WorldWideScience

Sample records for intramolecular quadruplexes sequence

  1. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  2. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  3. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  4. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  5. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  6. Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons

    Czech Academy of Sciences Publication Activity Database

    Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris

    2014-01-01

    Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  7. Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

    2016-01-01

    Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

  8. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  9. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  11. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  12. Extended molecular dynamics of a c-kit promoter quadruplex

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

    2015-01-01

    Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  13. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  14. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  15. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  16. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  17. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    Science.gov (United States)

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  18. Co-transcriptional formation of DNA:RNA hybrid G-quadruplex and potential function as constitutional cis element for transcription control.

    Science.gov (United States)

    Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng

    2013-05-01

    G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.

  19. DNA secondary structures: stability and function of G-quadruplex structures

    Science.gov (United States)

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  20. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  2. Effect of Urea on G-Quadruplex Stability.

    Science.gov (United States)

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  3. Studies of G-quadruplexes formed within self-assembled DNA mini-circles.

    Science.gov (United States)

    Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon

    2016-10-13

    We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.

  4. A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

    Science.gov (United States)

    Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

    2017-09-20

    Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

  5. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  6. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  7. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Directory of Open Access Journals (Sweden)

    Charlotte Rehm

    Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  8. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Science.gov (United States)

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  9. Experimental approaches to identify cellular G-quadruplex structures and functions.

    Science.gov (United States)

    Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar

    2012-05-01

    Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    Science.gov (United States)

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  11. Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

    Directory of Open Access Journals (Sweden)

    Bidisha Sengupta

    Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

  12. Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

    Science.gov (United States)

    Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

    2013-01-01

    Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

  13. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  14. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  15. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  16. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

    Science.gov (United States)

    Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

    2018-05-01

    Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

  18. Human telomere sequence DNA in water-free and high-viscosity solvents: G-quadruplex folding governed by Kramers rate theory.

    Science.gov (United States)

    Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V

    2012-09-19

    Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.

  19. Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

    Directory of Open Access Journals (Sweden)

    Victor Constantin Diculescu

    2010-01-01

    Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

  20. G-Quadruplex DNAzyme Molecular Beacon for Amplified Colorimetric Biosensing of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2013-01-01

    Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.

  1. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  2. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  3. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  4. A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

    Science.gov (United States)

    Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

    2012-01-01

    The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  5. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  6. Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

    Science.gov (United States)

    Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

    2015-06-22

    A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Thermal stability of DNA quadruplex-duplex hybrids.

    Science.gov (United States)

    Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

    2014-01-14

    DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

  8. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. G-Quadruplex conformational change driven by pH variation with potential application as a nanoswitch.

    Science.gov (United States)

    Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2013-10-01

    G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.

  10. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Aishwarya Prakash

    2011-01-01

    Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

  11. Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

    Directory of Open Access Journals (Sweden)

    Ezekiel Crenshaw

    Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

  12. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

    Science.gov (United States)

    Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

    2018-02-01

    Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

    Science.gov (United States)

    Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo

    2014-03-21

    In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    Science.gov (United States)

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  18. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...

  19. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  20. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  1. Interaction of pyrrolobenzodiazepine (PBD ligands with parallel intermolecular G-quadruplex complex using spectroscopy and ESI-MS.

    Directory of Open Access Journals (Sweden)

    Gajjela Raju

    Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.

  2. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  3. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  4. Selectivity in ligand recognition of G-quadruplex loops.

    Science.gov (United States)

    Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen

    2009-03-03

    A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.

  5. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  6. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    sequence of loops in the G-quadruplex module provided an equilibrium of antiparallel and parallel G-quadruplexes that shifted with cation binding. In conclusion, structures of G-quadruplex aptamers are flexible enough and are fine-tuned with different cation coordination.

  7. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  8. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  9. Repair of O6-methylguanine adducts in human telomeric G-quadruplex DNA by O6-alkylguanine-DNA alkyltransferase

    Science.gov (United States)

    Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.

    2014-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506

  10. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  11. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  12. DNA and RNA Quadruplex-Binding Proteins

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav

    2014-01-01

    Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014

  13. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  14. Triple Quenching of a Novel Self-Enhanced Ru(II) Complex by Hemin/G-Quadruplex DNAzymes and Its Potential Application to Quantitative Protein Detection.

    Science.gov (United States)

    Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo

    2015-08-04

    Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.

  15. Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

    2017-01-01

    Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  16. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  17. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  18. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  19. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    Science.gov (United States)

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.

    Science.gov (United States)

    Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni

    2018-02-10

    The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50  = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  2. Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.

    Science.gov (United States)

    Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke

    2016-01-01

    We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.

  3. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  4. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    Science.gov (United States)

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  5. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Computational Analysis of G-Quadruplex Forming Sequences across Chromosomes Reveals High Density Patterns Near the Terminal Ends.

    Directory of Open Access Journals (Sweden)

    Julia H Chariker

    Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.

  7. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  8. Utilization of circular dichroism and electrospray ionization mass spectrometry to understand the formation and conversion of G-quadruplex DNA at the human c-myb proto-oncogene.

    Science.gov (United States)

    Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui

    2018-10-05

    G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

    Science.gov (United States)

    Tawani, Arpita; Kumar, Amit

    2015-01-01

    Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

  10. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  11. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  12. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.

    Science.gov (United States)

    Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja

    2017-01-01

    G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  13. G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance

    Directory of Open Access Journals (Sweden)

    Vikas Yadav

    2017-07-01

    Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.

  14. Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents

    Science.gov (United States)

    Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David

    2013-01-01

    Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518

  15. Synthesis of potent G-quadruplex binders of macrocyclic heptaoxazole and evaluation of their activities.

    Science.gov (United States)

    Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo

    2009-01-01

    Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.

  16. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  17. Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

    Science.gov (United States)

    Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

    2017-08-01

    Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

  18. DNA sensors and aptasensors based on the hemin/G-quadruplex-controlled aggregation of Au NPs in the presence of L-cysteine.

    Science.gov (United States)

    Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar

    2014-07-23

    L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  20. Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

    Directory of Open Access Journals (Sweden)

    Dmitry Kaluzhny

    Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

  1. A label-free ultrasensitive fluorescence detection of viable Salmonella enteritidis using enzyme-induced cascade two-stage toehold strand-displacement-driven assembly of G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun

    2016-06-15

    The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  3. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  4. Macrocyclic G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, M C; Ulven, Trond

    2010-01-01

    are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...

  5. Fluorescent Dansyl-Guanosine Conjugates that Bind c-MYC Promoter G-Quadruplex and Downregulate c-MYC Expression.

    Science.gov (United States)

    Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee

    2016-03-02

    The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  7. Intramolecular and Transannular Diels-Alder Reactions

    DEFF Research Database (Denmark)

    Tanner, David Ackland; Ascic, Erhad

    2014-01-01

    Few reactions can compete with the Diels-Alder (DA) [4+2] cycloaddition for the rapid and efficient generation of molecular complexity. The DA reaction is atom-economic and stereospecific, as well as diastereo- and regioselective. The intramolecular version (IMDA) of the DA cycloaddition and its...... and dienophile, methods for acceleration of IMDA reactions (such as use of high pressure) and catalysis (using oxophilic or carbophilic metal complexes, Brønsted acids, and enzymes). The use of furans as diene components (IMDAF), intramolecular hetero-DA (IMHDA) and IMDA reactions with inverse electron demand...... are also covered. Applications of IMDA to asymmetric synthesis (from substrate control through to enantioselective catalysis, including organocatalysis) are presented, along with tandem sequences involving IMDA cycloaddition. A theme pervading the whole chapter is the use of IMDA reactions for the total...

  8. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    Science.gov (United States)

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  9. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

    Science.gov (United States)

    Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

    2014-09-01

    A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  12. Toward the design of new DNA G-quadruplex ligands through rational analysis of polymorphism and binding data.

    Science.gov (United States)

    Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano

    2013-10-01

    Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  13. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  15. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    Science.gov (United States)

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  16. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  17. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  18. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  19. A twice-as-smart synthetic G-quartet: PyroTASQ is both a smart quadruplex ligand and a smart fluorescent probe.

    Science.gov (United States)

    Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David

    2014-09-03

    Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.

  20. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  1. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  2. The Effects of Molecular Crowding on the Structure and Stability of G-Quadruplexes with an Abasic Site

    Science.gov (United States)

    Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-01-01

    Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901

  3. EThcD Discrimination of Isomeric Leucine/Isoleucine Residues in Sequencing of the Intact Skin Frog Peptides with Intramolecular Disulfide Bond

    Science.gov (United States)

    Samgina, Tatiana Yu; Kovalev, Sergey V.; Tolpina, Miriam D.; Trebse, Polonca; Torkar, Gregor; Lebedev, Albert T.

    2018-05-01

    Our scientific interests involve de novo sequencing of non-tryptic natural amphibian skin peptides including those with intramolecular S-S bond by means of exclusively mass spectrometry. Reliable discrimination of the isomeric leucine/isoleucine residues during peptide sequencing by means of mass spectrometry represents a bottleneck in the workflow for complete automation of the primary structure elucidation of these compounds. MS3 is capable of solving the problem. Earlier we demonstrated the advanced efficiency of ETD-HCD method to discriminate Leu/Ile in individual peptides by consecutive application of ETD to the polyprotonated peptides followed by HCD applied to the manually selected primary z-ions with the targeted isomeric residues at their N-termini and registration of the characteristic w-ions. Later this approach was extended to deal with several (4-7) broad band mass ranges, without special isolation of the primary z-ions. The present paper demonstrates an advanced version of this method when EThcD is applied in the whole mass range to a complex mixture of natural non-tryptic peptides without their separation and intermediate isolation of the targeted z-ions. The proposed EThcD method showed over 81% efficiency for the large natural peptides with intact disulfide ring, while the interfering process of radical site migration is suppressed. Due to higher speed and sensitivity, the proposed EThcD approach facilitates the analytical procedure and allows for the automation of the entire experiment and data processing. Moreover, in some cases it gives a chance to establish the nature of the residues in the intact intramolecular disulfide loops. [Figure not available: see fulltext.

  4. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  5. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    Science.gov (United States)

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    Science.gov (United States)

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  7. Development of a carbazole-based fluorescence probe for G-quadruplex DNA: The importance of side-group effect on binding specificity

    Science.gov (United States)

    Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao

    2018-06-01

    G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.

  8. Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates

    International Nuclear Information System (INIS)

    Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.

    1991-01-01

    Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures

  9. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  10. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  11. Intramolecular Association within the SAFT Framework

    DEFF Research Database (Denmark)

    Avlund, Ane Søgaard; Kontogeorgis, Georgios; Chapman, Walter G.

    2011-01-01

    A general theory for modelling intramolecular association within the SAFT framework is proposed. Sear and Jackson [Phys. Rev. E. 50 (1), 386 (1994)] and Ghonasgi and Chapman [J. Chem. Phys. 102 (6), 2585 (1995)] have previously extended SAFT to include intramolecular association for chains with two...... the contribution to the Helmholtz free energy from association (inter- as well as intramolecularly) at equilibrium. Sear and Jackson rederived the contribution to the Helmholtz free energy from association from the theory by Wertheim [J. Stat. Phys. 42 (3–4), 459 (1986)] with inclusion of intramolecular...

  12. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  13. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  14. The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

    Science.gov (United States)

    Zaccaria, F; Paragi, G; Fonseca Guerra, C

    2016-08-21

    The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

  15. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  16. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

    2017-01-01

    Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  18. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  19. Stability of Human Telomere Quadruplexes at High DNA Concentrations

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.

    2014-01-01

    Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

  20. Investigation of ‘Head-to-Tail’-Connected Oligoaryl N,O-Ligands as Recognition Motifs for Cancer-Relevant G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Natalia Rizeq

    2017-12-01

    Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.

  1. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  2. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  3. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  4. Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

    Science.gov (United States)

    Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

    2014-08-01

    Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  5. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Science.gov (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  6. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  9. An intramolecular [2 + 2] cycloaddition of ketenimines via palladium-catalyzed rearrangements of N-allyl-ynamides.

    Science.gov (United States)

    DeKorver, Kyle A; Hsung, Richard P; Song, Wang-Ze; Wang, Xiao-Na; Walton, Mary C

    2012-06-15

    A cascade of Pd-catalyzed N-to-C allyl transfer-intramolecular ketenimine-[2 + 2] cycloadditions of N-allyl ynamides is described. This tandem sequence is highly stereoselective and the [2 + 2] cycloaddition could be rendered in a crossed or fused manner depending on alkene substitutions, leading to bridged and fused bicycloimines.

  10. Excited state Intramolecular Proton Transfer in Anthralin

    DEFF Research Database (Denmark)

    Møller, Søren; Andersen, Kristine B.; Spanget-Larsen, Jens

    1998-01-01

    Quantum chemical calculations performed on anthralin (1,8-dihydroxy-9(10H)-anthracenone) predict the possibility of an excited-state intramolecular proton transfer process. Fluorescence excitation and emission spectra of the compound dissolved in n-hexane at ambient temperature results in an unus......Quantum chemical calculations performed on anthralin (1,8-dihydroxy-9(10H)-anthracenone) predict the possibility of an excited-state intramolecular proton transfer process. Fluorescence excitation and emission spectra of the compound dissolved in n-hexane at ambient temperature results......, associated with an excited-state intramolecular proton transfer process....

  11. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Science.gov (United States)

    Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

    2011-01-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

  12. Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

    Science.gov (United States)

    Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

    2015-01-01

    Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

  13. Fast and versatile microwave-assisted intramolecular Heck reaction in peptide macrocyclization using microwave energy.

    Science.gov (United States)

    Byk, Gerardo; Cohen-Ohana, Mirit; Raichman, Daniel

    2006-01-01

    We have revisited the intramolecular Heck reaction and investigated the microwave-assisted macrocyclization on preformed peptides using a model series of ring-varying peptides acryloyl-Gly-[Gly](n)-Phe(4-I)NHR; n = 0-4. The method was applied to both solution and solid supported cyclizations. We demonstrate that the intramolecular Heck reaction can be performed in peptides both in solution and solid support using a modified domestic microwave within 1 to 30 minutes in DMF under reflux with moderate yields ranging from 15 to 25% for a scale between 2-45 mg of linear precursors. The approach was applied to the synthesis of a constrained biologically relevant peptidomimetic bearing an Arg-Gly-Asp (RGD) sequence. These results make the microwave-assisted Heck reaction an attractive renovated approach for peptidomimetics. Copyright 2006 Wiley Periodicals, Inc.

  14. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  15. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  16. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

    Science.gov (United States)

    Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

    2011-12-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

  17. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These “Spare Tires” Have an Evolved Function?

    Science.gov (United States)

    2015-01-01

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692

  18. Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

    Directory of Open Access Journals (Sweden)

    Yunqiang Bian

    2014-04-01

    Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.

  19. Porous platinum nanotubes labeled with hemin/G-quadruplex based electrochemical aptasensor for sensitive thrombin analysis via the cascade signal amplification.

    Science.gov (United States)

    Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping

    2014-07-15

    For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  1. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  2. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    Science.gov (United States)

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  3. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    Science.gov (United States)

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  5. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  6. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

    Science.gov (United States)

    Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

    2015-05-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  8. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    Science.gov (United States)

    Dhapola, Parashar; Chowdhury, Shantanu

    2016-01-01

    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  9. Intramolecular hydrogen bonding in malonaldehyde and its radical analogues.

    Science.gov (United States)

    Lin, Chen; Kumar, Manoj; Finney, Brian A; Francisco, Joseph S

    2017-09-28

    High level Brueckner doubles with triples correction method-based ab initio calculations have been used to investigate the nature of intramolecular hydrogen bonding and intramolecular hydrogen atom transfer in cis-malonaldehyde (MA) and its radical analogues. The radicals considered here are the ones that correspond to the homolytic cleavage of C-H bonds in cis-MA. The results suggest that cis-MA and its radical analogues, cis-MA RS , and cis-MA RA , both exist in planar geometry. The calculated intramolecular O-H⋯O=C bond in cis-MA is shorter than that in the radical analogues. The intramolecular hydrogen bond in cis-MA is stronger than in its radicals by at least 3.0 kcal/mol. The stability of a cis-malonaldehyde radical correlates with the extent of electron spin delocalization; cis-MA RA , in which the radical spin is more delocalized, is the most stable MA radical, whereas cis-MA RS , in which the radical spin is strongly localized, is the least stable radical. The natural bond orbital analysis indicates that the intramolecular hydrogen bonding (O⋯H⋯O) in cis-malonaldehyde radicals is stabilized by the interaction between the lone pair orbitals of donor oxygen and the σ * orbital of acceptor O-H bond (n → σ * OH ). The calculated barriers indicate that the intramolecular proton transfer in cis-MA involves 2.2 kcal/mol lower barrier than that in cis-MA RS .

  10. Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela

    2009-01-01

    Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009

  11. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  12. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  13. Identification of a New G-Quadruplex Motif in the KRAS Promoter and Design of Pyrene-Modified G4-Decoys with Antiproliferative Activity in Pancreatic Cancer Cells

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav

    2009-01-01

    A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....

  14. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  15. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  16. RPA-mediated unfolding of systematically varying G-quadruplex structures.

    Science.gov (United States)

    Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza

    2013-05-21

    G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří

    2004-01-01

    Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004

  18. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  19. Higher-order human telomeric G-quadruplex DNA metalloenzymes enhance enantioselectivity in the Diels-Alder reaction.

    Science.gov (United States)

    Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can

    2015-03-02

    Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Solvent-dependent reactions for the synthesis of β-keto-benzo-δ-sultone scaffolds via DBU-catalyzed O-sulfonylation/intramolecular Baylis-Hillman/1,3-H shift or dehydration tandem sequences.

    Science.gov (United States)

    Ghandi, Mehdi; Bozcheloei, Abolfazl Hasani; Nazari, Seyed Hadi; Sadeghzadeh, Masoud

    2011-12-16

    We have developed a solvent-dependent method for the synthesis of novel benzo-δ-sultone scaffolds. A variety of benzylbenzo[e][1,2]oxathiin-4(3H)-one-2,2-dioxides were obtained in high yields in DMF using a one-pot, DBU-catalyzed condensation of 2-hydroxybenzaldehydes with a number of (E)-2-phenylethenesulfonyl chlorides. On the other hand, the initially prepared 2-formylphenyl-(E)-2-phenylethenesulfonate derivatives underwent DBU-catalyzed reactions to a series of 3-[methoxy(phenyl)methyl]benzo[e][1,2]oxathiine-2,2-dioxides in moderate to good yields in MeOH. These reactions presumably proceed via DBU-catalyzed O-sulfonylation/intramolecular Baylis-Hillman/1,3-H shift or dehydration tandem sequences, respectively.

  1. New stereoselective intramolecular

    Science.gov (United States)

    Alajarin; Vidal; Tovar; Ramirez De Arellano MC; Cossio; Arrieta; Lecea

    2000-11-03

    Efficient 1,4-asymmetric induction has been achieved in the highly stereocontrolled intramolecular [2 + 2] cycloadditions between ketenimines and imines, leading to 1,2-dihydroazeto[2, 1-b]quinazolines. The chiral methine carbon adjacent to the iminic nitrogen controls the exclusive formation of the cycloadducts with relative trans configuration at C2 and C8. The stepwise mechanistic model, based on theoretical calculations, fully supports the stereochemical outcome of these cycloadditions.

  2. Thermodynamic, Anticoagulant, and Antiproliferative Properties of Thrombin Binding Aptamer Containing Novel UNA Derivative

    DEFF Research Database (Denmark)

    Kotkowiak, Weronika; Lisowiec-Wachnicka, Jolanta; Grynda, Jakub

    2018-01-01

    Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antipar......Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular......, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation......-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G...

  3. The Effect of INA [(R)-1-O-(1-Pyrenylmethyl)Glycerol] Insertions on the Structure and Biological Activity of a G-Quadruplex from a Critical Kras G-Rich Sequence

    DEFF Research Database (Denmark)

    Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.

    2007-01-01

    Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...

  4. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    Science.gov (United States)

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  5. Fully integrated graphene electronic biosensor for label-free detection of lead (II) ion based on G-quadruplex structure-switching.

    Science.gov (United States)

    Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu

    2017-03-15

    This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Derivation of Reliable Geometries in QM Calculations of DNA Structures: Explicit Solvent QM/MM and Restrained Implicit Solvent QM Optimizations of G-Quadruplexes.

    Science.gov (United States)

    Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří

    2016-04-12

    Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.

  7. Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

    Czech Academy of Sciences Publication Activity Database

    Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

    2014-01-01

    Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  8. Intramolecular addition of benzylic radicals onto ketenimines. Synthesis of 2-alkylindoles.

    Science.gov (United States)

    Alajarín, Mateo; Vidal, Angel; Ortín, María-Mar

    2003-12-07

    The inter- and intramolecular addition of free radicals onto ketenimines is studied. All the attempts to add intermolecularly several silicon, oxygen or carbon centered radicals to N-(4-methylphenyl)-C,C-diphenyl ketenimine were unsuccessful. In contrast, the intramolecular addition of benzylic radicals, generated from xanthates, onto the central carbon of a ketenimine function with its N atom linked to the ortho position of the aromatic ring occurred under a variety of reaction conditions. These intramolecular cyclizations provide a novel radical-mediated synthesis of 2-alkylindoles.

  9. Intramolecular and nonlinear dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Davis, M.J. [Argonne National Laboratory, IL (United States)

    1993-12-01

    Research in this program focuses on three interconnected areas. The first involves the study of intramolecular dynamics, particularly of highly excited systems. The second area involves the use of nonlinear dynamics as a tool for the study of molecular dynamics and complex kinetics. The third area is the study of the classical/quantum correspondence for highly excited systems, particularly systems exhibiting classical chaos.

  10. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  11. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Science.gov (United States)

    Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.

    2017-10-01

    We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.

  12. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2018-06-01

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  13. Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

    105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

  14. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  15. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  16. Highly efficient induction of chirality in intramolecular

    Science.gov (United States)

    Cossio; Arrieta; Lecea; Alajarin; Vidal; Tovar

    2000-06-16

    Highly stereocontrolled, intramolecular [2 + 2] cycloadditions between ketenimines and imines leading to 1,2-dihydroazeto[2, 1-b]quinazolines have been achieved. The source of stereocontrol is a chiral carbon atom adjacent either to the iminic carbon or nitrogen atom. In the first case, the stereocontrol stems from the preference for the axial conformer in the first transition structure. In the second case, the origin of the stereocontrol lies on the two-electron stabilizing interaction between the C-C bond being formed and the sigma orbital corresponding to the polar C-X bond, X being an electronegative atom. These models can be extended to other related systems for predicting the stereochemical outcome in this intramolecular reaction.

  17. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  18. Photoswitchable Intramolecular H-Stacking of Perylenebisimide

    NARCIS (Netherlands)

    Wang, Jiaobing; Kulago, Artem; Browne, Wesley R.; Feringa, Ben L.

    2010-01-01

    Dynamic control over the formation of H- or J-type aggregates of chromophores is of fundamental importance for developing responsive organic optoelectronic materials. In this study, the first example of photoswitching between a nonstacked and an intramolecularly H-stacked arrangement of

  19. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  20. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding

    Science.gov (United States)

    Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza

    2014-01-01

    Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170

  2. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  3. 6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

    Science.gov (United States)

    Marathias, V M; Sawicki, M J; Bolton, P H

    1999-07-15

    The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

  4. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    Science.gov (United States)

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Conductance and activation energy for electron transport in series and parallel intramolecular circuits.

    Science.gov (United States)

    Hsu, Liang-Yan; Wu, Ning; Rabitz, Herschel

    2016-11-30

    We investigate electron transport through series and parallel intramolecular circuits in the framework of the multi-level Redfield theory. Based on the assumption of weak monomer-bath couplings, the simulations depict the length and temperature dependence in six types of intramolecular circuits. In the tunneling regime, we find that the intramolecular circuit rule is only valid in the weak monomer coupling limit. In the thermally activated hopping regime, for circuits based on two different molecular units M a and M b with distinct activation energies E act,a > E act,b , the activation energies of M a and M b in series are nearly the same as E act,a while those in parallel are nearly the same as E act,b . This study gives a comprehensive description of electron transport through intramolecular circuits from tunneling to thermally activated hopping. We hope that this work can motivate additional studies to design intramolecular circuits based on different types of building blocks, and to explore the corresponding circuit laws and the length and temperature dependence of conductance.

  6. Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

    2016-01-01

    Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

  7. Intramolecular migration of amide hydrogens in protonated peptides upon collisional activation

    DEFF Research Database (Denmark)

    Jørgensen, Thomas J. D.; Gårdsvoll, H.; Ploug, M.

    2005-01-01

    Presently different opinions exist as to the degree of scrambling of amide hydrogens in gaseous protonated peptides and proteins upon collisional activation in tandem mass spectrometry experiments. This unsettled controversy is not trivial, since only a very low degree of scrambling is tolerable...... if collision-induced dissociation (CID) should provide reliable site-specific information from (1)H/(2)H exchange experiments. We have explored a series of unique, regioselectively deuterium-labeled peptides as model systems to probe for intramolecular amide hydrogen migration under low-energy collisional...... are protected against exchange with the solvent, while the amide hydrogens of the nonbinding sequences exchange rapidly with the solvent. We have utilized such long-lived complexes to generate peptides labeled with deuterium in either the binding or nonbinding region, and the expected regioselectivity...

  8. Solvent control of intramolecular proton transfer

    DEFF Research Database (Denmark)

    Manolova, Y.; Marciniak, Heinz; Tschierlei, S.

    2017-01-01

    of molecules in the enol and zwitterionic proton transfer (PT) form exists in the ground state. However, the zwitterion is the energetically favored one in the electronically excited state. Optical excitation of the enol form results in intramolecular proton transfer and formation of the PT form within 1.4 ps...

  9. Competing Intramolecular vs. Intermolecular Hydrogen Bonds in Solution

    Directory of Open Access Journals (Sweden)

    Peter I. Nagy

    2014-10-01

    Full Text Available A hydrogen bond for a local-minimum-energy structure can be identified according to the definition of the International Union of Pure and Applied Chemistry (IUPAC recommendation 2011 or by finding a special bond critical point on the density map of the structure in the framework of the atoms-in-molecules theory. Nonetheless, a given structural conformation may be simply favored by electrostatic interactions. The present review surveys the in-solution competition of the conformations with intramolecular vs. intermolecular hydrogen bonds for different types of small organic molecules. In their most stable gas-phase structure, an intramolecular hydrogen bond is possible. In a protic solution, the intramolecular hydrogen bond may disrupt in favor of two solute-solvent intermolecular hydrogen bonds. The balance of the increased internal energy and the stabilizing effect of the solute-solvent interactions regulates the new conformer composition in the liquid phase. The review additionally considers the solvent effects on the stability of simple dimeric systems as revealed from molecular dynamics simulations or on the basis of the calculated potential of mean force curves. Finally, studies of the solvent effects on the type of the intermolecular hydrogen bond (neutral or ionic in acid-base complexes have been surveyed.

  10. Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

    Science.gov (United States)

    Rackwitz, Jenny; Bald, Ilko

    2018-03-26

    During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Intramolecularly Hydrogen-Bonded Polypyrroles as Electro-Optical Sensors

    National Research Council Canada - National Science Library

    Nicholson, Jesse

    2001-01-01

    We have developed a new class of polypyrroles bearing both hydrogen-bond acceptor and hydrogen-donor groups such that the intramolecular hydrogen bonding holds the system planar enhancing conjugation...

  12. INTRAMOLECULAR ISOTOPE EFFECTS IN HYDROCARBON MASS SPECTRA

    Energy Technology Data Exchange (ETDEWEB)

    Stevenson, D. P.; Schachtschneider, J. H.

    1963-07-15

    Approximate calculations based on the quasi-equilibrium rate theory of the origin of mass spectra are shown to lead to an approximately correct magnitude for the intramolecular ( pi /sup -/) isotope effect on C--H bond dissociation probabilities of various deuterohydrocarbons. (auth)

  13. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.

    2011-01-01

    Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011

  14. Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.

    Science.gov (United States)

    Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V

    2015-03-28

    Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.

  15. Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

    Science.gov (United States)

    Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-12-01

    Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

  16. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  17. Effects of acid concentration on intramolecular charge transfer ...

    Indian Academy of Sciences (India)

    rate. Time-dependent density functional theory calculations have been performed to understand the observed spectroscopic results. Keywords. Intramolecular charge transfer; absorption and fluorescence; time resolved fluorescence measurements; acid concentration dependence; time-dependent density functional theory.

  18. Targeting G-quadruplex DNA Structures by EMICORON has a strong antitumor efficacy against advanced models of human colon cancer

    DEFF Research Database (Denmark)

    Porru, Manuela; Artuso, Simona; Salvati, Erica

    2015-01-01

    We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...

  19. Intramolecular Hydrogen Bonding and Conformational Preferences of Arzanol—An Antioxidant Acylphloroglucinol

    Directory of Open Access Journals (Sweden)

    Liliana Mammino

    2017-08-01

    Full Text Available Arzanol is a naturally-occurring prenylated acylphloroglucinol isolated from Helichrysum italicum and exhibiting anti-oxidant, antibiotic and antiviral activities. The molecule contains an α-pyrone moiety attached to the phloroglucinol moiety through a methylene bridge. The presence of several hydrogen bond donor or acceptor sites makes intramolecular hydrogen bonding patterns the dominant stabilising factor. Conformers with all the possible different hydrogen bonding patterns were calculated at the HF/6-31G(d,p and DFT/B3LYP/6-31+G(d,p levels with fully relaxed geometry in vacuo and in three solvents—chloroform, acetonitrile and water (these levels being chosen to enable comparisons with previous studies on acylphloroglucinols. Calculations in solution were performed with the Polarisable Continuum Model. The results show that the lowest energy conformers have the highest number of stronger intramolecular hydrogen bonds. The influence of intramolecular hydrogen bonding patterns on the other molecular properties is also analysed.

  20. G-Quadruplexes influence pri-microRNA processing.

    Science.gov (United States)

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  1. Vinylcyclopropylacyl and polyeneacyl radicals. Intramolecular ketene alkyl radical additions in ring synthesis.

    Science.gov (United States)

    De Boeck, Benoit; Herbert, Nicola M A; Harrington-Frost, Nicole M; Pattenden, Gerald

    2005-01-21

    Treatment of a variety of substituted vinylcyclopropyl selenyl esters, e.g. 11, with Bu(3)SnH-AIBN in refluxing benzene leads to the corresponding acyl radical intermediates, which undergo rearrangement and intramolecular cyclisations via their ketene alkyl radical equivalents producing cyclohexenones in 50-60% yield. By contrast, treatment of conjugated triene selenyl esters, e.g. 32, with Bu(3)SnH-AIBN produces substituted 2-cyclopentenones via intramolecular cyclisations of their ketene alkyl radical intermediates. Under the same radical-initiating conditions the selenyl esters derived from o-vinylbenzoic acid and o-vinylcinnamic acid undergo intramolecular cyclisations producing 1-indanone and 5,6-dihydrobenzocyclohepten-7-one respectively in 60-70% yields. A tandem radical cyclisation from the alpha,beta,gamma,delta-diene selenyl ester 31 provides an expeditious synthesis of the diquinane 35 in 69% yield.

  2. Structure and Intramolecular Proton Transfer of Alanine Radical Cations

    International Nuclear Information System (INIS)

    Lee, Gab Yong

    2012-01-01

    The structures of the four lowest alanine conformers, along with their radical cations and the effect of ionization on the intramolecular proton transfer process, are studied using the density functional theory and MP2 method. The energy order of the radical cations of alanine differs from that of the corresponding neutral conformers due to changes in the basicity of the NH 2 group upon ionization. Ionization favors the intramolecular proton transfer process, leading to a proton-transferred radical-cation structure, [NH 3 + -CHCH 3 -COO·], which contrasts with the fact that a proton-transferred zwitterionic conformer is not stable for a neutral alanine in the gas phase. The energy barrier during the proton transfer process is calculated to be about 6 kcal/mol

  3. Intramolecular electron transfer in single-site-mutated azurins

    DEFF Research Database (Denmark)

    Farver, O; Skov, L K; Pascher, T

    1993-01-01

    . Natl. Acad. Sci. U.S.A. 86, 6968-6972]. The RSSR- radical produced in the above reaction was reoxidized in a slower intramolecular electron-transfer process (30-70 s-1 at 298 K) concomitant with a further reduction of the Cu(II) ion. The temperature dependence of the latter rates was determined......, lambda = 135 kJ mol-1 for the reorganization energy was derived. When Trp48, situated midway between the donor and the acceptor, was replaced by Leu or Met, only a small change in the rate of intramolecular electron transfer was observed, indicating that the aromatic residue in this position...... is apparently only marginally involved in electron transfer in wild-type azurin. Pathway calculations also suggest that a longer, through-backbone path is more efficient than the shorter one involving Trp48. The former pathway yields an exponential decay factor, beta, of 6.6 nm-1. Another mutation, raising...

  4. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...

  6. Symmetry of intramolecular quantum dynamics

    CERN Document Server

    Burenin, Alexander V

    2012-01-01

    The main goal of this book is to give a systematic description of intramolecular quantum dynamics on the basis of only the symmetry principles. In this respect, the book has no analogs in the world literature. The obtained models lead to a simple, purely algebraic, scheme of calculation and are rigorous in the sense that their correctness is limited only to the correct choice of symmetry of the internal dynamics. The book is basically intended for scientists working in the field of molecular spectroscopy, quantum and structural chemistry.

  7. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  8. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  9. Benzothiazole-Based AIEgen with Tunable Excited-State Intramolecular Proton Transfer and Restricted Intramolecular Rotation Processes for Highly Sensitive Physiological pH Sensing.

    Science.gov (United States)

    Li, Kai; Feng, Qi; Niu, Guangle; Zhang, Weijie; Li, Yuanyuan; Kang, Miaomiao; Xu, Kui; He, Juan; Hou, Hongwei; Tang, Ben Zhong

    2018-04-23

    In this work, a benzothiazole-based aggregation-induced emission luminogen (AIEgen) of 2-(5-(4-carboxyphenyl)-2-hydroxyphenyl)benzothiazole (3) was designed and synthesized, which exhibited multifluorescence emissions in different dispersed or aggregated states based on tunable excited-state intramolecular proton transfer (ESIPT) and restricted intramolecular rotation (RIR) processes. 3 was successfully used as a ratiometric fluorescent chemosensor for the detection of pH, which exhibited reversible acid/base-switched yellow/cyan emission transition. More importantly, the pH jump of 3 was very precipitous from 7.0 to 8.0 with a midpoint of 7.5, which was well matched with the physiological pH. This feature makes 3 very suitable for the highly sensitive detection of pH fluctuation in biosamples and neutral water samples. 3 was also successfully used as a ratiometric fluorescence chemosensor for the detection of acidic and basic organic vapors in test papers.

  10. Preparation of CN /Carbon Nanotube Intramolecular Junctions by ...

    African Journals Online (AJOL)

    NICO

    intramolecular junctions composed of CNx with a bamboo-like structure and empty hollow carbon nanotubes were observed, ... and excellent thermal and mechanical properties.1,2 In recent .... tion of hexane, and the other segment with a curved compart- ... by an arrow lies at the interface of the junction between 'b' and.

