WorldWideScience

Sample records for intramolecular quadruplexes sequence

  1. Probe development for detection of TERRA 1 intramolecular G-quadruplex formation using a fluorescent adenosine derivative.

    Science.gov (United States)

    Kim, In Sun; Seo, Young Jun

    2014-03-15

    We developed a probing system to detect the intramolecular G-quadruplex of telomeric repeat-containing RNA (TERRA 1). We used a fluorescent adenosine derivative rA(py) as a fluorophore and incorporated it into the dangling position of the parallel-type G-quadruplex sequence of TERRA 1. The rA(py)-modified G-quadruplex structure exhibited a strong fluorescence emission signal, while the emission signals of the single-strand and duplex structures were much lower. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

    Directory of Open Access Journals (Sweden)

    Deanna N Edwards

    Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

  3. Putative HIV and SIV G-Quadruplex Sequences in Coding and Noncoding Regions Can Form G-Quadruplexes

    Directory of Open Access Journals (Sweden)

    Petra Krafčíková

    2017-01-01

    Full Text Available The HIV virus is one of the most studied viruses in the world. This is especially true in terms of gene sequencing, and to date more than 9 thousand genomic sequences of HIV isolates have been sequenced and analyzed. In this study, a series of DNA sequences, which have the potential to form G-quadruplex structures, is analyzed. Several such sequences were found in various coding and noncoding virus domains, including the U3 LTR, tat, rev, env, and vpx regions. Interestingly, a homological sequence to the already well-known HIV integrase aptamer was identified in the minus-strand. The sequences derived from original isolates were analyzed using standard spectral and electrophoretic methods. In addition, a recently developed methodology is applied which uses induced circular dichroism spectral profiles of G-quadruplex-ligand (Thiazole Orange complexes to determine if G-rich sequences can adopt G-quadruplex structure. Targeting the G-quadruplexes or peptide domains corresponding to the G-rich coding sequence in HIV offers researchers attractive therapeutic targets which would be of particular use in the development of novel antiviral therapies. The analysis of G-rich regions can provide researchers with a path to find specific targets which could be of interest for specific types of virus.

  4. Intramolecular and intermolecular guanine quadruplexes of DNA in aqueous salt and ethanol solutions

    Czech Academy of Sciences Publication Activity Database

    Vorlíčková, Michaela; Bednářová, Klára; Kejnovská, Iva; Kypr, Jaroslav

    2007-01-01

    Roč. 86, č. 1 (2007), s. 1-10 ISSN 0006-3525 Institutional research plan: CEZ:AV0Z50040702 Keywords : guanine quadruplex * G-tetrads * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 2.389, year: 2007

  5. Hairpins participating in folding of human telomeric sequence quadruplexes studied by standard and T-REMD simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří

    2016-01-01

    Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016

  6. The parallel G-quadruplex structure of vertebrate telomeric repeat sequences is not the preferred folding topology under physiological conditions

    Czech Academy of Sciences Publication Activity Database

    Hansel, R.; Loehr, F.; Foldynová-Trantírková, Silvie; Bamberg, E.; Trantírek, L.; Doetsch, V.

    2011-01-01

    Roč. 39, č. 13 (2011), 5768-5775 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z60220518 Keywords : MOLECULAR CROWDING CONDITIONS * INTRAMOLECULAR G-QUADRUPLEX * CELL NMR-SPECTROSCOPY * C- MYC PROMOTER * K+ SOLUTION * DNA * STABILITY * PROTEIN * POLYMORPHISM * HYDRATION Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.026, year: 2011

  7. Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons

    Czech Academy of Sciences Publication Activity Database

    Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris

    2014-01-01

    Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  8. Selection of G-quadruplex folding topology with LNA-modified human telomeric sequences in K+ solution

    DEFF Research Database (Denmark)

    Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte

    2011-01-01

    G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...

  9. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    Science.gov (United States)

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  11. Right-handed and left-handed G-quadruplexes have the same DNA sequence: distinct conformations induced by an organic small molecule and potassium.

    Science.gov (United States)

    Fu, Boshi; Huang, Jinguo; Chen, Yuqi; Wang, Yafen; Xue, Tianrui; Xu, GuoHua; Wang, Shaoru; Zhou, Xiang

    2016-08-21

    Herein, we report two distinct G-quadruplex conformations of the same G-rich oligonucleotide, regulated by a small molecule. This is the first report in which both right- and left-handed G-quadruplex conformations have been obtained from the same sequence. We discriminated these two distinct conformations and investigated their kinetics and thermodynamics.

  12. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Science.gov (United States)

    Das, Kohal; Srivastava, Mrinal; Raghavan, Sathees C

    2016-01-01

    G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX), it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  13. GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Kohal Das

    Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

  14. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  15. The 3'-end region of the human PDGFR-β core promoter nuclease hypersensitive element forms a mixture of two unique end-insertion G-quadruplexes.

    Science.gov (United States)

    Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou

    2018-04-01

    While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Structural and functional analysis of DNA sequences with potential for forming G-quadruplex

    OpenAIRE

    Luciana Souto Mofatto

    2013-01-01

    Resumo: Os G-quadruplexes são estruturas secundárias de DNA altamente organizadas, constituídas por sequências ricas em guaninas capazes de formar tétrades ligadas por pontes de hidrogênio. Essas sequências são capazes de modular a transcrição gênica e o splicing alternativo de éxons. Além disso, estudos também mostraram que os G-quadruplexes estão presentes na região promotora de oncogenes (como c-MYC) e nas regiões terminais dos telômeros, indicando que o G-quadruplex pode ser um possível a...

  17. Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel

    2017-01-01

    Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  18. Sequence requirements and GTP-dependent formation of multimeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 15, č. 1 (2017), s. 15-16 ISSN 2336-7202. [Mezioborové setkání mladých biologů, biochemiků a chemiků /17./. 30.05.2017-01.06.2017, Milovy] Institutional support: RVO:61388963 Keywords : G-quadruplex * GTP-dependent formation Subject RIV: CE - Biochemistry

  19. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  20. Extended molecular dynamics of a c-kit promoter quadruplex

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří

    2015-01-01

    Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015

  1. DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor

    2009-01-01

    Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009

  2. DNA and RNA Quadruplex-Binding Proteins

    Directory of Open Access Journals (Sweden)

    Václav Brázda

    2014-09-01

    Full Text Available Four-stranded DNA structures were structurally characterized in vitro by NMR, X-ray and Circular Dichroism spectroscopy in detail. Among the different types of quadruplexes (i-Motifs, minor groove quadruplexes, G-quadruplexes, etc., the best described are G-quadruplexes which are featured by Hoogsteen base-paring. Sequences with the potential to form quadruplexes are widely present in genome of all organisms. They are found often in repetitive sequences such as telomeric ones, and also in promoter regions and 5' non-coding sequences. Recently, many proteins with binding affinity to G-quadruplexes have been identified. One of the initially portrayed G-rich regions, the human telomeric sequence (TTAGGGn, is recognized by many proteins which can modulate telomerase activity. Sequences with the potential to form G-quadruplexes are often located in promoter regions of various oncogenes. The NHE III1 region of the c-MYC promoter has been shown to interact with nucleolin protein as well as other G-quadruplex-binding proteins. A number of G-rich sequences are also present in promoter region of estrogen receptor alpha. In addition to DNA quadruplexes, RNA quadruplexes, which are critical in translational regulation, have also been predicted and observed. For example, the RNA quadruplex formation in telomere-repeat-containing RNA is involved in interaction with TRF2 (telomere repeat binding factor 2 and plays key role in telomere regulation. All these fundamental examples suggest the importance of quadruplex structures in cell processes and their understanding may provide better insight into aging and disease development.

  3. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  4. Topoisomerase I plays a critical role in suppressing genome instability at a highly transcribed G-quadruplex-forming sequence.

    Directory of Open Access Journals (Sweden)

    Puja Yadav

    2014-12-01

    Full Text Available G-quadruplex or G4 DNA is a non-B secondary DNA structure that comprises a stacked array of guanine-quartets. Cellular processes such as transcription and replication can be hindered by unresolved DNA secondary structures potentially endangering genome maintenance. As G4-forming sequences are highly frequent throughout eukaryotic genomes, it is important to define what factors contribute to a G4 motif becoming a hotspot of genome instability. Using a genetic assay in Saccharomyces cerevisiae, we previously demonstrated that a potential G4-forming sequence derived from a guanine-run containing immunoglobulin switch Mu (Sμ region becomes highly unstable when actively transcribed. Here we describe assays designed to survey spontaneous genome rearrangements initiated at the Sμ sequence in the context of large genomic areas. We demonstrate that, in the absence of Top1, a G4 DNA-forming sequence becomes a strong hotspot of gross chromosomal rearrangements and loss of heterozygosity associated with mitotic recombination within the ∼ 20 kb or ∼ 100 kb regions of yeast chromosome V or III, respectively. Transcription confers a critical strand bias since genome rearrangements at the G4-forming Sμ are elevated only when the guanine-runs are located on the non-transcribed strand. The direction of replication and transcription, when in a head-on orientation, further contribute to the elevated genome instability at a potential G4 DNA-forming sequence. The implications of our identification of Top1 as a critical factor in suppression of instability associated with potential G4 DNA-forming sequences are discussed.

  5. Sequencing and G-quadruplex folding of the canine proto-oncogene KIT promoter region: might dog be used as a model for human disease?

    Directory of Open Access Journals (Sweden)

    Silvia Da Ros

    Full Text Available Downregulation of gene expression by induction of non-canonical DNA structures at promotorial level is a novel attractive anticancer strategy. In human, two guanine-rich sequences (h_kit1 and h_kit2 were identified in the promotorial region of oncogene KIT. Their stabilization into G-quadruplex structures can find applications in the treatment of leukemias, mastocytosis, gastrointestinal stromal tumor, and lung carcinomas which are often associated to c-kit mis-regulation. Also the most common skin cancer in domestic dog, mast cell tumor, is linked to a mutation and/or to an over-expression of c-kit, thus supporting dog as an excellent animal model. In order to assess if the G-quadruplex mediated mechanism of regulation of c-kit expression is conserved among the two species, herein we cloned and sequenced the canine KIT promoter region and we compared it with the human one in terms of sequence and conformational equilibria in physiologically relevant conditions. Our results evidenced a general conserved promotorial sequence between the two species. As experimentally confirmed, this grants that the conformational features of the canine kit1 sequence are substantially shared with the human one. Conversely, two isoforms of the kit2 sequences were identified in the analyzed dog population. In comparison with the human counterpart, both of them showed an altered distribution among several folded conformations.

  6. A novel G-quadruplex motif in the Human MET promoter region.

    Science.gov (United States)

    Yan, Jing; Zhao, Deming; Dong, Liping; Pan, Shuang; Hao, Fengjin; Guan, Yifu

    2017-12-22

    It is known that the guanine-rich strands in proto-oncogene promoters can fold into G-quadruplex structures to regulate gene expression. An intramolecular parallel G-quadruplex has been identified in MET promoter. It acts as a repressor in regulating MET expression. However, the full guanine-rich region in MET promoter forms a hybrid parallel/antiparallel G-quadruplex structure under physiological conditions, which means there are some antiparallel and hybrid parallel/antiparallel G-quadruplex structures in this region. In the present study, our data indicate that g3-5 truncation adopts an intramolecular hybrid parallel/antiparallel G-quadruplex under physiological conditions in vitro The g3-5 G-quadruplex structure significantly stops polymerization by Klenow fragment in K + buffer. Furthermore, the results of circular dichroism (CD) spectra and polymerase stop assay directly demonstrate that the G-quadruplex structure in g3-5 fragment can be stabilized by the G-quadruplex ligand TMPyP4 (5,10,15,20-tetra-(N-methyl-4-pyridyl) porphine). But the dual luciferase assay indicates TMPyP4 has no effect on the formation of g3-5 G-quadruplex in HepG2 cells. The findings in the present study will enrich our understanding of the G-quadruplex formation in proto-oncogene promoters and the mechanisms of gene expression regulation. © 2017 The Author(s).

