (RT domain, followed by a putative RNA-binding domain with RNA splicing or maturase activity and, in some cases, a C-terminal DNA-binding (D region followed by a DNA endonuclease (En domain. In this study, we focused on bacterial group II intron ORF phylogenetic classes containing only reverse transcriptase/maturase open reading frames, with no recognizable D/En region (classes A, C, D, E, F and unclassified introns. On the basis of phylogenetic analyses of the maturase domain and its C-terminal extension, which appears to be a signature characteristic of ORF phylogenetic class, with support from the phylogeny inferred from the RT domain, we have revised the proposed new class F, defining new intron ORF varieties. Our results increase knowledge of the lineage of group II introns encoding proteins lacking the En-domain.

  17. Design and Experimental Evolution of trans-Splicing Group I Intron Ribozymes

    Directory of Open Access Journals (Sweden)

    Ulrich F. Müller

    2017-01-01

    Full Text Available Group I intron ribozymes occur naturally as cis-splicing ribozymes, in the form of introns that do not require the spliceosome for their removal. Instead, they catalyze two consecutive trans-phosphorylation reactions to remove themselves from a primary transcript, and join the two flanking exons. Designed, trans-splicing variants of these ribozymes replace the 3′-portion of a substrate with the ribozyme’s 3′-exon, replace the 5′-portion with the ribozyme’s 5′-exon, or insert/remove an internal sequence of the substrate. Two of these designs have been evolved experimentally in cells, leading to variants of group I intron ribozymes that splice more efficiently, recruit a cellular protein to modify the substrate’s gene expression, or elucidate evolutionary pathways of ribozymes in cells. Some of the artificial, trans-splicing ribozymes are promising as tools in therapy, and as model systems for RNA evolution in cells. This review provides an overview of the different types of trans-splicing group I intron ribozymes that have been generated, and the experimental evolution systems that have been used to improve them.

  18. Selection-driven extinction dynamics for group II introns in Enterobacteriales.

    Directory of Open Access Journals (Sweden)

    Sébastien Leclercq

    Full Text Available Transposable elements (TEs are one of the major driving forces of genome evolution, raising the question of the long-term dynamics underlying their evolutionary success. Some TEs were proposed to evolve under a pattern of periodic extinctions-recolonizations, in which elements recurrently invade and quickly proliferate within their host genomes, then start to disappear until total extinction. Depending on the model, TE extinction is assumed to be driven by purifying selection against colonized host genomes (Sel-DE model or by saturation of host genomes (Sat-DE model. Bacterial group II introns are suspected to follow an extinction-recolonization model of evolution, but whether they follow Sel-DE or Sat-DE dynamics is not known. Our analysis of almost 200 group II intron copies from 90 sequenced Enterobacteriales genomes confirms their extinction-recolonization dynamics: patchy element distributions among genera and even among strains within genera, acquisition of new group II introns through plasmids or other mobile genetic elements, and evidence for recent proliferations in some genomes. Distributions of recent and past proliferations and of their respective homing sites further provide strong support for the Sel-DE model, suggesting that group II introns are deleterious to their hosts. Overall, our observations emphasize the critical impact of host properties on TE dynamics.

  19. A method for construction, cloning and expression of intron-less gene from unannotated genomic DNA.

    Science.gov (United States)

    Agrawal, Vineet; Gupta, Bharti; Banerjee, Uttam Chand; Roy, Nilanjan

    2008-11-01

    The present century has witnessed an unprecedented rise in genome sequences owing to various genome-sequencing programs. However, the same has not been replicated with cDNA or expressed sequence tags (ESTs). Hence, prediction of protein coding sequence of genes from this enormous collection of genomic sequences presents a significant challenge. While robust high throughput methods of cloning and expression could be used to meet protein requirements, lack of intron information creates a bottleneck. Computational programs designed for recognizing intron-exon boundaries for a particular organism or group of organisms have their own limitations. Keeping this in view, we describe here a method for construction of intron-less gene from genomic DNA in the absence of cDNA/EST information and organism-specific gene prediction program. The method outlined is a sequential application of bioinformatics to predict correct intron-exon boundaries and splicing by overlap extension PCR for spliced gene synthesis. The gene construct so obtained can then be cloned for protein expression. The method is simple and can be used for any eukaryotic gene expression.

  20. Allelic polymorphism in introns 1 and 2 of the HLA-DQA1 gene.

    Science.gov (United States)

    Voorter, C E M; de Groot, N G; Meertens, C M H; Bontrop, R E; van den Berg-Loonen, E M

    2005-01-01

    Human leukocyte antigen (HLA) class II antigens are highly polymorphic membrane glycoproteins, encoded by the A and B genes of DR, DQ, and DP. The polymorphism is mainly located in exon 2, with the exception of DQA1. Of the 27 DQA1 alleles presently known, 18 cannot be identified on the basis of exon 2 alone, but need additional information from the other exons. DQA1 has been reported to be the most ancient class II gene. For evolutionary comparison and to assess the degree of polymorphism outside the exons, the sequences of introns 1 and 2 were determined from 30 different cell lines, encompassing 15 different DQA1 alleles. The sequences revealed major nucleotide differences between the different lineages, whereas within each lineage few differences were present. Phylogenetic analysis of intron and exon sequences confirmed this lineage specificity. Altogether, the present data indicate that the HLA-DQA1 lineages represent ancient entities. The observed variation of the introns in alleles with identical exon sequences implicates conservative selection of the exons within a given lineage. Intron sequences may provide the means to set up an accurate typing system.

  1. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  2. When a mid-intronic variation of DMD gene creates an ESE site.

    Science.gov (United States)

    Trabelsi, Madiha; Beugnet, Caroline; Deburgrave, Nathalie; Commere, Virgine; Orhant, Lucie; Leturcq, France; Chelly, Jamel

    2014-12-01

    Duchenne and Becker muscular dystrophy are X-linked allelic disorders caused by mutations in the DMD gene. The majority (65%) of these mutations are intragenic deletions/duplications that often lead to frameshift errors. Among the remaining ones, we find the mid-intronic mutations that usually create cryptic exons by activating potential splice sites. In this report, we identified, in a Becker muscular dystrophy patient, a mid-intronic variation that creates two ESE sites in intron 26 of DMD gene resulting in the insertion of a new cryptic exon in mRNA. Despite the out of frame character of this mutation, we observed the production of a reduced amount of full-size dystrophin which could be explained by the alternation between normal and altered splicing of dystrophin mRNA in this patient. To our knowledge, this is the first case report describing this novel pathogenic mechanism of mid-intronic variations of DMD gene. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. BIALLELIC POLYMORPHISM IN THE INTRON REGION OF B-TUBULIN GENE OF CRYPTOSPORIDIUM PARASITES

    Science.gov (United States)

    Nucleotide sequencing of polymerase chain reaction-amplified intron region of the Cryptosporidium parvum B-tubulin gene in 26 human and 15 animal isolates revealed distinct genetic polymorphism between the human and bovine genotypes. The separation of 2 genotypes of C. parvum is...

  4. Genomewide analysis of intronic microRNAs in rice and Arabidopsis

    Indian Academy of Sciences (India)

    mented with 3% sucrose and stratified at 4. ◦. C for two days in the dark prior to germination. .... RT-PCR results and the deep sequencing analysis together strongly suggest that most of the identified intronic miRNAs ...... Published on the Web: 13 December 2012. 324. Journal of Genetics, Vol. 91, No. 3, December 2012.

  5. An Orchestrated Intron Retention Program in Meiosis Controls Timely Usage of Transcripts during Germ Cell Differentiation.

    Science.gov (United States)

    Naro, Chiara; Jolly, Ariane; Di Persio, Sara; Bielli, Pamela; Setterblad, Niclas; Alberdi, Antonio J; Vicini, Elena; Geremia, Raffaele; De la Grange, Pierre; Sette, Claudio

    2017-04-10

    Global transcriptome reprogramming during spermatogenesis ensures timely expression of factors in each phase of male germ cell differentiation. Spermatocytes and spermatids require particularly extensive reprogramming of gene expression to switch from mitosis to meiosis and to support gamete morphogenesis. Here, we uncovered an extensive alternative splicing program during this transmeiotic differentiation. Notably, intron retention was largely the most enriched pattern, with spermatocytes showing generally higher levels of retention compared with spermatids. Retained introns are characterized by weak splice sites and are enriched in genes with strong relevance for gamete function. Meiotic intron-retaining transcripts (IRTs) were exclusively localized in the nucleus. However, differently from other developmentally regulated IRTs, they are stable RNAs, showing longer half-life than properly spliced transcripts. Strikingly, fate-mapping experiments revealed that IRTs are recruited onto polyribosomes days after synthesis. These studies reveal an unexpected function for regulated intron retention in modulation of the timely expression of select transcripts during spermatogenesis. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. Molecular evolution and phylogenetic utility of the petD group II intron: a case study in basal angiosperms.

    Science.gov (United States)

    Löhne, Cornelia; Borsch, Thomas

    2005-02-01

    Sequences of spacers and group I introns in plant chloroplast genomes have recently been shown to be very effective in phylogenetic reconstruction at higher taxonomic levels and not only for inferring relationships among species. Group II introns, being more frequent in those genomes than group I introns, may be further promising markers. Because group II introns are structurally constrained, we assumed that sequences of a group II intron should be alignable across seed plants. We designed universal amplification primers for the petD intron and sequenced this intron in a representative selection of 47 angiosperms and three gymnosperms. Our sampling of taxa is the most representative of major seed plant lineages to date for group II introns. Through differential analysis of structural partitions, we studied patterns of molecular evolution and their contribution to phylogenetic signal. Nonpairing stretches (loops, bulges, and interhelical nucleotides) were considerably more variable in both substitutions and indels than in helical elements. Differences among the domains are basically a function of their structural composition. After the exclusion of four mutational hotspots accounting for less than 18% of sequence length, which are located in loops of domains I and IV, all sequences could be aligned unambiguously across seed plants. Microstructural changes predominantly occurred in loop regions and are mostly simple sequence repeats. An indel matrix comprising 241 characters revealed microstructural changes to be of lower homoplasy than are substitutions. In showing Amborella first branching and providing support for a magnoliid clade through a synapomorphic indel, the petD data set proved effective in testing between alternative hypotheses on the basal nodes of the angiosperm tree. Within angiosperms, group II introns offer phylogenetic signal that is intermediate in information content between that of spacers and group I introns on the one hand and coding sequences

  7. Proliferation of group II introns in the chloroplast genome of the green alga Oedocladium carolinianum (Chlorophyceae

    Directory of Open Access Journals (Sweden)

    Jean-Simon Brouard

    2016-10-01

    Full Text Available Background The chloroplast genome sustained extensive changes in architecture during the evolution of the Chlorophyceae, a morphologically and ecologically diverse class of green algae belonging to the Chlorophyta; however, the forces driving these changes are poorly understood. The five orders recognized in the Chlorophyceae form two major clades: the CS clade consisting of the Chlamydomonadales and Sphaeropleales, and the OCC clade consisting of the Oedogoniales, Chaetophorales, and Chaetopeltidales. In the OCC clade, considerable variations in chloroplast DNA (cpDNA structure, size, gene order, and intron content have been observed. The large inverted repeat (IR, an ancestral feature characteristic of most green plants, is present in Oedogonium cardiacum (Oedogoniales but is lacking in the examined members of the Chaetophorales and Chaetopeltidales. Remarkably, the Oedogonium 35.5-kb IR houses genes that were putatively acquired through horizontal DNA transfer. To better understand the dynamics of chloroplast genome evolution in the Oedogoniales, we analyzed the cpDNA of a second representative of this order, Oedocladium carolinianum. Methods The Oedocladium cpDNA was sequenced and annotated. The evolutionary distances separating Oedocladium and Oedogonium cpDNAs and two other pairs of chlorophycean cpDNAs were estimated using a 61-gene data set. Phylogenetic analysis of an alignment of group IIA introns from members of the OCC clade was performed. Secondary structures and insertion sites of oedogonialean group IIA introns were analyzed. Results The 204,438-bp Oedocladium genome is 7.9 kb larger than the Oedogonium genome, but its repertoire of conserved genes is remarkably similar and gene order differs by only one reversal. Although the 23.7-kb IR is missing the putative foreign genes found in Oedogonium, it contains sequences coding for a putative phage or bacterial DNA primase and a hypothetical protein. Intergenic sequences are 1.5-fold

  8. An intronic deletion in the PROM1 gene leads to autosomal recessive cone-rod dystrophy.

    Science.gov (United States)

    Eidinger, Osnat; Leibu, Rina; Newman, Hadas; Rizel, Leah; Perlman, Ido; Ben-Yosef, Tamar

    2015-01-01

    To investigate the genetic basis for autosomal recessive cone-rod dystrophy (CRD) in a consanguineous Israeli Jewish family. Patients underwent a detailed ophthalmic evaluation, including eye examination, visual field testing, optical coherence tomography (OCT), and electrophysiological tests, electroretinography (ERG) and visual evoked potential (VEP). Genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array was performed to identify homozygous regions shared among two of the affected individuals. Mutation screening of the underlying gene was performed with direct sequencing. In silico and in vitro analyses were used to predict the effect of the identified mutation on splicing. The affected family members are three siblings who have various degrees of progressive visual deterioration, glare, color vision abnormalities, and night vision difficulties. Visual field tests revealed central scotomas of different extension. Cone and rod ERG responses were reduced, with cones more severely affected. Homozygosity mapping revealed several homozygous intervals shared among two of the affected individuals. One included the PROM1 gene. Sequence analysis of the 26 coding exons of PROM1 in one affected individual revealed no mutations in the coding sequence or in intronic splice sites. However, in intron 21, proximate to the intron-exon junction, we observed a homozygous 10 bp deletion between positions -26 and -17 (c.2281-26_-17del). The deletion was linked to a known SNP, c.2281-6C>G. The deletion cosegregated with the disease in the family, and was not detected in public databases or in 101 ethnically-matched control individuals. In silico analysis predicted that this deletion would lead to altered intron 21 splicing. Bioinformatic analysis predicted that a recognition site for the SRSF2 splicing factor is located within the deleted sequence. The in vitro splicing assay demonstrated that c.2281-26_-17del leads to complete exon 22 skipping. A novel

  9. Complex group-I introns in nuclear SSU rDNA of red and green algae: evidence of homing-endonuclease pseudogenes in the Bangiophyceae

    DEFF Research Database (Denmark)

    Haugen, P; Huss, V A; Nielsen, Henrik

    1999-01-01

    The green alga Scenedesmus pupukensis and the red alga Porphyra spiralis contain large group-IC1 introns in their nuclear small subunit ribosomal RNA genes due to the presence of open reading frames at the 5' end of the introns. The putative 555 amino-acid Scenedesmus-encoded protein harbors...... a sequence motif resembling the bacterial S9 ribosomal proteins. The Porphyra intron self-splices in vitro, and generates both ligated exons and a full-length intron RNA circle. The Porphyra intron has an unusual structural organization by encoding a potential 149 amino-acid homing-endonuclease-like protein...

  10. Intronic regulation of Aire expression by Jmjd6 for self-tolerance induction in the thymus.

    Science.gov (United States)

    Yanagihara, Toyoshi; Sanematsu, Fumiyuki; Sato, Tetsuya; Uruno, Takehito; Duan, Xuefeng; Tomino, Takahiro; Harada, Yosuke; Watanabe, Mayuki; Wang, Yuqing; Tanaka, Yoshihiko; Nakanishi, Yoichi; Suyama, Mikita; Yoshinori, Fukui

    2015-11-04

    The thymus has spatially distinct microenvironments, the cortex and the medulla, where the developing T-cells are selected to mature or die through the interaction with thymic stromal cells. To establish the immunological self in the thymus, medullary thymic epithelial cells (mTECs) express diverse sets of tissue-specific self-antigens (TSAs). This ectopic expression of TSAs largely depends on the transcriptional regulator Aire, yet the mechanism controlling Aire expression itself remains unknown. Here, we show that Jmjd6, a dioxygenase that catalyses lysyl hydroxylation of splicing regulatory proteins, is critical for Aire expression. Although Jmjd6 deficiency does not affect abundance of Aire transcript, the intron 2 of Aire gene is not effectively spliced out in the absence of Jmjd6, resulting in marked reduction of mature Aire protein in mTECs and spontaneous development of multi-organ autoimmunity in mice. These results highlight the importance of intronic regulation in controlling Aire protein expression.

  11. Learning to live together: mutualism between self-splicing introns and their hosts

    Directory of Open Access Journals (Sweden)

    Chalamcharla Venkata R

    2011-04-01

    Full Text Available Abstract Group I and II introns can be considered as molecular parasites that interrupt protein-coding and structural RNA genes in all domains of life. They function as self-splicing ribozymes and thereby limit the phenotypic costs associated with disruption of a host gene while they act as mobile DNA elements to promote their spread within and between genomes. Once considered purely selfish DNA elements, they now seem, in the light of recent work on the molecular mechanisms regulating bacterial and phage group I and II intron dynamics, to show evidence of co-evolution with their hosts. These previously underappreciated relationships serve the co-evolving entities particularly well in times of environmental stress.

  12. Differentiation and fiber type-specific activity of a muscle creatine kinase intronic enhancer

    Directory of Open Access Journals (Sweden)

    Tai Phillip WL

    2011-07-01

    Full Text Available Abstract Background Hundreds of genes, including muscle creatine kinase (MCK, are differentially expressed in fast- and slow-twitch muscle fibers, but the fiber type-specific regulatory mechanisms are not well understood. Results Modulatory region 1 (MR1 is a 1-kb regulatory region within MCK intron 1 that is highly active in terminally differentiating skeletal myocytes in vitro. A MCK small intronic enhancer (MCK-SIE containing a paired E-box/myocyte enhancer factor 2 (MEF2 regulatory motif resides within MR1. The SIE's transcriptional activity equals that of the extensively characterized 206-bp MCK 5'-enhancer, but the MCK-SIE is flanked by regions that can repress its activity via the individual and combined effects of about 15 different but highly conserved 9- to 24-bp sequences. ChIP and ChIP-Seq analyses indicate that the SIE and the MCK 5'-enhancer are occupied by MyoD, myogenin and MEF2. Many other E-boxes located within or immediately adjacent to intron 1 are not occupied by MyoD or myogenin. Transgenic analysis of a 6.5-kb MCK genomic fragment containing the 5'-enhancer and proximal promoter plus the 3.2-kb intron 1, with and without MR1, indicates that MR1 is critical for MCK expression in slow- and intermediate-twitch muscle fibers (types I and IIa, respectively, but is not required for expression in fast-twitch muscle fibers (types IIb and IId. Conclusions In this study, we discovered that MR1 is critical for MCK expression in slow- and intermediate-twitch muscle fibers and that MR1's positive transcriptional activity depends on a paired E-box MEF2 site motif within a SIE. This is the first study to delineate the DNA controls for MCK expression in different skeletal muscle fiber types.

  13. Antagonistic factors control the unproductive splicing of SC35 terminal intron

    OpenAIRE

    Dreumont, Natacha; Hardy, Sara; Behm-Ansmant, Isabelle; Kister, Liliane; Branlant, Christiane; St?venin, James; Bourgeois, Cyril F.

    2009-01-01

    Alternative splicing is regulated in part by variations in the relative concentrations of a variety of factors, including serine/arginine-rich (SR) proteins. The SR protein SC35 self-regulates its expression by stimulating unproductive splicing events in the 3? untranslated region of its own pre-mRNA. Using various minigene constructs containing the terminal retained intron and flanking exons, we identified in the highly conserved last exon a number of exonic splicing enhancer elements respon...

  14. Intronic TP53 Germline Sequence Variants Modify the Risk in German Breast/Ovarian Cancer Families

    Directory of Open Access Journals (Sweden)

    Liu Xuan

    2004-07-01

    Full Text Available Abstract To establish the contribution of TP53 germline mutations to familial breast/ovarian cancer in Germany we screened the complete coding region of the TP53 gene in a series of German breast/ovarian cancer families negative for mutations in the BRCA1 and BRCA2 genes. Two different intronic TP53 sequence variants were identified in 6/48 (12.5% breast/ovarian cancer families. A novel A to T nucleotide change at position 17708 in intron 10 segregating with the disease was detected in three breast cancer families (6.2%. One 17708 A>T-associated breast tumour showed loss of the wild-type allele. This variant was also found in 5/112 (4.5% healthy controls indicating that it is a polymorphism. A second sequence variant changing a G to C at position 13964 in intron 6 not segregating with the disease was found in two breast cancer families and one breast-ovarian cancer family (6.2%. This variant has previously been shown to occur at an elevated frequency in hereditary breast cancer patients from North America and to be of functional importance leading to inhibition of apoptosis and prolongation of cell survival after DNA-damage. Screening of 185 consecutive unselected German breast cancer patients revealed the 13964 G>C variant in four patients (2.2%. Immunohistochemical analysis of the TP53 protein showed negative immunoreactivity in normal and tumour tissues of one 17708 A>T and six 13964 G>C carriers. TP53 overexpression was detected in the tumour tissue of one sporadic breast cancer patient carrying the 13964 G>C variant. Our results show that intronic changes of the TP53 gene may act as or be associated with risk modifiers in familial breast cancer.

  15. Intronic non-CG DNA hydroxymethylation and alternative mRNA splicing in honey bees.

    Science.gov (United States)

    Cingolani, Pablo; Cao, Xiaoyi; Khetani, Radhika S; Chen, Chieh-Chun; Coon, Melissa; Sammak, Alya'a; Bollig-Fischer, Aliccia; Land, Susan; Huang, Yun; Hudson, Matthew E; Garfinkel, Mark D; Zhong, Sheng; Robinson, Gene E; Ruden, Douglas M

    2013-09-30

    Previous whole-genome shotgun bisulfite sequencing experiments showed that DNA cytosine methylation in the honey bee (Apis mellifera) is almost exclusively at CG dinucleotides in exons. However, the most commonly used method, bisulfite sequencing, cannot distinguish 5-methylcytosine from 5-hydroxymethylcytosine, an oxidized form of 5-methylcytosine that is catalyzed by the TET family of dioxygenases. Furthermore, some analysis software programs under-represent non-CG DNA methylation and hydryoxymethylation for a variety of reasons. Therefore, we used an unbiased analysis of bisulfite sequencing data combined with molecular and bioinformatics approaches to distinguish 5-methylcytosine from 5-hydroxymethylcytosine. By doing this, we have performed the first whole genome analyses of DNA modifications at non-CG sites in honey bees and correlated the effects of these DNA modifications on gene expression and alternative mRNA splicing. We confirmed, using unbiased analyses of whole-genome shotgun bisulfite sequencing (BS-seq) data, with both new data and published data, the previous finding that CG DNA methylation is enriched in exons in honey bees. However, we also found evidence that cytosine methylation and hydroxymethylation at non-CG sites is enriched in introns. Using antibodies against 5-hydroxmethylcytosine, we confirmed that DNA hydroxymethylation at non-CG sites is enriched in introns. Additionally, using a new technique, Pvu-seq (which employs the enzyme PvuRts1l to digest DNA at 5-hydroxymethylcytosine sites followed by next-generation DNA sequencing), we further confirmed that hydroxymethylation is enriched in introns at non-CG sites. Cytosine hydroxymethylation at non-CG sites might have more functional significance than previously appreciated, and in honey bees these modifications might be related to the regulation of alternative mRNA splicing by defining the locations of the introns.

  16. Learning to live together: mutualism between self-splicing introns and their hosts

    OpenAIRE

    Chalamcharla Venkata R; Edgell David R; Belfort Marlene

    2011-01-01

    Abstract Group I and II introns can be considered as molecular parasites that interrupt protein-coding and structural RNA genes in all domains of life. They function as self-splicing ribozymes and thereby limit the phenotypic costs associated with disruption of a host gene while they act as mobile DNA elements to promote their spread within and between genomes. Once considered purely selfish DNA elements, they now seem, in the light of recent work on the molecular mechanisms regulating bacter...

  17. Complex group-I introns in nuclear SSU rDNA of red and green algae: evidence of homing-endonuclease pseudogenes in the Bangiophyceae

    DEFF Research Database (Denmark)

    Haugen, P; Huss, V A; Nielsen, Henrik

    1999-01-01

    The green alga Scenedesmus pupukensis and the red alga Porphyra spiralis contain large group-IC1 introns in their nuclear small subunit ribosomal RNA genes due to the presence of open reading frames at the 5' end of the introns. The putative 555 amino-acid Scenedesmus-encoded protein harbors...... a sequence motif resembling the bacterial S9 ribosomal proteins. The Porphyra intron self-splices in vitro, and generates both ligated exons and a full-length intron RNA circle. The Porphyra intron has an unusual structural organization by encoding a potential 149 amino-acid homing-endonuclease-like protein...... on the complementary strand. A comparison between related group-I introns in the Bangiophyceae revealed homing-endonuclease-like pseudogenes due to frame-shifts and deletions in Porphyra and Bangia. The Scenedesmus and Porphyra introns provide new insights into the evolution and possible novel functions of nuclear...

  18. Unusual intron conservation near tissue-regulated exons found by splicing microarrays.

    Directory of Open Access Journals (Sweden)

    Charles W Sugnet

    2006-01-01

    Full Text Available Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5' splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families.

  19. Un gene con intrones en vez de exones / Envejecimiento Prematuro de la Piel

    Directory of Open Access Journals (Sweden)

    Tobías Mojica

    1996-04-01

    Full Text Available Un gene con intrones en vez de exones. La noción de que los genes son discontinuos (compuestos de exones e intrones en forma alterna y en cuya organización los exones representan regiones presentes, por medio del código genético en las proteínas, y los intrones nadie sabe todavía que representan produjo una cierta cantidad de desasosiego entre los genetistas mayores de edad, pero hoy día es ampliamente aceptada, con poco o ningún dolor, y se ha convertido en parte del cánon científico. / Envejecimiento Prematuro de la Piel. La exposición a largo plazo de la piel a la luz ultravioleta proveniente del sol resulta en daño al colágeno de la piel y a la elastina de la matriz extracelular; se cree que este daño es responsable de la apariencia típicamente arrugadita de la piel expuesta al sol por mucho tiempo (como en los vaqueros de los comerciales de la televisión.

  20. Significant association of interleukin-4 gene intron 3 VNTR polymorphism with susceptibility to knee osteoarthritis.

    Science.gov (United States)

    Yigit, Serbulent; Inanir, Ahmet; Tekcan, Akın; Tural, Ercan; Ozturk, Gokhan Tuna; Kismali, Gorkem; Karakus, Nevin

    2014-03-01

    Interleukin-4 (IL-4) is a strong chondroprotective cytokine and polymorphisms within this gene may be a risk factor for osteoarthritis (OA). We aimed to investigate genotype and allele frequencies of IL-4 gene intron 3 variable number of tandem repeats (VNTR) polymorphism in patients with knee OA in a Turkish population. The study included 202 patients with knee OA and 180 healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers followed by restriction fragment length polymorphism (RFLP) analysis. Our result show that there was statistically significant difference between knee OA patients and control group with respect to IL-4 genotype distribution and allele frequencies (p=0.000, OR: 0.20, 95% CI: 0.10-0.41, OR: 0.22, 95% CI: 0.12-0.42, respectively). Our findings suggest that there is an association of IL-4 gene intron 3 VNTR polymorphism with susceptibility of a person for development of knee OA. As a result, IL-4 gene intron 3 VNTR polymorphism could be a genetic marker in OA in a Turkish study population. This is the first association study that evaluates the associations between IL-4 gene VNTR polymorphism and knee OA. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  1. Characterization of cryptic splicing in germline PTEN intronic variants in Cowden syndrome.

    Science.gov (United States)

    Chen, Hannah Jinlian; Romigh, Todd; Sesock, Kaitlin; Eng, Charis

    2017-10-01

    Germline mutations in the tumor-suppressor gene PTEN predispose to subsets of Cowden syndrome (CS), Bannayan-Riley-Ruvalcaba syndrome, and autism. Evidence-based classification of PTEN variants as either deleterious or benign is urgently needed for accurate molecular diagnosis and gene-informed genetic counseling. We studied 34 different germline PTEN intronic variants from 61 CS patients, characterized their PTEN mRNA processing, and analyzed PTEN expression and downstream readouts of P-AKT and P-ERK1/2. While we found that many mutations near splice junctions result in exon skipping, we also identified the presence of cryptic splicing that resulted in premature termination or a shift in isoform usage. PTEN protein expression is significantly lower in the group with splicing changes while P-AKT, but not P-ERK1/2, is significantly increased. Our observations of these PTEN intronic variants should contribute to the determination of pathogenicity of PTEN intronic variants and aid in genetic counseling. © 2017 The Authors. Human Mutation published by Wiley Periodicals, Inc.

  2. Three Group-I introns in 18S rDNA of Endosymbiotic Algae of Paramecium bursaria from Japan

    Science.gov (United States)

    Hoshina, Ryo; Kamako, Shin-ichiro; Imamura, Nobutaka

    2004-08-01

    In the nuclear encoded small subunit ribosomal DNA (18S rDNA) of symbiotic alga of Paramecium bursaria (F36 collected in Japan) possesses three intron-like insertions (Hoshina et al., unpubl. data, 2003). The present study confirmed these exact lengths and insertion sites by reverse transcription-PCR. Two of them were inserted at Escherichia coli 16S rRNA genic position 943 and 1512 that are frequent intron insertion positions, but another insertion position (nearly 1370) was the first finding. Their secondary structures suggested they belong to Group-I intron; one belongs to subgroup IE, others belong to subgroup IC1. Similarity search indicated these introns are ancestral ones.

  3. Mutation analysis in Duchenne and Becker muscular dystrophy patients from Bulgaria shows a peculiar distribution of breakpoints by intron

    Energy Technology Data Exchange (ETDEWEB)

    Todorova, A.; Bronzova, J.; Kremensky, I. [Univ. Hospital of Obstetrics and Gynecology, Sofia (Bulgaria)] [and others

    1996-10-02

    For the first time in Bulgaria, a deletion/duplication screening was performed on a group of 84 unrelated Duchenne/Becker muscular dystrophy patients, and the breakpoint distribution in the dystrophin gene was analyzed. Intragenic deletions were detected in 67.8% of patients, and intragenic duplications in 2.4%. A peculiar distribution of deletion breakpoints was found. Only 13.2% of the deletion breakpoints fell in the {open_quotes}classical{close_quotes} hot spot in intron 44, whereas the majority (> 54%) were located within the segment encompassing introns 45-51, which includes intron 50, the richest in breakpoints (16%) in the Bulgarian sample. Comparison with data from Greece and Turkey points at the probable existence of a deletion hot spot within intron 50, which might be a characteristic of populations of the Balkan region. 17 refs., 2 figs.

  4. Large introns in relation to alternative splicing and gene evolution: a case study of Drosophila bruno-3

    Directory of Open Access Journals (Sweden)

    Kandul Nikolai P

    2009-10-01

    Full Text Available Abstract Background Alternative splicing (AS of maturing mRNA can generate structurally and functionally distinct transcripts from the same gene. Recent bioinformatic analyses of available genome databases inferred a positive correlation between intron length and AS. To study the interplay between intron length and AS empirically and in more detail, we analyzed the diversity of alternatively spliced transcripts (ASTs in the Drosophila RNA-binding Bruno-3 (Bru-3 gene. This gene was known to encode thirteen exons separated by introns of diverse sizes, ranging from 71 to 41,973 nucleotides in D. melanogaster. Although Bru-3's structure is expected to be conducive to AS, only two ASTs of this gene were previously described. Results Cloning of RT-PCR products of the entire ORF from four species representing three diverged Drosophila lineages provided an evolutionary perspective, high sensitivity, and long-range contiguity of splice choices currently unattainable by high-throughput methods. Consequently, we identified three new exons, a new exon fragment and thirty-three previously unknown ASTs of Bru-3. All exon-skipping events in the gene were mapped to the exons surrounded by introns of at least 800 nucleotides, whereas exons split by introns of less than 250 nucleotides were always spliced contiguously in mRNA. Cases of exon loss and creation during Bru-3 evolution in Drosophila were also localized within large introns. Notably, we identified a true de novo exon gain: exon 8 was created along the lineage of the obscura group from intronic sequence between cryptic splice sites conserved among all Drosophila species surveyed. Exon 8 was included in mature mRNA by the species representing all the major branches of the obscura group. To our knowledge, the origin of exon 8 is the first documented case of exonization of intronic sequence outside vertebrates. Conclusion We found that large introns can promote AS via exon-skipping and exon turnover during

  5. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences

    OpenAIRE

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-01

    Background The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Results Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consi...

  6. Using Group II Introns for Attenuating the In Vitro and In Vivo Expression of a Homing Endonuclease.

    Directory of Open Access Journals (Sweden)

    Tuhin Kumar Guha

    Full Text Available In Chaetomium thermophilum (DSM 1495 within the mitochondrial DNA (mtDNA small ribosomal subunit (rns gene a group IIA1 intron interrupts an open reading frame (ORF encoded within a group I intron (mS1247. This arrangement offers the opportunity to examine if the nested group II intron could be utilized as a regulatory element for the expression of the homing endonuclease (HEase. Constructs were generated where the codon-optimized ORF was interrupted with either the native group IIA1 intron or a group IIB type intron. This study showed that the expression of the HEase (in vivo in Escherichia coli can be regulated by manipulating the splicing efficiency of the HEase ORF-embedded group II introns. Exogenous magnesium chloride (MgCl2 stimulated the expression of a functional HEase but the addition of cobalt chloride (CoCl2 to growth media antagonized the expression of HEase activity. Ultimately the ability to attenuate HEase activity might be useful in precision genome engineering, minimizing off target activities, or where pathways have to be altered during a specific growth phase.

  7. Genome-wide generation and use of informative intron-spanning and intron-length polymorphism markers for high-throughput genetic analysis in rice

    Science.gov (United States)

    Badoni, Saurabh; Das, Sweta; Sayal, Yogesh K.; Gopalakrishnan, S.; Singh, Ashok K.; Rao, Atmakuri R.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.

    2016-01-01

    We developed genome-wide 84634 ISM (intron-spanning marker) and 16510 InDel-fragment length polymorphism-based ILP (intron-length polymorphism) markers from genes physically mapped on 12 rice chromosomes. These genic markers revealed much higher amplification-efficiency (80%) and polymorphic-potential (66%) among rice accessions even by a cost-effective agarose gel-based assay. A wider level of functional molecular diversity (17–79%) and well-defined precise admixed genetic structure was assayed by 3052 genome-wide markers in a structured population of indica, japonica, aromatic and wild rice. Six major grain weight QTLs (11.9–21.6% phenotypic variation explained) were mapped on five rice chromosomes of a high-density (inter-marker distance: 0.98 cM) genetic linkage map (IR 64 x Sonasal) anchored with 2785 known/candidate gene-derived ISM and ILP markers. The designing of multiple ISM and ILP markers (2 to 4 markers/gene) in an individual gene will broaden the user-preference to select suitable primer combination for efficient assaying of functional allelic variation/diversity and realistic estimation of differential gene expression profiles among rice accessions. The genomic information generated in our study is made publicly accessible through a user-friendly web-resource, “Oryza ISM-ILP marker” database. The known/candidate gene-derived ISM and ILP markers can be enormously deployed to identify functionally relevant trait-associated molecular tags by optimal-resource expenses, leading towards genomics-assisted crop improvement in rice. PMID:27032371

  8. Deep intronic GBE1 mutation in manifesting heterozygous patients with adult polyglucosan body disease.

    Science.gov (United States)

    Akman, H Orhan; Kakhlon, Or; Coku, Jorida; Peverelli, Lorenzo; Rosenmann, Hanna; Rozenstein-Tsalkovich, Lea; Turnbull, Julie; Meiner, Vardiella; Chama, Liat; Lerer, Israela; Shpitzen, Shoshi; Leitersdorf, Eran; Paradas, Carmen; Wallace, Mary; Schiffmann, Raphael; DiMauro, Salvatore; Lossos, Alexander; Minassian, Berge A

    2015-04-01

    We describe a deep intronic mutation in adult polyglucosan body disease. Similar mechanisms can also explain manifesting heterozygous cases in other inborn metabolic diseases. To explain the genetic change consistently associated with manifesting heterozygous patients with adult polyglucosan body disease. This retrospective study took place from November 8, 2012, to November 7, 2014. We studied 35 typical patients with adult polyglucosan body disease, of whom 16 were heterozygous for the well-known c.986A>C mutation in the glycogen branching enzyme gene (GBE1) but harbored no other known mutation in 16 exons. All 16 manifesting heterozygous patients had lower glycogen branching activity compared with homozygous patients, which showed inactivation of the apparently normal allele. We studied the messenger ribonucleic acid (mRNA) structure and the genetic change due to the elusive second mutation. When we reverse transcribed and sequenced the mRNA of GBE1, we found that all manifesting heterozygous patients had the c.986A>C mutant mRNA and complete lack of mRNA encoded by the second allele. We identified a deep intronic mutation in this allele, GBE1-IVS15+5289_5297delGTGTGGTGGinsTGTTTTTTACATGACAGGT, which acts as a gene trap, creating an ectopic last exon. The mRNA transcript from this allele missed the exon 16 and 3'UTR and encoded abnormal GBE causing further decrease of enzyme activity from 18% to 8%. We identified the deep intronic mutation, which acts as a gene trap. This second-most common adult polyglucosan body disease mutation explains another founder effect in all Ashkenazi-Jewish cases.

  9. Strong signature of natural selection within an FHIT intron implicated in prostate cancer risk.

    Directory of Open Access Journals (Sweden)

    Yan Ding

    Full Text Available Previously, a candidate gene linkage approach on brother pairs affected with prostate cancer identified a locus of prostate cancer susceptibility at D3S1234 within the fragile histidine triad gene (FHIT, a tumor suppressor that induces apoptosis. Subsequent association tests on 16 SNPs spanning approximately 381 kb surrounding D3S1234 in Americans of European descent revealed significant evidence of association for a single SNP within intron 5 of FHIT. In the current study, re-sequencing and genotyping within a 28.5 kb region surrounding this SNP further delineated the association with prostate cancer risk to a 15 kb region. Multiple SNPs in sequences under evolutionary constraint within intron 5 of FHIT defined several related haplotypes with an increased risk of prostate cancer in European-Americans. Strong associations were detected for a risk haplotype defined by SNPs 138543, 142413, and 152494 in all cases (Pearson's chi(2 = 12.34, df 1, P = 0.00045 and for the homozygous risk haplotype defined by SNPs 144716, 142413, and 148444 in cases that shared 2 alleles identical by descent with their affected brothers (Pearson's chi(2 = 11.50, df 1, P = 0.00070. In addition to highly conserved sequences encompassing SNPs 148444 and 152413, population studies revealed strong signatures of natural selection for a 1 kb window covering the SNP 144716 in two human populations, the European American (pi = 0.0072, Tajima's D = 3.31, 14 SNPs and the Japanese (pi = 0.0049, Fay & Wu's H = 8.05, 14 SNPs, as well as in chimpanzees (Fay & Wu's H = 8.62, 12 SNPs. These results strongly support the involvement of the FHIT intronic region in an increased risk of prostate cancer.

  10. The relationship between polymorphisms in intron 8 of vitamin D receptor gene and occult HBV infection

    Directory of Open Access Journals (Sweden)

    Rezvani ME

    2009-08-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 Background: Occult hepatitis B infection (OBI is a form of hepatitis in which despite absence of detectable HBsAg, HBV-DNA is present in peripheral blood of patients. The responsible mechanisms for progression of OBI yet to be clarified, but some investigators believed that the genetics and immunological parameters are different in resistant individuals and patients. Vitamin D3 and its receptor interaction could be involved in anti-viral immune response. The aim of this study was to investigate the association between polymorphisms in intron 8 of VDR with OBI."n"n Methods: In this experimental study, the plasma samples of 3700 blood donors were collected and tested for HBsAg and anti-HBs by ELISA. The HBsAg negative and anti-HBc positive samples were selected and screened for HBV-DNA using PCR. HBV-DNA positive samples were assigned as OBI cases and PCR-RFLP was performed to examine the polymorphisms in intron 8 of VDR genes."n"n Results: Results of current study indicated that 352 (9.5% of 3700 blood samples were HBsAg- and anti-HBc+. HBV-DNA was detected in 57/352 (16.1% of HBsAg- and anti-HBc+ samples. Our results showed that no significant difference was observed in Apa-1 polymorphisms of intron 8 of VDR and OBI patients."n"n Conclusion: Our results demonstrated that there are not any association between Apa-1 detected alleles and OBI, hence, it can be concluded that these alleles are not associated with OBI and other researchers should evaluate relation between other polymorphisms of VDR with OBI.

  11. Novel pre-mRNA splicing of intronically integrated HBV generates oncogenic chimera in hepatocellular carcinoma.

    Science.gov (United States)

    Chiu, Yung-Tuen; Wong, John K L; Choi, Shing-Wan; Sze, Karen M F; Ho, Daniel W H; Chan, Lo-Kong; Lee, Joyce M F; Man, Kwan; Cherny, Stacey; Yang, Wan-Ling; Wong, Chun-Ming; Sham, Pak-Chung; Ng, Irene O L

    2016-06-01

    Hepatitis B virus (HBV) integration is common in HBV-associated hepatocellular carcinoma (HCC) and may play an important pathogenic role through the production of chimeric HBV-human transcripts. We aimed to screen the transcriptome for HBV integrations in HCCs. Transcriptome sequencing was performed on paired HBV-associated HCCs and corresponding non-tumorous liver tissues to identify viral-human chimeric sites. Validation was further performed in an expanded cohort of human HCCs. Here we report the discovery of a novel pre-mRNA splicing mechanism in generating HBV-human chimeric protein. This mechanism was exemplified by the formation of a recurrent HBV-cyclin A2 (CCNA2) chimeric transcript (A2S), as detected in 12.5% (6 of 48) of HCC patients, but in none of the 22 non-HCC HBV-associated cirrhotic liver samples examined. Upon the integration of HBV into the intron of the CCNA2 gene, the mammalian splicing machinery utilized the foreign splice sites at 282nt. and 458nt. of the HBV genome to generate a pseudo-exon, forming an in-frame chimeric fusion with CCNA2. The A2S chimeric protein gained a non-degradable property and promoted cell cycle progression, demonstrating its potential oncogenic functions. A pre-mRNA splicing mechanism is involved in the formation of HBV-human chimeric proteins. This represents a novel and possibly common mechanism underlying the formation of HBV-human chimeric transcripts from intronically integrated HBV genome with functional impact. HBV is involved in the mammalian pre-mRNA splicing machinery in the generation of potential tumorigenic HBV-human chimeras. This study also provided insight on the impact of intronic HBV integration with the gain of splice sites in the development of HBV-associated HCC. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  12. The Tgif2 gene contains a retained intron within the coding sequence

    Directory of Open Access Journals (Sweden)

    Wotton David

    2006-01-01

    Full Text Available Abstract Background TGIF and TGIF2 are homeodomain proteins, which act as TGFβ specific Smad transcriptional corepressors. TGIF recruits general repressors including mSin3 and CtBP. The related TGIF2 protein functions in a similar manner, but does not bind CtBP. In addition to repressing TGFβ activated gene expression, TGIF and TGIF2 repress gene expression by binding directly to DNA. TGIF and TGIF2 share two major blocks of similarity, encompassing the homeodomain, and a conserved carboxyl terminal repression domain. Here we characterize two splice variants of the Tgif2 gene from mouse and demonstrate that the Tgif2 gene contains a retained intron. Results By PCR from mouse cDNA, we identified two alternate splice forms of the Tgif2 gene. One splice variant encodes the full length 237 amino acid Tgif2, whereas the shorter form results in the removal of 39 codons from the centre of the coding region. The generation of this alternate splice form occurs with the mouse RNA, but not the human, and both splice forms are present in all mouse tissues analyzed. Human and mouse Tgif2 coding sequences contain a retained intron, which in mouse Tgif2 is removed by splicing from around 25–50% of RNAs, as assessed by RT-PCR. This splicing event is dependent on sequences within the mouse Tgif2 coding sequence. Both splice forms of mouse Tgif2 encode proteins which are active transcriptional repressors, and can repress both TGFβ dependent and independent transcription. In addition, we show that human and mouse Tgif2 interact with the transcriptional corepressor mSin3. Conclusion These data demonstrate that the Tgif2 gene contains a retained intron, within the second coding exon. This retained intron is not removed from the human mRNA at a detectable level, but is spliced out in a significant proportion of mouse RNAs. This alternate splicing is dependent entirely on sequences within the mouse Tgif2 coding sequence, suggesting the presence of an exonic

  13. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  14. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc

    2010-05-01

    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  15. Use of a Fluorescent Aptamer RNA as an Exonic Sequence to Analyze Self-Splicing Ability of a Group I Intron from Structured RNAs

    Directory of Open Access Journals (Sweden)

    Airi Furukawa

    2016-11-01

    Full Text Available Group I self-splicing intron constitutes an important class of functional RNA molecules that can promote chemical transformation. Although the fundamental mechanism of the auto-excision from its precursor RNA has been established, convenient assay systems for its splicing activity are still useful for a further understanding of its detailed mechanism and of its application. Because some host RNA sequences, to which group I introns inserted form stable three-dimensional (3D structures, the effects of the 3D structures of exonic elements on the splicing efficiency of group I introns are important but not a fully investigated issue. We developed an assay system for group I intron self-splicing by employing a fluorescent aptamer RNA (spinach RNA as a model exonic sequence inserted by the Tetrahymena group I intron. We investigated self-splicing of the intron from spinach RNA, serving as a model exonic sequence with a 3D structure.

  16. Length and GC content variability of introns among teleostean genomes in the light of the metabolic rate hypothesis.

    Directory of Open Access Journals (Sweden)

    Ankita Chaurasia

    Full Text Available A comparative analysis of five teleostean genomes, namely zebrafish, medaka, three-spine stickleback, fugu and pufferfish was performed with the aim to highlight the nature of the forces driving both length and base composition of introns (i.e., bpi and GCi. An inter-genome approach using orthologous intronic sequences was carried out, analyzing independently both variables in pairwise comparisons. An average length shortening of introns was observed at increasing average GCi values. The result was not affected by masking transposable and repetitive elements harbored in the intronic sequences. The routine metabolic rate (mass specific temperature-corrected using the Boltzmann's factor was measured for each species. A significant correlation held between average differences of metabolic rate, length and GC content, while environmental temperature of fish habitat was not correlated with bpi and GCi. Analyzing the concomitant effect of both variables, i.e., bpi and GCi, at increasing genomic GC content, a decrease of bpi and an increase of GCi was observed for the significant majority of the intronic sequences (from ∼ 40% to ∼ 90%, in each pairwise comparison. The opposite event, concomitant increase of bpi and decrease of GCi, was counter selected (from <1% to ∼ 10%, in each pairwise comparison. The results further support the hypothesis that the metabolic rate plays a key role in shaping genome architecture and evolution of vertebrate genomes.

  17. Length and GC content variability of introns among teleostean genomes in the light of the metabolic rate hypothesis.

    Science.gov (United States)

    Chaurasia, Ankita; Tarallo, Andrea; Bernà, Luisa; Yagi, Mitsuharu; Agnisola, Claudio; D'Onofrio, Giuseppe

    2014-01-01

    A comparative analysis of five teleostean genomes, namely zebrafish, medaka, three-spine stickleback, fugu and pufferfish was performed with the aim to highlight the nature of the forces driving both length and base composition of introns (i.e., bpi and GCi). An inter-genome approach using orthologous intronic sequences was carried out, analyzing independently both variables in pairwise comparisons. An average length shortening of introns was observed at increasing average GCi values. The result was not affected by masking transposable and repetitive elements harbored in the intronic sequences. The routine metabolic rate (mass specific temperature-corrected using the Boltzmann's factor) was measured for each species. A significant correlation held between average differences of metabolic rate, length and GC content, while environmental temperature of fish habitat was not correlated with bpi and GCi. Analyzing the concomitant effect of both variables, i.e., bpi and GCi, at increasing genomic GC content, a decrease of bpi and an increase of GCi was observed for the significant majority of the intronic sequences (from ∼ 40% to ∼ 90%, in each pairwise comparison). The opposite event, concomitant increase of bpi and decrease of GCi, was counter selected (from hypothesis that the metabolic rate plays a key role in shaping genome architecture and evolution of vertebrate genomes.

  18. Regulation of mRNA Levels by Decay-Promoting Introns that Recruit the Exosome Specificity Factor Mmi1

    Directory of Open Access Journals (Sweden)

    Cornelia Kilchert

    2015-12-01

    Full Text Available In eukaryotic cells, inefficient splicing is surprisingly common and leads to the degradation of transcripts with retained introns. How pre-mRNAs are committed to nuclear decay is unknown. Here, we uncover a mechanism by which specific intron-containing transcripts are targeted for nuclear degradation in fission yeast. Sequence elements within these “decay-promoting” introns co-transcriptionally recruit the exosome specificity factor Mmi1, which induces degradation of the unspliced precursor and leads to a reduction in the levels of the spliced mRNA. This mechanism negatively regulates levels of the RNA helicase DDX5/Dbp2 to promote cell survival in response to stress. In contrast, fast removal of decay-promoting introns by co-transcriptional splicing precludes Mmi1 recruitment and relieves negative expression regulation. We propose that decay-promoting introns facilitate the regulation of gene expression. Based on the identification of multiple additional Mmi1 targets, including mRNAs, long non-coding RNAs, and sn/snoRNAs, we suggest a general role in RNA regulation for Mmi1 through transcript degradation.

  19. Genome-wide development and deployment of informative intron-spanning and intron-length polymorphism markers for genomics-assisted breeding applications in chickpea.

    Science.gov (United States)

    Srivastava, Rishi; Bajaj, Deepak; Sayal, Yogesh K; Meher, Prabina K; Upadhyaya, Hari D; Kumar, Rajendra; Tripathi, Shailesh; Bharadwaj, Chellapilla; Rao, Atmakuri R; Parida, Swarup K

    2016-11-01

    The discovery and large-scale genotyping of informative gene-based markers is essential for rapid delineation of genes/QTLs governing stress tolerance and yield component traits in order to drive genetic enhancement in chickpea. A genome-wide 119169 and 110491 ISM (intron-spanning markers) from 23129 desi and 20386 kabuli protein-coding genes and 7454 in silico InDel (insertion-deletion) (1-45-bp)-based ILP (intron-length polymorphism) markers from 3283 genes were developed that were structurally and functionally annotated on eight chromosomes and unanchored scaffolds of chickpea. A much higher amplification efficiency (83%) and intra-specific polymorphic potential (86%) detected by these markers than that of other sequence-based genetic markers among desi and kabuli chickpea accessions was apparent even by a cost-effective agarose gel-based assay. The genome-wide physically mapped 1718 ILP markers assayed a wider level of functional genetic diversity (19-81%) and well-defined phylogenetics among domesticated chickpea accessions. The gene-derived 1424 ILP markers were anchored on a high-density (inter-marker distance: 0.65cM) desi intra-specific genetic linkage map/functional transcript map (ICC 4958×ICC 2263) of chickpea. This reference genetic map identified six major genomic regions harbouring six robust QTLs mapped on five chromosomes, which explained 11-23% seed weight trait variation (7.6-10.5 LOD) in chickpea. The integration of high-resolution QTL mapping with differential expression profiling detected six including one potential serine carboxypeptidase gene with ILP markers (linked tightly to the major seed weight QTLs) exhibiting seed-specific expression as well as pronounced up-regulation especially in seeds of high (ICC 4958) as compared to low (ICC 2263) seed weight mapping parental accessions. The marker information generated in the present study was made publicly accessible through a user-friendly web-resource, "Chickpea ISM-ILP Marker Database

  20. An intronic ABCA3 mutation that is responsible for respiratory disease.

    Science.gov (United States)

    Agrawal, Amit; Hamvas, Aaron; Cole, F Sessions; Wambach, Jennifer A; Wegner, Daniel; Coghill, Carl; Harrison, Keith; Nogee, Lawrence M

    2012-06-01

    Member A3 of the ATP-binding cassette family of transporters (ABCA3) is essential for surfactant metabolism. Nonsense, missense, frameshift, and splice-site mutations in the ABCA3 gene (ABCA3) have been reported as causes of neonatal respiratory failure (NRF) and interstitial lung disease. We tested the hypothesis that mutations in noncoding regions of ABCA3 may cause lung disease. ABCA3-specific cDNA was generated and sequenced from frozen lung tissue from a child with fatal lung disease with only one identified ABCA3 mutation. ABCA3 was sequenced from genomic DNA prepared from blood samples obtained from the proband, parents, and other children with NRF. ABCA3 cDNA from the proband contained sequences derived from intron 25 that would be predicted to alter the structure and function of the ABCA3 protein. Genomic DNA sequencing revealed a heterozygous C>T transition in intron 25 trans to the known mutation, creating a new donor splice site. Seven additional infants with an ABCA3-deficient phenotype and inconclusive genetic findings had this same variant, which was not found in 2,132 control chromosomes. These findings support that this variant is a disease-causing mutation that may account for additional cases of ABCA3 deficiency with negative genetic studies.

  1. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases.