  11. Regulation of interleukin-4 signaling by extracellular reduction of intramolecular disulfides

    International Nuclear Information System (INIS)

    Curbo, Sophie; Gaudin, Raphael; Carlsten, Mattias; Malmberg, Karl-Johan; Troye-Blomberg, Marita; Ahlborg, Niklas; Karlsson, Anna; Johansson, Magnus; Lundberg, Mathias

    2009-01-01

    Interleukin-4 (IL-4) contains three structurally important intramolecular disulfides that are required for the bioactivity of the cytokine. We show that the cell surface of HeLa cells and endotoxin-activated monocytes can reduce IL-4 intramolecular disulfides in the extracellular space and inhibit binding of IL-4 to the IL-4Rα receptor. IL-4 disulfides were in vitro reduced by thioredoxin 1 (Trx1) and protein disulfide isomerase (PDI). Reduction of IL-4 disulfides by the cell surface of HeLa cells was inhibited by auranofin, an inhibitor of thioredoxin reductase that is an electron donor to both Trx1 and PDI. Both Trx1 and PDI have been shown to be located at the cell surface and our data suggests that these enzymes are involved in catalyzing reduction of IL-4 disulfides. The pro-drug N-acetylcysteine (NAC) that promotes T-helper type 1 responses was also shown to mediate the reduction of IL-4 disulfides. Our data provides evidence for a novel redox dependent pathway for regulation of cytokine activity by extracellular reduction of intramolecular disulfides at the cell surface by members of the thioredoxin enzyme family.

  12. Intramolecular BSSE and dispersion affect the structure of a dipeptide conformer

    Science.gov (United States)

    Hameed, Rabia; Khan, Afsar; van Mourik, Tanja

    2018-05-01

    B3LYP and MP2 calculations with the commonly-used 6-31+G(d) basis set predict qualitatively different structures for the Tyr-Gly conformer book1, which is the most stable conformer identified in a previous study. The structures differ mainly in the ψtyr Ramachandran angle (138° in the B3LYP structure and 120° in the MP2 structure). The causes for the discrepant structures are attributed to missing dispersion in the B3LYP calculations and large intramolecular BSSE in the MP2 calculations. The correct ψtyr value is estimated to be 130°. The MP2/6-31+G(d) profile identified an additional conformer, not present on the B3LYP surface, with a ψtyr value of 96° and a more folded structure. This minimum is, however, likely an artefact of large intramolecular BSSE values. We recommend the use of basis sets of at least quadruple-zeta quality in density functional theory (DFT), DFTaugmented with an empirical dispersion term (DFT-D) and second-order Møller-Plesset perturbation theory (MP2 ) calculations in cases where intramolecular BSSE is expected to be large.

  13. Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří

    2010-01-01

    Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010

  14. Sky-blue emitting bridged diiridium complexes: beneficial effects of intramolecular π-π stacking.

    Science.gov (United States)

    Congrave, Daniel G; Hsu, Yu-Ting; Batsanov, Andrei S; Beeby, Andrew; Bryce, Martin R

    2018-02-06

    The potential of intramolecular π-π interactions to influence the photophysical properties of diiridium complexes is an unexplored topic, and provides the motivation for the present study. A series of diarylhydrazide-bridged diiridium complexes functionalised with phenylpyridine (ppy)-based cyclometalating ligands is reported. It is shown by NMR studies in solution and single crystal X-ray analysis that intramolecular π-π interactions between the bridging and cyclometalating ligands rigidify the complexes leading to high luminescence quantum efficiencies in solution and in doped films. Fluorine substituents on the phenyl rings of the bridge promote the intramolecular π-π interactions. Notably, these non-covalent interactions are harnessed in the rational design and synthesis of the first examples of highly emissive sky-blue diiridium complexes featuring conjugated bridging ligands, for which they play a vital role in the structural and photophysical properties. Experimental results are supported by computational studies.

  15. Enantio- and Stereoselective Construction of Atisane Scaffold via Organocatalytic Intramolecular Michael Reaction and Diels-Alder Reaction.

    Science.gov (United States)

    Sekita, Hiroko; Adachi, Kyohei; Kobayashi, Ippei; Sato, Yusuke; Nakada, Masahisa

    2017-05-05

    An enantio- and stereoselective construction of the atisane scaffold via organocatalytic intramolecular Michael reaction and Diels-Alder reaction is described. The organocatalytic intramolecular Michael reaction has been found to stereoselectively generate a trans-stereodiad comprising an all-carbon quaternary and a tertiary stereogenic centers. Use of the chiral secondary amine bearing thiourea with benzoic acid as additive is the key to obtaining the desired product with excellent ee in synthetically acceptable yield. The prepared chiral building block has been successfully converted to the compound including the atisane scaffold via the highly stereoselective intramolecular Diels-Alder reaction.

  16. Label-free and enzyme-free detection of transcription factors with graphene oxide fluorescence switch-based multifunctional G-quadruplex-hairpin probe.

    Science.gov (United States)

    Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei

    2016-01-15

    Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  18. G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy.

    Directory of Open Access Journals (Sweden)

    Alexandro Membrino

    Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.

  19. Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.

    Science.gov (United States)

    Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar

    2010-06-01

    The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.

  20. Intramolecular inverse electron demand Diels-Alder reactions of pyrimidines

    NARCIS (Netherlands)

    Frissen, A.E.

    1990-01-01

    This thesis deals with the intramolecular inverse electron demand Diels-Alder reaction of pyrimidines. The main objective of the study was to investigate the synthetic applicability of this reaction and to get more insight in the electronic and steric effects which determine the reactivity

  1. Intramolecular 13C analysis of tree rings provides multiple plant ecophysiology signals covering decades.

    Science.gov (United States)

    Wieloch, Thomas; Ehlers, Ina; Yu, Jun; Frank, David; Grabner, Michael; Gessler, Arthur; Schleucher, Jürgen

    2018-03-22

    Measurements of carbon isotope contents of plant organic matter provide important information in diverse fields such as plant breeding, ecophysiology, biogeochemistry and paleoclimatology. They are currently based on 13 C/ 12 C ratios of specific, whole metabolites, but we show here that intramolecular ratios provide higher resolution information. In the glucose units of tree-ring cellulose of 12 tree species, we detected large differences in 13 C/ 12 C ratios (>10‰) among carbon atoms, which provide isotopically distinct inputs to major global C pools, including wood and soil organic matter. Thus, considering position-specific differences can improve characterisation of soil-to-atmosphere carbon fluxes and soil metabolism. In a Pinus nigra tree-ring archive formed from 1961 to 1995, we found novel 13 C signals, and show that intramolecular analysis enables more comprehensive and precise signal extraction from tree rings, and thus higher resolution reconstruction of plants' responses to climate change. Moreover, we propose an ecophysiological mechanism for the introduction of a 13 C signal, which links an environmental shift to the triggered metabolic shift and its intramolecular 13 C signature. In conclusion, intramolecular 13 C analyses can provide valuable new information about long-term metabolic dynamics for numerous applications.

  2. Rapid examination of the kinetic process of intramolecular lactamization of gabapentin using DSC-FTIR

    International Nuclear Information System (INIS)

    Hsu, C.-H.; Lin, S.-Y.

    2009-01-01

    The thermal stability and thermodynamics of gabapentin (GBP) in the solid state were investigated by DSC and TG techniques, and FTIR microspectroscopy. The detailed intramolecular lactamization process of GBP to form gabapentin-lactam (GBP-L) was also determined by thermal FTIR microspectroscopy. GBP exhibited a DSC endothermic peak at 169 deg. C. The weight loss in TG curve of GBP suggested that the evaporation process of water liberated via intramolecular lactamization was simultaneously combined with the evaporation process of GBP-L having a DSC endothermic peak at 91 deg. C. A thermal FTIR microspectroscopy clearly evidenced the IR spectra at 3350 cm -1 for water liberated and at 1701 cm -1 for lactam structure formed due to the lactam formation of GBP. This study indicates that the activation energy for combined processes of intramolecular lactamization of GBP and evaporation of GBP-L was about 114.3 ± 23.3 kJ/mol, but for the evaporation of GBP-L alone was 76.2 ± 1.5 kJ/mol. A powerful simultaneous DSC-FTIR combined technique was easily used to quickly examine the detailed kinetic processes of intramolecular cyclization of GPB and evaporation of GBP-L in the solid state

  3. Intramolecular Energy Transfer, Charge Transfer & Hydrogen Bond

    Indian Academy of Sciences (India)

    Ultrafast Dynamics of Chemical Reactions in Condensed Phase: Intramolecular Energy Transfer, Charge Transfer & Hydrogen Bond · PowerPoint Presentation · Slide 3 · Slide 4 · Slide 5 · Slide 6 · Slide 7 · Slide 8 · Slide 9 · Slide 10 · Slide 11 · Slide 12 · Slide 13 · Slide 14 · Slide 15 · Slide 16 · Slide 17 · Slide 18 · Slide 19.

  4. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Revaud, D.

    2009-06-01

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  5. A dynamic programming algorithm for identification of triplex-forming sequences

    Czech Academy of Sciences Publication Activity Database

    Lexa, M.; Martínek, T.; Burgetová, I.; Kopeček, D.; Brázdová, Marie

    2011-01-01

    Roč. 27, č. 18 (2011), s. 2510-2517 ISSN 1367-4803 R&D Projects: GA ČR(CZ) GA204/08/1560; GA ČR(CZ) GAP301/10/2370 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : OLIGONUCLEOTIDE TARGET SEQUENCES * INTRAMOLECULAR DNA TRIPLEXES * HELIX FORMATION Subject RIV: BO - Biophysics Impact factor: 5.468, year: 2011

  6. Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

    Science.gov (United States)

    Kocman, Vojč; Plavec, Janez

    2017-05-01

    Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

  7. OH stretching frequencies in systems with intramolecular hydrogen bonds

    DEFF Research Database (Denmark)

    Spanget-Larsen, Jens; Hansen, Bjarke Knud Vilster; Hansen, Poul Erik

    2011-01-01

    OH stretching wavenumbers were investigated for 30 species with intramolecularly hydrogen bonded hydroxyl groups, covering the range from 3600 to ca. 1900 cm-1. Theoretical wavenumbers were predicted with B3LYP/6-31G(d) density functional theory using the standard harmonic approximation, as well...

  8. Symmetry of quantum intramolecular dynamics

    International Nuclear Information System (INIS)

    Burenin, Alexander V

    2002-01-01

    The paper reviews the current progress in describing quantum intramolecular dynamics using merely symmetry principles as a basis. This closed qualitative approach is of particular interest because it is the only method currently available for a broad class of topical problems in the internal dynamics of molecules. Moreover, a molecule makes a physical system whose collective internal motions are geometrically structured, so that its description by perturbation methods requires a symmetry analysis of this structure. The nature of the geometrical symmetry groups crucial for the closed formulation of the qualitative approach is discussed. In particular, the point group of a molecule is of this type. (methodological notes)

  9. Mechanism of Intramolecular Rhodium- and Palladium-Catalyzed Alkene Alkoxyfunctionalizations

    KAUST Repository

    Vummaleti, Sai V. C.

    2015-11-13

    Density functional theory calculations have been used to investigate the reaction mechanism for the [Rh]-catalyzed intramolecular alkoxyacylation ([Rh] = [RhI(dppp)+] (dppp, 1,3-bis(diphenylphosphino)propane) and [Pd]/BPh3 dual catalytic system assisted intramolecular alkoxycyanation ([Pd] = Pd-Xantphos) using acylated and cyanated 2-allylphenol derivatives as substrates, respectively. Our results substantially confirm the proposed mechanism for both [Rh]- and [Pd]/ BPh3-mediated alkoxyfunctionalizations, offering a detailed geometrical and energetical understanding of all the elementary steps. Furthermore, for the [Rh]-mediated alkoxyacylation, our observations support the hypothesis that the quinoline group of the substrate is crucial to stabilize the acyl metal complex and prevent further decarbonylation. For [Pd]/BPh3-catalyzed alkoxycyanation, our findings clarify how the Lewis acid BPh3 cocatalyst accelerates the only slow step of the reaction, corresponding to the oxidative addition of the cyanate O-CN bond to the Pd center. © 2015 American Chemical Society.

  10. Mechanism of Intramolecular Rhodium- and Palladium-Catalyzed Alkene Alkoxyfunctionalizations

    KAUST Repository

    Vummaleti, Sai V. C.; Alghamdi, Miasser; Poater, Albert; Falivene, Laura; Scaranto, Jessica; Beetstra, Dirk J.; Morton, Jason G.; Cavallo, Luigi

    2015-01-01

    Density functional theory calculations have been used to investigate the reaction mechanism for the [Rh]-catalyzed intramolecular alkoxyacylation ([Rh] = [RhI(dppp)+] (dppp, 1,3-bis(diphenylphosphino)propane) and [Pd]/BPh3 dual catalytic system assisted intramolecular alkoxycyanation ([Pd] = Pd-Xantphos) using acylated and cyanated 2-allylphenol derivatives as substrates, respectively. Our results substantially confirm the proposed mechanism for both [Rh]- and [Pd]/ BPh3-mediated alkoxyfunctionalizations, offering a detailed geometrical and energetical understanding of all the elementary steps. Furthermore, for the [Rh]-mediated alkoxyacylation, our observations support the hypothesis that the quinoline group of the substrate is crucial to stabilize the acyl metal complex and prevent further decarbonylation. For [Pd]/BPh3-catalyzed alkoxycyanation, our findings clarify how the Lewis acid BPh3 cocatalyst accelerates the only slow step of the reaction, corresponding to the oxidative addition of the cyanate O-CN bond to the Pd center. © 2015 American Chemical Society.

  11. Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

    Science.gov (United States)

    Hirashima, Kyotaro; Seimiya, Hiroyuki

    2015-02-27

    Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Formation of benzo[f]-1-indanone frameworks by regulable intramolecular annulations of gem-dialkylthio trienynes.

    Science.gov (United States)

    Fang, Zhongxue; Liu, Ying; Barry, Badru-Deen; Liao, Peiqiu; Bi, Xihe

    2015-02-20

    An atom-economic route to benzo[f]-1-indanone frameworks has been developed starting from the readily available gem-dialkylthio trienynes by intramolecular annulations. The chemoselectivity of the intramolecular cyclizations can be regulated by both the base and the type of gas atmosphere used in the reaction, thus allowing the divergent synthesis of the corresponding functionalized benzo[f]-1-indanones in good to excellent yields.

  13. Intramolecular oxidative deselenization of acylselenoureas: a facile synthesis of benzoxazole amides and carbonic anhydrase inhibitors.

    Science.gov (United States)

    Angeli, A; Peat, T S; Bartolucci, G; Nocentini, A; Supuran, C T; Carta, F

    2016-12-28

    A mild, efficient and one pot procedure to access benzoxazoles using easily accessible acylselenoureas as starting materials has been discovered. Mechanistic studies revealed a pH dependent intramolecular oxidative deselenization, with ring closure due to an intramolecular nucleophilic attack of a phenoxide ion. All the benzoxazoles herein reported possessed a primary sulfonamide zinc binding group and showed effective inhibitory action on the enzymes, carbonic anhydrases.

  14. Intramolecular Diels-Alder Reactions in Organic Synthesis

    OpenAIRE

    Sizemore, Nicholas Blandford Luke

    2014-01-01

    Intramolecular Diels-Alder (IMDA) reactions are an important class of reactions in synthetic organic chemistry for the rapid construction of polycyclic frameworks. Three classes of IMDA reactions were investigated synthetically and computationally: 1) all-carbon type 1 IMDA reactions, 2) N-acylnitroso type 2 IMDA reactions, and 3) cyano-azadiene IMDA reactions. The first class was implemented in research toward the total synthesis of maoecrystal Z and isopalhinine A. The second class was stud...

  15. Enantioselective synthesis of almorexant via iridium-catalysed intramolecular allylic amidation

    NARCIS (Netherlands)

    Fananas Mastral, Martin; Teichert, Johannes F.; Fernandez-Salas, Jose Antonio; Heijnen, Dorus; Feringa, Ben L.

    2013-01-01

    An enantioselective synthesis of almorexant, a potent antagonist of human orexin receptors, is presented. The chiral tetrahydroisoquinoline core structure was prepared via iridium-catalysed asymmetric intramolecular allylic amidation. Further key catalytic steps of the synthesis include an oxidative

  16. THE ROLE OF INTRAMOLECULAR TIES ENERGY IN THE PYROLYSIS PROCESS OF PET

    Directory of Open Access Journals (Sweden)

    P. Iu. Salikov

    2014-01-01

    Full Text Available Summary. Recycling plastic waste to focus on. The main type of used products made of polyethylene terephthalate (PET is a container from the various types of beverages. There was considered a possibility of waste of PET (bottles, bottles, packaging containers by pyrolysis. Most of the proposed methods are not suitable for recycling (recycling of waste consumption contamination. Purpose - to develop technological foundations and optimum modes waste PET to obtain useful secondary products, taking into account the energy of chemical intramolecular bonds. Applied scientific basis of recycling PET into useful forms of secondary products, in particular the establishment of the collapse of the intramolecular bonds, depending on the temperature of the pyrolysis method of mathematical processing - differentiation of polynomial equations change in the degree of pyrolysis temperature-dependent. The optimum modes of processing. The block diagram of apparatus for processing contaminated waste PET pyrolysis methods of control processing in accordance with the specified composition of secondary products. The possibility of controlling the amount and types of fuel components of secondary products due to measurable parameters of the pyrolysis process. The effective temperature pyrolysis of waste PET with the CCA-tures energy intramolecular bonds.

  17. Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

    Czech Academy of Sciences Publication Activity Database

    Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

    2014-01-01

    Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  18. New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

    2014-01-01

    The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

  19. Charge splitters and charge transport junctions based on guanine quadruplexes

    Science.gov (United States)

    Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

    2018-04-01

    Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

  20. Intramolecular electron transfer through a bridging carboxylate group coordinated to two cobalt(III)-ions

    International Nuclear Information System (INIS)

    Wieghardt, K.

    1978-01-01

    Reduction of the binuclear μ-p-nitrobenzoato -di-μ-hydroxo -bis[triammine cobalt(III)] cation with (CH 3 ) 2 COH radicals yields a radical cation with the p-nitrobenzoato radical being coordinated to two cobalt(III) ions at the carboxylic group. The unprotonated form of this species undergoes intramolecular electron transfer producing Co(II) (k = (3.3 +- 0.3). x 10 3 s -1 ). The role of the carboxylate group in the intramolecular electron transfer process is tentatively assessed in terms of an intramolecular outer-sphere reaction because of lack of overlap of the donor orbitals (π) and the acceptor orbital (sigma). The protonated form of the radical cation (pKsub(a) = 2.5) disproportionates via a bimolecular process without production of Co(II). The effect of two coordinated Co(III) ions as compared to only one on the properties of the nitrobenzoate radical anion are discussed. (orig.) 891 HK 892 GM [de

  1. Chemical origin of blue- and redshifted hydrogen bonds: intramolecular hyperconjugation and its coupling with intermolecular hyperconjugation.

    Science.gov (United States)

    Li, An Yong

    2007-04-21

    Upon formation of a H bond Y...H-XZ, intramolecular hyperconjugation n(Z)-->sigma*(X-H) of the proton donor plays a key role in red- and blueshift characters of H bonds and must be introduced in the concepts of hyperconjugation and rehybridization. Intermolecular hyperconjugation transfers electron density from Y to sigma*(X-H) and causes elongation and stretch frequency redshift of the X-H bond; intramolecular hyperconjugation couples with intermolecular hyperconjugation and can adjust electron density in sigma*(X-H); rehybridization causes contraction and stretch frequency blueshift of the X-H bond on complexation. The three factors--intra- and intermolecular hyperconjugations and rehybridization--determine commonly red- or blueshift of the formed H bond. A proton donor that has strong intramolecular hyperconjugation often forms blueshifted H bonds.

  2. Intramolecular electron transfer in ascorbate oxidase is enhanced in the presence of oxygen

    DEFF Research Database (Denmark)

    Farver, O; Wherland, S; Pecht, I

    1994-01-01

    Intramolecular electron transfer from the type 1 copper center to the type 3 copper(II) pair is induced in the multi-copper enzyme, ascorbate oxidase, following pulse radiolytic reduction of the type 1 Cu(II) ion. In the presence of a slight excess of dioxygen over ascorbate oxidase, interaction...... between the trinuclear copper center and O2 is observed even with singly reduced ascorbate oxidase molecules. Under these conditions, the rate constant for intramolecular electron transfer from type 1 Cu(I) to type 3 Cu(II) increases 5-fold to 1100 +/- 300 s-1 (20 degrees C, pH 5.8) as compared...

  3. Synthesis of tetrahydrokhusitone. Annulation of the cyclohexane ring by free radical and carbanionic sequence of reactions

    Directory of Open Access Journals (Sweden)

    ZIVORAD CEKOVIC

    2003-05-01

    Full Text Available The synthesis of norcadinane sesquiterpene tetrahydrokhusitone 1 has been achieved by a new method for annulation of cyclohexane ring involving a sequence of free radical d-alkylation of the non-activated carbon atom and intramolecular carbanionic alkylation. (–-Menthol was used as the starting compound.

  4. Fluorescence enhancement upon G-quadruplex folding: synthesis, structure, and biophysical characterization of a dansyl/cyclodextrin-tagged thrombin binding aptamer.

    Science.gov (United States)

    De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela

    2013-11-20

    A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.

  5. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  6. Evaluation of intramolecular charge transfer state of 4-N, N ...

    Indian Academy of Sciences (India)

    Abstract. Intramolecular charge transfer of 4-N,N-dimethylamino cinnamaldehyde (DMACA) in vacuum and in five different aprotic solvents has been studied by using time-dependent density functional theory. (TDDFT). Polarizable continuum model (PCM) was employed to consider solvent–solute interactions. The potential ...

  7. APTO-253 Stabilizes G-quadruplex DNA, Inhibits MYC Expression, and Induces DNA Damage in Acute Myeloid Leukemia Cells.

    Science.gov (United States)

    Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G

    2018-06-01

    APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.

  8. A novel stereoselective synthesis of N-heterocycles by intramolecular hydrovinylation

    DEFF Research Database (Denmark)

    Bothe, Ulrich; Rudbeck, H. C.; Tanner, David Ackland

    2001-01-01

    A novel method for the synthesis of bicyclic amines has been developed. Cyclisation of 1,6-dienes by intramolecular hydrovinylation in the presence of catalytic amounts of allylpalladium chloride dimer afforded bicyclic amines in one step. Added phosphines, silver salts, as well as the nature of ...

  9. Label-Free and Ultrasensitive Biomolecule Detection Based on Aggregation Induced Emission Fluorogen via Target-Triggered Hemin/G-Quadruplex-Catalyzed Oxidation Reaction.

    Science.gov (United States)

    Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng

    2018-02-07

    Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.

  10. Intramolecular symmetry-adapted perturbation theory with a single-determinant wavefunction

    Energy Technology Data Exchange (ETDEWEB)

    Pastorczak, Ewa; Prlj, Antonio; Corminboeuf, Clémence, E-mail: clemence.corminboeuf@epfl.ch [Laboratory for Computational Molecular Design, Institut des Sciences et Ingénierie Chimiques, École Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland); Gonthier, Jérôme F. [Center for Computational Molecular Science and Technology, School of Chemistry and Biochemistry, School of Computational Science and Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332-0400 (United States)

    2015-12-14

    We introduce an intramolecular energy decomposition scheme for analyzing non-covalent interactions within molecules in the spirit of symmetry-adapted perturbation theory (SAPT). The proposed intra-SAPT approach is based upon the Chemical Hamiltonian of Mayer [Int. J. Quantum Chem. 23(2), 341–363 (1983)] and the recently introduced zeroth-order wavefunction [J. F. Gonthier and C. Corminboeuf, J. Chem. Phys. 140(15), 154107 (2014)]. The scheme decomposes the interaction energy between weakly bound fragments located within the same molecule into physically meaningful components, i.e., electrostatic-exchange, induction, and dispersion. Here, we discuss the key steps of the approach and demonstrate that a single-determinant wavefunction can already deliver a detailed and insightful description of a wide range of intramolecular non-covalent phenomena such as hydrogen bonds, dihydrogen contacts, and π − π stacking interactions. Intra-SAPT is also used to shed the light on competing intra- and intermolecular interactions.

  11. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  12. Femtosecond laser studies of ultrafast intramolecular processes

    Energy Technology Data Exchange (ETDEWEB)

    Hayden, C. [Sandia National Laboratories, Livermore, CA (United States)

    1993-12-01

    The goal of this research is to better understand the detailed mechanisms of chemical reactions by observing, directly in time, the dynamics of fundamental chemical processes. In this work femtosecond laser pulses are used to initiate chemical processes and follow the progress of these processes in time. The authors are currently studying ultrafast internal conversion and subsequent intramolecular relaxation in unsaturated hydrocarbons. In addition, the authors are developing nonlinear optical techniques to prepare and monitor the time evolution of specific vibrational motions in ground electronic state molecules.

  13. Optimal initiation of electronic excited state mediated intramolecular H-transfer in malonaldehyde by UV-laser pulses

    Science.gov (United States)

    Nandipati, K. R.; Singh, H.; Nagaprasad Reddy, S.; Kumar, K. A.; Mahapatra, S.

    2014-12-01

    Optimally controlled initiation of intramolecular H-transfer in malonaldehyde is accomplished by designing a sequence of ultrashort (~80 fs) down-chirped pump-dump ultra violet (UV)-laser pulses through an optically bright electronic excited [ S 2 ( π π ∗)] state as a mediator. The sequence of such laser pulses is theoretically synthesized within the framework of optimal control theory (OCT) and employing the well-known pump-dump scheme of Tannor and Rice [D.J. Tannor, S.A. Rice, J. Chem. Phys. 83, 5013 (1985)]. In the OCT, the control task is framed as the maximization of cost functional defined in terms of an objective function along with the constraints on the field intensity and system dynamics. The latter is monitored by solving the time-dependent Schrödinger equation. The initial guess, laser driven dynamics and the optimized pulse structure (i.e., the spectral content and temporal profile) followed by associated mechanism involved in fulfilling the control task are examined in detail and discussed. A comparative account of the dynamical outcomes within the Condon approximation for the transition dipole moment versus its more realistic value calculated ab initio is also presented.

  14. On combinatorial properties of elementary intramolecular operations

    Directory of Open Access Journals (Sweden)

    Vladimir Rogojin

    2014-11-01

    Full Text Available Here we tackle a problem from biology in terms of discrete mathematics. We are interested in a complex DNA manipulation process happening in eukaryotic organisms of a subclass of ciliate species called {\\it Stichotrichia} during so-called gene assembly. This process is in particular interesting since one can interpret gene assembly in ciliates as sorting of permutations. We survey here results related to studies on sorting permutations with some specific rewriting rules that formalize elementary intramolecular gene assembly operations. The research question is ``what permutation may be sorted with our operations?"

  15. Thermodynamic, Anticoagulant, and Antiproliferative Properties of Thrombin Binding Aptamer Containing Novel UNA Derivative

    Directory of Open Access Journals (Sweden)

    Weronika Kotkowiak

    2018-03-01

    Full Text Available Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation of a novel 4-thiouracil derivative of unlocked nucleic acid (UNA, as well as single incorporation of 4-thiouridine and all four canonical UNAs, was evaluated. The studies presented herein have shown that 4-thiouridine in RNA and UNA series, as well as all four canonical UNAs, can efficiently modulate G-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G-quadruplex anticoagulant properties. Noteworthy, some TBA variants, characterized by decreased ability to inhibit thrombin activity, possess significant antiproliferative properties reducing the viability of the HeLa cell line even by 95% at 10 μM concentration.

  16. On prediction of OH stretching frequencies in intramolecularly hydrogen bonded systems

    DEFF Research Database (Denmark)

    Hansen, Poul Erik; Spanget-Larsen, Jens

    2012-01-01

    OH stretching frequencies are investigated for a series of non-tautomerizing systems with intramolecular hydrogen bonds. Effective OH stretching wavenumbers are predicted by the application of empirical correlation procedures based on the results of B3LYP/6-31G(d) theoretical calculations...

  17. Intramolecular Diels-Alder reactions of pyrimidines, a synthetic and computational study

    NARCIS (Netherlands)

    Stolle, W.A.W.

    1992-01-01

    This thesis deals with an investigation on the ringtransformation reactions of 2and 5-(ω-alkynyl)pyrimidine derivatives, which undergo upon heating an intramolecular Diels-Alder reaction and subsequently a spontaneous retro Diels- Alder reaction. To get a better insight into the

  18. Recent applications of intramolecular Diels-Alder reactions to natural product synthesis

    DEFF Research Database (Denmark)

    Juhl, M.; Tanner, David Ackland

    2009-01-01

    This tutorial review presents some recent examples of intramolecular Diels-Alder (IMDA) reactions as key complexity-generating steps in the total synthesis of structurally intricate natural products. The opportunities afforded by transannular (TADA) versions of the IMDA reaction in complex molecu...... comprehensive, reviews....

  19. Intramolecular excimer and exciplex emission of 1,4-dipyrenyl substituted cyclohexasilane

    NARCIS (Netherlands)

    van Walree, C.A.; Kaats-Richters, V.E.M.; Jenneskens, L.W.; Williams, R.M.; van Stokkum, I.H.M.

    2002-01-01

    Intramolecular excimer emission is observed for cis-1,4-di(1-pyrenyl)decamethylcyclohexasilane in nonpolar solvents. Time-resolved fluorescence spectroscopy and kinetic modelling indicate that the driving force of excimer formation is very small, and that the process is governed by the flexibility

  20. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  1. Intramolecular photoinduced electron-transfer in azobenzene-perylene diimide

    International Nuclear Information System (INIS)

    Feng Wen-Ke; Wang Shu-Feng; Gong Qi-Huang; Feng Yi-Yu; Feng Wei; Yi Wen-Hui

    2010-01-01

    This paper studies the intramolecular photoinduced electron-transfer (PET) of covalent bonded azobenzene-perylene diimide (AZO-PDI) in solvents by using steady-state and time-resolved fluorescence spectroscopy together with ultrafast transient absorption spectroscopic techniques. Fast fluorescence quenching is observed when AZO-PDI is excited at characteristic wavelengths of AZO and perylene moieties. Reductive electron-transfer with transfer rate faster than 10 11 s −1 is found. This PET process is also consolidated by femtosecond transient absorption spectra

  2. Medium-Ring Effects on the Endo/Exo Selectivity of the Organocatalytic Intramolecular Diels-Alder Reaction.

    Science.gov (United States)

    Hooper, Joel F; James, Natalie C; Bozkurt, Esra; Aviyente, Viktorya; White, Jonathan M; Holland, Mareike C; Gilmour, Ryan; Holmes, Andrew B; Houk, K N

    2015-12-18

    The intramolecular Diels-Alder reaction has been used as a powerful method to access the tricyclic core of the eunicellin natural products from a number of 9-membered-ring precursors. The endo/exo selectivity of this reaction can be controlled through a remarkable organocatalytic approach, employing MacMillan's imidazolidinone catalysts, although the mechanistic origin of this selectivity remains unclear. We present a combined experimental and density functional theory investigation, providing insight into the effects of medium-ring constraints on the organocatalyzed intramolecular Diels-Alder reaction to form the isobenzofuran core of the eunicellins.

  3. Optimized measurements of separations and angles between intra-molecular fluorescent markers

    DEFF Research Database (Denmark)

    Mortensen, Kim; Sung, Jongmin; Flyvbjerg, Henrik

    2015-01-01

    We demonstrate a novel, yet simple tool for the study of structure and function of biomolecules by extending two-colour co-localization microscopy to fluorescent molecules with fixed orientations and in intra-molecular proximity. From each colour-separated microscope image in a time-lapse movie...

  4. Heterocycles by Transition Metals Catalyzed Intramolecular Cyclization of Acetylene Compounds

    International Nuclear Information System (INIS)

    Vizer, S.A.; Yerzhanov, K.B.; Dedeshko, E.C.

    2003-01-01

    Review shows the new strategies in the synthesis of heterocycles, having nitrogen, oxygen and sulfur atoms, via transition metals catalyzed intramolecular cyclization of acetylenic compounds on the data published at the last 30 years, Unsaturated heterocyclic compounds (pyrroles and pyrroline, furans, dihydro furans and benzofurans, indoles and iso-indoles, isoquinolines and isoquinolinones, aurones, iso coumarins and oxazolinone, lactams and lactones with various substitutes in heterocycles) are formed by transition metals, those salts [PdCl 2 , Pd(OAc) 2 , HgCl 2 , Hg(OAc) 2 , Hg(OCOCF 3 ) 2 , AuCl 3 ·2H 2 O, NaAuCl 4 ·2H 2 O, CuI, CuCl], oxides (HgO) and complexes [Pd(OAc) 2 (PPh 3 )2, Pd(PPh 3 ) 4 , PdCl 2 (MeCN) 2 , Pd(OAc ) 2 /TPPTS] catalyzed intramolecular cyclization of acetylenic amines, amides, ethers, alcohols, acids, ketones and βdiketones. More complex hetero polycyclic systems typical for natural alkaloids can to obtain similar. Proposed mechanisms of pyrroles, isoquinolines, iso indoles and indoles, benzofurans and iso coumarins, thiazolopyrimidinones formation are considered. (author)

  5. Light induced intramolecular electron and energy transfer events in rigidly linked borondipyrromethene: Corrole Dyad

    Energy Technology Data Exchange (ETDEWEB)

    Giribabu, Lingamallu, E-mail: giribabu@iict.res.in [Inorganic & Physical Chemistry Division, CSIR-Indian Institute of Chemical Technology, Tarnaka, Hyderabad 500007, Telangana (India); Jain, Kanika [Department of Chemistry, School of Chemical Sciences & Pharmacy, Central University of Rajasthan, Kishangarh, Dist. Ajmer, Rajasthan 305817 (India); Sudhakar, Kolanu; Duvva, Naresh [Inorganic & Physical Chemistry Division, CSIR-Indian Institute of Chemical Technology, Tarnaka, Hyderabad 500007, Telangana (India); Chitta, Raghu, E-mail: raghuchitta@curaj.ac.in [Department of Chemistry, School of Chemical Sciences & Pharmacy, Central University of Rajasthan, Kishangarh, Dist. Ajmer, Rajasthan 305817 (India)

    2016-09-15

    We have designed and synthesized a photo-induced energy/electron donor–acceptor conjugate comprising of corrole linked to BODIPY at the 5-position via ester linkage. The dyad was characterized by elemental analysis, MALDI-MS, UV-Visible, {sup 1}H NMR fluorescence spectroscopy (steady-state and time-resolved) as well as electrochemical methods. A comparison of the UV–visible and {sup 1}H NMR spectra of the dyad with those of the corresponding individual model compounds (i.e., BODIPY-CO{sub 2}H and BPFC-OH) reveal that there exist minimum π–π interactions between BODIPY and corrole π-planes. Quenched emission of BODIPY and corrole part of the dyad has been observed in five different solvents. Excitation spectral data provided evidence for an intramolecular excitation energy transfer (EET) from the singlet BODIPY to the corrole and an intramolecular photoinduced electron transfer (PET) from singlet state of corrole to ground state of BODIPY. Detailed analysis of the data suggests that Forster's dipole–dipole mechanism does not adequately explain this energy transfer but, an electron exchange mediated mechanism can, in principle, contribute to the intramolecular EET.