  7. G-Quadruplexes: Prediction, Characterization, and Biological Application.

    Science.gov (United States)

    Kwok, Chun Kit; Merrick, Catherine J

    2017-10-01

    Guanine (G)-rich sequences in nucleic acids can assemble into G-quadruplex structures that involve G-quartets linked by loop nucleotides. The structural and topological diversity of G-quadruplexes have attracted great attention for decades. Recent methodological advances have advanced the identification and characterization of G-quadruplexes in vivo as well as in vitro, and at a much higher resolution and throughput, which has greatly expanded our current understanding of G-quadruplex structure and function. Accumulating knowledge about the structural properties of G-quadruplexes has helped to design and develop a repertoire of molecular and chemical tools for biological applications. This review highlights how these exciting methods and findings have opened new doors to investigate the potential functions and applications of G-quadruplexes in basic and applied biosciences. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications

    Science.gov (United States)

    2018-01-01

    Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699

  9. A Concomitant Allylic Azide Rearrangement/Intramolecular Azide–Alkyne Cycloaddition Sequence

    Science.gov (United States)

    2015-01-01

    An intramolecular Huisgen cycloaddition of an interconverting set of isomeric allylic azides with alkynes affords substituted triazoles in high yield. The stereoisomeric vinyl-substituted triazoloxazines formed depend on the rate of cycloaddition of the different allylic azide precursors when the reaction is carried out under thermal conditions. In contrast, dimerized macrocyclic products were obtained when the reaction was done using copper(I)-catalyzed conditions, demonstrating the ability to control the reaction products through changing conditions. PMID:24635056

  10. Intramolecular circularization increases efficiency of RNA sequencing and enables CLIP-Seq of nuclear RNA from human cells

    Science.gov (United States)

    Chu, Yongjun; Wang, Tao; Dodd, David; Xie, Yang; Janowski, Bethany A.; Corey, David R.

    2015-01-01

    RNA sequencing (RNA-Seq) is a powerful tool for analyzing the identity of cellular RNAs but is often limited by the amount of material available for analysis. In spite of extensive efforts employing existing protocols, we observed that it was not possible to obtain useful sequencing libraries from nuclear RNA derived from cultured human cells after crosslinking and immunoprecipitation (CLIP). Here, we report a method for obtaining strand-specific small RNA libraries for RNA sequencing that requires picograms of RNA. We employ an intramolecular circularization step that increases the efficiency of library preparation and avoids the need for intermolecular ligations of adaptor sequences. Other key features include random priming for full-length cDNA synthesis and gel-free library purification. Using our method, we generated CLIP-Seq libraries from nuclear RNA that had been UV-crosslinked and immunoprecipitated with anti-Argonaute 2 (Ago2) antibody. Computational protocols were developed to enable analysis of raw sequencing data and we observe substantial differences between recognition by Ago2 of RNA species in the nucleus relative to the cytoplasm. This RNA self-circularization approach to RNA sequencing (RC-Seq) allows data to be obtained using small amounts of input RNA that cannot be sequenced by standard methods. PMID:25813040

  11. Plasmonic biosensor for label-free G-quadruplexes detection

    Science.gov (United States)

    Qiu, Suyan; Zhao, Fusheng; Santos, Greggy M.; Shih, Wei-Chuan

    2016-03-01

    G-quadruplex, readily formed by the G-rich sequence, potentially distributes in over 40 % of all human genes, such as the telomeric DNA with the G-rich sequence found at the end of the chromosome. The G-quadruplex structure is supposed to possess a diverse set of critical functions in the mammalian genome for transcriptional regulation, DNA replication and genome stability. However, most of the currently available methods for G-quadruplex identification are restricted to fluorescence techniques susceptible to poor sensitivity. It is essential to propose methods with higher sensitivity to specifically recognize the G-quadruplexes. In this study, we demonstrate a label-free plasmonic biosensor for G-quadruplex detection by relying on the advantages of nanoporous gold (NPG) disks that provide high-density plasmonic hot spots, suitable for molecular recognition capability without the requirement for labeling processes.

  12. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Science.gov (United States)

    Capra, John A; Paeschke, Katrin; Singh, Mona; Zakian, Virginia A

    2010-07-22

    G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs) across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs). Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  13. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  14. Complicated behavior of G-quadruplexes and evaluating G-quadruplexes' ligands in various systems mimicking cellular circumstance

    Directory of Open Access Journals (Sweden)

    Shi-Ke Wang

    2016-03-01

    Full Text Available Environments surrounding G-rich sequences remarkably affect the conformations of these structures. A proper evaluation system mimicking the crowded environment in a cell with macromolecules should be developed to perform structural and functional studies on G-quadruplexes. In this study, the topology and stability of a G-quadruplex formed by human telomeric repeat sequences were investigated in a macromolecule-crowded environment created by polyethylene glycol 200 (PEG200, tumor cell extract, and Xenopus laevis egg extract. The interactions between small molecules and telomeric G-quadruplexes were also evaluated in the different systems. The results suggested that the actual behavior of G-quadruplex structures in cells extract is quite different from that in the PEG crowding system, and proteins or other factors in extracts might play a very important role in G-quadruplex structures.

  15. Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

    DEFF Research Database (Denmark)

    Foulk, M. S.; Urban, J. M.; Casella, Cinzia

    2015-01-01

    Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...

  16. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  17. Superhelicity Constrains a Localized and R-Loop-Dependent Formation of G-Quadruplexes at the Upstream Region of Transcription.

    Science.gov (United States)

    Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng

    2017-10-20

    Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.

  18. 5'-UTR G-quadruplex structures acting as translational repressors.

    Science.gov (United States)

    Beaudoin, Jean-Denis; Perreault, Jean-Pierre

    2010-11-01

    Given that greater than 90% of the human genome is expressed, it is logical to assume that post-transcriptional regulatory mechanisms must be the primary means of controlling the flow of information from mRNA to protein. This report describes a robust approach that includes in silico, in vitro and in cellulo experiments permitting an in-depth evaluation of the impact of G-quadruplexes as translational repressors. Sequences including potential G-quadruplexes were selected within nine distinct genes encoding proteins involved in various biological processes. Their abilities to fold into G-quadruplex structures in vitro were evaluated using circular dichroism, thermal denaturation and the novel use of in-line probing. Six sequences were observed to fold into G-quadruplex structures in vitro, all of which exhibited translational inhibition in cellulo when linked to a reporter gene. Sequence analysis, direct mutagenesis and subsequent experiments were performed in order to define the rules governing the folding of G-quadruplexes. In addition, the impact of single-nucleotide polymorphism was shown to be important in the formation of G-quadruplexes located within the 5'-untranslated region of an mRNA. In light of these results, clearly the 5'-UTR G-quadruplexes represent a class of translational repressors that is broadly distributed in the cell.

  19. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  20. Biological Function and Medicinal Research Significance of G-Quadruplex Interactive Proteins.

    Science.gov (United States)

    Qiu, Jun; Wang, Mingxue; Zhang, Yan; Zeng, Ping; Ou, Tian-Miao; Tan, Jia-Heng; Huang, Shi-Liang; An, Lin-Kun; Wang, Honggen; Gu, Lian-Quan; Huang, Zhi-Shu; Li, Ding

    2015-01-01

    G-quadruplexes are four-stranded DNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Accumulating studies have revealed that G-quadruplex structures are formed in vivo and play important roles in biological processes such as DNA replication, transcription, recombination, epigenetic regulation, meiosis, antigenic variation, and maintenance of telomeres stability. Mounting evidence indicates that a variety of proteins are capable of binding selectively and tightly to G-quadruplex and play essential roles in G-quadruplex-mediated regulation processes. Some of these proteins promote the formation or/and stabilization of G-quadruplex, while some other proteins act to unwind G-quadruplex preferentially. From a drug discovery perspective, many of these G-quadruplex binding proteins and/or their complexes with G-quadruplexes are potential drug targets. Here, we present a general summary of reported G-quadruplex binding proteins and their biological functions, with focus on those of medicinal research significance. We elaborated the possibility for some of these G-quadruplex binding proteins and their complexes with G-quadruplexes as potential drug targets.

  1. Bisquinolinium compounds induce quadruplex-specific transcriptome changes in HeLa S3 cell lines

    Directory of Open Access Journals (Sweden)

    Halder Rashi

    2012-03-01

    Full Text Available Abstract Background Guanosine rich sequences capable of forming G-quadruplex (G4 motifs are enriched near the gene transcription start site (TSS in the human genome. When probed at the single gene level, G-quadruplex motifs residing in promoter regions show substantial effects on gene transcription. Moreover, further changes in transcription levels are noticed when G4-motifs are targeted with G-quadruplex-specific small molecules. Results Global studies concerning general changes of the transcriptome via targeting promoter-based G-quadruplex motifs are very limited and have so far only been carried out with compounds displaying weak selectivity for quadruplex sequences. Here we utilize two G-quadruplex-specific bisquinolinium derivatives PhenDC3 and 360A and investigate their effects on the expression of the HeLa S3 transcriptome. Our results show wide-spread changes in the transcriptome with specificity for genes with G-quadruplex motifs near their transcription start sites (TSS. Using real-time PCR we further confirmed the specificity of PhenDC3 and 360A as potent molecules to target G-quadruplex-regulated genes. Conclusions Specific effects on quadruplex-containing genes have been observed utilizing whole-transcriptome analysis upon treatment of cultured cells with quadruplex-selective bisquinolinium compounds.

  2. Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

    Directory of Open Access Journals (Sweden)

    Bidisha Sengupta

    Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

  3. Study on the polymorphism of G-quadruplexes by reversed-phase HPLC and LC-MS.

    Science.gov (United States)

    Qiao, Jun-Qin; Cao, Zhao-Ming; Liang, Chao; Chen, Hong-Juan; Zheng, Wei-Juan; Lian, Hong-Zhen

    2018-03-23

    Polymorphism is inherent for G-quadruplexes (G4s), and the different structural forms are important for the participation in different biological functions of telomeres. A lot of progress has been made in the exploration of G4 polymorphism. However, quick separation and reliable assessment methods for different conformations of G4 are still very few. In this work, the polymorphism of three sequences d[(G 3 T) 3 G 3 ], d[(G 3 C) 3 G 3 ] and d[(G 3 T) 4 ] annealed in six different solutions were investigated by means of reversed-phase high performance liquid chromatography (RP-HPLC), liquid chromatography-mass spectrometry (LC-MS), fluorescence spectroscopy, circular dichroism spectroscopy, together with native-polyacrylamide gel electrophoresis. Different G4 conformations of these three sequences can be separated clearly by RP-HPLC, and further characterized by on-line LC-MS analysis. It is revealed that high-order structures other than intramolecular quadruplexes were favored for d[(G 3 T) 3 G 3 ] and d[(G 3 C) 3 G 3 ] under the annealing conditions. However, flanking loop impeded d[(G 3 T) 4 ] to form higher-order structures than dimer. In addition, the nature and concentration of cation, as well as the annealing solution component, all have decent influence on the stability and relative ratios of various G4 building blocks. Based on the above findings, RP-HPLC and LC-MS combined with spectroscopic techniques can be used as a facile and powerful tool for quick separation and identification of G4s in solutions, and for effective assessment of DNA sequences and annealing environments on G4 polymorphism. The established protocol provides a novel strategy for evaluating G4 polymorphism, which will facilitate studies on quadruplex structures and their biophysical properties. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Analysis of G-5x Quadruplex DNA

    Science.gov (United States)

    Weglarz, Meredith; Vesenka, James; Fritzsche, Wolfgang; Yerkes, Sarah; Kmiec, Eric

    2008-10-01

    Pure guanine-rich oligonucleotide (GRO) DNA will self-assemble into quadruplex "G-wire" DNA in the absence of stabilizing monovalent cations. Atomic force microscopy of GRO G-wires bound to freshly cleaved mica and imaged in air reveal extensive networks of connected quadruplex DNA auto-oriented on the next nearest neighbor spacing of the mica substrate. Electrical measurements of GRO G-wires across micro-fabricated gold electrodes on silicon oxide indicate the GRO G-wire networks are electrical insulators. The suspected random nature of the GRO incorporation into quadruplex DNA suggested an alternative mechanism of incorporating metal ions into G-wires: through direct weak ionic binding to the extensive phosphate backbone exposure of both the quadruplex and partially assembled oligonucelotide sequences. High densities of GRO mixed with CuCl2 or AgNO3 produced dramatically wider wires that we believe are combinations of weakly interacting metal ions and GRO. After reduction by exposure to light the Ag+ doped structures appear to be electrically conductive. This process provides a simpler method for the creation of nanometer-scale conductive wires.