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C; Nottingham, Ryan M; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. © 2015 Qin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M

    1986-01-01

    Previous work has demonstrated the presence of a self-splicing intron in the large subunit ribosomal RNA coding region in some strains of the ciliate protozoan Tetrahymena. Sequence comparisons of the intron regions from six Tetrahymena species showed these to fall into three homology groups....... This phylogeny was consistent with the groupings suggested by comparisons of other biochemical characters including cytoskeletal proteins, isozyme analyses, and restriction maps of complete rRNA transcription units. The homology groupings that were based upon the intron sequence data do not agree....... In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...

  3. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences.

    Science.gov (United States)

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-26

    The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.

  4. Modulation of splicing of the preceding intron by antisense oligonucleotide complementary to intra-exon sequence deleted in dystrophin Kobe

    Energy Technology Data Exchange (ETDEWEB)

    Takeshima, Y.; Matuso, M.; Sakamoto, H.; Nishio, H. [Kobe Univ. School of Medicine and Science (Japan)

    1994-09-01

    Molecular analysis of dystrophin Kobe showed that exon 19 of the dystrophin gene bearing a 52 bp deletion was skipped during splicing, although the known consensus sequences at the 5{prime} and 3{prime} splice site of exon 19 were maintained. These data suggest that the deleted sequence of exon 19 may function as a cis-acting factor for exact splicing for the upstream intron. To investigate this potential role, an in vitro splicing system using dystrophin precursors was established. A two-exon precursor containing exon 18, truncated intron 18, and exon 19 was accurately spliced. However, splicing of intron 18 was dramatically inhibited when wild exon 19 was replaced with mutated exon 19. Even though the length of exon 19 was restored to normal by replacing the deleted sequence with other sequence, splicing of intron 18 was not fully reactivated. Characteristically, splicing of intron 18 was inactivated more markedly when the replaced sequence contained less polypurine stretches. These data suggested that modification of the exon sequence would result in a splicing abnormality. Antisense 31 mer 2`-O-methyl ribonucleotide was targeted against 5{prime} end of deleted region of exon 19 to modulate splicing of the mRNA precursor. Splicing of intron 18 was inhibited in a dose- and time-dependent manner. This is the first in vitro evidence to show splicing of dystrophin pre-mRNA can be managed by antisense oligonucleotides. These experiments represent an approach in which antisense oligonucleotides are used to restore the function of a defective dystrophin gene in Duchenne muscular dystrophy by inducing skipping of certain exons during splicing.

  5. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M

    1986-01-01

    Previous work has demonstrated the presence of a self-splicing intron in the large subunit ribosomal RNA coding region in some strains of the ciliate protozoan Tetrahymena. Sequence comparisons of the intron regions from six Tetrahymena species showed these to fall into three homology groups....... In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...

  6. The retrohoming of linear group II intron RNAs in Drosophila melanogaster occurs by both DNA ligase 4-dependent and -independent mechanisms.

    Directory of Open Access Journals (Sweden)

    Travis B White

    Full Text Available Mobile group II introns are bacterial retrotransposons that are thought to have invaded early eukaryotes and evolved into introns and retroelements in higher organisms. In bacteria, group II introns typically retrohome via full reverse splicing of an excised intron lariat RNA into a DNA site, where it is reverse transcribed by the intron-encoded protein. Recently, we showed that linear group II intron RNAs, which can result from hydrolytic splicing or debranching of lariat RNAs, can retrohome in eukaryotes by performing only the first step of reverse splicing, ligating their 3' end to the downstream DNA exon. Reverse transcription then yields an intron cDNA, whose free end is linked to the upstream DNA exon by an error-prone process that yields junctions similar to those formed by non-homologous end joining (NHEJ. Here, by using Drosophila melanogaster NHEJ mutants, we show that linear intron RNA retrohoming occurs by major Lig4-dependent and minor Lig4-independent mechanisms, which appear to be related to classical and alternate NHEJ, respectively. The DNA repair polymerase θ plays a crucial role in both pathways. Surprisingly, however, mutations in Ku70, which functions in capping chromosome ends during NHEJ, have only moderate, possibly indirect effects, suggesting that both Lig4 and the alternate end-joining ligase act in some retrohoming events independently of Ku. Another potential Lig4-independent mechanism, reverse transcriptase template switching from the intron RNA to the upstream exon DNA, occurs in vitro, but gives junctions differing from the majority in vivo. Our results show that group II introns can utilize cellular NHEJ enzymes for retromobility in higher organisms, possibly exploiting mechanisms that contribute to retrotransposition and mitigate DNA damage by resident retrotransposons. Additionally, our results reveal novel activities of group II intron reverse transcriptases, with implications for retrohoming mechanisms and

  7. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae

    Directory of Open Access Journals (Sweden)

    Cao Jiashu

    2011-09-01

    Full Text Available Abstract Background The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh were selected to investigate their molecular evolution and phylogenetic utility. Results DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Conclusions Our study represents the first phylogenetic analyses based

  8. An intronic microRNA links Rb/E2F and EGFR signaling.

    Directory of Open Access Journals (Sweden)

    Mary Truscott

    2014-07-01

    Full Text Available The importance of microRNAs in the regulation of various aspects of biology and disease is well recognized. However, what remains largely unappreciated is that a significant number of miRNAs are embedded within and are often co-expressed with protein-coding host genes. Such a configuration raises the possibility of a functional interaction between a miRNA and the gene it resides in. This is exemplified by the Drosophila melanogaster dE2f1 gene that harbors two miRNAs, mir-11 and mir-998, within its last intron. miR-11 was demonstrated to limit the proapoptotic function of dE2F1 by repressing cell death genes that are directly regulated by dE2F1, however the biological role of miR-998 was unknown. Here we show that one of the functions of miR-998 is to suppress dE2F1-dependent cell death specifically in rbf mutants by elevating EGFR signaling. Mechanistically, miR-998 operates by repressing dCbl, a negative regulator of EGFR signaling. Significantly, dCbl is a critical target of miR-998 since dCbl phenocopies the effects of miR-998 on dE2f1-dependent apoptosis in rbf mutants. Importantly, this regulation is conserved, as the miR-998 seed family member miR-29 repressed c-Cbl, and enhanced MAPK activity and wound healing in mammalian cells. Therefore, the two intronic miRNAs embedded in the dE2f1 gene limit the apoptotic function of dE2f1, but operate in different contexts and act through distinct mechanisms. These results also illustrate that examining an intronic miRNA in the context of its host's function can be valuable in elucidating the biological function of the miRNA, and provide new information about the regulation of the host gene itself.

  9. HLA-DQA1 introns 2 and 3 sequencing: DQA1 sequencing-based typing and characterization of a highly polymorphic microsatellite at intron 3 of DQA1*0505.

    Science.gov (United States)

    Balas, Antonio; Aviles, Maria J; Alonso-Nieto, Manuela; Zarapuz, Loreto; Blanco, Lydia; García-Sánchez, Felix; Vicario, Jose L

    2005-08-01

    DQA1 class II gene encodes the alpha-chain of the human leukocyte antigen (HLA)-DQ heterodimer. Sequencing-based typing (SBT) for HLA genes is the most powerful methodology described. However, most of the SBT procedures reported for HLA class II genes are not able to define complete exon 2 region. For that purpose, we have characterized introns 2 and 3 from most DQA1 alleles to design amplification procedures that were able to obtain complete exon 2 and 3 sequences from DQA1 genes. This coding information allowed us to reduce the number of ambiguities for DQA1 typing. DQA1 intron 2 and 3 characterization demonstrated the presence of two polymorphisms for alleles with the same exons 2 and 3 sequence from DQA1*05 group. Different samples including the DQA1*050101 alleles showed a single nucleotide polymorphism at position 53 of intron 2 (G53T). Additional haplotypic analysis showed the possible association of T53 allele with the Ax-Cw5-B18-DR17-DQ2 extended haplotype. On the other hand, DQA1*0505 sequencing from different control samples noticed the existence of a microsatellite (TTTC/AAAG)n located at position 126 of intron 3. Fragment length analysis demonstrated a high polymorphism for this short tandem repeat system (0505STR), defining alleles that ranged from 8 to 20 repetitions in our population.

  10. Effect of introns and AT-rich sequences on expression of the bacterial hygromycin B resistance gene in the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Scholtmeijer, K; Wosten, HAB; Springer, J; Wessels, JGH

    Previously, it was shown that introns are required for efficient mRNA accumulation in Schizophyllum commune and that the presence of AT-rich sequences in the coding region of genes can result in truncation of transcripts in this homobasidiomycete. Here we show that intron-dependent mRNA accumulation

  11. An Intron 7 Polymorphism in APP Affects the Age of Onset of Dementia in Down Syndrome

    Directory of Open Access Journals (Sweden)

    Emma L. Jones

    2011-01-01

    Full Text Available People with Down syndrome (DS develop Alzheimer's disease (AD with an early age of onset. A tetranucleotide repeat, attt5−8, in intron 7 of the amyloid precursor protein has been associated with the age of onset of AD in DS in a preliminary study. The authors examine the impact of this polymorphism in a larger cohort of individuals with DS. Adults with DS were genotyped for attt5−8 and APOE. The results were analysed with respect to the age of onset of dementia. The presence of three copies of the six-repeat allele resulted in onset of dementia seven years earlier than in the presence of other genotypes. Further study is essential to elucidate the mechanism by which this polymorphism functions, with an exciting opportunity to identify novel treatment targets relevant for people with DS and AD.

  12. Analysis and recognition of 5 ' UTR intron splice sites in human pre-mRNA

    DEFF Research Database (Denmark)

    Eden, E.; Brunak, Søren

    2004-01-01

    Prediction of splice sites in non-coding regions of genes is one of the most challenging aspects of gene structure recognition. We perform a rigorous analysis of such splice sites embedded in human 5' untranslated regions (UTRs), and investigate correlations between this class of splice sites...... and other features found in the adjacent exons and introns. By restricting the training of neural network algorithms to 'pure' UTRs (not extending partially into protein coding regions), we for the first time investigate the predictive power of the splicing signal proper, in contrast to conventional splice...... in the synaptic weights of the neural networks trained to identify UTR donor sites. Conventional splice site prediction methods perform poorly in UTRs because the reading frame pattern is absent. The NetUTR method presented here performs 2-.3-fold better compared with NetGene2 and GenScan in 5' UTRs. We also...

  13. [The chromosomal genes for black widow spider neurotoxins do not contain introns].

    Science.gov (United States)

    Danilevich, V N; Grishin, E V

    2000-12-01

    The overlapping fragments of the chromosomal DNA from black widow spider Latrodectus mactans carrying genes for high-molecular-mass protein neurotoxins, alpha- and delta-latroinsectotoxins (alpha-LIT and delta-LIT) and alpha-latrotoxin (alpha-LTX), were PCR-amplified and cloned. Restriction analysis of the PCR products showed that the distribution and sizes of the restriction fragments coincided with those deduced from the earlier sequencing of cDNAs of the corresponding genes. It thus followed that the alpha-LIT and delta-LIT genes are intronless. Along with our data on the structure of the alpha-latrocrustotoxin (alpha-LCT), this implies that the lack of introns is a common feature of the black widow spider genes encoding high molecular mass neurotoxins.

  14. Deep intronic mutation and pseudo exon activation as a novel muscular hypertrophy modifier in cattle.

    Directory of Open Access Journals (Sweden)

    Claire Bouyer

    Full Text Available Myostatin is essential for proper regulation of myogenesis, and inactivation of Myostatin results in muscle hypertrophy. Here, we identified an unexpected mutation in the myostatin gene which is almost fixed in Blonde d'Aquitaine cattle. In skeletal muscle, the mutant allele was highly expressed leading to an abnormal transcript consisting of a 41-bp inclusion and premature termination codons and to residual levels of a correctly spliced transcript. This expression pattern, caused by a leaky intronic mutation with regard to spliceosome activity and its apparent stability with regard to surveillance mechanisms, could contribute to the moderate muscle hypertrophy in this cattle breed. This finding is of importance for genetic counseling for meat quantity and quality in livestock production and possibly to manipulate myostatin pre-mRNA in human muscle diseases.

  15. Evolution of Fungal U3 snoRNAs: Structural Variation and Introns

    Directory of Open Access Journals (Sweden)

    Sebastian Canzler

    2017-01-01

    Full Text Available The U3 small nucleolar RNA (snoRNA is an essential player in the initial steps of ribosomal RNA biogenesis which is ubiquitously present in Eukarya. It is exceptional among the small nucleolar RNAs in its size, the presence of multiple conserved sequence boxes, a highly conserved secondary structure core, its biogenesis as an independent gene transcribed by polymerase III, and its involvement in pre-rRNA cleavage rather than chemical modification. Fungal U3 snoRNAs share many features with their sisters from other eukaryotic kingdoms but differ from them in particular in their 5’ regions, which in fungi has a distinctive consensus structure and often harbours introns. Here we report on a comprehensive homology search and detailed analysis of the evolution of sequence and secondary structure features covering the entire kingdom Fungi.

  16. An evolutionarily conserved intronic region controls the spatiotemporal expression of the transcription factor Sox10

    Directory of Open Access Journals (Sweden)

    Pavan William J

    2008-10-01

    Full Text Available Abstract Background A major challenge lies in understanding the complexities of gene regulation. Mutation of the transcription factor SOX10 is associated with several human diseases. The disease phenotypes reflect the function of SOX10 in diverse tissues including the neural crest, central nervous system and otic vesicle. As expected, the SOX10 expression pattern is complex and highly dynamic, but little is known of the underlying mechanisms regulating its spatiotemporal pattern. SOX10 expression is highly conserved between all vertebrates characterised. Results We have combined in vivo testing of DNA fragments in zebrafish and computational comparative genomics to identify the first regulatory regions of the zebrafish sox10 gene. Both approaches converged on the 3' end of the conserved 1st intron as being critical for spatial patterning of sox10 in the embryo. Importantly, we have defined a minimal region crucial for this function. We show that this region contains numerous binding sites for transcription factors known to be essential in early neural crest induction, including Tcf/Lef, Sox and FoxD3. We show that the identity and relative position of these binding sites are conserved between zebrafish and mammals. A further region, partially required for oligodendrocyte expression, lies in the 5' region of the same intron and contains a putative CSL binding site, consistent with a role for Notch signalling in sox10 regulation. Furthermore, we show that β-catenin, Notch signalling and Sox9 can induce ectopic sox10 expression in early embryos, consistent with regulatory roles predicted from our transgenic and computational results. Conclusion We have thus identified two major sites of sox10 regulation in vertebrates and provided evidence supporting a role for at least three factors in driving sox10 expression in neural crest, otic epithelium and oligodendrocyte domains.

  17. Recessive inheritance of population-specific intronic LINE-1 insertion causes a rotor syndrome phenotype.

    Science.gov (United States)

    Kagawa, Tatehiro; Oka, Akira; Kobayashi, Yoshinao; Hiasa, Yoichi; Kitamura, Tsuneo; Sakugawa, Hiroshi; Adachi, Yukihiko; Anzai, Kazuya; Tsuruya, Kota; Arase, Yoshitaka; Hirose, Shunji; Shiraishi, Koichi; Shiina, Takashi; Sato, Tadayuki; Wang, Ting; Tanaka, Masayuki; Hayashi, Hideki; Kawabe, Noboru; Robinson, Peter N; Zemojtel, Tomasz; Mine, Tetsuya

    2015-03-01

    Sequences of long-interspersed elements (LINE-1, L1) make up ∼17% of the human genome. De novo insertions of retrotransposition-active L1s can result in genetic diseases. It has been recently shown that the homozygous inactivation of two adjacent genes SLCO1B1 and SLCO1B3 encoding organic anion transporting polypeptides OATP1B1 and OATP1B3 causes a benign recessive disease presenting with conjugated hyperbilirubinemia, Rotor syndrome. Here, we examined SLCO1B1 and SLCO1B3 genes in six Japanese diagnosed with Rotor syndrome on the basis of laboratory data and laparoscopy. All six Japanese patients were homozygous for the c.1738C>T nonsense mutation in SLCO1B1 and homozygous for the insertion of a ∼6.1-kbp L1 retrotransposon in intron 5 of SLCO1B3, which altogether make up a Japanese-specific haplotype. RNA analysis revealed that the L1 insertion induced deleterious splicing resulting in SLCO1B3 transcripts lacking exon 5 or exons 5-7 and containing premature stop codons. The expression of OATP1B1 and OATP1B3 proteins was not detected in liver tissues. This is the first documented case of a population-specific polymorphic intronic L1 transposon insertion contributing to molecular etiology of recessive genetic disease. Since L1 activity in human genomes is currently seen as a major source of individual genetic variation, further investigations are warranted to determine whether this phenomenon results in other autosomal-recessive diseases. © 2014 WILEY PERIODICALS, INC.

  18. Inteins, introns, and homing endonucleases: recent revelations about the life cycle of parasitic genetic elements

    Directory of Open Access Journals (Sweden)

    Hilario Elena

    2006-11-01

    Full Text Available Abstract Self splicing introns and inteins that rely on a homing endonuclease for propagation are parasitic genetic elements. Their life-cycle and evolutionary fate has been described through the homing cycle. According to this model the homing endonuclease is selected for function only during the spreading phase of the parasite. This phase ends when the parasitic element is fixed in the population. Upon fixation the homing endonuclease is no longer under selection, and its activity is lost through random processes. Recent analyses of these parasitic elements with functional homing endonucleases suggest that this model in its most simple form is not always applicable. Apparently, functioning homing endonuclease can persist over long evolutionary times in populations and species that are thought to be asexual or nearly asexual. Here we review these recent findings and discuss their implications. Reasons for the long-term persistence of a functional homing endonuclease include: More recombination (sexual and as a result of gene transfer than previously assumed for these organisms; complex population structures that prevent the element from being fixed; a balance between active spreading of the homing endonuclease and a decrease in fitness caused by the parasite in the host organism; or a function of the homing endonuclease that increases the fitness of the host organism and results in purifying selection for the homing endonuclease activity, even after fixation in a local population. In the future, more detailed studies of the population dynamics of the activity and regulation of homing endonucleases are needed to decide between these possibilities, and to determine their relative contributions to the long term survival of parasitic genes within a population. Two outstanding publications on the amoeba Naegleria group I intron (Wikmark et al. BMC Evol Biol 2006, 6:39 and the PRP8 inteins in ascomycetes (Butler et al.BMC Evol Biol 2006, 6:42 provide

  19. Stress-induced endogenous siRNAs targeting regulatory intron sequences in Brachypodium.

    Science.gov (United States)

    Wang, Hsiao-Lin V; Dinwiddie, Brandon L; Lee, Herman; Chekanova, Julia A

    2015-02-01

    Exposure to abiotic stresses triggers global changes in the expression of thousands of eukaryotic genes at the transcriptional and post-transcriptional levels. Small RNA (smRNA) pathways and splicing both function as crucial mechanisms regulating stress-responsive gene expression. However, examples of smRNAs regulating gene expression remain largely limited to effects on mRNA stability, translation, and epigenetic regulation. Also, our understanding of the networks controlling plant gene expression in response to environmental changes, and examples of these regulatory pathways intersecting, remains limited. Here, to investigate the role of smRNAs in stress responses we examined smRNA transcriptomes of Brachypodium distachyon plants subjected to various abiotic stresses. We found that exposure to different abiotic stresses specifically induced a group of novel, endogenous small interfering RNAs (stress-induced, UTR-derived siRNAs, or sutr-siRNAs) that originate from the 3' UTRs of a subset of coding genes. Our bioinformatics analyses predicted that sutr-siRNAs have potential regulatory functions and that over 90% of sutr-siRNAs target intronic regions of many mRNAs in trans. Importantly, a subgroup of these sutr-siRNAs target the important intron regulatory regions, such as branch point sequences, that could affect splicing. Our study indicates that in Brachypodium, sutr-siRNAs may affect splicing by masking or changing accessibility of specific cis-elements through base-pairing interactions to mediate gene expression in response to stresses. We hypothesize that this mode of regulation of gene expression may also serve as a general mechanism for regulation of gene expression in plants and potentially in other eukaryotes. © 2015 Wang et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  20. Precise mapping of 17 deletion breakpoints within the central hotspot deletion region (introns 50 and 51) of the DMD gene.

    Science.gov (United States)

    Esposito, Gabriella; Tremolaterra, Maria Roberta; Marsocci, Evelina; Tandurella, Igor Cm; Fioretti, Tiziana; Savarese, Maria; Carsana, Antonella

    2017-12-01

    Exon deletions in the human DMD gene, which encodes the dystrophin protein, are the molecular defect in 50-70% of cases of Duchenne/Becker muscular dystrophies. Deletions are preferentially clustered in the 5' (exons 2-20) and the central (exons 45-53) region of DMD, likely because local DNA structure predisposes to specific breakage or recombination events. Notably, innovative therapeutic strategies may rescue dystrophin function by homology-based specific targeting of sequences within the central DMD hot spot deletion region. To further study molecular mechanisms that generate such frequent genome variations and to identify residual intronic sequences, we sequenced 17 deletion breakpoints within introns 50 and 51 of DMD and analyzed the surrounding genomic architecture. There was no breakpoint clustering within the introns nor extensive homology between sequences adjacent to each junction. However, at or near the breakpoint, we found microhomology, short tandem repeats, interspersed repeat elements and short sequence stretches that predispose to DNA deletion or bending. Identification of such structural elements contributes to elucidate general mechanisms generating deletion within the DMD gene. Moreover, precise mapping of deletion breakpoints and localization of repeated elements are of interest, because residual intronic sequences may be targeted by therapeutic strategies based on genome editing correction.

  1. Subcellular RNA sequencing reveals broad presence of cytoplasmic intron-sequence retaining transcripts in mouse and rat neurons.

    Directory of Open Access Journals (Sweden)

    Mugdha Khaladkar

    Full Text Available Recent findings have revealed the complexity of the transcriptional landscape in mammalian cells. One recently described class of novel transcripts are the Cytoplasmic Intron-sequence Retaining Transcripts (CIRTs, hypothesized to confer post-transcriptional regulatory function. For instance, the neuronal CIRT KCNMA1i16 contributes to the firing properties of hippocampal neurons. Intronic sub-sequence retention within IL1-β mRNA in anucleate platelets has been implicated in activity-dependent splicing and translation. In a recent study, we showed CIRTs harbor functional SINE ID elements which are hypothesized to mediate dendritic localization in neurons. Based on these studies and others, we hypothesized that CIRTs may be present in a broad set of transcripts and comprise novel signals for post-transcriptional regulation. We carried out a transcriptome-wide survey of CIRTs by sequencing micro-dissected subcellular RNA fractions. We sequenced two batches of 150-300 individually dissected dendrites from primary cultures of hippocampal neurons in rat and three batches from mouse hippocampal neurons. After statistical processing to minimize artifacts, we found a broad prevalence of CIRTs in the neurons in both species (44-60% of the expressed transcripts. The sequence patterns, including stereotypical length, biased inclusion of specific introns, and intron-intron junctions, suggested CIRT-specific nuclear processing. Our analysis also suggested that these cytoplasmic intron-sequence retaining transcripts may serve as a primary transcript for ncRNAs. Our results show that retaining intronic sequences is not isolated to a few loci but may be a genome-wide phenomenon for embedding functional signals within certain mRNA. The results hypothesize a novel source of cis-sequences for post-transcriptional regulation. Our results hypothesize two potentially novel splicing pathways: one, within the nucleus for CIRT biogenesis; and another, within the

  2. Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing

    Science.gov (United States)

    Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R.; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M.

    2013-01-01

    Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility (“retrohoming”) by a process that requires reverse transcription of a highly structured, 2–2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3′ ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications. PMID:23697550

  3. Neomycin B inhibits splicing of the td intron indirectly by interfering with translation and enhances missplicing in vivo.

    Science.gov (United States)

    Waldsich, C; Semrad, K; Schroeder, R

    1998-12-01

    The aminoglycoside antibiotic neomycin B inhibits translation in prokaryotes and interferes with RNA-protein interactions in HIV both in vivo and in vitro. Hitherto, inhibition of ribozyme catalysis has only been observed in vitro. We therefore monitored the activity of neomycin B and several other aminoglycoside antibiotics on splicing of the T4 phage thymidylate synthase (td) intron in vivo. All antibiotics tested inhibited splicing, even chloramphenicol, which does not inhibit splicing in vitro. Splicing of the td intron in vivo requires translation for proper folding of the pre-mRNA. In the absence of translation, two interactions between sequences in the upstream exon and the 5' and 3' splice sites trap the pre-mRNA in splicing-incompetent conformations. Their disruption by mutations rendered splicing less dependent on translation and also less sensitive to neomycin B. Intron splicing was affected by neither neomycin B nor gentamicin in Escherichia coli strains carrying antibiotic-resistance genes that modify the ribosomal RNA. Taken together, this demonstrates that in vivo splicing of td intron is not directly inhibited by aminoglycosides, but rather indirectly by their interference with translation. This was further confirmed by assaying splicing of the Tetrahymena group I intron, which is inserted in the E. coli 23 S rRNA and, thus, not translated. Furthermore, neomycin B, paromomycin, and streptomycin enhanced missplicing in antibiotic-sensitive strains. Missplicing is caused by an alternative structural element containing a cryptic 5' splice site, which serves as a substrate for the ribozyme. Our results demonstrate that aminoglycoside antibiotics display different effects on ribozymes in vivo and in vitro.

  4. The association between Interleukin (IL)-4 gene intron 3 VNTR polymorphism and alopecia areata (AA) in Turkish population.

    Science.gov (United States)

    Kalkan, Göknur; Karakus, Nevin; Baş, Yalçın; Takçı, Zennure; Ozuğuz, Pınar; Ateş, Omer; Yigit, Serbulent

    2013-09-25

    Alopecia areata (AA) is hypothesized to be an organ-specific autoimmune disease of hair follicles mediated by T cells. As immunological and genetic factors have been implicated in the pathogenesis of AA, the purpose of the present study was to investigate possible associations between the functional Interleukin (IL)-4 gene intron 3 VNTR polymorphism and AA susceptibility and disease progression in Turkish population. The study group consisted of 116 unrelated patients with AA and 125 unrelated healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers. No association was observed between AA patients and controls according to genotype distribution (p=0.051). The allele distribution of IL-4 gene intron 3 VNTR polymorphism was statistically different between AA patients and control group (p=0.026). The frequency of P1 allele in patients was significantly higher than that in the control group. When the P2P2 genotype was compared with P1P2+P1P1 genotypes, a statistically significant difference was observed between patients and controls (p=0.036). Intron 3 VNTR polymorphism in the IL-4 gene was found to be associated with AA susceptibility in Turkish population. The results suggest that IL-4 VNTR polymorphism in the intron 3 region may be a risk factor for the development of AA among Turkish population. This is the first to report that intron 3 VNTR polymorphism in the IL-4 gene is associated with AA susceptibility. © 2013.

  5. Mutations in the Lactococcus lactis Ll.LtrB group II intron that retain mobility in vivo

    Directory of Open Access Journals (Sweden)

    D'Souza Lisa M

    2002-12-01

    Full Text Available Abstract Background Group II introns are mobile genetic elements that form conserved secondary and tertiary structures. In order to determine which of the conserved structural elements are required for mobility, a series of domain and sub-domain deletions were made in the Lactococcus lactis group II intron (Ll.LtrB and tested for mobility in a genetic assay. Point mutations in domains V and VI were also tested. Results The largest deletion that could be made without severely compromising mobility was 158 nucleotides in DIVb(1–2. This mutant had a mobility frequency comparable to the wild-type Ll.LtrB intron (ΔORF construct. Hence, all subsequent mutations were done in this mutant background. Deletion of DIIb reduced mobility to approximately 18% of wild-type, while another deletion in domain II (nts 404–459 was mobile to a minor extent. Only two deletions in DI and none in DIII were tolerated. Some mobility was also observed for a DIVa deletion mutant. Of the three point mutants at position G3 in DV, only G3A retained mobility. In DVI, deletion of the branch-point nucleotide abolished mobility, but the presence of any nucleotide at the branch-point position restored mobility to some extent. Conclusions The smallest intron capable of efficient retrohoming was 725 nucleotides, comprising the DIVb(1–2 and DII(iia,b deletions. The tertiary elements found to be nonessential for mobility were alpha, kappa and eta. In DV, only the G3A mutant was mobile. A branch-point residue is required for intron mobility.

  6. Occurrence and characteristics of group 1 introns found at three different positions within the 28S ribosomal RNA gene of the dematiaceous Phialophora verrucosa: phylogenetic and secondary structural implications

    Directory of Open Access Journals (Sweden)

    Hashizume Toko

    2011-05-01

    Full Text Available Abstract Background Group 1 introns (ribozymes are among the most ancient and have the broadest phylogenetic distribution among the known self-splicing ribozymes. Fungi are known to be rich in rDNA group 1 introns. In the present study, five sequences of the 28S ribosomal RNA gene (rDNA regions of pathogenic dematiaceous Phialophora verrucosa were analyzed using PCR by site-specific primers and were found to have three insertions, termed intron-F, G and H, at three positions of the gene. We investigated the distribution of group 1 introns in this fungus by surveying 34 strains of P. verrucosa and seven strains of Phialophora americana as the allied species. Results Intron-F's (inserted at L798 position were found in 88% of P. verrucosa strains, while intron-G's (inserted at L1921 at 12% and intron-H's (inserted at L2563 at 18%. There was some correlation between intron distribution and geographic location. In addition, we confirmed that the three kinds of introns are group 1 introns from results of BLAST search, alignment analysis and Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR. Prediction of secondary structures and phylogenetic analysis of intron sequences identified introns-F and G as belonging to subgroup IC1. In addition, intron-H was identified as IE. Conclusion The three intron insertions and their insertion position in the 28S rDNA allowed the characterization of the clinical and environmental isolates of P. verrucosa and P. americana into five genotypes. All subgroups of introns-F and G and intron-H were characterized and observed for the first time in both species.

  7. Intronic sequences are required for AINTEGUMENTA-LIKE6 expression in Arabidopsis flowers.

    Science.gov (United States)

    Krizek, Beth A

    2015-10-12

    The AINTEGUMENTA-LIKE6/PLETHORA3 (AIL6/PLT3) gene of Arabidopsis thaliana is a key regulator of growth and patterning in both shoots and roots. AIL6 encodes an AINTEGUMENTA-LIKE/PLETHORA (AIL/PLT) transcription factor that is expressed in the root stem cell niche, the peripheral region of the shoot apical meristem and young lateral organ primordia. In flowers, AIL6 acts redundantly with AINTEGUMENTA (ANT) to regulate floral organ positioning, growth, identity and patterning. Experiments were undertaken to define the genomic regions required for AIL6 function and expression in flowers. Transgenic plants expressing a copy of the coding region of AIL6 in the context of 7.7 kb of 5' sequence and 919 bp of 3' sequence (AIL6:cAIL6-3') fail to fully complement AIL6 function when assayed in the ant-4 ail6-2 double mutant background. In contrast, a genomic copy of AIL6 with the same amount of 5' and 3' sequence (AIL6:gAIL6-3') can fully complement ant-4 ail6-2. In addition, a genomic copy of AIL6 with 590 bp of 5' sequence and 919 bp of 3' sequence (AIL6m:gAIL6-3') complements ant-4 ail6-2 and contains all regulatory elements needed to confer normal AIL6 expression in inflorescences. Efforts to map cis-regulatory elements reveal that the third intron of AIL6 contains enhancer elements that confer expression in young flowers but in a broader pattern than that of AIL6 mRNA in wild-type flowers. Some AIL6:gAIL6-3' and AIL6m:gAIL6-3' lines confer an over-rescue phenotype in the ant-4 ail6-2 background that is correlated with higher levels of AIL6 mRNA accumulation. The results presented here indicate that AIL6 intronic sequences serve as transcriptional enhancer elements. In addition, the results show that increased expression of AIL6 can partially compensate for loss of ANT function in flowers.

  8. An intronic LINE-1 insertion in MERTK is strongly associated with retinopathy in Swedish Vallhund dogs.

    Directory of Open Access Journals (Sweden)

    Richard Everson

    Full Text Available The domestic dog segregates a significant number of inherited progressive retinal diseases, several of which mirror human retinal diseases and which are collectively termed progressive retinal atrophy (PRA. In 2014, a novel form of PRA was reported in the Swedish Vallhund breed, and the disease was mapped to canine chromosome 17. The causal mutation was not identified, but expression analyses of the retinas of affected Vallhunds demonstrated a 6-fold increased expression of the MERTK gene compared to unaffected dogs. Using 24 retinopathy cases and 97 controls with no clinical signs of retinopathy, we replicated the chromosome 17 association in Swedish Vallhunds from the UK and aimed to elucidate the causal variant underlying this association using whole genome sequencing (WGS of an affected dog. This revealed a 6-8 kb insertion in intron 1 of MERTK that was not present in WGS of 49 dogs of other breeds. Sequencing and BLASTN analysis of the inserted segment was consistent with the insertion comprising a full-length intact LINE-1 retroelement. Testing of the LINE-1 insertion for association with retinopathy in the UK set of 24 cases and 97 controls revealed a strong statistical association (P-value 6.0 x 10-11 that was subsequently replicated in the original Finnish study set (49 cases and 89 controls (P-value 4.3 x 10-19. In a pooled analysis of both studies (73 cases and 186 controls, the LINE-1 insertion was associated with a ~20-fold increased risk of retinopathy (odds ratio 23.41, 95% confidence intervals 10.99-49.86, P-value 1.3 x 10-27. Our study adds further support for regulatory disruption of MERTK in Swedish Vallhund retinopathy; however, further work is required to establish a functional overexpression model. Future work to characterise the mechanism by which this intronic mutation disrupts gene regulation will further improve the understanding of MERTK biology and its role in retinal function.

  9. A STAT6 Intronic Single-Nucleotide Polymorphism is Associated with Clinical Malaria in Ghanaian Children

    Directory of Open Access Journals (Sweden)

    Daniel Amoako-Sakyi

    2016-01-01

    Full Text Available Malaria pathogenesis may be influenced by IgE responses and cytokine cross-regulation. Several mutations in the IL-4/STAT6 signaling pathway can alter cytokine cross-regulation and IgE responses during a Plasmodium falciparum malarial infection. This study investigated the relationship between a STAT6 intronic single-nucleotide polymorphism (rs3024974, total IgE, cytokines, and malaria severity in 238 Ghanaian children aged between 0.5 and 13 years. Total IgE and cytokine levels were measured by ELISA, while genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (RFLP. Compared with healthy controls, heterozygosity protected against clinical malaria: uncomplicated malaria (odds ratios [OR] = 0.13, P < 0.001, severe malarial anemia (OR = 0.18, P < 0.001, and cerebral malaria (OR = 0.39, P = 0.022. Levels of total IgE significantly differed among malaria phenotypes (P = 0.044 and rs3024974 genotypes (P = 0.037. Neither cytokine levels nor IL-6/IL-10 ratios were associated with malaria phenotypes or rs3024974 genotypes. This study suggests a role for rs3024974 in malaria pathogenesis and offers further insights into an IL-4/STAT6 pathway mutation in malaria pathogenesis.

  10. Phylogenetic inferences in Avena based on analysis of FL intron2 sequences.

    Science.gov (United States)

    Peng, Yuan-Ying; Wei, Yu-Ming; Baum, Bernard R; Yan, Ze-Hong; Lan, Xiu-Jin; Dai, Shou-Fen; Zheng, You-Liang

    2010-09-01

    The development and application of molecular methods in oats has been relatively slow compared with other crops. Results from the previous analyses have left many questions concerning species evolutionary relationships unanswered, especially regarding the origins of the B and D genomes, which are only known to be present in polyploid oat species. To investigate the species and genome relationships in genus Avena, among 13 diploid (A and C genomes), we used the second intron of the nuclear gene FLORICAULA/LEAFY (FL int2) in seven tetraploid (AB and AC genomes), and five hexaploid (ACD genome) species. The Avena FL int2 is rather long, and high levels of variation in length and sequence composition were found. Evidence for more than one copy of the FL int2 sequence was obtained for both the A and C genome groups, and the degree of divergence of the A genome copies was greater than that observed within the C genome sequences. Phylogenetic analysis of the FL int2 sequences resulted in topologies that contained four major groups; these groups reemphasize the major genomic divergence between the A and C genomes, and the close relationship among the A, B, and D genomes. However, the D genome in hexaploids more likely originated from a C genome diploid rather than the generally believed A genome, and the C genome diploid A. clauda may have played an important role in the origination of both the C and D genome in polyploids.

  11. Antagonistic factors control the unproductive splicing of SC35 terminal intron.

    Science.gov (United States)

    Dreumont, Natacha; Hardy, Sara; Behm-Ansmant, Isabelle; Kister, Liliane; Branlant, Christiane; Stévenin, James; Bourgeois, Cyril F

    2010-03-01

    Alternative splicing is regulated in part by variations in the relative concentrations of a variety of factors, including serine/arginine-rich (SR) proteins. The SR protein SC35 self-regulates its expression by stimulating unproductive splicing events in the 3' untranslated region of its own pre-mRNA. Using various minigene constructs containing the terminal retained intron and flanking exons, we identified in the highly conserved last exon a number of exonic splicing enhancer elements responding specifically to SC35, and showed an inverse correlation between affinity of SC35 and enhancer strength. The enhancer region, which is included in a long stem loop, also contains repressor elements, and is recognized by other RNA-binding proteins, notably hnRNP H protein and TAR DNA binding protein (TDP-43). Finally, in vitro and in cellulo experiments indicated that hnRNP H and TDP-43 antagonize the binding of SC35 to the terminal exon and specifically repress the use of SC35 terminal 3' splice site. Our study provides new information about the molecular mechanisms of SC35-mediated splicing activation. It also highlights the existence of a complex network of self- and cross-regulatory mechanisms between splicing regulators, which controls their homeostasis and offers many ways of modulating their concentration in response to the cellular environment.

  12. Polymorphism of the aryl-hydrocarbon receptor gene in intron 10 of human cancers

    Directory of Open Access Journals (Sweden)

    M. Rocas

    2011-11-01

    Full Text Available Polychlorinated dibenzo-p-dioxins (PCDDs and related halogenated aromatic hydrocarbons (e.g., PCDFs, often called "dioxins", are ubiquitously present environmental contaminants. Some of them, notably 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD, are among the most toxic synthetic compounds known. The biological effects of dioxins are mediated via the aryl hydrocarbon receptor (AhR. Mutations in the AhR transactivation domain are linked to sensitivity to the acute lethality of TCDD. We present here a study of AhR gene polymorphism in normal and cancer human tissues affecting pre-mRNA splicing in the AhR gene-coding transactivation domain region (exon 10, intron 10, exon 11 region, previously shown to be associated with AhR dysfunction. We tested 126 pairs of normal and cancer tissue samples from liver, lung, stomach, kidney, mucous, breast, and pancreas of 49 males and 77 females (45-70 years of age. We used in vitro splicing assay, RT-PCR and sequencing methods. Our results showed that in an in vitro system it is possible to reconstitute cellular pre-mRNA splicing events. Tested cancer tissues did not contain mutations in the AhR transactivation domain region when the DNA sequences were compared with those from normal tissues. There were also no differences in AhR mRNA splice variants between normal and malignant breast tissues and no polymorphisms in the studied regions or cDNA.

  13. DNA methylation in an intron of the IBM1 histone demethylase gene stabilizes chromatin modification patterns.

    Science.gov (United States)

    Rigal, Mélanie; Kevei, Zoltán; Pélissier, Thierry; Mathieu, Olivier

    2012-06-29

    The stability of epigenetic patterns is critical for genome integrity and gene expression. This highly coordinated process involves interrelated positive and negative regulators that impact distinct epigenetic marks, including DNA methylation and dimethylation at histone H3 lysine 9 (H3K9me2). In Arabidopsis, mutations in the DNA methyltransferase MET1, which maintains CG methylation, result in aberrant patterns of other epigenetic marks, including ectopic non-CG methylation and the relocation of H3K9me2 from heterochromatin into gene-rich chromosome regions. Here, we show that the expression of the H3K9 demethylase IBM1 (increase in BONSAI methylation 1) requires DNA methylation. Surprisingly, the regulatory methylated region is contained in an unusually large intron that is conserved in IBM1 orthologues. The re-establishment of IBM1 expression in met1 mutants restored the wild-type H3K9me2 nuclear patterns, non-CG DNA methylation and transcriptional patterns at selected loci, which included DNA demethylase genes. These results provide a mechanistic explanation for long-standing puzzling observations in met1 mutants and reveal yet another layer of control in the interplay between DNA methylation and histone modification, which stabilizes DNA methylation patterns at genes.

  14. Deep intronic variants introduce DMD pseudoexon in patient with muscular dystrophy.

    Science.gov (United States)

    Zaum, Ann-Kathrin; Stüve, Burkhard; Gehrig, Andrea; Kölbel, Heike; Schara, Ulrike; Kress, Wolfram; Rost, Simone

    2017-07-01

    Dystrophinopathies are X-linked muscle diseases caused by mutations in the large DMD gene. The most common mutations are detected by standard diagnostic techniques. However, some patients remain without detectable mutation, most likely due to changes in the non-coding sequence. We report on a boy with complete absence of dystrophin in muscle biopsy but no causative mutation according to standard diagnostics. To search for deep intronic variations (DIV) in the DMD gene we isolated mRNA from muscle tissue and amplified overlapping cDNA fragments using RT-PCR. One cDNA product revealed an augmented fragment size showing an insertion of 77 bp between the exons 7 and 8 by sequencing. We sequenced the flanking sequences of gDNA and found two hemizygous single nucleotide variants (c.650-39575 A>C and c.650-39498 A>G) surrounding the inserted fragment. Both variants create cryptic splice sites which initiate the formation of a pseudoexon that produces a frameshift in the DMD gene. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Identification of Six Introns in a Partial Sequence of Echinococcus granulosus Paramyosin Gene.

    Science.gov (United States)

    Esmaelizad, Majid; Ramezan, Atefeh; Razmaraii, Nasser; Mirjalili, Ali

    2015-03-01

    Paramyosin is a major protein produced by the metacestode cyst of Echinococcus granulosus, the causative agent of cystic hydatid disease. This protein has been shown to play an important role in modulating host immune responses. In this study, we attempted to characterize the noncoding sequence of the paramyosin gene. Genomic DNA was isolated from G1 Iranian hydatid cysts. A DNA fragment of 3200 bp in length was amplified from the paramyosin gene. The polymerase chain reaction (PCR) product was cloned to the pTZ57T vector and sequenced by M13 primers and then compared with unique cDNA coding sequences of E. granulosus (Z21787) and Taenia solium (AY034087). Six introns I (107 bp), II (75 bp), III (47 bp), IV (921 bp), V (19 bp), and VI (456 bp) were identified in the partial sequence of the paramyosin gene. Some nucleotide changes were observed in three exons I, IV, and VI. This data could help scientists in better understanding the possible alternative splicing and designing a real-time PCR technique for the evaluation of the transcription levels of paramyosin in the stages of the Echinococcus sp. life cycle.

  16. Becker muscular dystrophy due to an intronic splicing mutation inducing a dual dystrophin transcript.

    Science.gov (United States)

    Todeschini, Alice; Gualandi, Francesca; Trabanelli, Cecilia; Armaroli, Annarita; Ravani, Anna; Fanin, Marina; Rota, Silvia; Bello, Luca; Ferlini, Alessandra; Pegoraro, Elena; Padovani, Alessandro; Filosto, Massimiliano

    2016-10-01

    We describe a 29-year-old patient who complained of left thigh muscle weakness since he was 23 and of moderate proximal weakness of both lower limbs with difficulty in climbing stairs and running since he was 27. Mild weakness of iliopsoas and quadriceps muscles and muscle atrophy of both the distal forearm and thigh were observed upon clinical examination. He harboured a novel c.1150-3C>G substitution in the DMD gene, affecting the intron 10 acceptor splice site and causing exon 11 skipping and an out-of-frame transcript. However, protein of normal molecular weight but in reduced amounts was observed on Western Blot analysis. Reverse transcription analysis on muscle RNA showed production, via alternative splicing, of a transcript missing exon 11 as well as a low abundant full-length transcript which is enough to avoid the severe Duchenne phenotype. Our study showed that a reduced amount of full length dystrophin leads to a mild form of Becker muscular dystrophy. These results confirm earlier findings that low amounts of dystrophin can be associated with a milder phenotype, which is promising for therapies aiming at dystrophin restoration. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Nuclear introns outperform mitochondrial DNA in inter-specific phylogenetic reconstruction: Lessons from horseshoe bats (Rhinolophidae: Chiroptera).

    Science.gov (United States)

    Dool, Serena E; Puechmaille, Sebastien J; Foley, Nicole M; Allegrini, Benjamin; Bastian, Anna; Mutumi, Gregory L; Maluleke, Tinyiko G; Odendaal, Lizelle J; Teeling, Emma C; Jacobs, David S

    2016-04-01

    Despite many studies illustrating the perils of utilising mitochondrial DNA in phylogenetic studies, it remains one of the most widely used genetic markers for this purpose. Over the last decade, nuclear introns have been proposed as alternative markers for phylogenetic reconstruction. However, the resolution capabilities of mtDNA and nuclear introns have rarely been quantified and compared. In the current study we generated a novel ∼5kb dataset comprising six nuclear introns and a mtDNA fragment. We assessed the relative resolution capabilities of the six intronic fragments with respect to each other, when used in various combinations together, and when compared to the traditionally used mtDNA. We focused on a major clade in the horseshoe bat family (Afro-Palaearctic clade; Rhinolophidae) as our case study. This old, widely distributed and speciose group contains a high level of conserved morphology. This morphological stasis renders the reconstruction of the phylogeny of this group with traditional morphological characters complex. We sampled multiple individuals per species to represent their geographic distributions as best as possible (122 individuals, 24 species, 68 localities). We reconstructed the species phylogeny using several complementary methods (partitioned Maximum Likelihood and Bayesian and Bayesian multispecies-coalescent) and made inferences based on consensus across these methods. We computed pairwise comparisons based on Robinson-Foulds tree distance metric between all Bayesian topologies generated (27,000) for every gene(s) and visualised the tree space using multidimensional scaling (MDS) plots. Using our supported species phylogeny we estimated the ancestral state of key traits of interest within this group, e.g. echolocation peak frequency which has been implicated in speciation. Our results revealed many potential cryptic species within this group, even in taxa where this was not suspected a priori and also found evidence for mt

  18. Deep intronic mis-splicing mutation in JAK3 gene underlies T-B+NK- severe combined immunodeficiency phenotype.

    Science.gov (United States)

    Stepensky, Polina; Keller, Baerbel; Shamriz, Oded; NaserEddin, Adeeb; Rumman, Nisreen; Weintraub, Michael; Warnatz, Klaus; Elpeleg, Orly; Barak, Yaacov

    2016-02-01

    Severe combined immune deficiency (SCID) is a group of genetically heterogeneous diseases caused by an early block in T cell differentiation and present with life threatening infections, often within the first year of life. Janus kinase (JAK)3 gene mutations have been found to cause autosomal recessive T-B+ SCID phenotype. In this study we describe three patients with a novel deep intronic mis-splicing mutation in JAK3 as a cause of T-B+NK- SCID highlighting the need for careful evaluation of intronic regulatory elements of known genes associated with clearly defined clinical phenotypes. We present the cases and discuss the current literature. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Gene encoding the human. beta. -hexosaminidase. beta. chain: Extensive homology of intron placement in the. alpha. - and. beta. -chain genes

    Energy Technology Data Exchange (ETDEWEB)

    Proia, R.L. (National Institute of Diabetes, Digestive and Kidney Diseases, Bethesda, MD (USA))

    1988-03-01

    Lysosomal {beta}-hexosaminidase is composed of two structurally similar chains, {alpha} and {beta}, that are the products of different genes. Mutations in either gene causing {beta}-hexosaminidase deficiency result in the lysosomal storage disease GM2-gangliosidosis. To enable the investigation of the molecular lesions in this disorder and to study the evolutionary relationship between the {alpha} and {beta} chains, the {beta}-chain gene was isolated, and its organization was characterized. The {beta}-chain coding region is divided into 14 exons distributed over {approx}40 kilobases of DNA. Comparison with the {alpha}-chain gene revealed that 12 of the 13 introns interrupt the coding regions at homologous positions. This extensive sharing of intron placement demonstrates that the {alpha} and {beta} chains evolved by way of the duplication of a common ancestor.

  20. Site-specific, insertional inactivation of incA in Chlamydia trachomatis using a group II intron.

    Directory of Open Access Journals (Sweden)

    Cayla M Johnson

    Full Text Available Chlamydia trachomatis is an obligate, intracellular bacterial pathogen that has until more recently remained recalcitrant to genetic manipulation. However, the field still remains hindered by the absence of tools to create selectable, targeted chromosomal mutations. Previous work with mobile group II introns demonstrated that they can be retargeted by altering DNA sequences within the intron's substrate recognition region to create site-specific gene insertions. This platform (marketed as TargeTron™, Sigma has been successfully employed in a variety of bacteria. We subsequently modified TargeTron™ for use in C. trachomatis and as proof of principle used our system to insertionally inactivate incA, a chromosomal gene encoding a protein required for homotypic fusion of chlamydial inclusions. C. trachomatis incA::GII(bla mutants were selected with ampicillin and plaque purified clones were then isolated for genotypic and phenotypic analysis. PCR, Southern blotting, and DNA sequencing verified proper GII(bla insertion, while continuous passaging in the absence of selection demonstrated that the insertion was stable. As seen with naturally occurring IncA(- mutants, light and immunofluorescence microscopy confirmed the presence of non-fusogenic inclusions in cells infected with the incA::GII(bla mutants at a multiplicity of infection greater than one. Lack of IncA production by mutant clones was further confirmed by Western blotting. Ultimately, the ease of retargeting the intron, ability to select for mutants, and intron stability in the absence of selection makes this method a powerful addition to the growing chlamydial molecular toolbox.

  1. AML1/ETO trans-activates c-KIT expression through the long range interaction between promoter and intronic enhancer.

    Science.gov (United States)

    Tian, Ying; Wang, Genjie; Hu, Qingzhu; Xiao, Xichun; Chen, Shuxia

    2018-04-01

    The AML1/ETO onco-fusion protein is crucial for the genesis of t(8;21) acute myeloid leukemia (AML) and is well documented as a transcriptional repressor through dominant-negative effect. However, little is known about the transactivation mechanism of AML1/ETO. Through large cohort of patient's expression level data analysis and a series of experimental validation, we report here that AML1/ETO transactivates c-KIT expression through directly binding to and mediating the long-range interaction between the promoter and intronic enhancer regions of c-KIT. Gene expression analyses verify that c-KIT expression is significantly high in t(8;21) AML. Further ChIP-seq analysis and motif scanning identify two regulatory regions located in the promoter and intronic enhancer region of c-KIT, respectively. Both regions are enriched by co-factors of AML1/ETO, such as AML1, CEBPe, c-Jun, and c-Fos. Further luciferase reporter assays show that AML1/ETO trans-activates c-KIT promoter activity through directly recognizing the AML1 motif and the co-existence of co-factors. The induction of c-KIT promoter activity is reinforced with the existence of intronic enhancer region. Furthermore, ChIP-3C-qPCR assays verify that AML1/ETO mediates the formation of DNA-looping between the c-KIT promoter and intronic enhancer region through the long-range interaction. Collectively, our data uncover a novel transcriptional activity mechanism of AML1/ETO and enrich our knowledge of the onco-fusion protein mediated transcription regulation. © 2017 Wiley Periodicals, Inc.

  2. Genomic organization of the mouse src gene. Sequencing of src introns revealed a new chromosome 2 microsatellite marker

    Czech Academy of Sciences Publication Activity Database

    Fučík, Vladimír; Beran, Jaroslav; Černý, Zbyněk; Mácha, J.; Jonák, Jiří

    2002-01-01

    Roč. 48, č. 1 (2002), s. 34-39 ISSN 0015-5500 R&D Projects: GA ČR GV312/96/K205; GA AV ČR IPP2052002 Institutional research plan: CEZ:AV0Z5052915 Keywords : Mus musculus, c-src introns, microsatellite Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.615, year: 2002

  3. Development of Exon-Primed Intron-Crossing (EPIC) PCR primers for the malaria vector Anopheles pseudopunctipennis (Diptera : Culicidae)

    OpenAIRE

    Lardeux, Frédéric; Aliaga, Claudia; Tejerina, Rosenka; Ursic-Bedoya, Raul

    2012-01-01

    International audience; Using the Anopheles gambiae Giles genome as a template, we designed, screened and identified 14 novel Exon-Primed Intron-Crossing (EPIC) PCR primer pairs for Anopheles pseudopunctipennis Theobald 1901, a major vector of human Plasmodium sp. in South America. These primers were designed to target the conserved regions flanking consecutive exons of different genes and enabled the amplification of 17 loci of which nine were polymorphic. Polymorphisms at these loci ranged ...