  6. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  7. Exploration of zeroth-order wavefunctions and energies as a first step toward intramolecular symmetry-adapted perturbation theory

    Science.gov (United States)

    Gonthier, Jérôme F.; Corminboeuf, Clémence

    2014-04-01

    Non-covalent interactions occur between and within all molecules and have a profound impact on structural and electronic phenomena in chemistry, biology, and material science. Understanding the nature of inter- and intramolecular interactions is essential not only for establishing the relation between structure and properties, but also for facilitating the rational design of molecules with targeted properties. These objectives have motivated the development of theoretical schemes decomposing intermolecular interactions into physically meaningful terms. Among the various existing energy decomposition schemes, Symmetry-Adapted Perturbation Theory (SAPT) is one of the most successful as it naturally decomposes the interaction energy into physical and intuitive terms. Unfortunately, analogous approaches for intramolecular energies are theoretically highly challenging and virtually nonexistent. Here, we introduce a zeroth-order wavefunction and energy, which represent the first step toward the development of an intramolecular variant of the SAPT formalism. The proposed energy expression is based on the Chemical Hamiltonian Approach (CHA), which relies upon an asymmetric interpretation of the electronic integrals. The orbitals are optimized with a non-hermitian Fock matrix based on two variants: one using orbitals strictly localized on individual fragments and the other using canonical (delocalized) orbitals. The zeroth-order wavefunction and energy expression are validated on a series of prototypical systems. The computed intramolecular interaction energies demonstrate that our approach combining the CHA with strictly localized orbitals achieves reasonable interaction energies and basis set dependence in addition to producing intuitive energy trends. Our zeroth-order wavefunction is the primary step fundamental to the derivation of any perturbation theory correction, which has the potential to truly transform our understanding and quantification of non

  8. Exploration of zeroth-order wavefunctions and energies as a first step toward intramolecular symmetry-adapted perturbation theory

    International Nuclear Information System (INIS)

    Gonthier, Jérôme F.; Corminboeuf, Clémence

    2014-01-01

    Non-covalent interactions occur between and within all molecules and have a profound impact on structural and electronic phenomena in chemistry, biology, and material science. Understanding the nature of inter- and intramolecular interactions is essential not only for establishing the relation between structure and properties, but also for facilitating the rational design of molecules with targeted properties. These objectives have motivated the development of theoretical schemes decomposing intermolecular interactions into physically meaningful terms. Among the various existing energy decomposition schemes, Symmetry-Adapted Perturbation Theory (SAPT) is one of the most successful as it naturally decomposes the interaction energy into physical and intuitive terms. Unfortunately, analogous approaches for intramolecular energies are theoretically highly challenging and virtually nonexistent. Here, we introduce a zeroth-order wavefunction and energy, which represent the first step toward the development of an intramolecular variant of the SAPT formalism. The proposed energy expression is based on the Chemical Hamiltonian Approach (CHA), which relies upon an asymmetric interpretation of the electronic integrals. The orbitals are optimized with a non-hermitian Fock matrix based on two variants: one using orbitals strictly localized on individual fragments and the other using canonical (delocalized) orbitals. The zeroth-order wavefunction and energy expression are validated on a series of prototypical systems. The computed intramolecular interaction energies demonstrate that our approach combining the CHA with strictly localized orbitals achieves reasonable interaction energies and basis set dependence in addition to producing intuitive energy trends. Our zeroth-order wavefunction is the primary step fundamental to the derivation of any perturbation theory correction, which has the potential to truly transform our understanding and quantification of non

  9. Synthesis of novel steroid-tetrahydroquinoline hybrid molecules and D-homosteroids by intramolecular cyclization reactions.

    Science.gov (United States)

    Magyar, Angéla; Wölfling, János; Kubas, Melanie; Cuesta Seijo, Jose Antonio; Sevvana, Madhumati; Herbst-Irmer, Regine; Forgó, Péter; Schneider, Gyula

    2004-05-01

    Steroidal aryliminium salts were prepared from D-seco-pregnene aldehyde 2b, and their BF3.OEt2-catalyzed reactions were studied. The nature of the substituent R1 in the anilines 3-6 essentially influenced the chemoselectivity. Using unsubstituted 3, 4-methoxy- (4) or 4-bromoaniline (5), different tetrahydroquinoline derivatives 7a-13a via intramolecular hetero Diels-Alder reaction were formed. In the case of 4-nitroaniline (6) the N-arylamino-D-homopregnane (14a) were also obtained. We assume, that an intramolecular Prins reaction led to this type of fluoro-D-homosteroid. The main products represent a new class of tetrahydroquinolino-androstenes.

  10. CMPO-calix[4]arenes with spacer containing intramolecular hydrogen bonding: Effect of local rigidification on solvent extraction toward f-block elements

    International Nuclear Information System (INIS)

    Chu, Hongzhu; He, Lutao; Jiang, Qian; Fang, Yuyu; Jia, Yiming; Yuan, Xiangyang; Zou, Shuliang; Li, Xianghui; Feng, Wen; Yang, Yuanyou; Liu, Ning; Luo, Shunzhong; Yang, Yanqiu; Yang, Liang; Yuan, Lihua

    2014-01-01

    Highlights: • Three CMPO-calix[4]arenes with spacer containing intramolecular hydrogen bonds were designed and synthesized. • The influence of local rigidification caused by intramolecular hydrogen bonds upon extraction of f-elements was investigated. • Selective extraction is realized via tuning local chelating surroundings by aid of intramolecular hydrogen bonds. -- Abstract: To understand intramolecular hydrogen bonding in effecting liquid–liquid extraction behavior of CMPO-calixarenes, three CMPO-modified calix[4]arenes (CMPO-CA) 5a–5c with hydrogen-bonded spacer were designed and synthesized. The impact of spacer rotation that is hindered by introduction of intramolecular hydrogen bonding upon extraction of La 3+ , Eu 3+ , Yb 3+ , Th 4+ , and UO 2 2+ has been examined. The results show that 5b and 5c containing only one hydrogen bond with a less hindered rotation spacer extract La 3+ more efficiently than 5a containing two hydrogen bonds with a more hindered rotation spacer, demonstrating the importance of local rigidification of spacer in the design of extractants in influencing the coordination environment. The large difference in extractability between La 3+ and Yb 3+ (or Eu 3+ ) by 5b (or 5c), and the small difference by 5a, suggests intramolecular hydrogen bonding do exert pronounced influence upon selective extraction of light and heavy lanthanides. Log–log plot analysis indicates a 1:1, 2:1 and 1:1 stoichiometry (ligand/metal) for the extracted complex formed between 5b and La 3+ , Th 4+ , UO 2 2+ , respectively. Additionally, their corresponding acyclic analogs 7a–7c exhibit negligible extraction toward these metal ions. These results reveal the possibility of selective extraction via tuning local chelating surroundings of CMPO-CA by aid of intramolecular hydrogen bonding

  11. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  12. Intramolecular Charge-Transfer Interaction of Donor-Acceptor-Donor Arrays Based on Anthracene Bisimide.

    Science.gov (United States)

    Iwanaga, Tetsuo; Ogawa, Marina; Yamauchi, Tomokazu; Toyota, Shinji

    2016-05-20

    We designed anthracene bisimide (ABI) derivatives having two triphenylamine (TPA) groups as donor units at the 9,10-positions to form a novel π-conjugated donor-acceptor system. These compounds and their analogues with ethynylene linkers were synthesized by Suzuki-Miyaura and Sonogashira coupling reactions, respectively. In UV-vis spectra, the linker-free derivatives showed broad absorption bands arising from intramolecular charge-transfer interactions. Introducing ethynylene linkers resulted in a considerable red shift of the absorption bands. In fluorescence spectra, the ethynylene derivatives showed intense emission bands at 600-650 nm. Their photophysical and electrochemical properties were compared with those of the corresponding mono TPA derivatives on the basis of theoretical calculations and cyclic voltammetry to evaluate the intramolecular electronic interactions between the donor and acceptor units.

  13. Thermal and catalytic intramolecular [4+2]-cycloaddition in 2-alkenylfurans

    International Nuclear Information System (INIS)

    Zubkov, Fedor I; Nikitina, Evgenia V; Varlamov, Alexey V

    2005-01-01

    The published data on the intramolecular Diels-Alder reaction in compounds of the 2-alkenylfuran series are generalised. The methods and conditions for the preparation of tricyclic systems are considered. The effects of the substituents in the furan and the unsaturated fragments on the cycloaddition are discussed. The application of this reaction to the synthesis of alkaloids and terpenoids is exemplified.

  14. Thermal and catalytic intramolecular [4+2]-cycloaddition in 2-alkenylfurans

    Energy Technology Data Exchange (ETDEWEB)

    Zubkov, Fedor I; Nikitina, Evgenia V; Varlamov, Alexey V [Department of Physical, Mathematical and Natural Sciences, Peoples' Friendship University of Russia (Russian Federation)

    2005-07-31

    The published data on the intramolecular Diels-Alder reaction in compounds of the 2-alkenylfuran series are generalised. The methods and conditions for the preparation of tricyclic systems are considered. The effects of the substituents in the furan and the unsaturated fragments on the cycloaddition are discussed. The application of this reaction to the synthesis of alkaloids and terpenoids is exemplified.

  15. A simple and versatile design concept for fluorophore derivatives with intramolecular photostabilization

    NARCIS (Netherlands)

    van der Velde, Jasper H M; Oelerich, Jens; Huang, Jingyi; Smit, Jochem H; Aminian Jazi, Atieh; Galiani, Silvia; Kolmakov, Kirill; Guoridis, Giorgos; Eggeling, Christian; Herrmann, Andreas; Roelfes, Gerard; Cordes, Thorben

    2016-01-01

    Intramolecular photostabilization via triple-state quenching was recently revived as a tool to impart synthetic organic fluorophores with 'self-healing' properties. To date, utilization of such fluorophore derivatives is rare due to their elaborate multi-step synthesis. Here we present a general

  16. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Mms1 is an assistant for regulating G-quadruplex DNA structures.

    Science.gov (United States)

    Schwindt, Eike; Paeschke, Katrin

    2017-11-02

    The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.

  18. Antimalarial peroxides: the first intramolecular 1,2,4,5-tetraoxane

    Directory of Open Access Journals (Sweden)

    BOGDAN A. SOLAJA

    2002-07-01

    Full Text Available An intramolecular steroidal 1,2,4,5-tetraoxane has been synthesised in six steps starting from methyl 3-oxo-7a,12a-diacetoxy-5b-cholan-24-oate. The synthesised 1,2,4,5-tetraoxane has moderate in vitro antimalarial activity against P. falciparum strains (IC50 (D6 = 0.35 mg/mL; IC50 (W2 = 0.29 mg/mL.

  19. Intramolecular ketenimine-ketenimine [2 + 2] and [4 + 2] cycloadditions.

    Science.gov (United States)

    Alajarín, Mateo; Bonillo, Baltasar; Sanchez-Andrada, Pilar; Vidal, Angel; Bautista, Delia

    2007-07-20

    Bis(ketenimines), in which the two heterocumulenic functions are placed in close proximity on a carbon skeleton to allow their mutual interaction, show a rich and not easily predictable chemistry. Intramolecular [2 + 2] or [4 + 2] cycloadditions are, respectively, observed when both ketenimine functions are supported on either ortho-benzylic or 2,2'-biphenylenic scaffolds. In addition, nitrogen-to-carbon [1,3] and [1,5] shifts of arylmethyl groups in N-arylmethyl-C,C-diphenyl ketenimines are also disclosed.

  20. Chromophore-Dependent Intramolecular Exciton-Vibrational Coupling in the FMO Complex: Quantification and Importance for Exciton Dynamics.

    Science.gov (United States)

    Padula, Daniele; Lee, Myeong H; Claridge, Kirsten; Troisi, Alessandro

    2017-11-02

    In this paper, we adopt an approach suitable for monitoring the time evolution of the intramolecular contribution to the spectral density of a set of identical chromophores embedded in their respective environments. We apply the proposed method to the Fenna-Matthews-Olson (FMO) complex, with the objective to quantify the differences among site-dependent spectral densities and the impact of such differences on the exciton dynamics of the system. Our approach takes advantage of the vertical gradient approximation to reduce the computational demands of the normal modes analysis. We show that the region of the spectral density that is believed to strongly influence the exciton dynamics changes significantly in the timescale of tens of nanoseconds. We then studied the impact of the intramolecular vibrations on the exciton dynamics by considering a model of FMO in a vibronic basis and neglecting the interaction with the environment to isolate the role of the intramolecular exciton-vibration coupling. In agreement with the assumptions in the literature, we demonstrate that high frequency modes at energy much larger than the excitonic energy splitting have negligible influence on exciton dynamics despite the large exciton-vibration coupling. We also find that the impact of including the site-dependent spectral densities on exciton dynamics is not very significant, indicating that it may be acceptable to apply the same spectral density on all sites. However, care needs to be taken for the description of the exciton-vibrational coupling in the low frequency part of intramolecular modes because exciton dynamics is more susceptible to low frequency modes despite their small Huang-Rhys factors.

  1. Effect of intramolecular hydrogen bonding and electron donation on substituted anthrasemiquinone characteristics

    International Nuclear Information System (INIS)

    Pal, H.; Mukherjee, T.

    1994-01-01

    The acid-base and redox characteristics of the semiquinones of a number of hydroxy and amino-substituted anthraquinones have been investigated. Results are explained on the basis of electron-donating properties and intramolecular hydrogen bond forming capabilities of the substituents. (author). 4 refs., 1 tab., 1 fig

  2. The mucin-degradation strategy of Ruminococcus gnavus: The importance of intramolecular trans-sialidases.

    Science.gov (United States)

    Crost, Emmanuelle H; Tailford, Louise E; Monestier, Marie; Swarbreck, David; Henrissat, Bernard; Crossman, Lisa C; Juge, Nathalie

    2016-07-03

    We previously identified and characterized an intramolecular trans-sialidase (IT-sialidase) in the gut symbiont Ruminococcus gnavus ATCC 29149, which is associated to the ability of the strain to grow on mucins. In this work we have obtained and analyzed the draft genome sequence of another R. gnavus mucin-degrader, ATCC 35913, isolated from a healthy individual. Transcriptomics analyses of both ATCC 29149 and ATCC 35913 strains confirmed that the strategy utilized by R. gnavus for mucin-degradation is focused on the utilization of terminal mucin glycans. R. gnavus ATCC 35913 also encodes a predicted IT-sialidase and harbors a Nan cluster dedicated to sialic acid utilization. We showed that the Nan cluster was upregulated when the strains were grown in presence of mucin. In addition we demonstrated that both R. gnavus strains were able to grow on 2,7-anyhydro-Neu5Ac, the IT-sialidase transglycosylation product, as a sole carbon source. Taken together these data further support the hypothesis that IT-sialidase expressing gut microbes, provide commensal bacteria such as R. gnavus with a nutritional competitive advantage, by accessing and transforming a source of nutrient to their own benefit.

  3. An Intramolecular Heck reaction that Prefers a 5-endo- to a 6-exo-trig Cyclization Pathway

    DEFF Research Database (Denmark)

    Vital, Paulo; Norrby, Per-Ola; Tanner, David Ackland

    2006-01-01

    A regioselective aromatic Claisen rearrangement was used to prepare 17a, the precursor of triflate 17e. The intramolecular Heck reaction of 17e is promoted only by bidentate phosphine ligands, giving exclusively and in excellent yield 20, the product of a 5-endo-trig cyclization, despite the poss......A regioselective aromatic Claisen rearrangement was used to prepare 17a, the precursor of triflate 17e. The intramolecular Heck reaction of 17e is promoted only by bidentate phosphine ligands, giving exclusively and in excellent yield 20, the product of a 5-endo-trig cyclization, despite...

  4. Does the Intramolecular Hydrogen Bond Affect the Spectroscopic Properties of Bicyclic Diazole Heterocycles?

    Directory of Open Access Journals (Sweden)

    Paweł Misiak

    2018-01-01

    Full Text Available The formation of an intramolecular hydrogen bond in pyrrolo[1,2-a]pyrazin-1(2H-one bicyclic diazoles was analyzed, and the influence of N-substitution on HB formation is discussed in this study. B3LYP/aug-cc-pVDZ calculations were performed for the diazole, and the quantum theory of atoms in molecules (QTAIM approach as well as the natural bond orbital (NBO method was applied to analyze the strength of this interaction. It was found that the intramolecular hydrogen bond that closes an extra ring between the C=O proton acceptor group and the CH proton donor, that is, C=O⋯H–C, influences the spectroscopic properties of pyrrolopyrazine bicyclic diazoles, particularly the carbonyl frequencies. The influence of N-substitution on the aromaticity of heterocyclic rings is also discussed in this report.

  5. Contrasting intermolecular and intramolecular exciplex formation of a 1,4-dicyano-2-methylnaphthalene-N,N-dimethyl-p-toluidine dyad.

    Science.gov (United States)

    Imoto, Mitsutaka; Ikeda, Hiroshi; Fujii, Takayuki; Taniguchi, Hisaji; Tamaki, Akihiro; Takeda, Motonori; Mizuno, Kazuhiko

    2010-05-07

    An intramolecular exciplex is formed upon excitation of the cyclohexane solution of the 1,4-dicyano-2-methylnaphthalene-N,N-dimethyl-p-toluidine dyad, but little if any intramolecular CT complex exists in the ground state of this substance in solution. In contrast, in the crystalline state, the dyad forms an intermolecular mixed-stack CT complex in the ground state and an intermolecular exciplex when it is photoexcited.

  6. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  7. Target recycling amplification for label-free and sensitive colorimetric detection of adenosine triphosphate based on un-modified aptamers and DNAzymes.

    Science.gov (United States)

    Gong, Xue; Li, Jinfu; Zhou, Wenjiao; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2014-05-30

    Based on target recycling amplification, the development of a new label-free, simple and sensitive colorimetric detection method for ATP by using un-modified aptamers and DNAzymes is described. The association of the model target molecules (ATP) with the corresponding aptamers of the dsDNA probes leads to the release of the G-quadruplex sequences. The ATP-bound aptamers can be further degraded by Exonuclease III to release ATP, which can again bind the aptamers of the dsDNA probes to initiate the target recycling amplification process. Due to this target recycling amplification, the amount of the released G-quadruplex sequences is significantly enhanced. Subsequently, these G-quadruplex sequences bind hemin to form numerous peroxidase mimicking DNAzymes, which cause substantially intensified color change of the probe solution for highly sensitive colorimetric detection of ATP down to the sub-nanomolar (0.33nM) level. Our method is highly selective toward ATP against other control molecules and can be performed in one single homogeneous solution, which makes our sensing approach hold great potential for sensitive colorimetric detection of other small molecules and proteins. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Synthesis of benzannelated sultams by intramolecular Pd-catalyzed arylation of tertiary sulfonamides

    Directory of Open Access Journals (Sweden)

    Valentin A. Rassadin

    2017-09-01

    Full Text Available A new and efficient approach to five- and six-membered benzannelated sultams by intramolecular C-arylation of tertiary 1-(methoxycarbonylmethanesulfonamides under palladium catalysis is described. In case of the α-toluenesulfonamide derivative, an unexpected formation of a 2,3-diarylindole was observed under the same conditions.

  9. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

    Science.gov (United States)

    Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

    2016-01-15

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  10. Intramolecular Hydrogen Bonding in (2-Hydroxybenzoyl)benzoylmethane Enol

    DEFF Research Database (Denmark)

    Hansen, Bjarke Knud Vilster; Winther, Morten; Spanget-Larsen, Jens

    2014-01-01

    , and the dienol form of 1,3-dibenzoylacetone. But in these examples the two H-bonds are equivalent, while in the case of OHDBM they are chemically different, involving one enolic and one phenolic hydroxy group. OHDBM is thus an interesting model compound with two competing H-bonds to the same carbonyl group......In the stable enol tautomer of the title compound (OHDBM), one carbonyl group is flanked by two β-hydroxy groups, giving rise to bifold intramolecular H-bonding. A similar situation is found in other β,β'-dihydroxy carbonyl compounds like chrysazin, anthralin, 2,2'-dihydroxybenzophenone...

  11. TD-DFT investigation of the potential energy surface for Excited-State Intramolecular Proton Transfer (ESIPT) reaction of 10-hydroxybenzo[h]quinoline: Topological (AIM) and population (NBO) analysis of the intramolecular hydrogen bonding interaction

    International Nuclear Information System (INIS)

    Paul, Bijan Kumar; Guchhait, Nikhil

    2011-01-01

    Here, we report a Density Functional Theoretical (DFT) study on the photophysics of a potent Excited-State Intramolecular Proton Transfer (ESIPT) molecular system, viz., 10-hydroxybenzo[h]quinoline (HBQ). Particular emphasis has been rendered on the assessment of the proton transfer reaction in HBQ in the ground and excited-states through elucidation and a careful perusal of the potential energy surfaces (PES). The non-viability of Ground-State Intramolecular Proton Transfer (GSIPT) process is dictated by a high-energy barrier coupled with no energy minimum for the proton transferred (K-form) form at the ground-state (S 0 ) PES. Remarkable reduction of the barrier along with thermodynamic stability inversion between the enol (E-form) and the keto forms (K-form) of HBQ upon photoexcitation from S 0 to the S 1 -state advocate for the operation of ESIPT process. These findings have been cross-validated on the lexicon of analysis of optimized geometry parameters, Mulliken's charge distribution on the heavy atoms, and molecular orbitals (MO) of the E- and the K-forms of HBQ. Our computational results also corroborate to experimental observations. From the modulations in optimized geometry parameters in course of the PT process a critical assessment has been endeavoured to delve into the movement of the proton during the process. Additional stress has been placed on the analysis of the intramolecular hydrogen bonding (IMHB) interaction in HBQ. The IMHB interaction has been explored by calculation of electron density ρ(r) and the Laplacian ∇ 2 ρ(r) at the bond critical point (BCP) using Atoms-In-Molecule (AIM) method and by calculation of interaction between σ* of OH with the lone pair of the nitrogen atom using Natural Bond Orbital (NBO) analysis. - Highlights: → Theoretical modelling of the photophysics of an ESIPT probe 10-hydroxybenzo[h]quinoline (HBQ). → Calculation of intramolecular hydrogen bond (IMHB) energy. → Role of hyperconjugative charge transfer

  12. Vibrational Spectroscopy of Intramolecular Hydrogen Bonds in the Infrared and Near-Infrared Regions

    DEFF Research Database (Denmark)

    Schrøder, Sidsel Dahl

    and 1,4-diaminobutane). Experimentally, the hydrogen bonds have been studied with vibrational spectroscopy in the infrared and near-infrared regions. The focus is primarily on spectra recorded in the near-infrared regions, which in these studies are dominated by O-H and N-H stretching overtones....... Overtone spectra have been recorded with intracavity laser photoacoustic laser spectroscopy and conventional long path absorption spectroscopy. Theoretically, a combination of electronic structure calculations and local mode models have been employed to guide the assignment of bands in the vibrational......,4-diaminobutane, no sign of intramolecular N-H···N hydrogen bonds were identified in the overtone spectra. However, theoretical analyzes indicate that intramolecular N-H···N hydrogen bonds are present in all three diamines if two hydrogen atoms on one of the methylene groups are substituted with triuoromethyl...

  13. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  14. Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

    Science.gov (United States)

    Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

    2016-12-01

    Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  16. Iron(II)-catalyzed intramolecular aminohydroxylation of olefins with functionalized hydroxylamines.

    Science.gov (United States)

    Liu, Guan-Sai; Zhang, Yong-Qiang; Yuan, Yong-An; Xu, Hao

    2013-03-06

    A diastereoselective aminohydroxylation of olefins with a functionalized hydroxylamine is catalyzed by new iron(II) complexes. This efficient intramolecular process readily affords synthetically useful amino alcohols with excellent selectivity (dr up to > 20:1). Asymmetric catalysis with chiral iron(II) complexes and preliminary mechanistic studies reveal an iron nitrenoid is a possible intermediate that can undergo either aminohydroxylation or aziridination, and the selectivity can be controlled by careful selection of counteranion/ligand combinations.

  17. Origin of Exo/Endo Selectivity in the Intramolecular Diels-Alder Reaction

    International Nuclear Information System (INIS)

    Yan, Shihai; Ryu, Do Hyun; Lee, Jin Yong

    2010-01-01

    The stereoselectivity of the intramolecular Diels-Alder reactions of 1 and its derivatives were investigated by ab initio calculations. The stereoselectivity mainly originates from the steric repulsion and the orbital interactions. The additional s-cis and s-trans conformations by introducing the carbonyl group at the neighbor of diene or dienophile may change the stereoselectivity, hence this kind of substitution can be utilized for stereoselective asymmetric synthesis

  18. Organometallic copper I, II or III species in an intramolecular dechlorination reaction

    KAUST Repository

    Poater, Albert

    2013-03-15

    The present paper gives insight into an intramolecular dechlorination reaction involving Copper (I) and an ArCH2Cl moiety. The discussion of the presence of a CuIII organometallic intermediate becomes a challenge, and because of the lack of clear experimental detection of this proposed intermediate, and due to the computational evidence that it is less stable than other isomeric species, it can be ruled out for the complex studied here. Our calculations are completely consistent with the key hypothesis of Karlin et al. that TMPA-CuI is the substrate of intramolecular dechlorination reactions as well as the source to generate organometallic species. However the organometallic character of some intermediates has been refused because computationally these species are less stable than other isomers. Thus this study constitutes an additional piece towards the full understanding of a class of reaction of biological relevance. Further, the lack of high energy barriers and deep energy wells along the reaction pathway explains the experimental difficulties to trap other intermediates. © Springer-Verlag Berlin Heidelberg 2013.

  19. Unique Intramolecular Electronic Communications in Mono-ferrocenylpyrimidine Derivatives: Correlation between Redox Properties and Structural Nature

    International Nuclear Information System (INIS)

    Xiang, Debo; Noel, Jerome; Shao, Huibo; Dupas, Georges; Merbouh, Nabyl; Yu, Hua-Zhong

    2015-01-01

    Highlights: • Unique intramolecular electronic communications (electron withdrawing and π-bond delocalization effects) exist in the mono-ferrocenylpyrimidine derivatives. • The redox potential shift correlates the pyrimidine ring torsion angle with the extent of electron delocalization. • The correlation between redox properties and structural nature in mono-ferrocenylpyrimidine derivatives is evident. - Abstract: The correlation between redox properties and structural nature in a complete set of mono-ferrocenylpyrimidine derivatives (2-ferrocenylpyrimidine, 2-FcPy; 4-ferrocenylpyrimidine, 4-FcPy; 5-ferrocenylpyrimidine, 5-FcPy) was evaluated by investigating the intramolecular electronic communications. Both conventional electrochemical measurements in organic solvents and thin-film voltammetric studies of these compounds were carried out. It was discovered that their formal potentials are significantly different from each other, and shift negatively in the order of 4-FcPy > 5-FcPy > 2-FcPy. This result suggests that the intramolecular electronic communication is dictated by the delocalization effect of the π-bonding systems in 2-FcPy, and that the electron-withdrawing effect of the nitrogen atoms in the pyrimidine ring plays the key role in 4-FcPy and 5-FcPy. The single crystal X-ray structure analyis and Density Functional Theory (DFT) calculation provided additional evidence (e.g., different torsion angles between the cyclopentadienyl and pyrimidine rings) to support the observed correlation between the redox properties and structural nature

  20. Epr, structural characteristics and intramolecular movements of some phenoxyl radicals in toluene

    OpenAIRE

    Nizameev, I.; Pudovkin, M.; Kadirov, M.

    2010-01-01

    The method of electron paramagnetic resonance (EPR) spectroscopy was used for studying magnetic and dynamic properties of phenoxyl radicals in toluene at 170-370 K. Characteristics of intramolecular motion and structure of phenoxyl radicals were determined from the temperature dependence of EPR spectra. For all the given compounds the activation energies of transitions between the conformers were calculated.

  1. Surprisingly Mild Enolate-Counterion-Free Pd(0)-Catalyzed Intramolecular Allylic Alkylations

    DEFF Research Database (Denmark)

    Madec, David; Prestat, Guillaume; Martini, Elisabetta

    2005-01-01

    Palladium-catalyzed intramolecular allylic alkylations of unsaturated EWG-activated amides can take place under phase-transfer conditions or in the presence of a crown ether. These new reaction conditions are milder and higher yielding than those previously reported. A rationalization for such an...... for such an unexpected result is put forth and validated by DFT-B3LYP calculations. The results suggest cyclization via a counterion-free (E)-enolate TS....

  2. An intramolecular inverse electron demand Diels–Alder approach to annulated α-carbolines

    Directory of Open Access Journals (Sweden)

    Zhiyuan Ma

    2012-06-01

    Full Text Available Intramolecular inverse electron demand cycloadditions of isatin-derived 1,2,4-triazines with acetylenic dienophiles tethered by amidations or transesterifications proceed in excellent yields to produce lactam- or lactone-fused α-carbolines. Beginning with various isatins and alkynyl dienophiles, a pilot-scale library of eighty-eight α-carbolines was prepared by using this robust methodology for biological evaluation.

  3. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  4. Impact of undamped and damped intramolecular vibrations on the efficiency of photosynthetic exciton energy transfer

    Science.gov (United States)

    Juhász, Imre Benedek; Csurgay, Árpád I.

    2018-04-01

    In recent years, the role of molecular vibrations in exciton energy transfer taking place during the first stage of photosynthesis attracted increasing interest. Here, we present a model formulated as a Lindblad-type master equation that enables us to investigate the impact of undamped and especially damped intramolecular vibrational modes on the exciton energy transfer, particularly its efficiency. Our simulations confirm the already reported effects that the presence of an intramolecular vibrational mode can compensate the energy detuning of electronic states, thus promoting the energy transfer; and, moreover, that the damping of such a vibrational mode (in other words, vibrational relaxation) can further enhance the efficiency of the process by generating directionality in the energy flow. As a novel result, we show that this enhancement surpasses the one caused by pure dephasing, and we present its dependence on various system parameters (time constants of the environment-induced relaxation and excitation processes, detuning of the electronic energy levels, frequency of the intramolecular vibrational modes, Huang-Rhys factors, temperature) in dimer model systems. We demonstrate that vibrational-relaxation-enhanced exciton energy transfer (VREEET) is robust against the change of these characteristics of the system and occurs in wide ranges of the investigated parameters. With simulations performed on a heptamer model inspired by the Fenna-Matthews-Olson (FMO) complex, we show that this mechanism can be even more significant in larger systems at T = 300 K. Our results suggests that VREEET might be prevalent in light-harvesting complexes.

  5. Long-range intramolecular electron transfer in aromatic radical anions and binuclear transition metal complexes

    DEFF Research Database (Denmark)

    Kuznetsov, A. M.; Ulstrup, Jens

    1981-01-01

    Intramolecular electron transfer (ET) over distances up to about 10 Å between states in which the electron is localized on donor and acceptor groups by interaction with molecular or external solvent nuclear motion occurs, in particular, in two classes of systems. The excess electron in anionic ra...

  6. [Development of boomerang-type intramolecular cascade reactions and application to natural product synthesis].

    Science.gov (United States)

    Takasu, K

    2001-12-01

    Intramolecular cascade reaction has received much attention as a powerful methodology to construct a polycyclic framework in organic synthesis. We have been developing "boomerang-type cascade reaction" to construct a variety of polycyclic skeletons efficiently. In the above reactions, a nucleophilic function of substrates changes the character into an electrophile after the initial reaction, and the electrophilic group acts as a nucleophile in the second reaction. That is, the reaction center stepwise moves from one functional group back to the same one via other functional groups. The stream of the electron concerning the cascade reaction is like a locus of boomerang. We show here three different boomerang-type reactions via ionic species or free radicals. 1) Diastereoselective Michael-aldol reaction based on the chiral auxiliary method and enantioselective Michael-aldol reaction by the use of external chiral sources. 2) Short and efficient total syntheses of longifolane sesquiterpenes utilizing intramolecular double Michael addition as a key step. 3) Development of boomerang-type radical cascade reaction of halopolyenes to construct terpenoid skeletons and its regioselectivity.

  7. Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.

    Science.gov (United States)

    Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu

    2018-08-01

    In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Potassium hydroxide/dimethyl sulfoxide promoted intramolecular cyclization for the synthesis of benzimidazol-2-ones.

    Science.gov (United States)

    Beyer, Astrid; Reucher, Christine M M; Bolm, Carsten

    2011-06-03

    A new protocol for intramolecular N-arylations of ureas to form benzimidazol-2-ones has been developed. The cyclization reaction occurs in the presence of KOH and DMSO at close to ambient temperature. Under these conditions the yields are high and a wide range of functional groups are tolerated.

  9. Phenolic promiscuity in the cell nucleus--epigallocatechingallate (EGCG) and theaflavin-3,3'-digallate from green and black tea bind to model cell nuclear structures including histone proteins, double stranded DNA and telomeric quadruplex DNA.

    Science.gov (United States)

    Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai

    2013-02-01

    Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".

  10. Understanding perovskite formation through the intramolecular exchange method in ambient conditions

    Science.gov (United States)

    Szostak, Rodrigo; Castro, Jhon A. P.; Marques, Adriano S.; Nogueira, Ana F.

    2017-04-01

    Among the methods to prepare hybrid organic-inorganic perovskite films, the intramolecular exchange method was the first one that made possible to prepare perovskite solar cells with efficiencies higher than 20%. However, perovskite formation by this method is not completely understood, especially in ambient conditions. In this work, perovskite films were prepared by the intramolecular exchange method in ambient conditions. The spin coating speed and the frequency of the MAI solution dripping onto PbI2(DMSO) were varied during the deposition steps. With the combination of these two parameters, a rigid control of the solvent drying was possible. Thus, depending on the chosen conditions, the intermediate MAPb3I8·2DMSO was formed with residual PbI2. Otherwise, direct formation of perovskite film was attained. A mechanism for the direct formation of bulk perovskite was proposed. We also investigated how the posterior thermal annealing affects the crystallinity and defects in perovskite films. With prolonged thermal annealing, the excess of MAI can be avoided, increasing the efficiency and decreasing the hysteresis of the solar cells. The best perovskite solar cell achieved a stabilized power output of 12.9%. The findings of this work pave the way for realizing the fabrication of efficient perovskite solar cells in ambient atmosphere, a very desirable condition for cost-efficient large scale manufacturing of this technology.