  5. In silico identification of novel ligands for G-quadruplex in the c- MYC promoter

    Science.gov (United States)

    Kang, Hyun-Jin; Park, Hyun-Ju

    2015-04-01

    G-quadruplex DNA formed in NHEIII1 region of oncogene promoter inhibits transcription of the genes. In this study, virtual screening combining pharmacophore-based search and structure-based docking screening was conducted to discover ligands binding to G-quadruplex in promoter region of c- MYC. Several hit ligands showed the selective PCR-arresting effects for oligonucleotide containing c- MYC G-quadruplex forming sequence. Among them, three hits selectively inhibited cell proliferation and decreased c- MYC mRNA level in Ramos cells, where NHEIII1 is included in translocated c- MYC gene for overexpression. Promoter assay using two kinds of constructs with wild-type and mutant sequences showed that interaction of these ligands with the G-quadruplex resulted in turning-off of the reporter gene. In conclusion, combined virtual screening methods were successfully used for discovery of selective c- MYC promoter G-quadruplex binders with anticancer activity.

  6. Selective G-Quadruplex DNA Recognition by a New Class of Designed Cyanines

    Directory of Open Access Journals (Sweden)

    Markus W. Germann

    2013-11-01

    Full Text Available A variety of cyanines provide versatile and sensitive agents acting as DNA stains and sensors and have been structurally modified to bind in the DNA minor groove in a sequence dependent manner. Similarly, we are developing a new set of cyanines that have been designed to achieve highly selective binding to DNA G-quadruplexes with much weaker binding to DNA duplexes. A systematic set of structurally analogous trimethine cyanines has been synthesized and evaluated for quadruplex targeting. The results reveal that elevated quadruplex binding and specificity are highly sensitive to the polymethine chain length, heterocyclic structure and intrinsic charge of the compound. Biophysical experiments show that the compounds display significant selectivity for quadruplex binding with a higher preference for parallel stranded quadruplexes, such as cMYC. NMR studies revealed the primary binding through an end-stacking mode and SPR studies showed the strongest compounds have primary KD values below 100 nM that are nearly 100-fold weaker for duplexes. The high selectivity of these newly designed trimethine cyanines for quadruplexes as well as their ability to discriminate between different quadruplexes are extremely promising features to develop them as novel probes for targeting quadruplexes in vivo.

  7. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  8. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives.

    Science.gov (United States)

    Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu

    2018-03-01

    A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. EThcD Discrimination of Isomeric Leucine/Isoleucine Residues in Sequencing of the Intact Skin Frog Peptides with Intramolecular Disulfide Bond

    Science.gov (United States)

    Samgina, Tatiana Yu; Kovalev, Sergey V.; Tolpina, Miriam D.; Trebse, Polonca; Torkar, Gregor; Lebedev, Albert T.

    2018-01-01

    Our scientific interests involve de novo sequencing of non-tryptic natural amphibian skin peptides including those with intramolecular S-S bond by means of exclusively mass spectrometry. Reliable discrimination of the isomeric leucine/isoleucine residues during peptide sequencing by means of mass spectrometry represents a bottleneck in the workflow for complete automation of the primary structure elucidation of these compounds. MS3 is capable of solving the problem. Earlier we demonstrated the advanced efficiency of ETD-HCD method to discriminate Leu/Ile in individual peptides by consecutive application of ETD to the polyprotonated peptides followed by HCD applied to the manually selected primary z-ions with the targeted isomeric residues at their N-termini and registration of the characteristic w-ions. Later this approach was extended to deal with several (4-7) broad band mass ranges, without special isolation of the primary z-ions. The present paper demonstrates an advanced version of this method when EThcD is applied in the whole mass range to a complex mixture of natural non-tryptic peptides without their separation and intermediate isolation of the targeted z-ions. The proposed EThcD method showed over 81% efficiency for the large natural peptides with intact disulfide ring, while the interfering process of radical site migration is suppressed. Due to higher speed and sensitivity, the proposed EThcD approach facilitates the analytical procedure and allows for the automation of the entire experiment and data processing. Moreover, in some cases it gives a chance to establish the nature of the residues in the intact intramolecular disulfide loops.

  10. Exploration of G-quadruplex function in c-Myb gene and its transcriptional regulation by topotecan.

    Science.gov (United States)

    Li, Fangyuan; Zhou, Jiang; Xu, Ming; Yuan, Gu

    2018-02-01

    Our bioinformatics research shows that there are four G-rich sequences (S1-S4) in the upstream region of the transcription start site of c-Myb gene, and we have proved that these sequences have the ability to form G-quadruplex structures. This work mainly focuses on G-quadruplex function, recognition and transcription regulation in c-Myb gene, revealing a novel regulatory element in c-Myb proximal promoter region, and its transcription regulation by G-quadruplex binder. The research has identified that the enhancer effect in c-Myb transcription was primarily affected by the G-quadruplex formed by S1 sequence, and the up-regulation effect may due to the removal of repressive progress of MZF-1 by stabilizing G-quadruplex. Attentions were being paid to the development of G-quadruplex binders for selective recognition, and topotecan was found to have high binding affinity in vitro and could effectively affect the c-Myb transcription activities in cells. The regulation of G-quadruplex with binders in transcriptional, translational levels by Q-RT-PCR and western blot was in expectation of providing a strategy for gene expression modulation. In conclusion, our study revealed a G-quadruplex structure in c-Myb proximal promoter region, which was of great importance in the regulation of c-Myb function. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Role of electrostatic interactions in determining the G-quadruplex structures

    Science.gov (United States)

    Lee, Jinkeong; Im, Haeri; Chong, Song-Ho; Ham, Sihyun

    2018-02-01

    We investigate the energetics of the antiparallel, hybrid and parallel type G-quadruplex structures of the human telomere DNA sequence. We find that both the conformational energy and solvation free energy of these structures are roughly inversely proportional to their radii of gyration. We rationalize this finding in terms of the dominance of the electrostatic contributions. We also show that the solvation free energy is more significant than the conformational energy in determining the G-quadruplex structures, which is in contrast to the canonical B-DNA structures. Our work will contribute to an understanding of the molecular mechanisms dictating various G-quadruplex topologies.

  12. A new cationic porphyrin derivative (TMPipEOPP with large side arm substituents: a highly selective G-quadruplex optical probe.

    Directory of Open Access Journals (Sweden)

    Li-Na Zhu

    Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

  13. Folding equilibrium constants of telomere G-quadruplexes in free state or associated with proteins determined by isothermal differential hybridization.

    Science.gov (United States)

    Wang, Quan; Ma, Li; Hao, Yu-Hua; Tan, Zheng

    2010-11-15

    Guanine rich (G-rich) nucleic acids form G-quadruplex structures that are implicated in many biological processes, pharmaceutical applications, and molecular machinery. The folding equilibrium constant (K(F)) of the G-quadruplex not only determines its stability and competition against duplex formation in genomic DNA but also defines its recognition by proteins and drugs and technical specifications. The K(F) is most conveniently derived from thermal melting analysis that has so far yielded extremely diversified results for the human telomere G-quadruplex. Melting analysis cannot be used for nucleic acids associated with proteins, thus has difficulty to study how protein association affects the folding equilibrium of G-quadruplex structure. In this work, we established an isothermal differential hybridization (IDH) method that is able to determine the K(F) of G-quadruplex, either alone or associated with proteins. Using this method, we studied the folding equilibrium of the core sequence G(3)(T(2)AG(3))(3) from vertebrate telomere in K(+) and Na(+) solutions and how it is affected by proteins associated at its adjacent regions. Our results show that the K(F) obtained for the free G-quadruplex is within 1 order of magnitude of most of those obtained by melting analysis and protein binding beside a G-quadruplex can dramatically destabilize the G-quadruplex.

  14. Effect of G-quadruplex polymorphism on the recognition of telomeric DNA by a metal complex.

    Directory of Open Access Journals (Sweden)

    Caterina Musetti

    Full Text Available The physiological role(s played by G-quadruplexes renders these 'non-canonical' DNA secondary structures interesting new targets for therapeutic intervention. In particular, the search for ligands for selective recognition and stabilization of G-quadruplex arrangements has led to a number of novel targeted agents. An interesting approach is represented by the use of metal-complexes, their binding to DNA being modulated by ligand and metal ion nature, and by complex stoichiometry. In this work we characterized thermodynamically and stereochemically the interactions of a Ni(II bis-phenanthroline derivative with telomeric G-quadruplex sequences using calorimetric, chiroptical and NMR techniques. We employed three strictly related sequences based on the human telomeric repeat, namely Tel22, Tel26 and wtTel26, which assume distinct conformations in potassium containing solutions. We were able to monitor specific enthalpy/entropy changes according to the structural features of the target telomeric sequence and to dissect the binding process into distinct events. Interestingly, temperature effects turned out to be prominent both in terms of binding stoichiometry and ΔH/ΔS contributions, while the final G-quadruplex-metal complex architecture tended to merge for the examined sequences. These results underline the critical choice of experimental conditions and DNA sequence for practical use of thermodynamic data in the rational development of effective G-quadruplex binders.

  15. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  16. G-Quadruplex DNA Motifs in the Malaria Parasite Plasmodium falciparum and Their Potential as Novel Antimalarial Drug Targets.

    Science.gov (United States)

    Harris, Lynne M; Monsell, Katelyn R; Noulin, Florian; Famodimu, M Toyin; Smargiasso, Nicolas; Damblon, Christian; Horrocks, Paul; Merrick, Catherine J

    2018-03-01

    G-quadruplexes are DNA or RNA secondary structures that can be formed from guanine-rich nucleic acids. These four-stranded structures, composed of stacked quartets of guanine bases, can be highly stable and have been demonstrated to occur in vivo in the DNA of human cells and other systems, where they play important biological roles, influencing processes such as telomere maintenance, DNA replication and transcription, or, in the case of RNA G-quadruplexes, RNA translation and processing. We report for the first time that DNA G-quadruplexes can be detected in the nuclei of the malaria parasite Plasmodium falciparum , which has one of the most A/T-biased genomes sequenced and therefore possesses few guanine-rich sequences with the potential to form G-quadruplexes. We show that despite this paucity of putative G-quadruplex-forming sequences, P. falciparum parasites are sensitive to several G-quadruplex-stabilizing drugs, including quarfloxin, which previously reached phase 2 clinical trials as an anticancer drug. Quarfloxin has a rapid initial rate of kill and is active against ring stages as well as replicative stages of intraerythrocytic development. We show that several G-quadruplex-stabilizing drugs, including quarfloxin, can suppress the transcription of a G-quadruplex-containing reporter gene in P. falciparum but that quarfloxin does not appear to disrupt the transcription of rRNAs, which was proposed as its mode of action in both human cells and trypanosomes. These data suggest that quarfloxin has potential for repositioning as an antimalarial with a novel mode of action. Furthermore, G-quadruplex biology in P. falciparum may present a target for development of other new antimalarial drugs. Copyright © 2018 American Society for Microbiology.