  4. Site-specific, insertional inactivation of incA in Chlamydia trachomatis using a group II intron.

    Science.gov (United States)

    Johnson, Cayla M; Fisher, Derek J

    2013-01-01

    Chlamydia trachomatis is an obligate, intracellular bacterial pathogen that has until more recently remained recalcitrant to genetic manipulation. However, the field still remains hindered by the absence of tools to create selectable, targeted chromosomal mutations. Previous work with mobile group II introns demonstrated that they can be retargeted by altering DNA sequences within the intron's substrate recognition region to create site-specific gene insertions. This platform (marketed as TargeTron™, Sigma) has been successfully employed in a variety of bacteria. We subsequently modified TargeTron™ for use in C. trachomatis and as proof of principle used our system to insertionally inactivate incA, a chromosomal gene encoding a protein required for homotypic fusion of chlamydial inclusions. C. trachomatis incA::GII(bla) mutants were selected with ampicillin and plaque purified clones were then isolated for genotypic and phenotypic analysis. PCR, Southern blotting, and DNA sequencing verified proper GII(bla) insertion, while continuous passaging in the absence of selection demonstrated that the insertion was stable. As seen with naturally occurring IncA(-) mutants, light and immunofluorescence microscopy confirmed the presence of non-fusogenic inclusions in cells infected with the incA::GII(bla) mutants at a multiplicity of infection greater than one. Lack of IncA production by mutant clones was further confirmed by Western blotting. Ultimately, the ease of retargeting the intron, ability to select for mutants, and intron stability in the absence of selection makes this method a powerful addition to the growing chlamydial molecular toolbox.

  5. H2B ubiquitylation is part of chromatin architecture that marks exon-intron structure in budding yeast

    LENUS (Irish Health Repository)

    Shieh, Grace S.

    2011-12-22

    Abstract Background The packaging of DNA into chromatin regulates transcription from initiation through 3\\' end processing. One aspect of transcription in which chromatin plays a poorly understood role is the co-transcriptional splicing of pre-mRNA. Results Here we provide evidence that H2B monoubiquitylation (H2BK123ub1) marks introns in Saccharomyces cerevisiae. A genome-wide map of H2BK123ub1 in this organism reveals that this modification is enriched in coding regions and that its levels peak at the transcribed regions of two characteristic subgroups of genes. First, long genes are more likely to have higher levels of H2BK123ub1, correlating with the postulated role of this modification in preventing cryptic transcription initiation in ORFs. Second, genes that are highly transcribed also have high levels of H2BK123ub1, including the ribosomal protein genes, which comprise the majority of intron-containing genes in yeast. H2BK123ub1 is also a feature of introns in the yeast genome, and the disruption of this modification alters the intragenic distribution of H3 trimethylation on lysine 36 (H3K36me3), which functionally correlates with alternative RNA splicing in humans. In addition, the deletion of genes encoding the U2 snRNP subunits, Lea1 or Msl1, in combination with an htb-K123R mutation, leads to synthetic lethality. Conclusion These data suggest that H2BK123ub1 facilitates cross talk between chromatin and pre-mRNA splicing by modulating the distribution of intronic and exonic histone modifications.

  6. [Whole exon 5 and intron 5 replaced by RHD/CE in partial D phenotype DVa (Hus)].

    Science.gov (United States)

    Zhou, Yi-Yan; Xiong, Wen; Shao, Chao-Peng

    2005-02-01

    The study was purposed to analyze DNA and allele structure of the partial D phenotypes D(Va) and D(VI) of the Rhesus blood group in Chinese. Through polymerase chain reaction (PCR) and direct genomic DNA sequencing, the RHD gene was detected in three weak D individuals identified serologically. The results showed that among the three weak D individuals, one was identified as partial D phenotype D(Va) (Hus) type and genotyped DccEe; another two were testified as D(VI) III type and genotyped DCcee. Moreover, the breakpoints of the replaced region by RHCE in D(Va) (Hus) were 5' end of the exon 5 and 3' end of the intron 5, and there were 7 novel polymorphisms in intron 5: 23-25(GCA)2, 98G>A, 168-169insG, 205-206insT, 494-495insA, 1256-1257insC, 1347G>T. In conclusion the whole exon 5 and intron 5 are replaced by RHCE in D(Va) (Hus) detected in Chinese.

  7. Recruitment of Staufen2 Enhances Dendritic Localization of an Intron-Containing CaMKIIα mRNA

    Directory of Open Access Journals (Sweden)

    Raúl Ortiz

    2017-07-01

    Full Text Available Regulation of mRNA localization is a conserved cellular process observed in many types of cells and organisms. Asymmetrical mRNA distribution plays a particularly important role in the nervous system, where local translation of localized mRNA represents a key mechanism in synaptic plasticity. CaMKIIα is a very abundant mRNA detected in neurites, consistent with its crucial role at glutamatergic synapses. Here, we report the presence of CaMKIIα mRNA isoforms that contain intron i16 in dendrites, RNA granules, and synaptoneurosomes from primary neurons and brain. This subpopulation of unspliced mRNA preferentially localizes to distal dendrites in a synaptic-activity-dependent manner. Staufen2, a well-established marker of RNA transport in dendrites, interacts with intron i16 sequences and enhances its distal dendritic localization, pointing to the existence of intron-mediated mechanisms in the molecular pathways that modulate dendritic transport and localization of synaptic mRNAs.

  8. Molecular study in children with hemophilia A in Colombia: analysis of Intron 1 and 22 inversion using long-distance PCR technique

    Directory of Open Access Journals (Sweden)

    María Fernanda Garcés

    2017-04-01

    Conclusions: Inversions of intron 22 and 1 were found in half of this group of patients. These results are reproducible and useful to identify the two most frequent mutations in severe hemophilia A patients.

  9. Why Selection Might Be Stronger When Populations Are Small: Intron Size and Density Predict within and between-Species Usage of Exonic Splice Associated cis-Motifs

    Science.gov (United States)

    Wu, XianMing; Hurst, Laurence D.

    2015-01-01

    The nearly neutral theory predicts that small effective population size provides the conditions for weakened selection. This is postulated to explain why our genome is more “bloated” than that of, for example, yeast, ours having large introns and large intergene spacer. If a bloated genome is also an error prone genome might it, however, be the case that selection for error-mitigating properties is stronger in our genome? We examine this notion using splicing as an exemplar, not least because large introns can predispose to noisy splicing. We thus ask whether, owing to genomic decay, selection for splice error-control mechanisms is stronger, not weaker, in species with large introns and small populations. In humans much information defining splice sites is in cis-exonic motifs, most notably exonic splice enhancers (ESEs). These act as splice-error control elements. Here then we ask whether within and between-species intron size is a predictor of the commonality of exonic cis-splicing motifs. We show that, as predicted, the proportion of synonymous sites that are ESE-associated and under selection in humans is weakly positively correlated with the size of the flanking intron. In a phylogenetically controlled framework, we observe, also as expected, that mean intron size is both predicted by Ne.μ and is a good predictor of cis-motif usage across species, this usage coevolving with splice site definition. Unexpectedly, however, across taxa intron density is a better predictor of cis-motif usage than intron size. We propose that selection for splice-related motifs is driven by a need to avoid decoy splice sites that will be more common in genes with many and large introns. That intron number and density predict ESE usage within human genes is consistent with this, as is the finding of intragenic heterogeneity in ESE density. As intronic content and splice site usage across species is also well predicted by Ne.μ, the result also suggests an unusual circumstance in

  10. Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly

    OpenAIRE

    Haseloff, Jim; Siemering, Kirby R.; Prasher, Douglas C.; Hodge, Sarah

    1997-01-01

    The green fluorescent protein (GFP) from the jellyfish Aequorea victoria is finding wide use as a genetic marker that can be directly visualized in the living cells of many heterologous organisms. We have sought to express GFP in the model plant Arabidopsis thaliana, but have found that proper expression of GFP is curtailed due to aberrant mRNA processing. An 84-nt cryptic intron is efficiently recognized and excised from transcripts of the GFP coding sequence. The cryptic intron contains seq...

  11. [Reconstruction of the phylogenetic position of larch (Larix sukaczewii Dylis) by sequencing data for the trnK intron of chloroplast DNA].

    Science.gov (United States)

    Bashalkhanov, S I; Konstantinov, Iu M; Verbitskiĭ, D S; Kobzev, V F

    2003-10-01

    To reconstruct the systematic relationships of larch Larix sukaczewii, we used the chloroplast trnK intron sequences of L. decidua, L. sukaczewii, L. sibirica, L. czekanovskii, and L. gmelinii. Analysis of phylogenetic trees constructed using the maximum parsimony and maximum likelihood methods showed a clear divergence of the trnK intron sequences between L. sukaczewii and L. sibirica. This divergence reaches intraspecific level, which supports a previously published hypothesis on the taxonomic isolation of L. sukaczewii.

  12. A contracted DNA repeat in LHX3 intron 5 is associated with aberrant splicing and pituitary dwarfism in German shepherd dogs.

    Directory of Open Access Journals (Sweden)

    Annemarie M W Y Voorbij

    Full Text Available Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism.

  13. RNA-Seq Analysis of Differential Splice Junction Usage and Intron Retentions by DEXSeq.

    Directory of Open Access Journals (Sweden)

    Yafang Li

    Full Text Available Alternative splicing is an important biological process in the generation of multiple functional transcripts from the same genomic sequences. Differential analysis of splice junctions (SJs and intron retentions (IRs is helpful in the detection of alternative splicing events. In this study, we conducted differential analysis of SJs and IRs by use of DEXSeq, a Bioconductor package originally designed for differential exon usage analysis in RNA-seq data analysis. We set up an analysis pipeline including mapping of RNA-seq reads, the preparation of count tables of SJs and IRs as the input files, and the differential analysis in DEXSeq. We analyzed the public RNA-seq datasets generated from RNAi experiments on Drosophila melanogaster S2-DRSC cells to deplete RNA-binding proteins (GSE18508. The analysis confirmed previous findings on the alternative splicing of the trol and Ant2 (sesB genes in the CG8144 (ps-depletion experiment and identified some new alternative splicing events in other RNAi experiments. We also identified IRs that were confirmed in our SJ analysis. The proposed method used in our study can output the genomic coordinates of differentially used SJs and thus enable sequence motif search. Sequence motif search and gene function annotation analysis helped us infer the underlying mechanism in alternative splicing events. To further evaluate this method, we also applied the method to public RNA-seq data from human breast cancer (GSE45419 and the plant Arabidopsis (SRP008262. In conclusion, our study showed that DEXSeq can be adapted to differential analysis of SJs and IRs, which will facilitate the identification of alternative splicing events and provide insights into the molecular mechanisms of transcription processes and disease development.

  14. Characterization of the mouse cyclin D3 gene: Exon/intron organization and promoter activity

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhengyu; Zhang, Ying; Ravid, K. [Boston Univ. School of Medicine, Boston, MA (United States)] [and others

    1996-07-01

    The three D-type cyclins have been shown to be differentially expressed in a number of cell types, suggesting that they play distinct roles in cell cycle regulation in particular cell lineages. We have determined the complete nucleotide sequence (-1681 to +6582) of the mouse cyclin D3 gene, which encodes a G1 phase cyclin. The gene consists of five exons and four introns, varying in length from 422 to 2472 bp. Primer extension analysis revealed one major transcription initiation site at the position 107 bp 5{prime} upstream of the translation start. The promoter region lacks both canonical {open_quotes}TATA{close_quotes} and {open_quotes}CAAT{close_quotes} boxes. It contains, however, multiple transcription factor recognition by GATA, NF-{kappa}B, ATF, E2F, and TRE/AP1 transcription factors, E box binding myogenic factors, and the IL-6 induced-transcription factor, APRF. Promoter activity of the 1681-bp fragment upstream of the transcription initiation site was confirmed by linking it to a reporter gene and subjecting it to transient expression experiments in various cell types. Promoter activity was high in cell lines that expressed high levels of endogenous D3 mRNA, as indicated by Northern blot analysis, and was significantly reduced when the promoter was truncated to -122 bp. The characterization of the mouse cyclin D3 gene and insight into its promoter region will allow further studies defining the molecular events regulating the expression of this cyclin in proliferating and quiescent cells. 60 refs., 4 figs., 1 tab.

  15. Group I introns and associated homing endonuclease genes reveals a clinal structure for Porphyra spiralis var. amplifolia (Bangiales, Rhodophyta) along the Eastern coast of South America.

    Science.gov (United States)

    Milstein, Daniela; Oliveira, Mariana C; Martins, Felipe M; Matioli, Sergio R

    2008-11-07

    Group I introns are found in the nuclear small subunit ribosomal RNA gene (SSU rDNA) of some species of the genus Porphyra (Bangiales, Rhodophyta). Size polymorphisms in group I introns has been interpreted as the result of the degeneration of homing endonuclease genes (HEG) inserted in peripheral loops of intron paired elements. In this study, intron size polymorphisms were characterized for different Porphyra spiralis var. amplifolia (PSA) populations on the Southern Brazilian coast, and were used to infer genetic relationships and genetic structure of these PSA populations, in addition to cox2-3 and rbcL-S regions. Introns of different sizes were tested qualitatively for in vitro self-splicing. Five intron size polymorphisms within 17 haplotypes were obtained from 80 individuals representing eight localities along the distribution of PSA in the Eastern coast of South America. In order to infer genetic structure and genetic relationships of PSA, these polymorphisms and haplotypes were used as markers for pairwise Fst analyses, Mantel's test and median joining network. The five cox2-3 haplotypes and the unique rbcL-S haplotype were used as markers for summary statistics, neutrality tests Tajima's D and Fu's Fs and for median joining network analyses. An event of demographic expansion from a population with low effective number, followed by a pattern of isolation by distance was obtained for PSA populations with the three analyses. In vitro experiments have shown that introns of different lengths were able to self-splice from pre-RNA transcripts. The findings indicated that degenerated HEGs are reminiscent of the presence of a full-length and functional HEG, once fixed for PSA populations. The cline of HEG degeneration determined the pattern of isolation by distance. Analyses with the other markers indicated an event of demographic expansion from a population with low effective number. The different degrees of degeneration of the HEG do not refrain intron self

  16. Group I introns and associated homing endonuclease genes reveals a clinal structure for Porphyra spiralis var. amplifolia (Bangiales, Rhodophyta along the Eastern coast of South America

    Directory of Open Access Journals (Sweden)

    Matioli Sergio R

    2008-11-01

    Full Text Available Abstract Background Group I introns are found in the nuclear small subunit ribosomal RNA gene (SSU rDNA of some species of the genus Porphyra (Bangiales, Rhodophyta. Size polymorphisms in group I introns has been interpreted as the result of the degeneration of homing endonuclease genes (HEG inserted in peripheral loops of intron paired elements. In this study, intron size polymorphisms were characterized for different Porphyra spiralis var. amplifolia (PSA populations on the Southern Brazilian coast, and were used to infer genetic relationships and genetic structure of these PSA populations, in addition to cox2-3 and rbcL-S regions. Introns of different sizes were tested qualitatively for in vitro self-splicing. Results Five intron size polymorphisms within 17 haplotypes were obtained from 80 individuals representing eight localities along the distribution of PSA in the Eastern coast of South America. In order to infer genetic structure and genetic relationships of PSA, these polymorphisms and haplotypes were used as markers for pairwise Fst analyses, Mantel's test and median joining network. The five cox2-3 haplotypes and the unique rbcL-S haplotype were used as markers for summary statistics, neutrality tests Tajima's D and Fu's Fs and for median joining network analyses. An event of demographic expansion from a population with low effective number, followed by a pattern of isolation by distance was obtained for PSA populations with the three analyses. In vitro experiments have shown that introns of different lengths were able to self-splice from pre-RNA transcripts. Conclusion The findings indicated that degenerated HEGs are reminiscent of the presence of a full-length and functional HEG, once fixed for PSA populations. The cline of HEG degeneration determined the pattern of isolation by distance. Analyses with the other markers indicated an event of demographic expansion from a population with low effective number. The different degrees of

  17. Group I introns and associated homing endonuclease genes reveals a clinal structure for Porphyra spiralis var. amplifolia (Bangiales, Rhodophyta) along the Eastern coast of South America

    Science.gov (United States)

    2008-01-01

    Background Group I introns are found in the nuclear small subunit ribosomal RNA gene (SSU rDNA) of some species of the genus Porphyra (Bangiales, Rhodophyta). Size polymorphisms in group I introns has been interpreted as the result of the degeneration of homing endonuclease genes (HEG) inserted in peripheral loops of intron paired elements. In this study, intron size polymorphisms were characterized for different Porphyra spiralis var. amplifolia (PSA) populations on the Southern Brazilian coast, and were used to infer genetic relationships and genetic structure of these PSA populations, in addition to cox2-3 and rbcL-S regions. Introns of different sizes were tested qualitatively for in vitro self-splicing. Results Five intron size polymorphisms within 17 haplotypes were obtained from 80 individuals representing eight localities along the distribution of PSA in the Eastern coast of South America. In order to infer genetic structure and genetic relationships of PSA, these polymorphisms and haplotypes were used as markers for pairwise Fst analyses, Mantel's test and median joining network. The five cox2-3 haplotypes and the unique rbcL-S haplotype were used as markers for summary statistics, neutrality tests Tajima's D and Fu's Fs and for median joining network analyses. An event of demographic expansion from a population with low effective number, followed by a pattern of isolation by distance was obtained for PSA populations with the three analyses. In vitro experiments have shown that introns of different lengths were able to self-splice from pre-RNA transcripts. Conclusion The findings indicated that degenerated HEGs are reminiscent of the presence of a full-length and functional HEG, once fixed for PSA populations. The cline of HEG degeneration determined the pattern of isolation by distance. Analyses with the other markers indicated an event of demographic expansion from a population with low effective number. The different degrees of degeneration of the HEG

  18. Modulation of mdm2 pre-mRNA splicing by 9-aminoacridine-PNA (peptide nucleic acid conjugates targeting intron-exon junctions

    Directory of Open Access Journals (Sweden)

    Nielsen Peter E

    2010-06-01

    Full Text Available Abstract Background Modulation of pre-mRNA splicing by antisense molecules is a promising mechanism of action for gene therapeutic drugs. In this study, we have examined the potential of peptide nucleic acid (PNA 9-aminoacridine conjugates to modulate the pre-mRNA splicing of the mdm2 human cancer gene in JAR cells. Methods We screened 10 different 15 mer PNAs targeting intron2 at both the 5' - and the 3'-splice site for their effects on the splicing of mdm2 using RT-PCR analysis. We also tested a PNA (2512 targeting the 3'-splice site of intron3 with a complementarity of 4 bases to intron3 and 11 bases to exon4 for its splicing modulation effect. This PNA2512 was further tested for the effects on the mdm2 protein level as well as for inhibition of cell growth in combination with the DNA damaging agent camptothecin (CPT. Results We show that several of these PNAs effectively inhibit the splicing thereby producing a larger mRNA still containing intron2, while skipping of exon3 was not observed by any of these PNAs. The most effective PNA (PNA2406 targeting the 3'-splice site of intron2 had a complementarity of 4 bases to intron2 and 11 bases to exon3. PNA (2512 targeting the 3'-splice site of intron3 induced both splicing inhibition (intron3 skipping and skipping of exon4. Furthermore, treatment of JAR cells with this PNA resulted in a reduction in the level of MDM2 protein and a concomitant increase in the level of tumor suppressor p53. In addition, a combination of this PNA with CPT inhibited cell growth more than CPT alone. Conclusion We have identified several PNAs targeting the 5'- or 3'-splice sites in intron2 or the 3'-splice site of intron3 of mdm2 pre-mRNA which can inhibit splicing. Antisense targeting of splice junctions of mdm2 pre-mRNA may be a powerful method to evaluate the cellular function of MDM2 splice variants as well as a promising approach for discovery of mdm2 targeted anticancer drugs.

  19. Polymorphism in the intron 20 of porcine O-linked N-acetylglucosamine transferase

    Directory of Open Access Journals (Sweden)

    Jong Gug Kim

    2017-08-01

    Full Text Available Objective O-linked N-acetylglucosamine (O-GlcNAc transferase (OGT catalyzes the addition of O-GlcNAc and GlcNAcylation has extensive crosstalk with phosphorylation to regulate signaling and transcription. Pig OGT is located near the region of chromosome X that affects follicle stimulating hormone level and testes size. The objective of this study was to find the variations of OGT between European and Chinese pigs. Methods Pigs were tested initially for polymorphism in OGT among European and Chinese pigs by polymerase chain reaction and sequencing at the U.S. Meat Animal Research Center (USMARC. The polymorphism was also determined in an independent population of pigs including European and Chinese Meishan (ME breeds at the National Institute of Animal Science (NIAS, RDA, Korea. Results The intron 20 of OGT from European and Chinese pigs was 514 and 233 bp, respectively, in the pigs tested initially. They included 1 White composite (WC boar and 7 sows (2 Minzu×WC, 2 Duroc [DU]×WC, 2 ME×WC, 1 Fengzing×WC at USMARC. The 281-bp difference was due to an inserted 276-bp element and GACTT in European pigs. When additional WC and ME boars, the grandparents that were used to generate the 1/2ME×1/2WC parents, and the 84 boars of 16 litters from mating of 1/2ME×1/2WC parents were analyzed, the breeds of origin of X chromosome quantitative trait locus (QTL were confirmed. The polymorphism was determined in an independent population of pigs including DU, Landrace, Yorkshire, and ME breeds at NIAS. OGT was placed at position 67 cM on the chromosome X of the USMARC swine linkage map. Conclusion There was complete concordance with the insertion in European pigs at USMARC and NIAS. This polymorphism could be a useful marker to identify the breed of origin of X chromosome QTL in pigs produced by crossbreeding Chinese and European pigs.

  20. Complete Chloroplast Genome of Medicinal Plant Lonicera japonica: Genome Rearrangement, Intron Gain and Loss, and Implications for Phylogenetic Studies

    Directory of Open Access Journals (Sweden)

    Liu He

    2017-02-01

    Full Text Available The complete chloroplast (cp genome of Lonicera japonica, a common ornamental and medicinal plant in North America and East Asia, was sequenced and analyzed. The length of the L. japonica cp genome is 155,078 bp, contains a pair of inverted repeat regions (IRa and IRb, of 23,774 bp each, as well as large (LSC, 88,858 bp and small (SSC, 18,672 bp single-copy regions. A total of 129 genes were identified in the cp genome, 16 of which were duplicated within the IR regions. Relative to other plant cp genomes, the L. japonica cp genome had a unique rearrangement between trnI-CAU and trnN-GUU. In L. japonica cpDNA, rps19, rpl2, and rpl23 move to the LSC region, from the IR region. The ycf1 pesudogene in the IR region is lost, and only one copy locates in the SSC region. Comparative cp DNA sequence analyses of L. japonica with other cp genomes reveal that the gene order, and the gene and intron contents, are slightly different. The introns in ycf2 and rps18 genes are found for the first time. Four genes (clpP, petB, petD, and rpl16 lost introns. However, its genome structure, GC content, and codon usage were similar to those of typical angiosperm cp genomes. All preferred synonymous codons were found to use codons ending with A/T. The AT-rich sequences were less abundant in the coding regions than in the non-coding ones. A phylogenetic analysis based on 71 protein-coding genes supported the idea that L. japonica is a sister of the Araliaceae species. This study identified unique characteristics of the L. japonica cp genome that contribute to our understanding of the cpDNA evolution. It offers valuable information for the phylogenetic and specific barcoding of this medicinal plant.

  1. Intraspecific variations of Dekkera/Brettanomyces bruxellensis genome studied by capillary electrophoresis separation of the intron splice site profiles.

    Science.gov (United States)

    Vigentini, Ileana; De Lorenzis, Gabriella; Picozzi, Claudia; Imazio, Serena; Merico, Annamaria; Galafassi, Silvia; Piškur, Jure; Foschino, Roberto

    2012-06-15

    In enology, "Brett" character refers to the wine spoilage caused by the yeast Dekkera/Brettanomyces bruxellensis and its production of volatile phenolic off-flavours. However, the spoilage potential of this yeast is strain-dependent. Therefore, a rapid and reliable recognition at the strain level is a key point to avoid serious economic losses. The present work provides an operative tool to assess the genetic intraspecific variation in this species through the use of introns as molecular targets. Firstly, the available partial D./B. bruxellensis genome sequence was investigated in order to build primers annealing to introns 5' splice site sequence (ISS). This analysis allowed the detection of a non-random vocabulary flanking the site and, exploiting this feature, the creation of specific probes for strain discrimination. Secondly, the separation of the intron splice site PCR fragments was obtained throughout the set up of a capillary electrophoresis protocol, giving a 94% repeatability threshold in our experimental conditions. The comparison of results obtained with ISS-PCR/CE versus the ones performed by mtDNA RFLP revealed that the former protocol is more discriminating and allowed a reliable identification at strain level. Actually sixty D./B. bruxellensis isolates were recognised as unique strains, showing a level of similarity below 79% and confirming the high genetic polymorphism existing within the species. Two main clusters were grouped at similarity levels of about 46% and 47%, respectively, showing a poor correlation with the geographic area of isolation. Moreover, from the evolutionary point of view, the proposed technique could determine the frequency of the genome rearrangements that can occur in D./B. bruxellesis populations. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Single-dose protection against Plasmodium berghei by a simian adenovirus vector using a human cytomegalovirus promoter containing intron A.

    Science.gov (United States)

    Sridhar, S; Reyes-Sandoval, A; Draper, S J; Moore, A C; Gilbert, S C; Gao, G P; Wilson, J M; Hill, A V S

    2008-04-01

    Human adenovirus serotype 5 (AdH5) vector vaccines elicit strong immune responses to the encoded antigen and have been used in various disease models. We designed AdH5 vectors expressing antigen under the control of a human cytomegalovirus (HCMV) immediate-early promoter containing its intron A sequence. The transcriptional levels of antigen and immune responses to antigen for vectors with the HCMV promoter with the intron A sequence (LP) were greater than those for AdH5 vectors using the HCMV promoter sequence without intron A (SP). We compared an E1E3-deleted AdH5 adenoviral vector, which affords more space for insertion of foreign sequences, and showed it to be as immunogenic as an E1-deleted AdH5 vector. Neutralizing antibodies to AdH5 limit the efficacy of vaccines based on the AdH5 serotype, and simian adenoviral vectors offer an attractive option to overcome this problem. We constructed E1E3-deleted human and simian adenoviral vectors encoding the pre-erythrocytic-stage malarial antigen Plasmodium berghei circumsporozoite protein. We compared the immunogenicity and efficacy of AdC6, a recombinant simian adenovirus serotype 6 vector, in a murine malaria model to those of AdH5 and the poxviral vectors MVA and FP9. AdC6 induced sterile protection from a single dose in 90% of mice, in contrast to AdH5 (25%) and poxviral vectors MVA and FP9 (0%). Adenoviral vectors maintained potent CD8(+) T-cell responses for a longer period after immunization than did poxviral vectors and mainly induced an effector memory phenotype of cells. Significantly, AdC6 was able to maintain protection in the presence of preexisting immunity to AdH5.

  3. Resequencing PNMT in European hypertensive and normotensive individuals: no common susceptibilily variants for hypertension and purifying selection on intron 1

    Directory of Open Access Journals (Sweden)

    Viigimaa Margus

    2007-07-01

    Full Text Available Abstract Background Human linkage and animal QTL studies have indicated the contribution of genes on Chr17 into blood pressure regulation. One candidate gene is PNMT, coding for phenylethanolamine-N-methyltransferase, catalyzing the synthesis of epinephrine from norepinephrine. Methods Fine-scale variation of PNMT was screened by resequencing hypertensive (n = 50 and normotensive (n = 50 individuals from two European populations (Estonians and Czechs. The resulting polymorphism data were analyzed by statistical genetics methods using Genepop 3.4, PHASE 2.1 and DnaSP 4.0 software programs. In silico prediction of transcription factor binding sites for intron 1 was performed with MatInspector 2.2 software. Results PNMT was characterized by minimum variation and excess of rare SNPs in both normo- and hypertensive individuals. None of the SNPs showed significant differences in allelic frequencies among population samples, as well as between screened hypertensives and normotensives. In the joint case-control analysis of the Estonian and the Czech samples, hypertension patients had a significant excess of heterozygotes for two promoter region polymorphisms (SNP-184; SNP-390. The identified variation pattern of PNMT reflects the effect of purifying selection consistent with an important role of PNMT-synthesized epinephrine in the regulation of cardiovascular and metabolic functions, and as a CNS neurotransmitter. A striking feature is the lack of intronic variation. In silico analysis of PNMT intron 1 confirmed the presence of a human-specific putative Glucocorticoid Responsive Element (GRE, inserted by Alu-mediated transfer. Further analysis of intron 1 supported the possible existence of a full Glucocorticoid Responsive Unit (GRU predicted to consist of multiple gene regulatory elements known to cooperate with GRE in driving transcription. The role of these elements in regulating PNMT expression patterns and thus determining the dynamics of the

  4. DETECTING PRESENCE OF C/T POLYMORPHISM AT POSITION 34 SECOND INTRON OF THE MYOSTATIN GENE IN RABBITS

    Directory of Open Access Journals (Sweden)

    Agnieszka MARKOWSKA

    2011-01-01

    Full Text Available Myostatin gene is a negative regulator of skeletal muscles growth. It is responsible for normal development of skeletal muscles. The objective of the research was to detect variation of C/T at position 34 of the second intron of the MNST gene in rabbits. The research included 114 rabbits: 54 of them Polish Rabbits, and 60 of them White Flemish Giants, examined by means of the PCR-RFLP method using AluI restriction enzyme. We found allele C with a frequency of 0.6184 of the examined rabbit population, and allele T with a frequency of 0.3816 of the examined rabbits.

  5. DETECTING PRESENCE OF C/T POLYMORPHISM AT POSITION 34 SECOND INTRON OF THE MYOSTATIN GENE IN RABBITS

    OpenAIRE

    Agnieszka MARKOWSKA; Alica RAFAYOVA; Anna TRAKOWICKA

    2011-01-01

    Myostatin gene is a negative regulator of skeletal muscles growth. It is responsible for normal development of skeletal muscles. The objective of the research was to detect variation of C/T at position 34 of the second intron of the MNST gene in rabbits. The research included 114 rabbits: 54 of them Polish Rabbits, and 60 of them White Flemish Giants, examined by means of the PCR-RFLP method using AluI restriction enzyme. We found allele C with a frequency of 0.6184 of the examined rabbit pop...

  6. DETECTING PRESENCE OF C/T POLYMORPHISM AT POSITION 34 SECOND INTRON OF THE MYOSTATIN GENE IN RABBITS

    OpenAIRE

    MARKOWSKA, Agnieszka; RAFAYOVA, Alica; TRAKOWICKA, Anna

    2011-01-01

    Myostatin gene is a negative regulator of skeletal muscles growth. It is responsible for normal development of skeletal muscles. The objective of the research was to detect variation of C/T at position 34 of the second intron of the MNST gene in rabbits. The research included 114 rabbits: 54 of them Polish Rabbits, and 60 of them White Flemish Giants, examined by means of the PCR-RFLP method using AluI restriction enzyme. We found allele C with a frequency of 0.6184 of the examine...

  7. Identification of a novel tandemly repeated sequence present in an intron of the glucose phosphate isomerase (GPI) gene in mouse and man

    Energy Technology Data Exchange (ETDEWEB)

    Faik, P.; Walker, J.I.H.; Morgan, M.J. (Guy' s Hospital, London (United Kingdom))

    1994-05-01

    Glucose phosphate isomerase (GPI, glucose 6-phosphate ketol-isomerase, EC 5.3.1.9) is a housekeeping gene expressed in all tissues and organisms that utilize glycolysis and gluconeogenesis. Deficiency in humans leads to a rare form of nonspherocytic hemolytic anemia. The authors have isolated a 3.2-kb mouse cDNA containing glucose phosphate isomerase coding sequence and a 2.1-kb intronic sequence and a large proportion of the human gene (approaching 55 kb) in four phage [lambda] recombinants. A 4-kb intronic fragment from the human gene showing homology to the mouse intronic sequence has been isolated and sequenced. The fragment contains approximately 1.5 kb of sequence that is composited of 30 repeat units of a novel 50-kb tandemly repeated unit. The mouse intronic sequence contains 18 similar units. The human consensus sequence differs from the mouse consensus sequence at only 7 positions out of 50 (positions 16, 26, 27, 42, 43, 47, and 48). A probe containing the repeat element detects polymorphisms, specific to glucose phosphate isomerase, in human DNA. The repeat element does not appear to be present at any other loci in human DNA. The conservation of this intronic repeat element extends to pig and Chinese hamster. 26 refs., 4 figs.

  8. The Long Intron 1 of Growth Hormone Gene from Reeves' Turtle (Chinemys reevesii) Correlates with Negatively Regulated GH Expression in Four Cell Lines.

    Science.gov (United States)

    Liu, Wen-Sheng; Ma, Jing-E; Li, Wei-Xia; Zhang, Jin-Ge; Wang, Juan; Nie, Qing-Hua; Qiu, Feng-Fang; Fang, Mei-Xia; Zeng, Fang; Wang, Xing; Lin, Xi-Ran; Zhang, Li; Chen, Shao-Hao; Zhang, Xi-Quan

    2016-04-12

    Turtles grow slowly and have a long lifespan. Ultrastructural studies of the pituitary gland in Reeves' turtle (Chinemys reevesii) have revealed that the species possesses a higher nucleoplasmic ratio and fewer secretory granules in growth hormone (GH) cells than other animal species in summer and winter. C. reevesii GH gene was cloned and species-specific similarities and differences were investigated. The full GH gene sequence in C. reevesii contains 8517 base pairs (bp), comprising five exons and four introns. Intron 1 was found to be much longer in C. reevesii than in other species. The coding sequence (CDS) of the turtle's GH gene, with and without the inclusion of intron 1, was transfected into four cell lines, including DF-1 chicken embryo fibroblasts, Chinese hamster ovary (CHO) cells, human embryonic kidney 293FT cells, and GH4C1 rat pituitary cells; the turtle growth hormone (tGH) gene mRNA and protein expression levels decreased significantly in the intron-containing CDS in these cell lines, compared with that of the corresponding intronless CDS. Thus, the long intron 1 of GH gene in Reeves' turtle might correlate with downregulated gene expression.

  9. Evidence of uneven selective pressure on different subsets of the conserved human genome; implications for the significance of intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    MacKenzie Alasdair

    2009-12-01

    Full Text Available Abstract Background Human genetic variation produces the wide range of phenotypic differences that make us individual. However, little is known about the distribution of variation in the most conserved functional regions of the human genome. We examined whether different subsets of the conserved human genome have been subjected to similar levels of selective constraint within the human population. We used set theory and high performance computing to carry out an analysis of the density of Single Nucleotide Polymorphisms (SNPs within the evolutionary conserved human genome, at three different selective stringencies, intersected with exonic, intronic and intergenic coordinates. Results We demonstrate that SNP density across the genome is significantly reduced in conserved human sequences. Unexpectedly, we further demonstrate that, despite being conserved to the same degree, SNP density differs significantly between conserved subsets. Thus, both the conserved exonic and intronic genomes contain a significantly reduced density of SNPs compared to the conserved intergenic component. Furthermore the intronic and exonic subsets contain almost identical densities of SNPs indicating that they have been constrained to the same degree. Conclusion Our findings suggest the presence of a selective linkage between the exonic and intronic subsets and ascribes increased significance to the role of introns in human health. In addition, the identification of increased plasticity within the conserved intergenic subset suggests an important role for this subset in the adaptation and diversification of the human population.

  10. The Long Intron 1 of Growth Hormone Gene from Reeves’ Turtle (Chinemys reevesii Correlates with Negatively Regulated GH Expression in Four Cell Lines

    Directory of Open Access Journals (Sweden)

    Wen-Sheng Liu

    2016-04-01

    Full Text Available Turtles grow slowly and have a long lifespan. Ultrastructural studies of the pituitary gland in Reeves’ turtle (Chinemys reevesii have revealed that the species possesses a higher nucleoplasmic ratio and fewer secretory granules in growth hormone (GH cells than other animal species in summer and winter. C. reevesii GH gene was cloned and species-specific similarities and differences were investigated. The full GH gene sequence in C. reevesii contains 8517 base pairs (bp, comprising five exons and four introns. Intron 1 was found to be much longer in C. reevesii than in other species. The coding sequence (CDS of the turtle’s GH gene, with and without the inclusion of intron 1, was transfected into four cell lines, including DF-1 chicken embryo fibroblasts, Chinese hamster ovary (CHO cells, human embryonic kidney 293FT cells, and GH4C1 rat pituitary cells; the turtle growth hormone (tGH gene mRNA and protein expression levels decreased significantly in the intron-containing CDS in these cell lines, compared with that of the corresponding intronless CDS. Thus, the long intron 1 of GH gene in Reeves’ turtle might correlate with downregulated gene expression.

  11. Alteration of introns in a hyaluronan synthase 1 (HAS1 minigene convert Pre-mRNA [corrected] splicing to the aberrant pattern in multiple myeloma (MM: MM patients harbor similar changes.

    Directory of Open Access Journals (Sweden)

    Jitra Kriangkum

    Full Text Available Aberrant pre-mRNA splice variants of hyaluronan synthase 1 (HAS1 have been identified in malignant cells from cancer patients. Bioinformatic analysis suggests that intronic sequence changes can underlie aberrant splicing. Deletions and mutations were introduced into HAS1 minigene constructs to identify regions that can influence aberrant intronic splicing, comparing the splicing pattern in transfectants with that in multiple myeloma (MM patients. Introduced genetic variations in introns 3 and 4 of HAS1 as shown here can promote aberrant splicing of the type detected in malignant cells from MM patients. HAS1Vd is a novel intronic splice variant first identified here. HAS1Vb, an intronic splice variant previously identified in patients, skips exon 4 and utilizes the same intron 4 alternative 3'splice site as HAS1Vd. For transfected constructs with unaltered introns 3 and 4, HAS1Vd transcripts are readily detectable, frequently to the exclusion of HAS1Vb. In contrast, in MM patients, HAS1Vb is more frequent than HAS1Vd. In the HAS1 minigene, combining deletion in intron 4 with mutations in intron 3 leads to a shift from HAS1Vd expression to HAS1Vb expression. The upregulation of aberrant splicing, exemplified here by the expression of HAS1Vb, is shown here to be influenced by multiple genetic changes in intronic sequences. For HAS1Vb, this includes enhanced exon 4 skipping and increased usage of alternative 3' splice sites. Thus, the combination of introduced mutations in HAS1 intron3 with introduced deletions in HAS1 intron 4 promoted a shift to an aberrant splicing pattern previously shown to be clinically significant. Most MM patients harbor genetic variations in intron 4, and as shown here, nearly half harbor recurrent mutations in HAS1 intron 3. Our work suggests that aberrant intronic HAS1 splicing in MM patients may rely on intronic HAS1 deletions and mutations that are frequent in MM patients but absent from healthy donors.

  12. Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene.

    Science.gov (United States)

    Gonçalves, Ana; Oliveira, Jorge; Coelho, Teresa; Taipa, Ricardo; Melo-Pires, Manuel; Sousa, Mário; Santos, Rosário

    2017-10-03

    A broad mutational spectrum in the dystrophin ( DMD ) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD , adding to the diversity of mutational events that give rise to D/BMD.

  13. Identification and Functional Characterization of Two Intronic NIPBL Mutations in Two Patients with Cornelia de Lange Syndrome

    Directory of Open Access Journals (Sweden)

    María E. Teresa-Rodrigo

    2016-01-01

    Full Text Available Cornelia de Lange syndrome (CdLS is a rare genetically heterogeneous disorder with a high phenotypic variability including mental retardation, developmental delay, and limb malformations. The genetic causes in about 30% of patients with CdLS are still unknown. We report on the functional characterization of two intronic NIPBL mutations in two patients with CdLS that do not affect a conserved splice-donor or acceptor site. Interestingly, mRNA analyses showed aberrantly spliced transcripts missing exon 28 or 37, suggesting the loss of the branch site by the c.5329-15A>G transition and a disruption of the polypyrimidine by the c.6344del(-13_(-8 deletion. While the loss of exon 28 retains the reading frame of the NIBPL transcript resulting in a shortened protein, the loss of exon 37 shifts the reading frame with the consequence of a premature stop of translation. Subsequent quantitative PCR analysis demonstrated a 30% decrease of the total NIPBL mRNA levels associated with the frameshift transcript. Consistent with our results, this patient shows a more severe phenotype compared to the patient with the aberrant transcript that retains its reading frame. Thus, intronic variants identified by sequencing analysis in CdLS diagnostics should carefully be examined before excluding them as nonrelevant to disease.

  14. Identification and Functional Characterization of Two Intronic NIPBL Mutations in Two Patients with Cornelia de Lange Syndrome.

    Science.gov (United States)

    Teresa-Rodrigo, María E; Eckhold, Juliane; Puisac, Beatriz; Pozojevic, Jelena; Parenti, Ilaria; Baquero-Montoya, Carolina; Gil-Rodríguez, María C; Braunholz, Diana; Dalski, Andreas; Hernández-Marcos, María; Ayerza, Ariadna; Bernal, María L; Ramos, Feliciano J; Wieczorek, Dagmar; Gillessen-Kaesbach, Gabriele; Pié, Juan; Kaiser, Frank J

    2016-01-01

    Cornelia de Lange syndrome (CdLS) is a rare genetically heterogeneous disorder with a high phenotypic variability including mental retardation, developmental delay, and limb malformations. The genetic causes in about 30% of patients with CdLS are still unknown. We report on the functional characterization of two intronic NIPBL mutations in two patients with CdLS that do not affect a conserved splice-donor or acceptor site. Interestingly, mRNA analyses showed aberrantly spliced transcripts missing exon 28 or 37, suggesting the loss of the branch site by the c.5329-15A>G transition and a disruption of the polypyrimidine by the c.6344del(-13)_(-8) deletion. While the loss of exon 28 retains the reading frame of the NIBPL transcript resulting in a shortened protein, the loss of exon 37 shifts the reading frame with the consequence of a premature stop of translation. Subsequent quantitative PCR analysis demonstrated a 30% decrease of the total NIPBL mRNA levels associated with the frameshift transcript. Consistent with our results, this patient shows a more severe phenotype compared to the patient with the aberrant transcript that retains its reading frame. Thus, intronic variants identified by sequencing analysis in CdLS diagnostics should carefully be examined before excluding them as nonrelevant to disease.

  15. The Function of the Conserved Regulatory Element within the Second Intron of the Mammalian Csf1r Locus

    Science.gov (United States)

    O’Neal, Julie; Sester, David P.; Tagoh, Hiromi; Ingram, Richard M.; Pridans, Clare; Bonifer, Constanze; Hume, David A.

    2013-01-01

    The gene encoding the receptor for macrophage colony-stimulating factor (CSF-1R) is expressed exclusively in cells of the myeloid lineages as well as trophoblasts. A conserved element in the second intron, Fms-Intronic Regulatory Element (FIRE), is essential for macrophage-specific transcription of the gene. However, the molecular details of how FIRE activity is regulated and how it impacts the Csf1r promoter have not been characterised. Here we show that agents that down-modulate Csf1r mRNA transcription regulated promoter activity altered the occupancy of key FIRE cis-acting elements including RUNX1, AP1, and Sp1 binding sites. We demonstrate that FIRE acts as an anti-sense promoter in macrophages and reversal of FIRE orientation within its native context greatly reduced enhancer activity in macrophages. Mutation of transcription initiation sites within FIRE also reduced transcription. These results demonstrate that FIRE is an orientation-specific transcribed enhancer element. PMID:23383005

  16. The evolution of the macrophage-specific enhancer (Fms intronic regulatory element) within the CSF1R locus of vertebrates.

    Science.gov (United States)

    Hume, David A; Wollscheid-Lengeling, Evi; Rojo, Rocio; Pridans, Clare

    2017-12-07

    The Csf1r locus encodes the receptor for macrophage colony-stimulating factor, which controls the proliferation, differentiation and survival of macrophages. The 300 bp Fms intronic regulatory element (FIRE), within the second intron of Csf1r, is necessary and sufficient to direct macrophage-specific transcription. We have analysed the conservation and divergence of the FIRE DNA sequence in vertebrates. FIRE is present in the same location in the Csf1r locus in reptile, avian and mammalian genomes. Nearest neighbor analysis based upon this element alone largely recapitulates phylogenies inferred from much larger genomic sequence datasets. One core element, containing binding sites for AP1 family and the macrophage-specific transcription factor, PU.1, is conserved from lizards to humans. Around this element, the FIRE sequence is conserved within clades with the most conserved elements containing motifs for known myeloid-expressed transcription factors. Conversely, there is little alignment between clades outside the AP1/PU.1 element. The analysis favours a hybrid between "enhanceosome" and "smorgasbord" models of enhancer function, in which elements cooperate to bind components of the available transcription factor milieu.

  17. Identification of a nuclear matrix attachment region like sequence in the last intron of PI3Kγ

    International Nuclear Information System (INIS)

    Dai Bingbing; Ying Lei; Cai Rong; Li Ying; Zhang Xingqian; Lu Jian; Qian Guanxiang

    2006-01-01

    MARs are not only the structure bases of chromatin higher order structure but also have much biological significance. In this study, the whole sequence of about 100 kb in length from BAC clone of GS1-223D4 (GI: 5931478), in which human PI3Kγ gene is localized, was analyzed by two online-based computer programs, MARFinder and SMARTest. A strong potential MAR was predicted in the last and largest intron of PI3Kγ. The predicted 2 kb MAR, we refer to PIMAR, was further analyzed through biochemical methods in vitro and in vivo. The results showed that the PIMAR could be associated with nuclear matrices from HeLa cells both in vitro and in vivo. Further reporter gene analysis showed that in the transient transfection the expression of reporter gene linked with reversed PIMAR was repressed slightly, while in stably integrated state, the luciferase reporter both linked with reversed and orientated PIMAR was enhanced greatly in NIH-3T3 and K-562. These results suggest that the PIMAR maybe has the capacity of shielding integrated heterogeneous gene from chromatin position effect. Through combination of computer program analysis with confirmation by biochemical methods, we identified, for First time, a 2 kb matrix attachment region like sequence in the last intron of human PI3Kγ

  18. Variation of the OsGI intron and its phenotypic associations in Oryza rufipogon Griff. and Oryza sativa L.

    Science.gov (United States)

    Dong, Y; Chen, Z; Pei, X; Wang, F; Yuan, Q; Wu, H; Jia, S; Peng, Y

    2013-07-30

    We analyzed intron 9 of the OsGI gene in Oryza rufipogon and Oryza sativa in order to investigate evolutionary relationships in rice and the relationship between intron variation and phenotype. OsGI-9 was cloned in 38 O. rufipogon populations and in 139 O. sativa cultivars and the phylogeny was reconstructed. Seed cold tolerance and dormancy were quantified in O. sativa. Three OsGI-9 band types occurred in O. rufipogon: S-type (1.2 kb), F-type (0.9 kb), and FS-type (1.2 and 0.9 kb), whereas only the S-type and F-type occurred in O. sativa. The S-type contains two 255-bp repeats, the F-type contains one 255-bp repeat, and the FS-type contains both. All individuals could be divided into 5 groups in the organism's phylogenetic network: S-type O. rufipogon, F-type O. rufipogon, FS-type O. rufipogon, S-type O. sativa, and F-type O. sativa. F-type O. sativa are most closely related to F-type O. rufipogon and S-type O. sativa are most closely related to S-type O. rufipogon. Statistical analysis indicated that OsGI-9 type is significantly correlated with phenotype; most S-type O. sativa have strong seed dormancy and cold tolerance, and most F-type O. sativa have no seed dormancy and poor cold tolerance.

  19. Analysis of the intronic single nucleotide polymorphism rs#466452 of the nephrin gene in patients with diabetic nephropathy

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2009-01-01

    Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.

  20. In situ genetic correction of F8 intron 22 inversion in hemophilia A patient-specific iPSCs.

    Science.gov (United States)

    Wu, Yong; Hu, Zhiqing; Li, Zhuo; Pang, Jialun; Feng, Mai; Hu, Xuyun; Wang, Xiaolin; Lin-Peng, Siyuan; Liu, Bo; Chen, Fangping; Wu, Lingqian; Liang, Desheng

    2016-01-08

    Nearly half of severe Hemophilia A (HA) cases are caused by F8 intron 22 inversion (Inv22). This 0.6-Mb inversion splits the 186-kb F8 into two parts with opposite transcription directions. The inverted 5' part (141 kb) preserves the first 22 exons that are driven by the intrinsic F8 promoter, leading to a truncated F8 transcript due to the lack of the last 627 bp coding sequence of exons 23-26. Here we describe an in situ genetic correction of Inv22 in patient-specific induced pluripotent stem cells (iPSCs). By using TALENs, the 627 bp sequence plus a polyA signal was precisely targeted at the junction of exon 22 and intron 22 via homologous recombination (HR) with high targeting efficiencies of 62.5% and 52.9%. The gene-corrected iPSCs retained a normal karyotype following removal of drug selection cassette using a Cre-LoxP system. Importantly, both F8 transcription and FVIII secretion were rescued in the candidate cell types for HA gene therapy including endothelial cells (ECs) and mesenchymal stem cells (MSCs) derived from the gene-corrected iPSCs. This is the first report of an efficient in situ genetic correction of the large inversion mutation using a strategy of targeted gene addition.

  1. CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells.

    Science.gov (United States)

    Xia, Heng; Chen, Dong; Wu, Qijia; Wu, Gang; Zhou, Yanhong; Zhang, Yi; Zhang, Libin

    2017-09-01

    The current RIP-seq approach has been developed for the identification of genome-wide interaction between RNA binding protein (RBP) and the bound RNA transcripts, but still rarely for identifying its binding sites. In this study, we performed RIP-seq experiments in HeLa cells using a monoclonal antibody against CELF1. Mapping of the RIP-seq reads showed a biased distribution at the 3'UTR and intronic regions. A total of 15,285 and 1384 CELF1-specific sense and antisense peaks were identified using the ABLIRC software tool. Our bioinformatics analyses revealed that 5' and 3' splice site motifs and GU-rich motifs were highly enriched in the CELF1-bound peaks. Furthermore, transcriptome analyses revealed that alternative splicing was globally regulated by CELF1 in HeLa cells. For example, the inclusion of exon 16 of LMO7 gene, a marker gene of breast cancer, is positively regulated by CELF1. Taken together, we have shown that RIP-seq data can be used to decipher RBP binding sites and reveal an unexpected landscape of the genome-wide CELF1-RNA interactions in HeLa cells. In addition, we found that CELF1 globally regulates the alternative splicing by binding the exon-intron boundary in HeLa cells, which will deepen our understanding of the regulatory roles of CELF1 in the pre-mRNA splicing process. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Synonymous codon usage bias in plant mitochondrial genes is associated with intron number and mirrors species evolution.

    Directory of Open Access Journals (Sweden)

    Wenjing Xu

    Full Text Available Synonymous codon usage bias (SCUB is a common event that a non-uniform usage of codons often occurs in nearly all organisms. We previously found that SCUB is correlated with both intron number and exon position in the plant nuclear genome but not in the plastid genome; SCUB in both nuclear and plastid genome can mirror the evolutionary specialization. However, how about the rules in the mitochondrial genome has not been addressed. Here, we present an analysis of SCUB in the mitochondrial genome, based on 24 plant species ranging from algae to land plants. The frequencies of NNA and NNT (A- and T-ending codons are higher than those of NNG and NNC, with the strongest preference in bryophytes and the weakest in land plants, suggesting an association between SCUB and plant evolution. The preference for NNA and NNT is more evident in genes harboring a greater number of introns in land plants, but the bias to NNA and NNT exhibits even among exons. The pattern of SCUB in the mitochondrial genome differs in some respects to that present in both the nuclear and plastid genomes.

  3. SATB1 regulates SPARC expression in K562 cell line through binding to a specific sequence in the third intron

    International Nuclear Information System (INIS)

    Li, K.; Cai, R.; Dai, B.B.; Zhang, X.Q.; Wang, H.J.; Ge, S.F.; Xu, W.R.; Lu, J.

    2007-01-01

    Special AT-rich binding protein 1 (SATB1), a cell type-specific nuclear matrix attachment region (MAR) DNA-binding protein, tethers to a specific DNA sequence and regulates gene expression through chromatin remodeling and HDAC (histone deacetylase complex) recruitment. In this study, a SATB1 eukaryotic expression plasmid was transfected into the human erythroleukemia K562 cell line and individual clones that stably over-expressed the SATB1 protein were isolated. Microarray analysis revealed that hundreds of genes were either up- or down-regulated in the SATB1 over-expressing K562 cell lines. One of these was the extra-cellular matrix glycoprotein, SPARC (human secreted protein acidic and rich in cysteine). siRNA knock-down of SATB1 also reduced SPARC expression, which was consistent with elevated SPARC levels in the SATB1 over-expressing cell line. Bioinformatics software Mat-inspector showed that a 17 bp DNA sequence in the third intron of SPARC possessed a high potential for SATB1 binding; a finding confirmed by Chromatin immunoprecipitation (ChIP) with anti-SATB1 antibody. Our results show for the first time that forced-expression of SATB1 in K562 cells triggers SPARC up-regulation by binding to a 17 bp DNA sequence in the third intron

  4. RNA-sequencing of a mouse-model of spinal muscular atrophy reveals tissue-wide changes in splicing of U12-dependent introns

    DEFF Research Database (Denmark)

    Doktor, Thomas Koed; Hua, Yimin; Andersen, Henriette Skovgaard

    2016-01-01

    unknown. It is likely that aberrant splicing of genes expressed in motor neurons is involved in SMA pathogenesis, but increasing evidence indicates that pathologies also exist in other tissues. We present here a comprehensive RNA-seq study that covers multiple tissues in an SMA mouse model. We show...... elevated U12-intron retention in all examined tissues from SMA mice, and that U12-dependent intron retention is induced upon siRNA knock-down of SMN in HeLa cells. Furthermore, we show that retention of U12-dependent introns is mitigated by ASO treatment of SMA mice and that many transcriptional changes......Spinal Muscular Atrophy (SMA) is a neuromuscular disorder caused by insufficient levels of the Survival of Motor Neuron (SMN) protein. SMN is expressed ubiquitously and functions in RNA processing pathways that include trafficking of mRNA and assembly of snRNP complexes. Importantly, SMA severity...