  11. Intramolecular charge separation in spirobifluorene-based donor–acceptor compounds adsorbed on Au and indium tin oxide electrodes

    International Nuclear Information System (INIS)

    Heredia, Daniel; Otero, Luis; Gervaldo, Miguel; Fungo, Fernando; Dittrich, Thomas; Lin, Chih-Yen; Chi, Liang-Chen; Fang, Fu-Chuan; Wong, Ken-Tsung

    2013-01-01

    Surface photovoltage (SPV) measurements were performed with a Kelvin-probe in spirobifluorene-based donor (diphenylamine)–acceptor (dicyano or cyanoacrylic acid moieties) compounds adsorbed from highly diluted solutions onto Au and indium tin oxide electrode surfaces. Strong intramolecular charge separation (negative SPV signals up to more than 0.1 V) due to directed molecule adsorption was observed only for spirobifluorene donor–acceptor compounds with carboxylic acid moiety. SPV signals and onset energies of electronic transitions depended on ambience conditions. - Highlights: ► Fluorene donor–acceptor derivatives were adsorbed at Au and indium tin oxide. ► Surface photovoltage measurements were performed with a Kelvin-probe. ► Strong intra-molecular charge separation was observed. ► SPV signals depended on ambience conditions

  12. Frequency and organization of papA homologous DNA sequences among uropathogenic digalactoside-binding Escherichia coli strains.

    OpenAIRE

    Denich, K; Craiu, A; Rugo, H; Muralidhar, G; O'Hanley, P

    1991-01-01

    The frequency of selected papA DNA sequences among 89 digalactoside-binding, uropathogenic Escherichia coli strains was evaluated with 12 different synthetic 15-base probes corresponding to papA genes from four digalactoside-binding piliated recombinant strains (HU849, 201B, and 200A). The papA probes encode amino acids which are common at the carboxy terminus of all strains, adjacent to the proximal portion of the intramolecular disulfide loop of strain 210B, or predicted to constitute the t...

  13. A theoretical investigation on the regioselectivity of the intramolecular hetero Diels-Alder and 1,3-dipolar cycloaddition of 2-vinyloxybenzaldehyde derivatives

    Directory of Open Access Journals (Sweden)

    Hamzehloueian Mahshid

    2014-01-01

    Full Text Available The present study reports a systematic computational analysis of the two possible pathways, fused and bridged, for an intramolecular hetero Diels-Alder (IMHDA and an intramolecular 1,3-dipolar cycloaddition (IMDCA of 2-vinyloxybenzaldehyde derivatives. The potential energy surface analysis for both reactions is in agreement with experimental observations. The activation energies associated with the two regioisomeric channels in IMHDA reaction show that the bridged product is favored, although in IMDCA, the most stable TS results the fused product. The global electronic properties of fragments within each molecule were studied to discuss the reactivity patterns and charge transfer direction in the intramolecular processes. The asynchronicity of the bond formation and aromaticity of the optimized TSs in the Diels-Alder reaction as well as cycloaddition reaction were evaluated. Finally, 1H NMR chemical shifts of the possible regioisomers have been calculated using the GIAO method which of the most stable products are in agreement with the experimental data in the both reaction.

  14. Enantioselective Intramolecular CH-Insertions upon Cu-Catalyzed Decomposition of Phenyliodonium Ylides

    Directory of Open Access Journals (Sweden)

    Christelle Boléa

    2001-02-01

    Full Text Available The Cu-catalyzed intramolecular CH insertion of phenyliodonium ylide 5b has been investigated at 0° C in the presence of several chiral ligands. Enantioselectivities vary in the range of 38–72 %, and are higher than those resulting from reaction of the diazo compound 5c at 65° C. The results are consistent with a carbenoid mechanism for Cu-catalyzed decomposition of phenyliodonium ylides.

  15. The preparation and intramolecular radical cyclisation reactions of chiral oxyme ethers

    International Nuclear Information System (INIS)

    Booth, Susan E.; Jenkins, Paul R.

    1998-01-01

    Chiral oxime ether 2 and Oxime ester 4 have been prepared by alkylation and esterification of the oxime 1. Racemic hydroxylamine 6 and chiral hydroxylamine 10 have been synthesised from N-hydroxysuccinimide and the corresponding alcohol in the presence of diethyl azo dicarboxylate, the two product were converted into the oxime ethers 7 and 11 respectively. The intramolecular radical cyclisation reactions of these oxime ethers and esters has been studied, successful reaction was observed to produce alkyl hydroxylamines 3,8 and 12. (author)

  16. The Preparation and Intramolecular Radical Cyclisation Reactions of Chiral Oxime Ethers

    Directory of Open Access Journals (Sweden)

    Booth Susan E.

    1998-01-01

    Full Text Available Chiral oxime ether 2 and Oxime ester 4 have been prepared by alkylation and esterification of the oxime 1. Racemic hydroxylamine 6 and chiral hydroxylamine 10 have been synthesised from N-hydroxysuccinimide and the corresponding alcohol in the presence of diethylazodicarboxylate, the two products were converted into the oxime ethers 7 and 11 respectively. The intramolecular radical cyclisation reactions of these oxime ethers and esters has been studied, successful reaction was observed to produce alkyl hydroxylamines 3, 8 and 12.

  17. Ductile Glass of Polyrotaxane Toughened by Stretch-Induced Intramolecular Phase Separation.

    Science.gov (United States)

    Kato, Kazuaki; Nemoto, Kaito; Mayumi, Koichi; Yokoyama, Hideaki; Ito, Kohzo

    2017-09-27

    A new class of ductile glasses is created from a thermoplastic polyrotaxane. The hard glass, which has a Young's modulus of 1 GPa, shows crazing, necking, and strain hardening with a total elongation of 330%. Stress concentration is prevented through a unique stretch-induced intramolecular phase separation of the cyclic components and the exposed backbone. In situ synchrotron X-ray scattering studies indicate that the backbone polymer chains slip through the cyclic components in the regions where the stress is concentrated.

  18. Photoinduced intramolecular substitution reaction of aryl halide with carbonyl oxygen of amide group

    CERN Document Server

    Park, Y T; Kim, M S; Kwon, J H

    2002-01-01

    Photoreaction of N-(o-halophenyl)acetamide in basic acetonitrile produces an intramolecular substituted product, 2-methylbenzoxazole in addition to reduced product, acetanilide, whereas photoreaction of N-(o-halobenzyl)acetamide affords a reduced product, N-benzylacetamide only. On the basis of preparative reaction, kinetics, and UV/vis absorption behavior, an electrophilic aromatic substitution of aryl halide with oxygen of its amide bond are proposed.

  19. Photoinduced intramolecular substitution reaction of aryl halide with carbonyl oxygen of amide group

    Energy Technology Data Exchange (ETDEWEB)

    Park, Yong Tae; Song, Myong Geun; Kim, Moon Sub; Kwon, Jeong Hee [Kyungpook National Univ., Daegu (Korea, Republic of)

    2002-09-01

    Photoreaction of N-(o-halophenyl)acetamide in basic acetonitrile produces an intramolecular substituted product, 2-methylbenzoxazole in addition to reduced product, acetanilide, whereas photoreaction of N-(o-halobenzyl)acetamide affords a reduced product, N-benzylacetamide only. On the basis of preparative reaction, kinetics, and UV/vis absorption behavior, an electrophilic aromatic substitution of aryl halide with oxygen of its amide bond are proposed.

  20. Photoinduced intramolecular substitution reaction of aryl halide with carbonyl oxygen of amide group

    International Nuclear Information System (INIS)

    Park, Yong Tae; Song, Myong Geun; Kim, Moon Sub; Kwon, Jeong Hee

    2002-01-01

    Photoreaction of N-(o-halophenyl)acetamide in basic acetonitrile produces an intramolecular substituted product, 2-methylbenzoxazole in addition to reduced product, acetanilide, whereas photoreaction of N-(o-halobenzyl)acetamide affords a reduced product, N-benzylacetamide only. On the basis of preparative reaction, kinetics, and UV/vis absorption behavior, an electrophilic aromatic substitution of aryl halide with oxygen of its amide bond are proposed

  1. Chemical synthesis of dual labeled proteins via differently protected alkynes enables intramolecular FRET analysis.

    Science.gov (United States)

    Hayashi, Gosuke; Kamo, Naoki; Okamoto, Akimitsu

    2017-05-30

    We report a novel method for multisite protein conjugation by setting differently silyl-protected alkynes as conjugation handles, which can remain intact through the whole synthetic procedure and provide sequential and orthogonal conjugation. This strategy enables efficient preparation of a dual dye-labeled protein and structural analysis via an intramolecular FRET mechanism.

  2. On the nature of intramolecular vibrational energy transfer in dense molecular environments

    Energy Technology Data Exchange (ETDEWEB)

    Benten, Rebekka S. von [Institut fuer Physikalische Chemie der Universitaet Goettingen, Tammannstrasse 6, D-37077 Goettingen (Germany); Abel, Bernd, E-mail: Bernd.Abel@uni-lepzig.de [Wilhelm-Ostwald-Institut fuer Physikalische und Theoretische Chemie, Universitaet Leipzig, Linne-Strasse 2, D-04103 Leipzig (Germany)

    2010-12-09

    Graphical abstract: Mechanisms of IVR in multi-tiers of intramolecular energy levels in different molecular environments are investigated. - Abstract: Transient femtosecond-IR-pump-UV-absorption probe-spectroscopy has been employed to shed light on the nature of intramolecular vibrational energy transfer (IVR) in dense molecular environments ranging from the diluted gas phase to the liquid. A general feature in our experiments and those of others is that IVR proceeds via multiple timescales if overtones or combination vibrations of high frequency modes are excited. It has been found that collisions enhance IVR if its (slower) timescales can compete with collisions. This enhancement is, however, much more weaker and rather inefficient as opposed to the effect of collisions on intermolecular energy transfer which is well known. In a series of experiments we found that IVR depends not significantly on the average energy transferred in a collision but rather on the number of collisions. The collisions are much less efficient in affecting IVR than VET. We conclude that collision induced broadening of vibrational energy levels reduces the energy gaps and enhances existing couplings between tiers. The present results are an important step forward to rationalize and understand apparently different and not consistent results from different groups on different molecular systems between gas and liquid phases.

  3. Excited-state intramolecular proton transfer of 2-acetylindan-1,3-dione studied by ultrafast absorption and fluorescence spectroscopy

    Directory of Open Access Journals (Sweden)

    Pramod Kumar Verma

    2016-03-01

    Full Text Available We employ transient absorption from the deep-UV to the visible region and fluorescence upconversion to investigate the photoinduced excited-state intramolecular proton-transfer dynamics in a biologically relevant drug molecule, 2-acetylindan-1,3-dione. The molecule is a ß-diketone which in the electronic ground state exists as exocyclic enol with an intramolecular H-bond. Upon electronic excitation at 300 nm, the first excited state of the exocyclic enol is initially populated, followed by ultrafast proton transfer (≈160 fs to form the vibrationally hot endocyclic enol. Subsequently, solvent-induced vibrational relaxation takes place (≈10 ps followed by decay (≈390 ps to the corresponding ground state.

  4. Cascaded strand displacement for non-enzymatic target recycling amplification and label-free electronic detection of microRNA from tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Kai; Dou, Baoting; Yang, Jianmei; Yuan, Ruo; Xiang, Yun, E-mail: yunatswu@swu.edu.cn

    2016-04-15

    The monitoring of microRNA (miRNA) expression levels is of great importance in cancer diagnosis. In the present work, based on two cascaded toehold-mediated strand displacement reactions (TSDRs), we have developed a label- and enzyme-free target recycling signal amplification approach for sensitive electronic detection of miRNA-21 from human breast cancer cells. The junction probes containing the locked G-quadruplex forming sequences are self-assembled on the senor surface. The presence of the target miRNA-21 initiates the first TSDR and results in the disassembly of the junction probes and the release of the active G-quadruplex forming sequences. Subsequently, the DNA fuel strand triggers the second TSDR and leads to cyclic reuse of the target miRNA-21. The cascaded TSDRs thus generate many active G-quadruplex forming sequences on the sensor surface, which associate with hemin to produce significantly amplified current response for sensitive detection of miRNA-21 at 1.15 fM. The sensor is also selective and can be employed to monitor miRNA-21 from human breast cancer cells. - Highlights: • Amplified and sensitive detection of microRNA from tumor cells is achieved. • Signal amplification is realized by two cascaded strand displacement reactions. • The developed sensor is selective and label-free without involving any enzymes.

  5. Evidence for excited-state intramolecular proton transfer in 4-chlorosalicylic acid from combined experimental and computational studies: Quantum chemical treatment of the intramolecular hydrogen bonding interaction

    Energy Technology Data Exchange (ETDEWEB)

    Paul, Bijan Kumar [Department of Chemistry, University of Calcutta, 92 Acharya Prafulla Chandra Road, Calcutta 700009 (India); Guchhait, Nikhil, E-mail: nikhil.guchhait@rediffmail.com [Department of Chemistry, University of Calcutta, 92 Acharya Prafulla Chandra Road, Calcutta 700009 (India)

    2012-07-25

    Highlights: Black-Right-Pointing-Pointer Experimental and computational studies on the photophysics of 4-chlorosalicylic acid. Black-Right-Pointing-Pointer Spectroscopically established ESIPT reaction substantiated by theoretical calculation. Black-Right-Pointing-Pointer Quantum chemical treatment of IMHB unveils strength, nature and directional nature. Black-Right-Pointing-Pointer Superiority of quantum chemical treatment of H-bond over geometric criteria. Black-Right-Pointing-Pointer Role of H-bond as a modulator of aromaticity. -- Abstract: The photophysical study of a pharmaceutically important chlorine substituted derivative of salicylic acid viz., 4-chlorosalicylic acid (4ClSA) has been carried out by steady-state absorption, emission and time-resolved emission spectroscopy. A large Stokes shifted emission band with negligible solvent polarity dependence marks the spectroscopic signature of excited-state intramolecular proton transfer (ESIPT) reaction in 4ClSA. Theoretical calculation by ab initio and Density Functional Theory methods yields results consistent with experimental findings. Theoretical potential energy surfaces predict the occurrence of proton transfer in S{sub 1}-state. Geometrical and energetic criteria, Atoms-In-Molecule topological parameters, Natural Bond Orbital population analysis have been exploited to evaluate the intramolecular hydrogen bond (IMHB) interaction and to explore its directional nature. The inter-correlation between aromaticity and resonance assisted H-bond is also discussed in this context. Our results unveil that the quantum chemical treatment is a more accurate tool to assess hydrogen bonding interaction in comparison to geometrical criteria.

  6. Emission Spectroscopy as a Probe into Photoinduced Intramolecular Electron Transfer in Polyazine Bridged Ru(II,Rh(III Supramolecular Complexes

    Directory of Open Access Journals (Sweden)

    Karen J. Brewer

    2010-08-01

    Full Text Available Steady-state and time-resolved emission spectroscopy are valuable tools to probe photochemical processes of metal-ligand, coordination complexes. Ru(II polyazine light absorbers are efficient light harvesters absorbing in the UV and visible with emissive 3MLCT excited states known to undergo excited state energy and electron transfer. Changes in emission intensity, energy or band-shape, as well as excited state lifetime, provide insight into excited state dynamics. Photophysical processes such as intramolecular electron transfer between electron donor and electron acceptor sub-units may be investigated using these methods. This review investigates the use of steady-state and time-resolved emission spectroscopy to measure excited state intramolecular electron transfer in polyazine bridged Ru(II,Rh(III supramolecular complexes. Intramolecular electron transfer in these systems provides for conversion of the emissive 3MLCT (metal-to-ligand charge transfer excited state to a non-emissive, but potentially photoreactive, 3MMCT (metal-to-metal charge transfer excited state. The details of the photophysics of Ru(II,Rh(III and Ru(II,Rh(III,Ru(II systems as probed by steady-state and time-resolved emission spectroscopy will be highlighted.

  7. Some kinetic and spectroscopic evidence on intramolecular relaxation processes in polyatomic molecules

    International Nuclear Information System (INIS)

    Quack, M.

    1983-01-01

    The description and definition of intramolecular vibrational relaxation processes is discussed within the framework of the quantum mechanical and statistical mechanical equations of motion. The evidence from quite different experimental sources is summarized under the common aspect of vibrational relaxation. Although much of the evidence remains ambiguous, there is good indication that a localized vibrational excitation relaxes typically in 0.1 to 10 picoseconds, which is long compared to many optical and reactive processes

  8. Towards single-molecule detection of intramolecular exciplexes: Photophysics of a benzanthrone derivative

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Akifumi [Graduate School of Bio-Applications and Systems Engineering (BASE), Tokyo University of Agriculture and Technology, 2-24-16 Naka-machi, Koganei, Tokyo, 184-8588 (Japan); Department of Organic and Polymeric Materials, Tokyo Institute of Technology, Ookayama 2-12-1-S8, Meguro-ku, Tokyo, 152-8552 (Japan); Sato, Hisaya [Graduate School of Bio-Applications and Systems Engineering (BASE), Tokyo University of Agriculture and Technology, 2-24-16 Naka-machi, Koganei, Tokyo, 184-8588 (Japan); Vacha, Martin [Department of Organic and Polymeric Materials, Tokyo Institute of Technology, Ookayama 2-12-1-S8, Meguro-ku, Tokyo, 152-8552 (Japan)]. E-mail: vacha@op.titech.ac.jp

    2007-01-15

    We report luminescence study of intramolecular exciplexes based on an aminobenzanthrone derivative, dimethyl-amino-N-acetyl-3-aminobenzanthrone (BDA). The BDA compound shows strong dependence of the exciplex emission band intensity on the solvent dielectric function and moderate dependence on its viscosity. The exciplex emission mechanism is discussed in view of the unusual solvent polarity dependence and solvent-dependent excited state lifetimes. Preliminary results on single-molecule detection in polymer films are also presented.

  9. Towards single-molecule detection of intramolecular exciplexes: Photophysics of a benzanthrone derivative

    International Nuclear Information System (INIS)

    Hattori, Akifumi; Sato, Hisaya; Vacha, Martin

    2007-01-01

    We report luminescence study of intramolecular exciplexes based on an aminobenzanthrone derivative, dimethyl-amino-N-acetyl-3-aminobenzanthrone (BDA). The BDA compound shows strong dependence of the exciplex emission band intensity on the solvent dielectric function and moderate dependence on its viscosity. The exciplex emission mechanism is discussed in view of the unusual solvent polarity dependence and solvent-dependent excited state lifetimes. Preliminary results on single-molecule detection in polymer films are also presented

  10. Numerical simulation of dynamic quenching of dual-split fluorescence of molecules with intramolecular hydrogen bonds

    International Nuclear Information System (INIS)

    Morozov, V.A.; Chuvulkin, N.D.; Smolenskij, E.A.; Dubina, Yu.M.

    2014-01-01

    The dynamic quenching of intensity pulses of the dual-split fluorescence (DSF) has been simulated using numerical solutions of the equations for the population matrix of five states of the model fluorescent molecule (FM). The state with the highest energy is considered as resonantly excited by irradiation, and two other excited states populated by subsequent relaxation processes are taken as initial states for the FM transitions with emission of the DSF photons. The FM model parameters are selected to fit typical parameters of the molecules with intramolecular proton photo transfer. Quenching is considered as a consequence of non-radiative decay of the FM excited states due to collisions with the quencher molecules. Examples of two types of the DSF quenching of the FM are given. The first type leads to an intramolecular radiationless decay of particular excited states of the FM, and the second one results in radiationless transitions from the same states to the quencher molecule states. (authors)

  11. EVAPORATION: a new vapour pressure estimation methodfor organic molecules including non-additivity and intramolecular interactions

    Directory of Open Access Journals (Sweden)

    S. Compernolle

    2011-09-01

    Full Text Available We present EVAPORATION (Estimation of VApour Pressure of ORganics, Accounting for Temperature, Intramolecular, and Non-additivity effects, a method to predict (subcooled liquid pure compound vapour pressure p0 of organic molecules that requires only molecular structure as input. The method is applicable to zero-, mono- and polyfunctional molecules. A simple formula to describe log10p0(T is employed, that takes into account both a wide temperature dependence and the non-additivity of functional groups. In order to match the recent data on functionalised diacids an empirical modification to the method was introduced. Contributions due to carbon skeleton, functional groups, and intramolecular interaction between groups are included. Molecules typically originating from oxidation of biogenic molecules are within the scope of this method: aldehydes, ketones, alcohols, ethers, esters, nitrates, acids, peroxides, hydroperoxides, peroxy acyl nitrates and peracids. Therefore the method is especially suited to describe compounds forming secondary organic aerosol (SOA.

  12. The role of intramolecular crosslinking in the radiolysis of bulk crystallized high density polyethylene

    International Nuclear Information System (INIS)

    Lyons, B.J.

    1986-01-01

    Intramolecular crosslinks have been suggested to occur in bulk crystallized, irradiated, high density polyethylene (HDPE) and to account for the low rates of gel formation, especially those of previously annealed samples when compared with that manifested by the same resin when previously quenched from the melt. Such crosslinks do not contribute to the development of gel and contribute to only a limited extent to the elastic properties above the crystalline melting point when compared with intermolecular crosslinks, but, if the mesh size of the intra- and inter-molecular networks are comparable, are fully reflected in the rupture elongation. The rupture elongations of a wide range of HDPE resins, for a given sol fraction or elastic modulus, are found to be at least as high as and often higher than those of low (LDPE) or linear low (LLDPE) polyethylene resins, indicating that intramolecular crosslinking of this type does not occur to a significantly greater extent in these higher crystallinity resins. Other factors more likely to account for the reduced rates of inter alia gel formation in some HDPE resins are discussed. (author)

  13. CMPO-calix[4]arenes with spacer containing intramolecular hydrogen bonding: effect of local rigidification on solvent extraction toward f-block elements.

    Science.gov (United States)

    Chu, Hongzhu; He, Lutao; Jiang, Qian; Fang, Yuyu; Jia, Yiming; Yuan, Xiangyang; Zou, Shuliang; Li, Xianghui; Feng, Wen; Yang, Yuanyou; Liu, Ning; Luo, Shunzhong; Yang, Yanqiu; Yang, Liang; Yuan, Lihua

    2014-01-15

    To understand intramolecular hydrogen bonding in effecting liquid-liquid extraction behavior of CMPO-calixarenes, three CMPO-modified calix[4]arenes (CMPO-CA) 5a-5c with hydrogen-bonded spacer were designed and synthesized. The impact of spacer rotation that is hindered by introduction of intramolecular hydrogen bonding upon extraction of La(3+), Eu(3+), Yb(3+), Th(4+), and UO2(2+) has been examined. The results show that 5b and 5c containing only one hydrogen bond with a less hindered rotation spacer extract La(3+) more efficiently than 5a containing two hydrogen bonds with a more hindered rotation spacer, demonstrating the importance of local rigidification of spacer in the design of extractants in influencing the coordination environment. The large difference in extractability between La(3+) and Yb(3+) (or Eu(3+)) by 5b (or 5c), and the small difference by 5a, suggests intramolecular hydrogen bonding do exert pronounced influence upon selective extraction of light and heavy lanthanides. Log-log plot analysis indicates a 1:1, 2:1 and 1:1 stoichiometry (ligand/metal) for the extracted complex formed between 5b and La(3+), Th(4+), UO2(2+), respectively. Additionally, their corresponding acyclic analogs 7a-7c exhibit negligible extraction toward these metal ions. These results reveal the possibility of selective extraction via tuning local chelating surroundings of CMPO-CA by aid of intramolecular hydrogen bonding. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Photoinduced Ultrafast Intramolecular Excited-State Energy Transfer in the Silylene-Bridged Biphenyl and Stilbene (SBS) System: A Nonadiabatic Dynamics Point of View.

    Science.gov (United States)

    Wang, Jun; Huang, Jing; Du, Likai; Lan, Zhenggang

    2015-07-09

    The photoinduced intramolecular excited-state energy-transfer (EET) process in conjugated polymers has received a great deal of research interest because of its important role in the light harvesting and energy transport of organic photovoltaic materials in photoelectric devices. In this work, the silylene-bridged biphenyl and stilbene (SBS) system was chosen as a simplified model system to obtain physical insight into the photoinduced intramolecular energy transfer between the different building units of the SBS copolymer. In the SBS system, the vinylbiphenyl and vinylstilbene moieties serve as the donor (D) unit and the acceptor (A) unit, respectively. The ultrafast excited-state dynamics of the SBS system was investigated from the point of view of nonadiabatic dynamics with the surface-hopping method at the TDDFT level. The first two excited states (S1 and S2) are characterized by local excitations at the acceptor (vinylstilbene) and donor (vinylbiphenyl) units, respectively. Ultrafast S2-S1 decay is responsible for the intramolecular D-A excitonic energy transfer. The geometric distortion of the D moiety play an essential role in this EET process, whereas the A moiety remains unchanged during the nonadiabatic dynamics simulation. The present work provides a direct dynamical approach to understand the ultrafast intramolecular energy-transfer dynamics in SBS copolymers and other similar organic photovoltaic copolymers.

  15. Synthesis of anatoxin a via intramolecular cyclization of iminium salts

    International Nuclear Information System (INIS)

    Bates, H.A.; Rapoport, H.

    1979-01-01

    Anatoxin a (1) has been synthesized by exploiting intramolecular cyclization between an iminium salt and a nucleophilic carbon to construct the 9-azabicyclo[4.2.1]nonane ring system. Cyclization of malonate iminiumsalt 16 at alkaline pH afforded a low yield of bicyclic malonate 18 owing to an unfavorable equilibrium constant and lability of the iminium salt in base. In contrast, cyclization of ketoiminium salt 31 afforded a good yield of bicyclic ketone 34 in acidic methanol. Dihydropyrrolium salts 16 and 31 were generated quantitatively by decarbonylation of substituted N-methylprolines 15 and 30b, obtained by reduction of the corresponding pyrroles

  16. A new signal-on method for the detection of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao

    2015-08-05

    Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.

  17. TERRA mimicking ssRNAs prevail over the DNA substrate for telomerase in vitro due to interactions with the alternative binding site.

    Science.gov (United States)

    Azhibek, Dulat; Skvortsov, Dmitry; Andreeva, Anna; Zatsepin, Timofei; Arutyunyan, Alexandr; Zvereva, Maria; Dontsova, Olga

    2016-06-01

    Telomerase is a key component of the telomere length maintenance system in the majority of eukaryotes. Telomerase displays maximal activity in stem and cancer cells with high proliferative potential. In humans, telomerase activity is regulated by various mechanisms, including the interaction with telomere ssDNA overhangs that contain a repetitive G-rich sequence, and with noncoding RNA, Telomeric repeat-containing RNA (TERRA), that contains the same sequence. So these nucleic acids can compete for telomerase RNA templates in the cell. In this study, we have investigated the ability of different model substrates mimicking telomere DNA overhangs and TERRA RNA to compete for telomerase in vitro through a previously developed telomerase inhibitor assay. We have shown in this study that RNA oligonucleotides are better competitors for telomerase that DNA ones as RNA also use an alternative binding site on telomerase, and the presence of 2'-OH groups is significant in these interactions. In contrast to DNA, the possibility of forming intramolecular G-quadruplex structures has a minor effect for RNA binding to telomerase. Taking together our data, we propose that TERRA RNA binds better to telomerase compared with its native substrate - the 3'-end of telomere DNA overhang. As a result, some specific factor may exist that participates in switching telomerase from TERRA to the 3'-end of DNA for telomere elongation at the distinct period of a cell cycle in vivo. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  18. Symmetry-breaking intramolecular charge transfer in the excited state of meso-linked BODIPY dyads

    KAUST Repository

    Whited, Matthew T.; Patel, Niral M.; Roberts, Sean T.; Allen, Kathryn; Djurovich, Peter I.; Bradforth, Stephen E.; Thompson, Mark E.

    2012-01-01

    We report the synthesis and characterization of symmetric BODIPY dyads where the chromophores are attached at the meso position, using either a phenylene bridge or direct linkage. Both molecules undergo symmetry-breaking intramolecular charge transfer in the excited state, and the directly linked dyad serves as a visible-light-absorbing analogue of 9,9′-bianthryl.

  19. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  20. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  1. Environment-sensitive quinolone demonstrating long-lived fluorescence and unusually slow excited-state intramolecular proton transfer kinetics

    Czech Academy of Sciences Publication Activity Database

    Zamotaiev, O. M.; Shvadchak, Volodymyr; Sych, T. P.; Melnychuk, N. A.; Yushchenko, Dmytro A.; Mely, Y.; Pivovarenko, V. G.

    2016-01-01

    Roč. 4, č. 3 (2016), č. článku 034004. ISSN 2050-6120 Institutional support: RVO:61388963 Keywords : quinolone * fluorescent probes * local polarity * hydration * excited-state intramolecular proton transfer * kinetics Subject RIV: CC - Organic Chemistry Impact factor: 2.656, year: 2016

  2. Structural effects on the electronic characteristics of intramolecularly intercalated alkali-rubrene complexes

    International Nuclear Information System (INIS)

    Li, Tsung-Lung; Lu, Wen-Cai

    2016-01-01

    The geometric and electronic structures of neutral monolithium- and monosodium-rubrene (Li 1 Rub and Na 1 Rub) isomers are investigated and compared with monopotassium-rubrene (K 1 Rub). Based on the alkali binding site, all isomers of these alkali-rubrene complexes can be subdivided into two types: intramolecularly intercalated and extramolecularly adsorbed. The minimum-energy Li 1 Rub and Na 1 Rub are intercalated structures, whereas the minimum-energy K 1 Rub is adsorbed. The fact that the intercalated Li 1 Rub and Na 1 Rub structures are energetically favorable over the adsorbed ones can be explained by two energy rules. First, “double” proximity of the intercalating alkali element to a pair of phenyl side groups enormously reduces the total energy. Second, accommodation of a minuscule intercalant does not significantly deform the carbon frame and, thus, increases the energy only by a small amount. Additionally, the peculiar effects of intramolecular intercalation on the electronic structures of molecules are also studied in this simulation of monoalkali intercalation. In the monoalkali-intercalated rubrene complex, only one of the two pairs of phenyl groups of rubrene is intercalated, intentionally leaving another pair pristine, which facilitates the comparison of electronic structures between the intercalated and pristine pairs of phenyl side groups in a single molecule. The uniformity of chemical environments of the phenyl groups of the intercalated Li 1 Rub/Na 1 Rub is deteriorated by the incorporation of the intercalant, and leads to their spectral characteristics in contrast to K 1 Rub. In particular, the introduction of the intercalant promotes the carbon 2p orbitals of the intercalated phenyl pair to take part in the electronic structures of the HOMO and LUMO peaks of Li 1 Rub/Na 1 Rub. The unpaired electron in the HOMO is delocalized over the backbone with higher probability of distributing over the central two fused rings than over the outer two

  3. Intramolecular carbenoid ylide forming reactions of 2-diazo-3-keto-4-phthalimidocarboxylic esters derived from methionine and cysteine

    Directory of Open Access Journals (Sweden)

    Marc Enßle

    2012-03-01

    Full Text Available Methionine, S-benzylcysteine and S-allylcysteine were converted into 2-diazo-3-oxo-4-phthalimidocarboxylic esters 8a–c in three steps. Upon rhodium-catalysed dediazoniation, two intramolecular carbenoid reactions competed, namely the formation of a cyclic sulfonium ylide and that of a six-ring carbonyl ylide. The S-methyl and S-benzyl ylides 12a and b could be isolated, while S-allyl ylide 12c underwent a [2,3]-sigmatropic rearrangement. The short-lived carbonyl ylides derived from methionine and S-benzylcysteine formed head-to-tail dimers by a [3 + 3]-cycloaddition and could be trapped with external dipolarophiles, while the S-allyl derivative 14c yielded the pentacyclic compound 17 by an intramolecular [3 + 2]-cycloaddition reaction.

  4. On the intramolecular origin of the blue shift of A-H stretching frequencies: triatomic hydrides HAX.

    Science.gov (United States)

    Karpfen, Alfred; Kryachko, Eugene S

    2009-04-30

    A series of intermolecular complexes formed between the triatomic hydrides HAX and various interaction partners are investigated computationally aiming (1) to demonstrate that either an appearance or nonappearance of a blue shift of the A-H stretching frequency is directly related to the sign of the intramolecular coupling that exists between the two degrees of freedom, the A-H and A-X bond lengths, and (2) to offer the following conjecture: the theoretical protonation of a triatomic neutral molecule HAX at the site X is a simple and rather efficient probe of a red or blue shift that the stretching frequency nu(A-H) undergoes upon complex formation regardless of whether this bond is directly involved in hydrogen bonding or not. In other words, to predict whether this A-H bond is capable to display a blue or red shift of nu(A-H), it suffices to compare the equilibrium structures and vibrational spectra of a given molecule with its protonated counterpart. The two above goals are achieved invoking a series of 11 triatomic molecules: HNO, HSN, HPO, and HPS characterized by a negative intramolecular coupling; HON and HNS as intermediate cases; and HOF, HOCl, HCN, HNC, and HCP with a positive intramolecular coupling. For these purposes, the latter molecules are investigated at the MP2/6-311++G(2p,2d) level in the neutral and protonated HAXH(+) forms as well as their complexes with H(2)O and with the fluoromethanes H(3)CF, H(2)CF(2), and HCF(3).

  5. Unfolding mechanism of thrombin-binding aptamer revealed by molecular dynamics simulation and Markov State Model.

    Science.gov (United States)

    Zeng, Xiaojun; Zhang, Liyun; Xiao, Xiuchan; Jiang, Yuanyuan; Guo, Yanzhi; Yu, Xinyan; Pu, Xuemei; Li, Menglong

    2016-04-05

    Thrombin-binding aptamer (TBA) with the sequence 5'GGTTGGTGTGGTTGG3' could fold into G-quadruplex, which correlates with functionally important genomic regionsis. However, unfolding mechanism involved in the structural stability of G-quadruplex has not been satisfactorily elucidated on experiments so far. Herein, we studied the unfolding pathway of TBA by a combination of molecular dynamics simulation (MD) and Markov State Model (MSM). Our results revealed that the unfolding of TBA is not a simple two-state process but proceeds along multiple pathways with multistate intermediates. One high flux confirms some observations from NMR experiment. Another high flux exhibits a different and simpler unfolding pathway with less intermediates. Two important intermediate states were identified. One is similar to the G-triplex reported in the folding of G-quadruplex, but lack of H-bonding between guanines in the upper plane. More importantly, another intermediate state acting as a connector to link the folding region and the unfolding one, was the first time identified, which exhibits higher population and stability than the G-triplex-like intermediate. These results will provide valuable information for extending our understanding the folding landscape of G-quadruplex formation.

  6. Fe(II)/Fe(III)-Catalyzed Intramolecular Didehydro-Diels-Alder Reaction of Styrene-ynes.

    Science.gov (United States)

    Mun, Hyeon Jin; Seong, Eun Young; Ahn, Kwang-Hyun; Kang, Eun Joo

    2018-02-02

    The intramolecular didehydro-Diels-Alder reaction of styrene-ynes was catalyzed by Fe(II) and Fe(III) to produce various naphthalene derivatives under microwave heating conditions. Mechanistic calculations found that the Fe(II) catalyst activates the styrenyl diene in an inverse-electron-demand Diels-Alder reaction, and the consecutive dehydrogenation reaction can be promoted by either Fe(II)-catalyzed direct dehydrogenation or an Fe(III)-catalyzed rearomatization/dehydrogenation pathway.