  17. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    Science.gov (United States)

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. G-quadruplex organic frameworks

    Science.gov (United States)

    Wu, Yi-Lin; Horwitz, Noah E.; Chen, Kan-Sheng; Gomez-Gualdron, Diego A.; Luu, Norman S.; Ma, Lin; Wang, Timothy C.; Hersam, Mark C.; Hupp, Joseph T.; Farha, Omar K.; Snurr, Randall Q.; Wasielewski, Michael R.

    2017-05-01

    Two-dimensional covalent organic frameworks often π stack into crystalline solids that allow precise spatial positioning of molecular building blocks. Inspired by the hydrogen-bonded G-quadruplexes found frequently in guanine-rich DNA, here we show that this structural motif can be exploited to guide the self-assembly of naphthalene diimide and perylene diimide electron acceptors end-capped with two guanine electron donors into crystalline G-quadruplex-based organic frameworks, wherein the electron donors and acceptors form ordered, segregated π-stacked arrays. Time-resolved optical and electron paramagnetic resonance spectroscopies show that photogenerated holes and electrons in the frameworks have long lifetimes and display recombination kinetics typical of dissociated charge carriers. Moreover, the reduced acceptors form polarons in which the electron is shared over several molecules. The G-quadruplex frameworks also demonstrate potential as cathode materials in Li-ion batteries because of the favourable electron- and Li-ion-transporting capacity provided by the ordered rylene diimide arrays and G-quadruplex structures, respectively.

  19. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  20. Targeting G-quadruplex DNA structures in the telomere and oncogene promoter regions by benzimidazole‒carbazole ligands.

    Science.gov (United States)

    Kaulage, Mangesh H; Maji, Basudeb; Pasadi, Sanjeev; Ali, Asfa; Bhattacharya, Santanu; Muniyappa, K

    2018-03-25

    Recent studies support the idea that G-quadruplex structures in the promoter regions of oncogenes and telomere DNA can serve as potential therapeutic targets in the treatment of cancer. Accordingly, several different types of organic small molecules that stabilize G-quadruplex structures and inhibit telomerase activity have been discerned. Here, we describe the binding of benzimidazole-carbazole ligands to G-quadruplex structures formed in G-rich DNA sequences containing the promoter regions of human c-MYC, c-KIT1, c-KIT2, VEGF and BCL2 proto-oncogenes. The fluorescence spectroscopic data indicate that benzimidazole-carbazole ligands bind and stabilize the G-quadruplexes in the promoter region of oncogenes. The molecular docking studies provide insights into the mode and extent of binding of this class of ligands to the G-quadruplexes formed in oncogene promoters. The high stability of these G-quadruplex structures was validated by thermal denaturation and telomerase-catalyzed extension of the 3' end. Notably, benzimidazole-carbazole ligands suppress the expression of oncogenes in cancer cells in a dose-dependent manner. We anticipate that benzimidazole-carbazole ligands, by virtue of their ability to stabilize G-quadruplex structures in the promoter regions of oncogenes, might reduce the risk of cancer through the loss of function in the proteins encoded by these genes. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  1. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  2. G-quadruplex structure at intron 2 of TFE3 and its role in Xp11.2 translocation and splicing.

    Science.gov (United States)

    Verma, Shiv Prakash; Das, Parimal

    2018-03-01

    Transcription Factor E3 (TFE3) translocation is found in a group of different type of cancers and most of the translocations are located in the 5' region of TFE3 which may be considered as Breakpoint Region (BR). In our In silico study by QGRS mapper and non BdB web servers we found a Potential G-quadruplex forming Sequence (PQS) in the intron 2 of TFE3 gene. In vitro G-quadruplex formation was shown by native PAGE in presence of Pyridostatin(PDS), which with inter molecular secondary structure caused reduced mobility to migrate slower. G-quadruplex formation was mapped at single base resolution by Sanger sequencing and Circular Dichroism showed the formation of parallel G-quadruplex. FRET analysis revealed increased and decreased formation of G-quadruplex in presence of PDS and antisense oligonucleotide respectively. PCR stop assay, transcriptional and translational inhibition by PQS showed stable G-quadruplex formation affecting the biological processes. TFE3 minigene splicing study showed the involvement of this G-quadruplex in TFE3 splicing too. Therefore, G-quadruplex is evident to be the reason behind TFE3 induced oncogenesis executed by translocation and also involved in the mRNA splicing. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

    Directory of Open Access Journals (Sweden)

    Victor Constantin Diculescu

    2010-01-01

    Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

  4. Metal Cations in G-Quadruplex Folding and Stability

    Science.gov (United States)

    Bhattacharyya, Debmalya; Mirihana Arachchilage, Gayan; Basu, Soumitra

    2016-09-01

    This review is focused on the structural and physico-chemical aspects of metal cation coordination to G-Quadruplexes (GQ) and their effects on GQ stability and conformation. G-Quadruplex structures are non-canonical secondary structures formed by both DNA and RNA. G-quadruplexes regulate a wide range of important biochemical processes. Besides the sequence requirements, the coordination of monovalent cations in the GQ is essential for its formation and determines the stability and polymorphism of GQ structures. The nature, location and dynamics of the cation coordination and their impact on the overall GQ stability are dependent on several factors such as the ionic radii, hydration energy and the bonding strength to the O6 of guanines. The intracellular monovalent cation concentration and the localized ion concentrations determine the formation of GQs and can potentially dictate their regulatory roles. A wide range of biochemical and biophysical studies on an array of GQ enabling sequences have generated at a minimum the knowledge base that allows us to often predict the stability of GQs in presence of the physiologically relevant metal ions, however, prediction of conformation of such GQs is still out of the realm.

  5. New insights from molecular dynamic simulation studies of the multiple binding modes of a ligand with G-quadruplex DNA

    Science.gov (United States)

    Hou, Jin-Qiang; Chen, Shuo-Bin; Tan, Jia-Heng; Luo, Hai-Bin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

    2012-12-01

    G-quadruplexes are higher-order DNA and RNA structures formed from guanine-rich sequences. These structures have recently emerged as a new class of potential molecular targets for anticancer drugs. An understanding of the three-dimensional interactions between small molecular ligands and their G-quadruplex targets in solution is crucial for rational drug design and the effective optimization of G-quadruplex ligands. Thus far, rational ligand design has been focused mainly on the G-quartet platform. It should be noted that small molecules can also bind to loop nucleotides, as observed in crystallography studies. Hence, it would be interesting to elucidate the mechanism underlying how ligands in distinct binding modes influence the flexibility of G-quadruplex. In the present study, based on a crystal structure analysis, the models of a tetra-substituted naphthalene diimide ligand bound to a telomeric G-quadruplex with different modes were built and simulated with a molecular dynamics simulation method. Based on a series of computational analyses, the structures, dynamics, and interactions of ligand-quadruplex complexes were studied. Our results suggest that the binding of the ligand to the loop is viable in aqueous solutions but dependent on the particular arrangement of the loop. The binding of the ligand to the loop enhances the flexibility of the G-quadruplex, while the binding of the ligand simultaneously to both the quartet and the loop diminishes its flexibility. These results add to our understanding of the effect of a ligand with different binding modes on G-quadruplex flexibility. Such an understanding will aid in the rational design of more selective and effective G-quadruplex binding ligands.

  6. DNA and RNA Quadruplex-Binding Proteins

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav

    2014-01-01

    Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014

  7. Multimerization rules for G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.

    2017-01-01

    Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https:// academic .oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes

  8. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  9. Fragile X mental retardation protein recognizes a G quadruplex structure within the survival motor neuron domain containing 1 mRNA 5'-UTR.

    Science.gov (United States)

    McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L

    2017-07-25

    G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.

  10. Distinct differences in metal ion specificity of RNA and DNA G-quadruplexes.

    Science.gov (United States)

    Guiset Miserachs, Helena; Donghi, Daniela; Börner, Richard; Johannsen, Silke; Sigel, Roland K O

    2016-12-01

    RNA G-quadruplexes, as their well-studied DNA analogs, require the presence of cations to fold and remain stable. This is the first comprehensive study on the interaction of RNA quadruplexes with metal ions. We investigated the formation and stability of two highly conserved and biologically relevant RNA quadruplex-forming sequences (24nt-TERRA and 18nt-NRAS) in the presence of several monovalent and divalent metal ions, namely Li + , Na + , K + , Rb + , Cs + , NH 4 + , Mg 2+ , Ca 2+ , Sr 2+ , and Ba 2+ . Circular dichroism was used to probe the influence of these metal ions on the folded fraction of the parallel G-quadruplexes, and UV thermal melting experiments allowed to assess the relative stability of the structures in each cationic condition. Our results show that the RNA quadruplexes are more stable than their DNA counterparts under the same buffer conditions. We have observed that the addition of mainly Na + , K + , Rb + , NH 4 + , as well as Sr 2+ and Ba 2+ in water, shifts the equilibrium to the folded quadruplex form, whereby the NRAS sequence responds stronger than TERRA. However, only K + and Sr 2+ lead to a significant increase in the stability of the folded structures, which is consistent with their coordination to the O6 atoms from the G-quartet guanosines. Compared to the respective DNA motives, dNRAS and htelo, the RNA sequences are not stabilized by Na + ions. Finally, the difference in response between NRAS and TERRA, as well as to the corresponding DNA sequences with respect to different metal ions, could potentially be exploited for selective targeting purposes.

  11. Structure of long human telomeric RNA (TERRA): G-quadruplexes formed by four and eight UUAGGG repeats are stable building blocks.

    Science.gov (United States)

    Martadinata, Herry; Heddi, Brahim; Lim, Kah Wai; Phan, Anh Tuân

    2011-07-26

    The discovery of long RNA transcripts of telomeric repeats (TERRA) and their potential to form G-quadruplexes stimulated studies on the possible arrangements of G-quadruplexes along TERRA. Here we performed ribonuclease protection assay to investigate the structures formed by long human TERRA. We found that G-quadruplexes comprising four and eight UUAGGG repeats were most resistant to RNase T1 digestion, presumably with the former adopting an all-parallel-stranded propeller-type conformation and the latter forming a structure with two tandemly stacked G-quadruplex subunits each containing three G-tetrad layers. Molecular dynamics simulations of eight-repeat human TERRA sequences consisting of different stacking interfaces between the two G-quadruplex subunits, i.e., 5'-5', 3'-3', 3'-5', and 5'-3', demonstrated stacking feasibility for all but the 5'-3' arrangement. A continuous stacking of the loop bases from one G-quadruplex subunit to the next was observed for the 5'-5' stacking conformation. We also put forward other possible stacking arrangements that involve more than one linker connecting the two G-quadruplex subunits. On the basis of these results, we propose a "beads-on-a-string"-like arrangement along human TERRA, whereby each bead is made up of either four or eight UUAGGG repeats in a one- or two-block G-quadruplex arrangement, respectively. © 2011 American Chemical Society

  12. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  13. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    Science.gov (United States)

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the diagonal loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Williams, Huw E L; Searle, Mark S

    2009-02-06

    We describe the NMR structural characterisation of a bimolecular anti-parallel DNA quadruplex d(G(3)ACGTAGTG(3))(2) containing an autonomously stable mini-hairpin motif inserted within the diagonal loop. A folding topology is identified that is different from that observed for the analogous d(G(3)T(4)G(3))(2) dimer with the two structures differing in the relative orientation of the diagonal loops. This appears to reflect specific base stacking interactions at the quadruplex-duplex interface that are not present in the structure with the T(4)-loop sequence. A truncated version of the bimolecular quadruplex d(G(2)ACGTAGTG(2))(2), with only two core G-tetrads, is less stable and forms a heterogeneous mixture of three 2-fold symmetric quadruplexes with different loop arrangements. We demonstrate that the nature of the loop sequence, its ability to form autonomously stable structure, the relative stabilities of the hairpin loop and core quadruplex, and the ability to form favourable stacking interactions between these two motifs are important factors in controlling DNA G-quadruplex topology.