  5. RNA-binding protein regulates plant DNA methylation by controlling mRNA processing at the intronic heterochromatin-containing gene IBM1.

    Science.gov (United States)

    Wang, Xingang; Duan, Cheng-Guo; Tang, Kai; Wang, Bangshing; Zhang, Huiming; Lei, Mingguang; Lu, Kun; Mangrauthia, Satendra K; Wang, Pengcheng; Zhu, Guohui; Zhao, Yang; Zhu, Jian-Kang

    2013-09-17

    DNA methylation-dependent heterochromatin formation is a conserved mechanism of epigenetic silencing of transposons and other repeat elements in many higher eukaryotes. Genes adjacent to repetitive elements are often also subjected to this epigenetic silencing. Consequently, plants have evolved antisilencing mechanisms such as active DNA demethylation mediated by the REPRESSOR OF SILENCING 1 (ROS1) family of 5-methylcytosine DNA glycosylases to protect these genes from silencing. Some transposons and other repeat elements have found residence in the introns of genes. It is unclear how these intronic repeat elements-containing genes are regulated. We report here the identification of ANTI-SILENCING 1 (ASI1), a bromo-adjacent homology domain and RNA recognition motif-containing protein, from a forward genetic screen for cellular antisilencing factors in Arabidopsis thaliana. ASI1 is required to prevent promoter DNA hypermethylation and transcriptional silencing of some transgenes. Genome-wide DNA methylation analysis reveals that ASI1 has a similar role to that of the histone H3K9 demethylase INCREASE IN BONSAI METHYLATION 1 (IBM1) in preventing CHG methylation in the bodies of thousands of genes. We found that ASI1 is an RNA-binding protein and ensures the proper expression of IBM1 full-length transcript by associating with an intronic heterochromatic repeat element of IBM1. Through mRNA sequencing, we identified many genes containing intronic transposon elements that require ASI1 for proper expression. Our results suggest that ASI1 associates with intronic heterochromatin and binds the gene transcripts to promote their 3' distal polyadenylation. The study thus reveals a unique mechanism by which higher eukaryotes deal with the collateral effect of silencing intronic repeat elements.

  6. Suppression of the Arboviruses Dengue and Chikungunya Using a Dual-Acting Group-I Intron Coupled with Conditional Expression of the Bax C-Terminal Domain.

    Directory of Open Access Journals (Sweden)

    James R Carter

    Full Text Available In portions of South Asia, vectors and patients co-infected with dengue (DENV and chikungunya (CHIKV are on the rise, with the potential for this occurrence in other regions of the world, for example the United States. Therefore, we engineered an antiviral approach that suppresses the replication of both arboviruses in mosquito cells using a single antiviral group I intron. We devised unique configurations of internal, external, and guide sequences that permit homologous recognition and splicing with conserved target sequences in the genomes of both viruses using a single trans-splicing Group I intron, and examined their effectiveness to suppress infections of DENV and CHIKV in mosquito cells when coupled with a proapoptotic 3' exon, ΔN Bax. RT-PCR demonstrated the utility of these introns in trans-splicing the ΔN Bax sequence downstream of either the DENV or CHIKV target site in transformed Aedes albopictus C6/36 cells, independent of the order in which the virus specific targeting sequences were inserted into the construct. This trans-splicing reaction forms DENV or CHIKV ΔN Bax RNA fusions that led to apoptotic cell death as evidenced by annexin V staining, caspase, and DNA fragmentation assays. TCID50-IFA analyses demonstrate effective suppression of DENV and CHIKV infections by our anti-arbovirus group I intron approach. This represents the first report of a dual-acting Group I intron, and demonstrates that we can target DENV and CHIKV RNAs in a sequence specific manner with a single, uniquely configured CHIKV/DENV dual targeting group I intron, leading to replication suppression of both arboviruses, and thus providing a promising single antiviral for the transgenic suppression of multiple arboviruses.

  7. Six group I introns and three internal transcribed spacers in the chloroplast large subunit ribosomal RNA gene of the green alga Chlamydomonas eugametos.

    Science.gov (United States)

    Turmel, M; Boulanger, J; Schnare, M N; Gray, M W; Lemieux, C

    1991-03-20

    The chloroplast large subunit rRNA gene of Chlamydomonas eugametos and its 5' flanking region encoding tRNA(Ile) (GAU) and tRNA(Ala) (UGC) have been sequenced. The DNA sequence data along with the results of a detailed RNA analysis disclosed two unusual features of this green algal large subunit rRNA gene: (1) the presence of six group I introns (CeLSU.1-CeLSU.6) whose insertion positions have not been described previously, and (2) the presence of three short internal transcribed spacers that are post-transcriptionally excised to yield four rRNA species of 280, 52, 810 and 1720 nucleotides, positioned in this order (5' to 3') in the primary transcript. Together, these RNA species can assume a secondary structure that is almost identical to that proposed for the 23 S rRNA of Escherichia coli. All three internal transcribed spacers map to variable regions of primary sequence and/or potential secondary structure, whereas all six introns lie within highly conserved regions. The first three introns are inserted within the sequence encoding the 810 nucleotide rRNA species and map within domain II of the large subunit rRNA structure; the remaining introns, found in the sequence encoding the 1720 nucleotide rRNA species, lie within either domain IV or V, as is the case for all other large subunit rDNA introns that have been documented to date. CeLSU.5 and CeLSU.6 each contain a long open reading frame (ORF) of more than 200 codons. While the CeLSU.6 ORF is not related to any known ORFs, the CeLSU.5 ORF belongs to a family of ORFs that have been identified in Podospora and Neurospora mitochondrial group I introns. The finding that a polymorphic marker showing unidirectional gene conversion during crosses between C. eugametos and Chlamydomonas moewusii is located within the CeLSU.5 ORF makes it likely that this intron is a mobile element and that its ORF encodes a site-specific endonuclease promoting the transfer of the intron DNA sequence.

  8. Mutation at intronic repeats of the ataxia-telangiectasia mutated (ATM gene and ATM protein loss in primary gastric cancer with microsatellite instability.

    Directory of Open Access Journals (Sweden)

    Hee Sung Kim

    Full Text Available Ataxia-telangiectasia mutated (ATM is a Ser/Thr protein kinase that plays a critical role in DNA damage-induced signaling and initiation of cell cycle checkpoint signaling in response to DNA-damaging agents such as ionizing radiation. We have previously reported the ATM protein loss by immunohistochemistry (IHC in 16% of human gastric cancer (GC tissue. We hypothesized that ATM gene intron mutations targeted by microsatellite instability (MSI cause ATM protein loss in a subset of GC. We studied mononucleotide mutations at the intron of ATM gene, ATM IHC and MSI in GC. Ten human gastric cancer cell lines were studied for the ATM gene mutation at introns, RT-PCR, direct sequencing, and immunohistochemistry. GC tissues of 839 patients were analyzed for MSI and ATM IHC. Among them, 604 cases were analyzed for the ATM mutations at introns preceding exon 6, exon 10 and exon 20. Two human GC cell lines (SNU-1 and -638 showed ATM intron mutations, deletion in RT-PCR and direct sequencing, and ATM protein loss by IHC. The frequencies of ATM mutation, MSI, and ATM protein loss were 12.9% (78/604, 9.2% (81/882 and 15.2% (134/839, respectively. Analysis of associations among MSI, ATM gene mutation, and ATM protein loss revealed highly co-existing ATM gene alterations and MSI. ATM intron mutation and ATM protein loss were detected in 69.3% (52/75 and 53.3% (40/75 of MSI positive GC. MSI positivity and ATM protein loss were present in 68.4% (52/76 and 48.7% (37/76 of GC with ATM intron mutation. ATM mutation and ATM protein loss had characteristics of old age, distal location of tumor, large tumor size, and histologic intestinal type. Our study might be interpreted as that ATM gene mutation at intron might be targeted by MSI and lead to ATM protein loss in a selected group of GC.

  9. Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns

    Directory of Open Access Journals (Sweden)

    Fraser Tresa S

    2010-11-01

    Full Text Available Abstract Background Dengue viruses (DENV are one of the most important viral diseases in the world with approximately 100 million infections and 200,000 deaths each year. The current lack of an approved tetravalent vaccine and ineffective insecticide control measures warrant a search for alternatives to effectively combat DENV. The trans-splicing variant of the Tetrahymena thermophila group I intron catalytic RNA, or ribozyme, is a powerful tool for post-transcriptional RNA modification. The nature of the ribozyme and the predictability with which it can be directed makes it a powerful tool for modifying RNA in nearly any cell type without the need for genome-altering gene therapy techniques or dependence on native cofactors. Results Several anti-DENV Group I trans-splicing introns (αDENV-GrpIs were designed and tested for their ability to target DENV-2 NGC genomes in situ. We have successfully targeted two different uracil bases on the positive sense genomic strand within the highly conserved 5'-3' cyclization sequence (CS region common to all serotypes of DENV with our αDENV-GrpIs. Our ribozymes have demonstrated ability to specifically trans-splice a new RNA sequence downstream of the targeted site in vitro and in transfected insect cells as analyzed by firefly luciferase and RT-PCR assays. The effectiveness of these αDENV-GrpIs to target infecting DENV genomes is also validated in transfected or transformed Aedes mosquito cell lines upon infection with unattenuated DENV-2 NGC. Conclusions Analysis shows that our αDENV-GrpIs have the ability to effectively trans-splice the DENV genome in situ. Notably, these results show that the αDENV-GrpI 9v1, designed to be active against all forms of Dengue virus, effectively targeted the DENV-2 NGC genome in a sequence specific manner. These novel αDENV-GrpI introns provide a striking alternative to other RNA based approaches for the transgenic suppression of DENV in transformed mosquito cells and

  10. Molecular studies of Callithrix pygmaea (Primates, Platyrrhini based on transferrin intronic and ND1 regions: implications for taxonomy and conservation

    Directory of Open Access Journals (Sweden)

    Tagliaro Claudia Helena

    2000-01-01

    Full Text Available Traditional classifications of Platyrrhini monkeys, based mainly on morphological features, are being contested by recent molecular data. The subfamily Callitrichinae (Platyrrhini, Primates consists of a diverse group of species, many of them considered endangered. Our analysis of two DNA regions, a mtDNA gene (ND1 and a nuclear gene (intronic regions of the transferrin gene, suggests that Callithrix pygmaea may have sufficient variability to justify the existence of subspecies or even separate species. Phylogenetic dendrograms based on the ND1 region show that this species is more closely related to Amazonian than to Atlantic forest marmosets. These results reopen the discussion about diversity and conservation programs based exclusively on traditional classifications.

  11. Molecular genetic analysis of cereal β-amylase genes using exon-primed intron-crossing (EPIC PCR

    Directory of Open Access Journals (Sweden)

    Stratula Olga

    2014-01-01

    Full Text Available The proteins encoded by cereal β-amylase genes Bamy1 and Bamy2 genes play an important role in seedling germination and in the brewing process. Here, we use exon-primed intron-crossing (EPIC to analyse Bamy1 and Bamy2 genetic diversity among 38 accessions belonging to six Poaceae tribes. DNA sequence alignment of multiple Poaceae species β-amylase sequences allowed design of EPIC primers that simultaneously amplify Bamy1 and Bamy2 in all the cereal species investigated. The genetic variation observed in the samples investigated is analysed and discussed, and illustrates the effectiveness of this approach for intra- and interspecific analysis in plant species.

  12. Effects of promoter, intron and enhancer elements on transient gene expression in sugar-cane and carrot protoplasts.

    Science.gov (United States)

    Rathus, C; Bower, R; Birch, R G

    1993-11-01

    Various chimaeric promoter regions coupled to the uidA beta-glucuronidase gene were evaluated for transient expression strength following electroporation into sugar-cane (monocot) and carrot (dicot) protoplasts. Multiple enhancer elements increased expression in sugar-cane, by up to 400-fold for the artificial Emu promoter relative to the CaMV 35S promoter. The relative expression strengths of promoters varied substantially between the species. Sugar-cane also differed in some respects from previously tested species in the family Poaceae. For example, in sugar-cane the nopaline synthase and CaMV 35S promoters were of equivalent strength, and insertion of Adh1 intron 1 into the 5' transcribed region decreased expression strength.

  13. Characterization of a canine tetranucleotide microsatellite marker located in the first intron of the tumor necrosis factor alpha gene.

    Science.gov (United States)

    Watanabe, Masashi; Tanaka, Kazuaki; Takizawa, Tatsuya; Segawa, Kazuhito; Neo, Sakurako; Tsuchiya, Ryo; Murata, Michiko; Murakami, Masaru; Hisasue, Masaharu

    2014-01-01

    A polymorphic tetranucleotide (GAAT)n microsatellite in the first intron of the canine tumor necrosis factor alpha (TNFA) gene was characterized in this study; 139 dogs were analyzed: 22 Beagles, 26 Chihuahuas, 20 Miniature Dachshunds, 24 Miniature Poodles, 22 Pembroke Welsh Corgis and 25 Shiba Inus. We detected the presence of the 4 alleles (GAAT)5, (GAAT)6, (GAAT)7 and (GAAT)8, including 9 of the 10 expected genotypes. The expected heterozygosity (He) and the polymorphic information content (PIC) value of this microsatellite locus varied from 0.389 to 0.749 and from 0.333 to 0.682, respectively, among the 6 breeds. The allelic frequency differed greatly among breeds, but this microsatellite marker was highly polymorphic and could be a useful marker for the canine TNFA gene.

  14. Arabidopsis mTERF15 is required for mitochondrial nad2 intron 3 splicing and functional complex I activity.

    Directory of Open Access Journals (Sweden)

    Ya-Wen Hsu

    Full Text Available Mitochondria play a pivotal role in most eukaryotic cells, as they are responsible for the generation of energy and diverse metabolic intermediates for many cellular events. During endosymbiosis, approximately 99% of the genes encoded by the mitochondrial genome were transferred into the host nucleus, and mitochondria import more than 1000 nuclear-encoded proteins from the cytosol to maintain structural integrity and fundamental functions, including DNA replication, mRNA transcription and RNA metabolism of dozens of mitochondrial genes. In metazoans, a family of nuclear-encoded proteins called the mitochondrial transcription termination factors (mTERFs regulates mitochondrial transcription, including transcriptional termination and initiation, via their DNA-binding activities, and the dysfunction of individual mTERF members causes severe developmental defects. Arabidopsis thaliana and Oryza sativa contain 35 and 48 mTERFs, respectively, but the biological functions of only a few of these proteins have been explored. Here, we investigated the biological role and molecular mechanism of Arabidopsis mTERF15 in plant organelle metabolism using molecular genetics, cytological and biochemical approaches. The null homozygous T-DNA mutant of mTERF15, mterf15, was found to result in substantial retardation of both vegetative and reproductive development, which was fully complemented by the wild-type genomic sequence. Surprisingly, mitochondria-localized mTERF15 lacks obvious DNA-binding activity but processes mitochondrial nad2 intron 3 splicing through its RNA-binding ability. Impairment of this splicing event not only disrupted mitochondrial structure but also abolished the activity of mitochondrial respiratory chain complex I. These effects are in agreement with the severe phenotype of the mterf15 homozygous mutant. Our study suggests that Arabidopsis mTERF15 functions as a splicing factor for nad2 intron 3 splicing in mitochondria, which is essential

  15. The essential function of the Trypanosoma brucei Trl1 homolog in procyclic cells is maturation of the intron-containing tRNATyr

    Czech Academy of Sciences Publication Activity Database

    Lopes, R.R.S.; Silveira, G. de O.; Eitler, R.; Vidal, R.S.; Kessler, A.; Hinger, S.; Paris, Zdeněk; Alfonzo, J. D.; Polycarpo, C.

    2016-01-01

    Roč. 22, č. 8 (2016), s. 1190-1199 ISSN 1355-8382 R&D Projects: GA ČR GJ15-21450Y Institutional support: RVO:60077344 Keywords : Trypanosoma * tRNA * tRNA editing * splicing * intron Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.605, year: 2016

  16. quatre-quart1 is an indispensable U12 intron-containing gene that plays a crucial role in Arabidopsis development.

    Science.gov (United States)

    Kwak, Kyung Jin; Kim, Bo Mi; Lee, Kwanuk; Kang, Hunseung

    2017-05-17

    Despite increasing understanding of the importance of the splicing of U12-type introns in plant development, the key question of which U12 intron-containing genes are essential for plant development has not yet been explored. Here, we assessed the functional role of the quatre-quart1 (QQT1) gene, one of the ~230 U12 intron-containing genes in Arabidopsis thaliana. Expression of QQT1 in the U11/U12-31K small nuclear ribonucleoprotein mutant (31k) rescued the developmental-defect phenotypes of the 31k mutant, whereas the miRNA-mediated qqt1 knockdown mutants displayed severe defects in growth and development, including severely arrested stem growth, small size, and the formation of serrated leaves. The structures of the shoot apical meristems in the qqt1 mutants were abnormal and disordered. Identification of QQT1-interacting proteins via a yeast two-hybrid screening and a firefly luciferase complementation-imaging assay revealed that a variety of proteins, including many chloroplast-targeted proteins, interacted with QQT1. Importantly, the levels of chloroplast-targeted proteins in the chloroplast were reduced, and the chloroplast structure was abnormal in the qqt1 mutant. Collectively, these results provide clear evidence that QQT1 is an indispensable U12 intron-containing gene whose correct splicing is crucial for the normal development of Arabidopsis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  17. Abiotic stresses affect differently the intron splicing and expression of chloroplast genes in coffee plants (Coffea arabica) and rice (Oryza sativa).

    Science.gov (United States)

    Nguyen Dinh, Sy; Sai, Than Zaw Tun; Nawaz, Ghazala; Lee, Kwanuk; Kang, Hunseung

    2016-08-20

    Despite the increasing understanding of the regulation of chloroplast gene expression in plants, the importance of intron splicing and processing of chloroplast RNA transcripts under stress conditions is largely unknown. Here, to understand how abiotic stresses affect the intron splicing and expression patterns of chloroplast genes in dicots and monocots, we carried out a comprehensive analysis of the intron splicing and expression patterns of chloroplast genes in the coffee plant (Coffea arabica) as a dicot and rice (Oryza sativa) as a monocot under abiotic stresses, including drought, cold, or combined drought and heat stresses. The photosynthetic activity of both coffee plants and rice seedlings was significantly reduced under all stress conditions tested. Analysis of the transcript levels of chloroplast genes revealed that the splicing of tRNAs and mRNAs in coffee plants and rice seedlings were significantly affected by abiotic stresses. Notably, abiotic stresses affected differently the splicing of chloroplast tRNAs and mRNAs in coffee plants and rice seedlings. The transcript levels of most chloroplast genes were markedly downregulated in both coffee plants and rice seedlings upon stress treatment. Taken together, these results suggest that coffee and rice plants respond to abiotic stresses via regulating the intron splicing and expression of different sets of chloroplast genes. Copyright © 2016 Elsevier GmbH. All rights reserved.

  18. Molecular analysis of the androgen-receptor gene in a family with receptor-positive partial androgen insensitivity: an unusual type of intronic mutation

    NARCIS (Netherlands)

    H.T. Brüggenwirth (Hennie); A.L.M. Boehmer (Annemie); S. Ramnarain; M.C. Verleun-Mooijman; D.P.E. Satijn (David); J. Trapman (Jan); J.A. Grootegoed (Anton); A.O. Brinkmann (Albert)

    1997-01-01

    textabstractIn the coding part and the intron-exon boundaries of the androgen-receptor gene of a patient with partial androgen insensitivity, no mutation was found. The androgen receptor of this patient displayed normal ligand-binding parameters and migrated as a

  19. G/T substitution in intron 1 of the UNC13B gene is associated with increased risk of nephropathy in patients with type 1 diabetes

    DEFF Research Database (Denmark)

    Tregouet, D.A.; Groop, P.H.; McGinn, S.

    2008-01-01

    . We report molecular genetic studies for 127 candidate genes for nephropathy. RESEARCH DESIGN AND METHODS: Polymorphisms were identified through sequencing of promoter, exon, and flanking intron gene regions and a database search. A total of 344 nonredundant SNPs and nonsynonymous variants were tested...

  20. Identification of GATA2 and AP-1 activator elements within the enhancer VNTR occurring in intron 5 of the human SIRT3 gene

    Science.gov (United States)

    Human SIRT3 gene contains an intronic VNTR enhancer. A T > C transition occurring in the second repeat of each VNTR allele implies the presence/absence of a putative GATA binding motif. A partially overlapping AP-1 site, not affected by the transition, was also identified. Aims of the present study ...

  1. The Role of Transcription Factor PU.I in the Activity of the Intronic Enhancer of the Eosinophil-Derived Neurotoxin (RNS2) Gene

    NARCIS (Netherlands)

    Dijk, Thamar B. van; Caldenhoven, Eric; Raaijmakers, J.A.M.; Lammers, J.W.J.; Koenderman, L.; Groot, Rolf P. de

    1997-01-01

    Eosinophil-derived neurotoxin (EDN) found in the granules of human eosinophils is a cationic ribonuclease toxin. Expression of the EDN gene (RNS2) in eosinophils is dependent on proximal promoter sequences in combination with an enhancer located in the first intron. We further define here

  2. Intronic variation at the CHD1-Z gene in black-tailed godwits Limosa limosa limosa : correlations with fitness components revisited

    NARCIS (Netherlands)

    Trimbos, Krijn B.; Kentie, Rosemarie; van der Velde, Marco; Hooijmeijer, Jos C.E.W.; Poley, Carola; Musters, C. J. M.; de Snoo, Geert R.; Piersma, Theunis

    Recently, Schroeder etal. (2010, Ibis 152: 368-377) suggested that intronic variation in the CHD1-Z gene of Black-tailed Godwits breeding in southwest Friesland, The Netherlands, correlated with fitness components. Here we re-examine this surprising result using an expanded dataset (2088 birds

  3. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability

    Directory of Open Access Journals (Sweden)

    Joardar Vinita

    2012-12-01

    Full Text Available Abstract Background The genera Aspergillus and Penicillium include some of the most beneficial as well as the most harmful fungal species such as the penicillin-producer Penicillium chrysogenum and the human pathogen Aspergillus fumigatus, respectively. Their mitochondrial genomic sequences may hold vital clues into the mechanisms of their evolution, population genetics, and biology, yet only a handful of these genomes have been fully sequenced and annotated. Results Here we report the complete sequence and annotation of the mitochondrial genomes of six Aspergillus and three Penicillium species: A. fumigatus, A. clavatus, A. oryzae, A. flavus, Neosartorya fischeri (A. fischerianus, A. terreus, P. chrysogenum, P. marneffei, and Talaromyces stipitatus (P. stipitatum. The accompanying comparative analysis of these and related publicly available mitochondrial genomes reveals wide variation in size (25–36 Kb among these closely related fungi. The sources of genome expansion include group I introns and accessory genes encoding putative homing endonucleases, DNA and RNA polymerases (presumed to be of plasmid origin and hypothetical proteins. The two smallest sequenced genomes (A. terreus and P. chrysogenum do not contain introns in protein-coding genes, whereas the largest genome (T. stipitatus, contains a total of eleven introns. All of the sequenced genomes have a group I intron in the large ribosomal subunit RNA gene, suggesting that this intron is fixed in these species. Subsequent analysis of several A. fumigatus strains showed low intraspecies variation. This study also includes a phylogenetic analysis based on 14 concatenated core mitochondrial proteins. The phylogenetic tree has a different topology from published multilocus trees, highlighting the challenges still facing the Aspergillus systematics. Conclusions The study expands the genomic resources available to fungal biologists by providing mitochondrial genomes with consistent

  4. Role of intron-mediated enhancement on accumulation of an Arabidopsis NB-LRR class R-protein that confers resistance to Cucumber mosaic virus.

    Directory of Open Access Journals (Sweden)

    Yukiyo Sato

    Full Text Available The accumulation of RCY1 protein, which is encoded by RESISTANCE TO CMV(Y (RCY1, a CC-NB-LRR class R-gene, is tightly correlated with the strength of the resistance to a yellow strain of Cucumber mosaic virus [CMV(Y] in Arabidopsis thaliana. In order to enhance resistance to CMV by overexpression of RCY1, A. thaliana was transformed with intron-less RCY1 cDNA construct under the control of strong CaMV35S promoter. Remarkably, a relative amount of RCY1 protein accumulation in the transformants was much lower than that in plants expressing genomic RCY1 under the control of its native promoter. To identify a regulatory element of RCY1 that could cause such differential levels of RCY1 accumulation, a series of RCY1 cDNA and genomic RCY1 constructs were transiently expressed in Nicotiana benthamiana leaves by the Agrobacterium-mediated infiltration method. Comparative analysis of the level of RCY1 accumulation in the leaf tissues transiently expressing each construct indicated that the intron located in the RCY1-coding region of genomic RCY1, but not the native RCY1 genomic promoter or the 5'-and 3'-untranslated regions of RCY1, was indispensable for high level RCY1 accumulation. The increased levels of RCY1 accelerated plant disease defense reactions. Interestingly, such intron-mediated enhancement of RCY1 accumulation depended neither on the abundance of the RCY1 transcript nor on the RCY1 specific-intron sequence. Taken together, intron-mediated RCY1 expression seems to play a key role in the expression of complete resistance to CMV(Y by maintaining RCY1 accumulation at high levels.

  5. Reverse transcription of spliced psbA mRNA in Chlamydomonas spp. and its possible role in evolutionary intron loss.

    Science.gov (United States)

    Odom, Obed W; Herrin, David L

    2013-12-01

    Reverse transcription of mRNA is thought to be an important first step in a model that explains certain evolutionary changes within genes, such as the loss of introns or RNA editing sites. In this model, reverse transcription of mRNA produces cDNA molecules that replace part of the parental gene by homologous recombination. In vivo evidence of reverse transcription of physiologically relevant mRNAs is generally lacking, however, except in genetically engineered cells. Here, we provide in vivo evidence for reverse transcription of the chloroplast psbA mRNA in two naturally occurring species of Chlamydomonas (raudensis and subcaudata) that is based on the presence of spliced cDNAs in both organisms. The psbA cDNAs, which lack the group II intron of the genomic gene, are nearly full length, and the majority of them--though not all--are in the form of RNA-cDNA hybrids. Moreover, the presence in these species of psbA cDNAs is correlated with the loss of an early group I intron from the same psbA gene. The group II intron that interrupts psbA in C. raudensis and C. subcaudata potentially encodes a protein with a reverse transcriptase domain, and the C. raudensis protein was shown to have reverse transcriptase activity in vitro. These results provide strong evidence for reverse transcription of a physiologically important mRNA (psbA) in two species of Chlamydomonas that have also lost an intron from the same gene, possibly through recombination with the cDNA.

  6. Structure and expression of the human Lysyl hydroxylase gene (PLOD): Introns 9 and 16 contain Alu sequences at the sites of recombination in Ehlers-Danlos syndrome type VI patients

    Energy Technology Data Exchange (ETDEWEB)

    Heikkinen, J.; Hautala, T.; Kivirikko, K.I. [Univ. of Oulu (Finland)] [and others

    1994-12-01

    Lysyl hydroxylase (EC 1.14.11.4) catalyzes the formation of hydroxylysine in collagens by the hydroxylation of lysine residues in peptide linkages. This enzyme activity is known to be reduced in patients with the type VI variant of the Ehlers-Danlos syndrome, and the first mutations in the lysyl hydroxylase gene (PLOD) have recently been identified. We have now isolated genomic clones for human lysyl hydroxylase and determined the complete structure of the gene, which contains 19 exons and a 5{prime} flanking region with characteristics shared by housekeeping genes. The constitutive expression of the gene in different tissues further suggests that lysyl hydroxylase has an essential function. We have sequenced the introns of the gene in the region where many mutations and rearrangements analyzed to date are concentrated. Intron 9 and intron 16 show extensive homology resulting from the many Alu sequences found in these introns. Intron 9 contains five and intron 16 eight Alu sequences. The high homology and many short identical or complementary sequences in these introns generate many potential recombination sites with the gene. The delineation of the structure of the lysyl hydroxylase gene contributes significantly to our understanding of the rearrangements in the genome of Ehlers-Danlos type VI patients. 21 refs., 2 figs., 2 tabs.

  7. Suprafamilial relationships among Rodentia and the phylogenetic effect of removing fast-evolving nucleotides in mitochondrial, exon and intron fragments

    Directory of Open Access Journals (Sweden)

    Arnal Véronique

    2008-11-01

    Full Text Available Abstract Background The number of rodent clades identified above the family level is contentious, and to date, no consensus has been reached on the basal evolutionary relationships among all rodent families. Rodent suprafamilial phylogenetic relationships are investigated in the present study using ~7600 nucleotide characters derived from two mitochondrial genes (Cytochrome b and 12S rRNA, two nuclear exons (IRBP and vWF and four nuclear introns (MGF, PRKC, SPTBN, THY. Because increasing the number of nucleotides does not necessarily increase phylogenetic signal (especially if the data is saturated, we assess the potential impact of saturation for each dataset by removing the fastest-evolving positions that have been recognized as sources of inconsistencies in phylogenetics. Results Taxonomic sampling included multiple representatives of all five rodent suborders described. Fast-evolving positions for each dataset were identified individually using a discrete gamma rate category and sites belonging to the most rapidly evolving eighth gamma category were removed. Phylogenetic tree reconstructions were performed on individual and combined datasets using Parsimony, Bayesian, and partitioned Maximum Likelihood criteria. Removal of fast-evolving positions enhanced the phylogenetic signal to noise ratio but the improvement in resolution was not consistent across different data types. The results suggested that elimination of fastest sites only improved the support for nodes moderately affected by homoplasy (the deepest nodes for introns and more recent nodes for exons and mitochondrial genes. Conclusion The present study based on eight DNA fragments supports a fully resolved higher level rodent phylogeny with moderate to significant nodal support. Two inter-suprafamilial associations emerged. The first comprised a monophyletic assemblage containing the Anomaluromorpha (Anomaluridae + Pedetidae + Myomorpha (Muridae + Dipodidae as sister clade to the

  8. Interactions of SR45, an SR-like protein, with spliceosomal proteins and an intronic sequence: insights into regulated splicing.

    Science.gov (United States)

    Day, Irene S; Golovkin, Maxim; Palusa, Saiprasad G; Link, Alicia; Ali, Gul S; Thomas, Julie; Richardson, Dale N; Reddy, Anireddy S N

    2012-09-01

    SR45 is a serine/arginine-rich (SR)-like protein with two arginine/serine-rich (RS) domains. We have previously shown that SR45 regulates alternative splicing (AS) by differential selection of 5' and 3' splice sites. However, it is unknown how SR45 regulates AS. To gain mechanistic insights into the roles of SR45 in splicing, we screened a yeast two-hybrid library with SR45. This screening resulted in the isolation of two spliceosomal proteins, U1-70K and U2AF(35) b that are known to function in 5' and 3' splice site selection, respectively. This screen not only confirmed our prior observation that U1-70K and SR45 interact, but also helped to identify an additional interacting partner (U2AF(35) ). In vitro and in vivo analyses revealed an interaction of SR45 with both paralogs of U2AF(35) . Furthermore, we show that the RS1 and RS2 domains of SR45, and not the RNA recognition motif (RRM) domain, associate independently with both U2AF(35) proteins. Interaction studies among U2AF(35) paralogs and between U2AF(35) and U1-70K revealed that U2AF(35) can form homo- or heterodimers and that U2AF(35) proteins can associate with U1-70K. Using RNA probes from SR30 intron 10, whose splicing is altered in the sr45 mutant, we show that SR45 and U2AF(35) b bind to different parts of the intron, with a binding site for SR45 in the 5' region and two binding regions, each ending with a known 3' splice site, for U2AF(35) b. These results suggest that SR45 recruits U1snRNP and U2AF to 5' and 3' splice sites, respectively, by interacting with pre-mRNA, U1-70K and U2AF(35) and modulates AS. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  9. Arginine kinase in Toxocara canis: Exon-intron organization, functional analysis of site-directed mutants and evaluation of putative enzyme inhibitors.

    Science.gov (United States)

    Wickramasinghe, Susiji; Yatawara, Lalani; Nagataki, Mitsuru; Agatsuma, Takeshi

    2016-10-01

    To determine exon/intron organization of the Toxocara canis (T. canis) AK (TCAK) and to test green and black tea and several other chemicals against the activity of recombinant TCAK in the guanidino-specific region by site-directed mutants. Amplification of genomic DNA fragments containing introns was carried out by PCRs. The open-reading frame (1200 bp) of TCAK (wild type) was cloned into the BamH1/SalI site of pMAL-c2X. The maltose-binding protein-TCAK fusion protein was expressed in Escherichia coli TB1 cells. The purity of the expressed enzyme was verified by SDS-PAGE. Mutations were introduced into the guanidino-specific region and other areas of pMAL/TCAK by PCR. Enzyme activity was measured with an NADH-linked assay at 25 °C for the forward reaction (phosphagen synthesis). Arginine kinase in T. canis has a seven-exon/six-intron gene structure. The lengths of the introns ranged from 542 bp to 2 500 bp. All introns begin with gt and end with ag. Furthermore, we measured the enzyme activity of site-directed mutants of the recombinant TCAK. The K m value of the mutant (Alanine to Serine) decreased indicating a higher affinity for substrate arginine than the wild-type. The K m value of the mutant (Serine to Glycine) increased to 0.19 mM. The K m value (0.19 mM) of the double mutant (Alanine-Serine to Serine-Glycine) was slightly greater than in the wild-type (0.12 mM). In addition, several other chemicals were tested; including plant extract Azadiracta indica (A. indica), an aminoglycoside antibiotic (aminosidine), a citrus flavonoid glycoside (rutin) and a commercially available catechin mixture against TCAK. Green and black tea (1:10 dilution) produced 15% and 25% inhibition of TCAK, respectively. The extract of A. indica produced 5% inhibition of TCAK. Moreover, green and black tea produced a non-competitive type of inhibition and A. indica produced a mixed-type of inhibition on TCAK. Arginine kinase in T. canis has a seven-exon/six-intron gene

  10. A Central Nervous System-Dependent Intron-Embedded Gene Encodes a Novel Murine Fyn Binding Protein.

    Science.gov (United States)

    Ben Khalaf, Noureddine; Taha, Safa; Bakhiet, Moiz; Fathallah, M Dahmani

    2016-01-01

    The interplay between the nervous and immune systems is gradually being unraveled. We previously reported in the mouse the novel soluble immune system factor ISRAA, whose activation in the spleen is central nervous system-dependent. We also showed that ISRAA plays a role in modulating anti-infection immunity. Herein, we report the genomic description of the israa locus, along with some insights into the structure-function relationship of the protein. Our findings revealed that israa is nested within intron 6 of the mouse zmiz1 gene. Protein sequence analysis revealed a typical SH2 binding motif (Y102TEV), with Fyn being the most likely binding partner. Docking simulation showed a favorable conformation for the ISRAA-Fyn complex, with a specific binding mode for the binding of the YTEV motif to the SH2 domain. Experimental studies showed that in vitro, recombinant ISRAA is phosphorylated by Fyn at tyrosine 102. Cell transfection and pull-down experiments revealed Fyn as a binding partner of ISRAA in the EL4 mouse T-cell line. Indeed, we demonstrated that ISRAA downregulates T-cell activation and the phosphorylation of an activation tyrosine (Y416) of Src-family kinases in mouse splenocytes. Our observations highlight ISRAA as a novel Fyn binding protein that is likely to be involved in a signaling pathway driven by the nervous system.

  11. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Directory of Open Access Journals (Sweden)

    Yanhe Li

    2015-06-01

    Full Text Available Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China.

  12. Identification and Genetic Analysis of a Factor IX Gene Intron 3 Mutation in a Hemophilia B Pedigree in China

    Directory of Open Access Journals (Sweden)

    Dong Hua Cao

    2014-09-01

    Full Text Available OBJECTIVE: Hemophilia B is caused by coagulation defects in the factor IX gene located in Xq27.1 on the X chromosome. A wide range of mutations, showing extensive molecular heterogeneity, have been described in hemophilia B patients. Our study was aimed at genetic analysis and prenatal diagnosis of hemophilia B in order to further elucidate the pathogenesis of the hemophilia B pedigree in China. METHODS: Polymerase chain reaction amplification and direct sequencing of all the coding regions was conducted in hemophilia B patients and carriers. Prenatal diagnosis of the proband was conducted at 20 weeks. RESULTS: We identified the novel point mutation 10.389 A>G, located upstream of the intron 3 acceptor site in hemophilia B patients. The fetus of the proband’s cousin was identified as a carrier. CONCLUSION: Our identification of a novel mutation in the F9 gene associated with hemophilia B provides novel insight into the pathogenesis of this genetically inherited disorder and also represents the basis of prenatal diagnosis.

  13. Association of eNOS gene intron 4 a/b VNTR polymorphisms in children with nephrotic syndrome.

    Science.gov (United States)

    Dursun, Hasan; Noyan, Aytul; Matyar, Selcuk; Buyukcelik, Mithat; Soran, Mustafa; Cengiz, Nurcan; Bayazit, Aysun K; Seydaoglu, Gulsah; Attila, Gulen; Anarat, Ali

    2013-06-15

    To investigate the association of endothelial nitric oxide synthase gene intron 4 (eNOS4) polymorphisms with nephrotic syndrome, the eNOS4 genotypes were assessed in 161 children with nephrotic syndrome in comparison with 78 healthy subjects. We classified the children with nephritic syndrome into 2 groups: as steroid-sensitive nephrotic syndrome (SSNS) (n=125) and steroid-resistant nephrotic syndrome (SRNS) (n=36). The eNOS4 polymorphisms were analyzed by polymerase chain reaction. The frequencies of eNOS4 aa, ab and bb genotypes were 3%, 31%, and 66% in all the nephrotic syndrome groups, and 1%, 23%, and 76% in the control group (x(2)=2.87, p>0.05). In addition, the frequencies of eNOS4 aa, ab and bb genotypes were 2%, 33%, and 65% in SSNS group, and 5%, 28%, and 67% in the SRNS group (x(2)=1.13, p=0.567). The present study is the first to investigate eNOS4 gene polymorphisms in children with SSNS and SRNS. Our data show that the eNOS4 gene polymorphisms were not associated with the development, frequent relapse and response to steroid in nephritic syndrome. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

    Science.gov (United States)

    Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

    1999-07-01

    With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World.

  15. MCM3AP is transcribed from a promoter within an intron of the overlapping gene for GANP.

    Science.gov (United States)

    Wickramasinghe, Vihandha O; McMurtrie, Paul I A; Marr, Jackie; Amagase, Yoko; Main, Sarah; Mills, Anthony D; Laskey, Ronald A; Takei, Yoshinori

    2011-02-25

    MCM3 acetylase (MCM3AP) and germinal-centre associated nuclear protein (GANP) are transcribed from the same locus and are therefore confused in databases because the MCM3 acetylase DNA sequence is contained entirely within the much larger GANP sequence and the entire MCM3AP sequence is identical to the carboxy terminus of GANP. Thus, the MCM3AP and GANP genes are read in the same reading frame and MCM3AP is an N-terminally truncated region of GANP. However, we show here that MCM3AP and GANP are different proteins, occupying different locations in the cell and transcribed from different promoters. Intriguingly, a promoter for MCM3AP lies within an intron of GANP. This report is an interesting example in nature of two separate gene products from the same locus that perform two entirely different functions in the cell. Therefore, to avoid further confusion, they should now be referred to as separate but overlapping genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. A Two-Piece Derivative of a Group I Intron RNA as a Platform for Designing Self-Assembling RNA Templates to Promote Peptide Ligation

    Directory of Open Access Journals (Sweden)

    Takahiro Tanaka

    2012-01-01

    Full Text Available Multicomponent RNA-peptide complexes are attractive from the viewpoint of artificial design of functional biomacromolecular systems. We have developed self-folding and self-assembling RNAs that serve as templates to assist chemical ligation between two reactive peptides with RNA-binding capabilities. The design principle of previous templates, however, can be applied only to limited classes of RNA-binding peptides. In this study, we employed a two-piece derivative of a group I intron RNA from the Tetrahymena large subunit ribosomal RNA (LSU rRNA as a platform for new template RNAs. In this group I intron-based self-assembling platform, modules for the recognition of substrate peptides can be installed independently from modules holding the platform structure. The new self-assembling platform allows us to expand the repertoire of substrate peptides in template RNA design.

  17. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    Energy Technology Data Exchange (ETDEWEB)

    Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  18. Gene encoding the human beta-hexosaminidase beta chain: extensive homology of intron placement in the alpha- and beta-chain genes.

    Science.gov (United States)

    Proia, R L

    1988-03-01

    Lysosomal beta-hexosaminidase (EC 3.2.1.52) is composed of two structurally similar chains, alpha and beta, that are the products of different genes. Mutations in either gene causing beta-hexosaminidase deficiency result in the lysosomal storage disease GM2-gangliosidosis. To enable the investigation of the molecular lesions in this disorder and to study the evolutionary relationship between the alpha and beta chains, the beta-chain gene was isolated, and its organization was characterized. The beta-chain coding region is divided into 14 exons distributed over approximately 40 kilobases of DNA. Comparison with the alpha-chain gene revealed that 12 of the 13 introns interrupt the coding regions at homologous positions. This extensive sharing of intron placement demonstrates that the alpha and beta chains evolved by way of the duplication of a common ancestor.

  19. Multilocus Intron Trees Reveal Extensive Male-Biased Homogenization of Ancient Populations of Chamois (Rupicapra spp.) across Europe during Late Pleistocene.

    Science.gov (United States)

    Pérez, Trinidad; Fernández, Margarita; Hammer, Sabine E; Domínguez, Ana

    2017-01-01

    The inferred phylogenetic relationships between organisms often depend on the molecular marker studied due to the diverse evolutionary mode and unlike evolutionary histories of different parts of the genome. Previous studies have shown conflicting patterns of differentiation of mtDNA and several nuclear markers in chamois (genus Rupicapra) that indicate a complex evolutionary picture. Chamois are mountain caprine that inhabit most of the medium to high altitude mountain ranges of southern Eurasia. The most accepted taxonomical classification considers two species, R. pyrenaica (with the subspecies parva, pyrenaica and ornata) from southwestern Europe and R. rupicapra (with the subspecies cartusiana, rupicapra, tatrica, carpatica, balcanica, asiatica and caucasica) from northeastern Europe. Phylogenies of mtDNA revealed three very old clades (from the early Pleistocene, 1.9 Mya) with a clear geographical signal. Here we analyze a set of 23 autosomal introns, comprising 15,411 nucleotides, in 14 individuals covering the 10 chamois subspecies. Introns offered an evolutionary scenario that contrasts with mtDNA. The nucleotidic diversity was 0.0013± 0.0002, at the low range of what is found in other mammals even if a single species is considered. A coalescent multilocus analysis with *BEAST indicated that introns diversified 88 Kya, in the late Pleistocene, and the effective population size at the root was lower than 10,000 individuals. The dispersal of some few migrant males should have rapidly spread trough the populations of chamois, given the homogeneity of intron sequences. The striking differences between mitochondrial and nuclear markers can be attributed to strong female philopatry and extensive male dispersal. Our results highlight the need of analyzing multiple and varied genome components to capture the complex evolutionary history of organisms.

  20. Molecular phylogeny of C1 inhibitor depicts two immunoglobulin-like domains fusion in fishes and ray-finned fishes specific intron insertion after separation from zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Abhishek, E-mail: akumar@bot.uni-kiel.de [Department of Genetics and Molecular Biology in Botany, Institute of Botany, Christian-Albrechts-University at Kiel, Kiel (Germany); Bhandari, Anita [Molecular Physiology, Zoological Institute, Christian-Albrechts-University at Kiel, Kiel (Germany); Sarde, Sandeep J. [Department of Genetics and Molecular Biology in Botany, Institute of Botany, Christian-Albrechts-University at Kiel, Kiel (Germany); Goswami, Chandan [National Institute of Science Education and Research, Bhubaneswar, Orissa (India)

    2014-07-18

    Highlights: • C1 inhibitors of fishes have two Ig domains fused in the N-terminal end. • Spliceosomal introns gain in two Ig domains of selected ray-finned fishes. • C1 inhibitors gene is maintained from 450 MY on the same locus. • C1 inhibitors gene is missing in frog and lampreys. • C1 inhibitors of tetrapod and fishes differ in the RCL region. - Abstract: C1 inhibitor (C1IN) is a multi-facet serine protease inhibitor in the plasma cascades, inhibiting several proteases, notably, regulates both complement and contact system activation. Despite huge advancements in the understanding of C1IN based on biochemical properties and its roles in the plasma cascades, the phylogenetic history of C1IN remains uncharacterized. To date, there is no comprehensive study illustrating the phylogenetic history of C1IN. Herein, we explored phylogenetic history of C1IN gene in vertebrates. Fishes have C1IN with two immunoglobulin like domains attached in the N-terminal region. The RCL regions of CIIN from fishes and tetrapod genomes have variations at the positions P2 and P1′. Gene structures of C1IN gene from selected ray-finned fishes varied in the Ig domain region with creation of novel intron splitting exon Im2 into Im2a and Im2b. This intron is limited to ray-finned fishes with genome size reduced below 1 Gb. Hence, we suggest that genome compaction and associated double-strand break repairs are behind this intron gain. This study reveals the evolutionary history of C1IN and confirmed that this gene remains the same locus for ∼450 MY in 52 vertebrates analysed, but it is not found in frogs and lampreys.

  1. Molecular phylogeny of C1 inhibitor depicts two immunoglobulin-like domains fusion in fishes and ray-finned fishes specific intron insertion after separation from zebrafish

    International Nuclear Information System (INIS)

    Kumar, Abhishek; Bhandari, Anita; Sarde, Sandeep J.; Goswami, Chandan

    2014-01-01

    Highlights: • C1 inhibitors of fishes have two Ig domains fused in the N-terminal end. • Spliceosomal introns gain in two Ig domains of selected ray-finned fishes. • C1 inhibitors gene is maintained from 450 MY on the same locus. • C1 inhibitors gene is missing in frog and lampreys. • C1 inhibitors of tetrapod and fishes differ in the RCL region. - Abstract: C1 inhibitor (C1IN) is a multi-facet serine protease inhibitor in the plasma cascades, inhibiting several proteases, notably, regulates both complement and contact system activation. Despite huge advancements in the understanding of C1IN based on biochemical properties and its roles in the plasma cascades, the phylogenetic history of C1IN remains uncharacterized. To date, there is no comprehensive study illustrating the phylogenetic history of C1IN. Herein, we explored phylogenetic history of C1IN gene in vertebrates. Fishes have C1IN with two immunoglobulin like domains attached in the N-terminal region. The RCL regions of CIIN from fishes and tetrapod genomes have variations at the positions P2 and P1′. Gene structures of C1IN gene from selected ray-finned fishes varied in the Ig domain region with creation of novel intron splitting exon Im2 into Im2a and Im2b. This intron is limited to ray-finned fishes with genome size reduced below 1 Gb. Hence, we suggest that genome compaction and associated double-strand break repairs are behind this intron gain. This study reveals the evolutionary history of C1IN and confirmed that this gene remains the same locus for ∼450 MY in 52 vertebrates analysed, but it is not found in frogs and lampreys

  2. Development of intron targeting (IT) markers specific for chromosome arm 4VS of Haynaldia villosa by chromosome sorting and next-generation sequencing

    Czech Academy of Sciences Publication Activity Database

    Wang, H.; Dai, K.; Xiao, J.; Yuan, C.; Zhao, R. L.; Doležel, Jaroslav; Wu, Y.; Cao, A.; Chen, P.; Zhang, S.; Wang, X.

    2017-01-01

    Roč. 18, FEB 15 (2017), č. článku 167. ISSN 1471-2164 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : triticum-aestivum l. * conferring resistance * wild relatives * mosaic-virus * plug markers * bread wheat * genome * gene * rye * improvement * Triticum aestivum * Haynaldia villosa * Molecular marker * Intron polymorphism Subject RIV: EB - Gene tics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 3.729, year: 2016

  3. Multi-species comparative analysis of the equine ACE gene identifies a highly conserved potential transcription factor binding site in intron 16.

    Directory of Open Access Journals (Sweden)

    Natasha A Hamilton

    Full Text Available Angiotensin converting enzyme (ACE is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism.

  4. The fission yeast RNA binding protein Mmi1 regulates meiotic genes by controlling intron specific splicing and polyadenylation coupled RNA turnover.

    Directory of Open Access Journals (Sweden)

    Huei-Mei Chen

    Full Text Available The polyA tails of mRNAs are monitored by the exosome as a quality control mechanism. We find that fission yeast, Schizosaccharomyces pombe, adopts this RNA quality control mechanism to regulate a group of 30 or more meiotic genes at the level of both splicing and RNA turnover. In vegetative cells the RNA binding protein Mmi1 binds to the primary transcripts of these genes. We find the novel motif U(U/C/GAAAC highly over-represented in targets of Mmi1. Mmi1 can specifically regulate the splicing of particular introns in a transcript: it inhibits the splicing of introns that are in the vicinity of putative Mmi1 binding sites, while allowing the splicing of other introns that are far from such sites. In addition, binding of Mmi1, particularly near the 3' end, alters 3' processing to promote extremely long polyA tails of up to a kilobase. The hyperadenylated transcripts are then targeted for degradation by the nuclear exonuclease Rrp6. The nuclear polyA binding protein Pab2 assists this hyperadenylation-mediated RNA decay. Rrp6 also targets other hyperadenylated transcripts, which become hyperadenylated in an unknown, but Mmi1-independent way. Thus, hyperadenylation may be a general signal for RNA degradation. In addition, binding of Mmi1 can affect the efficiency of 3' cleavage. Inactivation of Mmi1 in meiosis allows meiotic expression, through splicing and RNA stabilization, of at least 29 target genes, which are apparently constitutively transcribed.

  5. Splicing defects in ABCD1 gene leading to both exon skipping and partial intron retention in X-linked adrenoleukodystrophy Tunisian patient.

    Science.gov (United States)

    Kallabi, Fakhri; Hadj Salem, Ikhlass; Ben Chehida, Amel; Ben Salah, Ghada; Ben Turkia, Hadhami; Tebib, Neji; Keskes, Leila; Kamoun, Hassen

    2015-08-01

    X-linked adrenoleukodystrophy (X-ALD) affects the nervous system white matter and adrenal cortex secondary to mutations in the ABCD1 gene that encodes a peroxisomal membrane protein: the adrenoleukodystrophy protein. The disease is characterized by high concentrations of very long-chain fatty acids in plasma, adrenal, testicular and nervous tissues. Various types of mutations have been identified in the ABCD1 gene: point mutations, insertions, and deletions. To date, more than 40 point mutations have been reported at the splice junctions of the ABCD1 gene; only few functional studies have been performed to explore these types of mutations. In this study, we have identified de novo splice site mutation c.1780+2T>G in ABCD1 gene in an X-ALD Tunisian patient. Sequencing analysis of cDNA showed a minor transcript lacking exon 7 and a major transcript with a partial intron 7 retention due to activation of a new intronic cryptic splice site. Both outcomes lead to frameshifts with premature stop codon generation in exon 8 and intron 7 respectively. To the best of our knowledge, the current study demonstrates that a single splicing mutation affects the ABCD1 transcripts and the ALDP protein function. Copyright © 2015 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

  6. Modulation of mdm2 pre-mRNA splicing by 9-aminoacridine-PNA (peptide nucleic acid) conjugates targeting intron-exon junctions

    DEFF Research Database (Denmark)

    Shiraishi, Takehiko; Eysturskard, Jonhard; Nielsen, Peter E

    2010-01-01

    ABSTRACT: BACKGROUND: Modulation of pre-mRNA splicing by antisense molecules is a promising mechanism of action for gene therapeutic drugs. In this study, we have examined the potential of peptide nucleic acid (PNA) 9-aminoacridine conjugates to modulate the pre-mRNA splicing of the mdm2 human...... cancer gene in JAR cells. METHODS: We screened 10 different 15 mer PNAs targeting intron2 at both the 5;- and the 3;-splice site for their effects on the splicing of mdm2 using RT-PCR analysis. We also tested a PNA (2512) targeting the 3;-splice site of intron3 with a complementarity of 4 bases to intron......3 and 11 bases to exon4 for its splicing modulation effect. This PNA2512 was further tested for the effects on the mdm2 protein level as well as for inhibition of cell growth in combination with the DNA damaging agent camptothecin (CPT). RESULTS: We show that several of these PNAs effectively...