  7. Vibrational spectroscopy and intramolecular energy transfer in isocyanic acid (HNCO)

    International Nuclear Information System (INIS)

    Coffey, M.J.; Berghout, H.L.; Woods, E. III; Crim, F.F.

    1999-01-01

    Room temperature photoacoustic spectra in the region of the first through the fourth overtones (2ν 1 to 5ν 1 ) and free-jet action spectra of the second through the fourth overtones (3ν 1 to 5ν 1 ) of the N - H stretching vibration permit analysis of the vibrational and rotational structure of HNCO. The analysis identifies the strong intramolecular couplings that control the early stages of intramolecular vibrational energy redistribution (IVR) and gives the interaction matrix elements between the zero-order N - H stretching states and the other zero-order states with which they interact. The experimentally determined couplings and zero-order state separations are consistent with ab initio calculations of East, Johnson, and Allen [J. Chem. Phys. 98, 1299 (1993)], and comparison with the calculation identifies the coupled states and likely interactions. The states most strongly coupled to the pure N - H stretching zero-order states are ones with a quantum of N - H stretching excitation (ν 1 ) replaced by different combinations of N - C - O asymmetric or symmetric stretching excitation (ν 2 or ν 3 ) and trans-bending excitation (ν 4 ). The two strongest couplings of the nν 1 state are to the states (n-1)ν 1 +ν 2 +ν 4 and (n-1)ν 1 +ν 3 +2ν 4 , and sequential couplings through a series of low order resonances potentially play a role. The analysis shows that if the pure N - H stretch zero-order state were excited, energy would initially flow out of that mode into the strongly coupled mode in 100 fs to 700 fs, depending on the level of initial excitation. copyright 1999 American Institute of Physics

  8. Molecular Dynamics Simulation of Barnase: Contribution of Noncovalent Intramolecular Interaction to Thermostability

    Directory of Open Access Journals (Sweden)

    Zhiguo Chen

    2013-01-01

    Full Text Available Bacillus amyloliquefaciens ribonuclease Barnase (RNase Ba is a 12 kD (kilodalton small extracellular ribonuclease. It has broad application prospects in agriculture, clinical medicine, pharmaceutical, and so forth. In this work, the thermal stability of Barnase has been studied using molecular dynamics simulation at different temperatures. The present study focuses on the contribution of noncovalent intramolecular interaction to protein stability and how they affect the thermal stability of the enzyme. Profiles of root mean square deviation and root mean square fluctuation identify thermostable and thermosensitive regions of Barnase. Analyses of trajectories in terms of secondary structure content, intramolecular hydrogen bonds and salt bridge interactions indicate distinct differences in different temperature simulations. In the simulations, Four three-member salt bridge networks (Asp8-Arg110-Asp12, Arg83-Asp75-Arg87, Lys66-Asp93-Arg69, and Asp54-Lys27-Glu73 have been identified as critical salt bridges for thermostability which are maintained stably at higher temperature enhancing stability of three hydrophobic cores. The study may help enlighten our knowledge of protein structural properties, noncovalent interactions which can stabilize secondary peptide structures or promote folding, and also help understand their actions better. Such an understanding is required for designing efficient enzymes with characteristics for particular applications at desired working temperatures.

  9. Heat conduction in chain polymer liquids: molecular dynamics study on the contributions of inter- and intramolecular energy transfer.

    Science.gov (United States)

    Ohara, Taku; Yuan, Tan Chia; Torii, Daichi; Kikugawa, Gota; Kosugi, Naohiro

    2011-07-21

    In this paper, the molecular mechanisms which determine the thermal conductivity of long chain polymer liquids are discussed, based on the results observed in molecular dynamics simulations. Linear n-alkanes, which are typical polymer molecules, were chosen as the target of our studies. Non-equilibrium molecular dynamics simulations of bulk liquid n-alkanes under a constant temperature gradient were performed. Saturated liquids of n-alkanes with six different chain lengths were examined at the same reduced temperature (0.7T(c)), and the contributions of inter- and intramolecular energy transfer to heat conduction flux, which were identified as components of heat flux by the authors' previous study [J. Chem. Phys. 128, 044504 (2008)], were observed. The present study compared n-alkane liquids with various molecular lengths at the same reduced temperature and corresponding saturated densities, and found that the contribution of intramolecular energy transfer to the total heat flux, relative to that of intermolecular energy transfer, increased with the molecular length. The study revealed that in long chain polymer liquids, thermal energy is mainly transferred in the space along the stiff intramolecular bonds. This finding implies a connection between anisotropic thermal conductivity and the orientation of molecules in various organized structures with long polymer molecules aligned in a certain direction, which includes confined polymer liquids and self-organized structures such as membranes of amphiphilic molecules in water.

  10. QTAIM and Stress Tensor Characterization of Intramolecular Interactions Along Dynamics Trajectories of a Light-Driven Rotary Molecular Motor.

    Science.gov (United States)

    Wang, Lingling; Huan, Guo; Momen, Roya; Azizi, Alireza; Xu, Tianlv; Kirk, Steven R; Filatov, Michael; Jenkins, Samantha

    2017-06-29

    A quantum theory of atoms in molecules (QTAIM) and stress tensor analysis was applied to analyze intramolecular interactions influencing the photoisomerization dynamics of a light-driven rotary molecular motor. For selected nonadiabatic molecular dynamics trajectories characterized by markedly different S 1 state lifetimes, the electron densities were obtained using the ensemble density functional theory method. The analysis revealed that torsional motion of the molecular motor blades from the Franck-Condon point to the S 1 energy minimum and the S 1 /S 0 conical intersection is controlled by two factors: greater numbers of intramolecular bonds before the hop-time and unusually strongly coupled bonds between the atoms of the rotor and the stator blades. This results in the effective stalling of the progress along the torsional path for an extended period of time. This finding suggests a possibility of chemical tuning of the speed of photoisomerization of molecular motors and related molecular switches by reshaping their molecular backbones to decrease or increase the degree of coupling and numbers of intramolecular bond critical points as revealed by the QTAIM/stress tensor analysis of the electron density. Additionally, the stress tensor scalar and vector analysis was found to provide new methods to follow the trajectories, and from this, new insight was gained into the behavior of the S 1 state in the vicinity of the conical intersection.

  11. Intra-molecular selectivity of muonium towards chlorinated aromatic compounds

    International Nuclear Information System (INIS)

    Venkateswaran, K.; Stadlbauer, J.M.; Laing, M.E.; Klugkist, J.; Chong, D.P.; Porter, G.B.; Walker, D.C.

    1994-01-01

    Muon resonance studies show that muonium atoms (Mu) in ethanol add selectively to certain C-sites of aromatic compounds containing -Cl and -OH substituents. The sites chosen seem to be those carrying the lowest electron density. This helps to characterize Mu as a nucleophile in addition reactions and, in this respect, Mu differs from ordinary H-atoms. The study shows no apparent inter-molecular selectivity between a pair of aromatic solutes in an equimolar mixture, but strong intra-molecular selectivity in an ether composed of those two aromatic rings. This difference between intra- and inter-molecular selectivity is interpreted as kinetic in origin - arising from the 'caging effect' of the solvent and peculiar to reactions close to the diffusion-controlled limit. (orig.)

  12. Intramolecular anionic diels-alder reactions of 1-aryl-4-oxahepta-1,6-diyne systems in DMSO.

    Science.gov (United States)

    Kudoh, Takayuki; Mori, Tomoko; Shirahama, Mitsuhito; Yamada, Masashi; Ishikawa, Teruhiko; Saito, Seiki; Kobayashi, Hisayoshi

    2007-04-25

    Base-promoted cycloaddition reactions of 1-aryl- or 1-aryl-7-substituted-4-oxahepta-1,6-diyne systems in DMSO have proven to involve an anionic intramolecular Diels-Alder process taking place even at room temperature in spite of the reaction suffering from temporary disruption of aromaticity. Although initially formed alpha-arylallenide anion can be protonated by DMSO, it can be back to the allenide anion probably because of a small acidity difference between alpha-arylallene and DMSO. The alpha-arylallenide anion in combination with the alpha-aryl substituent can constitute an anionic diene structure that undergoes the intramolecular Diels-Alder reaction involving the C(6)-yne part, a very fast process probably because of the increased HOMO-1 level of the anionic diene, as shown by DFT calculations. Diversified substituted naphthalenes, benzofurans, phenanthrenes, and quinolines, including biaryl architectures, are available from 4-oxahepta-1,6-diynes in a highly expeditious way.

  13. On Hydrogen Bonding in the Intramolecularly Chelated Taitomers of Enolic Malondialdehyde and its Mono- and Dithio-Analogues

    DEFF Research Database (Denmark)

    Carlsen, Lars; Duus, Fritz

    1980-01-01

    The intramolecular hydrogen bondings in enolic malondialdehyde and it mono- and dithio-analogues have been evaluated by a semiempricial SCF–MO–CNDO method. The calculations predict that the hydrogen bonds play an important part in the stabilities of malondialdehyde and monothiomalondialdehyde...

  14. An efficient and green synthesis of 1-indanone and 1-tetralone via intramolecular Friedel-Crafts acylation reaction

    DEFF Research Database (Denmark)

    Tran, Phuong Hoang; Huynh, Vy Hieu; Hansen, Poul Erik

    2015-01-01

    Metal-triflate-catalyzed intramolecular Friedel–Crafts acylation of 3-arylpropanoic and 4-arylbutanoic acids in triflate-anion ionic liquids under monomodal microwave irradiation is reported. The environmentally benign synthetic procedure allows the formation of cyclic ketones in good yields with...

  15. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  16. Diastereoselective Synthesis of Novel Heterocyclic Scaffolds through Tandem Petasis 3-Component/Intramolecular Diels-Alder and ROM-RCM Reactions

    DEFF Research Database (Denmark)

    Ishøy, Mette; Petersen, Rico; Petersen, Michael Åxman

    2017-01-01

    A high-yielding, stereoselective and extraordinarily complexity generatingPetasis 3-component/intramolecular Diels-Alderreaction has been developed. In combination with ROM-RCM, rapid access to complex sp3-rich heterocyclic scaffolds amenableto subsequent functionalization and library synthesis...

  17. Intramolecular interactions in a new tris-dithizonatocobalt(III) complex

    International Nuclear Information System (INIS)

    Eschwege, Karel G. von; As, Lydia van; Joubert, Chris C.; Swarts, Jannie C.; Aquino, Manuel A.S.; Cameron, T. Stanley

    2013-01-01

    Graphical abstract: Electrochemically Co(HDz) 3 (5), show three main ligand-based redox processes, two reductions and one oxidation. Ligand oxidations can be resolved into three components highlighting effective intramolecular interactions between molecular fragments; a spectroelectrochemical study of (5) highlighted spectroscopic changes during the six observed redox steps. - Highlights: • Comparative CV's of dithizone (1), PhHg(HDz) and new Co(HDz) 3 (5), is discussed. • One oxidation and two reductions per ligand and a Co III/II couple for (5) are observed. • Mono- and tris-coordinated PhHg(HDz) and (5) have stable metal thioether bonds. • Crystal structure details explain good resolution between ligand redox processes. • Spectro-electrochemistry of (5) highlights spectroscopic properties of redox products. - Abstract: The reactions between dithizone (H 2 Dz (1)) or potassium dithizonate (KHDz (3)), and [Co(H 2 O) 6 ] 2+ (6), in acetone or methanol to liberate tris-dithizonatocobalt(III), Co(HDz) 3 (5), are described. The structure of (5) was confirmed by single crystal X-ray analyses and shows bidentate coordination to Co III via S and N donor atoms for all three HDz − ligands. A comparative voltammetric and spectro-electrochemical study revealed that (1) can be oxidised in two one-electron transfer steps, to generate a disulphide first and then HDz + . In contrast, upon complexation with cobalt, the free mercaptan group of (1) becomes a stable “metal thioether”, Co-S-C, which effectively prevents disulphide formation in all three ligands of (5) upon electrochemical oxidation. As a result, each ligand of Co(HDz) 3 shows just one oxidation process. Intramolecular communication between ligands is evident because the three separate ligand-based oxidations are well resolved. Two irreversible ligand reduction steps, each consisting of three unresolved components related to each of the three ligands, were also observed. The Co II /Co III couple

  18. Structural effects on the electronic characteristics of intramolecularly intercalated alkali-rubrene complexes

    Energy Technology Data Exchange (ETDEWEB)

    Li, Tsung-Lung, E-mail: quantum@mail.ncyu.edu.tw [Department of Electrophysics, National Chia-Yi University, 300 Hsueh-Fu Road, Chiayi, 60004, Taiwan, ROC (China); Lu, Wen-Cai, E-mail: wencailu@jlu.edu.cn [Laboratory of Fiber Materials and Modern Textile, Growing Base for State Key Laboratory, College of Physics, Qingdao University, Qingdao, Shandong 266071 (China); State Key Laboratory of Theoretical and Computational Chemistry, Institute of Theoretical Chemistry, Jilin University, Changchun, Jilin 130021 (China)

    2016-11-01

    The geometric and electronic structures of neutral monolithium- and monosodium-rubrene (Li{sub 1} Rub and Na{sub 1} Rub) isomers are investigated and compared with monopotassium-rubrene (K{sub 1} Rub). Based on the alkali binding site, all isomers of these alkali-rubrene complexes can be subdivided into two types: intramolecularly intercalated and extramolecularly adsorbed. The minimum-energy Li{sub 1} Rub and Na{sub 1} Rub are intercalated structures, whereas the minimum-energy K{sub 1} Rub is adsorbed. The fact that the intercalated Li{sub 1} Rub and Na{sub 1} Rub structures are energetically favorable over the adsorbed ones can be explained by two energy rules. First, “double” proximity of the intercalating alkali element to a pair of phenyl side groups enormously reduces the total energy. Second, accommodation of a minuscule intercalant does not significantly deform the carbon frame and, thus, increases the energy only by a small amount. Additionally, the peculiar effects of intramolecular intercalation on the electronic structures of molecules are also studied in this simulation of monoalkali intercalation. In the monoalkali-intercalated rubrene complex, only one of the two pairs of phenyl groups of rubrene is intercalated, intentionally leaving another pair pristine, which facilitates the comparison of electronic structures between the intercalated and pristine pairs of phenyl side groups in a single molecule. The uniformity of chemical environments of the phenyl groups of the intercalated Li{sub 1} Rub/Na{sub 1} Rub is deteriorated by the incorporation of the intercalant, and leads to their spectral characteristics in contrast to K{sub 1} Rub. In particular, the introduction of the intercalant promotes the carbon 2p orbitals of the intercalated phenyl pair to take part in the electronic structures of the HOMO and LUMO peaks of Li{sub 1} Rub/Na{sub 1} Rub. The unpaired electron in the HOMO is delocalized over the backbone with higher probability of

  19. Intramolecular Azide to Alkene Cycloadditions for the Construction of Pyrrolobenzodiazepines and Azetidino-Benzodiazepines

    Directory of Open Access Journals (Sweden)

    Karl Hemming

    2014-10-01

    Full Text Available The coupling of proline- and azetidinone-substituted alkenes to 2-azidobenzoic and 2-azidobenzenesulfonic acid gives precursors that undergo intramolecular azide to alkene 1,3-dipolar cycloadditions to give imine-, triazoline- or aziridine-containing pyrrolo[1,4]benzodiazepines (PBDs, pyrrolo[1,2,5]benzothiadiazepines (PBTDs, and azetidino[1,4]benzodiazepines. The imines and aziridines are formed after loss of nitrogen from a triazoline cycloadduct. The PBDs are a potent class of antitumour antibiotics.

  20. Molecular structures and intramolecular dynamics of pentahalides

    Science.gov (United States)

    Ischenko, A. A.

    2017-03-01

    This paper reviews advances of modern gas electron diffraction (GED) method combined with high-resolution spectroscopy and quantum chemical calculations in studies of the impact of intramolecular dynamics in free molecules of pentahalides. Some recently developed approaches to the electron diffraction data interpretation, based on direct incorporation of the adiabatic potential energy surface parameters to the diffraction intensity are described. In this way, complementary data of different experimental and computational methods can be directly combined for solving problems of the molecular structure and its dynamics. The possibility to evaluate some important parameters of the adiabatic potential energy surface - barriers to pseudorotation and saddle point of intermediate configuration from diffraction intensities in solving the inverse GED problem is demonstrated on several examples. With increasing accuracy of the electron diffraction intensities and the development of the theoretical background of electron scattering and data interpretation, it has become possible to investigate complex nuclear dynamics in fluxional systems by the GED method. Results of other research groups are also included in the discussion.

  1. Flower bud transcriptome analysis of Sapium sebiferum (Linn.) Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Science.gov (United States)

    Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang

    2015-01-01

    Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  2. The Intramolecular Diels–Alder Reaction of Tryptamine-Derived Zincke Aldehydes Is a Stepwise Process

    OpenAIRE

    Pham, Hung V.; Martin, David B. C.; Vanderwal, Christopher D.; Houk, K. N.

    2012-01-01

    Computational studies show that the base-mediated intramolecular Diels–Alder of tryptamine-derived Zincke aldehydes, used as a key step in the synthesis of the Strychnos alkaloids norfluorocurarine and strychnine, proceeds via a stepwise pathway. The experimentally determined importance of a potassium counterion in the base is explained by its ability to preorganize the Zincke aldehyde diene in an s-cis conformation suitable to bicyclization. Computation also supports the thermodynamic import...

  3. Modeling and computations of the intramolecular electron transfer process in the two-heme protein cytochrome em>c>4

    DEFF Research Database (Denmark)

    Natzmutdinov, Renat R.; Bronshtein, Michael D.; Zinkicheva, Tamara T.

    2012-01-01

    force were determined using dielectric continuum models. We then calculated the electronic transmission coefficient of the intramolecular ET rate using perturbation theory combined with the electronic wave functions determined by the DFT calculations for different heme group orientations and Fe...

  4. A Convergent Enantioselective Total Synthesis of (-)-Perhydrohistrionicotoxin with an Intramolecular Imino Ene-type Reaction as a Key Step

    DEFF Research Database (Denmark)

    Tanner, David Ackland; Hagberg, Lars

    1998-01-01

    A convergent enantioselective total synthesis of the neurotoxic spirocyclic alkaloid (-)-perhydrohistrionicotoxin (2) is described. A Lewis acid-mediated intramolecular imine ene-type reaction was used for the key spirocyclisation step (14 to 3, with 3 being obtained as a single diastereoisomer...

  5. A novel and facile decay path of Criegee intermediates by intramolecular insertion reactions via roaming transition states

    International Nuclear Information System (INIS)

    Nguyen, Trong-Nghia; Putikam, Raghunath; Lin, M. C.

    2015-01-01

    We have discovered a new and highly competitive product channel in the unimolecular decay process for small Criegee intermediates, CH 2 OO and anti/syn-CH 3 C(H)OO, occurring by intramolecular insertion reactions via a roaming-like transition state (TS) based on quantum-chemical calculations. Our results show that in the decomposition of CH 2 OO and anti-CH 3 C(H)OO, the predominant paths directly produce cis-HC(O)OH and syn-CH 3 C(O)OH acids with >110 kcal/mol exothermicities via loose roaming-like insertion TSs involving the terminal O atom and the neighboring C–H bonds. For syn-CH 3 C(H)OO, the major decomposition channel occurs by abstraction of a H atom from the CH 3 group by the terminal O atom producing CH 2 C(H)O–OH. At 298 K, the intramolecular insertion process in CH 2 OO was found to be 600 times faster than the commonly assumed ring-closing reaction

  6. Flow Cytometry Enables Multiplexed Measurements of Genetically Encoded Intramolecular FRET Sensors Suitable for Screening.

    Science.gov (United States)

    Doucette, Jaimee; Zhao, Ziyan; Geyer, Rory J; Barra, Melanie M; Balunas, Marcy J; Zweifach, Adam

    2016-07-01

    Genetically encoded sensors based on intramolecular FRET between CFP and YFP are used extensively in cell biology research. Flow cytometry has been shown to offer a means to measure CFP-YFP FRET; we suspected it would provide a unique way to conduct multiplexed measurements from cells expressing different FRET sensors, which is difficult to do with microscopy, and that this could be used for screening. We confirmed that flow cytometry accurately measures FRET signals using cells transiently transfected with an ERK activity reporter, comparing responses measured with imaging and cytometry. We created polyclonal long-term transfectant lines, each expressing a different intramolecular FRET sensor, and devised a way to bar-code four distinct populations of cells. We demonstrated the feasibility of multiplexed measurements and determined that robust multiplexed measurements can be conducted in plate format. To validate the suitability of the method for screening, we measured responses from a plate of bacterial extracts that in unrelated experiments we had determined contained the protein kinase C (PKC)-activating compound teleocidin A-1. The multiplexed assay correctly identifying the teleocidin A-1-containing well. We propose that multiplexed cytometric FRET measurements will be useful for analyzing cellular function and for screening compound collections. © 2016 Society for Laboratory Automation and Screening.

  7. Effect of Hartree-Fock exact exchange on intramolecular magnetic coupling constants of organic diradicals

    Science.gov (United States)

    Cho, Daeheum; Ko, Kyoung Chul; Ikabata, Yasuhiro; Wakayama, Kazufumi; Yoshikawa, Takeshi; Nakai, Hiromi; Lee, Jin Yong

    2015-01-01

    The intramolecular magnetic coupling constant (J) of diradical systems linked with five- or six-membered aromatic rings was calculated to obtain the scaling factor (experimental J/calculated J ratio) for various density functional theory (DFT) functionals. Scaling factors of group A (PBE, TPSSh, B3LYP, B97-1, X3LYP, PBE0, and BH&HLYP) and B (M06-L, M06, M06-2X, and M06-HF) were shown to decrease as the amount of Hartree-Fock exact exchange (HFx) increases, in other words, overestimation of calculated J becomes more severe as the HFx increases. We further investigated the effect of HFx fraction of DFT functional on J value, spin contamination, and spin density distributions by comparing the B3LYP analogues containing different amount of HFx. It was revealed that spin contamination and spin densities at each atom increases as the HFx increases. Above all, newly developed BLYP-5 functional, which has 5% of HFx, was found to have the scaling factor of 1.029, indicating that calculated J values are very close to that of experimental values without scaling. BLYP-5 has potential to be utilized for accurate evaluation of intramolecular magnetic coupling constant (J) of diradicals linked by five- or six-membered aromatic ring couplers.

  8. Effect of Hartree-Fock exact exchange on intramolecular magnetic coupling constants of organic diradicals

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Daeheum; Ko, Kyoung Chul; Lee, Jin Yong, E-mail: jinylee@skku.edu [Department of Chemistry, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Ikabata, Yasuhiro; Wakayama, Kazufumi; Yoshikawa, Takeshi [Department of Chemistry and Biochemistry, School of Advanced Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555 (Japan); Nakai, Hiromi, E-mail: nakai@waseda.jp [Department of Chemistry and Biochemistry, School of Advanced Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555 (Japan); Research Institute for Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555 (Japan); CREST, Japan Science and Technology Agency, Tokyo 102-0075 (Japan); Elements Strategy Initiative for Catalysts and Batteries (ESICB), Kyoto University, Katsura, Kyoto 615-8520 (Japan)

    2015-01-14

    The intramolecular magnetic coupling constant (J) of diradical systems linked with five- or six-membered aromatic rings was calculated to obtain the scaling factor (experimental J/calculated J ratio) for various density functional theory (DFT) functionals. Scaling factors of group A (PBE, TPSSh, B3LYP, B97-1, X3LYP, PBE0, and BH and HLYP) and B (M06-L, M06, M06-2X, and M06-HF) were shown to decrease as the amount of Hartree-Fock exact exchange (HFx) increases, in other words, overestimation of calculated J becomes more severe as the HFx increases. We further investigated the effect of HFx fraction of DFT functional on J value, spin contamination, and spin density distributions by comparing the B3LYP analogues containing different amount of HFx. It was revealed that spin contamination and spin densities at each atom increases as the HFx increases. Above all, newly developed BLYP-5 functional, which has 5% of HFx, was found to have the scaling factor of 1.029, indicating that calculated J values are very close to that of experimental values without scaling. BLYP-5 has potential to be utilized for accurate evaluation of intramolecular magnetic coupling constant (J) of diradicals linked by five- or six-membered aromatic ring couplers.

  9. Direct electrochemistry and intramolecular electron transfer of ascorbate oxidase confined on L-cysteine self-assembled gold electrode.

    Science.gov (United States)

    Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo

    2014-02-01

    A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 166±3mV (vs. Ag│AgCl│KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.41×10(-11)molcm(-2) with the apparent adsorption coefficient of 1.63×10(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function. © 2013.

  10. Spectroscopic studies of the intramolecular hydrogen bonding in o-hydroxy Schiff bases, derived from diaminomaleonitrile, and their deprotonation reaction products

    Science.gov (United States)

    Szady-Chełmieniecka, Anna; Kołodziej, Beata; Morawiak, Maja; Kamieński, Bohdan; Schilf, Wojciech

    2018-01-01

    The structural study of five Schiff bases derived from diaminomaleonitrile (DAMN) and 2-hydroxy carbonyl compounds was performed using 1H, 13C and 15N NMR methods in solution and in the solid state as well. ATR-FTIR and X-Ray spectroscopies were used for confirmation of the results obtained by NMR method. The imine obtained from DAMN and benzaldehyde was synthesized as a model compound which lacks intramolecular hydrogen bond. Deprotonation of all synthesized compounds was done by treating with tetramethylguanidine (TMG). NMR data revealed that salicylidene Schiff bases in DMSO solution exist as OH forms without intramolecular hydrogen bonds and independent on the substituents in aromatic ring. In the case of 2-hydroxy naphthyl derivative, the OH proton is engaged into weak intramolecular hydrogen bond. Two of imines (salDAMN and 5-BrsalDAMN) exist in DMSO solution as equilibrium mixtures of two isomers (A and B). The structures of equilibrium mixture in the solid state have been studied by NMR, ATR-FTIR and X-Ray methods. The deprotonation of three studied compounds (salDAMN, 5-BrsalDAMN, and 5-CH3salDAMN) proceeded in two different ways: deprotonation of oxygen atom (X form) or of nitrogen atom of free primary amine group of DAMN moiety (Y form). For 5-NO2salDAMN and naphDAMN only one form (X) was observed.

  11. Cloning, Sequencing, and Expression of the Gene Encoding Cyclic 2,3-Diphosphoglycerate Synthetase, the Key Enzyme of Cyclic 2,3-Diphosphoglycerate Metabolism in Methanothermus fervidus

    OpenAIRE

    Matussek, Karl; Moritz, Patrick; Brunner, Nina; Eckerskorn, Christoph; Hensel, Reinhard

    1998-01-01

    Cyclic 2,3-diphosphoglycerate synthetase (cDPGS) catalyzes the synthesis of cyclic 2,3-diphosphoglycerate (cDPG) by formation of an intramolecular phosphoanhydride bond in 2,3-diphosphoglycerate. cDPG is known to be accumulated to high intracellular concentrations (>300 mM) as a putative thermoadapter in some hyperthermophilic methanogens. For the first time, we have purified active cDPGS from a methanogen, the hyperthermophilic archaeon Methanothermus fervidus, sequenced the coding gene, and...

  12. Diazo Esters as Dienophiles in Intramolecular (4 + 2) Cycloadditions: Computational Explorations of Mechanism.

    Science.gov (United States)

    Duan, Abing; Yu, Peiyuan; Liu, Fang; Qiu, Huang; Gu, Feng Long; Doyle, Michael P; Houk, K N

    2017-02-22

    The first experimental examples of Diels-Alder (DA) reactions of diazo compounds as heterodienophiles with dienes have been studied with density functional theory (DFT) using the M06-2X functional. For comparison, the reactivities of diazo esters as dienophiles or 1,3-dipoles with 1,3-dienes in intermolecular model systems have been analyzed by the distortion/interaction model. The 1,3-dipolar cycloaddition is strongly favored for the intermolecular system. The intramolecular example is unique because the tether strongly favors the (4 + 2) cycloaddition.

  13. Intramolecular Valence and Spin Interaction in meso and rac Diastereomers of a p-Quinonoid-Bridged Diruthenium Complex

    Czech Academy of Sciences Publication Activity Database

    Kumbhakar, D.; Sarkar, B.; Maji, S.; Mobin, S. M.; Fiedler, Jan; Urbanos, F. A.; Jimenez-Aparicio, R.; Kaim, W.; Lahiri, G. K.

    2008-01-01

    Roč. 130, č. 51 (2008), s. 17575-17583 ISSN 0002-7863 R&D Projects: GA MŠk OC 139; GA MŠk LC510 Institutional research plan: CEZ:AV0Z40400503 Keywords : intramolecular valence * spin interaction * diruthenium complex Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 8.091, year: 2008

  14. The controlled formation and cleavage of an intramolecular d8-d8 Pt-Pt interaction in a dinuclear cycloplatinated molecular "pivot-hinge".

    Science.gov (United States)

    Koo, Chi-Kin; Wong, Ka-Leung; Lau, Kai-Cheung; Wong, Wai-Yeung; Lam, Michael Hon-Wah

    2009-08-03

    The bis(diphenylphosphino)methane (dppm)-bridged dinuclear cycloplatinated complex {[Pt(L)](2)(mu-dppm)}(2+) (Pt(2)dppm; HL: 2-phenyl-6-(1H-pyrazol-3-yl)-pyridine) demonstrates interesting reversible "pivot-hinge"-like intramolecular motions in response to the protonation/deprotonation of L. In its protonated "closed" configuration, the two platinum(II) centers are held in position by intramolecular d(8)-d(8) Pt-Pt interaction. In its deprotonated "open" configuration, such Pt-Pt interaction is cleaved. To further understand the mechanism behind this hingelike motion, an analogous dinuclear cycloplatinated complex, {[Pt(L)](2)(mu-dchpm)}(2+) (Pt(2)dchpm) with bis(dicyclohexylphosphino)methane (dchpm) as the bridging ligand, was synthesized. From its protonation/deprotonation responses, it was revealed that aromatic pi-pi interactions between the phenyl moieties of the mu-dppm and the deprotonated pyrazolyl rings of L was essential to the reversible cleavage of the intramolecular Pt-Pt interaction in Pt(2)dppm. In the case of Pt(2)dchpm, spectroscopic and spectrofluorometric titrations as well as X-ray crystallography indicated that the distance between the two platinum(II) centers shrank upon deprotonation, thus causing a redshift in its room-temperature triplet metal-metal-to-ligand charge-transfer emission from 614 to 625 nm. Ab initio calculations revealed the presence of intramolecular hydrogen bonding between the deprotonated and negatively charged 1-pyrazolyl-N moiety and the methylene CH and phenyl C-H of the mu-dppm. The "open" configuration of the deprotonated Pt(2)dppm was estimated to be 19 kcal mol(-1) more stable than its alternative "closed" configuration. On the other hand, the open configuration of the deprotonated Pt(2)dchpm was 6 kcal mol(-1) less stable than its alternative closed configuration.

  15. Remote Stereoinductive Intramolecular Nitrile Oxide Cycloaddition: Asymmetric Total Synthesis and Structure Revision of (-)-11β-Hydroxycurvularin.

    Science.gov (United States)

    Choe, Hyeonjeong; Pham, Thuy Trang; Lee, Joo Yun; Latif, Muhammad; Park, Haeil; Kang, Young Kee; Lee, Jongkook

    2016-03-18

    The first total synthesis and structure revision of (-)-11β-hydroxycurvularin (1b), a macrolide possessing a β-hydroxyketone moiety, were accomplished. The β-hydroxyketone moiety in this natural product was introduced by cleavage of the N-O bond in an isoxazoline ring that was formed diastereoselectively in a 1,5-remote stereocontrolled fashion by employing intramolecular nitrile oxide cycloaddition.

  16. Synthesis of 2,5-Disubstituted Octahydroquinolin-4-ones via anIntramolecular Hetero Diels-Alder Reaction

    Directory of Open Access Journals (Sweden)

    J. Antonio Palenzuela

    2007-02-01

    Full Text Available A route for the preparation of 2,5-disubstituted octahydroquinolin-4-ones, synthetic precursors of the decahydroquinoline-type toxins, is presented. The key steps are an asymmetric epoxidation and an intramolecular hetero Diels-Alder reaction between an activated diene and an imine. The presence of an allylic stereogenic center induces some selectivity and thus only two cycloadducts are obtained in 70:30 ratio and good yield.

  17. Energy of Intramolecular Hydrogen Bonding in ortho-Hydroxybenzaldehydes, Phenones and Quinones. Transfer of Aromaticity from ipso-Benzene Ring to the Enol System(s

    Directory of Open Access Journals (Sweden)

    Danuta Rusinska-Roszak

    2017-03-01

    Full Text Available Intramolecular hydrogen bonding (HB is one of the most studied noncovalent interactions of molecules. Many physical, spectral, and topological properties of compounds are under the influence of HB, and there are many parameters used to notice and to describe these changes. Hitherto, no general method of measurement of the energy of intramolecular hydrogen bond (EHB has been put into effect. We propose the molecular tailoring approach (MTA for EHB calculation, modified to apply it to Ar-O-H∙∙∙O=C systems. The method, based on quantum calculations, was checked earlier for hydroxycarbonyl-saturated compounds, and for structures with resonance-assisted hydrogen bonding (RAHB. For phenolic compounds, the accuracy, repeatability, and applicability of the method is now confirmed for nearly 140 structures. For each structure its aromaticity HOMA indices were calculated for the central (ipso ring and for the quasiaromatic rings given by intramolecular HB. The comparison of calculated HB energies and values of estimated aromaticity indices allowed us to observe, in some substituted phenols and quinones, the phenomenon of transfer of aromaticity from the ipso-ring to the H-bonded ring via the effect of electron delocalization.

  18. Structural, photophysical, and theoretical studies of imidazole-based excited-state intramolecular proton transfer molecules

    Science.gov (United States)

    Somasundaram, Sivaraman; Kamaraj, Eswaran; Hwang, Su Jin; Park, Sanghyuk

    2018-02-01

    Imidazole-based excited state intramolecular proton transfer (ESIPT) blue fluorescent molecules, 2-(1-(4-chlorophenyl)-4,5-diphenyl-1H-imidazol-2-yl)phenol (BHPI-Cl) and 2-(1-(4-bromophenyl)-4,5-diphenyl-1H-imidazol-2-yl)phenol (BHPI-Br) were designed and synthesized by Debus-Radziszewski method through a one-pot multicomponent reaction in high yield. The synthesized compounds were fully characterized by 1H NMR, 13C NMR, FT-IR, FT-Raman, GC-Mass, and elemental analysis. The molecular structures in single crystal lattice were studied by X-ray crystallographic analysis. Because of the intramolecular hydrogen bonding, hydroxyphenyl group is planar to the central imidazole ring, while the other phenyl rings gave distorted conformations to the central heterocyclic ring. BHPI-Cl and BHPI-Br molecules showed intense ESIPT fluorescence at 480 nm, because the two twisted phenyl rings on 4- and 5-positions have reduced intermolecular interaction between adjacent molecules in each crystal through a head-to-tail packing manner. Quantum chemical calculations of energies were carried out by (TD-)DFT using B3LYP/6-31G(d, p) basis set to predict the electronic absorption spectra of the compounds, and they showed good agreement between the computational and the experimental values. The thermal analyses of the synthesized molecules were also carried out by TGA/DSC method.