  15. Oligonucleotide Models of Telomeric DNA and RNA Form a Hybrid G-quadruplex Structure as a Potential Component of Telomeres*

    Science.gov (United States)

    Xu, Yan; Ishizuka, Takumi; Yang, Jie; Ito, Kenichiro; Katada, Hitoshi; Komiyama, Makoto; Hayashi, Tetsuya

    2012-01-01

    Telomeric repeat-containing RNA, a non-coding RNA molecule, has recently been found in mammalian cells. The detailed structural features and functions of the telomeric RNA at human chromosome ends remain unclear, although this RNA molecule may be a key component of the telomere machinery. In this study, using model human telomeric DNA and RNA sequences, we demonstrated that human telomeric RNA and DNA oligonucleotides form a DNA-RNA G-quadruplex. We next employed chemistry-based oligonucleotide probes to mimic the naturally formed telomeric DNA-RNA G-quadruplexes in living cells, suggesting that the process of DNA-RNA G-quadruplex formation with oligonucleotide models of telomeric DNA and RNA could occur in cells. Furthermore, we investigated the possible roles of this DNA-RNA G-quadruplex. The formation of the DNA-RNA G-quadruplex causes a significant increase in the clonogenic capacity of cells and has an effect on inhibition of cellular senescence. Here, we have used a model system to provide evidence about the formation of G-quadruplex structures involving telomeric DNA and RNA sequences that have the potential to provide a protective capping structure for telomere ends. PMID:23012368

  16. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    Directory of Open Access Journals (Sweden)

    Rosalba Perrone

    Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.

  17. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    Science.gov (United States)

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  18. Structure of human telomeric RNA (TERRA): stacking of two G-quadruplex blocks in K(+) solution.

    Science.gov (United States)

    Martadinata, Herry; Phan, Anh Tuân

    2013-04-02

    Telomeric repeat-containing RNAs (TERRA) are transcription products of the telomeres. Human TERRA sequences containing UUAGGG repeats can form parallel-stranded G-quadruplexes. The stacking interaction of such structures was shown to be important for ligand targeting and higher-order arrangement of G-quadruplexes in long TERRA sequences. Here we report on the first high-resolution structure of a stacked G-quadruplex formed by the 10-nucleotide human TERRA sequence r(GGGUUAGGGU) in potassium solution. This structure comprises two dimeric three-layer parallel-stranded G-quadruplex blocks, which stack on each other at their 5'-ends. The adenine in each UUA loop is nearly coplanar with the 5'-end G-tetrad forming an A·(G·G·G·G)·A hexad, thereby increasing the stacking contacts between the two blocks. Interestingly, this stacking and loop conformation is different from all structures previously reported for the free human TERRA but resembles the structure previously determined for a complex between a human TERRA sequence and an acridine ligand. This stacking conformation is a potential target for drugs that recognize or induce the stacking interface.

  19. Volumetric contributions of loop regions of G-quadruplex DNA to the formation of the tertiary structure.

    Science.gov (United States)

    Takahashi, Shuntaro; Sugimoto, Naoki

    2017-12-01

    DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. RNA G-quadruplex secondary structure promotes alternative splicing via the RNA-binding protein hnRNPF.

    Science.gov (United States)

    Huang, Huilin; Zhang, Jing; Harvey, Samuel E; Hu, Xiaohui; Cheng, Chonghui

    2017-11-15

    It is generally thought that splicing factors regulate alternative splicing through binding to RNA consensus sequences. In addition to these linear motifs, RNA secondary structure is emerging as an important layer in splicing regulation. Here we demonstrate that RNA elements with G-quadruplex-forming capacity promote exon inclusion. Destroying G-quadruplex-forming capacity while keeping G tracts intact abrogates exon inclusion. Analysis of RNA-binding protein footprints revealed that G quadruplexes are enriched in heterogeneous nuclear ribonucleoprotein F (hnRNPF)-binding sites and near hnRNPF-regulated alternatively spliced exons in the human transcriptome. Moreover, hnRNPF regulates an epithelial-mesenchymal transition (EMT)-associated CD44 isoform switch in a G-quadruplex-dependent manner, which results in inhibition of EMT. Mining breast cancer TCGA (The Cancer Genome Atlas) data sets, we demonstrate that hnRNPF negatively correlates with an EMT gene signature and positively correlates with patient survival. These data suggest a critical role for RNA G quadruplexes in regulating alternative splicing. Modulation of G-quadruplex structural integrity may control cellular processes important for tumor progression. © 2017 Huang et al.; Published by Cold Spring Harbor Laboratory Press.

  1. Interaction of Pyrrolobenzodiazepine (PBD) Ligands with Parallel Intermolecular G-Quadruplex Complex Using Spectroscopy and ESI-MS

    Science.gov (United States)

    Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana

    2012-01-01

    Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271

  2. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1-pyrenylet......Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4......-(1-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...... of the antiviral QFOs in the present study formed more thermally stable G-quadruplexes and also high-order G-quadruplex structures which might be responsible for the increased antiviral activity observed....

  3. G-quadruplex DNA biosensor for sensitive visible detection of genetically modified food.

    Science.gov (United States)

    Jiang, Xiaohua; Zhang, Huimin; Wu, Jun; Yang, Xiang; Shao, Jingwei; Lu, Yujing; Qiu, Bin; Lin, Zhenyu; Chen, Guonan

    2014-10-01

    In this paper, a novel label-free G-quadruplex DNAzyme sensor has been proposed for colorimetric identification of GMO using CaMV 35S promoter sequence as the target. The binary probes can fold into G-quadruplex structure in the presence of DNA-T (Target DNA) and then combine with hemin to form a DNAzyme resembling horseradish peroxidase. The detection system consists of two G-rich probes with 2:2 split mode by using the absorbance and color of ABTS(2-) as signal reporter. Upon the addition of a target sequence, two probes both hybridize with target and then their G-rich sequences combine to form a G-quadruplex DNAzyme, and the DNAzyme can catalyze the reaction of ABTS(2-) with H2O2. Then the linear range is from 0.05 to 0.5 μM while detection limit is 5nM. These results demonstrate that the proposed G-quadruplex DNAzyme method could be used as a simple, sensitive and cost-effective approach for assays of GMO. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Solution structure of a 2:1 quindoline-c-MYC G-quadruplex: insights into G-quadruplex-interactive small molecule drug design.

    Science.gov (United States)

    Dai, Jixun; Carver, Megan; Hurley, Laurence H; Yang, Danzhou

    2011-11-09

    Unimolecular parallel-stranded G-quadruplex structures are found to be prevalent in gene promoters. The nuclease hypersensitivity element III(1) (NHE III(1)) of the c-MYC promoter can form transcriptionally active and silenced forms, and the formation of DNA G-quadruplex structures has been shown to be critical for c-MYC transcriptional silencing. The solution structure of a 2:1 quindoline-G-quadruplex complex has been solved and shows unexpected features, including the drug-induced reorientation of the flanking sequences to form a new binding pocket. While both 3' and 5' complexes show overall similar features, there are identifiable differences that emphasize the importance of both stacking and electronic interactions. For the first time, we describe the importance of the shape of the ligand as well as the two flanking bases in determining drug binding specificity. These structures provide important insights for the structure-based rational design of drugs that bind to unimolecular parallel G-quadruplexes commonly found in promoter elements.

  5. A triple stranded G-quadruplex formation in the promoter region of human myosin β(Myh7) gene.

    Science.gov (United States)

    Singh, Anju; Kukreti, Shrikant

    2017-09-19

    Regulatory regions in human genome, enriched in guanine-rich DNA sequences have the propensity to fold into G-quadruplex structures. On exploring the genome for search of G-tracts, it was interesting to find that promoter of Human Myosin Gene (MYH7) contains a conserved 23-mer G-rich sequence (HM-23). Mutations in this gene are associated with familial cardiomyopathy. Enrichment of MYH7 gene in G-rich sequences could possibly play a critical role in its regulation. We used polyacrylamide gel electrophoresis (PAGE), UV-Thermal denaturation (UV-Tm) and Circular Dichroism (CD), to demonstrate the formation of a G-quadruplex by 23-mer G-rich sequence HM23 in promoter location of MYH7 gene. We observed that the wild G-rich sequence HM23 containing consecutive G 5 stretch in two stacks adopt G-quadruplexes of diverse molecularity by involvement of four-strand, three-strand and two-strands with same parallel topology. Interestingly, the mutated sequence in the absence of continuous G 5 stretch obstructs the formation of three-stranded G-quadruplex. We demonstrated that continuous G 5 stretch is mandatory for the formation of a unique three-stranded G-quadruplex. Presence of various transcription factors (TF) in vicinity of the sequence HM23 leave fair possibility of recognition by TF binding sites, and so modulate gene expression. These findings may add on our understanding about the effect of base change in the formation of varied structural species in similar solution condition. This study may give insight about structural polymorphism arising due to recognition of non-Watson-Crick G-quadruplex structures by cellular proteins and designing structure specific molecules.

  6. Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.

    Science.gov (United States)

    Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek

    2015-06-22

    A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Stabilization of Telomere G-Quadruplexes Interferes with Human Herpesvirus 6A Chromosomal Integration.

    Science.gov (United States)

    Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis

    2017-07-15

    Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the

  8. Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome.

    Science.gov (United States)

    De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân

    2016-07-27

    The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Intramolecular and nonlinear dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Davis, M.J. [Argonne National Laboratory, IL (United States)

    1993-12-01

    Research in this program focuses on three interconnected areas. The first involves the study of intramolecular dynamics, particularly of highly excited systems. The second area involves the use of nonlinear dynamics as a tool for the study of molecular dynamics and complex kinetics. The third area is the study of the classical/quantum correspondence for highly excited systems, particularly systems exhibiting classical chaos.

  10. Interaction of hnRNP A1 with telomere DNA G-quadruplex structures studied at the single molecule level

    DEFF Research Database (Denmark)

    Krüger, Asger Christian; Raarup, Merete Krog; Nielsen, Morten Muhlig

    2010-01-01

    G-rich telomeric DNA sequences can form G-quadruplex structures. The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) and a shortened derivative (UP1) are active in telomere length regulation, and it has been reported that UP1 can unwind G-quadruplex structures. Here, we investigate...... the interaction of hnRNP A1 with G-quadruplex DNA structures containing the human telomere repeat (TTAGGG) by gel retardation assays, ensemble fluorescence energy transfer (FRET) spectroscopy, and single molecule FRET microscopy. Our biochemical experiments show that hnRNP A1 binds well to the G...... to the previously reported crystal structures of UP1-telomere DNA complexes where the DNA oligo within the protein-DNA complex is in a fully open conformation....