  7. Insertion of a T next to the donor splice site of intron 1 causes aberrantly spliced mRNA in a case of infantile GM1-gangliosidosis.

    Science.gov (United States)

    Morrone, A; Morreau, H; Zhou, X Y; Zammarchi, E; Kleijer, W J; Galjaard, H; d'Azzo, A

    1994-01-01

    The lysosomal storage disorders GM1-gangliosidosis and Morquio B syndrome are caused by a complete or partial deficiency of acid beta-galactosidase. Here, we have characterized the mutation segregating in a family with two siblings affected by the severe infantile form of GM1-gangliosidosis. In total mRNA preparations derived from the patients' fibroblasts at least two aberrantly spliced beta-galactosidase transcripts (1 and 2) have been identified. Both transcripts contain a 20 nucleotide (nt) insertion derived from the 5' end of intron 1 of the beta-galactosidase gene. Furthermore, in transcript 2 sequences encoded by exon II are deleted during the splicing process. Comparison of the 20-nt insertion with wild-type intronic sequences indicated that in the genomic DNA of the patients an extra T nucleotide is present immediately downstream of the conserved GT splice donor dinucleotide of intron 1. Both patients are homozygous for the T nucleotide insertion. We propose that this single base insertion is the mutation responsible for aberrant splicing of beta-galactosidase pre-mRNA, giving rise to transcripts that cannot encode a normal protein.

  8. Polyphyletic origin of the genus Physarum (Physarales, Myxomycetes revealed by nuclear rDNA mini-chromosome analysis and group I intron synapomorphy

    Directory of Open Access Journals (Sweden)

    Nandipati Satish CR

    2012-08-01

    Full Text Available Abstract Background Physarales represents the largest taxonomic order among the plasmodial slime molds (myxomycetes. Physarales is of particular interest since the two best-studied myxomycete species, Physarum polycephalum and Didymium iridis, belong to this order and are currently subjected to whole genome and transcriptome analyses. Here we report molecular phylogeny based on ribosomal DNA (rDNA sequences that includes 57 Physarales isolates. Results The Physarales nuclear rDNA sequences were found to be loaded with 222 autocatalytic group I introns, which may complicate correct alignments and subsequent phylogenetic tree constructions. Phylogenetic analysis of rDNA sequences depleted of introns confirmed monophyly of the Physarales families Didymiaceae and Physaraceae. Whereas good correlation was noted between phylogeny and taxonomy among the Didymiaceae isolates, significant deviations were seen in Physaraceae. The largest genus, Physarum, was found to be polyphyletic consisting of at least three well supported clades. A synapomorphy, located at the highly conserved G-binding site of L2449 group I intron ribozymes further supported the Physarum clades. Conclusions Our results provide molecular relationship of Physarales genera, species, and isolates. This information is important in further interpretations of comparative genomics nd transcriptomics. In addition, the result supports a polyphyletic origin of the genus Physarum and calls for a reevaluation of current taxonomy.

  9. Presence of isochore structures in reptile genomes suggested by the relationship between GC contents of intron regions and those of coding regions.

    Science.gov (United States)

    Hamada, Kazuo; Horiike, Tokumasa; Ota, Hidetoshi; Mizuno, Keiko; Shinozawa, Takao

    2003-04-01

    Vertebrate genomes are mosaics of isochores. On the assumption that marked differences exist in the isochore structure between warm-blooded and cold-blooded animals, variations among vertebrates were previously attributed to adaptation to homeothermy. However, based on the data of coding regions from representatives of extant vertebrates, including a turtle, a crocodile (Archosauromorpha) and a few kinds of snakes (Lepidosauromorpha), it was recently hypothesized that the common ancestors of mammals, birds and extant reptiles already had the "warm-blooded" isochore structure. To test this hypothesis, the nucleotide sequences of alpha-globin genes including non-coding regions (introns) from two snakes, N. kaouthia and E. climacophora, were determined (accession number: AB104824, AB104825). The correlation between the GC contents in the introns and exons of alpha-globin genes from snakes and those from other vertebrates supports the above hypothesis. Similar analysis using data for exons and introns of other genes obtained from the GenBank (Release 131) also support the above hypothesis.

  10. The Unusual 23S rRNA Gene of Coxiella burnetii: Two Self-Splicing Group I Introns Flank a 34-Base-Pair Exon, and One Element Lacks the Canonical ΩG▿

    Science.gov (United States)

    Raghavan, Rahul; Miller, Scott R.; Hicks, Linda D.; Minnick, Michael F.

    2007-01-01

    We describe the presence and characteristics of two self-splicing group I introns in the sole 23S rRNA gene of Coxiella burnetii. The two group I introns, Cbu.L1917 and Cbu.L1951, are inserted at sites 1917 and 1951 (Escherichia coli numbering), respectively, in the 23S rRNA gene of C. burnetii. Both introns were found to be self-splicing in vivo and in vitro even though the terminal nucleotide of Cbu.L1917 is adenine and not the canonical conserved guanine, termed ΩG, found in Cbu.L1951 and all other group I introns described to date. Predicted secondary structures for both introns were constructed and revealed that Cbu.L1917 and Cbu.L1951 were group IB2 and group IA3 introns, respectively. We analyzed strains belonging to eight genomic groups of C. burnetii to determine sequence variation and the presence or absence of the elements and found both introns to be highly conserved (≥99%) among them. Although phylogenetic analysis did not identify the specific identities of donors, it indicates that the introns were likely acquired independently; Cbu.L1917 was acquired from other bacteria like Thermotoga subterranea and Cbu.L1951 from lower eukaryotes like Acanthamoeba castellanii. We also confirmed the fragmented nature of mature 23S rRNA in C. burnetii due to the presence of an intervening sequence. The presence of three selfish elements in C. burnetii's 23S rRNA gene is very unusual for an obligate intracellular bacterium and suggests a recent shift to its current lifestyle from a previous niche with greater opportunities for lateral gene transfer. PMID:17644584

  11. Detection of potentially valuable polymorphisms in four group I intron insertion sites at the 3'-end of the LSU rDNA genes in biocontrol isolates of Metarhizium anisopliae

    Directory of Open Access Journals (Sweden)

    Monte Enrique

    2006-09-01

    Full Text Available Abstract Background The entomopathogenic anamorphic fungus Metarhizum anisopliae is currently used as a biocontrol agent (BCA of insects. In the present work, we analyzed the sequence data obtained from group I introns in the large subunit (LSU of rDNA genes with a view to determining the genetic diversity present in an autochthonous collection of twenty-six M. anisopliae isolates selected as BCAs. Results DNA fragments corresponding to the 3'-end of the nuclear LSU rDNA genes of 26 M. anisopliae isolates were amplified by PCR. The amplicon sizes ranged from 0.8 to 3.4-kb. Four intron insertion sites, according to Escherichia coli J01695 numbering, were detected- Ec1921, Ec2066, Ec2449 and Ec2563- after sequencing and analysis of the PCR products. The presence/absence of introns allowed the 26 isolates to be distributed into seven genotypes. Nine of the isolates tested showed no introns, 4 had only one, 3 two, and 10 displayed three introns. The most frequent insertion sites were Ec1921 and Ec2449. Of the 26 isolates, 11 showed insertions at Ec2563 and a 1754-bp sequence was observed in ten of them. The most-parsimonious (MP tree obtained from parsimony analysis of the introns revealed a main set containing four-groups that corresponded to the four insertion sites. Conclusion Four insertion sites of group I introns in the LSU rDNA genes allowed the establishment of seven genotypes among the twenty-six biocontrol isolates of M. anisopliae. Intron insertions at the Ec2563 site were observed for first time in this species.

  12. Robust RNAi-mediated resistance to infection of seven potyvirids in soybean expressing an intron hairpin NIb RNA.

    Science.gov (United States)

    Yang, Xiangdong; Niu, Lu; Zhang, Wei; He, Hongli; Yang, Jing; Xing, Guojie; Guo, Dongquan; Du, Qian; Qian, Xueyan; Yao, Yao; Li, Qiyun; Dong, Yingshan

    2017-10-01

    Viral pathogens, such as soybean mosaic virus (SMV), are a major constraint in soybean production and often cause significant yield loss and quality deterioration. Engineering resistance by RNAi-mediated gene silencing is a powerful strategy for controlling viral diseases. In this study, a 248-bp inverted repeat of the replicase (nuclear inclusion b, NIb) gene was isolated from the SMV SC3 strain, driven by the leaf-specific rbcS2 promoter from Phaseolus vulgaris, and introduced into soybean. The transgenic lines had significantly lower average disease indices (ranging from 2.14 to 12.35) than did the non-transformed (NT) control plants in three consecutive generations, exhibiting a stable and significantly enhanced resistance to the SMV SC3 strain under field conditions. Furthermore, seed mottling did not occur in transgenic seeds, whereas the NT plants produced ~90% mottled seeds. Virus resistance spectrum screening showed that the greenhouse-grown transgenic lines exhibited robust resistance to five SMV strains (SC3, SC7, SC15, SC18, and a recombinant SMV), bean common mosaic virus, and watermelon mosaic virus. Nevertheless, no significantly enhanced resistance to bean pod mottle virus (BPMV, Comovirus) was observed in the transgenic lines relative to their NT counterparts. Consistent with the results of resistance evaluation, the accumulation of each potyvirid (but not of BPMV) was significantly inhibited in the transgenic plants relative to the NT controls as confirmed by quantitative real-time (qRT-PCR) and double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). These results demonstrate that robust RNAi-mediated resistance to multiple potyvirids in soybean was conferred by expressing an intron hairpin SMV NIb RNA.

  13. Expression of a constitutively active calcineurin encoded by an intron-retaining mRNA in follicular keratinocytes.

    Directory of Open Access Journals (Sweden)

    Atsushi Fujimura

    Full Text Available Hair growth is a highly regulated cyclical process. Immunosuppressive immunophilin ligands such as cyclosporin A (CsA and FK506 are known as potent hair growth modulatory agents in rodents and humans that induce active hair growth and inhibit hair follicle regression. The immunosuppressive effectiveness of these drugs has been generally attributed to inhibition of T cell activation through well-characterized pathways. Specifically, CsA and FK506 bind to intracellular proteins, principally cyclophilin A and FKBP12, respectively, and thereby inhibit the phosphatase calcineurin (Cn. The calcineurin (Cn/NFAT pathway has an important, but poorly understood, role in the regulation of hair follicle development. Here we show that a novel-splicing variant of calcineurin Aß CnAß-FK, which is encoded by an intron-retaining mRNA and is deficient in the autoinhibitory domain, is predominantly expressed in mature follicular keratinocytes but not in the proliferating keratinocytes of rodents. CnAß-FK was weakly sensitive to Ca(2+ and dephosphorylated NFATc2 under low Ca(2+ levels in keratinocytes. Inhibition of Cn/NFAT induced hair growth in nude mice. Cyclin G2 was identified as a novel target of the Cn/NFATc2 pathway and its expression in follicular keratinocytes was reduced by inhibition of Cn/NFAT. Overexpression of cyclin G2 arrested the cell cycle in follicular keratinocytes in vitro and the Cn inhibitor, cyclosporin A, inhibited nuclear localization of NFATc2, resulting in decreased cyclin G2 expression in follicular keratinocytes of rats in vivo. We therefore suggest that the calcineurin/NFAT pathway has a unique regulatory role in hair follicle development.

  14. Influence of IL-1RN intron 2 variable number of tandem repeats (VNTR) polymorphism on bipolar disorder.

    Science.gov (United States)

    Rafiei, A; Hosseini, S H; Taheri, M; Hosseni-khah, Z; Hajilooi, M; Mazaheri, Z

    2013-01-01

    Several lines of evidence point to the role of neurobiological mechanisms and genetic background in bipolar disorder (BD). The interleukin-1 receptor antagonist (IL-1Ra) is the principal regulator of IL-1α and IL-1β bioactivities. This study aimed to investigate the potential role of the variable number of tandem repeats (VNTR) polymorphisms of the IL-1Ra gene (IL1RN) in conferring susceptibility to BD. In total, 217 patients meeting DSM-IV-TR criteria for BD and 212 controls were recruited for the study. Genotyping of IL1RN was determined by polymerase chain reaction amplification of VNTR of 86 base pairs in intron 2 of IL1RN. The genotype distribution of IL1RN polymorphism was significantly different between BD patients and controls. The IL1RN*1/2 genotype was more prevalent in BD patients than in controls (44.2 vs. 30.2%, p = 0.003). Multiple logistic regression analysis demonstrated that IL1RN*1/2 heterozygotes had a significantly higher risk for BD (OR 1.83 and 95% CI 1.22-2.74, p = 0.003). Further stratification of the BD patients into IL1RN*2 allele carrier and noncarrier subgroups revealed a strong association between IL1RN*2 carriage and prolongation of the disease (p = 0.02). These findings suggest a positive association between VNTR polymorphism in IL1RN and BD. Additional studies, particularly with a prospective approach, are necessary to clarify the precise role of the VNTR polymorphism on the disease in different ethnic populations. Copyright © 2013 S. Karger AG, Basel.

  15. Identification of the Rare, Four Repeat Allele of IL-4 Intron-3 VNTR Polymorphism in Indian Populations.

    Science.gov (United States)

    Verma, Henu Kumar; Jha, Aditya Nath; Khodiar, Prafulla Kumar; Patra, Pradeep Kumar; Bhaskar, Lakkakula Venkata Kameswara Subrahmanya

    2016-06-01

    Cytokines are cell signaling molecules which upon release by cells facilitate the recruitment of immune-modulatory cells towards the sites of inflammation. Genetic variations in cytokine genes are shown to regulate their production and affect the risk of infectious as well as autoimmune diseases. Intron-3 of interleukin-4 gene (IL-4) harbors 70-bp variable number of tandem repeats (VNTR) that may alter the expression level of IL-4 gene. To determine the distribution of IL-4 70-bp VNTR polymorphism in seven genetically heterogeneous populations of Chhattisgarh, India and their comparison with the finding of other Indian and world populations. A total of 371 healthy unrelated individuals from 5 caste and 2 tribal populations were included in the present study. The IL-4 70-bp VNTR genotyping was carried out using PCR and electrophoresis. Overall, 3 alleles of IL-4 70-bp VNTR (a2, a3 and a4) were detected. The results demonstrated the variability of the IL-4 70-bp VNTR polymorphism in Chhattisgarh populations. Allele a3 was the most common allele at the 70-bp VNTR locus in all populations followed by a2 allele. This study reports the presence four repeat allele a4 at a low frequency in the majority of the Chhattisgarh populations studied. Further, the frequency of the minor allele (a2) in Chhattisgarh populations showed similarity with the frequencies of European populations but not with the East Asian populations where the a2 allele is a major allele. Our study provides a baseline for future research into the role of the IL-4 locus in diseases linked to inflammation in Indian populations.

  16. A Tth111I RFLP in intron 1 of the mouse Pgk-1 gene allows tracing of X chromosome inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Shanmugan, V.; Saha, B.K. [Emory Univ. School of Medicine, Atlanta, GA (United States)

    1994-09-01

    The X-linked immunodeficiency (xid) in CBA/N mice serves as a model for the X-linked agammaglobulinemia (XLA) syndrome in humans. Like the XLA carriers, the female mice heterozygous for xid (X{sup xid}/X{sup W}) are asymptomatic. The pattern of X chromosome inactivation in the F1 heterozygotes [CBA/N (X{sup xid}/X{sup xid}) X CAST/Ei (X{sup W}/Y)] was investigated by monitoring the methylation status of the two Pgk-1 alleles. Methylation of a CpG dinucleotide in the 5{prime} region of the Pgk-1 gene was previously shown to absolutely correlate with the inactivation of the corresponding X chromosome. In order to distinguish the two alleles, the proximal end of intron 1 of the Pgk-1 gene from CBA/N and CAST/Ei was sequenced. Several nucleotide polymorphisms, including a Tth111I RFLP, were detected in close proximity of the critical CpG dinucleotide. This allowed us to devise an assay based on PCR-amplification of a target DNA encompassing the CpG site as well as the Tth111I site. Results indicate that in circulating B lymphocytes of the female heterozygote only the X-chromosome carrying the normal allele is active (non-random inactivation of the X chromosome) whereas in non-B cells both the X chromosomes are active (random inactivation of the X chromosome). These results were further confirmed by direct measurement of transcription of the two alleles (X{sup xid} and X{sup W}).

  17. A phylogenetic analysis of the genus Fragaria (strawberry) using intron-containing sequence from the ADH-1 gene.

    Science.gov (United States)

    DiMeglio, Laura M; Staudt, Günter; Yu, Hongrun; Davis, Thomas M

    2014-01-01

    The genus Fragaria encompasses species at ploidy levels ranging from diploid to decaploid. The cultivated strawberry, Fragaria×ananassa, and its two immediate progenitors, F. chiloensis and F. virginiana, are octoploids. To elucidate the ancestries of these octoploid species, we performed a phylogenetic analysis using intron-containing sequences of the nuclear ADH-1 gene from 39 germplasm accessions representing nineteen Fragaria species and one outgroup species, Dasiphora fruticosa. All trees from Maximum Parsimony and Maximum Likelihood analyses showed two major clades, Clade A and Clade B. Each of the sampled octoploids contributed alleles to both major clades. All octoploid-derived alleles in Clade A clustered with alleles of diploid F. vesca, with the exception of one octoploid allele that clustered with the alleles of diploid F. mandshurica. All octoploid-derived alleles in clade B clustered with the alleles of only one diploid species, F. iinumae. When gaps encoded as binary characters were included in the Maximum Parsimony analysis, tree resolution was improved with the addition of six nodes, and the bootstrap support was generally higher, rising above the 50% threshold for an additional nine branches. These results, coupled with the congruence of the sequence data and the coded gap data, validate and encourage the employment of sequence sets containing gaps for phylogenetic analysis. Our phylogenetic conclusions, based upon sequence data from the ADH-1 gene located on F. vesca linkage group II, complement and generally agree with those obtained from analyses of protein-encoding genes GBSSI-2 and DHAR located on F. vesca linkage groups V and VII, respectively, but differ from a previous study that utilized rDNA sequences and did not detect the ancestral role of F. iinumae.

  18. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  19. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  20. Genetic analysis of optic nerve head coloboma in the Nova Scotia Duck Tolling Retriever identifies discordance with the NHEJ1 intronic deletion (collie eye anomaly mutation).

    Science.gov (United States)

    Brown, Emily A; Thomasy, Sara M; Murphy, Christopher J; Bannasch, Danika L

    2018-03-01

    Collie eye anomaly (CEA) encompasses a spectrum of different ophthalmic phenotypes from clinically inconsequential choroidal hypoplasia to blindness from coloboma of the optic nerve head (ONH). A previous study found a 7.8-kb deletion in intron 4 of the NHEJ1 gene to be associated with CEA. A genetic test based on this association is recommended for many breeds, including the Nova Scotia Duck Tolling Retriever (NSDTR). Collection of ONH coloboma-affected NSDTR showed lack of concordance of the NHEJ1 intronic deletion with ONH coloboma. Using genomewide single nucleotide polymorphism (SNP) genotyping in 7 ONH coloboma-affected NSDTR cases and 47 unaffected NSDTR controls with no ophthalmic signs, one SNP, located on chromosome 7, demonstrated genomewide significance. However, high genomic inflation may have confounded the results. Therefore, the genomewide association study was repeated using EMMAX to control for population structure in the cohort of 7 cases and 47 controls. However, no regions of the genome were significantly associated with ONH coloboma. These results failed to document significant association with the CEA locus. Due to the complex genetic etiology of ONH coloboma, the NHEJ1 intronic deletion test results should be carefully considered when making breeding decisions. If the goal is to select for visually competent dogs, our data suggest that eye examinations of puppies would be more effective as a guide in selection of breeding pairs than relying solely on currently available genetic tests. © 2017 The Authors. Veterinary Ophthalmology published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Ophthalmologists.

  1. Comparison of substitution rates in ZFX and ZFY introns of sheep and goat related species supports the hypothesis of male-biased mutation rates.

    Science.gov (United States)

    Lawson, Lori-Jayne; Hewitt, Godfrey M

    2002-01-01

    There is a growing body of evidence that males serve as the major generators of mutations, due to the larger number of cell divisions involved in sperm compared to egg production. In mammals, this hypothesis (referred to as "male-driven evolution") has been tested by comparison of nucleotide substitution rates on the X and Y sex chromosomes in a limited number of taxa, predominantly primates and rodents. This study asks whether male-driven evolution is a more general phenomenon among mammals, by comparison of paralogous ZFX and ZFY intron sequences in sheep and goat species (the tribe Caprini). The male-to-female mutation ratio, alpha(m), was estimated to be between 2.93 (95% CI, 1.51-8.61) and 3.94 (95% CI, 1.25-32.29) when calculated using pairwise distance and branch length, respectively, suggesting that the Caprini are subject to weak, male-driven evolution. Comparison to published values for primates, felids, and rodents implies that there may be some correlation with reproductive life span. However, this is difficult to test with current data because confidence intervals are large and overlapping. Nonindependent evolution of paralogous sequences and/or the presence of selective constraints could lead to inaccurate estimates of alpha(m). No evidence for gene conversion between the ZFX and the ZFY introns was found, and this suggests that they have evolved independently during the radiation of the Caprini. Finally, there was no apparent evidence that these introns are subject to selective constraints, although low levels of intraspecific polymorphism reduce the power of neutrality tests.

  2. CLN2/TPP1 deficiency: the novel mutation IVS7-10A>G causes intron retention and is associated with a mild disease phenotype.

    Science.gov (United States)

    Bessa, C; Teixeira, C A; Dias, A; Alves, M; Rocha, S; Lacerda, L; Loureiro, L; Guimarães, A; Ribeiro, M G

    2008-01-01

    The classical form of late infantile neuronal ceroid lipofuscinosis (LINCL) is a childhood hereditary neurodegenerative disease usually fatal in the first decade of life. The underlying gene, CLN2, encodes the lysosomal soluble enzyme tripeptidyl-peptidase 1 (TPP1). In a Portuguese patient with juvenile form of the disease, the histochemical study revealed the presence of curvilinear inclusions typical of LINCL. In vitro TPP1 activity was deficient in patient's cells. CLN2 gene analysis revealed the transition IVS7-10A>G (g.4196A>G) in both alleles. In silico analysis suggested that A-to-G change in the A-rich region of intron 7 could cause aberrant splicing of exon 8 by creating a novel acceptor splice site. However, because the wild-type acceptor of intron 7 is weak and it was not apparently affected, the severity of this mutation could not be established through sequencing data of gDNA. Normal level of spliced CLN2/mRNA was observed in patient's fibroblasts. In the cDNA, the 9-nt retention of intronic sequence (c.886_887ins9) was observed. The mutation is predicted to result in a protein with three extra amino acids between proline 295 and glycine 296. In patient's fibroblasts the level of mutant CLN2p was reduced to about 60% but the migration pattern was similar to the wild-type protein, suggesting that it was correctly targeted to the lysosomes. Taken together, these findings suggest that the first "ag" is selected for splicing and the mutant protein must retain some residual catalytic activity, thus explaining the late onset and the delayed progression of the disease.

  3. Might there be a link between intron 3 VNTR polymorphism in the XRCC4 DNA repair gene and the etiopathogenesis of rheumatoid arthritis?

    Science.gov (United States)

    Pehlivan, Sacide; Balci, Sibel Oguzkan; Aydeniz, Ali; Pehlivan, Mustafa; Sever, Tugce; Gursoy, Savas

    2015-01-01

    DNA repair genes are involved in several diseases such as cancers and autoimmune diseases. Previous studies indicated that a DNA repair system was involved in the development of rheumatoid arthritis (RA). In this study, we aimed to examine whether four polymorphisms in the DNA repair genes (xeroderma pigmentosum complementation group D [XPD], X-ray repair cross-complementing group 1 [XRCC1], and X-ray repair cross-complementing group 4 [XRCC4]) were associated with RA. Sixty-five patients with RA and 70 healthy controls (HCs) were examined for XPD (A-751G), XRCC1 (A399G), and XRCC4 (intron 3 VNTR and G-1394T) polymorphisms. All polymorphisms were genotyped by PCR and/or PCR-RFLP. The association between the polymorphisms and RA was analyzed using the chi-square test and de Finetti program. The intron 3 VNTR polymorphism in the XRCC4 gene showed an association with RA patients. The DI genotype was found lower in RA patients (χ(2)=8.227; p=0.0021), while the II genotype was higher in RA patients (χ(2)=5.285; p=0.010). There were deviations from the Hardy-Weinberg Equilibrium (HWE) in both intron 3 VNTR and G-1394T polymorphisms in the XRCC4 gene and in the polymorphism in the XRCC1 gene, and the observed genotype counts deviated from those expected according to the HWE (p=0.027, 0.004, and 0.002, respectively); however, there was no deviation in the other gene polymorphisms. There is no statistical difference between the RA patients and HCs for XPD (A-751G), XRCC1 (A399G), and XRCC4 (G-1394T) gene polymorphisms (p>0.05). Although XPD (A-751G), XRCC1 (A399G), and XRCC4 (G-1394T) gene polymorphisms have been extensively investigated in different clinical pictures, this is the first study to evaluate the role of these polymorphisms in the genetic etiopathogenesis of RA in Turkish patients. In conclusion, we suggested that the intron 3 VNTR polymorphism in the XRCC4 gene may be associated with the etiopathogenesis of RA as a marker of immune aging.

  4. The T -786C, G894T, and Intron 4 VNTR (4a/b) Polymorphisms of the Endothelial Nitric Oxide Synthase Gene in Prostate Cancer Cases.

    Science.gov (United States)

    Diler, S B; Öden, A

    2016-02-01

    In previously conducted some studies it has been revealed that nitric oxide (NO) and nitric oxide synthase (NOS) system play a significant role in carcinogenesis. Nitric oxide (NO) is regulated by endothelial nitric oxide synthase (eNOS) enzyme which is one of the isoenzymes of NO synthase (NOS). In this study we have tried to come to a conclusion about whether eNOS gene T -786C, G894T and Intron 4 VNTR (4a/b) polymorphisms might be considered as a risk factor causing prostate cancer (PCa) or not. A total of 200 subjects were included in this research. 84 patients with PCa (mean age 70.0 ± 6.4) and 116 healthy controls (mean age 69.9 ± 7.5) were recruited in this case-control study. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Maryland, USA), according to the manufacturer's guidelines. The T-786C, G894T and Intron 4 VNTR (4a/b) polymorphisms were amplified using polymerase chain reation (PCR), detected by restriction fragment length polymorphism (RFLP). For T -786C polymorphism CC genotype [odds ratio (OR): 0.34, 95% confidence interval (CI): 0.15-0.78, P = 0.009)] and allele frequency (OR: 0.631, CI: 0.421-0.946, P = 0.026) is significant for control. In patients with PCa eNOS G894T polymorphism, both GT (OR: 0.069, CI: 0.027-0.174; P = 0.0001) and TT (OR: 0.040, CI: 0.013-0.123; P = = 0.0001) genotype distribution, and also T allele frequency (OR: 0.237, CI: 0.155-0.362, P = 0.0001) were considered significant statistically. While genotype distribution for the other polymorphism eNOS, intron 4 VNTR (4a/b), is insignificant statistically, "a" allele frequency was found out to be significant (OR: 2.223, CI: 1.311-3.769, P = 0.003). In this study we indicated that genotype and allele frequencies of eNOS T -786C and G894T polymorphisms are statistically significant in patients with PCa. eNOS T -786C and G894T polymorphisms may be associated with PCa susceptibility in the Turkish population. In contrast, intron 4 VNTR (4a

  5. The mitochondrial genome of the arbuscular mycorrhizal fungus Gigaspora margarita reveals two unsuspected trans-splicing events of group I introns.

    Science.gov (United States)

    Pelin, Adrian; Pombert, Jean-François; Salvioli, Alessandra; Bonen, Linda; Bonfante, Paola; Corradi, Nicolas

    2012-05-01

    • Arbuscular mycorrhizal fungi (AMF) are ubiquitous organisms that benefit ecosystems through the establishment of an association with the roots of most plants: the mycorrhizal symbiosis. Despite their ecological importance, however, these fungi have been poorly studied at the genome level. • In this study, total DNA from the AMF Gigaspora margarita was subjected to a combination of 454 and Illumina sequencing, and the resulting reads were used to assemble its mitochondrial genome de novo. This genome was annotated and compared with those of other relatives to better comprehend the evolution of the AMF lineage. • The mitochondrial genome of G. margarita is unique in many ways, exhibiting a large size (97 kbp) and elevated GC content (45%). This genome also harbors molecular events that were previously unknown to occur in fungal mitochondrial genomes, including trans-splicing of group I introns from two different genes coding for the first subunit of the cytochrome oxidase and for the small subunit of the rRNA. • This study reports the second published genome from an AMF organelle, resulting in relevant DNA sequence information from this poorly studied fungal group, and providing new insights into the frequency, origin and evolution of trans-spliced group I introns found across the mitochondrial genomes of distantly related organisms. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  6. Exon-primed intron-crossing (EPIC) markers for evolutionary studies of Ficus and other taxa in the fig family (Moraceae).

    Science.gov (United States)

    Yao, Xiaohong; Li, Chenhong; Dick, Christopher W

    2013-10-01

    The genus Ficus (fig trees) comprises ca. 750 species of trees, vines, and stranglers found in tropical forests throughout the world. Fig trees are keystone species in many tropical forests, and their relationship with host-specific wasp pollinators has received much attention, although many questions remain unresolved regarding the levels of host specificity, cospeciation, and the role of hybridization in fig and wasp speciation. We developed exon-primed intron-crossing (EPIC) markers to obtain phylogenetic resolution needed to address these questions. • Expressed sequence tags (ESTs) from F. elastica were compared to Arabidopsis and Populus genomes to locate introns and to design primers in flanking exons. Primer pairs for 80 EPIC markers were tested in samples from divergent clades within Ficus and the outgroup Poulsenia (Moraceae). • Thirty-one EPIC markers were successfully sequenced across Ficus, and 29 of the markers also amplified in Poulsenia, indicating broad transferability within Moraceae. All of the EPIC markers were polymorphic and showed levels of polymorphism similar to that of the widely used internal transcribed spacer (ITS).

  7. Exon-primed intron-crossing (EPIC) markers for evolutionary studies of Ficus and other taxa in the fig family (Moraceae)1

    Science.gov (United States)

    Yao, Xiaohong; Li, Chenhong; Dick, Christopher W.

    2013-01-01

    • Premise of the study: The genus Ficus (fig trees) comprises ca. 750 species of trees, vines, and stranglers found in tropical forests throughout the world. Fig trees are keystone species in many tropical forests, and their relationship with host-specific wasp pollinators has received much attention, although many questions remain unresolved regarding the levels of host specificity, cospeciation, and the role of hybridization in fig and wasp speciation. We developed exon-primed intron-crossing (EPIC) markers to obtain phylogenetic resolution needed to address these questions. • Methods and Results: Expressed sequence tags (ESTs) from F. elastica were compared to Arabidopsis and Populus genomes to locate introns and to design primers in flanking exons. Primer pairs for 80 EPIC markers were tested in samples from divergent clades within Ficus and the outgroup Poulsenia (Moraceae). • Conclusions: Thirty-one EPIC markers were successfully sequenced across Ficus, and 29 of the markers also amplified in Poulsenia, indicating broad transferability within Moraceae. All of the EPIC markers were polymorphic and showed levels of polymorphism similar to that of the widely used internal transcribed spacer (ITS). PMID:25202490

  8. WES homozygosity mapping in a recessive form of Charcot-Marie-Tooth neuropathy reveals intronic GDAP1 variant leading to a premature stop codon.

    Science.gov (United States)

    Masingue, Marion; Perrot, Jimmy; Carlier, Robert-Yves; Piguet-Lacroix, Guenaelle; Latour, Philippe; Stojkovic, Tanya

    2018-02-02

    Charcot-Marie-Tooth disease (CMT) refers to a group of clinically and genetically heterogeneous inherited neuropathies. Ganglioside-induced differentiation-associated protein 1 GDAP1-related CMT has been reported in an autosomal dominant or recessive form in patients presenting either axonal or demyelinating neuropathy. We report two Sri Lankan sisters born to consanguineous parents and presenting with a severe axonal sensorimotor neuropathy. The early onset of the disease, the distal and proximal weakness and atrophy leading to major disability, along with areflexia, and, most notably, vocal cord and diaphragm paralysis were highly evocative of a GDAP1-related CMT. However, sequencing of the coding regions of the gene was normal. Whole-exome sequencing (WES) was performed and revealed that the largest region of homozygosity was around GDAP1 with several variants, mostly in non-coding regions. In view of the high clinical suspicion of GDAP1 gene involvement, we examined the variants in this gene and this, along with functional studies, allowed us to identify an alternative splicing site revealing a cryptic in-frame stop codon in intron 4 responsible for a severe loss of wild-type GDAP1. This work is the first to describe a deleterious mutation in GDAP1 gene outside of coding sequences or intronic junctions and emphasizes the importance of interpreting molecular analysis, and in particular WES results, in light of the clinical and electrophysiological phenotype.

  9. The white gene of the tephritid fruit fly Bactrocera tryoni is characterized by a long untranslated 5' leader and a 12kb first intron.

    Science.gov (United States)

    Bennett, C L; Frommer, M

    1997-11-01

    A 300 bp fragment from exon 6 of the white gene of Bactrocera tryoni was used to screen a B. tryoni genomic library. One positive (approximately 14 kb) insert contained exons 2-6 of white by nucleotide and amino acid sequence similarity to the white genes of D. melanogaster (O'Hare et al., 1984; Pepling & Mount, 1990). Lucilia cuprina (Garcia et al., 1996). Ceratitis capitata (Zwiebel et al., 1995) and Anopheles gambiae (Besansky et al., 1995). A white 5' cDNA fragment containing exons 1, 2 and part of exon 3 was amplified, cloned and sequenced. An inverse PCR fragment of genomic DNA was generated, containing the exon 1 coding region plus approximately 2.1 kb of upstream sequence, encompassing the putative promoter of the gene. Exon 1 was found to be 728 bp long, encoding the first twenty-five amino acids. The full length of intron 1 was shown to be 12 kb (amplified using long PCR protocols), up to 3 times the length of the longest white intron 1 isolated to date.

  10. The evaluation of angiotensin-converting enzyme (ACE) gene I/D and IL-4 gene intron 3 VNTR polymorphisms in coronary artery disease.

    Science.gov (United States)

    Basol, Nursah; Celik, Atac; Karakus, Nevin; Ozturk, Sibel Demir; Ozsoy, Sibel Demir; Yigit, Serbulent

    2014-01-01

    Genetic polymorphism is a strong risk factor for coronary artery disease (CAD). In the present study, our aim was to evaluate angiotensin-converting enzyme (ACE) gene I/D polymorphism and interleukin-4 (IL-4) gene Intron 3 variable number of tandem repeat (VNTR) polymorphism in CAD. One hundred and twenty-four CAD patients and one hundred and twenty-three controls were enrolled. Genomic DNA was isolated and genotyped using polymerase chain reaction (PCR) analyses. The risk associated with inheriting the combined genotypes for the two polymorphisms were evaluated and it was found that the individuals who were P2P2-homozygous at IL-4 gene intron 3 VNTR and DD-homozygous at ACE gene I/D have a higher risk of developing CAD. Although, there is no correlation between IL4 VNTR polymorphism and ACE gene polymorphism and CAD, there is a strong association between CAD and co-existence of IL-4 VNTR and ACE gene polymorphisms in the Turkish population. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  11. Exon-Primed Intron-Crossing (EPIC Markers for Evolutionary Studies of Ficus and Other Taxa in the Fig Family (Moraceae

    Directory of Open Access Journals (Sweden)

    Xiaohong Yao

    2013-10-01

    Full Text Available Premise of the study: The genus Ficus (fig trees comprises ca. 750 species of trees, vines, and stranglers found in tropical forests throughout the world. Fig trees are keystone species in many tropical forests, and their relationship with host-specific wasp pollinators has received much attention, although many questions remain unresolved regarding the levels of host specificity, cospeciation, and the role of hybridization in fig and wasp speciation. We developed exon-primed intron-crossing (EPIC markers to obtain phylogenetic resolution needed to address these questions. Methods and Results: Expressed sequence tags (ESTs from F. elastica were compared to Arabidopsis and Populus genomes to locate introns and to design primers in flanking exons. Primer pairs for 80 EPIC markers were tested in samples from divergent clades within Ficus and the outgroup Poulsenia (Moraceae. Conclusions: Thirty-one EPIC markers were successfully sequenced across Ficus, and 29 of the markers also amplified in Poulsenia, indicating broad transferability within Moraceae. All of the EPIC markers were polymorphic and showed levels of polymorphism similar to that of the widely used internal transcribed spacer (ITS.

  12. A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea.

    Science.gov (United States)

    Ford, Kathryn L; Baumgartner, Kendra; Henricot, Béatrice; Bailey, Andy M; Foster, Gary D

    2016-07-07

    Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled using yeast-based recombination methods. These have been designed to allow easy exchange of promoters and inclusion of introns. The vectors were first tested by transformation into basidiomycete Clitopilus passeckerianus to ascertain vector functionality then used to transform A. mellea. We show that heterologous promoters from the basidiomycetes Agaricus bisporus and Phanerochaete chrysosporium that were used successfully to control the hygromycin resistance cassette were not able to support expression of mRFP or GFP in A. mellea. The endogenous A. mellea gpd promoter delivered efficient expression, and we show that inclusion of an intron was also required for transgene expression. GFP and mRFP expression was stable in mycelia and fluorescence was visible in transgenic fruiting bodies and GFP was detectable in planta. Use of these vectors has been successful in giving expression of the fluorescent proteins GFP and mRFP in A. mellea, providing an additional molecular tool for this pathogen.

  13. The Intron 4 Polymorphism in the Calcium-Sensing Receptor Gene in Diabetes Mellitus and its Chronic Complications, Diabetic Nephropathy and Non-Diabetic Renal Disease

    Directory of Open Access Journals (Sweden)

    Viera Železníková

    2014-10-01

    Full Text Available Background/Aims: Calcium-Sensing Receptor (CaSR significantly affects calcium-phosphate metabolism in kidneys, and it is implicated in the pathogenesis of diabetes mellitus (DM due to its expression in pancreatic F-cells. The role of CaSR as one of the players in pathogenesis of chronic kidney disease (CKD has been speculated. Methods: 158 Type 2 diabetic patients divided into three groups according to occurrence and type of kidney complications, 66 nondiabetic patients CKD, and 93 healthy subjects were enrolled into the study to analyze the role of two CaSR polymorphisms (in the codon 990 and in the intron 4 in ethiopathogenesis of DM and CKD. The Type 2 diabetic groups consisted of 48 patients without any kidney abnormalities, 58 patients with diabetic nephropathy (DN, and 52 patients with nondiabetic renal disease (NDRD. The distribution of genotype and allele frequencies was studied using PCR with the TaqMan Discrimination Assay or followed by the Restriction Fragment Length Polymorphism method, respectively. Results: We have found that the intron 4 polymorphism is a risk factor for the development of DM and CKD, except DN, while the codon 990 does not show any disease association. Conclusion: We conclude that CaSR is a general factor in pancreas and kidney pathologies. i 2014 S. Karger AG, Basel

  14. Improvement of a yeast self-excising integrative vector by prevention of expression leakage of the intronated Cre recombinase gene during plasmid maintenance in Escherichia coli.

    Science.gov (United States)

    Agaphonov, Michael O

    2017-12-01

    The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  16. Identification and characterization of a FOXA2-regulated transcriptional enhancer at a type 2 diabetes intronic locus that controls GCKR expression in liver cells.

    Science.gov (United States)

    López Rodríguez, Maykel; Kaminska, Dorota; Lappalainen, Kati; Pihlajamäki, Jussi; Kaikkonen, Minna U; Laakso, Markku

    2017-07-06

    Genome-wide association studies (GWAS) have identified more than 100 genetic loci associated with type 2 diabetes (T2D). However, the underlying biological mechanisms for many of these associations remain unknown. GWAS signals close to the glucokinase regulatory protein gene (GCKR) have been reported for lipid and glucose metabolism traits and the risk of T2D. We investigated the regulatory function of an intronic locus at GCKR represented by the lead single nucleotide polymorphism (SNP) rs780094. We used ENCODE project histone modification and transcription factor binding data to determine the regulatory features of a GCKR intronic locus formed by the high linkage disequilibrium rs780094(C/T), rs780095(G/A), and rs780096(G/C) SNPs. Characterization of the transcriptional activity of this region was assessed by luciferase reporter assays in HepG2 cells and mouse primary hepatocytes. ChIP-qPCR was used to determine the levels of haplotype specific transcription factor binding and histone marks. A CRISPR-dCas9 transcriptional activator system and qPCR were used to activate the locus and measure GCKR expression, respectively. Differential haplotype expression was measured from human liver biopsies. The ENCODE data suggest the existence of a liver-specific intragenic enhancer at the locus represented by s780094. We observed that FOXA2 increased the transcriptional activity of this region in a haplotype specific way (CGG > TAC; rs780094, rs780095, and rs780096). In addition, the CGG haplotype showed higher binding to FOXA2 and higher levels of the H3K27Ac histone mark. The epigenetic activation of this locus increased the expression of endogenous GCKR in HepG2 cells, confirming that GCKR is the direct target gene of the enhancer. Finally, we confirmed that the CGG haplotype exhibits higher levels of transcription in human liver. Our results demonstrate the existence of a liver-specific FOXA2-regulated transcriptional enhancer at an intronic T2D locus represented by

  17. An intronic variation in SLC52A1 causes exon skipping and transient riboflavin-responsive multiple acyl-CoA dehydrogenation deficiency

    DEFF Research Database (Denmark)

    Mosegaard, Signe; Bruun, Gitte Hoffmann; Flyvbjerg, Karen Freund

    2017-01-01

    Vitamin B2, riboflavin is essential for cellular function, as it participates in a diversity of redox reactions central to human metabolism, through its role as precursor for the cofactors flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD), which are electron carriers. The electron......-CoA dehydrogenation deficiency (MADD), but genetic variations in the riboflavin metabolism or transportation of riboflavin can also cause MADD. The most common variations are located in the riboflavin transporter 2 (RFVT2) and 3 (RFVT3), that are highly expressed in brain and intestinal tissues, respectively....... Deficiency of riboflavin transporter 1 (RFVT1), encoded by the SLC52A1 gene, highly expressed in the placenta, has only been reported once. We here report a case of transient MADD, caused by a heterozygous intronic variation, c.1134+11G>A, in the SLC52A1 gene encoding RFVT1. This variation creates a binding...

  18. Occipital horn syndrome and classical Menkes syndrome caused by deep intronic mutations, leading to the activation of ATP7A pseudo-exon

    DEFF Research Database (Denmark)

    Yasmeen, Saiqa; Lund, Katrine; De Paepe, Anne

    2014-01-01

    Menkes disease is an X-linked disorder of copper metabolism caused by mutations in the ATP7A gene. Whereas most of the patients exhibit a severe classical form, about 9% of the patients exhibit a milder form of Menkes disease. The mildest form is called occipital horn syndrome (OHS). Mutations...... patients: two patients with OHS and one patient with classical Menkes disease. The pseudo-exons were inserted between exons 10 and 11, between exons 16 and 17 and between exons 14 and 15 in the three patients, as a result of deep intronic mutations. This is the first time the activation of pseudo...... mechanism, which has hitherto been overlooked.European Journal of Human Genetics advance online publication, 4 September 2013; doi:10.1038/ejhg.2013.191....

  19. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Ethnic differences in five intronic polymorphisms associated with arsenic metabolism within human arsenic (+ 3 oxidation state) methyltransferase (AS3MT) gene

    International Nuclear Information System (INIS)

    Fujihara, Junko; Fujii, Yoshimi; Agusa, Tetsuro; Kunito, Takashi; Yasuda, Toshihiro; Moritani, Tamami; Takeshita, Haruo

    2009-01-01

    Human arsenic (+ 3 oxidation state) methyltransferase (AS3MT) is known to catalyze the methylation of arsenite, and intronic single-nucleotide polymorphisms (SNPs: G7395A, G12390C, T14215C, T35587C, and G35991A) in the AS3MT gene were shown to be related to inter-individual variation in the arsenic metabolism. In the present study, the genotyping for these SNPs was developed using the polymerase chain reaction and restriction fragment length polymorphism technique. Applying this method, the genotype distribution among the Ovambo, Turkish, Mongolian, Korean, and Japanese populations was investigated, and our results were compared with those from other studies. G7395, G12390, T35587, and A35991 were predominant among the five populations in our study. However, a previous study in Argentina, C12390 and G35991 showed the highest allele frequency among the eight populations studied in other studies. The dominant allele of T14215C differed among populations: the T14215 allele was predominant in Argentina, the allele frequency of C14215 was higher than that of T14215 among Turks, Mongolians, Europeans, and American ancestry. In Korea and Japan, similar allele frequencies were observed in T14215 and C14215. Higher allele frequencies were observed in haplotype G7395/G12390/C14215/T35587 with frequencies of 0.40 (Turks), 0.28 (Mongolians), and 0.23 (Koreans). On the other hand, the allele frequency for G7395/G14215/T35587/A35991 was the highest among the Ovambos (0.32), and the frequency for G7395/G12390/C35587/G35991 was the highest among the Japanese (0.27). It is noteworthy that the Japanese haplotype differs from that of the Koreans and Mongolians, which indicates the importance of investigating other intronic polymorphisms in AS3MT, especially in Asians

  1. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  2. BCL2-like 11 intron 2 deletion polymorphism is not associated with non-small cell lung cancer risk and prognosis.

    Science.gov (United States)

    Cho, Eun Na; Kim, Eun Young; Jung, Ji Ye; Kim, Arum; Oh, In Jae; Kim, Young Chul; Chang, Yoon Soo

    2015-10-01

    BCL2-Like 11(BIM), which encodes a BH3-only protein, is a major pro-apoptotic molecule that facilitates cell death. We hypothesized that a BIM intron 2 deletion polymorphism increases lung cancer risk and predicts poor prognosis in non-small lung cancer (NSCLC) patients. We prospectively recruited 450 lung cancer patients and 1:1 age, sex, and smoking status matched control subjects from February 2013 to April 2014 among patients treated at Severance, Gangnam Severance, and Chonnam Hwasoon Hospital. The presence of a 2903-bp genomic DNA deletion polymorphism of intron 2 of BIM was analyzed by PCR and validated by sequencing. Odds ratios were calculated by chi-square tests and survival analysis with Kaplan-Meier estimation. Sixty-nine out of 450 (15.3%) lung cancer patients carried the BIM deletion polymorphism, while 66 out of 450 (14.7%) control subjects carried the BIM deletion polymorphism, with an odds ratio of for lung cancer of 1.054 (95% CI; 0.731-1.519). We categorized 406 NSCLC patients according to the presence of the polymorphism and found that there were no statistically significant differences in age, sex, histologic type, or stage between subjects with and without the deletion polymorphism. The BIM deletion polymorphism did not influence overall survival (OS) or progression free survival (PFS) in our sample (OS; 37.6 vs 34.4 months (P=0.759), PFS; 49.6 vs 26.0 months (P=0.434)). These findings indicate that the BIM deletion polymorphism is common in Korean NSCLC patients but does not significantly affect the intrinsic biologic function of BH3-only protein. Furthermore, the BIM deletion polymorphism did not predict clinical outcomes in patients with NSCLC. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Novel mutations causing biotinidase deficiency in individuals identified by newborn screening in Michigan including an unique intronic mutation that alters mRNA expression of the biotinidase gene.

    Science.gov (United States)

    Li, H; Spencer, L; Nahhas, F; Miller, J; Fribley, A; Feldman, G; Conway, R; Wolf, B

    2014-07-01

    Biotinidase deficiency (BD) is an autosomal recessive disorder resulting in the inability to recycle the vitamin biotin. Individuals with biotinidase deficiency can develop neurological and cutaneous symptoms if they are not treated with biotin. To date, more than 165 mutations in the biotinidase gene (BTD) have been reported. Essentially all the mutations result in enzymatic activities with less than 10% of mean normal serum enzyme activity (profound biotinidase deficiency) with the exception of the c.1330G>C (p.D444H) mutation, which results in an enzyme having 50% of mean normal serum activity and causes partial biotinidase deficiency (10-30% of mean normal serum biotinidase activity) if there is a mutation for profound biotinidase deficiency on the second allele. We now reported eight novel mutations in ten children identified by newborn screening in Michigan from 1988 to the end of 2012. Interestingly, one intronic mutation, c.310-15delT, results in an approximately two-fold down-regulation of BTD mRNA expression by Quantitative real-time reverse-transcription PCR (qRT-PCR). This is the first report of an intronic mutation in the BTD gene with demonstration of its effect on enzymatic activity by altering mRNA expression. This study identified three other mutations likely to cause partial biotinidase deficiency. These results emphasize the importance of full gene sequencing of BTD on patients with biotinidase deficiency to better understand the genotype and phenotype correlation in the future. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. The evolution of controlled multitasked gene networks: the role of introns and other noncoding RNAs in the development of complex organisms.

    Science.gov (United States)

    Mattick, J S; Gagen, M J

    2001-09-01

    Eukaryotic phenotypic diversity arises from multitasking of a core proteome of limited size. Multitasking is routine in computers, as well as in other sophisticated information systems, and requires multiple inputs and outputs to control and integrate network activity. Higher eukaryotes have a mosaic gene structure with a dual output, mRNA (protein-coding) sequences and introns, which are released from the pre-mRNA by posttranscriptional processing. Introns have been enormously successful as a class of sequences and comprise up to 95% of the primary transcripts of protein-coding genes in mammals. In addition, many other transcripts (perhaps more than half) do not encode proteins at all, but appear both to be developmentally regulated and to have genetic function. We suggest that these RNAs (eRNAs) have evolved to function as endogenous network control molecules which enable direct gene-gene communication and multitasking of eukaryotic genomes. Analysis of a range of complex genetic phenomena in which RNA is involved or implicated, including co-suppression, transgene silencing, RNA interference, imprinting, methylation, and transvection, suggests that a higher-order regulatory system based on RNA signals operates in the higher eukaryotes and involves chromatin remodeling as well as other RNA-DNA, RNA-RNA, and RNA-protein interactions. The evolution of densely connected gene networks would be expected to result in a relatively stable core proteome due to the multiple reuse of components, implying that cellular differentiation and phenotypic variation in the higher eukaryotes results primarily from variation in the control architecture. Thus, network integration and multitasking using trans-acting RNA molecules produced in parallel with protein-coding sequences may underpin both the evolution of developmentally sophisticated multicellular organisms and the rapid expansion of phenotypic complexity into uncontested environments such as those initiated in the Cambrian

  5. Fox-2 Splicing Factor Binds to a Conserved Intron Motif to PromoteInclusion of Protein 4.1R Alternative Exon 16

    Energy Technology Data Exchange (ETDEWEB)

    Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo; Lersch,Robert A.; Gee, Sherry L.; Hou, Victor C.; Lo, Annie J.; Short, Sarah A.; Chasis, Joel A.; Winkelmann, John C.; Conboy, John G.

    2006-03-01

    Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding to the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.

  6. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

    Science.gov (United States)

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

    2016-01-12

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

  7. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS Gene

    Directory of Open Access Journals (Sweden)

    Yoko Nakajima

    2016-01-01

    Full Text Available Dihydropyrimidinase (DHP deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

  8. Association analysis between a VNTR intron 8 polymorphism of the dopamine transporter gene (SLC6A3 and obsessive- compulsive disorder in a Brazilian sample Análise de associação entre um polimorfismo VNTR no intron 8 do gene do transportador de dopamina (SLC6A3 e transtorno obsessivo-compulsivo em uma amostra brasileira

    Directory of Open Access Journals (Sweden)

    Karen Miguita

    2007-12-01

    Full Text Available Family, twin and segregation analysis have provided evidences that genetic factors are implicated in the susceptibility for obsessive-compulsive disorder (OCD. Several lines of research suggest that the dopaminergic system may be involved in the pathophysiology of OCD. Thus, the aim of the present study was to investigate a possible association between a polymorphism located in intron 8 of the dopamine transporter gene (SLC6A3 and OCD in a Brazilian sample composed by 208 patients and 865 healthy controls. No statistically differences were observed in allelic and genotype distributions between cases and controls. No association was also observed when the sample was divided according to specific phenotypic features such as gender, presence of tic disorders co-morbidity and age at onset of obsessive-compulsive symptoms (OCS. Our results suggest that the intron 8 VNTR of the SLC6A3 investigated in this study is not related to the susceptibility for OCD in our Brazilian sample.Estudos de família, gêmeos e de segregação têm demonstrado que fatores genéticos estão envolvidos na susceptibilidade para o desenvolvimento do transtorno obsessivo-compulsivo (TOC. Várias linhas de pesquisa sugerem que o sistema dopaminérgico possa estar envolvido na fisiopatologia do TOC. Assim, o objetivo do presente estudo foi investigar uma possível associação entre o polimorfismo localizado no intron 8 do gene do transportador da dopamina (SLC6A3 e o TOC em uma amostra brasileira composta por 208 pacientes e 865 controles sadios. Nenhuma diferença estatisticamente significante foi observada nas distribuições alélicas e genotípicas entre os grupos de pacientes e controles. Nenhuma associação também foi observada quando as amostras foram divididas de acordo com características fenotípicas específicas, tais como gênero, presença de co-morbidade com tiques e idade de início dos sintomas obsessivo-compulsivo (SOC. Nossos resultados sugerem que o VNTR

  9. Regulation of α-Smooth Muscle Actin Expression in Granulation Tissue Myofibroblasts Is Dependent on the Intronic CArG Element and the Transforming Growth Factor-β1 Control Element

    Science.gov (United States)

    Tomasek, James J.; McRae, Joel; Owens, Gary K.; Haaksma, Carol J.