  19. A novel and facile decay path of Criegee intermediates by intramolecular insertion reactions via roaming transition states

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Trong-Nghia [Department of Applied Chemistry and Institute of Molecular Science, National Chiao Tung University, Hsinchu 30010, Taiwan (China); Department of Physical Chemistry, Hanoi University of Science and Technology, Hanoi (Viet Nam); Putikam, Raghunath; Lin, M. C., E-mail: chemmcl@emory.edu [Department of Applied Chemistry and Institute of Molecular Science, National Chiao Tung University, Hsinchu 30010, Taiwan (China)

    2015-03-28

    We have discovered a new and highly competitive product channel in the unimolecular decay process for small Criegee intermediates, CH{sub 2}OO and anti/syn-CH{sub 3}C(H)OO, occurring by intramolecular insertion reactions via a roaming-like transition state (TS) based on quantum-chemical calculations. Our results show that in the decomposition of CH{sub 2}OO and anti-CH{sub 3}C(H)OO, the predominant paths directly produce cis-HC(O)OH and syn-CH{sub 3}C(O)OH acids with >110 kcal/mol exothermicities via loose roaming-like insertion TSs involving the terminal O atom and the neighboring C–H bonds. For syn-CH{sub 3}C(H)OO, the major decomposition channel occurs by abstraction of a H atom from the CH{sub 3} group by the terminal O atom producing CH{sub 2}C(H)O–OH. At 298 K, the intramolecular insertion process in CH{sub 2}OO was found to be 600 times faster than the commonly assumed ring-closing reaction.

  20. An excited-state intramolecular photon transfer fluorescence probe for localizable live cell imaging of cysteine

    Science.gov (United States)

    Liu, Wei; Chen, Wen; Liu, Si-Jia; Jiang, Jian-Hui

    2017-03-01

    Small molecule probes suitable for selective and specific fluorescence imaging of some important but low-concentration intracellular reactive sulfur species such as cysteine (Cys) pose a challenge in chemical biology. We present a readily available, fast-response fluorescence probe CHCQ-Ac, with 2-(5‧-chloro-2-hydroxyl-phenyl)-6-chloro-4(3 H)-quinazolinone (CHCQ) as the fluorophore and acrylate group as the functional moiety, that enables high-selectivity and high-sensitivity for detecting Cys in both solution and biological system. After specifically reacted with Cys, the probe undergoes a seven-membered intramolecular cyclization and released the fluorophore CHCQ with excited-state intramolecular photon transfer effect. A highly fluorescent, insoluble aggregate was then formed to facilitate high-sensitivity and high-resolution imaging. The results showed that probe CHCQ-Ac affords a remarkably large Stokes shift and can detect Cys under physiological pH condition with no interference from other analytes. Moreover, this probe was proved to have excellent chemical stability, low cytotoxicity and good cell permeability. Our design of this probe provides a novel potential tool to visualize and localize cysteine in bioimaging of live cells that would greatly help to explore various Cys-related physiological and pathological cellular processes in cell biology and diagnostics.

  1. Comparative analysis of complete chloroplast genome sequence and inversion variation in Lasthenia burkei (Madieae, Asteraceae).

    Science.gov (United States)

    Walker, Joseph F; Zanis, Michael J; Emery, Nancy C

    2014-04-01

    Complete chloroplast genome studies can help resolve relationships among large, complex plant lineages such as Asteraceae. We present the first whole plastome from the Madieae tribe and compare its sequence variation to other chloroplast genomes in Asteraceae. We used high throughput sequencing to obtain the Lasthenia burkei chloroplast genome. We compared sequence structure and rates of molecular evolution in the small single copy (SSC), large single copy (LSC), and inverted repeat (IR) regions to those for eight Asteraceae accessions and one Solanaceae accession. The chloroplast sequence of L. burkei is 150 746 bp and contains 81 unique protein coding genes and 4 coding ribosomal RNA sequences. We identified three major inversions in the L. burkei chloroplast, all of which have been found in other Asteraceae lineages, and a previously unreported inversion in Lactuca sativa. Regions flanking inversions contained tRNA sequences, but did not have particularly high G + C content. Substitution rates varied among the SSC, LSC, and IR regions, and rates of evolution within each region varied among species. Some observed differences in rates of molecular evolution may be explained by the relative proportion of coding to noncoding sequence within regions. Rates of molecular evolution vary substantially within and among chloroplast genomes, and major inversion events may be promoted by the presence of tRNAs. Collectively, these results provide insight into different mechanisms that may promote intramolecular recombination and the inversion of large genomic regions in the plastome.

  2. Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.

    Science.gov (United States)

    Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh

    2017-10-18

    G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  3. Dynamics of excited-state intramolecular proton transfer reactions in piroxicam. Role of triplet states

    Science.gov (United States)

    Cho, Dae Won; Kim, Yong Hee; Yoon, Minjoong; Jeoung, Sae Chae; Kim, Dongho

    1994-08-01

    The picosecond time-resolved fluorescence and transient absorption behavior of piroxicam at room temperature are reported. The keto tautomer in the excited singlet state ( 1K*) formed via the fast intramolecular proton transfer (≈ 20 ps) is observed. The short-lived (7.5 ns) triplet state of keto tauomer ( 3K*) is generated from 1K * in toluene whereas it is hardly observed in ethanol. Consequently, rapid reverse proton transfer takes place from 3K * to the enol triplet state ( 3E *.

  4. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  5. Deuterium isotope effect on the intramolecular electron transfer in Pseudomonas aeruginosa azurin

    DEFF Research Database (Denmark)

    Farver, O.; Zhang, Jingdong; Chi, Qijin

    2001-01-01

    rather than negative. Isotope effects are, however, also inherent in the nuclear reorganization Gibbs free energy and in the tunneling factor for the electron transfer process. A slightly larger thermal protein expansion in H2O than in D2O (0.001 nm K-1) is sufficient both to account for the activation......Intramolecular electron transfer in azurin in water and deuterium oxide has been studied over a broad temperature range. The kinetic deuterium isotope effect, k(H)/k(D), is smaller than unity (0.7 at 298 K), primarily caused by the different activation entropies in water (-56.5 J K-1 mol(-1...

  6. Rotational Isomers, Intramolecular Hydrogen Bond, and IR Spectra of o-Vinylphenol Homologs

    Science.gov (United States)

    Glazunov, V. P.; Berdyshev, D. V.; Balaneva, N. N.; Radchenko, O. S.; Novikov, V. L.

    2018-03-01

    The ν(OH) stretching-mode bands in solution IR spectra of five o-vinylphenol (o-VPh) homologs in the slightly polar solvents CCl4 and n-hexane were studied. Several rotamers with free OH groups were found in solutions of o-VPh and its methyl-substituted derivatives in n-hexane. The proportion of rotamers in o-VPh homologs with intramolecular hydrogen bonds (IHBs) O-H...π varied from 22 to 97% in the gas and cyclohexane according to B3LYP/cc-pVTZ calculations. The theoretically estimated effective enthalpies -ΔH of their IHBs varied in the range 0.20-2.24 kcal/mol.

  7. Intramolecular dynamics within the N-Cap-SH3-SH2 regulatory unit of the c-Abl tyrosine kinase reveal targeting to the cellular membrane.

    Science.gov (United States)

    de Oliveira, Guilherme A P; Pereira, Elen G; Ferretti, Giulia D S; Valente, Ana Paula; Cordeiro, Yraima; Silva, Jerson L

    2013-09-27

    c-Abl is a key regulator of cell signaling and is under strict control via intramolecular interactions. In this study, we address changes in the intramolecular dynamics coupling within the c-Abl regulatory unit by presenting its N-terminal segment (N-Cap) with an alternative function in the cell as c-Abl becomes activated. Using small angle x-ray scattering, nuclear magnetic resonance, and confocal microscopy, we demonstrate that the N-Cap and the Src homology (SH) 3 domain acquire μs-ms motions upon N-Cap association with the SH2-L domain, revealing a stabilizing synergy between these segments. The N-Cap-myristoyl tether likely triggers the protein to anchor to the membrane because of these flip-flop dynamics, which occur in the μs-ms time range. This segment not only presents the myristate during c-Abl inhibition but may also trigger protein localization inside the cell in a functional and stability-dependent mechanism that is lost in Bcr-Abl(+) cells, which underlie chronic myeloid leukemia. This loss of intramolecular dynamics and binding to the cellular membrane is a potential therapeutic target.

  8. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

    Science.gov (United States)

    Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

    2012-06-01

    Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Synthesis and Intramolecular [4+2] Cycloaddition Reactions of 4-Pyridazinecarbonitriles with Alkyne Side Chains

    Directory of Open Access Journals (Sweden)

    Norbert Haider

    1998-01-01

    Full Text Available The preparation of a series of new 3-(alkynyl-X-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2] cycloaddition reaction.

  10. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  11. Enantioselective synthesis of chiral 3-aryl-1-indanones through rhodium-catalyzed asymmetric intramolecular 1,4-addition.

    Science.gov (United States)

    Yu, Yue-Na; Xu, Ming-Hua

    2013-03-15

    Enantioselective synthesis of potentially useful chiral 3-aryl-1-indanones was achieved through a rhodium-catalyzed asymmetric intramolecular 1,4-addition of pinacolborane chalcone derivatives using extraordinary simple MonoPhos as chiral ligand under relatively mild conditions. This novel protocol offers an easy access to a wide variety of enantioenriched 3-aryl-1-indanone derivatives in high yields (up to 95%) with excellent enantioselectivities (up to 95% ee).

  12. An abnormally slow proton transfer reaction in a simple HBO derivative due to ultrafast intramolecular-charge transfer events.

    Science.gov (United States)

    Alarcos, Noemí; Gutierrez, Mario; Liras, Marta; Sánchez, Félix; Douhal, Abderrazzak

    2015-07-07

    We report on the steady-state, picosecond and femtosecond time-resolved studies of a charge and proton transfer dye 6-amino-2-(2'-hydroxyphenyl)benzoxazole (6A-HBO) and its methylated derivative 6-amino-2-(2'-methoxyphenyl)benzoxazole (6A-MBO), in different solvents. With femtosecond resolution and comparison with the photobehaviour of 6A-MBO, we demonstrate for 6A-HBO in solution, the photoproduction of an intramolecular charge-transfer (ICT) process at S1 taking place in ∼140 fs or shorter, followed by solvent relaxation in the charge transferred species. The generated structure (syn-enol charge transfer conformer) experiences an excited-state intramolecular proton-transfer (ESIPT) reaction to produce a keto-type tautomer. This subsequent proton motion occurs in 1.2 ps (n-heptane), 14 ps (DCM) and 35 ps (MeOH). In MeOH, it is assisted by the solvent molecules and occurs through tunneling for which we got a large kinetic isotope effect (KIE) of about 13. For the 6A-DBO (deuterated sample in CD3OD) the global proton-transfer reaction takes place in 200 ps, showing a remarkable slow KIE regime. The slow ESIPT reaction in DCM (14 ps), not through tunnelling as it is not sensitive to OH/OD exchange, has however to overcome an energy barrier using intramolecular as well as solvent coordinates. The rich ESIPT dynamics of 6A-HBO in the used solutions is governed by an ICT reaction, triggered by the amino group, and it is solvent dependent. Thus, the charge injection to a 6A-HBO molecular frame makes the ICT species more stable, and the phenol group less acidic, slowing down the subsequent ESIPT reaction. Our findings bring new insights into the coupling between ICT and ESIPT reactions on the potential-energy surfaces of several barriers.

  13. Inter- and intramolecular deuterium isotope effects on the cytochrome P-450-catalyzed oxidative dehalogenation of 1,1,2,2-tetrachloroethane

    International Nuclear Information System (INIS)

    Hales, D.B.; Ho, B.; Thompson, J.A.

    1987-01-01

    The oxidation of 1,1,2,2-tetrachloroethane to dichloroacetic acid was investigated with rat liver microsomes and purified cytochrome P-450. Deuterium substitution had no effect on Km values, but both the inter- and intramolecular isotope effects (kH/kD) on Vmax were in the range 5.7-6.1. The equivalence of the inter- and intramolecular values indicates that 6.0 may be a good estimate of the intrinsic isotope effect. The intermolecular kH/kD value for the conversion of 1,1,2,2-trichloroethane and its 1- 2 H analog to chloroacetic acid was 5.5. These data, and the finding that 1 atom of 18 O was incorporated into the product when TCEA was oxidized in an 18 O 2 atmosphere, support an oxidative dechlorination mechanism that involves hydrogen atom abstraction by the P-450 intermediate oxo complex

  14. The effect of intramolecular donor–acceptor moieties with donor–π-bridge–acceptor structure on the solar photovoltaic performance

    Directory of Open Access Journals (Sweden)

    T. L. Wang

    2015-10-01

    Full Text Available A series of intramolecular donor–acceptor polymers containing different contents of (E-1-(2-ethylhexyl-6,9-dioctyl-2-(2-(thiophen-3-ylvinyl-1H-phenanthro[9,10-d]imidazole (thiophene-DOPI moiety and 4,4-diethylhexylcyclopenta[ 2,1-b:3,4-b']dithiophene (CPDT unit was synthesized via Grignard metathesis (GRIM polymerization. The synthesized random copolymers and homopolymer of thiophene-DOPI contain the donor–π-bridge–acceptor conjugated structure to tune the absorption spectra and energy levels of the resultant polymers. UV-vis spectra of the three polymer films exhibit panchromatic absorptions ranging from 300 to 1100 nm and low band gaps from 1.38 to 1.51 eV. It is found that more thiophene-DOPI moieties result in the decrease of band gap and lower the highest occupied molecular orbital (HOMO and lowest unoccupied molecular orbital (LUMO values of polymers. Photovoltaic performance results indicate that if the content of the intramolecular donor–acceptor moiety is high enough, the copolymer structure may be better than homopolymer due to more light-harvesting afforded by both monomer units.

  15. Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

    Science.gov (United States)

    2017-01-01

    We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

  16. Intramolecular transformation of thiyl radicals to α-aminoalkyl radicals: 'ab initio' calculations on homocystein

    International Nuclear Information System (INIS)

    Chhun, S.; Berges, J.; Bleton, V.; Abedinzadeh, Z.

    2000-01-01

    One-electron oxidation of thiols by oxidizing radicals leads to the formation of thiyl radical and carbon-centered radicals. It has been shown experimentally that in the absence of oxygen, the thiyl radicals derived from certain thiols of biological interest such as glutathion, cysteine and homocysteine decay rapidly by intramolecular rearrangement reactions into the carbon-centered radical. In the present work we have investigated theoretically the structure and the stability of thiyl and carbon-centered radicals of homocysteine in order to check the possibility of this rearrangement. (author)

  17. Use of ionic model for analysis of intramolecular movement in alkali metal metaborate molecules

    International Nuclear Information System (INIS)

    Ezhov, Yu.S.; Vinogradov, V.S.

    1978-01-01

    To clear out the peculiarities of intramolecular movement in MBO 2 (where M=Li, Na, K, Rb, Cs) molecules the energy dependence of cation electrostatic interaction with BO 2 anion on the charge value of oxygen, values of the MOB valence angle and internuclear distance r(M-O) is calculated. The calculation results on the base of ionic model show that the minimum of potential energy function corresponds to angular configuration of the MBO 2 molecules. Parameters of potential function of deformation oscillation connected with the change of MOB angle, are evaluated

  18. Synthesis of 1-indanones through the intramolecular Friedel-Crafts acylation reaction using NbCl5 as Lewis acid

    International Nuclear Information System (INIS)

    Polo, Ellen Christine; Silva-Filho, Luiz Carlos da; Silva, Gil Valdo Jose da; Constantino, Mauricio Gomes

    2008-01-01

    The intramolecular Friedel-Crafts acylation reaction of 3-arylpropanoic acids to give 1-indanones can be effected in good yields under mild conditions (room temperature) by using niobium pentachloride. Our results indicate that NbCl 5 acts both as reagent (to transform carboxylic acids into acyl chlorides) and as catalyst in the Friedel-Crafts cyclization. (author)

  19. Approach to Interfacial and Intramolecular Electron Transfer of the Diheme Protein Cytochrome c(4) Assembled on Au(111) Surfaces

    DEFF Research Database (Denmark)

    Chi, Qijin; Zhang, Jingdong; Taner, Arslan

    2010-01-01

    in homogeneous solution for which kinetic analysis clearly testifies to electrostatic cooperative effects but no intramolecular, interheme ET higher than 0.1-10 s(-1). This difference suggests a strong gating feature of the process. On the basis of the three-dimensional structure of P. stutzeri cyt c(4), gating...

  20. Negative resists for i-line lithography utilizing acid-catalyzed intramolecular dehydration reaction

    Science.gov (United States)

    Ueno, Takumi; Uchino, Shou-ichi; Hattori, Keiko T.; Onozuka, Toshihiko; Shirai, Seiichiro; Moriuchi, Noboru; Hashimoto, Michiaki; Koibuchi, S.

    1994-05-01

    Chemical amplification negative resist system composed of a novolak resin, a carbinol and an acid generator is investigated for i-line phase-shift lithography. The reaction in this resist is based on an acid-catalyzed intramolecular dehydration reaction. The dehydration products act as aqueous-base dissolution inhibitors, and carbinol compounds in unexposed areas work as dissolution promoters. The resist composed of a novolak resin, 1,4-bis((alpha) -hydroxyisopropyl) benzene (DIOL-1) and 2- naphthoylmethyltetramethylenesulfonium triflate (PAG-2) gives the best lithographic performance in terms of sensitivity and resolution. Line-and-space patterns of 0.275 micrometers are obtained using an i-line stepper (NA:0.45) in conjunction with a phase shifting mask.

  1. Electron capture dissociation proceeds with a low degree of intramolecular migration of peptide amide hydrogens

    DEFF Research Database (Denmark)

    Rand, Kasper D; Adams, Christopher M; Zubarev, Roman A

    2008-01-01

    scrambling) that occurs during vibrational excitation of gas-phase ions. Unlike traditional collisional ion activation, electron capture dissociation (ECD) is not associated with substantial vibrational excitation. We investigated the extent of intramolecular backbone amide hydrogen (1H/2H) migration upon...... ECD using peptides with a unique selective deuterium incorporation. Our results show that only limited amide hydrogen migration occurs upon ECD, provided that vibrational excitation prior to the electron capture event is minimized. Peptide ions that are excessively vibrationally excited...

  2. A Novel Practical Synthesis of Phenanthrenes Using Iron(Ⅲ) Chloride Involved Intramolecular Oxidative Coupling at Room Temperature

    Institute of Scientific and Technical Information of China (English)

    L(U),Mao-Yun; WANG,Kai-Liang; CAI,Fei; WANG,Hai-Ying; WANG,Qing-Min

    2008-01-01

    Iron(Ⅲ) chloride has been used to prepare the polymethoxy substituted phenanthrene derivatives via in-tramolecular oxidative coupling of (E or Z)-2,3-di(substituted phenyl)acrylate at room temperature in excellent yields. Mild reaction conditions and the use of inexpensive and nontoxic FeCI3 provide a novel practical and large-scaled viable route for the synthesis of the important phenanthrene rings.

  3. Studies toward the synthesis of palhinine lycopodium alkaloids: a Morita-Baylis-Hillman/intramolecular Diels-Alder approach.

    Science.gov (United States)

    Sizemore, Nicholas; Rychnovsky, Scott D

    2014-02-07

    A synthetic route to the isotwistane core of palhinine lycopodium alkaloids is described. A Morita-Baylis-Hillman/intramolecular Diels-Alder (IMDA) strategy sets the vicinal all-carbon quaternary centers present in this family of natural products. The regioselectivity of the IMDA reaction is dictated by the conditions employed for silyl enol ether formation, with one set of conditions providing the core of cardionine and alternate conditions generating the desired isotwistane core of isopalhinine.

  4. Long-Range Intramolecular Electronic Communication in a Trinuclear Ruthenium Tropolonate Complex.

    Science.gov (United States)

    Yoshida, Jun; Kuwahara, Kyohei; Suzuki, Kota; Yuge, Hidetaka

    2017-02-20

    Dinuclear and trinuclear ruthenium complexes, [Ru(trop) 2 (C 2 trop)Ru(dppe)Cp] [2b; trop = tropolonato, C 2 trop = ethynyltropolonato, dppe = 1,2-bis(diphenylphosphino)ethane] and [Ru(trop){(C 2 trop)Ru(dppe)Cp} 2 ] (3), were synthesized, and their electronic and electrochemical properties were investigated in comparison with our previously reported complex [Ru(acac) 2 (C 2 trop)Ru(dppe)Cp] (2a). The electron-donating Ru II (dppe)Cp unit and electron-accepting Ru III O 6 unit are connected by C 2 trop in these complexes. 2a incorporates acetylacetonate as an ancillary ligand, while 2b and 3 incorporate tropolonate as an ancillary ligand. Every complex, 2a, 2b, and 3, exhibits similar UV-vis-near-IR (NIR) absorption spectra, demonstrating the lack of explicit intramolecular electronic communication between the units at least in the neutral state. The weak NIR absorption in 2a further diminished upon electrochemical oxidation, indicating almost no electronic communication between the units. In contrast, 2b and 3 exhibit broad NIR absorptions upon oxidation. Additionally, 3 exhibits four stepwise redox couples in the electrochemical study, which are formally attributed to [Ru II (trop) 3 ] - /[Ru III (trop) 3 ], two [Ru II (dppe)Cp]/[Ru III (dppe)Cp] + , and [Ru III (trop) 3 ]/[Ru IV (trop) 3 ] + couples. Clear separation of the redox couples attributed to the two terminal [Ru(dppe)Cp] units demonstrates the thermodynamic stability of the intermediate oxidation states with respect to disproportionation. Further electrochemical studies using an electrolyte including perfluorinated weakly coordinating anions and density functional theory/time-dependent density functional theory calculations confirmed the effect of ancillary ligands, acetylacetonate and tropolonate. In the case of 2a, electronic delocalization over the whole complex, especially over the [Ru(acac) 2 (trop)] unit, appears to be small. In contrast, the electronic communication between [Ru(dppe)Cp] and [Ru

  5. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    Science.gov (United States)

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  6. Exciplex fluorescence emission from simple organic intramolecular constructs in non-polar and highly polar media as model systems for DNA-assembled exciplex detectors.

    Science.gov (United States)

    Bichenkova, Elena V; Sardarian, Ali R; Wilton, Amanda N; Bonnet, Pascal; Bryce, Richard A; Douglas, Kenneth T

    2006-01-21

    Organic intramolecular exciplexes, N-(4-dimethylaminobenzyl)-N-(1-pyrenemethyl)amine (1) and N'-4-dimethylaminonaphthyl-N-(1-pyrenemethyl)amine (2), were used as model systems to reveal major factors affecting their exciplex fluorescence, and thus lay the basis for developing emissive target-assembled exciplexes for DNA-mounted systems in solution. These models with an aromatic pyrenyl hydrocarbon moiety as an electron acceptor appropriately connected to an aromatic dimethylamino electron donor component (N,N-dimethylaminophenyl or N,N-dimethylaminonaphthyl) showed strong intramolecular exciplex emission in both non-polar and highly polar solvents. The effect of dielectric constant on the maximum wavelength for exciplex emission was studied, and emission was observed for 1 and 2 over the full range of solvent from non-polar hydrocarbons up to N-methylformamide with a dielectric constant of 182. Quantum yields were determined for these intramolecular exciplexes in a range of solvents relative to that for Hoechst 33,258. Conformational analysis of 1 was performed both computationally and via qualitative 2D NMR using (1)H-NOESY experiments. The results obtained indicated the contribution of pre-folded conformation(s) to the ground state of 1 conducive to exciplex emission. This research provides the initial background for design of self-assembled, DNA-mounted exciplexes and underpins further development of exciplex-based hybridisation bioassays.

  7. Bicyclic Guanidine Catalyzed Asymmetric Tandem Isomerization Intramolecular-Diels-Alder Reaction: The First Catalytic Enantioselective Total Synthesis of (+)-alpha-Yohimbine.

    Science.gov (United States)

    Feng, Wei; Jiang, Danfeng; Kee, Choon-Wee; Liu, Hongjun; Tan, Choon-Hong

    2016-02-04

    Hydroisoquinoline derivatives were prepared in moderate to good enantioselectivities via a bicyclic guanidine-catalyzed tandem isomerization intramolecular-Diels-Alder (IMDA) reaction of alkynes. With this synthetic method, the first enantioselective synthesis of (+)-alpha-yohimbine was completed in 9 steps from the IMDA products. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Backbone modified TBA analogues endowed with antiproliferative activity.

    Science.gov (United States)

    Esposito, Veronica; Russo, Annapina; Amato, Teresa; Varra, Michela; Vellecco, Valentina; Bucci, Mariarosaria; Russo, Giulia; Virgilio, Antonella; Galeone, Aldo

    2017-05-01

    The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Specific optical signalling of anions via intramolecular charge transfer pathway based on acridinedione fluorophore

    International Nuclear Information System (INIS)

    Thiagarajan, Viruthachalam; Ramamurthy, Perumal

    2007-01-01

    We present a simple but highly specific acridinedione fluorophore (ADD-1) that acts both as a fluorescent and colorimetric sensor for anions in acetonitrile. The specific optical signalling of ADD-1 is due to the formation of new distinct intramolecular charge transfer (ICT) emitting states in the presence of AcO - (490 nm), H 2 PO 4 - (440 nm), and F - (510 nm) over other anions. Presence of F - shows a colour change that is perceptible to the naked eye, from colourless to an intense fluorescent green due to the deprotonation of acridinedione ring amino hydrogen

  10. A concise, efficient synthesis of sugar-based benzothiazoles through chemoselective intramolecular C-S coupling

    KAUST Repository

    Shen, Chao

    2012-01-01

    Sugar-based benzothiazoles are a new class of molecules promising for many biological applications. Here, we have synthesized a wide range of sugar-based benzothiazoles from readily accessible glycosyl thioureas by chemoselective, palladium-catalyzed C-S coupling reactions. Corroborated by theoretical calculations, a mechanistic investigation indicates that the coordination to the palladium by a pivaloyl carbonyl group and the presence of intramolecular hydrogen bonding play important roles in the efficiency and chemoselectivity of reaction. These fluorescent glycoconjugates can be observed to readily enter mammalian tumor cells and exhibit potential in vitro antitumor activity. This journal is © The Royal Society of Chemistry 2012.

  11. On the Catalytic Effect of Water in the Intramolecular Diels–Alder Reaction of Quinone Systems: A Theoretical Study

    Directory of Open Access Journals (Sweden)

    Renato Contreras

    2012-11-01

    Full Text Available The mechanism of the intramolecular Diels–Alder (IMDA reaction of benzoquinone 1, in the absence and in the presence of three water molecules, 1w, has been studied by means of density functional theory (DFT methods, using the M05-2X and B3LYP functionals for exploration of the potential energy surface (PES. The energy and geometrical results obtained are complemented with a population analysis using the NBO method, and an analysis based on the global, local and group electrophilicity and nucleophilicity indices. Both implicit and explicit solvation emphasize the increase of the polarity of the reaction and the reduction of activation free energies associated with the transition states (TSs of this IMDA process. These results are reinforced by the analysis of the reactivity indices derived from the conceptual DFT, which show that the increase of the electrophilicity of the quinone framework by the hydrogen-bond formation correctly explains the high polar character of this intramolecular process. Large polarization at the TSs promoted by hydrogen-bonds and implicit solvation by water together with a high electrophilicity-nucleophilicity difference consistently explains the catalytic effects of water molecules.

  12. On the Possibility of Uphill Intramolecular Electron Transfer in Multicopper Oxidases: Electrochemical and Quantum Chemical Study of Bilirubin Oxidase

    Czech Academy of Sciences Publication Activity Database

    Shleev, S.; Andoralov, V.; Falk, M.; Reimann, C. T.; Ruzgas, T.; Srnec, Martin; Ryde, U.; Rulíšek, Lubomír

    2012-01-01

    Roč. 24, č. 7 (2012), s. 1524-1540 ISSN 1040-0397 Grant - others:7th Framework Program(XE) NMP4-SL-2009-229255 Institutional research plan: CEZ:AV0Z40550506 Keywords : bilirubin oxidase * intramolecular electron transfer * rate-limiting catalytic step * reorganization energy * QM/MM calculations Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.817, year: 2012

  13. Cloning, Sequencing, and Expression of the Gene Encoding Cyclic 2,3-Diphosphoglycerate Synthetase, the Key Enzyme of Cyclic 2,3-Diphosphoglycerate Metabolism in Methanothermus fervidus

    Science.gov (United States)

    Matussek, Karl; Moritz, Patrick; Brunner, Nina; Eckerskorn, Christoph; Hensel, Reinhard

    1998-01-01

    Cyclic 2,3-diphosphoglycerate synthetase (cDPGS) catalyzes the synthesis of cyclic 2,3-diphosphoglycerate (cDPG) by formation of an intramolecular phosphoanhydride bond in 2,3-diphosphoglycerate. cDPG is known to be accumulated to high intracellular concentrations (>300 mM) as a putative thermoadapter in some hyperthermophilic methanogens. For the first time, we have purified active cDPGS from a methanogen, the hyperthermophilic archaeon Methanothermus fervidus, sequenced the coding gene, and expressed it in Escherichia coli. cDPGS purification resulted in enzyme preparations containing two isoforms differing in their electrophoretic mobility under denaturing conditions. Since both polypeptides showed the same N-terminal amino acid sequence and Southern analyses indicate the presence of only one gene coding for cDPGS in M. fervidus, the two polypeptides originate from the same gene but differ by a not yet identified modification. The native cDPGS represents a dimer with an apparent molecular mass of 112 kDa and catalyzes the reversible formation of the intramolecular phosphoanhydride bond at the expense of ATP. The enzyme shows a clear preference for the synthetic reaction: the substrate affinity and the Vmax of the synthetic reaction are a factor of 8 to 10 higher than the corresponding values for the reverse reaction. Comparison with the kinetic properties of the electrophoretically homogeneous, apparently unmodified recombinant enzyme from E. coli revealed a twofold-higher Vmax of the enzyme from M. fervidus in the synthesizing direction. PMID:9811660

  14. Cloning, sequencing, and expression of the gene encoding cyclic 2, 3-diphosphoglycerate synthetase, the key enzyme of cyclic 2, 3-diphosphoglycerate metabolism in Methanothermus fervidus.

    Science.gov (United States)

    Matussek, K; Moritz, P; Brunner, N; Eckerskorn, C; Hensel, R

    1998-11-01

    Cyclic 2,3-diphosphoglycerate synthetase (cDPGS) catalyzes the synthesis of cyclic 2,3-diphosphoglycerate (cDPG) by formation of an intramolecular phosphoanhydride bond in 2,3-diphosphoglycerate. cDPG is known to be accumulated to high intracellular concentrations (>300 mM) as a putative thermoadapter in some hyperthermophilic methanogens. For the first time, we have purified active cDPGS from a methanogen, the hyperthermophilic archaeon Methanothermus fervidus, sequenced the coding gene, and expressed it in Escherichia coli. cDPGS purification resulted in enzyme preparations containing two isoforms differing in their electrophoretic mobility under denaturing conditions. Since both polypeptides showed the same N-terminal amino acid sequence and Southern analyses indicate the presence of only one gene coding for cDPGS in M. fervidus, the two polypeptides originate from the same gene but differ by a not yet identified modification. The native cDPGS represents a dimer with an apparent molecular mass of 112 kDa and catalyzes the reversible formation of the intramolecular phosphoanhydride bond at the expense of ATP. The enzyme shows a clear preference for the synthetic reaction: the substrate affinity and the Vmax of the synthetic reaction are a factor of 8 to 10 higher than the corresponding values for the reverse reaction. Comparison with the kinetic properties of the electrophoretically homogeneous, apparently unmodified recombinant enzyme from E. coli revealed a twofold-higher Vmax of the enzyme from M. fervidus in the synthesizing direction.

  15. TDDFT study on excited state intramolecular proton transfer mechanism in 2-amino-3-(2‧-benzazolyl)-quinolines

    Science.gov (United States)

    Jia, Xueli; Li, Chaozheng; Li, Donglin; Liu, Yufang

    2018-03-01

    The intramolecular proton transfer reaction of the 2-amino-3-(2‧-benzoxazolyl)-quinoline (ABO) and 2-amino-3-(2‧-benzothiazolyl)-quinoline (ABT) molecules in both S0 and S1 states at B3LYP/6-311 ++G(d,p) level in ethanol solvent have been studied to reveal the deactivation mechanism of the tautomers of the two molecules from the S1 state to the S0 state. The results show that the tautomers of ABO and ABT molecules may return to the S0 state by emitting fluorescence. In addition, the bond lengths, angles and infrared spectra are analyzed to confirm the hydrogen bonds strengthened upon photoexcitation, which can facilitate the proton transfer process. The frontier molecular orbitals (MOs) and natural bond orbital (NBO) are also calculated to indicate the intramolecular charge transfer which can be used to explore the tendency of ESIPT reaction. The potential energy surfaces of the ABO and ABT molecules in the S0 and S1 states have been constructed. According to the energy potential barrier of 9.12 kcal/mol for ABO molecule and 5.96 kcal/mol for ABT molecule, it can be indicated that the proton transfer may occur in the S1 state.

  16. Discovery of intramolecular signal transduction network based on a new protein dynamics model of energy dissipation.

    Directory of Open Access Journals (Sweden)

    Cheng-Wei Ma

    Full Text Available A novel approach to reveal intramolecular signal transduction network is proposed in this work. To this end, a new algorithm of network construction is developed, which is based on a new protein dynamics model of energy dissipation. A key feature of this approach is that direction information is specified after inferring protein residue-residue interaction network involved in the process of signal transduction. This enables fundamental analysis of the regulation hierarchy and identification of regulation hubs of the signaling network. A well-studied allosteric enzyme, E. coli aspartokinase III, is used as a model system to demonstrate the new method. Comparison with experimental results shows that the new approach is able to predict all the sites that have been experimentally proved to desensitize allosteric regulation of the enzyme. In addition, the signal transduction network shows a clear preference for specific structural regions, secondary structural types and residue conservation. Occurrence of super-hubs in the network indicates that allosteric regulation tends to gather residues with high connection ability to collectively facilitate the signaling process. Furthermore, a new parameter of propagation coefficient is defined to determine the propagation capability of residues within a signal transduction network. In conclusion, the new approach is useful for fundamental understanding of the process of intramolecular signal transduction and thus has significant impact on rational design of novel allosteric proteins.