  11. Comprehensive identification of proteins binding to RNA G-quadruplex motifs in the 5' UTR of tumor-associated mRNAs.

    Science.gov (United States)

    Serikawa, Tatsuo; Spanos, Christos; von Hacht, Annekathrin; Budisa, Nediljko; Rappsilber, Juri; Kurreck, Jens

    2018-01-01

    G-quadruplex structures in the 5' UTR of mRNAs are widely considered to suppress translation without affecting transcription. The current study describes the comprehensive analysis of proteins binding to four different G-quadruplex motifs located in mRNAs of the cancer-related genes Bcl-2, NRAS, MMP16, and ARPC2. Following metabolic labeling (Stable Isotope Labeling with Amino acids in Cell culture, SILAC) of proteins in the human cell line HEK293, G-quadruplex binding proteins were enriched by pull-down assays and identified by LC-orbitrap mass spectrometry. We found different patterns of interactions for the G-quadruplex motifs under investigation. While the G-quadruplexes in the mRNAs of NRAS and MMP16 specifically interacted with a small number of proteins, the Bcl-2 and ARPC2 G-quadruplexes exhibited a broad range of proteinaceous interaction partners with 99 and 82 candidate proteins identified in at least two replicates, respectively. The use of a control composed of samples from all G-quadruplex-forming sequences and their mutated controls ensured that the identified proteins are specific for RNA G-quadruplex structures and are not general RNA-binding proteins. Independent validation experiments based on pull-down assays and Western blotting confirmed the MS data. Among the interaction partners were many proteins known to bind to RNA, including multiple heterogenous nuclear ribonucleoproteins (hnRNPs). Several of the candidate proteins are likely to reflect stalling of the ribosome by RNA G-quadruplex structures. Interestingly, additional proteins were identified that have not previously been described to interact with RNA. Gene ontology analysis of the candidate proteins revealed that many interaction partners are known to be tumor related. The majority of the identified RNA G-quadruplex interacting proteins are thought to be involved in post-transcriptional processes, particularly in splicing. These findings indicate that protein-G-quadruplex interactions

  12. Intramolecular and Transannular Diels-Alder Reactions

    DEFF Research Database (Denmark)

    Tanner, David Ackland; Ascic, Erhad

    2014-01-01

    Few reactions can compete with the Diels-Alder (DA) [4+2] cycloaddition for the rapid and efficient generation of molecular complexity. The DA reaction is atom-economic and stereospecific, as well as diastereo- and regioselective. The intramolecular version (IMDA) of the DA cycloaddition and its...... and dienophile, methods for acceleration of IMDA reactions (such as use of high pressure) and catalysis (using oxophilic or carbophilic metal complexes, Brønsted acids, and enzymes). The use of furans as diene components (IMDAF), intramolecular hetero-DA (IMHDA) and IMDA reactions with inverse electron demand...... are also covered. Applications of IMDA to asymmetric synthesis (from substrate control through to enantioselective catalysis, including organocatalysis) are presented, along with tandem sequences involving IMDA cycloaddition. A theme pervading the whole chapter is the use of IMDA reactions for the total...

  13. Simultaneous G-Quadruplex DNA Logic.

    Science.gov (United States)

    Bader, Antoine; Cockroft, Scott L

    2018-04-03

    A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Altered biochemical specificity of G-quadruplexes with mutated tetrads

    Czech Academy of Sciences Publication Activity Database

    Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.

    2016-01-01

    Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes

  15. Enantioselective targeting left-handed Z-G-quadruplex.

    Science.gov (United States)

    Zhao, Andong; Zhao, Chuanqi; Ren, Jinsong; Qu, Xiaogang

    2016-01-25

    Herein, we report the first example where an M-enantiomer of a chiral metal complex can selectively stabilize a left-handed G-quadruplex, but its P-enantiomer cannot. The interactions between the chiral metal complexes and the left-handed G-quadruplex were evaluated by UV melting, circular dichroism, isothermal titration calorimetry, gel electrophoresis and NMR titrations.

  16. Effect of Pressure on Thermal Stability of G-Quadruplex DNA and Double-Stranded DNA Structures

    Directory of Open Access Journals (Sweden)

    Shuntaro Takahashi

    2013-10-01

    Full Text Available Pressure is a thermodynamic parameter that can induce structural changes in biomolecules due to a volumetric decrease. Although most proteins are denatured by pressure over 100 MPa because they have the large cavities inside their structures, the double-stranded structure of DNA is stabilized or destabilized only marginally depending on the sequence and salt conditions. The thermal stability of the G-quadruplex DNA structure, an important non-canonical structure that likely impacts gene expression in cells, remarkably decreases with increasing pressure. Volumetric analysis revealed that human telomeric DNA changed by more than 50 cm3 mol−1 during the transition from a random coil to a quadruplex form. This value is approximately ten times larger than that for duplex DNA under similar conditions. The volumetric analysis also suggested that the formation of G-quadruplex DNA involves significant hydration changes. The presence of a cosolute such as poly(ethylene glycol largely repressed the pressure effect on the stability of G-quadruplex due to alteration in stabilities of the interactions with hydrating water. This review discusses the importance of local perturbations of pressure on DNA structures involved in regulation of gene expression and highlights the potential for application of high-pressure chemistry in nucleic acid-based nanotechnology.

  17. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  18. Identification, characterization and application of a G-quadruplex structured DNA aptamer against cancer biomarker protein anterior gradient homolog 2.

    Directory of Open Access Journals (Sweden)

    Jie Wu

    Full Text Available BACKGROUND: Anterior gradient homolog 2 (AGR2 is a functional protein with critical roles in a diverse range of biological systems, including vertebrate tissue development, inflammatory tissue injury responses, and cancer progression. Clinical studies have shown that the AGR2 protein is overexpressed in a wide range of human cancers, including carcinomas of the esophagus, pancreas, breast, prostate, and lung, making the protein as a potential cancer biomarker. However, the general biochemical functions of AGR2 in human cells remain undefined, and the signaling mechanisms that drive AGR2 to inhibit p53 are still not clearly illustrated. Therefore, it is of great interest to develop molecular probes specifically recognizing AGR2 for its detection and for the elucidation of AGR2-associated molecular mechanism. METHODOLOGY/PRINCIPAL FINDINGS: Through a bead-based and flow cytometry monitored SELEX technology, we have identified a group of DNA aptamers that can specifically bind to AGR2 with K(d values in the nanomolar range after 14 rounds of selections. Aptamer C14B was chosen to further study, due to its high binding affinity and specificity. The optimized and shortened C14B1 has special G-rich characteristics, and the G-rich region of this binding motif was further characterized to reveal an intramolecular parallel G-quadruplex by CD spectroscopy and UV spectroscopy. Our experiments confirmed that the stability of the G-quadruplex structure was strongly dependent on the nature of the monovalent ions and the formation of G-quadruplex structure was also important for the binding capacity of C14B1 to the target. Furthermore, we have designed a kind of allosteric molecule beacon (aMB probe for selective and sensitive detection of AGR2. CONCLUSION/SIGNIFICANCE: In this work, we have developed new aptamer probes for specific recognition of the AGR2. Structural study have identified that the binding motif of aptamer is an intramolecular parallel G-quadruplex

  19. Fluorescence detection of DNA, adenosine-5'-triphosphate (ATP), and telomerase activity by zinc(II)-protoporphyrin IX/G-quadruplex labels.

    Science.gov (United States)

    Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar

    2012-06-05

    The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.

  20. Cellular Detection of G-Quadruplexes by Optical Imaging Methods.

    Science.gov (United States)

    Amor, Souheila; Yang, Sunny Y; Wong, Judy M Y; Monchaud, David

    2017-09-01

    G-quadruplexes (G4s) are higher-order nucleic acid structures that fold from guanine (G)-rich DNA and RNA strands. This field of research gains traction as a major chemical biology area since it aims at uncovering many key cellular mechanisms in which quadruplexes are involved. The wealth of knowledge acquired over the past three decades strongly supports pivotal roles of G4 in the regulation of gene expression at both transcriptional (DNA quadruplexes) and translational levels (RNA quadruplexes). Recent biochemical discoveries uncovered myriad of additional G4 actions: from chromosomal stability to the firing of replication origins, from telomere homeostasis to functional dysregulations underlying genetic diseases (including cancers and neurodegeneration). Here, we listed a repertoire of protocols that we have developed over the past years to visualize quadruplexes in cells. These achievements were made possible thanks to the discovery of a novel family of versatile quadruplex-selective fluorophores, the twice-as-smart quadruplex ligands named TASQ (for template-assembled synthetic G-quartet). The versatility of this probe allows for multiple imaging techniques in both fixed and live cells, including the use of the multiphoton microscopy, confocal microscopy, and real-time fluorescent image collection. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  1. Structure of a left-handed DNA G-quadruplex.

    Science.gov (United States)

    Chung, Wan Jun; Heddi, Brahim; Schmitt, Emmanuelle; Lim, Kah Wai; Mechulam, Yves; Phan, Anh Tuân

    2015-03-03

    Aside from the well-known double helix, DNA can also adopt an alternative four-stranded structure known as G-quadruplex. Implications of such a structure in cellular processes, as well as its therapeutic and diagnostic applications, have been reported. The G-quadruplex structure is highly polymorphic, but so far, only right-handed helical forms have been observed. Here we present the NMR solution and X-ray crystal structures of a left-handed DNA G-quadruplex. The structure displays unprecedented features that can be exploited as unique recognition elements.

  2. Elevated levels of G-quadruplex formation in human stomach and liver cancer tissues.

    Science.gov (United States)

    Biffi, Giulia; Tannahill, David; Miller, Jodi; Howat, William J; Balasubramanian, Shankar

    2014-01-01

    Four-stranded G-quadruplex DNA secondary structures have recently been visualized in the nuclei of human cultured cells. Here, we show that BG4, a G-quadruplex-specific antibody, can be used to stain DNA G-quadruplex structures in patient-derived tissues using immunohistochemistry. We observe a significantly elevated number of G-quadruplex-positive nuclei in human cancers of the liver and stomach as compared to background non-neoplastic tissue. Our results suggest that G-quadruplex formation can be detected and measured in patient-derived material and that elevated G-quadruplex formation may be a characteristic of some cancers.

  3. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  4. IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation

    Czech Academy of Sciences Publication Activity Database

    Haroniková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva; Fojta, Miroslav; Dvořáková, P.; Muller, P.; Vojtešek, B.; Brázda, Václav

    2016-01-01

    Roč. 11, č. 6 (2016) E-ISSN 1932-6203 R&D Projects: GA ČR GA15-21855S; GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : INTERFERON-INDUCIBLE PROTEIN * CIRCULAR-DICHROISM SPECTROSCOPY * RELEVANT G-QUADRUPLEX Subject RIV: BO - Biophysics Impact factor: 2.806, year: 2016

  5. Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

    Science.gov (United States)

    Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

    2017-12-21

    An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.

  6. Linking of Antitumor trans NHC-Pt(II) Complexes to G-Quadruplex DNA Ligand for Telomeric Targeting.

    Science.gov (United States)

    Betzer, Jean-François; Nuter, Frédérick; Chtchigrovsky, Mélanie; Hamon, Florian; Kellermann, Guillaume; Ali, Samar; Calméjane, Marie-Ange; Roque, Sylvain; Poupon, Joël; Cresteil, Thierry; Teulade-Fichou, Marie-Paule; Marinetti, Angela; Bombard, Sophie

    2016-06-15

    G-quadruplex structures (G4) are promising anticancerous targets. A great number of small molecules targeting these structures have already been identified through biophysical methods. In cellulo, some of them are able to target either telomeric DNA and/or some sequences involved in oncogene promotors, both resulting in cancer cell death. However, only a few of them are able to bind to these structures G4 irreversibly. Here we combine within the same molecule the G4-binding agent PDC (pyridodicarboxamide) with a N-heterocyclic carbene-platinum complex NHC-Pt already identified for its antitumor properties. The resulting conjugate platinum complex NHC-Pt-PDC stabilizes strongly G-quadruplex structures in vitro, with affinity slightly affected as compared to PDC. In addition, we show that the new conjugate binds preferentially and irreversibly the quadruplex form of the human telomeric sequence with a profile in a way different from that of NHC-Pt thereby indicating that the platination reaction is oriented by stacking of the PDC moiety onto the G4-structure. In cellulo, NHC-Pt-PDC induces a significant loss of TRF2 from telomeres that is considerably more important than the effect of its two components alone, PDC and NHC-Pt, respectively.