    2005-01-01

    Myofibroblasts are specialized contractile fibroblasts that are critical in wound closure and tissue contracture. Generation of contractile force is correlated with the expression of α-smooth muscle actin (α-SMA); however, little is known regarding molecular mechanisms that control activation of α-SMA in myofibroblasts in granulation tissue. The aims of the present studies were to identify sufficient promoter regions required for α-SMA expression in myofibroblasts in vivo and to determine whether activation of α-SMA expression in myofibroblasts in vivo is dependent on an intronic CArG [CC(A/T)6GG] and a transforming growth factor-β1 control element (TCE) that are required for α-SMA expression in smooth muscle cells. A Lac Z transgene construct from −2600 through the first intron was expressed in myofibroblasts within granulation tissue of cutaneous wounds in a pattern that closely mimicked endogenous α-SMA expression. Mutation of either the intronic CArG element or the TCE completely inhibited transgene expression in myofibroblasts in granulation tissue and responsiveness to transforming growth factor-β1 in cultured transgenic fibroblasts. These same elements were also critical in regulating α-SMA expression during skeletal muscle repair but not during skeletal muscle development. Taken together, these results provide the first in vivo evidence for the importance of the intronic CArG and TCE cis-elements in the regulation of α-SMA expression in myofibroblasts in granulation tissue. PMID:15855636

  10. Effective suppression of dengue virus using a novel group-I intron that induces apoptotic cell death upon infection through conditional expression of the Bax C-terminal domain.

    Science.gov (United States)

    Carter, James R; Keith, James H; Fraser, Tresa S; Dawson, James L; Kucharski, Cheryl A; Horne, Kate M; Higgs, Stephen; Fraser, Malcolm J

    2014-06-13

    Approximately 100 million confirmed infections and 20,000 deaths are caused by Dengue virus (DENV) outbreaks annually. Global warming and rapid dispersal have resulted in DENV epidemics in formally non-endemic regions. Currently no consistently effective preventive measures for DENV exist, prompting development of transgenic and paratransgenic vector control approaches. Production of transgenic mosquitoes refractory for virus infection and/or transmission is contingent upon defining antiviral genes that have low probability for allowing escape mutations, and are equally effective against multiple serotypes. Previously we demonstrated the effectiveness of an anti-viral group I intron targeting U143 of the DENV genome in mediating trans-splicing and expression of a marker gene with the capsid coding domain. In this report we examine the effectiveness of coupling expression of ΔN Bax to trans-splicing U143 intron activity as a means of suppressing DENV infection of mosquito cells. Targeting the conserved DENV circularization sequence (CS) by U143 intron trans-splicing activity appends a 3' exon RNA encoding ΔN Bax to the capsid coding region of the genomic RNA, resulting in a chimeric protein that induces premature cell death upon infection. TCID50-IFA analyses demonstrate an enhancement of DENV suppression for all DENV serotypes tested over the identical group I intron coupled with the non-apoptotic inducing firefly luciferase as the 3' exon. These cumulative results confirm the increased effectiveness of this αDENV-U143-ΔN Bax group I intron as a sequence specific antiviral that should be useful for suppression of DENV in transgenic mosquitoes. Annexin V staining, caspase 3 assays, and DNA ladder observations confirm DCA-ΔN Bax fusion protein expression induces apoptotic cell death. This report confirms the relative effectiveness of an anti-DENV group I intron coupled to an apoptosis-inducing ΔN Bax 3' exon that trans-splices conserved sequences of the 5' CS

  11. G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

    Energy Technology Data Exchange (ETDEWEB)

    Willing, M.; Deschenes, S. [Univ. of Iowa, Iowa City, IA (United States)

    1994-09-01

    We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exon 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.

  12. Intron retention in mRNA encoding ancillary subunit of insect voltage-gated sodium channel modulates channel expression, gating regulation and drug sensitivity.

    Directory of Open Access Journals (Sweden)

    Céline M Bourdin

    Full Text Available Insect voltage-gated sodium (Nav channels are formed by a well-known pore-forming α-subunit encoded by para-like gene and ancillary subunits related to TipE from the mutation "temperature-induced-paralysis locus E." The role of these ancillary subunits in the modulation of biophysical and pharmacological properties of Na(+ currents are not enough documented. The unique neuronal ancillary subunit TipE-homologous protein 1 of Drosophila melanogaster (DmTEH1 strongly enhances the expression of insect Nav channels when heterologously expressed in Xenopus oocytes. Here we report the cloning and functional expression of two neuronal DmTEH1-homologs of the cockroach, Periplaneta americana, PaTEH1A and PaTEH1B, encoded by a single bicistronic gene. In PaTEH1B, the second exon encoding the last 11-amino-acid residues of PaTEH1A is shifted to 3'UTR by the retention of a 96-bp intron-containing coding-message, thus generating a new C-terminal end. We investigated the gating and pharmacological properties of the Drosophila Nav channel variant (DmNav1-1 co-expressed with DmTEH1, PaTEH1A, PaTEH1B or a truncated mutant PaTEH1Δ(270-280 in Xenopus oocytes. PaTEH1B caused a 2.2-fold current density decrease, concomitant with an equivalent α-subunit incorporation decrease in the plasma membrane, compared to PaTEH1A and PaTEH1Δ(270-280. PaTEH1B positively shifted the voltage-dependences of activation and slow inactivation of DmNav1-1 channels to more positive potentials compared to PaTEH1A, suggesting that the C-terminal end of both proteins may influence the function of the voltage-sensor and the pore of Nav channel. Interestingly, our findings showed that the sensitivity of DmNav1-1 channels to lidocaine and to the pyrazoline-type insecticide metabolite DCJW depends on associated TEH1-like subunits. In conclusion, our work demonstrates for the first time that density, gating and pharmacological properties of Nav channels expressed in Xenopus oocytes can be

  13. Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

    Science.gov (United States)

    Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

    2013-08-08

    Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of

  14. Intron sequence of the taurocyamine kinase gene as a marker to investigate genetic variation of Paragonimus species in Japan and the origins of triploidy in P. westermani.

    Science.gov (United States)

    Saijuntha, Weerachai; Tantrawatpan, Chairat; Jarilla, Blanca R; Agatsuma, Takeshi; Andrews, Ross H; Petney, Trevor N

    2016-01-01

    Paragonimiasis is a foodborne parasitic infection caused by lung flukes of the genus Paragonimus. Several species of Paragonimus are endemic in Japan: P. westermani (diploid and triploid) P. miyazakii, P. ohirai and P. iloktsuenensis. The taxonomic status and genetic variability of these lung flukes remains poorly understood. The second intron of domain 1 of the taurocyamine kinase gene (TKD1int2) region was used to explore genetic variation and differentiation of diploid and triploid P. westermani, as well as P. miyazakii, P. ohirai and P. iloktsuenensis originating from Japan. We found high levels of intraspecific variation in P. westermani, but only low levels of variation within the other species studied. Haplotype network and phylogenetic tree analyses demonstrated the sister-group relationship of P. ohirai and P. iloktsuenensis and the phylogenetically distant relationship of P. westermani with the other species. All individuals except for triploid P. westermani were homozygous. Each triploid contained at least one allele similar to that seen in most diploids from Chiba and one allele resembling that seen in diploids from Oita. One triploid contained three different sequences. Our findings suggested that the TKD1int2 region is a suitable marker for use in studying the genetic variation and phylogenetics of Paragonimus species, as well as providing clues to the origins of triploidy in P. westermani. © The Author 2015. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Lenalidomide modulates gene expression in human ABC-DLBCL cells by regulating IKAROS interaction with an intronic control region of SPIB.

    Science.gov (United States)

    Solomon, Lauren A; Batista, Carolina R; DeKoter, Rodney P

    2017-12-01

    Activated B-cell diffuse large B-cell lymphoma (ABC-DLBCL) is associated with a poor prognosis compared with other DLBCL types and therefore represents a top priority for developing novel therapies. Lenalidomide, an immunomodulatory drug in trials for treatment of ABC-DLBCL, targets the transcription factor IKAROS for degradation by the cereblon E3 ubiquitin ligase complex. In this study, we investigated whether the gene encoding the transcription factor SPI-B is a target of IKAROS. Using cultured ABC-DLBCL cell lines, we found that high levels of SPI-B expression conferred resistance to lenalidomide. Lenalidomide treatment of ABC-DLBCL cells resulted in downregulation of SPIB at the level of transcription. SPIB was regulated directly by IKAROS through a binding site located in the first intron of the gene. Inhibition of IKAROS binding using CRISPR/Cas9-mediated transcriptional repression downregulated endogenous SPIB transcription. Finally, ectopic expression of IKAROS protected SPIB from downregulation. These results show that the mechanism of action of lenalidomide in ABC-DLBCL cells involves downregulation of SPIB transcription by cereblon-induced degradation of IKAROS. These results have implications for the design of synthetic lethal therapy for the treatment of ABC-DLBCL. Copyright © 2017 ISEH – Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.

  16. Rapid and recent diversification of curassows, guans, and chachalacas (Galliformes: Cracidae) out of Mesoamerica: Phylogeny inferred from mitochondrial, intron, and ultraconserved element sequences.

    Science.gov (United States)

    Hosner, Peter A; Braun, Edward L; Kimball, Rebecca T

    2016-09-01

    The Cracidae (curassows, guans, and chachalacas) include some of the most spectacular and endangered Neotropical bird species. They lack a comprehensive phylogenetic hypothesis, hence their geographic origin and the history of their diversification remain unclear. We present a species-level phylogeny of Cracidae inferred from a matrix of 430 ultraconserved elements (UCEs; at least one species sampled per genus) and eight more variable loci (introns and mtDNA; all available species). We use this phylogeny along with probabilistic biogeographic modeling to test whether Gondwanan vicariance, ancient dispersal to South America, ancient dispersal from South America, or massive global cooling isolated cracids in the Neotropics. Contrary to previous estimates that extant cracids diversified in the Cretaceous, our fossil-calibrated divergence time estimates instead support that crown Cracidae originated in the late Miocene. Species-rich genera Crax, Penelope, and Ortalis began diversifying as recently as 3Mya. Biogeographic reconstructions indicate that modern cracids originated in Mesoamerica and were isolated from a widespread Laurasian ancestor, consistent with the massive global cooling hypothesis. Current South American diversity is the result of multiple colonization events following uplift of the Panamanian Isthmus, coupled with rapid diversification and evolution of secondary sympatry. Of the four major cracid lineages (curassows, chachalacas, typical guans, horned guan), the only lineage that has failed to colonize and diversify South America is the unique horned guan (Oreophasis derbianus), which is sister to curassows and chachalacas rather than typical guans. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. G-quadruplex structure at intron 2 of TFE3 and its role in Xp11.2 translocation and splicing.

    Science.gov (United States)

    Verma, Shiv Prakash; Das, Parimal

    2018-03-01

    Transcription Factor E3 (TFE3) translocation is found in a group of different type of cancers and most of the translocations are located in the 5' region of TFE3 which may be considered as Breakpoint Region (BR). In our In silico study by QGRS mapper and non BdB web servers we found a Potential G-quadruplex forming Sequence (PQS) in the intron 2 of TFE3 gene. In vitro G-quadruplex formation was shown by native PAGE in presence of Pyridostatin(PDS), which with inter molecular secondary structure caused reduced mobility to migrate slower. G-quadruplex formation was mapped at single base resolution by Sanger sequencing and Circular Dichroism showed the formation of parallel G-quadruplex. FRET analysis revealed increased and decreased formation of G-quadruplex in presence of PDS and antisense oligonucleotide respectively. PCR stop assay, transcriptional and translational inhibition by PQS showed stable G-quadruplex formation affecting the biological processes. TFE3 minigene splicing study showed the involvement of this G-quadruplex in TFE3 splicing too. Therefore, G-quadruplex is evident to be the reason behind TFE3 induced oncogenesis executed by translocation and also involved in the mRNA splicing. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Multiple single nucleotide polymorphisms in the first intron of the IL2RA gene affect transcription factor binding and enhancer activity.

    Science.gov (United States)

    Schwartz, Anton M; Demin, Denis E; Vorontsov, Ilya E; Kasyanov, Artem S; Putlyaeva, Lidia V; Tatosyan, Karina A; Kulakovskiy, Ivan V; Kuprash, Dmitry V

    2017-02-20

    IL2RA gene encodes the alpha subunit of a high-affinity receptor for interleukin-2 which is expressed by several distinct populations of lymphocytes involved in autoimmune processes. A large number of polymorphic alleles of the IL2RA locus are associated with the development of various autoimmune diseases. With bioinformatics analysis we the dissected the first intron of the IL2RA gene and selected several single nucleotide polymorphisms (SNPs) that may influence the regulation of the IL2RA gene in cell types relevant to autoimmune pathology. We described five enhancers containing the selected SNPs that stimulated activity of the IL2RA promoter in a cell-type specific manner, and tested the effect of specific SNP alleles on activity of the respective enhancers (E1 to E5, labeled according to the distance to the promoter). The E4 enhancer with minor T variant of rs61839660 SNP demonstrated reduced activity due to disrupted binding of MEF2A/C transcription factors (TFs). Neither rs706778 nor rs706779 SNPs, both associated with a number of autoimmune diseases, had any effect on the activity of the enhancer E2. However, rare variants of several SNPs (rs139767239, rs115133228, rs12722502, rs12722635) genetically linked to either rs706778 and/or rs706779 significantly influenced the activity of E1, E3 and E5 enhancers, presumably by disrupting EBF1, GABPA and ELF1 binding sites. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Influence of IL-1RN intron 2 variable number of tandem repeats (VNTR) polymorphism on the age at onset of neuropsychiatric symptoms in Wilson's disease.

    Science.gov (United States)

    Gromadzka, Grazyna; Członkowska, Anna

    2011-01-01

    ABSTRACT Wilson's disease (WND) is an autosomal recessive copper storage disease characterized with diverse clinical pictures with the hepatic and/or neuropsychiatric symptoms manifesting at variable age. On the basis of the existing knowledge on possible copper-proinflammatory cytokines interactions, we hypothesized that in WND hereditary, over-/underexpression of PC or anti-inflammatory cytokines may have an impact on the course of the disease. We analyzed the clinical manifestations of WND in relationship to polymorphisms within genes for interleukin-1 receptor antagonist (IL1RN intron 2 VNTR polymorphism), interleukin-1α (IL1A G4845T), IL-1β (IL1B C-511T), IL-6 (IL6 G-174C), and tumor necrosis factor (TNF G-308A) in a total sample of 332 patients. The IL1B C-511T and IL1RN VNTR polymorphisms had an impact on copper metabolism parameters. None of the studied gene polymorphisms had effect on the mode of WND manifestation (neuropsychiatric vs. hepatic). Carriership of the IL1RN *2 allele was related to earlier WND onset, especially among patients with neuropsychiatric form of the disease (median 27.5 vs. 32.0 years, p = .003). Because of the crucial modulatory role of IL1ra on IL-1α and IL-1β proinflammatory functions, IL1ra and its interactions may play a role in the pathogenesis of the neurodegenerative process in WND; our results need to be replicated, possibly in different ethnic groups.

  20. MLPA analysis of an Argentine cohort of patients with dystrophinopathy: Association of intron breakpoints hot spots with STR abundance in DMD gene.

    Science.gov (United States)

    Luce, Leonela N; Dalamon, Viviana; Ferrer, Marcela; Parma, Diana; Szijan, Irene; Giliberto, Florencia

    2016-06-15

    Dystrophinopathies are X-linked recessive diseases caused by mutations in the DMD gene. Our objective was to identify mutations in this gene by Multiplex Ligation Probe Amplification (MLPA), to confirm the clinical diagnosis and determine the carrier status of at-risk relatives. Also, we aimed to characterize the Dystrophinopathies argentine population and the DMD gene. We analyzed a cohort of 121 individuals (70 affected boys, 11 symptomatic women, 37 at-risk women and 3 male villus samples). The MLPA technique identified 56 mutations (45 deletions, 9 duplications and 2 point mutations). These results allowed confirming the clinical diagnosis in 63% (51/81) of patients and symptomatic females. We established the carrier status of 54% (20/37) of females at-risk and 3 male villus samples. We could establish an association between the most frequent deletion intron breakpoints and the abundance of dinucleotide microsatellites loci, despite the underlying mutational molecular mechanism remains to be elucidated. The MLPA demonstrate, again, to be the appropriate first mutation screening methodology for molecular diagnosis of Dystrophinopathies. The reported results permitted to characterize the Dystrophinopathies argentine population and lead to better understanding of the genetic and molecular basis of rearrangements in the DMD gene, useful information for the gene therapies being developed. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Mosaic and Intronic Mutations in TSC1/TSC2 Explain the Majority of TSC Patients with No Mutation Identified by Conventional Testing.

    Science.gov (United States)

    Tyburczy, Magdalena E; Dies, Kira A; Glass, Jennifer; Camposano, Susana; Chekaluk, Yvonne; Thorner, Aaron R; Lin, Ling; Krueger, Darcy; Franz, David N; Thiele, Elizabeth A; Sahin, Mustafa; Kwiatkowski, David J

    2015-11-01

    Tuberous sclerosis complex (TSC) is an autosomal dominant tumor suppressor gene syndrome due to germline mutations in either TSC1 or TSC2. 10-15% of TSC individuals have no mutation identified (NMI) after thorough conventional molecular diagnostic assessment. 53 TSC subjects who were NMI were studied using next generation sequencing to search for mutations in these genes. Blood/saliva DNA including parental samples were available from all subjects, and skin tumor biopsy DNA was available from six subjects. We identified mutations in 45 of 53 subjects (85%). Mosaicism was observed in the majority (26 of 45, 58%), and intronic mutations were also unusually common, seen in 18 of 45 subjects (40%). Seventeen (38%) mutations were seen at an allele frequency mutation detection, show that analysis of TSC-related tumors can increase the mutation detection rate, indicate that it is not likely that a third TSC gene exists, and enable provision of genetic counseling to the substantial population of TSC individuals who are currently NMI.

  2. Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1.

    Science.gov (United States)

    Jain, Niyati; Morgan, Christopher E; Rife, Brittany D; Salemi, Marco; Tolbert, Blanton S

    2016-01-29

    Splicing patterns in human immunodeficiency virus type 1 (HIV-1) are maintained through cis regulatory elements that recruit antagonistic host RNA-binding proteins. The activity of the 3' acceptor site A7 is tightly regulated through a complex network of an intronic splicing silencer (ISS), a bipartite exonic splicing silencer (ESS3a/b), and an exonic splicing enhancer (ESE3). Because HIV-1 splicing depends on protein-RNA interactions, it is important to know the tertiary structures surrounding the splice sites. Herein, we present the NMR solution structure of the phylogenetically conserved ISS stem loop. ISS adopts a stable structure consisting of conserved UG wobble pairs, a folded 2X2 (GU/UA) internal loop, a UU bulge, and a flexible AGUGA apical loop. Calorimetric and biochemical titrations indicate that the UP1 domain of heterogeneous nuclear ribonucleoprotein A1 binds the ISS apical loop site-specifically and with nanomolar affinity. Collectively, this work provides additional insights into how HIV-1 uses a conserved RNA structure to commandeer a host RNA-binding protein. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. 5-hmC in the brain is abundant in synaptic genes and shows differences at the exon-intron boundary.

    Science.gov (United States)

    Khare, Tarang; Pai, Shraddha; Koncevicius, Karolis; Pal, Mrinal; Kriukiene, Edita; Liutkeviciute, Zita; Irimia, Manuel; Jia, Peixin; Ptak, Carolyn; Xia, Menghang; Tice, Raymond; Tochigi, Mamoru; Moréra, Solange; Nazarians, Anaies; Belsham, Denise; Wong, Albert H C; Blencowe, Benjamin J; Wang, Sun Chong; Kapranov, Philipp; Kustra, Rafal; Labrie, Viviane; Klimasauskas, Saulius; Petronis, Arturas

    2012-10-01

    The 5-methylcytosine (5-mC) derivative 5-hydroxymethylcytosine (5-hmC) is abundant in the brain for unknown reasons. Here we characterize the genomic distribution of 5-hmC and 5-mC in human and mouse tissues. We assayed 5-hmC by using glucosylation coupled with restriction-enzyme digestion and microarray analysis. We detected 5-hmC enrichment in genes with synapse-related functions in both human and mouse brain. We also identified substantial tissue-specific differential distributions of these DNA modifications at the exon-intron boundary in human and mouse. This boundary change was mainly due to 5-hmC in the brain but due to 5-mC in non-neural contexts. This pattern was replicated in multiple independent data sets and with single-molecule sequencing. Moreover, in human frontal cortex, constitutive exons contained higher levels of 5-hmC relative to alternatively spliced exons. Our study suggests a new role for 5-hmC in RNA splicing and synaptic function in the brain.

  4. Bayesian phylogeny analysis of vertebrate serpins illustrates evolutionary conservation of the intron and indels based six groups classification system from lampreys for ∼500 MY

    Directory of Open Access Journals (Sweden)

    Abhishek Kumar

    2015-06-01

    Full Text Available The serpin superfamily is characterized by proteins that fold into a conserved tertiary structure and exploits a sophisticated and irreversible suicide-mechanism of inhibition. Vertebrate serpins are classified into six groups (V1–V6, based on three independent biological features—genomic organization, diagnostic amino acid sites and rare indels. However, this classification system was based on the limited number of mammalian genomes available. In this study, several non-mammalian genomes are used to validate this classification system using the powerful Bayesian phylogenetic method. This method supports the intron and indel based vertebrate classification and proves that serpins have been maintained from lampreys to humans for about 500 MY. Lampreys have fewer than 10 serpins, which expand into 36 serpins in humans. The two expanding groups V1 and V2 have SERPINB1/SERPINB6 and SERPINA8/SERPIND1 as the ancestral serpins, respectively. Large clusters of serpins are formed by local duplications of these serpins in tetrapod genomes. Interestingly, the ancestral HCII/SERPIND1 locus (nested within PIK4CA possesses group V4 serpin (A2APL1, homolog of α2-AP/SERPINF2 of lampreys; hence, pointing to the fact that group V4 might have originated from group V2. Additionally in this study, details of the phylogenetic history and genomic characteristics of vertebrate serpins are revisited.

  5. An SduI polymorphism at intron 20 of the Chinese Holstein cow STAT4 gene and its effect on milk performance traits.

    Science.gov (United States)

    Song, X M; Zhang, L; Jiang, J F; Shi, F X; Jiang, Y Q

    2013-05-13

    The signal transducer and activator of transcription (STAT) genes are responsive to a wide range of cytokines, growth factors, and hormones, and thus control important biological processes. In humans, STAT4 mutations have been identified as genetic markers for rheumatoid arthritis, systemic lupus erythematosus, and primary Sjögren's syndrome, whereas little research has been conducted on bovine STAT4 mutations and their potential effects. Herein, 585 Chinese Holstein cows were used to investigate STAT4 mutations and their effects on milk performance traits. One haplotype block, containing g.95879G>A, g.96013G>C, was identified in intron 20 of the bovine STAT4 gene by restriction fragment length polymorphism-polymerase chain reaction and DNA sequencing. Two single nucleotide polymorphisms were significantly associated with milk yield at 305 days (P cows with the haplotype GGGG had higher milk yields at 305 days and lower protein percentages. These results suggest that the 2 single nucleotide polymorphisms of STAT4 could be used as genetic markers for milk performance traits in Chinese Holstein cows.

  6. Genotyping Single Nucleotide Polymorphism C4685T in 14. Intron of Bovine CAPN1 Gene by Rapid Tetra-Primer ARMS-PCR Method

    Directory of Open Access Journals (Sweden)

    Michal Gábor

    2011-05-01

    Full Text Available Single nucleotide polymorphism (SNP C4685T located in 14. intron of bovine CAPN1 gene have shown significant association with a higher lean share in valuable cuts for mutant genotype TT. The work was oriented to developed a sensitive single tube tetra-primer amplification refractory mutation system PCR (ARMS-PCR method for detection of C4685T polymorphism in CAPNI gene and analysis of genotype structure in population of 130 animals of Slovak Pinzgau cattle. The genomic DNA was isolated from samples of blood and hairs of cattle. Design of primers for ARMS-PCR was realized by using program Tetra-Primer ARMS-PCR. The presence of wild allele C and mutant allele T on agarose gel was detected by one control 439 bp fragment for both alleles and one specific fragment for each allele C - 204 bp and T - 290 bp. For the checking of correct genotyping was used PCR-RFLP method with restriction endonuclease BseGI. In the population of Slovak Pinzgau cattle we detected all genotypes. There were detected homozygote genotype CC with frequency 0.3308, heterozygote genotype CT with frequency 0.4 and homozygote genotype TT with frequency 0.2692. Frequency of alleles C and T for SNP C4685T of gene CAPN1 were 0.5308 and 0.4692.

  7. Prevalent Exon-Intron Structural Changes in the APETALA1/FRUITFULL, SEPALLATA, AGAMOUS-LIKE6, and FLOWERING LOCUS C MADS-Box Gene Subfamilies Provide New Insights into Their Evolution.

    Science.gov (United States)

    Yu, Xianxian; Duan, Xiaoshan; Zhang, Rui; Fu, Xuehao; Ye, Lingling; Kong, Hongzhi; Xu, Guixia; Shan, Hongyan

    2016-01-01

    AP1/FUL, SEP, AGL6, and FLC subfamily genes play important roles in flower development. The phylogenetic relationships among them, however, have been controversial, which impedes our understanding of the origin and functional divergence of these genes. One possible reason for the controversy may be the problems caused by changes in the exon-intron structure of genes, which, according to recent studies, may generate non-homologous sites and hamper the homology-based sequence alignment. In this study, we first performed exon-by-exon alignments of these and three outgroup subfamilies (SOC1, AG, and STK). Phylogenetic trees reconstructed based on these matrices show improved resolution and better congruence with species phylogeny. In the context of these phylogenies, we traced evolutionary changes of exon-intron structures in each subfamily. We found that structural changes have occurred frequently following gene duplication and speciation events. Notably, exons 7 and 8 (if present) suffered more structural changes than others. With the knowledge of exon-intron structural changes, we generated more reasonable alignments containing all the focal subfamilies. The resulting trees showed that the SEP subfamily is sister to the monophyletic group formed by AP1/FUL and FLC subfamily genes and that the AGL6 subfamily forms a sister group to the three abovementioned subfamilies. Based on this topology, we inferred the evolutionary history of exon-intron structural changes among different subfamilies. Particularly, we found that the eighth exon originated before the divergence of AP1/FUL, FLC, SEP, and AGL6 subfamilies and degenerated in the ancestral FLC-like gene. These results provide new insights into the origin and evolution of the AP1/FUL, FLC, SEP, and AGL6 subfamilies.

  8. Gene organization of a novel defensin of Ixodes ricinus: first annotation of an intron/exon structure in a hard tick defensin gene and first evidence of the occurrence of two isoforms of one member of the arthropod defensin family

    Czech Academy of Sciences Publication Activity Database

    Rudenko, Natalia; Golovchenko, Maryna; Grubhoffer, Libor

    2007-01-01

    Roč. 16, č. 4 (2007), s. 501-507 ISSN 0962-1075 R&D Projects: GA MŠk(CZ) LC06009; GA ČR(CZ) GA524/06/1479 Institutional research plan: CEZ:AV0Z60220518 Keywords : defensin * Ixodes ricinus * intron/exon structure * immune response * antimicrobial activity Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.787, year: 2007

  9. An intronic single-nucleotide polymorphism (rs13217795) in FOXO3 is associated with asthma and allergic rhinitis: a case-case-control study.

    Science.gov (United States)

    Amarin, Justin Z; Naffa, Randa G; Suradi, Haya H; Alsaket, Yousof M; Obeidat, Nathir M; Mahafza, Tareq M; Zihlif, Malek A

    2017-11-15

    Asthma and allergic rhinitis are respiratory diseases with a significant global burden. Forkhead box O3 (FOXO3) is a gene involved in the etiology of a number of respiratory diseases. The objective of this study is to assess the association of rs13217795, an intronic FOXO3 single-nucleotide polymorphism, with asthma and allergic rhinitis. In this case-case-control genetic association study, genotyping was conducted using the PCR-RFLP method. Genotype-based associations were investigated under the general, recessive, and dominant models of disease penetrance using binomial logistic regression; and, allele-based associations were tested using Pearson's chi-squared test. The final study population consisted of 94 controls, 124 asthmatics, and 110 allergic rhinitis patients. The general and recessive models of disease penetrance were statistically significant for both case-control comparisons. Under the general model, the odds of the asthma phenotype were 1.46 (0.64 to 3.34) and 3.42 (1.37 to 8.57) times higher in heterozygotes and derived allele homozygotes, respectively, compared to ancestral allele homozygotes. The corresponding odds ratios for the allergic rhinitis phenotype were 1.05 (0.46 to 2.40) and 2.35 (0.96 to 5.73), respectively. The dominant model of disease penetrance was not statistically significant. The minor allele in all study groups was the ancestral allele, with a frequency of 0.49 in controls. There was no deviation from Hardy-Weinberg equilibrium in controls. Both case-control allele-based associations were statistically significant. Herein we present the first report of the association between rs13217795 and allergic rhinitis, and the first independent verification of the association between rs13217795 and asthma. Marker selection in future genetic association studies of asthma and allergic rhinitis should include functional polymorphisms in linkage disequilibrium with rs13217795.

  10. Susceptibility to gastric cancer and polymorphisms of insertion/deletion at the intron 3 of the XRCC4 and VNTR at the promoter region of the XRCC5.

    Science.gov (United States)

    Saadat, Mostafa; Pashaei, Samira; Amerizade, Foroozan

    2015-07-01

    The genes encoding X-ray repair cross-complementing group 4 (XRCC4; OMIM: 194363) and 5 (XRCC5; OMIM: 194364) are involved in repair of DNA double-strand breaks. To investigating the associations between polymorphisms of Insertion/Deletion (I/D, rs28360071) in the intron 3 of the XRCC4 and VNTR in the promoter region of the XRCC5 and risk of gastric cancer, the present study was carried out. We included 159 (56 females, 103 males) with gastric cancer and 242 (75 females, 167 males) healthy blood donors frequency matched for age and gender. Using PCR-based methods, the genotypes of the study polymorphisms were determined. The alleles of VNTR XRCC5 polymorphism divided into two groups: L (0 and 1 repeats) and H (2 and 3 repeats) alleles. For the I/D XRCC4 polymorphism, after stratification of the subjects according to their family history (FH) of cancer, either the ID (OR = 3.19, 95%CI: 1.35-7.50, P = 0.008) or the DD genotypes (OR = 4.62, 95%CI: 1.63-13.0, P = 0.004) among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and II genotype). For the VNTR XRCC5 polymorphism, the LH + HH genotypes among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and LL genotype) (OR = 2.88, 95%CI: 1.34-6.18, P = 0.006). Sensitivity analysis showed that the above mentioned associations were not occurred due to the maldistribution of the genotypes among missing data. The present study suggests that both polymorphisms of the XRCC4 and XRCC5 might be risk factors for gastric cancer development especially among persons with positive FH.

  11. Suicide ideators and attempters with schizophrenia--the role of 5-HTTLPR, rs25531, and 5-HTT VNTR Intron 2 variants.

    Science.gov (United States)

    Božina, N; Jovanović, N; Podlesek, A; Rojnić Kuzman, M; Kudumija Slijepčević, M; Roguljić, A; Dimitrović, A; Božina, T; Lovrić, J; Ljubić, H; Medved, V

    2012-06-01

    To examine the role of 5-HTTLPR, rs25531 and 5-HTT VNTR Intron 2 variants in subjects with psychotic disorders manifesting suicide ideation and behaviour. The study included 519 subsequently hospitalized subjects who were genotyped for 5-HTTLPR, rs25531 and 5-HTT VNTR In2 variants. Clinical assessments included structured psychiatric interview, sociodemographic characteristics, suicide ideation and behaviour (SIBQ), severity of psychopathology (PANSS) and depression (CDSS). Three subgroups were identified: suicide attempters (N = 161), suicide ideators (N = 174) and subjects who never reported suicide ideation or behaviour (comparative group, N = 184). 1) Suicide attempters scored highest on the CDSS, while no differences between the three clinical subgroups were detected in the PANSS scores; 2) Suicide attempters were more frequently the carriers of L(A) allele, while subjects in the comparative group were more frequently the carriers of low expression 5-HTTLPR/5-HTT rs25531 haplotype SL(G); 3) No difference was found between the three clinical groups in the 5-HTT VNTR In2 variants; 4) Subjects with 5-HTTLPR/5-HTT rs25531 intermediate expression haplotype (L(A)L(G,)SL(A)) scored higher on the PANSS general psychopathology subscale; 5) There was no association between suicide attempt or ideation and 5-HTTLPR/In2 or 5-HTTLPR/rs25531/In2 haplotype distribution. The suicide ideators, attempters and controls did not differ significantly in 5-HTTLPR or 5-HTT VNTR In 2 variants, but 5-HTTLPR/5-HTT rs25531 haplotype might be a useful genetic marker in distinguishing these three clinical groups. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. An intronic polymorphism of IRF4 gene influences gene transcription in vitro and shows a risk association with childhood acute lymphoblastic leukemia in males.

    Science.gov (United States)

    Do, Thuy N; Ucisik-Akkaya, Esma; Davis, Charronne F; Morrison, Brittany A; Dorak, M Tevfik

    2010-02-01

    The interferon regulatory factor (IRF) family of DNA-binding proteins regulates expression of interferon-inducible genes with roles in the immune response and carcinogenesis. IRF4 is involved in the differentiation of B and T cells and is overexpressed in B-cell malignancies as a result of c-REL (NF-kappaB) hyperactivation. IRF4 polymorphisms are associated with susceptibility to chronic lymphoid leukemia (CLL) and non-Hodgkin lymphoma (NHL). We examined 13 IRF4 SNPs in 114 cases of childhood acute lymphoblastic leukemia (ALL) and 388 newborn controls from Wales (U.K.) using TaqMan assays. IRF4 intron 4 SNP rs12203592 showed a male-specific risk association (OR=4.4, 95% CI=1.5 to 12.6, P=0.007). Functional consequences of the C>T substitution at this SNP were assessed by cell-based reporter assays using three different cell lines. We found a repressive effect of the rs12203592 wildtype allele C on IRF4 promoter activity (Pcell line tested. Thus, homozygosity for the rs12203592 variant allele would result in increased IRF4 expression. This increase would be compounded by high levels of NF-kappaB activity in males due to the absence of estrogen. IRF4 differs from other IRFs in its anti-interferon activity which interferes with immune surveillance. We propose that a detailed study of IRF4 can provide information on the mechanism of the sex effect and the role of immune surveillance in childhood ALL development. Copyright 2009 Elsevier B.V. All rights reserved.

  13. Molecular characterization of a novel HEXA mutation at the +3 position of intron 8 in a Tay-Sachs disease patient

    Energy Technology Data Exchange (ETDEWEB)

    Richard, M.; Triggs-Raine, B. [Univ. of Manitoba, Winnipeg (Canada); Natowicz, M. [E.K. Shriver Center, Waltham, MA (United States)

    1994-09-01

    Tay-Sachs disease is an autosomal recessive lysosomal storage disorder resulting from mutations in the HEXA gene that cause a deficiency in the activity of that enzyme {beta}-hexosaminidase A (Hex A). This deficiency leads to the build-up of G{sub M2} ganglioside, resulting in neurodegeneration and death. Biochemical analysis of a non-Jewish patient with a late-infantile form of Tay-Sachs disease revealed a substantial level of Hex A activity (38.4%) when 4-MUG was used as the substrate. However, when a substrate (4-MUGS) specific for the {alpha}-subunit of Hex A ({alpha}{beta}) was used, almost no activity was detected in the HEXA gene of the patient using SSCP analysis followed by sequencing. The first mutation, a G533A substitution in exon 5, is previously described and associated with the B1 form of Tay-Sachs disease. The second mutation is a novel a-to-g base change at the +3 position of intron 8. This was confirmed using the AIRS method, whereby a MaeIII site was created in the presence of the mutation. Normal and patient mRNA was reverse transcribed and exons 7 to 9 were PCR-amplified from the cDNA. An abnormally sized amplification product detected only in the patient cDNA was sequenced; exon 8 had been deleted and exons 7 and 9 were spliced together. A substantial level of normally-sized PCR product was also detected in the patient`s cDNA. Experiments are in progress to determine if this is produced from the allele harboring the G533A mutation. Given that previous mutations of this type have been associated with 97-100% abnormal splicing, this mutation is likely to be the cause, together with the G533A mutation, of Tay-Sachs disease in this patient.

  14. ABO exon and intron analysis in individuals with the AweakB phenotype reveals a novel O1v-A2 hybrid allele that causes four missense mutations in the A transferase

    Directory of Open Access Journals (Sweden)

    Chester M Alan

    2003-11-01

    Full Text Available Abstract Background Since the cloning in 1990 of cDNA corresponding to mRNA transcribed at the blood-group ABO locus, polymorphisms due to ethnic and/or phenotypic variations have been reported. Some subgroups have been explained at the molecular level, but unresolved samples are frequently encountered in the reference laboratory. Results ABO blood grouping discrepancies were investigated serologically and by ABO genotyping [duplex polymerase-chain-reaction (PCR – restriction-fragment-length-polymorphism (RFLP and PCR – allele-specific-primer (ASP across intron 6] and DNA sequencing of the ABO gene and its proposed regulatory elements. Blood samples from five individuals living in Portugal, Switzerland, Sweden and the USA were analysed. These individuals were confirmed to be of Black ethnic origin and had the unusual AweakB phenotype but appeared to have the A2B genotype without previously reported mutations associated with weak A or B expression. Sequencing of this A allele (having 467C>T and 1061delC associated with the common A2 [A201] allele revealed three mutations regularly encountered in the O1v [O02] allele: 106C>T (Val36Phe, 188G>A (Arg63His, 220C>T (Pro74Ser in exons 3, 4 and 5, respectively. The additional presence of 46G>A (Ala16Thr was noted, whilst 189C>T that normally accompanies 188G>A in O1v was missing, as were all O1v-related mutations in exons 6 and 7 (261delG, 297A>G, 646T>A, 681G>A, 771C>T and 829G>A. On screening other samples, 46G>A was absent, but two new O alleles were found, a Jordanian O1 and an African O1v allele having 188G>A but lacking 189C>T. Sequencing of introns 2, 3, 4 and 5 in common alleles (A1 [A101], A2, B [B101], O1, O1vand O2 [O03] revealed 7, 12, 17 and 8 polymorphic positions, respectively, suggesting that alleles could be defined by intronic sequences. These polymorphic sites allowed definition of a breakpoint in intron 5 where the O1v-related sequence was fused with A2 to form the new hybrid

  15. Genetic Variants of Intron Region of Aquaporin AQP5 Gene and Development of Pulmonary Edema in Lung Infection Complicated by Septic Shock

    Directory of Open Access Journals (Sweden)

    A. E. Myazin

    2016-01-01

    Full Text Available Purpose of the study. Determine the value of genetic variants of a single nucleotide polymorphic site rs3736309 of intron 3 of aquaporin5 (AQP5 gene in the course of critical illness in patients with documented pulmonary infection. Materials and methods. Patients with critical illness admitted to the intensive care units were examined during the course of treatment (n=86, age 27 to 82 years, mean age 53.20±14.34 years. Main diagnosis included malignancies (15%, peritonitis (16% and necrotizing pancreatitis (37%. Patients developed nosocomial pneumonia (55%, acute respiratory distress syndrome (ARDS (54%, septic shock (48%, ARDS combined with septic shock (33%. Bacterial species of Pseudomonas aeruginosa , Klebsiella pneumoniae, Acinetobacter baumannii, and/or Proteus mirabilis alone or in association were revealed in lavage fluid. DNA genotyping DNA was carried out using tetraprimer polymerase chain reaction (PCR. Statistical processing was performed using GraphPad InStat program (GraphPad, USA.Results. The distribution of frequencies of genotypes AA, GA and GG (AQP5, rs3736309 in cohort of patients corresponded to HardyWeinberg equilibrium (P=0.923 and was similar to frequencies of same alleles determined in a conditionally healthy Caucasian individuals (literature data (P>0.05. In a subgroup of patients with septic shock and AQP5 AA (rs3736309 genotype the lower EVLWI values were found compared to patients with genotypes GG and GA with septic shock in spite of the same approach to treatment. The differences between genetically different subgroups of patients with septic shock were maintained throughout the life of the survey (P<0.05,days 1, 3, 5 and 7. Genetic variant AQP5 G+ (rs3736309 contributed to the development of pulmonary edema resistant to treatment (odds ratio, OR = 6,75; P=0.032. Only the subgroup of patients with septic shock and genotype G + (but not all patients or the subgroup of patients without septic shock of the

  16. Replacement of Imu-Cmu intron by NeoR gene alters Imu germ-line expression but has no effect on V(D)J recombination.

    Science.gov (United States)

    Haddad, Dania; Dougier, Hei-Lanne; Laviolette, Nathalie; Puget, Nadine; Khamlichi, Ahmed Amine

    2010-02-01

    The NeoR gene has often been used to unravel the mechanisms underlying long-range interactions between promoters and enhancers during V(D)J assembly and class switch recombination (CSR) in the immunoglobulin heavy chain (IgH) locus. This approach led to the notion that CSR is regulated through competition of germ-line (GL) promoters for activities displayed by the 3' regulatory region (3'RR). This polarized long-range effect of the 3'RR is disturbed upon insertion of NeoR gene in the IgH constant (C(H)) region, where only GL transcription derived from upstream GL promoters is impaired. In the context of V(D)J recombination, replacement of Emu enhancer or Emu core enhancer (cEmu) by NeoR gene fully blocked V(D)J recombination and mu0 GL transcription which originates 5' of DQ52 and severely diminished Imu GL transcription derived from Emu/Imu promoter, suggesting a critical role for cEmu in the regulation of V(D)J recombination and of mu0 and Imu expression. Here we focus on the effect of NeoR gene on mu0 and Imu GL transcription in a mouse line in which the Imu-Cmu intron was replaced by a NeoR gene in the sense-orientation. B cell development was characterized by a marked but incomplete block at the pro-B cell stage. However, V(D)J recombination was unaffected in sorted pro-B and pre-B cells excluding an interference with the accessibility control function of Emu. mu0 GL transcription initiation was relatively normal but the maturation step seemed to be affected most likely through premature termination at NeoR polyadenylation sites. In contrast, Imu transcription initiation was impaired suggesting an interference of NeoR gene with the IgH enhancers that control Imu expression. Surprisingly, in stark contrast with the NeoR effect in the C(H) region, LPS-induced NeoR expression restored Imu transcript levels to normal. The data suggest that Emu enhancer may be the master control element that counteracts the down-regulatory "Neo effect" on Imu expression upon LPS

  17. An integrative genomic approach reveals coordinated expression of intronic miR-335, miR-342, and miR-561 with deregulated host genes in multiple myeloma.

    Science.gov (United States)

    Ronchetti, Domenica; Lionetti, Marta; Mosca, Laura; Agnelli, Luca; Andronache, Adrian; Fabris, Sonia; Deliliers, Giorgio Lambertenghi; Neri, Antonino

    2008-08-13

    The role of microRNAs (miRNAs) in multiple myeloma (MM) has yet to be fully elucidated. To identify miRNAs that are potentially deregulated in MM, we investigated those mapping within transcription units, based on evidence that intronic miRNAs are frequently coexpressed with their host genes. To this end, we monitored host transcript expression values in a panel of 20 human MM cell lines (HMCLs) and focused on transcripts whose expression varied significantly across the dataset. miRNA expression was quantified by Quantitative Real-Time PCR. Gene expression and genome profiling data were generated on Affymetrix oligonucleotide microarrays. Significant Analysis of Microarrays algorithm was used to investigate differentially expressed transcripts. Conventional statistics were used to test correlations for significance. Public libraries were queried to predict putative miRNA targets. We identified transcripts specific to six miRNA host genes (CCPG1, GULP1, EVL, TACSTD1, MEST, and TNIK) whose average changes in expression varied at least 2-fold from the mean of the examined dataset. We evaluated the expression levels of the corresponding intronic miRNAs and identified a significant correlation between the expression levels of MEST, EVL, and GULP1 and those of the corresponding miRNAs miR-335, miR-342-3p, and miR-561, respectively. Genome-wide profiling of the 20 HMCLs indicated that the increased expression of the three host genes and their corresponding intronic miRNAs was not correlated with local copy number variations. Notably, miRNAs and their host genes were overexpressed in a fraction of primary tumors with respect to normal plasma cells; however, this finding was not correlated with known molecular myeloma groups. The predicted putative miRNA targets and the transcriptional profiles associated with the primary tumors suggest that MEST/miR-335 and EVL/miR-342-3p may play a role in plasma cell homing and/or interactions with the bone marrow microenvironment. Our

  18. An integrative genomic approach reveals coordinated expression of intronic miR-335, miR-342, and miR-561 with deregulated host genes in multiple myeloma

    Directory of Open Access Journals (Sweden)

    Agnelli Luca

    2008-08-01

    Full Text Available Abstract Background The role of microRNAs (miRNAs in multiple myeloma (MM has yet to be fully elucidated. To identify miRNAs that are potentially deregulated in MM, we investigated those mapping within transcription units, based on evidence that intronic miRNAs are frequently coexpressed with their host genes. To this end, we monitored host transcript expression values in a panel of 20 human MM cell lines (HMCLs and focused on transcripts whose expression varied significantly across the dataset. Methods miRNA expression was quantified by Quantitative Real-Time PCR. Gene expression and genome profiling data were generated on Affymetrix oligonucleotide microarrays. Significant Analysis of Microarrays algorithm was used to investigate differentially expressed transcripts. Conventional statistics were used to test correlations for significance. Public libraries were queried to predict putative miRNA targets. Results We identified transcripts specific to six miRNA host genes (CCPG1, GULP1, EVL, TACSTD1, MEST, and TNIK whose average changes in expression varied at least 2-fold from the mean of the examined dataset. We evaluated the expression levels of the corresponding intronic miRNAs and identified a significant correlation between the expression levels of MEST, EVL, and GULP1 and those of the corresponding miRNAs miR-335, miR-342-3p, and miR-561, respectively. Genome-wide profiling of the 20 HMCLs indicated that the increased expression of the three host genes and their corresponding intronic miRNAs was not correlated with local copy number variations. Notably, miRNAs and their host genes were overexpressed in a fraction of primary tumors with respect to normal plasma cells; however, this finding was not correlated with known molecular myeloma groups. The predicted putative miRNA targets and the transcriptional profiles associated with the primary tumors suggest that MEST/miR-335 and EVL/miR-342-3p may play a role in plasma cell homing and

  19. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    Energy Technology Data Exchange (ETDEWEB)

    Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

  20. A novel intronic peroxisome proliferator-activated receptor gamma enhancer in the uncoupling protein (UCP) 3 gene as a regulator of both UCP2 and -3 expression in adipocytes

    DEFF Research Database (Denmark)

    Bugge, Anne Skovsø; Siersbaek, Majken; Madsen, Maria S

    2010-01-01

    homologues function to facilitate mitochondrial fatty acid oxidation. UCP2 and -3 expression is activated by the peroxisome proliferator-activated receptors (PPARs), but so far no PPAR response element has been reported in the vicinity of the Ucp2 and Ucp3 genes. Using genome-wide profiling of PPARgamma...... in the Ucp2 and Ucp3 loci is located in intron 1 of the Ucp3 gene and is the only site that facilitates PPARgamma transactivation of a heterologous promoter. This site furthermore transactivates the endogenous Ucp3 promoter, and using chromatin conformation capture we show that it loops out to specifically...

  1. Elevated levels of manna-binding lectin (MBL) and eosinophilia in patients of bronchial asthma with allergic rhinitis and allergic bronchopulmonary aspergillosis associated with a novel intronic polymorphism in MBL

    DEFF Research Database (Denmark)

    Kaur, S.; Gupta, G.K.; Shah, A.

    2006-01-01

    ) and allergic bronchopulmonary aspergillosis (APBA) (n = 11) and unrelated age-matched healthy controls of Indian origin (n = 84). A novel intronic SNP, G1011A of MBL, showed a significant association with both the patient groups in comparison to the controls (P ... being determined by genetic polymorphisms in its collagen region, we investigated the association of single nucleotide polymorphisms (SNPs) in the collagen region of human MBL with respiratory allergic diseases. The study groups comprised patients of bronchial asthma with allergic rhinitis (n = 49...... showed significantly higher plasma MBL levels and activity than those homozygous for the 1011G allele (P 1 s (FEV(1)) (P

  2. mCSF1, a nucleus-encoded CRM protein required for the processing of many mitochondrial introns, is involved in the biogenesis of respiratory complexes I and IV in Arabidopsis.

    Science.gov (United States)

    Zmudjak, Michal; Colas des Francs-Small, Catherine; Keren, Ido; Shaya, Felix; Belausov, Eduard; Small, Ian; Ostersetzer-Biran, Oren

    2013-07-01

    The coding regions of many mitochondrial genes in plants are interrupted by intervening sequences that are classified as group II introns. Their splicing is essential for the expression of the genes they interrupt and hence for respiratory function, and is facilitated by various protein cofactors. Despite the importance of these cofactors, only a few of them have been characterized. CRS1-YhbY domain (CRM) is a recently recognized RNA-binding domain that is present in several characterized splicing factors in plant chloroplasts. The Arabidopsis genome encodes 16 CRM proteins, but these are largely uncharacterized. Here, we analyzed the intracellular location of one of these hypothetical proteins in Arabidopsis, mitochondrial CAF-like splicing factor 1 (mCSF1; At4 g31010), and analyzed the growth phenotypes and organellar activities associated with mcsf1 mutants in plants. Our data indicated that mCSF1 resides within mitochondria and its functions are essential during embryogenesis. Mutant plants with reduced mCSF1 displayed inhibited germination and retarded growth phenotypes that were tightly associated with reduced complex I and IV activities. Analogously to the functions of plastid-localized CRM proteins, analysis of the RNA profiles in wildtype and mcsf1 plants showed that mCSF1 acts in the splicing of many of the group II intron RNAs in Arabidopsis mitochondria. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  3. COL5A1: Fine genetic mapping, intron/exon organization, and exclusion as candidate gene in families with tuberous sclerosis complex 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

    Energy Technology Data Exchange (ETDEWEB)

    Greenspan, D.S. [Univ. of Wisconsin, Madison, WI (United States); Papenberg, K.A.; Marchuk, D.A. [Duke Univ., Durham, NC (United States)] [and others

    1994-09-01

    Type V collagen is the only fibrillar collagen which has yet to be implicated in the pathogenesis of genetic diseases in humans or mice. To begin examining the possible role of type V collagen in genetic disease, we have previously mapped COL5A1, the gene for the {alpha}1 chain of type V collagen, to 9q23.2{r_arrow}q34.3 and described two restriction site polymorphisms which allowed us to exclude COL5A1 as candidate gene for nail-patella syndrome. We have now used these polymorphisms to exclude COL5A1 as candidate gene for tuberous sclerosis complex 1 and Ehlers-Danlos syndrome type II. In addition, we describe a CA repeat, with observed heterozygosity of about 0.5, in a COL5A1 intron, which has allowed us to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia and to place COL5A1 on the CEPH family genetic map between markers D9S66 and D9S67. We have also determined the entire intron/exon organization of COL5A1, which will facilitate characterization of mutations in genetic diseases with which COL5A1 may be linked in future studies.

  4. Chloroplast microsatellites and mitochondrial nad1 intron 2 sequences indicate congruent phylogenetic relationships among Swiss stone pine (Pinus cembra), Siberian stone pine (Pinus sibirica), and Siberian dwarf pine (Pinus pumila).