  17. Computational study of the rate constants and free energies of intramolecular radical addition to substituted anilines

    Directory of Open Access Journals (Sweden)

    Andreas Gansäuer

    2013-08-01

    Full Text Available The intramolecular radical addition to aniline derivatives was investigated by DFT calculations. The computational methods were benchmarked by comparing the calculated values of the rate constant for the 5-exo cyclization of the hexenyl radical with the experimental values. The dispersion-corrected PW6B95-D3 functional provided very good results with deviations for the free activation barrier compared to the experimental values of only about 0.5 kcal mol−1 and was therefore employed in further calculations. Corrections for intramolecular London dispersion and solvation effects in the quantum chemical treatment are essential to obtain consistent and accurate theoretical data. For the investigated radical addition reaction it turned out that the polarity of the molecules is important and that a combination of electrophilic radicals with preferably nucleophilic arenes results in the highest rate constants. This is opposite to the Minisci reaction where the radical acts as nucleophile and the arene as electrophile. The substitution at the N-atom of the aniline is crucial. Methyl substitution leads to slower addition than phenyl substitution. Carbamates as substituents are suitable only when the radical center is not too electrophilic. No correlations between free reaction barriers and energies (ΔG‡ and ΔGR are found. Addition reactions leading to indanes or dihydrobenzofurans are too slow to be useful synthetically.

  18. Cooperative Metal–Ligand Catalyzed Intramolecular Hydroamination and Hydroalkoxylation of Allenes Using a Stable Iron Catalyst

    KAUST Repository

    El-Sepelgy, Osama

    2018-01-18

    A new iron-catalyzed chemoselective intramolecular hydroamination and hydroalkoxylation of the readily available α-allenic amines and alcohols to valuable unsaturated 5-membered heterocycles, 2,3-dihydropyrrole and 2,3-dihydrofuran, is reported. Effective selectivity control is achieved by a metal–ligand cooperative activation of the substrates. The mild reaction conditions and the use of low amounts of an air and moisture stable iron catalyst allow for the hydrofunctionalization of a wide range of allenes bearing different functional groups in good yields in the absence of base or any sensitive additives.

  19. Cooperative Metal–Ligand Catalyzed Intramolecular Hydroamination and Hydroalkoxylation of Allenes Using a Stable Iron Catalyst

    KAUST Repository

    El-Sepelgy, Osama; Brzozowska, Aleksandra; Sklyaruk, Jan; Jang, Yoon Kyung; Zubar, Viktoriia; Rueping, Magnus

    2018-01-01

    A new iron-catalyzed chemoselective intramolecular hydroamination and hydroalkoxylation of the readily available α-allenic amines and alcohols to valuable unsaturated 5-membered heterocycles, 2,3-dihydropyrrole and 2,3-dihydrofuran, is reported. Effective selectivity control is achieved by a metal–ligand cooperative activation of the substrates. The mild reaction conditions and the use of low amounts of an air and moisture stable iron catalyst allow for the hydrofunctionalization of a wide range of allenes bearing different functional groups in good yields in the absence of base or any sensitive additives.

  20. Pulse radiolytic and electrochemical investigations of intramolecular electron transfer in carotenoporphyrins and carotenoporphyrin-quinone triads

    International Nuclear Information System (INIS)

    Land, E.J.; Lexa, D.; Bensasson, R.V.; Gust, D.; Moore, T.A.; Moore, A.L.; Liddell, P.A.; Nemeth, G.A.

    1987-01-01

    Thermodynamic and kinetic aspects of intramolecular electron-transfer reactions in carotenoporphyrin dyads and carotenoid-porphyrin-quinone triads have been studied by using pulse radiolysis and cyclic voltammetry. Rapid (<1 μs) electron transfer from carotenoid radical anions to attached porphyrins has been inferred. Carotenoid cations, on the other hand, do not readily accept electrons from attached porphyrins or pyropheophorbides. Electrochemical studies provide the thermodynamic basis for these observations and also allow estimation of the energetics of photoinitiated two-step electron transfer and two-step charge recombination in triad models for photosynthetic charge separation

  1. Iodine-Mediated Intramolecular Dehydrogenative Coupling: Synthesis of N-Alkylindolo[3,2-c]- and -[2,3-c]quinoline Iodides.

    Science.gov (United States)

    Volvoikar, Prajesh S; Tilve, Santosh G

    2016-03-04

    An I2/TBHP-mediated intramolecular dehydrogenative coupling reaction is developed for the synthesis of a library of medicinally important 5,11-dialkylindolo[3,2-c]quinoline salts and 5,7-dimethylindolo[2,3-c]quinoline salts. The annulation reaction is followed by aromatization to yield tetracycles in good yield. This protocol is also demonstrated for the synthesis of the naturally occurring isocryptolepine in salt form.

  2. Tether-directed synthesis of highly substituted oxasilacycles via an intramolecular allylation employing allylsilanes

    Directory of Open Access Journals (Sweden)

    Cox Liam R

    2007-02-01

    Full Text Available Abstract Background Using a silyl tether to unite an aldehyde electrophile and allylsilane nucleophile into a single molecule allows a subsequent Lewis-acid-mediated allylation to proceed in an intramolecular sense and therefore receive all the benefits associated with such processes. However, with the ability to cleave the tether post allylation, a product that is the result of a net intermolecular reaction can be obtained. In the present study, four diastereoisomeric β-silyloxy-α-methyl aldehydes, which contain an allylsilane tethered through the β-carbinol centre, have been prepared, in order to probe how the relative configuration of the two stereogenic centres affects the efficiency and selectivity of the intramolecular allylation. Results Syn-aldehydes, syn-4a and syn-4b, both react poorly, affording all four possible diastereoisomeric oxasilacycle products. In contrast, the anti aldehydes anti-4a and anti-4b react analogously to substrates that lack substitution at the α-site, affording only two of the four possible allylation products. Conclusion The outcome of the reaction with anti-aldehydes is in accord with reaction proceeding through a chair-like transition state (T.S.. In these systems, the sense of 1,3-stereoinduction can be rationalised by the aldehyde electrophile adopting a pseudoaxial orientation, which will minimise dipole-dipole interactions in the T.S. The 1,4-stereoinduction in these substrates is modest and seems to be modulated by the R substituent in the starting material. In the case of the syn-substrates, cyclisation through a chair T.S. is unlikely as this would require the methyl substituent α to the reacting carbonyl group to adopt an unfavourable pseudoaxial position. It is therefore proposed that these substrates react through poorly-defined T.S.s and consequently exhibit essentially no stereoselectivity.

  3. Intramolecular Crosstalk between Catalytic Activities of Receptor Kinases

    KAUST Repository

    Kwezi, Lusisizwe

    2018-01-22

    Signal modulation is important for the growth and development of plants and this process is mediated by a number of factors including physiological growth regulators and their associated signal transduction pathways. Protein kinases play a central role in signaling, including those involving pathogen response mechanisms. We previously demonstrated an active guanylate cyclase (GC) catalytic center in the brassinosteroid insensitive receptor (AtBRI1) within an active intracellular kinase domain resulting in dual enzymatic activity. Here we propose a novel type of receptor architecture that is characterized by a functional GC catalytic center nested in the cytosolic kinase domain enabling intramolecular crosstalk. This may be through a cGMP-AtBRI1 complex forming that may induce a negative feedback mechanism leading to desensitisation of the receptor, regulated through the cGMP production pathway. We further argue that the comparatively low but highly localized cGMP generated by the GC in response to a ligand is sufficient to modulate the kinase activity. This type of receptor therefore provides a molecular switch that directly and/or indirectly affects ligand dependent phosphorylation of downstream signaling cascades and suggests that subsequent signal transduction and modulation works in conjunction with the kinase in downstream signaling.

  4. Intramolecular Crosstalk between Catalytic Activities of Receptor Kinases

    KAUST Repository

    Kwezi, Lusisizwe; Wheeler, Janet I; Marondedze, Claudius; Gehring, Christoph A; Irving, Helen R

    2018-01-01

    Signal modulation is important for the growth and development of plants and this process is mediated by a number of factors including physiological growth regulators and their associated signal transduction pathways. Protein kinases play a central role in signaling, including those involving pathogen response mechanisms. We previously demonstrated an active guanylate cyclase (GC) catalytic center in the brassinosteroid insensitive receptor (AtBRI1) within an active intracellular kinase domain resulting in dual enzymatic activity. Here we propose a novel type of receptor architecture that is characterized by a functional GC catalytic center nested in the cytosolic kinase domain enabling intramolecular crosstalk. This may be through a cGMP-AtBRI1 complex forming that may induce a negative feedback mechanism leading to desensitisation of the receptor, regulated through the cGMP production pathway. We further argue that the comparatively low but highly localized cGMP generated by the GC in response to a ligand is sufficient to modulate the kinase activity. This type of receptor therefore provides a molecular switch that directly and/or indirectly affects ligand dependent phosphorylation of downstream signaling cascades and suggests that subsequent signal transduction and modulation works in conjunction with the kinase in downstream signaling.

  5. Tandem cross enyne metathesis (CEYM)-intramolecular Diels-Alder reaction (IMDAR). An easy entry to linear bicyclic scaffolds.

    Science.gov (United States)

    Miró, Javier; Sánchez-Roselló, María; Sanz, Álvaro; Rabasa, Fernando; Del Pozo, Carlos; Fustero, Santos

    2015-01-01

    A new tandem cross enyne metathesis (CEYM)-intramolecular Diels-Alder reaction (IMDAR) has been carried out. It involves conjugated ketones, esters or amides bearing a remote olefin and aromatic alkynes as the starting materials. The overall process enables the preparation of a small family of linear bicyclic scaffolds in a very simple manner with moderate to good levels of diastereoselectivity. This methodology constitutes one of the few examples that employ olefins differently than ethylene in tandem CEYM-IMDAR protocols.

  6. Size measuring techniques as tool to monitor pea proteins intramolecular crosslinking by transglutaminase treatment.

    Science.gov (United States)

    Djoullah, Attaf; Krechiche, Ghali; Husson, Florence; Saurel, Rémi

    2016-01-01

    In this work, techniques for monitoring the intramolecular transglutaminase cross-links of pea proteins, based on protein size determination, were developed. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis profiles of transglutaminase-treated low concentration (0.01% w/w) pea albumin samples, compared to the untreated one (control), showed a higher electrophoretic migration of the major albumin fraction band (26 kDa), reflecting a decrease in protein size. This protein size decrease was confirmed, after DEAE column purification, by dynamic light scattering (DLS) where the hydrodynamic radius of treated samples appears to be reduced compared to the control one. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Fused-Ring Formation by an Intramolecular "Cut-and-Sew" Reaction between Cyclobutanones and Alkynes.

    Science.gov (United States)

    Deng, Lin; Jin, Likun; Dong, Guangbin

    2018-03-01

    The development of a catalytic intramolecular "cut-and-sew" transformation between cyclobutanones and alkynes to construct cyclohexenone-fused rings is described herein. The challenge arises from the need for selective coupling at the more sterically hindered proximal position, and can be addressed by using an electron-rich, but less bulky, phosphine ligand. The control experiment and 13 C-labelling study suggest that the reaction may start with cleavage of the less hindered distal C-C bond of cyclobutanones, followed by decarbonylation and CO reinsertion to enable Rh insertion at the more hindered proximal position. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Influence of intramolecular hydrogen bonds on the binding potential of methylated β-cyclodextrin derivatives

    Directory of Open Access Journals (Sweden)

    Gerhard Wenz

    2012-11-01

    Full Text Available Various heptasubstituted derivatives of β-cyclodextrin (β-CD bearing 1, 2 and 3 methyl substituents per glucose unit were synthesized by regioselective methods. Binding free energies and binding enthalpies of these hosts towards 4-tert-butylbenzoate and adamantane-1-carboxylate were determined by isothermal titration microcalorimetry (ITC. It was found that methyl substituents at the secondary positions of β-CD lead to a tremendous reduction of the binding potential, while methylation at the primary positions significantly improved binding. Stabilizing intramolecular hydrogen bonds between the glucose units were made responsible for the high binding potentials of those β-CD derivatives that possess secondary hydroxy groups.

  9. An Efficient Synthesis of Substituted Furans by Cupric Halide-Mediated Intramolecular Halocyclization of 2-(1-Alkynyl)-2-alken-1-ones

    International Nuclear Information System (INIS)

    Fu, Weijun; Guo, Wenbo; Zhu, Mei; Xu, Chen; Xu, Fengjuan

    2013-01-01

    An efficient synthesis of 3-halofurans by the intramolecular cyclization of 2-(1-alkynyl)-2-alken-1-ones with cupric halide has been developed. A broad range of 3-chloro- and 3-bromofuran derivatives could be obtained in the present method in moderate to good yields. The 3-halofuran derivatives are potential synthetic intermediates for amplification of molecular complexity

  10. Isolation of deletion alleles by G4 DNA-induced mutagenesis

    NARCIS (Netherlands)

    Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel

    Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature

  11. Reaction Coordinate, Free Energy, and Rate of Intramolecular Proton Transfer in Human Carbonic Anhydrase II.

    Science.gov (United States)

    Paul, Sanjib; Paul, Tanmoy Kumar; Taraphder, Srabani

    2018-03-22

    The role of structure and dynamics of an enzyme has been investigated at three different stages of its function including the chemical event it catalyzes. A one-pot computational method has been designed for each of these stages on the basis of classical and/or quantum mechanical-molecular mechanical molecular dynamics and transition path sampling simulations. For a pair of initial and final states A and B separated by a high free-energy barrier, using a two-stage selection process, several collective variables (CVs) are identified that can delineate A and B. However, these CVs are found to exhibit strong cross-coupling over the transition paths. A set of mutually orthogonal order parameters is then derived from these CVs and an optimal reaction coordinate, r, determined applying half-trajectory likelihood maximization along with a Bayesian information criterion. The transition paths are also used to project the multidimensional free energy surface and barrier crossing dynamics along r. The proposed scheme has been applied to the rate-determining intramolecular proton transfer reaction of the well-known enzyme human carbonic anhydrase II. The potential of mean force, F( r), in the absence of the chemical step is found to reproduce earlier results on the equilibrium population of two side-chain orientations of key residue His-64. Estimation of rate constants, k, from mean first passage times for the three different stages of catalysis shows that the rate-determining step of intramolecular proton transfer occurs with k ≃ 1.0 × 10 6 s -1 , in close agreement with known experimental results.

  12. Reações de inserção intramolecular de diazo compostos polifuncionais catalisadas por ródio(II: síntese de oxetan-3-ona-2-carboxilato e outros heterociclos funcionalizados Rhodium(II-catalysed intramolecular insertion reaction of multifunctional diazo compounds: synthesis of oxetan-3-one-2-carboxilate and other heterocycles

    Directory of Open Access Journals (Sweden)

    Albert Padwa

    1999-12-01

    Full Text Available gamma-Hydroxy-alpha-diazo-beta-ketoesters are key intermediates in the chemistry of penicilin-based antibiotics and natural products. The method developed here for the synthesis of ethyl 2-diazo-4-hydroxy-3-oxo-butanoate 17 (in two steps from the diazo mercurial 2 compares very favorably with those reported in the literature for similar compounds. The Rh2(OAc4-mediated intramolecular OH-insertion reaction of the diazo hydroxy ester 17 was investigated, furnishing the oxetan-3-one-2-carboxilate 18 in good yield. When the diazo ester lacks a free hydroxyl group as in the case of the phenoxy diazo ester 11 an intramolecular CH-insertion takes place, affording the 2H-chromene 20 in almost quantitative yield. The behavior of other functionalized diazo esters towards Rh2(OAc4 was also investigated.

  13. Study of intramolecular isotope heterogeneity of organic oxy acids in order to detect sophisticated wines and juice drinks

    Directory of Open Access Journals (Sweden)

    Kuzmina Helen

    2014-01-01

    Full Text Available According to International Code of Oenological Practices it is allowed to use acide L(+tartrique for wine acidification, while use of synthetic dihydroxysuccinic acid is forbidden. Today it is impossible to differentiate natural dihydroxysuccinic acid from synthetic one by standard techniques. Even by using very sensitive method of isotope mass spectrometry certain difficulties emerge because total isotope characteristics of carbon of dihydroxysuccinic acid of different nature have the same values. However, isotope characteristics of carbon of intramolecular structural groups of dihydroxysuccinic acid made of different raw materials differ significantly. This allows specifying the nature of dihydroxysuccinic acid that is used for making of wines and juice drinks. In Russia, scientific and research institute of beer brewing and wine-making industry carried out a work for studying isotope characteristics of intramolecular isotope heterogeneity of dihydroxysuccinic acid from different origins in order to identify wines and juice drinks. Isotope characteristics of organic oxy acids from different origins were studied including them obtained by synthetic way and numeric range of value δ13 C,‰ were specified. The obtained results allow performing identification tests of wines and juice drinks to find out the products that contain not specified additives as that allowed for its use in production process.

  14. Comparison of IRMS and NMR spectrometry for the determination of intramolecular 13C isotope composition: application to ethanol.

    Science.gov (United States)

    Gilbert, Alexis; Hattori, Ryota; Silvestre, Virginie; Wasano, Nariaki; Akoka, Serge; Hirano, Satoshi; Yamada, Keita; Yoshida, Naohiro; Remaud, Gérald S

    2012-09-15

    Isotopic (13)C NMR is a relatively recent technique which allows the determination of intramolecular (13)C isotope composition at natural abundance. It has been used in various scientific fields such as authentication, counterfeiting or plant metabolism. Although its precision has already been evaluated, the determination of its trueness remains still challenging. To deal with that issue, a comparison with another normalized technique must be achieved. In this work, we compare the intramolecular (13)C isotope distribution of ethanol from different origins obtained using both Isotope Ratio Mass Spectrometry (IRMS) and Nuclear Magnetic Resonance (NMR) spectrometry techniques. The IRMS approach consists of the oxidation of ethanol to acetic acid followed by the degradation of the latter for the analysis of each fragments formed. We show here that the oxidation of ethanol to acetic acid does not bring any significant error on the determination of the site-specific δ(13)C (δ(13)C(i)) of ethanol using the IRMS approach. The difference between the data obtained for 16 samples from different origins using IRMS and NMR approaches is not statistically significant and remains below 0.3‰. These results are encouraging for the future studies using isotopic NMR, especially in combination with the IRMS approach. Copyright © 2012. Published by Elsevier B.V.

  15. Intramolecular singlet-singlet energy transfer in antenna-substituted azoalkanes.

    Science.gov (United States)

    Pischel, Uwe; Huang, Fang; Nau, Werner M

    2004-03-01

    Two novel azoalkane bichromophores and related model compounds have been synthesised and photophysically characterised. Dimethylphenylsiloxy (DPSO) or dimethylnaphthylsiloxy (DNSO) serve as aromatic donor groups (antenna) and the azoalkane 2,3-diazabicyclo[2.2.2]oct-2-ene (DBO) as the acceptor. The UV spectral window of DBO (250-300 nm) allows selective excitation of the donor. Intramolecular singlet-singlet energy transfer to DBO is highly efficient and proceeds with quantum yields of 0.76 with DPSO and 0.99 with DNSO. The photophysical and spectral properties of the bichromophoric systems suggest that energy transfer occurs through diffusional approach of the donor and acceptor within a van der Waals contact at which the exchange mechanism is presumed to dominate. Furthermore, akin to the behaviour of electron-transfer systems in the Marcus inverted region, a rate of energy transfer 2.5 times slower was observed for the system with the more favourable energetics, i.e. singlet-singlet energy transfer from DPSO proceeded slower than from DNSO, although the process is more exergonic for DPSO (-142 kJ mol(-1) for DPSO versus-67 kJ mol(-1) for DNSO).

  16. Instantaneous normal mode analysis for intermolecular and intramolecular vibrations of water from atomic point of view.

    Science.gov (United States)

    Chen, Yu-Chun; Tang, Ping-Han; Wu, Ten-Ming

    2013-11-28

    By exploiting the instantaneous normal mode (INM) analysis for models of flexible molecules, we investigate intermolecular and intramolecular vibrations of water from the atomic point of view. With two flexible SPC/E models, our investigations include three aspects about their INM spectra, which are separated into the unstable, intermolecular, bending, and stretching bands. First, the O- and H-atom contributions in the four INM bands are calculated and their stable INM spectra are compared with the power spectra of the atomic velocity autocorrelation functions. The unstable and intermolecular bands of the flexible models are also compared with those of the SPC/E model of rigid molecules. Second, we formulate the inverse participation ratio (IPR) of the INMs, respectively, for the O- and H-atom and molecule. With the IPRs, the numbers of the three species participated in the INMs are estimated so that the localization characters of the INMs in each band are studied. Further, by the ratio of the IPR of the H atom to that of the O atom, we explore the number of involved OH bond per molecule participated in the INMs. Third, by classifying simulated molecules into subensembles according to the geometry of their local environments or their H-bond configurations, we examine the local-structure effects on the bending and stretching INM bands. All of our results are verified to be insensible to the definition of H-bond. Our conclusions about the intermolecular and intramolecular vibrations in water are given.

  17. De novo sequencing of two novel peptides homologous to calcitonin-like peptides, from skin secretion of the Chinese Frog, Odorrana schmackeri

    Directory of Open Access Journals (Sweden)

    Geisa P.C. Evaristo

    2015-09-01

    Full Text Available An MS/MS based analytical strategy was followed to solve the complete sequence of two new peptides from frog (Odorrana schmackeri skin secretion. This involved reduction and alkylation with two different alkylating agents followed by high resolution tandem mass spectrometry. De novo sequencing was achieved by complementary CID and ETD fragmentations of full-length peptides and of selected tryptic fragments. Heavy and light isotope dimethyl labeling assisted with annotation of sequence ion series. The identified primary structures are GCD[I/L]STCATHN[I/L]VNE[I/L]NKFDKSKPSSGGVGPESP-NH2 and SCNLSTCATHNLVNELNKFDKSKPSSGGVGPESF-NH2, i.e. two carboxyamidated 34 residue peptides with an aminoterminal intramolecular ring structure formed by a disulfide bridge between Cys2 and Cys7. Edman degradation analysis of the second peptide positively confirmed the exact sequence, resolving I/L discriminations. Both peptide sequences are novel and share homology with calcitonin, calcitonin gene related peptide (CGRP and adrenomedullin from other vertebrates. Detailed sequence analysis as well as the 34 residue length of both O. schmackeri peptides, suggest they do not fully qualify as either calcitonins (32 residues or CGRPs (37 amino acids and may justify their classification in a novel peptide family within the calcitonin gene related peptide superfamily. Smooth muscle contractility assays with synthetic replicas of the S–S linked peptides on rat tail artery, uterus, bladder and ileum did not reveal myotropic activity.

  18. Detection of Intramolecular Charge Transfer and Dynamic Solvation in Eosin B by Femtosecond Two-Dimensional Electronic Spectroscopy

    Science.gov (United States)

    Ghosh, Soumen; Roscioli, Jerome D.; Beck, Warren F.

    2014-06-01

    We have employed 2D electronic photon echo spectroscopy to study intramolecular charge-transfer dynamics in eosin B. After preparation of the first excited singlet state (S_1) with 40-fs excitation pulses at 520 nm, the nitro group (--NO_2) in eosin B undergoes excited state torsional motion towards a twisted intramolecular charge transfer (TICT) state. As the viscosity of the surrounding solvent increases, the charge-transfer rate decreases because the twisting of the --NO_2 group is hindered. These conclusions are supported by the time evolution of the 2D spectrum, which provides a direct measure of the the ground-to-excited-state energy gap time-correlation function, M(t). In comparison to the inertial and diffusive solvation time scales exhibited by eosin Y, which lacks the nitro group, the M(t) function for eosin B exhibits under the same conditions an additional component on the 150-fs timescale that arises from quenching of the S_1 state by crossing to the TICT state. These results indicate that 2D electronic spectroscopy can be used as a sensitive probe of the rate of charge transfer in a molecular system and of the coupling to the motions of the surrounding solvent. (Supported by grant DE-SC0010847 from the Department of Energy, Office of Basic Energy Sciences, Photosynthetic Systems program.)

  19. One-pot synthesis of spiropyrroloquinoline-isoindolinone and their aza-analogs via the Ugi-4CR/metal-free intramolecular bis-annulation process.

    Science.gov (United States)

    Ghandi, Mehdi; Zarezadeh, Nahid; Abbasi, Alireza

    2015-08-14

    This presentation discloses a one-pot synthesis of a series of spiropyrroloquinoline isoindolinone and spiropyrroloquinoline aza-isoindolinone scaffolds. The reaction proceeds by the combination of a Ugi four-component reaction (4CR) and two intramolecular cyclizations under metal-free conditions. The proof of the structures relies on analytical investigation and X-ray crystallography.

  20. Estudio computacional de transferencia electrónica intramolecular en tríadas conjugadas ferroceno-puente-aceptor

    OpenAIRE

    García López, Rafaela

    2016-01-01

    En el presente trabajo se analiza, desde el punto de vista teórico a través de cálculos mecanocuánticos, el comportamiento dador del ferroceno, de potencial utilidad en procesos de reconocimiento de cationes metálicos, así como la estabilización de deficiencias electrónicas en  a grupos ferrocenilo. Esto permite el estudio del fenómeno de transferencia electrónica intramolecular en diferentes tríadas ferroceno-puente-aceptor, así como el efecto de la naturaleza y longitud de espaciadores -c...

  1. Tandem cross enyne metathesis (CEYM–intramolecular Diels–Alder reaction (IMDAR. An easy entry to linear bicyclic scaffolds

    Directory of Open Access Journals (Sweden)

    Javier Miró

    2015-08-01

    Full Text Available A new tandem cross enyne metathesis (CEYM–intramolecular Diels–Alder reaction (IMDAR has been carried out. It involves conjugated ketones, esters or amides bearing a remote olefin and aromatic alkynes as the starting materials. The overall process enables the preparation of a small family of linear bicyclic scaffolds in a very simple manner with moderate to good levels of diastereoselectivity. This methodology constitutes one of the few examples that employ olefins differently than ethylene in tandem CEYM–IMDAR protocols.

  2. TDDFT study on intramolecular hydrogen bond of photoexcited methyl salicylate.

    Science.gov (United States)

    Qu, Peng; Tian, Dongxu

    2014-01-01

    The equilibrium geometries, IR-spectra and transition mechanism of intramolecular hydrogen-bonded methyl salicylate in excited state were studied using DFT and TDDFT with 6-31++G (d, p) basis set. The length of hydrogen bond OH⋯OC is decreased from 1.73 Å in the ground state to 1.41 and 1.69 Å in the excited S1 and S3 states. The increase of bond length for HO and CO group also indicates that in excited state the hydrogen bond OH⋯OC is strengthened. IR spectra show HO and CO stretching bands are strongly redshifted by 1387 and 67 cm(-1) in the excited S1 and S3 states comparing to the ground state. The excitation energy and the absorption spectrum show the S3 state is the main excited state of the low-lying excited states. By analyzing the frontier molecular orbitals, the transition from the ground state to the excited S1 and S3 states was predicted to be the π→π∗ mode. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Rh(I) -Catalyzed Intramolecular Carbonylative C-H/C-I Coupling of 2-Iodobiphenyls Using Furfural as a Carbonyl Source.

    Science.gov (United States)

    Furusawa, Takuma; Morimoto, Tsumoru; Nishiyama, Yasuhiro; Tanimoto, Hiroki; Kakiuchi, Kiyomi

    2016-08-19

    Synthesis of fluoren-9-ones by a Rh-catalyzed intramolecular C-H/C-I carbonylative coupling of 2-iodobiphenyls using furfural as a carbonyl source is presented. The findings indicate that the rate-determining step is not a C-H bond cleavage but, rather, the oxidative addition of the C-I bond to a Rh(I) center. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. NMR of proteins (4Fe-4S): structural properties and intramolecular electron transfer

    International Nuclear Information System (INIS)

    Huber, J.G.

    1996-01-01

    NMR started to be applied to Fe-S proteins in the seventies. Its use has recently been enlarged as the problems arising from the paramagnetic polymetallic clusters ware overcome. Applications to [4Fe-4S] are presented herein. The information derived thereof deepens the understanding of the redox properties of these proteins which play a central role in the metabolism of bacterial cells. The secondary structure elements and the overall folding of Chromatium vinosum ferredoxin (Cv Fd) in solution have been established by NMR. The unique features of this sequence have been shown to fold as an α helix at the C-terminus and as a loop between two cysteines ligand of one cluster: these two parts localize in close proximity from one another. The interaction between nuclear and electronic spins is a source of additional structural information for (4Fe-AS] proteins. The conformation of the cysteine-ligands, as revealed by the Fe-(S γ -C β -H β )Cys dihedral angles, is related to the chemical shifts of the signals associated with the protons of these residues. The longitudinal relaxation times of the protons depend on their distance to the cluster. A quantitative relationship has been established and used to show that the solution structure of the high-potential ferredoxin from Cv differs significantly from the crystal structure around Phe-48. Both parameters (chemical shifts and longitudinal relaxation times) give also insight into the electronic and magnetic properties of the [4Fe-4S] clusters. The rate of intramolecular electron transfer between the two [4FE-4S] clusters of ferredoxins has been measured by NMR. It is far slower in the case of Cv Fd than for shorter ferredoxins. The difference may be associated with changes in the magnetic and/or electronic properties of one cluster. The strong paramagnetism of the [4Fe-4S] clusters, which originally limited the applicability of NMR to proteins containing these cofactors, has been proven instrumental in affording new

  5. Intra-molecular Charge Transfer and Electron Delocalization in Non-fullerene Organic Solar Cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qinghe [Department of Chemistry, Key Laboratory for Preparation and Application of Ordered Structural Materials of Guangdong Province, Shantou University, Guangdong 515063, P. R. China; Zhao, Donglin [Department of Chemistry, The James Franck Institute, The University of Chicago, 929 E 57th Street, Chicago, Illinois 60637, United States; Goldey, Matthew B. [Institute for Molecular Engineering, The University of Chicago, 5747 South Ellis Avenue, Chicago, Illinois 60637, United States; Filatov, Alexander S. [Department of Chemistry, The James Franck Institute, The University of Chicago, 929 E 57th Street, Chicago, Illinois 60637, United States; Sharapov, Valerii [Department of Chemistry, The James Franck Institute, The University of Chicago, 929 E 57th Street, Chicago, Illinois 60637, United States; Colón, Yamil J. [Institute for Molecular Engineering, Materials Science Division, Argonne National Laboratory, 9700 Cass Avenue, Lemont, Illinois 60439, United States; Institute for Molecular Engineering, The University of Chicago, 5747 South Ellis Avenue, Chicago, Illinois 60637, United States; Cai, Zhengxu [Department of Chemistry, The James Franck Institute, The University of Chicago, 929 E 57th Street, Chicago, Illinois 60637, United States; Chen, Wei [Institute for Molecular Engineering, Materials Science Division, Argonne National Laboratory, 9700 Cass Avenue, Lemont, Illinois 60439, United States; Institute for Molecular Engineering, The University of Chicago, 5747 South Ellis Avenue, Chicago, Illinois 60637, United States; de Pablo, Juan [Institute for Molecular Engineering, Materials Science Division, Argonne National Laboratory, 9700 Cass Avenue, Lemont, Illinois 60439, United States; Institute for Molecular Engineering, The University of Chicago, 5747 South Ellis Avenue, Chicago, Illinois 60637, United States; Galli, Giulia [Institute for Molecular Engineering, Materials Science Division, Argonne National Laboratory, 9700 Cass Avenue, Lemont, Illinois 60439, United States; Institute for Molecular Engineering, The University of Chicago, 5747 South Ellis Avenue, Chicago, Illinois 60637, United States; Yu, Luping [Department of Chemistry, The James Franck Institute, The University of Chicago, 929 E 57th Street, Chicago, Illinois 60637, United States

    2018-03-02

    Two types of electron acceptors were synthesized by coupling two kinds of electron-rich cores with four equivalent perylene diimides (PDIs) at the a position. With fully aromatic cores, TPB and TPSe have pi-orbitals spread continuously over the whole aromatic conjugated backbone, unlike TPC and TPSi, which contain isolated PDI units due to the use of a tetrahedron carbon or silicon linker. Density functional theory calculations of the projected density of states showed that the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) for TPB are localized in separate regions of space. Further, the LUMO of TPB shows a greater contribution from the orbitals belonging to the connective core of the molecules than that of TPC. Overall, the properties of the HOMO and LUMO point at increased intra-molecular delocalization of negative charge carriers for TPB and TPSe than for TPC and TPSi and hence at a more facile intra-molecular charge transfer for the former. The film absorption and emission spectra showed evidences for the inter -molecular electron delocalization in TPB and TPSe, which is consistent with the network structure revealed by X-ray diffraction studies on single crystals of TPB. These features benefit the formation of charge transfer states and/or facilitate charge transport. Thus, higher electron mobility and higher charge dissociation probabilities under J(sc) condition were observed in blend films of TPB:PTB7-Th and TPSe:PTB7-Th than those in TPC:PTB7Th and TPSi:PTB7-Th blend films. As a result, the J(sc) and fill factor values of 15.02 mA/cm(2), 0.58 and 14.36 mA/cm(2), 0.55 for TPB- and TPSe-based solar cell are observed, whereas those for TPC and TPSi are 11.55 mA/cm2, 0.47 and 10.35 mA/cm(2), 0.42, respectively.

  6. Dynamics of the excited state intramolecular charge transfer

    International Nuclear Information System (INIS)

    Joo, T.; Kim, C.H.

    2006-01-01

    The 6-dodecanoyl-2-dimethylaminonaphtalene (laurdan), a derivative of 6-propanoyl- 2-dimethylaminonaphthalene (prodan), has been used as a fluorescent probe in cell imaging, especially in visualizing the lipid rafts by the generalized polarization (GP) images, where GP=(I 440 -I 490 )/(I 440 +I 490 ) with I being the fluorescence intensity. The fluorescence spectrum of laurdan is sensitive to its dipolar environment due to the intramolecular charge transfer (ICT) process in S 1 state, which results in a dual emission from the locally excited (LE) and the ICT states. The ICT process and the solvation of the ICT state are very sensitive to the dipolar nature of the environment. In this work, the ICT of laurdan in ethanol has been studied by femtosecond time resolved fluorescence (TRF), especially TRF spectra measurement without the conventional spectral reconstruction method. TRF probes the excited states exclusively, a unique advantage over the pump/probe transient absorption technique, although time resolution of the TRF is generally lower than transient absorption and the TRF spectra measurement was possible only though the spectral reconstruction. Over the years, critical advances in TRF technique have been made in our group to achieve <50 fs time resolution with direct full spectra measurement capability. Detailed ICT and the subsequent solvation processes can be visualized unambiguously from the TRF spectra. Fig. 1 shows the TRF spectra of laurdan in ethanol at several time delays. Surprisingly, two bands at 433 and 476 nm are clearly visible in the TRF spectra of laurdan even at T = 0 fs. As time increases, the band at 476 nm shifts to the red while its intensity increases. The band at 433 nm also shifts slightly to the red, but loses intensity as time increases. The intensity of the 476 nm band reaches maximum at around 5 ps, where it is roughly twice as intense as that at 0 fs, and stays constant until lifetime decay is noticeable. The spectra were fit by

  7. Controlling Long-Lived Triplet Generation from Intramolecular Singlet Fission in the Solid State

    KAUST Repository

    Pace, Natalie A.; Zhang, Weimin; Arias, Dylan H.; McCulloch, Iain; Rumbles, Garry; Johnson, Justin C.