  7. A Split G-Quadruplex and Graphene Oxide-Based Low-Background Platform for Fluorescence Authentication of Pseudostellaria heterophylla

    Directory of Open Access Journals (Sweden)

    Zhenzhu Zheng

    2014-12-01

    Full Text Available A label-free split G-quadruplex and graphene oxide (GO-based fluorescence platform has been designed to distinguish Pseudostellaria heterophylla (PH from its adulterants based on the differences in their nrDNA ITS sequences. Herein, GO has been first introduced to capture G-rich probes with 2:2 split mode and then decrease the background signal. As T-DNA exists, the probes leave the GO surface to form double-stranded structures followed by the formation of the overhanging G-rich sequence into a G-quadruplex structure, which combines quinaldine red specifically to produce a strong fluorescence signal. In addition, this strategy allows detection of T-DNA in a wide range of concentrations from 1.0 × 10−8 to 2.0 × 10−6 mol·L−1 with a detection limit of 7.8 × 10−9 mol·L−1. We hope that the split G-quadruplex/GO platform can be utilized to further develop gene identification sensors in Traditional Chinese Medicine or other analysis areas.

  8. Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.

    Science.gov (United States)

    Armas, Pablo; David, Aldana; Calcaterra, Nora B

    2017-01-01

    G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.

  9. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Oncogene Expression Modulation in Cancer Cell Lines by DNA G-Quadruplex-Interactive Small Molecules.

    Science.gov (United States)

    Francisco, Ana Paula; Paulo, Alexandra

    2017-01-01

    Nucleic acids are prone to structural polymorphism and a number of structures may be formed in addition to the well-known DNA double helix. Among these is a family of nucleic acid four-stranded structures known as G-quadruplexes (G4). These quadruplex structures can be formed by sequences containing repetitive guanine-rich tracks and the analysis of Non-B-DNA database indicated an enrichment of these sequences in genomic regions controlling cellular proliferation, such as for example in the promoter regions of c- MYC, k-RAS, c-KIT, HSP90 and VEGF among others. The broad concept of G4 targeting with small molecules is now generally accepted as a promising novel approach to anticancer therapy and several small molecules with antiproliferative activity in cancer cell lines have also been shown to stabilize these DNA structures, thus suggesting a potential application of G4-interactive small molecules as new anticancer drugs. Herein we review, by targeted oncogene and main chemical scaffold, those G4-interactive small molecules with reported gene expression modulatory activity in cancer cell lines. The data obtained so far are encouraging but further efforts are needed to validate G4 as drug targets and optimize the structure of G4- interactive small molecules into new anticancer drugs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  11. G-quadruplex-based aptamers against protein targets in therapy and diagnostics.

    Science.gov (United States)

    Platella, Chiara; Riccardi, Claudia; Montesarchio, Daniela; Roviello, Giovanni N; Musumeci, Domenica

    2017-05-01

    Nucleic acid aptamers are single-stranded DNA or RNA molecules identified to recognize with high affinity specific targets including proteins, small molecules, ions, whole cells and even entire organisms, such as viruses or bacteria. They can be identified from combinatorial libraries of DNA or RNA oligonucleotides by SELEX technology, an in vitro iterative selection procedure consisting of binding (capture), partitioning and amplification steps. Remarkably, many of the aptamers selected against biologically relevant protein targets are G-rich sequences that can fold into stable G-quadruplex (G4) structures. Aiming at disseminating novel inspiring ideas within the scientific community in the field of G4-structures, the emphasis of this review is placed on: 1) recent advancements in SELEX technology for the efficient and rapid identification of new candidate aptamers (introduction of microfluidic systems and next generation sequencing); 2) recurrence of G4 structures in aptamers selected by SELEX against biologically relevant protein targets; 3) discovery of several G4-forming motifs in important regulatory regions of the human or viral genome bound by endogenous proteins, which per se can result into potential aptamers; 4) an updated overview of G4-based aptamers with therapeutic potential and 5) a discussion on the most attractive G4-based aptamers for diagnostic applications. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate

    Science.gov (United States)

    Ranjan, Nihar; Davis, Erik; Xue, Liang

    2013-01-01

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792

  13. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  14. Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

    Directory of Open Access Journals (Sweden)

    Li-Ping Bai

    Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.

  15. Quadruplex-Flanking Stem Structures Modulate the Stability and Metal Ion Preferences of RNA Mimics of GFP.

    Science.gov (United States)

    Ageely, Eman A; Kartje, Zachary J; Rohilla, Kushal J; Barkau, Christopher L; Gagnon, Keith T

    2016-09-16

    The spinach family of RNA aptamers are RNA mimics of green fluorescent protein (GFP) that have previously been designed to address the challenges of imaging RNA inside living cells. However, relatively low levels of free intracellular magnesium limited the practical use of these aptamers. Recent cell-based selections identified the broccoli RNA aptamer, which requires less magnesium for fluorescence, but the basis for magnesium preference remained unclear. Here, we find that the broccoli RNA structure is very similar to that of baby spinach, a truncated version of the spinach aptamer. Differences in stability and metal ion preferences between these two aptamers, and among broccoli mutants, are primarily associated with the sequence and structure of predicted quadruplex-flanking stem structures. Mutation of purine-purine pairs in broccoli at the terminal stem-quadruplex transition caused reversion of broccoli to a higher magnesium dependence. Unique duplex-to-quadruplex transitions in GFP-mimic RNAs likely explain their sensitivity to magnesium for stability and fluorescence. Thus, optimizations designed to improve aptamers should take into consideration the role of metal ions in stabilizing the transitions and interactions between independently folding RNA structural motifs.

  16. New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.

    Science.gov (United States)

    Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni

    2018-02-10

    The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50  = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  17. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    Science.gov (United States)

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  18. Symmetry of intramolecular quantum dynamics

    CERN Document Server

    Burenin, Alexander V

    2012-01-01

    The main goal of this book is to give a systematic description of intramolecular quantum dynamics on the basis of only the symmetry principles. In this respect, the book has no analogs in the world literature. The obtained models lead to a simple, purely algebraic, scheme of calculation and are rigorous in the sense that their correctness is limited only to the correct choice of symmetry of the internal dynamics. The book is basically intended for scientists working in the field of molecular spectroscopy, quantum and structural chemistry.

  19. Guanine quadruplex structures localize to heterochromatin.

    Science.gov (United States)

    Hoffmann, Roland F; Moshkin, Yuri M; Mouton, Stijn; Grzeschik, Nicola A; Kalicharan, Ruby D; Kuipers, Jeroen; Wolters, Anouk H G; Nishida, Kazuki; Romashchenko, Aleksander V; Postberg, Jan; Lipps, Hans; Berezikov, Eugene; Sibon, Ody C M; Giepmans, Ben N G; Lansdorp, Peter M

    2016-01-08

    Increasing amounts of data support a role for guanine quadruplex (G4) DNA and RNA structures in various cellular processes. We stained different organisms with monoclonal antibody 1H6 specific for G4 DNA. Strikingly, immuno-electron microscopy showed exquisite specificity for heterochromatin. Polytene chromosomes from Drosophila salivary glands showed bands that co-localized with heterochromatin proteins HP1 and the SNF2 domain-containing protein SUUR. Staining was retained in SUUR knock-out mutants but lost upon overexpression of SUUR. Somatic cells in Macrostomum lignano were strongly labeled, but pluripotent stem cells labeled weakly. Similarly, germline stem cells in Drosophila ovaries were weakly labeled compared to most other cells. The unexpected presence of G4 structures in heterochromatin and the difference in G4 staining between somatic cells and stem cells with germline DNA in ciliates, flatworms, flies and mammals point to a conserved role for G4 structures in nuclear organization and cellular differentiation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Toward the design of a catalytic metallodrug: selective cleavage of G-quadruplex telomeric DNA by an anticancer copper-acridine-ATCUN complex.

    Science.gov (United States)

    Yu, Zhen; Han, Menglu; Cowan, James A

    2015-02-02

    Telomeric DNA represents a novel target for the development of anticancer drugs. By application of a catalytic metallodrug strategy, a copper-acridine-ATCUN complex (CuGGHK-Acr) has been designed that targets G-quadruplex telomeric DNA. Both fluorescence solution assays and gel sequencing demonstrate the CuGGHK-Acr catalyst to selectively bind and cleave the G-quadruplex telomere sequence. The cleavage pathway has been mapped by matrix assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) experiments. CuGGHK-Acr promotes significant inhibition of cancer cell proliferation and shortening of telomere length. Both senescence and apoptosis are induced in the breast cancer cell line MCF7. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Stability of Human Telomere Quadruplexes at High DNA Concentrations

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.

    2014-01-01

    Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

  2. Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands

    DEFF Research Database (Denmark)

    Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond

    2012-01-01

    Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....

  3. Assaying the binding strength of G-quadruplex ligands using single-molecule TPM experiments.

    Science.gov (United States)

    Liu, Shih-Wei; Chu, Jen-Fei; Tsai, Cheng-Ting; Fang, Hung-Chih; Chang, Ta-Chau; Li, Hung-Wen

    2013-05-15

    G-quadruplexes are stable secondary structures formed by Hoogsteen base pairing of guanine-rich single-stranded DNA sequences in the presence of monovalent cations (Na(+) or K(+)). Folded G-quadruplex (G4) structures in human telomeres have been proposed as a potential target for cancer therapy. In this study, we used single-molecule tethered particle motion (TPM) experiments to assay the binding strength of possible G4 ligands. We found that individual single-stranded DNA molecules containing the human telomeric sequence d[AGGG(TTAGGG)3] fluctuated between the folded and the unfolded states in a 10 mM Na(+) solution at 37 °C. The durations of folded and unfolded states were single-exponentially distributed, and in return the folding and unfolding rate constants were 1.68 ± 0.01 and 1.63 ± 0.03 (s(-1)), respectively. In the presence of G4 ligands, such as TMPyP4, DODCI, BMVC, and BMVPA, the unfolding rate constant decreased appreciably. In addition, combining the Cu(2+)-induced G4 unfolding and TPM assay, we showed that BMVC and TMPyP4 are better G4 stabilizers than DODCI. The capability of monitoring the fluctuation between the folded and the unfolded state of G4 DNA in real time allows the determination of both kinetic and thermodynamic parameters in a single measurement and offers a simple way to assay binding strength under various conditions. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.

  4. Symmetric cyanovinyl-pyridinium triphenylamine: a novel fluorescent switch-on probe for an antiparallel G-quadruplex.

    Science.gov (United States)

    Lai, Han; Lai, Hai; Xiao, Yijie; Yan, Shengyong; Tian, Fangfang; Zhong, Cheng; Liu, Yi; Weng, Xiaocheng; Zhou, Xiang

    2014-04-21

    In this study, we present a fluorescent switch-on probe based on a cyanovinyl-pyridinium triphenylamine (CPT) derivative that exhibited a 190-fold increase in fluorescence upon binding to G-quadruplex-forming oligonucleotide 22AG. This probe showed specificity and selectivity towards an antiparallel G-quadruplex, indicating its promising potential in G-quadruplex imaging.

  5. Intramolecular Energy Transfer, Charge Transfer & Hydrogen Bond

    Indian Academy of Sciences (India)

    Ultrafast Dynamics of Chemical Reactions in Condensed Phase: Intramolecular Energy Transfer, Charge Transfer & Hydrogen Bond. Dipak K. Palit Radaition & Photochemistry Division Bhabha Atomic Research Centre Mumbai 400 085, India.

  6. Intramolecular Association within the SAFT Framework

    DEFF Research Database (Denmark)

    Avlund, Ane Søgaard; Kontogeorgis, Georgios; Chapman, Walter G.

    2011-01-01

    the contribution to the Helmholtz free energy from association (inter- as well as intramolecularly) at equilibrium. Sear and Jackson rederived the contribution to the Helmholtz free energy from association from the theory by Wertheim [J. Stat. Phys. 42 (3–4), 459 (1986)] with inclusion of intramolecular...... association, and using this approach we obtain an expression for the Helmholtz free energy that is valid also at non-equilibrium states (with respect to hydrogen bonds), which is very useful when calculating derivatives.......A general theory for modelling intramolecular association within the SAFT framework is proposed. Sear and Jackson [Phys. Rev. E. 50 (1), 386 (1994)] and Ghonasgi and Chapman [J. Chem. Phys. 102 (6), 2585 (1995)] have previously extended SAFT to include intramolecular association for chains with two...