    Science.gov (United States)

    Gugerli, F; Senn, J; Anzidei, M; Madaghiele, A; Büchler, U; Sperisen, C; Vendramin, G G

    2001-06-01

    We studied the phylogenetic relationships among the three stone pine species, Pinus cembra, P. sibirica, and P. pumila, using chloroplast microsatellites and mitochondrial nad1 intron 2 sequences. The three chloroplast microsatellite loci combined into a total of 18 haplotypes. Fourteen haplotypes were detected in 15 populations of P. cembra and one population of P. sibirica, five of which were shared between the two species, and the two populations of P. pumila comprised four species-specific haplotypes. Mitochondrial intron sequences confirmed this grouping of species. Sequences of P. cembra and P. sibirica were identical, but P. pumila differed by several nucleotide substitutions and insertions/deletions. A repeat region found in the former two species showed no intraspecific variation. These results indicate a relatively recent evolutionary separation of P. cembra and P. sibirica, despite their currently disjunct distributions. The species-specific chloroplast and mitochondrial markers of P. sibirica and P. pumila should help to trace the hybridization in their overlapping distribution area and to identify fossil remains with respect to the still unresolved postglacial re-colonization history of these two species.

  5. A Bifunctional Intronic Element Regulates the Expression of the Arginine/Lysine Transporter Cat-1 via Mechanisms Involving the Purine-rich Element Binding Protein A (Purα)*

    Science.gov (United States)

    Huang, Charlie C.; Chiribau, Calin-Bogdan; Majumder, Mithu; Chiang, Cheng-Ming; Wek, Ronald C.; Kelm, Robert J.; Khalili, Kamel; Snider, Martin D.; Hatzoglou, Maria

    2009-01-01

    Expression of the arginine/lysine transporter Cat-1 is highly induced in proliferating and stressed cells via mechanisms that include transcriptional activation. A bifunctional INE (intronic element) within the first intron of the Cat-1 gene was identified and characterized in this study. The INE had high sequence homology to an amino acid response element and was shown to act as a transcriptional enhancer in unstressed cells by binding the transcription factor, purine-rich element binding protein A (Purα). During endoplasmic reticulum stress, binding of Purα to the INE decreased; the element acted as a positive regulator in early stress by binding of the transcription factor ATF4 and as a negative regulator in prolonged stress by binding the stress-induced C/EBP family member, CHOP. We conclude that transcriptional control of the Cat-1 gene is tightly controlled by multiple cis-DNA elements, contributing to regulation of cationic amino acid transport for cell growth and proliferation. In addition, we propose that genes may use stress-response elements such as the INE to support basal expression in the absence of stress. PMID:19720825

  6. A mutation at IVS1 + 5 of the von Hippel-Lindau gene resulting in intron retention in transcripts is not pathogenic in a patient with a tongue cancer?: case report

    Directory of Open Access Journals (Sweden)

    Asakawa Takeshi

    2012-03-01

    Full Text Available Abstract Background Von Hippel-Lindau disease (VHL is a dominantly inherited familial cancer syndrome predisposing the patient to a variety of malignant and benign neoplasms, most frequently hemangioblastoma, renal cell carcinoma, pheochromocytoma, and pancreatic tumors. VHL is caused by mutations of the VHL tumor suppressor gene on the short arm of chromosome 3, and clinical manifestations develop if both alleles are inactivated according to the two-hit hypothesis. VHL mutations are more frequent in the coding region and occur occasionally in the splicing region of the gene. Previously, we reported that the loss of heterozygosity (LOH of the VHL gene is common in squamous cell carcinoma tissues of the tongue. Case Presentation We describe a case of squamous cell carcinoma in the tongue caused by a point mutation in the splicing region of the VHL gene and discuss its association with VHL disease. Sequence analysis of DNA extracted from the tumor and peripheral blood of the patient with squamous cell carcinoma revealed a heterozygous germline mutation (c. 340 + 5 G > C in the splice donor sequence in intron 1 of the VHL gene. RT-PCR analysis of the exon1/intron1 junction in RNA from tumor tissue detected an unspliced transcript. Analysis of LOH using a marker with a heterozygous mutation of nucleotides (G or C revealed a deletion of the mutant C allele in the carcinoma tissues. Conclusions The fifth nucleotide G of the splice donor site of the VHL gene is important for the efficiency of splicing at that site. The development of tongue cancer in this patient was not associated with VHL disease because the mutation occurred in only a single allele of the VHL gene and that allele was deleted in tumor cells.

  7. A novel Rieske-type protein derived from an apoptosis-inducing factor-like (AIFL) transcript with a retained intron 4 induces change in mitochondrial morphology and growth arrest

    Energy Technology Data Exchange (ETDEWEB)

    Murata, Yasuhiko, E-mail: 97318@ib.k.u-tokyo.ac.jp [Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Furuyama, Isao; Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Mitani, Hiroshi, E-mail: mitani@k.u-tokyo.ac.jp [Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan)

    2011-04-01

    Highlights: {yields} A novel major transcript, AIFL-I4, is found. {yields} Nuclear localization of AIFL-I4 induces mitochondrial morphology change and suppression of cell proliferation. {yields} AIFL-I4 mutant with a lesion in [2Fe-2S] cluster binding site does not induce these phenotypes. {yields} [2Fe-2S] cluster binding site is essential for these phenotypes. -- Abstract: Apoptosis-inducing factor-like (AIFL) protein contains a Rieske domain and pyridine nucleotide-disulfide oxidoreductase (Pyr{sub r}edox) domain that shows 35% homology to that of apoptosis-inducing factor (AIF) protein. We identified a novel major transcript of the medaka (Oryzias latipes) AIFL gene that retained intron 4 (AIFL-I4) in embryos and tissues from adult fish. The product of this transcript, AIFL-I4 protein, lacked the Pyr{sub r}edox domain because of a nonsense codon in intron 4. Both AIFL-I4 and full-length AIFL (fAIFL) transcripts were highly expressed in the brain and late embryos, and relative fAIFL and AIFL-I4 expression levels differed among tissues. Transient expression of AIFL-I4 and fAIFL tagged with GFP showed that AIFL-I4 localized in the nucleus, while fAIFL localized throughout the cytoplasm. We also found that overexpression of AIFL-I4 induced a change in mitochondrial morphology and suppression of cell proliferation. AIFL-I4 mutant with a lesion in [2Fe-2S] cluster binding site of the Rieske domain did not induce these phenotypes. This report is the first to demonstrate nuclear localization of a Rieske-type protein translated from the AIFL gene. Our data suggested that the [2Fe-2S] cluster binding site was essential for the nuclear localization and involved in mitochondrial morphology and suppression of cell proliferation.

  8. Leu72Met and Other Intronic Polymorphisms in the and Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population

    Directory of Open Access Journals (Sweden)

    Faris Elbahi Joatar

    2017-09-01

    Full Text Available BackgroundGhrelin (GHRL, a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs, namely the Leu72Met polymorphism (rs696217 TG, with type 2 diabetes mellitus (T2DM and insulin resistance (IR, while others have not. The controversies in these associations raise the issue of ‘which SNPs in which populations.’ The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis.MethodsBlood was collected from 208 Saudi subjects with (n=107 and without (n=101 T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT and GHSR (rs509030 GC genes. In addition, plasma GHRL levels were measured by a radioimmunoassay.ResultsNone of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region.ConclusionNeither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR.

  9. Aberrant splicing in transgenes containing introns, exons, and V5 epitopes: lessons from developing an FSHD mouse model expressing a D4Z4 repeat with flanking genomic sequences.

    Science.gov (United States)

    Ansseau, Eugénie; Domire, Jacqueline S; Wallace, Lindsay M; Eidahl, Jocelyn O; Guckes, Susan M; Giesige, Carlee R; Pyne, Nettie K; Belayew, Alexandra; Harper, Scott Q

    2015-01-01

    The DUX4 gene, encoded within D4Z4 repeats on human chromosome 4q35, has recently emerged as a key factor in the pathogenic mechanisms underlying Facioscapulohumeral muscular dystrophy (FSHD). This recognition prompted development of animal models expressing the DUX4 open reading frame (ORF) alone or embedded within D4Z4 repeats. In the first published model, we used adeno-associated viral vectors (AAV) and strong viral control elements (CMV promoter, SV40 poly A) to demonstrate that the DUX4 cDNA caused dose-dependent toxicity in mouse muscles. As a follow-up, we designed a second generation of DUX4-expressing AAV vectors to more faithfully genocopy the FSHD-permissive D4Z4 repeat region located at 4q35. This new vector (called AAV.D4Z4.V5.pLAM) contained the D4Z4/DUX4 promoter region, a V5 epitope-tagged DUX4 ORF, and the natural 3' untranslated region (pLAM) harboring two small introns, DUX4 exons 2 and 3, and the non-canonical poly A signal required for stabilizing DUX4 mRNA in FSHD. AAV.D4Z4.V5.pLAM failed to recapitulate the robust pathology of our first generation vectors following delivery to mouse muscle. We found that the DUX4.V5 junction sequence created an unexpected splice donor in the pre-mRNA that was preferentially utilized to remove the V5 coding sequence and DUX4 stop codon, yielding non-functional DUX4 protein with 55 additional residues on its carboxyl-terminus. Importantly, we further found that aberrant splicing could occur in any expression construct containing a functional splice acceptor and sequences resembling minimal splice donors. Our findings represent an interesting case study with respect to AAV.D4Z4.V5.pLAM, but more broadly serve as a note of caution for designing constructs containing V5 epitope tags and/or transgenes with downstream introns and exons.

  10. Aberrant splicing in transgenes containing introns, exons, and V5 epitopes: lessons from developing an FSHD mouse model expressing a D4Z4 repeat with flanking genomic sequences.

    Directory of Open Access Journals (Sweden)

    Eugénie Ansseau

    Full Text Available The DUX4 gene, encoded within D4Z4 repeats on human chromosome 4q35, has recently emerged as a key factor in the pathogenic mechanisms underlying Facioscapulohumeral muscular dystrophy (FSHD. This recognition prompted development of animal models expressing the DUX4 open reading frame (ORF alone or embedded within D4Z4 repeats. In the first published model, we used adeno-associated viral vectors (AAV and strong viral control elements (CMV promoter, SV40 poly A to demonstrate that the DUX4 cDNA caused dose-dependent toxicity in mouse muscles. As a follow-up, we designed a second generation of DUX4-expressing AAV vectors to more faithfully genocopy the FSHD-permissive D4Z4 repeat region located at 4q35. This new vector (called AAV.D4Z4.V5.pLAM contained the D4Z4/DUX4 promoter region, a V5 epitope-tagged DUX4 ORF, and the natural 3' untranslated region (pLAM harboring two small introns, DUX4 exons 2 and 3, and the non-canonical poly A signal required for stabilizing DUX4 mRNA in FSHD. AAV.D4Z4.V5.pLAM failed to recapitulate the robust pathology of our first generation vectors following delivery to mouse muscle. We found that the DUX4.V5 junction sequence created an unexpected splice donor in the pre-mRNA that was preferentially utilized to remove the V5 coding sequence and DUX4 stop codon, yielding non-functional DUX4 protein with 55 additional residues on its carboxyl-terminus. Importantly, we further found that aberrant splicing could occur in any expression construct containing a functional splice acceptor and sequences resembling minimal splice donors. Our findings represent an interesting case study with respect to AAV.D4Z4.V5.pLAM, but more broadly serve as a note of caution for designing constructs containing V5 epitope tags and/or transgenes with downstream introns and exons.

  11. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    International Nuclear Information System (INIS)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S.; Brown, T.R.; Migeon, C.J.

    1989-01-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development

  12. A novel point mutation (G[sup [minus]1] to T) in a 5[prime] splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker Muscular Dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Hagiwara, Yoko; Nishio, Hisahide; Kitoh, Yoshihiko; Takeshima, Yasuhiro; Narita, Naoko; Wada, Hiroko; Yokoyama, Mitsuhiro; Nakamura, Hajime; Matsuo, Masafumi (Kobe Univ. School of Medicine (Japan))

    1994-01-01

    The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. The authors now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5[prime] splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophin lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5[prime] splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G[sup [minus]1]-to-T mutation at the 5[prime] splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. 48 refs., 5 figs.

  13. Single nucleotide polymorphism (SNP discovery in duplicated genomes: intron-primed exon-crossing (IPEC as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar and other salmonid fishes

    Directory of Open Access Journals (Sweden)

    Primmer Craig R

    2006-07-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp. The SNP frequency and the overall nucleotide diversity (3.99 × 10-4 in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases.

  14. The Ia-2β intronic miRNA, miR-153, is a negative regulator of insulin and dopamine secretion through its effect on the Cacna1c gene in mice.

    Science.gov (United States)

    Xu, Huanyu; Abuhatzira, Liron; Carmona, Gilberto N; Vadrevu, Suryakiran; Satin, Leslie S; Notkins, Abner L

    2015-10-01

    miR-153 is an intronic miRNA embedded in the genes that encode IA-2 (also known as PTPRN) and IA-2β (also known as PTPRN2). Islet antigen (IA)-2 and IA-2β are major autoantigens in type 1 diabetes and are important transmembrane proteins in dense core and synaptic vesicles. miR-153 and its host genes are co-regulated in pancreas and brain. The present experiments were initiated to decipher the regulatory network between miR-153 and its host gene Ia-2β (also known as Ptprn2). Insulin secretion was determined by ELISA. Identification of miRNA targets was assessed using luciferase assays and by quantitative real-time PCR and western blots in vitro and in vivo. Target protector was also employed to evaluate miRNA target function. Functional studies revealed that miR-153 mimic suppresses both glucose- and potassium-induced insulin secretion (GSIS and PSIS, respectively), whereas miR-153 inhibitor enhances both GSIS and PSIS. A similar effect on dopamine secretion also was observed. Using miRNA target prediction software, we found that miR-153 is predicted to target the 3'UTR region of the calcium channel gene, Cacna1c. Further studies confirmed that Cacna1c mRNA and protein are downregulated by miR-153 mimics and upregulated by miR-153 inhibitors in insulin-secreting freshly isolated mouse islets, in the insulin-secreting mouse cell line MIN6 and in the dopamine-secreting cell line PC12. miR-153 is a negative regulator of both insulin and dopamine secretion through its effect on Cacna1c expression, which suggests that IA-2β and miR-153 have opposite functional effects on the secretory pathway.

  15. A novel intronic splice site deletion of the IL-2 receptor common gamma chain results in expression of a dysfunctional protein and T-cell-positive X-linked Severe combined immunodeficiency.

    Science.gov (United States)

    Gray, P E A; Logan, G J; Alexander, I E; Poulton, S; Roscioli, T; Ziegler, J

    2015-02-01

    X-linked severe combined immunodeficiency is caused by mutations in the IL-2 receptor common gamma chain and classically presents in the first 6 months of life with predisposition to bacterial, viral and fungal infections. In most instances, affected individuals are lymphopenic with near complete absence of T cells and NK cells. We report a boy who presented at 12 months of age with Pneumocystis jiroveci pneumonia and a family history consistent with X-linked recessive inheritance. He had a normal lymphocyte count including the presence of T cells and a broad T-cell-receptor diversity, as well as normal surface expression of the common gamma chain (CD132) protein. He however had profound hypogammaglobulinaemia, and IL-2-induced STAT5 phosphorylation was absent. Sequencing of IL-2RG demonstrated a 12-base pair intronic deletion close to the canonical splice site of exon 5, which resulted in a variety of truncated IL2RG mRNA species. A review of the literature identified 4 other patients with T-cell-positive X-SCID, with the current patient being the first associated with an mRNA splicing defect. This case raises the question of how a dysfunctional protein incapable of mediating STAT5 phosphorylation might nonetheless support T-cell development. Possible explanations are that STAT5-mediated signal transduction may be less relevant to IL7-receptor-mediated T-cell development than are other IL7R-induced intracellular transduction pathways or that a low level of STAT5 phosphorylation, undetectable in the laboratory, may be sufficient to support some T-cell development. © 2014 John Wiley & Sons Ltd.

  16. Peginterferon Alfa-2b (PEG-Intron)

    Science.gov (United States)

    ... 2b injection pen, follow these steps: Take the carton containing the injection pen out of the refrigerator ... temperature. Check the expiration date printed on the carton, and do not use the carton if the ...

  17. The STR polymorphism (AAAATn within the intron 1 of the tumor protein 53 (TP53 locus in 17 populations of different ethnic groups of Africa, America, Asia and Europe

    Directory of Open Access Journals (Sweden)

    Jorge Azofeifa

    2004-09-01

    Full Text Available The STR (AAAATn within intron 1 of the TP53 locus was screened in 17 populations from 3 main ethnic groups: Europeans, Asiatics, and Africans, and from the hybrid population of Costa Rica (1968 samples. Three alleles, 126/7 (bp/copies of the repeat, 131/8 and 136/9 were the most prevalent in all populations. Other alleles rarely reached frequencies of 10% or higher. Observed heterozygosities ranged between 0.351 and 0.829. Patterns of diversity fit well with both the geographic origin of the samples and the history of the populations screened. A statistical test suggests that single-step mutational events have been the main mechanism producing new alleles at this locus. Fixation indexes (R ST for this marker showed an effect of population subdivision on divergence only within the Asiatic group; they were insensitive at the level of major ethnic groups as well as within Africans and within Europeans. Rev. Biol. Trop. 52(3: 645-657. Epub 2004 Dic 15.Se estudió el polimorfismo del microsatélite (AAAATn del intrón 1 del gene TP53 en 17 poblaciones de 3 grupos étnicos: europeos, asiáticos, y africanos subsaharianos, así como de la población híbrida de Costa Rica (en total 1968 muestras. Tres alelos, 126/7 (pares de bases/ copias de la repetición, 131/8 y 136/9 fueron los más frecuentes en todas las poblaciones, aunque se observaron otros alelos usualmente a frecuencias menores al 10%. Las heterocigosis observadas variaron de 0.351 a 0.829. La distribución de la diversidad parece concordar con el origen geográfico de las muestras y con la historia de las poblaciones estudiadas. Una prueba estadística indica que el evento mutacional que más alelos nuevos produce en este marcador es el de un solo paso (expansión o contracción de una sola copia de la repetición. El índice de fijación R ST mostró los efectos de la subdivision de poblaciones sólo dentro del grupo de los asiáticos y mostró falta de sensibilidad cuando los grupos

  18. Double-target Antisense U1snRNAs Correct Mis-splicing Due to c.639+861C>T and c.639+919G>A GLA Deep Intronic Mutations

    Directory of Open Access Journals (Sweden)

    Lorenzo Ferri

    2016-01-01

    Full Text Available Fabry disease is a rare X-linked lysosomal storage disorder caused by deficiency of the α-galactosidase A (α-Gal A enzyme, which is encoded by the GLA gene. GLA transcription in humans produces a major mRNA encoding α-Gal A and a minor mRNA of unknown function, which retains a 57-nucleotide-long cryptic exon between exons 4 and 5, bearing a premature termination codon. NM_000169.2:c.639+861C>T and NM_000169.2:c.639+919G>A GLA deep intronic mutations have been described to cause Fabry disease by inducing overexpression of the alternatively spliced mRNA, along with a dramatic decrease in the major one. Here, we built a wild-type GLA minigene and two minigenes that carry mutations c.639+861C>T and c.639+919G>A. Once transfected into cells, the minigenes recapitulate the molecular patterns observed in patients, at the mRNA, protein, and enzymatic level. We constructed a set of specific double-target U1asRNAs to correct c.639+861C>T and c.639+919G>A GLA mutations. Efficacy of U1asRNAs in inducing the skipping of the cryptic exon was evaluated upon their transient co-transfection with the minigenes in COS-1 cells, by real-time polymerase chain reaction (PCR, western blot analysis, and α-Gal A enzyme assay. We identified a set of U1asRNAs that efficiently restored α-Gal A enzyme activity and the correct splicing pathways in reporter minigenes. We also identified a unique U1asRNA correcting both mutations as efficently as the mutation-specific U1asRNAs. Our study proves that an exon skipping-based approach recovering α-Gal A activity in the c.639+861C>T and c.639+919G>A GLA mutations is active.

  19. Highly efficient expression of interleukin-2 under the control of rabbit β-globin intron II gene enhances protective immune responses of porcine reproductive and respiratory syndrome (PRRS DNA vaccine in pigs.

    Directory of Open Access Journals (Sweden)

    Yijun Du

    Full Text Available Highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV had caused catastrophic losses in swine industry in China. The current inactivated vaccine provided only limited protection, and the attenuated live vaccine could protect piglets against the HP-PRRSV but there was a possibility that the attenuated virus returned to high virulence. In this study, the eukaryotic expression vector pVAX1© was modified under the control of rabbit β-globin intron II gene and the modified vector pMVAX1© was constructed. Porcine interleukin-2 (IL-2 and GP3-GP5 fusion protein of HP-PRRSV strain SD-JN were highly expressed by pMVAX1©. Mice inoculated with pMVAX1©-GP35 developed significantly higher PRRSV-specific antibody responses and T cell proliferation than those vaccinated with pVAX1©-GP35. pMVAX1©-GP35 was selected as PRRS DNA vaccine candidate and co-administrated with pVAX1©-IL-2 or pMVAX1©-IL-2 in pigs. pMVAX1©-IL-2+pMVAX1©-GP35 could provide enhanced PRRSV-specific antibody responses, T cell proliferation, Th1-type and Th2-type cytokine responses and CTL responses than pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35. Following homologous challenge with HP-PRRSV strain SD-JN, similar with attenuated PRRS vaccine group, pigs inoculated with pMVAX1©-IL-2+pMVAX1©-GP35 showed no clinical signs, almost no lung lesions and no viremia, as compared to those in pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35 groups. It indicated that pMVAX1©-IL-2 effectively increases humoral and cell mediated immune responses of pMVAX1©-GP35. Co-administration of pMVAX1©-IL-2 and pMVAX1©-GP35 might be attractive candidate vaccines for preventing HP-PRRSV infections.

  20. Highly efficient expression of interleukin-2 under the control of rabbit β-globin intron II gene enhances protective immune responses of porcine reproductive and respiratory syndrome (PRRS) DNA vaccine in pigs.

    Science.gov (United States)

    Du, Yijun; Lu, Yu; Wang, Xinglong; Qi, Jing; Liu, Jiyu; Hu, Yue; Li, Feng; Wu, Jiaqiang; Guo, Lihui; Liu, Junzhen; Tao, Haiying; Sun, Wenbo; Chen, Lei; Cong, Xiaoyan; Ren, Sufang; Shi, Jianli; Li, Jun; Wang, Jinbao; Huang, Baohua; Wan, Renzhong

    2014-01-01

    Highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) had caused catastrophic losses in swine industry in China. The current inactivated vaccine provided only limited protection, and the attenuated live vaccine could protect piglets against the HP-PRRSV but there was a possibility that the attenuated virus returned to high virulence. In this study, the eukaryotic expression vector pVAX1© was modified under the control of rabbit β-globin intron II gene and the modified vector pMVAX1© was constructed. Porcine interleukin-2 (IL-2) and GP3-GP5 fusion protein of HP-PRRSV strain SD-JN were highly expressed by pMVAX1©. Mice inoculated with pMVAX1©-GP35 developed significantly higher PRRSV-specific antibody responses and T cell proliferation than those vaccinated with pVAX1©-GP35. pMVAX1©-GP35 was selected as PRRS DNA vaccine candidate and co-administrated with pVAX1©-IL-2 or pMVAX1©-IL-2 in pigs. pMVAX1©-IL-2+pMVAX1©-GP35 could provide enhanced PRRSV-specific antibody responses, T cell proliferation, Th1-type and Th2-type cytokine responses and CTL responses than pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35. Following homologous challenge with HP-PRRSV strain SD-JN, similar with attenuated PRRS vaccine group, pigs inoculated with pMVAX1©-IL-2+pMVAX1©-GP35 showed no clinical signs, almost no lung lesions and no viremia, as compared to those in pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35 groups. It indicated that pMVAX1©-IL-2 effectively increases humoral and cell mediated immune responses of pMVAX1©-GP35. Co-administration of pMVAX1©-IL-2 and pMVAX1©-GP35 might be attractive candidate vaccines for preventing HP-PRRSV infections.

  1. Mutations in intron 1 and intron 22 inversion negative haemophilia A patients from Western India.

    Directory of Open Access Journals (Sweden)

    Preethi S Nair

    Full Text Available Despite increased awareness and diagnostic facilities, 70-80% of the haemophilia A (HA patients still remain undiagnosed in India. Very little data is available on prevalent mutations in HA from this country. We report fifty mutations in seventy one Indian HA patients, of which twenty were novel. Ten novel missense mutations [p.Leu11Pro (p.Leu-8Pro, p.Tyr155Ser (p.Tyr136Ser, p.Ile405Thr (p.Ile386Thr, p.Gly582Val (p.Gly563Val p.Thr696Ile (p.Thr677Ile, p.Tyr737Cys (p.Tyr718Cys, p.Pro1999Arg (p.Pro1980Arg, p.Ser2082Thr (p.Ser2063Thr, p.Leu2197Trp (p.Leu2178Trp, p.Asp2317Glu (p.Asp2298Glu] two nonsense [p.Lys396* (p.Lys377*, p.Ser2205* (p.Ser2186*], one insertion [p.Glu1268_Asp1269ins (p.Glu1249_Asp1250] and seven deletions [p.Leu882del (p.Leu863del, p.Met701del (p.Met682del, p.Leu1223del (p.Leu1204del, p.Trp1961_Tyr1962del (p.Trp1942_Tyr1943del p.Glu1988del (p.Glu1969del, p.His1841del (p.His1822del, p.Ser2205del (p.Ser2186del] were identified. Double mutations (p.Asp2317Glu; p.Thr696Ile were observed in a moderate HA case. Mutations [p. Arg612Cys (p.Arg593Cys, p.Arg2326Gln (p.Arg2307Gln] known to be predisposing to inhibitors to factor VIII (FVIII were identified in two patients. 4.6% of the cases were found to be cross reacting material positive (CRM+ve. A wide heterogeneity in the nature of mutations was seen in the present study which has been successfully used for carrier detection and antenatal diagnosis in 10 families affected with severe to moderate HA.

  2. Efecto del Polimorfismo del Intrón 6 del Gen LTF Bovino con Algunas Enfermedades de Alta Incidencia en la Producción Lechera Effect of the Polymorphism in the Intron 6 of the Bovine LTF Gene with Some Diseases of High Incidence in Dairy Production

    Directory of Open Access Journals (Sweden)

    Nancy Rodríguez Colorado

    2012-06-01

    Full Text Available Resumen. El objetivo de la investigación fue determinar la asociación del polimorfismo (C/T del intrón 6 del gen de la bLTF, con la incidencia de algunas enfermedades en ganado lechero. Para ello fueron observadas 482 vacas Holstein, durante al menos una lactancia, determinando la incidencia de algunas de las enfermedades mas importantes en la ganaderia de leche. La genotipificación para el polimorfismo de bLTF, se hizo usando la técnica de PCR-RFLP con DNA extraído de sangre periférica mediante la técnica de salting out. Para estudiar la asociación de los alelos del gen LTF, se utilizó el alelo B como control y se determinó el Odds Ratio (OR. Como resultados se obtiene que las frecuencias de los alelos A y B para el gen bLTF fueron 0,78 y 0,22 respectivamente. Las frecuencias genotípicas fueron 0,60, 0,36 y 0,04 para AA, AB y BB respectivamente. Una asociación altamente significativa (P≤0,001 fue hallada entre la incidencia de mastitis clínica y el polimorfismo del gen LTF. Los individuos portadores del alelo B tuvieron una probabilidad de incidencia de mastitis dos veces superior a los portadores del alelo A (OR=2.115 IC del 95%, 1.392-3.213. En el caso de la mastitis subclínica la probabilidad de incidencia fue de 1,6 veces más en los portadores del alelo B, con un OR=1.637 IC del 95% 1.184-2.264. Para la incidencia de enfermedades metabólicas, reproductivas, respiratorias, parasitarias, cáncer y cojeras, no se halló diferencia significativa (P>0,05 y se encontró asociación del alelo B del polimorfismo del intrón 6 del gen bLTF con la incidencia de mastitis clínica y subclínica.Abstract. The research objective was to determine the association of polymorphism (C/T of intron 6 bLTF gene, with the incidence of some diseases on dairy cattle. A total of 482 Holstein cows located in different herds in the department of Antioquia - Colombia, were used to follow the incidence of disease, for at least a full lactation

  3. Characteristics of binding sites of intergenic, intronic and exonic ...

    African Journals Online (AJOL)

    user

    2013-03-06

    2005). DTL. Denticleless homolog (Drosophila). Baraniskin et al. (2012). EBF3. Early B-cell factor 3. Kim and Kim (2007). EGFL7. EGF-like-domain, multiple 7. Díaz et al. (2008). EIF4H. Eukaryotic translation initiation factor 4H.

  4. (rpS16) intron sequences in Morus (Urticales: Moraceae)

    African Journals Online (AJOL)

    In this study, the chloroplast rps16 sequence variation of Morus was examined. Sequence data were obtained from 18 mulberry individuals belonging to 13 species and three varieties, and two accessions of Broussonetia papyrifera and Ficus carica of the related Moraceae, designed as outgroup were analyzed.

  5. A comparative study of group-I intron struct

    Indian Academy of Sciences (India)

    Unknown

    Tetrahymena thermophila. Tetrahymena malaccensis. Tetrahymena cosmopolitanis. Tetrahymena hyperangularis. Tetrahymena pigmentosa. Physarum polycephalum. Acanthamoeba griffini. Dunaliella parva i2. Dunaliella parva i1. Dunaliella salina. Chlorella mirabilis. -. Chlorella ellipsiodea IAM 87. Chlorella ellipsiodea ...

  6. Allelic prevalence of intron 3 insertion/deletion genetic ...

    African Journals Online (AJOL)

    Leila Fallahzadeh-Abarghooei

    2015-03-18

    Mar 18, 2015 ... genetic polymorphism of DNA double-strand break repair gene XRCC4 in four healthy Iranian populations. Leila Fallahzadeh-Abarghooei, Tahereh Zahedi, Farkhonde Mirabedi,. Mostafa Saadat *. Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran. Received 12 January 2015; ...

  7. Analysis of Claviceps africana and C. sorghi from India using AFLPs, EF-1alfa gene intron 4, and Beta-tubulin gene intron 3

    Czech Academy of Sciences Publication Activity Database

    Tooley, P. W.; Bandyopadhyay, R.; Carras, M. M.; Pažoutová, Sylvie

    2006-01-01

    Roč. 101, č. 4 (2006), s. 441-451 ISSN 0953-7562 Institutional research plan: CEZ:AV0Z50200510 Keywords : clavicipitaceae * coevolution * ergot Subject RIV: EE - Microbiology, Virology Impact factor: 1.860, year: 2006

  8. WRN mutations in Werner syndrome patients : genomic rearrangements, unusual intronic mutations and ethnic-specific alterations

    NARCIS (Netherlands)

    Friedrich, Katrin; Lee, Lin; Leistritz, Dru F.; Nuernberg, Gudrun; Saha, Bidisha; Hisama, Fuki M.; Eyman, Daniel K.; Lessel, Davor; Nuernberg, Peter; Li, Chumei; Garcia-F-Villalta, Maria J.; Kets, Carolien M.; Schmidtke, Joerg; Cruz, Vitor Tedim; Van den Akker, Peter C.; Boak, Joseph; Peter, Dincy; Compoginis, Goli; Cefle, Kivanc; Ozturk, Sukru; Lopez, Norberto; Wessel, Theda; Poot, Martin; Ippel, P. F.; Groff-Kellermann, Birgit; Hoehn, Holger; Martin, George M.; Kubisch, Christian; Oshima, Junko

    Werner syndrome (WS) is an autosomal recessive segmental progeroid syndrome caused by null mutations at the WRN locus, which codes for a member of the RecQ family of DNA helicases. Since 1988, the International Registry of Werner syndrome had enrolled 130 molecularly confirmed WS cases from among

  9. An Intronic MBTPS2 Variant Results in a Splicing Defect in Horses with Brindle Coat Texture.

    OpenAIRE

    Murgiano Leonardo; Dominik P. Waluk; Rachel Towers; Natalie Wiedemar; Joëlle Dietrich; Vidhya Jagannathan; Michaela Drögemüller; Pierre Balmer; Tom Druet; Arnaud Galichet; M. Cecilia Penedo; Eliane J. Müller; Petra Roosje; Welle Monika; Tosso Leeb

    2016-01-01

    We investigated a family of horses exhibiting irregular vertical stripes in their hair coat texture along the neck, back, hindquarters, and upper legs. This phenotype is termed "brindle" by horse breeders. We propose the term "brindle 1 (BR1)" for this specific form of brindle. In some BR1 horses, the stripes were also differentially pigmented. Pedigree analyses were suggestive of a monogenic X-chromosomal semidominant mode of inheritance. Haplotype analyses identified a 5 Mb candidate region...

  10. Identification and association of SNP in intron 1 in the growth ...

    African Journals Online (AJOL)

    Ahmed

    (http://biotools.umassmed.edu/bioapps/primer3_www.cgi). The gene from -44 bp upstream of the first exon to +37 bp downstream of the last exon was analyzed. The primer sequences, location and size of the amplified fragments are shown in Table (1). PCR was performed in a reaction volume of 25 µL using 100 ng of DNA ...

  11. The splicing factor ASF/SF2 and intron retention as markers of endothelial senescence

    Directory of Open Access Journals (Sweden)

    Francisco Javier Blanco

    2012-03-01

    Full Text Available Aging is the major risk factor per se for the development of cardiovascular diseases. The senescence of endothelial cells, that line the lumen of blood vessels, is at the cellular basis of these age-dependent vascular pathologies, including atherosclerosis and hypertension. Along their lifespan, endothelial cells may reach the senescence stage by two different pathways, the replicative one derived from their finite number of divisions, and the one induced by stress stimuli. Also, certain physiological stimuli, such as TGF-β are able to modulate cellular senescence. Currently, the cellular aging process is being widely studied to identify novel molecular markers whose changes correlate with senescence. This review focuses on the regulation of alternative splicing mediated by the serine-arginine splicing factor 1 (SRSF1, or ASF/SF2 during endothelial senescence, a process that is associated with a differential subcellular localization of SRSF1, showing a scattered distribution throughout the cytoplasm. Based on its senescence-dependent involvement in alternative splicing, we postulate that SRSF1 is a key marker of endothelial cell senescence regulating the expression of alternative isoforms of target genes such as ENG, VEGFA, T3 or LMNA that integrate a common molecular senescence program.

  12. Analysis of chloroplast ribosomal subunit S16 (rpS16) intron ...

    African Journals Online (AJOL)

    use

    2011-12-05

    Dec 5, 2011 ... In this study, the chloroplast rps16 sequence variation of Morus was examined. Sequence data were obtained from 18 mulberry individuals belonging to 13 species and three varieties, and two accessions of Broussonetia papyrifera and Ficus carica of the related Moraceae, designed as outgroup were.

  13. Human obesity associated with an intronic SNP in the brain-derived neurotrophic factor locus

    Science.gov (United States)

    Brain-derived neurotrophic factor (BDNF) plays a key role in energy balance. In population studies, SNPs of the BDNF locus have been linked to obesity, but the mechanism by which these variants cause weight gain is unknown. Here, we examined human hypothalamic BDNF expression in association with 44 ...

  14. Intronic sequences are required for AINTEGUMENTA-LIKE6 expression in Arabidopsis flowers

    OpenAIRE

    Krizek, Beth A.

    2015-01-01

    Background The AINTEGUMENTA-LIKE6/PLETHORA3 (AIL6/PLT3) gene of Arabidopsis thaliana is a key regulator of growth and patterning in both shoots and roots. AIL6 encodes an AINTEGUMENTA-LIKE/PLETHORA (AIL/PLT) transcription factor that is expressed in the root stem cell niche, the peripheral region of the shoot apical meristem and young lateral organ primordia. In flowers, AIL6 acts redundantly with AINTEGUMENTA (ANT) to regulate floral organ positioning, growth, identity and patterning. Experi...

  15. Revised Mimivirus major capsid protein sequence reveals intron-containing gene structure and extra domain

    Directory of Open Access Journals (Sweden)

    Suzan-Monti Marie

    2009-05-01

    Full Text Available Abstract Background Acanthamoebae polyphaga Mimivirus (APM is the largest known dsDNA virus. The viral particle has a nearly icosahedral structure with an internal capsid shell surrounded with a dense layer of fibrils. A Capsid protein sequence, D13L, was deduced from the APM L425 coding gene and was shown to be the most abundant protein found within the viral particle. However this protein remained poorly characterised until now. A revised protein sequence deposited in a database suggested an additional N-terminal stretch of 142 amino acids missing from the original deduced sequence. This result led us to investigate the L425 gene structure and the biochemical properties of the complete APM major Capsid protein. Results This study describes the full length 3430 bp Capsid coding gene and characterises the 593 amino acids long corresponding Capsid protein 1. The recombinant full length protein allowed the production of a specific monoclonal antibody able to detect the Capsid protein 1 within the viral particle. This protein appeared to be post-translationnally modified by glycosylation and phosphorylation. We proposed a secondary structure prediction of APM Capsid protein 1 compared to the Capsid protein structure of Paramecium Bursaria Chlorella Virus 1, another member of the Nucleo-Cytoplasmic Large DNA virus family. Conclusion The characterisation of the full length L425 Capsid coding gene of Acanthamoebae polyphaga Mimivirus provides new insights into the structure of the main Capsid protein. The production of a full length recombinant protein will be useful for further structural studies.

  16. Association of the NOS3 intron-4 VNTR polymorphism with aneurysmal subarachnoid hemorrhage

    DEFF Research Database (Denmark)

    Staalsø, Jonatan Myrup; Edsen, Troels; Kotinis, Alexandros

    2014-01-01

    OBJECT: The nitric oxide system has been linked to the pathogenesis of aneurysmal subarachnoid hemorrhage (SAH). The authors performed a case-control study to investigate the association between SAH and common genetic variants within the endothelial nitric oxide synthase gene (NOS3). METHODS: Three...

  17. Molecular differentiation of Russian wild ginseng using mitochondrial nad7 intron 3 region

    Directory of Open Access Journals (Sweden)

    Guisheng Li

    2017-07-01

    Conclusion: An effective DNA method for molecular discrimination of Russian wild ginseng from Chinese and Korean cultivated ginseng was developed. The established real-time allele-specific PCR was simple and reliable, and the present method should be a crucial complement of chemical analysis for authentication of Russian wild ginseng.

  18. molecular analysis of intron-1 mutation in β-Globin gene of β-Thalassemia

    International Nuclear Information System (INIS)

    Kamel, S.A.L.M.

    2004-01-01

    β-thalassemia is considered the most common genetic disorder worldwide, it occurs in a particularly high frequency in abroad belt extending from the mediterranean basin through the middle east, and abundance in egypt. the thalassemias are a group of genetic (inherited) blood disorders that share in common one feature, the defective production of hemoglobin. there are many different disorders with defective hemoglobin synthesis and, hence, many types of thalassemia. about 3% of the world's population (180 million people) carry β-thalassemia genes.the present study was carried out in the biological application department of nuclear research center, atomic energy authority and microbiology department and hematology unit of pediatrics department, faculty of medicine, Zagazig University

  19. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    The extrachromosomal rDNA molecules from a number of Tetrahymena strains were characterized by restriction enzyme mapping using three different restriction enzymes combined with gel blotting and hybridization analysis. Strains from four out of six recently described species were found to contain...

  20. Insertion of Introns: A Strategy to Facilitate Assembly of Infectious Full Length Clones

    DEFF Research Database (Denmark)

    Johansen, Ida Elisabeth; Lund, Ole Søgaard

    2008-01-01

    Some DNA fragments are difficult to clone in Escherichia coli by standard methods. It has been speculated that unintended transcription and translation result in expression of proteins that are toxic to the bacteria. This problem is frequently observed during assembly of infectious full-length vi......Some DNA fragments are difficult to clone in Escherichia coli by standard methods. It has been speculated that unintended transcription and translation result in expression of proteins that are toxic to the bacteria. This problem is frequently observed during assembly of infectious full...... the virus sequence in the plant nucleus. The resulting RNA, which enters the cytoplasm, is identical to the virus sequence and can initiate infection...

  1. Actina de Paramecium tetraurelia : una actina no convencional que contiene cortos intrones

    OpenAIRE

    Díaz Ramos, Corín

    1998-01-01

    Los ciliados constituyen un grupo de ecuariotas unicelulares entre los que existe una gran distancia genética. Los estudios realizados en la actina de estos organismos son escasos e indican que esta proteína no presenta muchas de las características de la

  2. Human Obesity Associated with an Intronic SNP in the Brain-Derived Neurotrophic Factor Locus

    Directory of Open Access Journals (Sweden)

    Zongyang Mou

    2015-11-01

    Full Text Available Brain-derived neurotrophic factor (BDNF plays a key role in energy balance. In population studies, SNPs of the BDNF locus have been linked to obesity, but the mechanism by which these variants cause weight gain is unknown. Here, we examined human hypothalamic BDNF expression in association with 44 BDNF SNPs. We observed that the minor C allele of rs12291063 is associated with lower human ventromedial hypothalamic BDNF expression (p < 0.001 and greater adiposity in both adult and pediatric cohorts (p values < 0.05. We further demonstrated that the major T allele for rs12291063 possesses a binding capacity for the transcriptional regulator, heterogeneous nuclear ribonucleoprotein D0B, knockdown of which disrupts transactivation by the T allele. Binding and transactivation functions are both disrupted by substituting C for T. These findings provide a rationale for BDNF augmentation as a targeted treatment for obesity in individuals who have the rs12291063 CC genotype.

  3. Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients

    DEFF Research Database (Denmark)

    Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J

    2013-01-01

    Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomic...

  4. An intron splice acceptor polymorphism in hMSH2 and risk of leukemia after treatment with chemotherapeutic alkylating agents.

    Science.gov (United States)

    Worrillow, Lisa J; Travis, Lois B; Smith, Alexandra G; Rollinson, Sara; Smith, Andrew J; Wild, Christopher P; Holowaty, Eric J; Kohler, Betsy A; Wiklund, Tom; Pukkala, Eero; Roman, Eve; Morgan, Gareth J; Allan, James M

    2003-08-01

    We sought to determine whether the -6 exon 13 T>C polymorphism in the DNA mismatch repair gene hMSH2 modulates susceptibility to acute myeloid leukemia after therapy and particularly after O(6)-guanine alkylating chemotherapy. We also determined the extent of microsatellite instability (MSI) in therapy-related acute myeloid leukemia (t-AML) as a marker of dysfunctional DNA mismatch repair. Using a novel restriction fragment length polymorphism, verified by direct sequencing, we have genotyped 91 t-AML cases, 420 de novo acute myeloid leukemia cases, and 837 controls for the hMSH2 -6 exon 13 polymorphism. MSI was evaluated in presentation bone marrow from 34 cases using the mononucleotide microsatellite markers BAT16, BAT25, and BAT26. Distribution of the hMSH2 -6 exon 13 polymorphism was not significantly different between de novo acute myeloid leukemia cases and controls, with heterozygotes and homozygotes for the variant (C) allele representing 12.2 and 1.6%, respectively, of the control population. However, the variant (C) hMSH2 allele was significantly overrepresented in t-AML cases that had previously been treated with O(6)-guanine alkylating agents, including cyclophosphamide and procarbazine, compared with controls (odds ratio, 4.02; 95% confidence interval, 1.40-11.37). Thirteen of 34 (38%) t-AML cases were MSI positive, and 2 of these 13 cases were homozygous for the variant (C) allele, a frequency substantially higher than in the control population. Association of the hMSH2 -6 exon 13 variant (C) allele with leukemia after O(6)-guanine alkylating agents implicates this allele in conferring a nondisabling DNA mismatch repair defect with concomitant moderate alkylation tolerance, which predisposes to the development of t-AML via the induction of DNA mismatch repair-disabling mutations and high-grade MSI. Homozygosity for the hMSH2 variant in 2 of 13 MSI-positive t-AML cases provides some support for this model.

  5. Understanding RNA flexibility using explicit solvent simulations: The ribosomal and group I intron reverse kink-turn motifs

    Czech Academy of Sciences Publication Activity Database

    Sklenovský, P.; Florová, P.; Banáš, P.; Réblová, Kamila; Lankaš, Filip; Otyepka, M.; Šponer, Jiří

    2011-01-01

    Roč. 7, č. 9 (2011), s. 2963-2980 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GD203/09/H046; GA AV ČR(CZ) IAA400040802; GA MŠk(CZ) LC512; GA AV ČR(CZ) KJB400040901; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Grant - others:GA ČR(CZ) GPP301/11/ P558 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : reverse kink-turn * simulation * flexibility Subject RIV: BO - Biophysics Impact factor: 5.215, year: 2011

  6. Genomic organization of the mouse src gene. Sequencing of src introns revealed a new chromosome 2 microsatellite marker

    Czech Academy of Sciences Publication Activity Database

    Fučík, Vladimír; Beran, Jaroslav; Černý, Zbyněk; Mácha, J.; Jonák, Jiří

    2002-01-01

    Roč. 2002, č. 48 (2002), s. 34-39 ISSN 0015-5500 R&D Projects: GA AV ČR IPP2052002 Institutional research plan: CEZ:AV0Z5052915 Keywords : Mus musculus * protein tyrosine kinase * c-src Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.615, year: 2002

  7. Expression of intronic miRNAs and their host gene Igf2 in a murine unilateral ureteral obstruction model

    Energy Technology Data Exchange (ETDEWEB)

    Li, N.Q. [Nephrology Department, The First Affiliated Hospital, Harbin Medical University, Harbin (China); Yang, J. [Nephrology Department, Daqing Oilfield General Hospital, Daqing (China); Cui, L. [Nephrology Department, The First Affiliated Hospital, Harbin Medical University, Harbin (China); Ma, N. [Department of Biochemistry and Molecular Biology, Harbin Medical University, Harbin (China); Zhang, L.; Hao, L.R. [Nephrology Department, The First Affiliated Hospital, Harbin Medical University, Harbin (China)

    2015-03-27

    The objective of this study was to determine the expression of miR-483 and miR-483* and the relationship among them, their host gene (Igf2), and other cytokines in a murine model of renal fibrosis. The extent of renal fibrosis was visualized using Masson staining, and fibrosis was scored 3 days and 1 and 2 weeks after unilateral ureteral obstruction (UUO). Expression of miR-483, miR-483* and various cytokine mRNAs was detected by real-time polymerase chain reaction (PCR). Expression of miR-483 and miR-483* was significantly upregulated in the UUO model, particularly miR-483 expression was the greatest 2 weeks after surgery. Additionally, miR-483 and miR-483* expression negatively correlated with Bmp7 expression and positively correlated with Igf2, Tgfβ, Hgf, and Ctgf expression, as determined by Pearson's correlation analysis. Hgf expression significantly increased at 1 and 2 weeks after the surgery compared to the control group. This study showed that miR-483 and miR-483* expression was upregulated in a murine UUO model. These data suggest that miR-483 and miR-483* play a role in renal fibrosis and that miR-483* may interact with miR-483 in renal fibrosis. Thus, these miRNAs may play a role in the pathogenesis of renal fibrosis and coexpression of their host gene Igf2.

  8. Intronic deletions that disrupt mRNA splicing of the tva receptor gene result in decreased susceptibility to infection by avian sarcoma and leukosis virus subgroup A

    Czech Academy of Sciences Publication Activity Database

    Reinišová, Markéta; Plachý, Jiří; Trejbalová, Kateřina; Šenigl, Filip; Kučerová, Dana; Geryk, Josef; Svoboda, Jan; Hejnar, Jiří

    2012-01-01

    Roč. 86, č. 4 (2012), s. 2021-2030 ISSN 1098-5514 R&D Projects: GA ČR GAP502/10/1651 Institutional research plan: CEZ:AV0Z50520514 Keywords : avian sarcoma and leukosis virus * virus- host coevolution * resistance to retroviruses Subject RIV: EB - Genetics ; Molecular Biology

  9. A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea

    Science.gov (United States)

    Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled u...

  10. Deletion of a conserved noncoding sequence in Plzf intron leads to Plzf down-regulation in limb bud and polydactyly in the rat

    Czech Academy of Sciences Publication Activity Database

    Liška, F.; Šnajdr, P.; Šedová, L.; Šeda, O.; Chylíková, B.; Slámová, P.; Krejčí, E.; Sedmera, David; Grim, M.; Křenová, D.; Křen, Vladimír

    2009-01-01

    Roč. 238, č. 3 (2009), s. 673-684 ISSN 1058-8388 Grant - others:GA ČR(CZ) GA304/06/0116; GA ČR(CZ) GP301/07/P178; EC(XE) LSHG-CT-2005-019015 Institutional research plan: CEZ:AV0Z50110509 Keywords : Plzf * polydactyly * rat Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.833, year: 2009

  11. Intronic deletions that disrupt mRNA splicing of the tva receptor gene result in decreased susceptibility to infection by avian sarcoma and leukosis virus subgroup A

    Czech Academy of Sciences Publication Activity Database

    Reinišová, Markéta; Plachý, Jiří; Trejbalová, Kateřina; Šenigl, Filip; Kučerová, Dana; Geryk, Josef; Svoboda, Jan; Hejnar, Jiří

    2012-01-01

    Roč. 86, č. 4 (2012), s. 2021-2030 ISSN 1098-5514 R&D Projects: GA ČR GAP502/10/1651 Institutional research plan: CEZ:AV0Z50520514 Keywords : avian sarcoma and leukosis virus * virus-host coevolution * resistance to retroviruses Subject RIV: EB - Genetics ; Molecular Biology

  12. Carcass and physical meat characteristics of thin tail sheep (TTS based on calpastatin gene (CAST (Locus intron 5 – exon 6 genotypes variation

    Directory of Open Access Journals (Sweden)

    Muhammad Ihsan Andi Dagong

    2012-03-01

    Full Text Available The quality of sheep carcass is mostly determined by the total lean meat production, meat distribution on the carcass and the quality of meat. Calpastatin gene (CAST is known to have an association with carcass and meat quality traits. The objective of this research was to identify the association between CAST polymorphisms and carcass characteristics in Thin Tail Sheep (TTS. Thirty three heads of sheep representing three genotypes of CAST (CAST-11, CAST-12 and CAST-22 were identified for carcass and meat characterisation. There was no significant difference between CAST polymorphisms with meat tenderness, pH, water holding capacity and cooking loss, neither with carcass weight and dressing percentage among genotypes. Shoulder proportion of CAST-11 genotype was larger than that of CAST-12 or CAST-22, but the lean meat proportion of CAST-22 genotype in shoulder, rack and loin were higher than those of CAST-11 but not different from CAST-12. The fat percentage of CAST-11 was the highest among the genotypes. CAST-22 genotype has higher lean meat percentage than the CAST-11. Variation in CAST gene could be used as marker assisted selection in sheep for higher lean meat proportion.

  13. TrnL-trnF intergenetic spacer and trnL intron define major clades within Luzula and Juncus (Juncaceae): Importance of structural mutations

    Czech Academy of Sciences Publication Activity Database

    Drábková, Lenka; Kirschner, Jan; Vlček, Čestmír; Pačes, Václav

    2004-01-01

    Roč. 59, - (2004), s. 1-10 ISSN 0022-2844 R&D Projects: GA AV ČR KSK6005114; GA ČR GA206/02/0355; GA MŠk(CZ) LN00A079 Institutional research plan: CEZ:AV0Z6005908 Keywords : Luzula * Juncus * trnL-trnF Subject RIV: EF - Botanics Impact factor: 2.751, year: 2004

  14. Intronic variants in the NFKB1 gene may influence hearing forecast in patients with unilateral sensorineural hearing loss in Meniere's disease.

    Directory of Open Access Journals (Sweden)

    Sonia Cabrera

    Full Text Available Meniere's disease is an episodic vestibular syndrome associated with sensorineural hearing loss (SNHL and tinnitus. Patients with MD have an elevated prevalence of several autoimmune diseases (rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis and psoriasis, which suggests a shared autoimmune background. Functional variants of several genes involved in the NF-κB pathway, such as REL, TNFAIP3, NFKB1 and TNIP1, have been associated with two or more immune-mediated diseases and allelic variations in the TLR10 gene may influence bilateral affectation and clinical course in MD. We have genotyped 716 cases of MD and 1628 controls by using the ImmunoChip, a high-density genotyping array containing 186 autoimmune loci, to explore the association of immune system related-loci with sporadic MD. Although no single nucleotide polymorphism (SNP reached a genome-wide significant association (p40 dB HL (log-rank test, corrected p values were p = 0.009 for rs3774937 and p = 0.003 for rs4648011, respectively. No variants influenced hearing in bilateral MD. Our data support that the allelic variants rs3774937 and rs4648011 can modify hearing outcome in patients with MD and unilateral SNHL.

  15. Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5' splice site

    DEFF Research Database (Denmark)

    Martínez-Pizarro, Ainhoa; Dembic, Maja; Pérez, Belén

    2018-01-01

    Phenylketonuria (PKU), one of the most common inherited diseases of amino acid metabolism, is caused by mutations in the phenylalanine hydroxylase (PAH) gene. Recently, PAH exon 11 was identified as a vulnerable exon due to a weak 3' splice site, with different exonic mutations affecting exon 11...

  16. The IGF2-intron3-G3072A substitution explains a major imprinted QTL effect on backfat thickness in a Meishan x European white pig intercross

    NARCIS (Netherlands)

    Jungerius, B.J.; Laere, van A.S.; Pas, te M.F.W.; Oost, van B.A.; Andersson, L.; Groenen, M.A.M.