    2017-01-01

    The conjugated polymer poly(benzothiophene dioxide) (PBTDO1) has recently been shown to exhibit efficient intramolecular singlet fission in solution. In this paper, we investigate the role of intermolecular interactions in triplet separation dynamics after singlet fission. We use transient absorption spectroscopy to determine the singlet fission rate and triplet yield in two polymers differing only by side chain motif in both solution and the solid state. Whereas solid-state films show singlet fission rates identical to those measured in solution, the average lifetime of the triplet population increases dramatically, and is strongly dependent on side-chain identity. These results show that it may be necessary to carefully engineer the solid-state microstructure of these “singlet fission polymers” in order to produce the long-lived triplets needed to realize efficient photovoltaic devices.

  8. Controlling Long-Lived Triplet Generation from Intramolecular Singlet Fission in the Solid State

    KAUST Repository

    Pace, Natalie A.

    2017-11-30

    The conjugated polymer poly(benzothiophene dioxide) (PBTDO1) has recently been shown to exhibit efficient intramolecular singlet fission in solution. In this paper, we investigate the role of intermolecular interactions in triplet separation dynamics after singlet fission. We use transient absorption spectroscopy to determine the singlet fission rate and triplet yield in two polymers differing only by side chain motif in both solution and the solid state. Whereas solid-state films show singlet fission rates identical to those measured in solution, the average lifetime of the triplet population increases dramatically, and is strongly dependent on side-chain identity. These results show that it may be necessary to carefully engineer the solid-state microstructure of these “singlet fission polymers” in order to produce the long-lived triplets needed to realize efficient photovoltaic devices.

  9. Diffracted X-ray tracking for monitoring intramolecular motion in individual protein molecules using broad band X-ray

    Energy Technology Data Exchange (ETDEWEB)

    Ichiyanagi, Kouhei; Sasaki, Yuji C. [Department of Advanced Materials Science, Graduate School of Frontier Sciences, The University of Tokyo, 609 Kiban Building 5-1-5 Kashiwanoha, Kahiwashi, Chiba 277-8561 (Japan); Japan Science and Technology Agency, CREST, CREST, Sasaki-Team, 609 Kiban Building, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Sekiguchi, Hiroshi; Hoshino, Masato; Kajiwara, Kentaro; Senba, Yasunori; Ohashi, Haruhiko; Ohta, Noboru [Japan Synchrotron Radiation Research Institute, SPring-8, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan); Hoshisashi, Kentaro; Jae-won, Chang; Tokue, Maki; Matsushita, Yufuku [Department of Advanced Materials Science, Graduate School of Frontier Sciences, The University of Tokyo, 609 Kiban Building 5-1-5 Kashiwanoha, Kahiwashi, Chiba 277-8561 (Japan); Nishijima, Masaki; Inoue, Yoshihisa [Department of Applied Chemistry and Office for University-Industry Collaboration, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yagi, Naoto [Japan Science and Technology Agency, CREST, CREST, Sasaki-Team, 609 Kiban Building, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Japan Synchrotron Radiation Research Institute, SPring-8, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan)

    2013-10-15

    Diffracted X-ray tracking (DXT) enables the tilting and twisting motions of single protein molecules to be monitored with micro- to milliradian resolution using a highly brilliant X-ray source with a wide energy bandwidth. We have developed a technique to monitor single molecules using gold nanocrystals attached to individual protein molecules using the BL28B2 beamline at SPring-8. In this paper we present the installation of a single toroidal X-ray mirror at BL28B2 to focus X-rays in an energy range of 10–20 keV (△E/E = 82% for an X-ray with a wide energy bandwidth). With this beamline we tracked diffraction spots from gold nanocrystals over a wide angle range than that using quasi-monochromatic X-rays. Application of the wide angle DXT technique to biological systems enabled us to observe the on-site motions of single protein molecules that have been functionalized in vivo. We further extend the capability of DXT by observing the fractional tilting and twisting motions of inner proteins under various conditions. As a proof of this methodology and to determine instrumental performance the intramolecular motions of a human serum albumin complex with 2-anthracenecarboxylic acid was investigated using the BL28B2 beamline. The random tilting and twisting intramolecular motions are shown to be directly linked to the movement of individual protein molecules in the buffer solution.

  10. α-Bromodiazoacetamides – a new class of diazo compounds for catalyst-free, ambient temperature intramolecular C–H insertion reactions

    Directory of Open Access Journals (Sweden)

    Åsmund Kaupang

    2013-07-01

    Full Text Available In this work, we introduce a new class of halodiazocarbonyl compounds, α-halodiazoacetamides, which through a metal-free, ambient-temperature thermolysis perform intramolecular C–H insertions to produce α-halo-β-lactams. When carried out with α-bromodiazoacetamides bearing cyclic side chains, the thermolysis reaction affords bicyclic α-halo-β-lactams, in some cases in excellent yields, depending on the ring size and substitution pattern of the cyclic amide side chains.

  11. Nickel-Catalyzed C-S Bond Formation via Decarbonylative Thioetherification of Esters, Amides and Intramolecular Recombination Fragment Coupling of Thioesters

    KAUST Repository

    Lee, Shao-Chi

    2018-01-15

    A nickel catalyzed cross-coupling protocol for the straightforward C-S bond formation has been developed. Various mercaptans and a wide range of ester and amide substrates bearing various substituents were tolerated in this process which afforded products in good to excellent yields. Furthermore, an intramolecular protocol for the synthesis of thioethers starting from thioesters has been developed. The utility of this protocol has been demonstrated in the synthesis of benzothiophene on the bench top.

  12. Nickel-Catalyzed C-S Bond Formation via Decarbonylative Thioetherification of Esters, Amides and Intramolecular Recombination Fragment Coupling of Thioesters

    KAUST Repository

    Lee, Shao-Chi; Liao, Hsuan-Hung; Chatupheeraphat, Adisak; Rueping, Magnus

    2018-01-01

    A nickel catalyzed cross-coupling protocol for the straightforward C-S bond formation has been developed. Various mercaptans and a wide range of ester and amide substrates bearing various substituents were tolerated in this process which afforded products in good to excellent yields. Furthermore, an intramolecular protocol for the synthesis of thioethers starting from thioesters has been developed. The utility of this protocol has been demonstrated in the synthesis of benzothiophene on the bench top.

  13. Theoretical study of γ-aminobutyric acid conformers: Intramolecular interactions and ionization energies

    Science.gov (United States)

    Wang, Ke-Dong; Wang, Mei-Ting; Meng, Ju

    2014-10-01

    Allowing for all combinations of internal single-bond rotamers, 1,296 unique trial structures of γ-Aminobutyric acid (GABA) are obtained. All of these structures are optimized at the M06-2X level of theory and a total of 68 local minimal conformers are found. The nine low-lying conformers are used for further studies. According to the calculated relative Gibbs free energies at M06-2X level of theory, we find that the dispersion is important for the relative energy of GABA. The intramolecular hydrogen bonds and hyperconjugative interaction and their effects on the conformational stability are studied. The results show that both of them have great influence on the conformers. The vertical ionization energies (VIE) are calculated and match the experimental data well. The results show that the neutral GABA in the gas phase is a multi-conformer system and at least four conformations exist.

  14. Strategies to enhance the excitation energy-transfer efficiency in a light-harvesting system using the intra-molecular charge transfer character of carotenoids

    Energy Technology Data Exchange (ETDEWEB)

    Yukihira, Nao [Department of Applied Chemistry for Environment; School of Science and Technology; Kwansei Gakuin University; Sanda; Japan; Sugai, Yuko [Department of Applied Chemistry for Environment; School of Science and Technology; Kwansei Gakuin University; Sanda; Japan; Fujiwara, Masazumi [Department of Applied Chemistry for Environment; School of Science and Technology; Kwansei Gakuin University; Sanda; Japan; Kosumi, Daisuke [Institute of Pulsed Power Science; Kumamoto University; Kumamoto; Japan; Iha, Masahiko [South Product Co. Ltd.; Uruma-shi; Japan; Sakaguchi, Kazuhiko [Department of Chemistry; Graduate School of Science; Osaka City University; Osaka 558-8585; Japan; Katsumura, Shigeo [Department of Chemistry; Graduate School of Science; Osaka City University; Osaka 558-8585; Japan; Gardiner, Alastair T. [Glasgow Biomedical Research Centre; University of Glasgow; 126 University Place; Glasgow, G12 8QQ; UK; Cogdell, Richard J. [Glasgow Biomedical Research Centre; University of Glasgow; 126 University Place; Glasgow, G12 8QQ; UK; Hashimoto, Hideki [Department of Applied Chemistry for Environment; School of Science and Technology; Kwansei Gakuin University; Sanda; Japan

    2017-01-01

    Fucoxanthin is a carotenoid that is mainly found in light-harvesting complexes from brown algae and diatoms. Due to the presence of a carbonyl group attached to polyene chains in polar environments, excitation produces an excited intra-molecular charge transfer. This intra-molecular charge transfer state plays a key role in the highly efficient (~95%) energy-transfer from fucoxanthin to chlorophyllain the light-harvesting complexes from brown algae. In purple bacterial light-harvesting systems the efficiency of excitation energy-transfer from carotenoids to bacteriochlorophylls depends on the extent of conjugation of the carotenoids. In this study we were successful, for the first time, in incorporating fucoxanthin into a light-harvesting complex 1 from the purple photosynthetic bacterium,Rhodospirillum rubrumG9+ (a carotenoidless strain). Femtosecond pump-probe spectroscopy was applied to this reconstituted light-harvesting complex in order to determine the efficiency of excitation energy-transfer from fucoxanthin to bacteriochlorophyllawhen they are bound to the light-harvesting 1 apo-proteins.

  15. Aqueous Synthesis of 1-H-2-Substituted Benzimidazoles via Transition-Metal-Free Intramolecular Amination of Aryl Iodides

    Directory of Open Access Journals (Sweden)

    Chunxia Chen

    2012-10-01

    Full Text Available A straightforward method has been developed for the synthesis of the benzimidazole ring system through a carbon-nitrogen cross-coupling reaction. In the presence of 2.0 equiv. of K2CO3 in water at 100 °C for 30 h, the intramolecular cyclization of N-(2-iodoarylbenzamidine provides benzimidazole derivatives in moderate to high yields. Remarkably, the procedure occurs exclusively in water and doesn’t require the use of any additional reagent/catalyst, rendering the methodology highly valuable from both environmental and economical points of view.

  16. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  17. Syntheses of the hexahydroindene cores of indanomycin and stawamycin by combinations of iridium-catalyzed asymmetric allylic alkylations and intramolecular Diels-Alder reactions.

    Science.gov (United States)

    Gärtner, Martin; Satyanarayana, Gedu; Förster, Sebastian; Helmchen, Günter

    2013-01-02

    Short and concise syntheses of the hexahydroindene cores of the antibiotics indanomycin (X-14547 A) and stawamycin are presented. Key methods used are an asymmetric iridium-catalyzed allylic alkylation, a modified Julia olefination, a Suzuki-Miyaura coupling, and an intramolecular Diels-Alder reaction. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6

    Science.gov (United States)

    Dai, Yawei; Seeger, Markus; Weng, Jingwei; Song, Song; Wang, Wenning; Tan, Yan-Wen

    2016-08-01

    Cellular informational and metabolic processes are propagated with specific membrane fusions governed by soluble N-ethylmaleimide sensitive factor attachment protein receptors (SNARE). SNARE protein Ykt6 is highly expressed in brain neurons and plays a critical role in the membrane-trafficking process. Studies suggested that Ykt6 undergoes a conformational change at the interface between its longin domain and the SNARE core. In this work, we study the conformational state distributions and dynamics of rat Ykt6 by means of single-molecule Förster Resonance Energy Transfer (smFRET) and Fluorescence Cross-Correlation Spectroscopy (FCCS). We observed that intramolecular conformational dynamics between longin domain and SNARE core occurred at the timescale ~200 μs. Furthermore, this dynamics can be regulated and even eliminated by the presence of lipid dodecylphoshpocholine (DPC). Our molecular dynamic (MD) simulations have shown that, the SNARE core exhibits a flexible structure while the longin domain retains relatively stable in apo state. Combining single molecule experiments and theoretical MD simulations, we are the first to provide a quantitative dynamics of Ykt6 and explain the functional conformational change from a qualitative point of view.

  19. Unprecedented twofold intramolecular hydroamination in diam(m)ine-dicarboxylatodichloridoplatinum(IV) complexes - ethane-1,2-diamine vs. ammine ligands.

    Science.gov (United States)

    Reithofer, Michael R; Galanski, Markus; Arion, Vladimir B; Keppler, Bernhard K

    2008-03-07

    Reaction of (OC-6-13)-bis(2Z-3-carboxyacrylato)dichlorido(ethane-1,2-diamine)platinum(IV) and (OC-6-13)-diamminebis(2Z-3-carboxyacrylato)dichloridoplatinum(IV) with propylamine in the presence of 1,1'-carbonyl diimidazole afforded not the expected amides; instead, beside amide formation, a twofold intramolecular attack of the am(m)ine ligand at the C[double bond, length as m-dash]C bonds was observed involving either both (ethane-1,2-diamine) or only one (ammine) coordinated nitrogen atom(s).

  20. Construction of Azabicyclo[6.4.0]dodecatrienes Based on Rhodium(I)-Catalyzed Intramolecular [6+2] Cycloaddition between Azetidine, Allene, and Alkynes.

    Science.gov (United States)

    Yasuda, Shigeo; Yokosawa, Haruna; Mukai, Chisato

    2016-01-01

    Treatment of the allenylazetidine-alkynes with a catalytic amount of [RhCl(CO)dppp]2 (dppp: 1,3-bis(diphenylphosphino)propane) effected the intramolecular hetero-[6+2]-type ring-closing reaction via the C-C bond cleavage of the azetidine ring to produce azabicyclo[6.4.0]dodecatriene derivatives in good to excellent yields. The formation of the oxa analogue could also be achieved.

  1. Phase transition and intramolecular hydrogen bonding in nitro derivatives of ortho-hydroxy acetophenones

    Science.gov (United States)

    Filarowski, A.; Kochel, A.; Koll, A.; Bator, G.; Mukherjee, S.

    2006-03-01

    The crystal structures of two ortho-hydroxy aryl ketones (5-chloro-3-nitro-2-hydroxyacetophenone, 5-methyl-3-nitro-2-hydroxyacetophenone and the complex 5-chloro-3-nitro-2-hydroxyacetophenone with 2-aminobenzoic acid (anthranilic acid)) were determined by X-ray diffraction. The existence of an intramolecular hydrogen bond of enol character between the hydroxyl and acetyl groups was found by the X-ray method. The enol character was also confirmed by DFT (B3LYP/6-31+G(d,p)) calculations. A phase transition was found at 138 K in 5-chloro-3-nitro-2-hydroxyacetophenone. This phase transition was investigated by differential scanning calorimetry (DSC), dilatometry, and the dielectric method. A study of the nitro-group dynamics in the ortho-hydroxy acetophenones was carried out with DFT (B3LYP/6-31+G(d,p)) calculations.

  2. Photoinduced Intramolecular Bifurcate Hydrogen Bond: Unusual Mutual Influence of the Components.

    Science.gov (United States)

    Sigalov, Mark V; Shainyan, Bagrat A; Sterkhova, Irina V

    2017-09-01

    A series of 7-hydroxy-2-methylidene-2,3-dihydro-1H-inden-1-ones with 2-pyrrolyl (3), 4-dimethylaminophenyl (4), 4-nitrophenyl (5), and carboxyl group (6) as substituents at the exocyclic double bond was synthesized in the form of the E-isomers (4-6) or predominantly as the Z-isomer (3) which in solution is converted to the E-isomer. The synthesized compounds and their model analogues were studied by NMR spectroscopy, X-ray analysis, and MP2 theoretical calculations. The E-isomers having intramolecular O-H···O═C hydrogen bond are converted by UV irradiation to the Z-isomers having bifurcated O-H···O···H-X hydrogen bond. Unexpected shortening (and, thus, strengthening) of the O-H···O═C component of the bifurcated hydrogen bond upon the formation of the C═O···H-X hydrogen bond was found experimentally, proved theoretically (MP2), and explained by a roundabout interaction of the H-donor (HX) and H-acceptor (C═O) via the system of conjugated bonds.

  3. Toll-Like Receptor-9-Mediated Invasion in Breast Cancer

    Science.gov (United States)

    2011-07-01

    AMBER starting from the in-vacuum minimized Watson - Crick based paired 9-mer hairpin structures. These models were then used with NMR derived distance...the cell. The oligonucleotides studied adopt many different secondary structures such as Watson - Crick duplex, hairpin, quadruplex, and single...deoxyoligonucleotide. Although the mechanism(s) for this induction is unknown, our studies reveal key insights into the structural and sequence requirements for DNA

  4. Diversity-Oriented Synthesis of Coumarin-Linked Benzimidazoles via a One-Pot, Three-Step, Intramolecular Knoevenagel Cyclization.

    Science.gov (United States)

    Yao, Po-Hsin Eric; Kumar, Sunil; Liu, Yu-Li; Fang, Chiu-Ping; Liu, Chia-Chen; Sun, Chung-Ming

    2017-04-10

    Diversity-oriented synthesis of coumarin-linked benzimidazoles from N-(2-aminophenyl)-2-cyanoacetamide was achieved via a one-pot, three-step sequential reaction in excellent yields. In situ intramolecular cyclization of the cyanoacetamide afforded benzimidazoles which subsequently underwent a Knoevenagel condensation of the 2-cyanomethylbenzimidazoles with salicylaldehydes promoted by triethylamine to reach the target compounds. An important intermediate, 2-(2-imino-2H-chromen-3-yl)-1H-benzimidazole was characterized by X-ray analysis and further hydrolyzed to 2-(coumarin-3-yl)benzimidazole in acidic condition. Among the synthesized compounds, some were found to be promising inhibitors of porcine kidney d-amino acid oxidase (pkDAO).

  5. Total synthesis of (+/-)-taiwaniaquinol B via a domino intramolecular friedel-crafts acylation/carbonyl alpha-tert-alkylation reaction.

    Science.gov (United States)

    Fillion, Eric; Fishlock, Dan

    2005-09-28

    The first synthesis of taiwaniaquinol B, a 6-nor-5(6-->7)abeoabietane-type diterpenoid exhibiting the uncommon fused 6-5-6 tricyclic carbon skeleton, was accomplished in 15 steps. A Lewis acid-promoted tandem intramolecular Friedel-Crafts/carbonyl alpha-tert-alkylation reaction was exploited as the core strategy for the synthesis of the sterically congested 1-indanone-containing tricyclic structure. This multiple carbon-carbon bond forming reaction exploits the unique reactivity of Meldrum's acid. The facile precursor synthesis makes this a useful methodology for the expedient modification and assembly of sterically congested 1-indanone-containing ring systems.

  6. Ready synthesis of free N-H 2-arylindoles via the copper-catalyzed amination of 2-bromo-arylacetylenes with aqueous ammonia and sequential intramolecular cyclization.

    Science.gov (United States)

    Wang, Huifeng; Li, Yaming; Jiang, Linlin; Zhang, Rong; Jin, Kun; Zhao, Defeng; Duan, Chunying

    2011-07-07

    A wide range of free N-H 2-arylindoles were synthesised via the copper(II)-catalyzed amination of 2-bromo-arylacetylenes with aqueous ammonia and sequential intramolecular cyclization. The convenience and atom economy of aqueous ammonia, and the low cost of the copper catalytic system make this protocol readily superior in practical application.

  7. Twisted intramolecular charge transfer investigation of semi organic L-Glutamic acid hydrochloride single crystal for organic light-emitting and optical limiting applications

    Science.gov (United States)

    Joy, Lija K.; George, Merin; Alex, Javeesh; Aravind, Arun; Sajan, D.; Vinitha, G.

    2018-03-01

    Single crystals of L-Glutamic acid hydrochloride (LGHCl) were grown by slow evaporation solution technique and good crystalline perfection was confirmed by Powder X-ray diffraction studies. The complete vibrational studies of the compound were analyzed by FT-IR, FT-Raman and UV-visible spectra combined with Normal Coordinate Analysis (NCA) following the scaled quantum mechanical force field methodology and density functional theory (DFT). Twisted Intramolecular Charge Transfer (ICT) occurs due to the presence of strong ionic intra-molecular Nsbnd H⋯O hydrogen bonding was confirmed by Hirshfeld Surface analysis. The existence of intermolecular Nsbnd H⋯Cl hydrogen bonds due to the interaction between the lone pair of oxygen with the antibonding orbital was established by NBO analysis. The Z-scan result indicated that the title molecule exhibits saturable absorption behavior. The attractive third-order nonlinear properties suggest that LGHCl can be a promising candidate for the design and development devices for optical limiting applications. LGHCL exhibits distinct emission in the blue region of the fluorescence lifetime which proves to be a potential candidate for blue- Organic light-emitting diodes (OLEDs) fabrication.

  8. Highly Stereoselective Synthesis of Cyclopentanes bearing Four Stereocenters by a Rhodium Carbene–Initiated Domino Sequence

    Science.gov (United States)

    Parr, Brendan T.; Davies, Huw M. L.

    2014-01-01

    Stereoselective synthesis of a cyclopentane nucleus by convergent annulations constitutes a significant challenge for synthetic chemists. Though a number of biologically relevant cyclopentane natural products are known, more often than not, the cyclopentane core is assembled in a stepwise fashion due to lack of efficient annulation strategies. Herein, we report the rhodium-catalyzed reactions of vinyldiazoacetates with (E)-1,3-disubstituted 2-butenols generate cyclopentanes, containing four new stereogenic centers with very high levels of stereoselectivity (99% ee, >97 : 3 dr). The reaction proceeds by a carbene–initiated domino sequence consisting of five distinct steps: rhodium–bound oxonium ylide formation, [2,3]-sigmatropic rearrangement, oxy-Cope rearrangement, enol–keto tautomerization, and finally an intramolecular carbonyl ene reaction. A systematic study is presented detailing how to control chirality transfer in each of the four stereo-defining steps of the cascade, consummating in the development of a highly stereoselective process. PMID:25082301

  9. New fast organic scintillators using intramolecular bromine quenching

    International Nuclear Information System (INIS)

    Berlman, I.B.; Lutz, S.S.; Flournoy, J.M.; Ashford, C.B.; Franks, L.A.

    1984-01-01

    Organic scintillator solutions with decay times as fast as 500 ps and with relatively high conversion efficiencies have been developed. The intramolecular quenching was achieved through the novel approach of adding a bromine atom to the 3- or 4-position of para-oligophenylenes, the fluorescent solutes in these binary solutions. The bromine serves to enhance singlet-to-triplet intersystem crossing in the chromophore, causing a reduction in the scintillation yield and a concomitant reduction in the decay time. The very fast value given above probably also involves some intermolecular self-quenching at high concentration. In addition, the bromine reduces the symmetry of the molecules, thereby increasing their solubility. Finally, an alkyl chain on the opposite para position further increases the solubility and also increases the immunity of the chromophore to quenching. The decay times for binary liquid solutions in toluene (at the indicated concentrations) were 0.51 ns for 4-BHTP (0.14 M), 0.75 ns for 3-BHTP (0.14 M), 0.57 ns for 3-BTP (0.14 M), and 1.3 ns for 4-BHQP (0.06 M). Binary plastics with 4-BHTP as the solute in concentrations up to 0.14 M were cast in polystyrene. The shortest decay time, 0.40 ns, was measured for the 0.14 M concentration. A plastic scintillator containing 3-BTP (0.11 M in polystyrene) had a decay time of 0.85 ns. These results compare favorably with the plastic scintillator BC-422 whose decay time is about 1.4 ns. (orig./HSI)

  10. Tandem Cu-catalyzed ketenimine formation and intramolecular nucleophile capture: Synthesis of 1,2-dihydro-2-iminoquinolines from 1-(o-acetamidophenyl)propargyl alcohols

    Science.gov (United States)

    Kant, Ruchir

    2014-01-01

    Summary The copper-catalyzed ketenimine formation reaction of 1-(o-acetamidophenyl)propargyl alcohols with various sulfonyl azides is found to undergo a concomitant intramolecular nucleophile attack to generate 1,2-dihydro-2-iminoquinolines after aromatization (via elimination of acetyl and hydroxy groups) and tautomerization. The reaction produces 4-substituted and 3,4-unsubstituted title compounds in moderate to good yields under mild reaction conditions. PMID:24991276

  11. Unusual NHC-Iridium(I) Complexes and Their Use in the Intramolecular Hydroamination of Unactivated Aminoalkenes

    KAUST Repository

    Sipos, Gellé rt; Ou, Arnold; Skelton, Brian W.; Falivene, Laura; Cavallo, Luigi; Dorta, Reto

    2016-01-01

    N-heterocyclic carbene (NHC) ligands with naphthyl side chains were employed for the synthesis of unsaturated, yet isolable [(NHC)Ir(cod)]+ (cod=1,5-cyclooctadiene) complexes. These compounds are stabilised by an interaction of the aromatic wingtip that leads to a sideways tilt of the NHC-Ir bond. Detailed studies show how the tilting of such N-heterocyclic carbenes affects the electronic shielding properties of the carbene carbon atom and how this is reflected by significant upfield shifts in the 13CNMR signals. When employed in the intramolecular hydroamination, these [(NHC)Ir(cod)]+ species show very high catalytic activity under mild reaction conditions. An enantiopure version of the catalyst system produces pyrrolidines with excellent enantioselectivities. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Unusual NHC-Iridium(I) Complexes and Their Use in the Intramolecular Hydroamination of Unactivated Aminoalkenes

    KAUST Repository

    Sipos, Gellért

    2016-04-10

    N-heterocyclic carbene (NHC) ligands with naphthyl side chains were employed for the synthesis of unsaturated, yet isolable [(NHC)Ir(cod)]+ (cod=1,5-cyclooctadiene) complexes. These compounds are stabilised by an interaction of the aromatic wingtip that leads to a sideways tilt of the NHC-Ir bond. Detailed studies show how the tilting of such N-heterocyclic carbenes affects the electronic shielding properties of the carbene carbon atom and how this is reflected by significant upfield shifts in the 13CNMR signals. When employed in the intramolecular hydroamination, these [(NHC)Ir(cod)]+ species show very high catalytic activity under mild reaction conditions. An enantiopure version of the catalyst system produces pyrrolidines with excellent enantioselectivities. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Experimental test of a four-level kinetic model for excited-state intramolecular proton transfer dye lasers

    Energy Technology Data Exchange (ETDEWEB)

    Costela, A; Munnoz, J M; Douhal, A; Figuera, J M; Acuna, A U [Inst. de Quimica Fisica ' ' Rocasolano' ' , C.S.I.C., Madrid (Spain)

    1989-11-01

    The nanosecond pulses of a dye laser oscillator based on the excited-state intramolecular proton-transfer reaction (IPT) of salicylamide and 2'-hydroxylphenyl benzimidazole dyes have been studied as a function of several experimental parameters. To explain the operation of this laser a numerical four-level kinetic model was developed until the lasing properties of these dyes, in the presence of a variable oxygen concentration and pumped with a double pulse technique, could be reproduced. This was possible only by assuming that the efficiency of the laser is controlled by the absorption cross-section of a transient state with a lifetime in the nanosecond-picosecond range, which was tentatively identified as a ground state tautomeric species. (orig.).

  14. Coherent pulse and environmental characteristics of the intramolecular proton-transfer lasers based on 3-hydroxyflavone and fisetin

    Science.gov (United States)

    Parthenopoulos, Dimitri A.; Kasha, Michael

    1988-04-01

    Coherent stimulated emission and laser beams of good quality are reported for 3-hydroxyfiavone (3-HF) and a polyhydroxyfiavone, risetin, acting as intramolecular proton-transfer lasers. The laser beam quality of these materials is comparable to that observed for rhodamine-6G. Studies of amplified spontaneous emission of 3-hydroxyflavone in highly polar solvents are also reported. The very large changes in dipole moment upon electronic excitation of 3-HF expected according to ZINDO semiempirical molecular orbital calculations fail to give rise to spectral shifts in the high dielectric constant solvents. The results are interpreted as a masking spectral effect caused by specific hydrogen bonding by the solvent.

  15. Collisional activation by MALDI tandem time-of-flight mass spectrometry induces intramolecular migration of amide hydrogens in protonated peptides

    DEFF Research Database (Denmark)

    Jørgensen, Thomas J D; Bache, Nicolai; Roepstorff, Peter

    2005-01-01

    of doubly protonated peptides that the original regioselective deuterium pattern of these peptides is completely erased (Jørgensen, T. J. D., Gårdsvoll, H., Ploug, M., and Roepstorff, P. (2005) Intramolecular migration of amide hydrogens in protonated peptides upon collisional activation. J. Am. Chem. Soc...... randomization among all exchangeable sites (i.e. all N- and O-linked hydrogens) also occurs upon high energy collisional activation of singly protonated peptides. This intense proton/deuteron traffic precludes the use of MALDI tandem time-of-flight mass spectrometry to obtain reliable information...

  16. Photochemical Dynamics of Intramolecular Singlet Fission

    Science.gov (United States)

    Lin, Zhou; Iwasaki, Hikari; Van Voorhis, Troy

    2017-06-01

    Singlet fission (SF) converts a singlet exciton (S_1) into a pair of triplet ones (T_1) via a ``multi-exciton'' (ME) intermediate: S_1 \\longleftrightarrow ^1ME \\longleftrightarrow ^1(T_1T_1) \\longrightarrow 2T_1. In exothermic cases, e.g., crystalline pentacene or its derivatives, the quantum yield of SF can reach 200%. With SF doubling the electric current generated by an incident high-energy photon, the solar conversion efficiency in pentacene-based organic photovoltaics (OPVs) can exceed the Shockley-Queisser limit of 33.7%. The ME state is popularly considered to be a dimeric state with significant charge transfer (CT) character that is strongly coupled to both S_1 and ^1(T_1T_1), while this local model lacks strong support from full quantum dynamics studies. Intramolecular SF (ISF) occurring to covalently-bound dimers in the solution phase is an excellent model for a straightforward dynamics simulation of local excitons. In the present study, we investigate the ISF mechanisms for three covalently-bound dimers of pentacene derivatives, including ortho-, meta-, and para-bis(6,13-bis(triisopropylsilylethynyl)pentacene)benzene, in non-protic solvents. Specifically, we propagate the real-time, non-adiabatic quantum mechanical/molecular mechanical (QM/MM) dynamics on the potential energy surfaces associated with the states of S_1, ^1(T_1T_1) and CT. We explore how the energies of these ISF-relevant states and the non-adiabatic couplings between each other fluctuate with time and the instantaneous molecular configuration (e.g., intermonomer distance and orientation). We also quantitatively compare Condon and non-Condon ISF dynamics with solution-phase spectroscopic data. Our results allow us to understand the roles of CT energy levels in the ISF mechanism and propose a design strategy to maximize ISF efficiency. M. B. Smith and J. Michl, Chem. Rev. 110, 6891 (2010). W. Shockley and H. J. Queisser, J. Appl. Phys. 32, 510 (1961). T. C. Berkelbach, M. S. Hybertsen

  17. Ruthenium-modified cytochrome c: temperature dependence of the rate of intramolecular electron transfer

    International Nuclear Information System (INIS)

    Isied, S.S.; Kuehn, C.; Worosila, G.

    1984-01-01

    The ruthenium-modified horse heart cytochrome c, Ru(III)-cyt c(III), where the ruthenium is bound to the histidines-33 residue has been synthesized and characterized by ruthenium analysis, UV-vis and CD spectra, and differential pulse polarography and cyclic voltammetry. The intermediate Ru(III)-cyt c(III) has been generated by pulse-radioanalysis with use of four different radicals, CO 2 -., (CH 3 )COH., (CH 2 OH) 3 CCHOH, and -OCCH(OH)C(OH)CO 2 -. The rate of intramolecular electron transfer within the Ru(III)-cyt c(III) complex and its temperature dependence were determined over a 40 0 C temperature range with the CO 2 -. radical. At 25 0 C, these values are k/sub u/=53 +/- s/sup -1/ (pH 7.01 M phosphate buffer, 0.1 M NaHCO 2 ), ΔH/sup +/=3.5 +/- 0.2 kcal mol/sup -1/, and ΔS/sup +/=-39 +/- 1 eu

  18. Spectroscopy and intramolecular relaxation of methyl salicylate in its first excited singlet state

    Science.gov (United States)

    Kuper, Jerry W.; Perry, David S.

    1984-05-01

    High resolution fluorescence excitation experiments are reported for the blue emitting rotamer of methyl salicylate in its first excited singlet state. These experiments employ moderate expansions of methyl salicylate seeded in argon ( P0D=5-8 Torr cm) to achieve rotational and vibrational cooling in a pulsed supersonic jet. The rotational contour of the electronic origin at 30 055.3 cm-1 is shown to be consistent with a geometrically distorted π-π* excited state, partially polarized along the A axis and with a rotational temperature of 5-7 K. A noticeable broadening of the spectral features beyond the rotational contour begins at 500 cm-1 above the origin and then increases rapidly above 900 cm-1 reaching a width of 12 cm-1 near 1200 cm-1. The constancy of fluorescence decay lifetimes in this region indicate that intramolecular vibrational relaxation in the S1 manifold is the broadening mechanism.

  19. Synthetic Studies on Bioactive Natural Polyketides: Intramolecular Nitrile Oxide-Olefin Cycloaddition Approach for Construction of a Macrolactone Skeleton of Macrosphelide B

    Directory of Open Access Journals (Sweden)

    Seung-Mann Paek

    2011-06-01

    Full Text Available Studies on the synthesis of macrosphelide B via an intramolecular nitrile oxide-olefin cycloaddition (INOC is described. In particular, an asymmetric INOC approach using phase transfer catalysts seems to be a potentially efficient and versatile procedure for the construction of the macrolactone skeleton of macrosphelide B in terms of facial selectivity. Our preliminary and unprecedented stereoselective procedure is anticipated to be usefully applied through further studies for the synthesis of the macrosphelide family.

  20. Functional analysis of propeptide as an intramolecular chaperone for in vivo folding of subtilisin nattokinase.

    Science.gov (United States)

    Jia, Yan; Liu, Hui; Bao, Wei; Weng, Meizhi; Chen, Wei; Cai, Yongjun; Zheng, Zhongliang; Zou, Guolin

    2010-12-01

    Here, we show that during in vivo folding of the precursor, the propeptide of subtilisin nattokinase functions as an intramolecular chaperone (IMC) that organises the in vivo folding of the subtilisin domain. Two residues belonging to β-strands formed by conserved regions of the IMC are crucial for the folding of the subtilisin domain through direct interactions. An identical protease can fold into different conformations in vivo due to the action of a mutated IMC, resulting in different kinetic parameters. Some interfacial changes involving conserved regions, even those induced by the subtilisin domain, blocked subtilisin folding and altered its conformation. Insight into the interaction between the subtilisin and IMC domains is provided by a three-dimensional structural model. Copyright © 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.