    2004-01-01

    A paternally expressed QTL for muscle growth and backfat thickness (BFT) has previously been identified near the IGF2 locus on the distal tip of pig chromosome 2 (SSC2p) in three experimental F-2 populations. Recently, a mutation in a regulatory element of the IGF2 gene was identified as the

  17. A large insertion in intron 2 of the TYRP1 gene associated with American Palomino phenotype in American mink

    DEFF Research Database (Denmark)

    Cirera Salicio, Susanna; Markakis, Marios Nektarios; Kristiansen, Thea

    2016-01-01

    A number of American mink phenotypes display a range of brownish colours. One of these phenotypes, namely American Palomino (b (P) b (P) ) (AP) has been found to be associated with the tyrosinase-related protein 1 (TYRP1) gene by genotyping microsatellite markers in one sire family. Trials...

  18. Comparative genomic survey, exon-intron annotation and phylogenetic analysis of NAT-homologous sequences in archaea, protists, fungi, viruses, and invertebrates

    Science.gov (United States)

    We have previously published extensive genomic surveys [1-3], reporting NAT-homologous sequences in hundreds of sequenced bacterial, fungal and vertebrate genomes. We present here the results of our latest search of 2445 genomes, representing 1532 (70 archaeal, 1210 bacterial, 43 protist, 97 fungal,...

  19. Clinical Expression and New SPINK5 Splicing Defects in Netherton Syndrome : Unmasking a Frequent Founder Synonymous Mutation and Unconventional Intronic Mutations

    NARCIS (Netherlands)

    Lacroix, Matthieu; Lacaze-Buzy, Laetitia; Furio, Laetitia; Tron, Elodie; Valari, Manthoula; Van der Wier, Gerda; Bodemer, Christine; Bygum, Anette; Bursztejn, Anne-Claire; Gaitanis, George; Paradisi, Mauro; Stratigos, Alexander; Weibel, Lisa; Deraison, Celine; Hovnanian, Alain

    Netherton syndrome (NS) is a severe skin disease caused by loss-of-function mutations in SPINK5 (serine protease inhibitor Kazal-type 5) encoding the serine protease inhibitor LEKTI (lympho-epithelial Kazal type-related inhibitor). Here, we disclose new SPINK5 defects in 12 patients, who presented a

  20. Specific analysis of the intron 22 XbaI polymorphism of the human factor VIII gene using long-distance PCR.

    Science.gov (United States)

    De Brasi, C D; Bowen, D J; Collins, P W; Larripa, I B

    1999-12-01

    A rapid, non-radioactive, PCR-based method to genotype the XbaI restriction fragment length polymorphism of the human factor VIII gene is described. The method uses long-distance PCR followed by XbaI restriction digestion and agarose gel electrophoresis. The 6.6 kb amplification product includes a constant XbaI site, which provides a digestion control. The specificity of the method was challenged by a blind experiment with 16 genomic DNA samples previously genotyped by Southern blot analysis: a perfect correlation was obtained between genotypes determined using Southern blot and PCR.

  1. Insertion-Deletions In a FADS2 Intron 1 Conserved Regulatory Locus Control Expression Of Fatty Acid Desaturases 1 and 2 And Modulate Response To Simvastatin

    OpenAIRE

    Reardon, Holly T.; Zhang, Jimmy; Kothapalli, Kumar S.D.; Kim, Andrea J.; Park, Woo Jung; Brenna, J. Thomas

    2012-01-01

    The fatty acid desaturase genes (FADS1 and FADS2) code for enzymes required for synthesis of omega-3 and omega-6 long-chain polyunsaturated fatty acids (LCPUFA) important in the central nervous system, inflammatory response, and cardiovascular health. SNPs in these genes are associated with numerous health outcomes, but it is unclear how genetic variation affects enzyme function. Here, lymphoblasts obtained from Japanese participants in the International HapMap Project were evaluated for asso...

  2. Microsatellite instability affecting the T17 repeats in intron 8 of HSP110, as well as five mononucleotide repeats in patients with colorectal carcinoma.

    Science.gov (United States)

    Markovic, Srdjan; Antic, Jadranka; Dimitrijevic, Ivan; Zogovic, Branimir; Bojic, Daniela; Svorcan, Petar; Markovic, Velimir; Krivokapic, Zoran

    2013-08-01

    To investigate mononucleotide markers: BAT-25, BAT-26, NR-21, NR-22 and NR-24 in patients with colorectal cancer (CRC), and the status of HSP110T17, KRAS, BRAF and the MLH1 promoter mutations in microsatellite unstable CRC. Genetic assessments were performed on samples obtained following resection of CRC in 200 patients. Allelic variations of HSP110T17 were found in all 18 patients with microsatellite instabilities (MSIs) in at least three markers (high-frequency MSI). By contrast, mutations of HSP110T17 were absent in all 20 patients with no MSI frequency. Eight out of 182 patients with low (instability in one marker) or no frequency MSI had allelic shifts due to polymorphisms of BAT-25 (1.5%), NR-21 (1.75%) and NR-24 (1.5%). BRAF mutations were associated with >5 bp shortening of HSP110T17. Patients with high-frequency MSI CRC had allelic variations of HSP110T17. BRAF mutations occur along with greater shortening in HSP110T17 during oncogenesis via the MSI pathway.

  3. The introns in FLOWERING LOCUS T-LIKE (FTL) genes are useful markers for tracking paternity in tetraploid Chenopodium quinoa Willd

    Czech Academy of Sciences Publication Activity Database

    Štorchová, Helena; Drabešová, Jana; Cháb, David; Kolář, Jan; Jellen, E.N.

    2015-01-01

    Roč. 62, č. 6 (2015), s. 913-925 ISSN 0925-9864 R&D Projects: GA ČR(CZ) GAP506/12/1359 Institutional support: RVO:61389030 Keywords : Ancestry * Chenopodium quinoa * FLOWERING LOCUS T-LIKE (FTL) genes Subject RIV: EF - Botanics Impact factor: 1.258, year: 2015

  4. An intronic mutation leading to incomplete skipping of exon-2 in KCNQ1 rescues hearing in Jervell and Lange-Nielsen syndrome

    NARCIS (Netherlands)

    Bhuiyan, Zahurul A.; Momenah, Tarek S.; Amin, Ahmad S.; Al-Khadra, Ayman S.; Alders, Marielle; Wilde, Arthur A. M.; Mannens, Marcel M. A. M.

    2008-01-01

    Romano-Ward syndrome (RWs) and Jervell and Lange-Nielsen Syndrome (JLNs) are two inherited arrhythmia disorders caused by monoallelic or bi-allelic mutations, respectively, in the KCNQ1 or KCNE1 genes. Both disorders could cause Long QT syndrome either without deafness (RWs), or with deafness

  5. c-Myc/Max heterodimers bind cooperatively to the E-box sequences located in the first intron of the rat ornithine decarboxylase (ODC) gene

    NARCIS (Netherlands)

    Walhout, A.J.M.; Gubbels, J.M.; Bernards, R.A.; Vliet, P.C. van der; Timmers, H.T.M.

    1997-01-01

    The oncoprotein c-Myc plays an important role in cell proliferation, transformation, inhibition of differentiation and apoptosis. These functions most likely result from the transcription factor activity of c-Myc. As a heterodimer with Max, the c-Myc protein binds to the E-box sequence (CACGTG),

  6. A NciI PCR-RFLP within intron 2 of the porcine insulin-like growth factor 2 (IGF2) gene

    Czech Academy of Sciences Publication Activity Database

    Knoll, Aleš; Putnová, L.; Dvořák, J.; Čepica, Stanislav

    2000-01-01

    Roč. 31, - (2000), s. 140-157 ISSN 0268-9146 R&D Projects: GA ČR GA523/99/P043; GA ČR GA523/99/0842; GA AV ČR KSK2052601 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.863, year: 2000

  7. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    NARCIS (Netherlands)

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA

  8. An Intronic Polymorphism in couch potato Is Not Distributed Clinally in European Drosophila melanogaster Populations nor Does It Affect Diapause Inducibility.

    Science.gov (United States)

    Zonato, Valeria; Fedele, Giorgio; Kyriacou, Charalambos P

    2016-01-01

    couch potato (cpo) encodes an RNA binding protein that has been reported to be expressed in the peripheral and central nervous system of embryos, larvae and adults, including the major endocrine organ, the ring gland. A polymorphism in the D. melanogaster cpo gene coding region displays a latitudinal cline in frequency in North American populations, but as cpo lies within the inversion In(3R)Payne, which is at high frequencies and itself shows a strong cline on this continent, interpretation of the cpo cline is not straightforward. A second downstream SNP in strong linkage disequilibrium with the first has been claimed to be primarily responsible for the latitudinal cline in diapause incidence in USA populations.Here, we investigate the frequencies of these two cpo SNPs in populations of Drosophila throughout continental Europe. The advantage of studying cpo variation in Europe is the very low frequency of In(3R)Payne, which we reveal here, does not appear to be clinally distributed. We observe a very different geographical scenario for cpo variation from the one in North America, suggesting that the downstream SNP does not play a role in diapause. In an attempt to verify whether the SNPs influence diapause we subsequently generated lines with different combinations of the two cpo SNPs on known timeless (tim) genetic backgrounds, because polymorphism in the clock gene tim plays a significant role in diapause inducibility. Our results reveal that the downstream cpo SNP does not seem to play any role in diapause induction in European populations in contrast to the upstream coding cpo SNP. Consequently, all future diapause studies on strains of D. melanogaster should initially determine their tim and cpo status.

  9. The Trypanosoma brucei La protein is a candidate poly(U) shield that impacts spliced leader RNA maturation and tRNA intron removal

    Czech Academy of Sciences Publication Activity Database

    Trantírková, Silvie; Paris, Zdeněk; Sturm, N. R.; Campbell, D. A.; Lukeš, Julius

    2005-01-01

    Roč. 35, č. 4 (2005), s. 359-366 ISSN 0020-7519 R&D Projects: GA AV ČR IAA5022302 Grant - others:NIH(US) AI34536; NIH(US) AI056034 Institutional research plan: CEZ:AV0Z60220518 Keywords : splicing * Trypanosoma * RNA interference Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.346, year: 2005

  10. Morphological character evolution of Amorphophallus (Araceae) based on a combined phylogenetic analysis of trnL, rbcL, and LEAFY second intron sequences

    NARCIS (Netherlands)

    Sedayu, A.; Eurlings, M.C.M.; Gravendeel, B.; Hetterscheid, W.L.A.

    2010-01-01

    Sequences of three different genes in 69 taxa of Amorphophallus were combined to reconstruct the molecular phylogeny of this species-rich Aroid genus. The data set was analyzed by three different methods, Maximum Parsimony, Maximum Likelihood and Bayesian analysis, producing slightly different tree

  11. Platelet monoamine oxidase type B, MAOB intron 13 and MAOA-uVNTR polymorphism and symptoms of post-traumatic stress disorder.

    Science.gov (United States)

    Svob Strac, Dubravka; Kovacic Petrovic, Zrnka; Nikolac Perkovic, Matea; Umolac, Danica; Nedic Erjavec, Gordana; Pivac, Nela

    2016-07-01

    Post-traumatic stress disorder (PTSD), a disorder that develops following exposure to traumatic experience(s), is frequently associated with agitation, aggressive behavior and psychotic symptoms. Monoamine oxidase (MAO) degrades different biogenic amines and regulates mood, emotions and behavior, and has a role in the pathophysiology of various neuropsychiatric disorders. The aim of the study was to investigate the association between different symptoms occurring in PTSD [PTSD symptom severity assessed by the Clinician Administered PTSD Scale (CAPS), agitation and selected psychotic symptoms assessed by the Positive and Negative Syndrome Scale (PANSS)] and platelet MAO-B activity and/or genetic variants of MAOB rs1799836 and MAOA-uVNTR polymorphisms in 249 Croatian male veterans with PTSD. Our study revealed slightly higher platelet MAO-B activity in veterans with PTSD with more severe PTSD symptoms and in veterans with agitation, and significantly higher platelet MAO-B activity in veterans with more pronounced psychotic symptoms compared to veterans with less pronounced psychotic symptoms. Platelet MAO-B activity was associated with smoking but not with age. Genetic variants of MAOB rs1799836 and MAOA-uVNTR were not associated with agitation and selected psychotic symptoms in veterans with PTSD. A marginally significant association was found between MAOB rs1799836 polymorphism and severity of PTSD symptoms, but it was not confirmed since carriers of G or A allele of MAOB rs1799836 did not differ in their total CAPS scores. These findings suggest an association of platelet MAO-B activity, but a lack of association of MAOB rs1799836 and MAOA-uVNTR, with selected psychotic symptoms in ethnically homogenous veterans with PTSD.

  12. Intronic SNP in ESR1 encoding human estrogen receptor alpha is associated with brain ESR1 mRNA isoform expression and behavioral traits.

    Directory of Open Access Journals (Sweden)

    Julia K Pinsonneault

    Full Text Available Genetic variants of ESR1 have been implicated in multiple diseases, including behavioral disorders, but causative variants remain uncertain. We have searched for regulatory variants affecting ESR1 expression in human brain, measuring allelic ESR1 mRNA expression in human brain tissues with marker SNPs in exon4 representing ESR1-008 (or ESRα-36, and in the 3'UTR of ESR1-203, two main ESR1 isoforms in brain. In prefrontal cortex from subjects with bipolar disorder, schizophrenia, and controls (n = 35 each; Stanley Foundation brain bank, allelic ESR1 mRNA ratios deviated from unity up to tenfold at the exon4 marker SNP, with large allelic ratios observed primarily in bipolar and schizophrenic subjects. SNP scanning and targeted sequencing identified rs2144025, associated with large allelic mRNA ratios (p = 1.6E10-6. Moreover, rs2144025 was significantly associated with ESR1 mRNA levels in the Brain eQTL Almanac and in brain regions in the Genotype-Tissue Expression project. In four GWAS cohorts, rs2104425 was significantly associated with behavioral traits, including: hypomanic episodes in female bipolar disorder subjects (GAIN bipolar disorder study; p = 0.0004, comorbid psychological symptoms in both males and females with attention deficit hyperactivity disorder (GAIN ADHD, p = 0.00002, psychological diagnoses in female children (eMERGE study of childhood health, subject age ≥9, p = 0.0009, and traits in schizophrenia (e.g., grandiose delusions, GAIN schizophrenia, p = 0.0004. The first common ESR1 variant (MAF 12-33% across races linked to regulatory functions, rs2144025 appears conditionally to affect ESR1 mRNA expression in the brain and modulate traits in behavioral disorders.

  13. Supplementary data: Association of CTLA4, CD28 and ICOS gene ...

    Indian Academy of Sciences (India)

    CTLA4 (2q33) rs231777. Intron 1. Forward: TGAATACATTTGAGCTGGGTTTC. 710. Reverse: ACTAAATGCGGTCACACTCAACT rs231779. Intron 1. Forward: CATCTCTGATAGGCAGAGGTGAG. 700. Reverse: AGTAGCTGTGTCTTGATGCACTG. ICOS (2q33) rs4270326. Intron 3. Forward: TGAAGTTCTGGTTACCCATAGGA.

  14. G-allele of intronic rs10830963 in MTNR1B confers increased risk of impaired fasting glycemia and type 2 diabetes through an impaired glucose-stimulated insulin release: studies involving 19,605 Europeans

    DEFF Research Database (Denmark)

    Sparsø, Thomas; Bonnefond, Amélie; Andersson, Ehm

    2009-01-01

    OBJECTIVE: Genome-wide association studies have identified several variants within the MTNR1B locus that are associated with fasting plasma glucose (FPG) and type 2 diabetes. We refined the association signal by direct genotyping and examined for associations of the variant displaying the most in...

  15. The prevalent deep intronic c. 639+919 G>A GLA mutation causes pseudoexon activation and Fabry disease by abolishing the binding of hnRNPA1 and hnRNP A2/B1 to a splicing silencer

    DEFF Research Database (Denmark)

    Palhais, Bruno; Dembic, Maja; Sabaratnam, Rugivan

    2016-01-01

    Fabry disease is an X-linked recessive inborn disorder of the glycosphingolipid metabolism, caused by total or partial deficiency of the lysosomal α-galactosidase A enzyme due to mutations in the GLA gene. The prevalent c.639+919 G>A mutation in GLA leads to pathogenic insertion of a 57bp...... oligonucleotide (SSO) mediated blocking of the pseudoexon 3'ss and 5'ss effectively restores normal GLA splicing. This indicates that SSO based splicing correction may be a therapeutic alternative in the treatment of Fabry disease....

  16. A novel LPL intronic variant: g.18704C>A identified by re-sequencing Kuwaiti Arab samples is associated with high-density lipoprotein, very low-density lipoprotein and triglyceride lipid levels

    Science.gov (United States)

    Al-Serri, Ahmad; Annice, Babitha G.; Alnaqeeb, Majed A.; Al-Kandari, Wafa Y.; Dashti, Mohammed

    2018-01-01

    The role interethnic genetic differences play in plasma lipid level variation across populations is a global health concern. Several genes involved in lipid metabolism and transport are strong candidates for the genetic association with lipid level variation especially lipoprotein lipase (LPL). The objective of this study was to re-sequence the full LPL gene in Kuwaiti Arabs, analyse the sequence variation and identify variants that could attribute to variation in plasma lipid levels for further genetic association. Samples (n = 100) of an Arab ethnic group from Kuwait were analysed for sequence variation by Sanger sequencing across the 30 Kb LPL gene and its flanking sequences. A total of 293 variants including 252 single nucleotide polymorphisms (SNPs) and 39 insertions/deletions (InDels) were identified among which 47 variants (32 SNPs and 15 InDels) were novel to Kuwaiti Arabs. This study is the first to report sequence data and analysis of frequencies of variants at the LPL gene locus in an Arab ethnic group with a novel “rare” variant (LPL:g.18704C>A) significantly associated to HDL (B = -0.181; 95% CI (-0.357, -0.006); p = 0.043), TG (B = 0.134; 95% CI (0.004–0.263); p = 0.044) and VLDL (B = 0.131; 95% CI (-0.001–0.263); p = 0.043) levels. Sequence variation in Kuwaiti Arabs was compared to other populations and was found to be similar with regards to the number of SNPs, InDels and distribution of the number of variants across the LPL gene locus and minor allele frequency (MAF). Moreover, comparison of the identified variants and their MAF with other reports provided a list of 46 potential variants across the LPL gene to be considered for future genetic association studies. The findings warrant further investigation into the association of g.18704C>A with lipid levels in other ethnic groups and with clinical manifestations of dyslipidemia. PMID:29438437

  17. Association of Angiotensin-Converting Enzyme Intron 16 Insertion/Deletion and Angiotensin II Type 1 Receptor A1166C Gene Polymorphisms with Preeclampsia in South East of Iran

    Directory of Open Access Journals (Sweden)

    Saeedeh Salimi

    2011-01-01

    Full Text Available Some evidence suggests that a variety of genetic factors contributed in pathogenesis of the preeclampsia. The aim of this study was to assess the association between the angiotensin-converting enzyme (ACE I/D and angiotensin II type1 receptor A1166C polymorphisms with preeclampsia. This study was performed in 125 preeclamptic pregnant women and 132 controls. The I/D Polymorphism of the ACE gene was assessed by polymerase chain reaction and the A1166C Polymorphism of the AT1R gene was determined by restriction fragment length polymorphism. The genotype and allele frequencies of I/D polymorphism differed between two groups. The risk of preeclampsia was 3.2-fold in pregnant women with D allele (OR, 3.2 [95% CI, 1.1 to 3.8]; P=0.01. The distribution of the AT1R gene A1166C polymorphism was similar in affected and control groups. Our results supported that presence of the I/D polymorphism of ACE gene is a marker for the increased risk of preeclampsia.

  18. The gene encoding the Acyl-CoA-binding protein is activated by peroxisome proliferator-activated receptor gamma through an intronic response element functionally conserved between humans and rodents

    DEFF Research Database (Denmark)

    Helledie, Torben; Grøntved, Lars; Jensen, Søren S

    2002-01-01

    metabolic and regulatory purposes. The protein is particularly abundant in cells with a high level of lipogenesis and de novo fatty acid synthesis and is significantly induced during adipocyte differentiation. However, the molecular mechanisms underlying the regulation of ACBP expression in mammalian cells...

  19. Sequence analyses reveal that a TPR–DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR–DP domains and prokaryotic GerD proteins

    Science.gov (United States)

    Papandreou, Nikolaos; Chomilier, Jacques

    2008-01-01

    The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR–DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR–DP domains. Electronic supplementary material The online version of this article (doi:10.1007/s12192-008-0083-8) contains supplementary material, which is available to authorized users. PMID:18987995

  20. Sequence analyses reveal that a TPR-DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR-DP domains and prokaryotic GerD proteins.

    Science.gov (United States)

    Hernández Torres, Jorge; Papandreou, Nikolaos; Chomilier, Jacques

    2009-05-01

    The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR-DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR-DP domains.

  1. Prenatal diagnosis and molecular genetic analysis of short rib-polydactyly syndrome type III (Verma-Naumoff in a second-trimester fetus with a homozygous splice site mutation in intron 4 in the NEK1 gene

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2012-06-01

    Conclusion: Polydactyly, micromelia, metaphyseal spurs, widened humeral metaphyses, and shortened ribs can be prominent prenatal ultrasound findings of SRPS III. The present case provides evidence for a correlation of a mutation in the NEK1 gene with SRPS III.

  2. The NOD2 p.Leu1007fsX1008 mutation (rs2066847 is a stronger predictor of the clinical course of Crohn's disease than the FOXO3A intron variant rs12212067.

    Directory of Open Access Journals (Sweden)

    Fabian Schnitzler

    Full Text Available Very recently, a sub-analysis of genome-wide association scans revealed that the non-coding single nucleotide polymorphism (SNP rs12212067 in the FOXO3A gene is associated with a milder course of Crohn's disease (CD (Cell 2013;155:57-69. The aim of our study was to evaluate the clinical value of the SNP rs12212067 in predicting the severity of CD by correlating CD patient genotype status with the most relevant complications of CD such as stenoses, fistulas, and CD-related surgery.We genotyped 550 CD patients for rs12212067 (FOXO3A and the three common CD-associated NOD2 mutations rs2066844, rs2066847, and rs2066847 and performed genotype-phenotype analyses.No significant phenotypic differences were found between the wild-type genotype TT of the FOXO3A SNP rs12212067 and the minor genotypes TG and GG independently from NOD2 variants. The allele frequency of the minor G allele was 12.7%. Age at diagnosis, disease duration, body mass index, surgery rate, stenoses, fistula, need for immunosuppressive therapy, and disease course were not significantly different. In contrast, the NOD2 mutant p.Leu1007fsX1008 (rs2066847 was highly associated with penetrating CD (p = 0.01, the development of fistulas (p = 0.01 and stenoses (p = 0.01, and ileal disease localization (p = 0.03. Importantly, the NOD2 SNP rs2066847 was a strong separator between an aggressive and a mild course of CD (p = 2.99×10(-5, while the FOXO3A SNP rs12212067 did not separate between mild and aggressive CD behavior in our cohort (p = 0.35. 96.2% of the homozygous NOD2 p.Leu1007fsX1008 carriers had an aggressive disease behavior compared to 69.3% of the patients with the NOD2 wild-type genotype (p = 0.007.In clinical practice, the NOD2 variant p.Leu1007fsX1008 (rs2066847, in particular in homozygous form, is a much stronger marker for a severe clinical phenotype than the FOXO3A rs12212067 SNP for a mild disease course on an individual patient level despite its important impact on the inflammatory response of monocytes.

  3. The use of hygromycin phosphotransferase gene (hpt) with an ...

    African Journals Online (AJOL)

    Previously, we have developed a marker-off system to truncate a selec marker in transgenic plants by locating one end of the transposon in the intron of the marker gene (glyphosate-tolerant epsps gene). In order to expand this technique to those marker genes without intron in this report, we created an artificial intron ...

  4. Phylogenetics and Gene Structure Dynamics of Polygalacturonase Genes in Aspergillus and Neurospora crassa

    Directory of Open Access Journals (Sweden)

    Jin-Sung Hong

    2013-09-01

    Full Text Available Polygalacturonase (PG gene is a typical gene family present in eukaryotes. Forty-nine PGs were mined from the genomes of Neurospora crassa and five Aspergillus species. The PGs were classified into 3 clades such as clade 1 for rhamno-PGs, clade 2 for exo-PGs and clade 3 for exo- and endo-PGs, which were further grouped into 13 sub-clades based on the polypeptide sequence similarity. In gene structure analysis, a total of 124 introns were present in 44 genes and five genes lacked introns to give an average of 2.5 introns per gene. Intron phase distribution was 64.5% for phase 0, 21.8% for phase 1, and 13.7% for phase 2, respectively. The introns varied in their sequences and their lengths ranged from 20 bp to 424 bp with an average of 65.9 bp, which is approximately half the size of introns in other fungal genes. There were 29 homologous intron blocks and 26 of those were sub-clade specific. Intron losses were counted in 18 introns in which no obvious phase preference for intron loss was observed. Eighteen introns were placed at novel positions, which is considerably higher than those of plant PGs. In an evolutionary sense both intron loss and gain must have taken place for shaping the current PGs in these fungi. Together with the small intron size, low conservation of homologous intron blocks and higher number of novel introns, PGs of fungal species seem to have recently undergone highly dynamic evolution.

  5. Chloroplast group III twintron excision utilizing multiple 5'- and 3'-splice sites.

    OpenAIRE

    Copertino, D W; Shigeoka, S; Hallick, R B

    1992-01-01

    The chloroplast genes of Euglena gracilis contain more than 60 group II and 47 group III introns. Some Euglena chloroplast genes also contain twintrons, introns-within-introns. Two types of twintrons have previously been described, a group II twintron and a mixed group II/group III twintron. We report that four introns, three within the RNA polymerase subunit gene rpoC1 and one within ribosomal protein gene rpl16, with mean lengths twice typical group III introns, are a new type of twintron. ...

  6. From the comparative analysis of fungal mitochondrial genes to the development of taxonomic and phylogenetic tools

    OpenAIRE

    Barroso, Gérard; Ferandon, Cyril; Callac, Philippe

    2011-01-01

    The complete sequence of the mitochondrial cox1 gene, encoding the largest subunit of the cytochrome oxidase of the Basidiomycota Agaricus bisporus has been achieved. It has the longest cox1 gene (29,902 nt) with the largest number of group I introns (18 group I introns) reported to date in any eukaryote. The group I introns in the A. bisporus cox1 gene are similar to those reported in other Basidiomycetes includeing: 3 of the 4 introns in Agrocybe aegerita, 7 of the 9 introns in Pleu...

  7. Non-sequential and multi-step splicing of the dystrophin transcript.

    Science.gov (United States)

    Gazzoli, Isabella; Pulyakhina, Irina; Verwey, Nisha E; Ariyurek, Yavuz; Laros, Jeroen F J; 't Hoen, Peter A C; Aartsma-Rus, Annemieke

    2016-01-01

    The dystrophin protein encoding DMD gene is the longest human gene. The 2.2 Mb long human dystrophin transcript takes 16 hours to be transcribed and is co-transcriptionally spliced. It contains long introns (24 over 10kb long, 5 over 100kb long) and the heterogeneity in intron size makes it an ideal transcript to study different aspects of the human splicing process. Splicing is a complex process and much is unknown regarding the splicing of long introns in human genes. Here, we used ultra-deep transcript sequencing to characterize splicing of the dystrophin transcripts in 3 different human skeletal muscle cell lines, and explored the order of intron removal and multi-step splicing. Coverage and read pair analyses showed that around 40% of the introns were not always removed sequentially. Additionally, for the first time, we report that non-consecutive intron removal resulted in 3 or more joined exons which are flanked by unspliced introns and we defined these joined exons as an exon block. Lastly, computational and experimental data revealed that, for the majority of dystrophin introns, multistep splicing events are used to splice out a single intron. Overall, our data show for the first time in a human transcript, that multi-step intron removal is a general feature of mRNA splicing.

  8. Putative cross-kingdom horizontal gene transfer in sponge (Porifera mitochondria

    Directory of Open Access Journals (Sweden)

    Ilan Micha

    2006-09-01

    Full Text Available Abstract Background The mitochondrial genome of Metazoa is usually a compact molecule without introns. Exceptions to this rule have been reported only in corals and sea anemones (Cnidaria, in which group I introns have been discovered in the cox1 and nad5 genes. Here we show several lines of evidence demonstrating that introns can also be found in the mitochondria of sponges (Porifera. Results A 2,349 bp fragment of the mitochondrial cox1 gene was sequenced from the sponge Tetilla sp. (Spirophorida. This fragment suggests the presence of a 1143 bp intron. Similar to all the cnidarian mitochondrial introns, the putative intron has group I intron characteristics. The intron is present in the cox1 gene and encodes a putative homing endonuclease. In order to establish the distribution of this intron in sponges, the cox1 gene was sequenced from several representatives of the demosponge diversity. The intron was found only in the sponge order Spirophorida. A phylogenetic analysis of the COI protein sequence and of the intron open reading frame suggests that the intron may have been transmitted horizontally from a fungus donor. Conclusion Little is known about sponge-associated fungi, although in the last few years the latter have been frequently isolated from sponges. We suggest that the horizontal gene transfer of a mitochondrial intron was facilitated by a symbiotic relationship between fungus and sponge. Ecological relationships are known to have implications at the genomic level. Here, an ecological relationship between sponge and fungus is suggested based on the genomic analysis.

  9. Maple syrup urine disease: The E1{beta} gene of human branched-chain {alpha}-ketoacid dehydrogenase complex has 11 rather than 10 exons, and the 3{prime} UTR in one of the two E1{beta} mRNAs arises from intronic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, J.L.; Chuang, D.T.; Cox, R.P. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States)

    1996-06-01

    Maple syrup urine disease (MSUD) or branched-chain ketoaciduria is caused by a deficiency in the mitochondrial branched-chain {alpha}-ketoacid dehydrogenase (BCKAD) complex. The clinical manifestations are characterized by accumulation of branched chain amino and {alpha}-ketoacids, which leads to severe cerebral edema with seizures, ketoacidosis, and mental retardation. The BCKAD complex comprises three catalytic components, i.e., a decarboxylase (E1) consisting of two E1{alpha} (M{sub r} = 46,000) and two E1{Beta} (M{sub r} = 37,500) subunits, a transacylase (E2) that contains 24 lipoic acid-bearing subunits, and a dehydrogenase (E3), which is a homodimeric flavoprotein. MSUD is genetically heterogeneous, since mutations in the E1{alpha} subunit (type IA MSUD), the E1{Beta} subunit (type IB), the E2 subunit (type II) and the E3 subunit (type III) have been described. The functional consequences of certain mutations in the BCKAD complex have been studied. 23 refs., 3 figs.

  10. Homozygotic intronic GAA mutation in three siblings with late-onset Pompe's disease Mutação homozigótica intrônica no gene GAA em três irmãos com doença de Pompe de início tardio

    Directory of Open Access Journals (Sweden)

    Anderson Kuntz Grzesiuk

    2010-04-01

    Full Text Available Pompe's disease (PD is a metabolic myopathy caused by the accumulation of lysosomal glycogen, secondary to acid α-glucosidase (GAA enzyme deficiency. Childhood and late-onset forms are described, differing by the age of onset and symptoms. In this study were analyzed affected siblings with Pompe's disease (PD and their distinct clinical and pathological presentations. METHOD: Diagnosis was performed by the clinical presentation of limb-girdle dystrophies and respiratory compromise. Confirmatory diagnoses were conducted by muscle biopsy, GAA activity measurement and by GAA gene genotyping. RESULTS: The findings suggested muscular involvement due to GAA deficiency. GAA genotyping showed they are homozygous for the c.-32-3C>A mutation. CONCLUSION: Herein we reported a family where three out of five siblings were diagnosed with late-onset PD, although it is a rare metabolic disease inherited in an autossomal recessive manner. We emphasize the importance of including this presentation within the differential diagnoses of the limb-girdle dystrophies once enzyme replacement therapy is available.A doença de Pompe (DP é uma miopatia originada do acúmulo lisossomal de glicogênio, devido à deficiência da enzima α-glicosidase ácida (GAA, sendo descritas formas de inicio precoce e tardio. Neste estudo analisamos retrospectivamente o perfil clinico e patológico de 3 irmãos portadores de doença de Pompe de inicio tardio. MÉTODO: O diagnóstico foi realizado mediante apresentação clinica de distrofia de cinturas associado a comprometimento respiratório, sendo confirmado por biópsia muscular e análise da atividade e genotipagem da GAA. RESULTADOS: Os exames clínicos e laboratoriais demonstram envolvimento muscular devido à deficiência da GAA, com uma mutação c.-32-3C>A em homozigose. CONCLUSÃO: Relatamos os aspectos clínicos e laboratoriais de 3 irmãos afetados por doença de Pompe de início tardio. Enfatizamos a importância de incluir esta patologia no diagnóstico diferencial das distrofias de cinturas, uma vez que para esta patologia específica existe a possibilidade terapêutica através de reposição enzimática.

  11. Genomic organization of a receptor from sea anemones, structurally and evolutionary related to glycoprotein hormone receptors from mamals

    DEFF Research Database (Denmark)

    Vibede, N; Hauser, Frank; Williamson, M

    1998-01-01

    Abstract Cnidarians (e.g., sea anemones and corals) are the lowest animal group having a nervous system. Previously, we cloned a receptor from sea anemones that showed a strong structural similarity to the glycoprotein hormone (TSH, FSH, LH/CG) receptors from mammals. Here, we determine the genomic...... organization of this sea anemone receptor. The receptor gene contains eight introns that are all localized within a region coding for the large extracellular N terminus. These introns occur at the same positions and have the same intron phasing as eight introns in the genes coding for the mammalian...

  12. The plant mitochondrial mat-r gene/nad1 gene complex. Progress report

    Energy Technology Data Exchange (ETDEWEB)

    Wolstenholme, D.R.

    1994-06-01

    The authors have completed sequencing the segments (totalling 19 kb, both complementary strands) of the maize mtDNA molecule that encode the entire NADH dehydrogenase subunit (nadl) gene. They have identified nucleotides in mature transcripts of the nadl gene that are edited and have generated clones of cDNAs of entire mature (fully spliced) nadl transcripts. They have examined the relative rates of splicing in transcripts of the four nadl gene group II introns and begun examining nadl intron cDNAs to determine the extent and distribution of RNA edits in introns, in order to evaluate the possibility that intron excision and exon splicing might be editing independent.

  13. Dicty_cDB: Contig-U15594-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available e, intron; ... 32 1.7 4 ( AY163064 ) Bryum capillare tRNA-Gly (trnG) gene, intron sequ... 32 1.7 4 ( EF362523 ) Plagio...bryum capillare tRNA-Gly (trnG) gene, intro... 32 1.7 4 ( DQ536453 ) Plagiobryum capillare tRNA-Gl

  14. High-resolution phylogenic microbial community profiling

    Science.gov (United States)

    PIECE (Plant Intron Exon Comparison and Evolution) is a web-accessible database that houses intron and exon information of plant genes. PIECE serves as a resource for biologists interested in comparing intron–exon organization and provides valuable insights into the evolution of gene structure in pl...

  15. Cloning of the astaxanthin synthase gene from Xanthophyllomyces dendrorhous (Phaffia rhodozyma) and its assignment as a beta-carotene 3-hydroxylase/4-ketolase

    NARCIS (Netherlands)

    Ojima, K.; Breitenbach, J.; Visser, J.H.; Setoguchi, Y.; Tabata, K.; Hoshino, T.; Berg, van den J.A.; Sandmann, G.

    2006-01-01

    A gene has been cloned from Xanthophyllomyces dendrorhous by complementation of astaxanthin formation in a ß-carotene accumulating mutant. It consists of 3,166 bp and contains 17 introns. For the ß-carotene mutant ATCC 96815, a single point mutation in the splicing sequence of intron 8 was found.

  16. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Research on evolutionary relationship and expression profiles of MATE-type gene family in maize .... To analyse the evolutionary relationships among the 49 ... sess 11 to 13 introns. Additionally, some close gene pairs were indeed distinct in intron–exon arrangements. For exam- ple, ZmMATE24 contained six introns, ...

  17. Detection of combined genomic variants in a Jordanian family with ...

    Indian Academy of Sciences (India)

    Keywords. familial hyperthyroidism; TSHR gene; genomic variants; TSAB; intron; human genetics. ... The sequence analysis of all TSHR gene exons and intron borders revealed two genomic variants. ... This is the first Jordanian family with familial non-autoimmune hyperthyroidism, with mutations affecting the TSHR gene.

  18. Piece2.0: an update for the pant gene structure comparison and evolution database

    Science.gov (United States)

    PIECE (Plant Intron Exon Comparison and Evolution) is a web-accessible database that houses intron and exon information of plant genes. PIECE serves as a resource for biologists interested in comparing intron–exon organization and provides valuable insights into the evolution of gene structure in pl...

  19. Italian Mediterranean river buffalo CSN2 gene structure and promoter analysis

    Directory of Open Access Journals (Sweden)

    Gianfranco Cosenza

    2010-01-01

    Full Text Available The nucleotide sequence of the whole buffalo β-casein encoding gene (CSN2 plus 1,476 nt at the 5' flanking region and 51 nt at the 3' flanking region was determined. The gene is spread over 10.2 kb and consists of 9 exons varying in length from 24 (exon 5 to 498 bp (exon 7 and 8 introns from 92 bp (intron 5 to 22 59 bp (intron 1. Furthermore, highly conserved sequences, mainly located in the 5' flanking region, were found between this gene and the β-casein encoding genes of other species. The comparison between the obtained promoter and exonic regions and buffalo sequences present in EMBL evidenced different polymorphic sites. Finally, 5 interspersed repeated elements (4 in the bovine CSN2 gene were also identified at 3 different locations of the sequenced region: 5' untranscribed region, intron 1, and intron 4.

  20. Comparative Analysis of Four Calypogeia Species Revealed Unexpected Change in Evolutionarily-Stable Liverwort Mitogenomes

    Directory of Open Access Journals (Sweden)

    Monika Ślipiko

    2017-12-01

    Full Text Available Liverwort mitogenomes are considered to be evolutionarily stable. A comparative analysis of four Calypogeia species revealed differences compared to previously sequenced liverwort mitogenomes. Such differences involve unexpected structural changes in the two genes, cox1 and atp1, which have lost three and two introns, respectively. The group I introns in the cox1 gene are proposed to have been lost by two-step localized retroprocessing, whereas one-step retroprocessing could be responsible for the disappearance of the group II introns in the atp1 gene. These cases represent the first identified losses of introns in mitogenomes of leafy liverworts (Jungermanniopsida contrasting the stability of mitochondrial gene order with certain changes in the gene content and intron set in liverworts.

  1. Accurate, simple, and inexpensive assays to diagnoseF8gene inversion mutations in hemophilia A patients and carriers.

    Science.gov (United States)

    Dutta, Debargh; Gunasekera, Devi; Ragni, Margaret V; Pratt, Kathleen P

    2016-12-27

    The most frequent mutations resulting in hemophilia A are an intron 22 or intron 1 gene inversion, which together cause ∼50% of severe hemophilia A cases. We report a simple and accurate RNA-based assay to detect these mutations in patients and heterozygous carriers. The assays do not require specialized equipment or expensive reagents; therefore, they may provide useful and economic protocols that could be standardized for central laboratory testing. RNA is purified from a blood sample, and reverse transcription nested polymerase chain reaction (RT-NPCR) reactions amplify DNA fragments with the F8 sequence spanning the exon 22 to 23 splice site (intron 22 inversion test) or the exon 1 to 2 splice site (intron 1 inversion test). These sequences will be amplified only from F8 RNA without an intron 22 or intron 1 inversion mutation, respectively. Additional RT-NPCR reactions are then carried out to amplify the inverted sequences extending from F8 exon 19 to the first in-frame stop codon within intron 22 or a chimeric transcript containing F8 exon 1 and the VBP1 gene. These latter 2 products are produced only by individuals with an intron 22 or intron 1 inversion mutation, respectively. The intron 22 inversion mutations may be further classified (eg, as type 1 or type 2, reflecting the specific homologous recombination sites) by the standard DNA-based "inverse-shifting" PCR assay if desired. Efficient Bcl I and T4 DNA ligase enzymes that cleave and ligate DNA in minutes were used, which is a substantial improvement over previous protocols that required overnight incubations. These protocols can accurately detect F8 inversion mutations via same-day testing of patient samples.

  2. DMD

    Science.gov (United States)

    Niba, Emma Tabe Eko; Yamanaka, Ryo; Rani, Abdul Qawee Mahyoob; Awano, Hiroyuki; Matsumoto, Masaaki; Nishio, Hisahide; Matsuo, Masafumi

    2017-01-01

    The DMD gene encoding dystrophin is mutated in Duchenne muscular dystrophy, a fatal progressive muscle wasting disease. DMD has also been shown to act as a tumor suppressor gene. Rhabdomyosarcoma (RMS) is a mesodermal sarcoma that shares characteristics of skeletal muscle precursors. Products of the DMD gene in RMS have not yet been fully clarified. Here, DMD products were analyzed in CRL-2061 cells established from alveolar RMS. The 14-kb long DMD cDNA was PCR amplified as 20 separated fragments, as were nine short intron regions. Dystrophin was analyzed by Western blotting using an antibody against the C-terminal region of dystrophin. Sixteen of the 20 DMD cDNA fragments could be amplified from CRL-2061 cells as muscle cDNA. Three fragments included aberrant gene products, including one in which exon 71 was omitted and one each with retention of introns 40 and 58. In one fragment, extending from exon 70 to 79, no normally spliced product was obtained. Rather, six alternatively spliced products were identified, including a new product deleting exon 73, with the most abundant product showing deletion of exon 78. Although dystrophin expression was expected in CRL-2061 cells, western blotting of cell lysates showed no evidence of dystrophin, suggesting that translation of full-length DMD mRNA was inhibited by intron retention that generated a premature stop codon. Intron specific PCR amplification of nine short introns, showed retention of introns 40, 58, and 70, which constituted about 60, 25 and 9%, respectively, of the total PCR amplified products. The most abundant DMD transcript contained two abnormalities, intron 40 retention and exon 78 skipping. Intron-specific PCR amplification showed that DMD transcripts contained high levels of introns 40, 58 and 70. Retention of these introns may have been responsible for the lack of dystrophin expression by CRL-2061 cells, thereby abolishing the tumor suppressor activity of dystrophin.

  3. Quantification of pre-mRNA escape rate and synergy in splicing.

    Science.gov (United States)

    Bonde, Marie Mi; Voegeli, Sylvia; Baudrimont, Antoine; Séraphin, Bertrand; Becskei, Attila

    2014-11-10

    Splicing reactions generally combine high speed with accuracy. However, some of the pre-mRNAs escape the nucleus with a retained intron. Intron retention can control gene expression and increase proteome diversity. We calculated the escape rate for the yeast PTC7 intron and pre-mRNA. This prediction was facilitated by the observation that splicing is a linear process and by deriving simple algebraic expressions from a model of co- and post-transcriptional splicing and RNA surveillance that determines the rate of the nonsense-mediated decay (NMD) of the pre-mRNAs with the retained intron. The escape rate was consistent with the observed threshold of splicing rate below which the mature mRNA level declined. When an mRNA contains multiple introns, the outcome of splicing becomes more difficult to predict since not only the escape rate of the pre-mRNA has to be considered, but also the possibility that the splicing of each intron is influenced by the others. We showed that the two adjacent introns in the SUS1 mRNA are spliced cooperatively, but this does not counteract the escape of the partially spliced mRNA. These findings will help to infer promoter activity and to predict the behavior of and to control splicing regulatory networks. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Plant nonsense-mediated mRNA decay is controlled by different autoregulatory circuits and can be induced by an EJC-like complex

    Science.gov (United States)

    Nyikó, Tünde; Kerényi, Farkas; Szabadkai, Levente; Benkovics, Anna H.; Major, Péter; Sonkoly, Boglárka; Mérai, Zsuzsanna; Barta, Endre; Niemiec, Emilia; Kufel, Joanna; Silhavy, Dániel

    2013-01-01

    Nonsense-mediated mRNA decay (NMD) is a eukaryotic quality control system that recognizes and degrades transcripts containing NMD cis elements in their 3′untranslated region (UTR). In yeasts, unusually long 3′UTRs act as NMD cis elements, whereas in vertebrates, NMD is induced by introns located >50 nt downstream from the stop codon. In vertebrates, splicing leads to deposition of exon junction complex (EJC) onto the mRNA, and then 3′UTR-bound EJCs trigger NMD. It is proposed that this intron-based NMD is vertebrate specific, and it evolved to eliminate the misproducts of alternative splicing. Here, we provide evidence that similar EJC-mediated intron-based NMD functions in plants, suggesting that this type of NMD is evolutionary conserved. We demonstrate that in plants, like in vertebrates, introns located >50 nt from the stop induces NMD. We show that orthologs of all core EJC components are essential for intron-based plant NMD and that plant Partner of Y14 and mago (PYM) also acts as EJC disassembly factor. Moreover, we found that complex autoregulatory circuits control the activity of plant NMD. We demonstrate that expression of suppressor with morphogenic effect on genitalia (SMG)7, which is essential for long 3′UTR- and intron-based NMD, is regulated by both types of NMD, whereas expression of Barentsz EJC component is downregulated by intron-based NMD. PMID:23666629

  5. The role of transposable elements in the evolution of non-mammalian vertebrates and invertebrates

    Science.gov (United States)

    2010-01-01

    Background Transposable elements (TEs) have played an important role in the diversification and enrichment of mammalian transcriptomes through various mechanisms such as exonization and intronization (the birth of new exons/introns from previously intronic/exonic sequences, respectively), and insertion into first and last exons. However, no extensive analysis has compared the effects of TEs on the transcriptomes of mammals, non-mammalian vertebrates and invertebrates. Results We analyzed the influence of TEs on the transcriptomes of five species, three invertebrates and two non-mammalian vertebrates. Compared to previously analyzed mammals, there were lower levels of TE introduction into introns, significantly lower numbers of exonizations originating from TEs and a lower percentage of TE insertion within the first and last exons. Although the transcriptomes of vertebrates exhibit significant levels of exonization of TEs, only anecdotal cases were found in invertebrates. In vertebrates, as in mammals, the exonized TEs are mostly alternatively spliced, indicating that selective pressure maintains the original mRNA product generated from such genes. Conclusions Exonization of TEs is widespread in mammals, less so in non-mammalian vertebrates, and very low in invertebrates. We assume that the exonization process depends on the length of introns. Vertebrates, unlike invertebrates, are characterized by long introns and short internal exons. Our results suggest that there is a direct link between the length of introns and exonization of TEs and that this process became more prevalent following the appearance of mammals. PMID:20525173

  6. Heritability in the efficiency of nonsense-mediated mRNA decay in humans

    KAUST Repository

    Seoighe, Cathal

    2010-07-21

    Background: In eukaryotes mRNA transcripts of protein-coding genes in which an intron has been retained in the coding region normally result in premature stop codons and are therefore degraded through the nonsense-mediated mRNA decay (NMD) pathway. There is evidence in the form of selective pressure for in-frame stop codons in introns and a depletion of length three introns that this is an important and conserved quality-control mechanism. Yet recent reports have revealed that the efficiency of NMD varies across tissues and between individuals, with important clinical consequences. Principal Findings: Using previously published Affymetrix exon microarray data from cell lines genotyped as part of the International HapMap project, we investigated whether there are heritable, inter-individual differences in the abundance of intron-containing transcripts, potentially reflecting differences in the efficiency of NMD. We identified intronic probesets using EST data and report evidence of heritability in the extent of intron expression in 56 HapMap trios. We also used a genome-wide association approach to identify genetic markers associated with intron expression. Among the top candidates was a SNP in the DCP1A gene, which forms part of the decapping complex, involved in NMD. Conclusions: While we caution that some of the apparent inter-individual difference in intron expression may be attributable to different handling or treatments of cell lines, we hypothesize that there is significant polymorphism in the process of NMD, resulting in heritable differences in the abundance of intronic mRNA. Part of this phenotype is likely to be due to a polymorphism in a decapping enzyme on human chromosome 3. © 2010 Seoighe, Gehring.

  7. Heritability in the efficiency of nonsense-mediated mRNA decay in humans.

    LENUS (Irish Health Repository)

    Seoighe, Cathal

    2010-01-01

    BACKGROUND: In eukaryotes mRNA transcripts of protein-coding genes in which an intron has been retained in the coding region normally result in premature stop codons and are therefore degraded through the nonsense-mediated mRNA decay (NMD) pathway. There is evidence in the form of selective pressure for in-frame stop codons in introns and a depletion of length three introns that this is an important and conserved quality-control mechanism. Yet recent reports have revealed that the efficiency of NMD varies across tissues and between individuals, with important clinical consequences. PRINCIPAL FINDINGS: Using previously published Affymetrix exon microarray data from cell lines genotyped as part of the International HapMap project, we investigated whether there are heritable, inter-individual differences in the abundance of intron-containing transcripts, potentially reflecting differences in the efficiency of NMD. We identified intronic probesets using EST data and report evidence of heritability in the extent of intron expression in 56 HapMap trios. We also used a genome-wide association approach to identify genetic markers associated with intron expression. Among the top candidates was a SNP in the DCP1A gene, which forms part of the decapping complex, involved in NMD. CONCLUSIONS: While we caution that some of the apparent inter-individual difference in intron expression may be attributable to different handling or treatments of cell lines, we hypothesize that there is significant polymorphism in the process of NMD, resulting in heritable differences in the abundance of intronic mRNA. Part of this phenotype is likely to be due to a polymorphism in a decapping enzyme on human chromosome 3.

  8. Molecular characterization of beta-tubulin gene from Pleurotus sajor-caju.

    Science.gov (United States)

    Kim, B G; Yoo, Y B; Kwon, S T; Magae, Y

    2001-10-01

    A beta-tubulin gene (TUB1) from the basidiomycete Pleurotus sajor-caju was sequenced. TUB1 encodes a 446-amino-acid protein. The coding region is interrupted by 9 introns, all of which had a 5'-GTRNGT... YAG-3' sequence at the boundaries. Locations of the introns in TUB1 were common between the beta-tubulin genes of other basidiomycetes, but not with animals, ascomycetes, or plants. This suggests that the introns were inserted independently into the beta-tubulin gene after these divisions had diverged.

  9. Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

    OpenAIRE

    Dall'Olio, Stefania; Fontanesi, Luca; Nanni Costa, Leonardo; Tassinari, Marco; Minieri, Laura; Falaschini, Adalberto

    2010-01-01

    Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T > C and GQ183900:g.156T > C, the latter loc...

  10. An mRNA is capped by a 2', 5' lariat catalyzed by a group I-like ribozyme

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Westhof, Eric; Johansen, Steinar

    2005-01-01

    Twin-ribozyme introns are formed by two ribozymes belonging to the group I family and occur in some ribosomal RNA transcripts. The group I-like ribozyme, GIR1, liberates the 5' end of a homing endonuclease messenger RNA in the slime mold Didymium iridis. We demonstrate that this cleavage occurs...... by a transesterification reaction with the joining of the first and the third nucleotide of the messenger by a 2',5'-phosphodiester linkage. Thus, a group I-like ribozyme catalyzes an RNA branching reaction similar to the first step of splicing in group II introns and spliceosomal introns. The resulting short lariat...

  11. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    DEFF Research Database (Denmark)

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.

    2003-01-01

    in the amino acid sequences except for one polymorphism in, the leader sequence of CTLA-4. In the present study, we examined the ICOS gene of an unrelated group of healthy donors from the Danish population. We were able to report 16 intronic SNP, one intronic G-insert and two repeat regions in intron 4...... resided in putative NF-kB and Sp1 sites In accordance with. previous studies we detected no variations in the coding regions except for a rare polymorphism that was found in one donor in the last codon of exon 5, which lead to a heterozygous genotype, but no amino acid change. This suggests...

  12. tRNA splicing

    OpenAIRE

    Abelson, John; Trotta, Christopher R.; Li, Hong

    1998-01-01

    Introns interrupt the continuity of many eukaryal genes, and therefore their removal by splicing is a crucial step in gene expression. Interestingly, even within Eukarya there are at least four splicing mechanisms. mRNA splicing in the nucleus takes place in two phosphotransfer reactions on a complex and dynamic machine, the spliceosome. This reaction is related in mechanism to the two self-splicing mechanisms for Group 1 and Group 2 introns. In fact the Group 2 introns are spliced by an iden...

  13. Detection of combined genomic variants in a Jordanian family with ...

    Indian Academy of Sciences (India)

    TSHR) gene was performed by direct sequencing of genomic DNA extracted from peripheral blood leukocytes of all family members. The sequence analysis of all TSHR gene exons and intron borders revealed two genomic variants. The first ...

  14. Linkage disequilibria among (CA){sub n} polymorphisms in the human dystrophin gene and their implications in carrier detection and prenatal diagnosis in Duchenne and Becker musclar dystrophies