  7. G-quadruplex RNA binding and recognition by the lysine-specific histone demethylase-1 enzyme.

    Science.gov (United States)

    Hirschi, Alexander; Martin, William J; Luka, Zigmund; Loukachevitch, Lioudmila V; Reiter, Nicholas J

    2016-08-01

    Lysine-specific histone demethylase 1 (LSD1) is an essential epigenetic regulator in metazoans and requires the co-repressor element-1 silencing transcription factor (CoREST) to efficiently catalyze the removal of mono- and dimethyl functional groups from histone 3 at lysine positions 4 and 9 (H3K4/9). LSD1 interacts with over 60 regulatory proteins and also associates with lncRNAs (TERRA, HOTAIR), suggesting a regulatory role for RNA in LSD1 function. We report that a stacked, intramolecular G-quadruplex (GQ) forming TERRA RNA (GG[UUAGGG]8UUA) binds tightly to the functional LSD1-CoREST complex (Kd ≈ 96 nM), in contrast to a single GQ RNA unit ([UUAGGG]4U), a GQ DNA ([TTAGGG]4T), or an unstructured single-stranded RNA. Stabilization of a parallel-stranded GQ RNA structure by monovalent potassium ions (K(+)) is required for high affinity binding to the LSD1-CoREST complex. These data indicate that LSD1 can distinguish between RNA and DNA as well as structured versus unstructured nucleotide motifs. Further, cross-linking mass spectrometry identified the primary location of GQ RNA binding within the SWIRM/amine oxidase domain (AOD) of LSD1. An ssRNA binding region adjacent to this GQ binding site was also identified via X-ray crystallography. This RNA binding interface is consistent with kinetic assays, demonstrating that a GQ-forming RNA can serve as a noncompetitive inhibitor of LSD1-catalyzed demethylation. The identification of a GQ RNA binding site coupled with kinetic data suggests that structured RNAs can function as regulatory molecules in LSD1-mediated mechanisms. © 2016 Hirschi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  8. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

    2017-01-01

    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redox...... marked single- and double-strand OGNs has reached the single-molecule level based i.a. on electrochemical in situ scanning tunnelling microscopy (STM) and break-junction (B-J) STM. There are much fewer such reports on “non-canonical” OGN structures such as G-quadruplexes. We discuss first single......-molecule electrochemical conductivity of pure and redox marked duplex OGNs, and address next electrochemistry and electrochemical conductivity in the few reported monolayer and single-molecule G-quadruplex studies. Facile electrochemical electron transfer of iron protoporphyrin IX stacked onto three-quartet 12-guanine...

  9. Spectroscopic Detection of DNA Quadruplexes by Vibrational Circular Dichroism

    Czech Academy of Sciences Publication Activity Database

    Andrushchenko, Valery; Tsankov, D.; Krasteva, M.; Wieser, H.; Bouř, Petr

    2011-01-01

    Roč. 133, č. 38 (2011), s. 15055-15064 ISSN 0002-7863 R&D Projects: GA ČR GAP208/10/0559; GA ČR GAP208/11/0105; GA MŠk(CZ) LH11033 Grant - others:AV ČR(CZ) M200550902 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleic acids * VCD * DFT computations * DNA quadruplexes Subject RIV: CC - Organic Chemistry Impact factor: 9.907, year: 2011

  10. Identification of novel interactors of human telomeric G-quadruplex DNA.

    Science.gov (United States)

    Pagano, Bruno; Margarucci, Luigi; Zizza, Pasquale; Amato, Jussara; Iaccarino, Nunzia; Cassiano, Chiara; Salvati, Erica; Novellino, Ettore; Biroccio, Annamaria; Casapullo, Agostino; Randazzo, Antonio

    2015-02-18

    A chemoproteomic-driven approach was used to investigate the interaction network between human telomeric G-quadruplex DNA and nuclear proteins. We identified novel G-quadruplex binding partners, able to recognize these DNA structures at chromosome ends, suggesting a possible, and so far unknown, role of these proteins in telomere functions.

  11. Tracking the Dynamic Folding and Unfolding of RNA G-Quadruplexes in Live Cells.

    Science.gov (United States)

    Chen, Xiu-Cai; Chen, Shuo-Bin; Dai, Jing; Yuan, Jia-Hao; Ou, Tian-Miao; Huang, Zhi-Shu; Tan, Jia-Heng

    2018-04-16

    Because of the absence of methods for tracking RNA G-quadruplex dynamics, especially the folding and unfolding of this attractive structure in live cells, understanding of the biological roles of RNA G-quadruplexes is so far limited. Herein, we report a new red-emitting fluorescent probe, QUMA-1, for the selective, continuous, and real-time visualization of RNA G-quadruplexes in live cells. The applications of QUMA-1 in several previously intractable applications, including live-cell imaging of the dynamic folding, unfolding, and movement of RNA G-quadruplexes and the visualization of the unwinding of RNA G-quadruplexes by RNA helicase have been demonstrated. Notably, our real-time results revealed the complexity of the dynamics of RNA G-quadruplexes in live cells. We anticipate that the further application of QUMA-1 in combination with appropriate biological and imaging methods to explore the dynamics of RNA G-quadruplexes will uncover more information about the biological roles of RNA G-quadruplexes. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Identification of small molecules capable of regulating conformational changes of telomeric G-quadruplex

    Science.gov (United States)

    Chen, Shuo-Bin; Liu, Guo-Cai; Gu, Lian-Quan; Huang, Zhi-Shu; Tan, Jia-Heng

    2018-02-01

    Design of small molecules targeted at human telomeric G-quadruplex DNA is an extremely active research area. Interestingly, the telomeric G-quadruplex is a highly polymorphic structure. Changes in its conformation upon small molecule binding may be a powerful method to achieve a desired biological effect. However, the rational development of small molecules capable of regulating conformational change of telomeric G-quadruplex structures is still challenging. In this study, we developed a reliable ligand-based pharmacophore model based on isaindigotone derivatives with conformational change activity toward telomeric G-quadruplex DNA. Furthermore, virtual screening of database was conducted using this pharmacophore model and benzopyranopyrimidine derivatives in the database were identified as a strong inducer of the telomeric G-quadruplex DNA conformation, transforming it from hybrid-type structure to parallel structure.

  14. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  15. Quinolino[3,4-b]quinoxalines and pyridazino[4,3-c]quinoline derivatives: Synthesis, inhibition of topoisomerase IIα, G-quadruplex binding and cytotoxic properties.

    Science.gov (United States)

    Palluotto, Fausta; Sosic, Alice; Pinato, Odra; Zoidis, Grigoris; Catto, Marco; Sissi, Claudia; Gatto, Barbara; Carotti, Angelo

    2016-11-10

    The quinoline motif fused with other heterocyclic systems plays an important role in the field of anticancer drug development. An extensive series of tetracyclic quinolino[3,4-b]quinoxalines N-5 or C-6 substituted with basic side chain and a limited number of tricyclic pyridazino[4,3-c]quinolines N-6 substituted were designed, synthesized and evaluated for topoisomerase IIα (Topo IIα) inhibitory activity, ability to bind and stabilize G-quadruplex structures and cytotoxic properties against two human cancer cell lines (HeLa and MCF-7). Almost all of the tested agents showed a high activity as Topo IIα inhibitors and G-quadruplex stabilizers. Among all the derivatives studied, the quinolino[3,4-b]quinoxalines 11 and 23, N-5 and C-6 substituted respectively, stand out as the most promising compounds. Derivative 11 resulted a selective binder to selected G-quadruplex sequences, while derivative 23 displayed the most interesting Topo IIα inhibitory activity (IC50 = 5.14 μM); both showed high cytotoxic activity (IC50 HeLa = 2.04 μM and 2.32 μM, respectively). Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. Exonuclease-assisted multicolor aptasensor for visual detection of ochratoxin A based on G-quadruplex-hemin DNAzyme-mediated etching of gold nanorod.

    Science.gov (United States)

    Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu

    2018-04-21

    An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.

  17. Structural and biophysical insight into dual site binding of the protoberberine alkaloid palmatine to parallel G-quadruplex DNA using NMR, fluorescence and circular dichroism spectroscopy.

    Science.gov (United States)

    Padmapriya, Kumar; Barthwal, Ritu

    2018-02-20

    Plant derived small molecules, which interact with and stabilize G-quadruplex DNA, act as inhibitors of telomere elongation and oncogene expression in humans. The inhibition of telomerase enzyme has immense potential since it is over expressed in most cancer cells. Interaction of palmatine, an antitumor alkaloid, to parallel G-quadruplex DNA, [d(TTGGGGT)] 4 and [d(TTAGGGT)] 4 , has been investigated using Nuclear Magnetic Resonance (NMR), fluorescence and Circular Dichroism (CD) spectroscopy. Titrations were monitored by recording 1 H and 31 P NMR spectra and solution structure of palmatine-[d(TTGGGGT)] 4 complex was obtained by restrained Molecular Dynamics (rMD) simulations using distance restraints from 2D NOESY spectra. Thermal stabilization of DNA was determined by CD, 1 H NMR and Differential Scanning Calorimetry (DSC). Binding of palmatine induces 98% enhancement of fluorescence accompanied by blue shift ∼8 nm. CD spectral bands of DNA show minor changes. Diffusion NMR studies confirm formation of a stable complex. Proton NMR signals of palmatine shift upfield upon binding and NOE cross peaks of H10, H3, H28, 5OCH 3 protons with T2, A3/G3, G6 and T7 residues reveal dual recognition sites in both G-quadruplex DNA sequences, resulting in thermal stabilization of G-quadruplex by ∼13-17 °C. Restrained molecular dynamics simulations using NOE distance restraints for 2:1 palmatine-[d(TTGGGGT)] 4 complex reveal end-stacking of palmatine at G6pT7 step and groove binding along T2pG3 step. Binding to [d(TTAGGGT)] 4 takes place at T2pA3pG4 and G6pT7 steps. Structural features of molecular recognition of two different G-quadruplex DNA sequences by palmatine have relevance in rational drug development for anti-cancer therapy. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  18. Identification of New Natural DNA G-Quadruplex Binders Selected by a Structure-Based Virtual Screening Approach

    Directory of Open Access Journals (Sweden)

    Stefano Alcaro

    2013-09-01

    Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.

  19. Morphological effects of G-quadruplex stabilization using a small molecule in zebrafish.

    Science.gov (United States)

    Agarwal, Tani; Lalwani, Mukesh Kumar; Kumar, Santosh; Roy, Saumya; Chakraborty, Tushar Kanti; Sivasubbu, Sridhar; Maiti, Souvik

    2014-02-25

    Zebrafish (Danio rerio) embryos are transparent and advantageous for studying early developmental changes due to ex utero development, making them an appropriate model for studying gene expression changes as a result of molecular targeting. Zebrafish embryos were injected with a previously reported G-quadruplex selective ligand, and the phenotypic changes were recorded. We report marked discrepancies in the development of intersegmental vessels. In silico analysis determined that the putative G-quadruplex motif occur in the upstream promoter region of the Cdh5 (N-cadherin) gene. A real-time polymerase chain reaction-based investigation indicated that in zebrafish, CDH-2 (ZN-cad) was significantly downregulated in the ligand-treated embryos. Biophysical characterization of the interaction of the ligand with the G-quadruplex motif found in this promoter yielded strong binding and stabilization of the G-quadruplex with this ligand. Hence, we report for the first time the phenotypic impact of G-quadruplex targeting with a ligand in a vertebrate organism. This study has unveiled not only G-quadruplex targeting in non-human animal species but also the potential that G-quadruplexes can provide a ready tool for understanding the phenotypic effects of targeting certain important genes involved in differentiation and developmental processes in a living eukaryotic organism.

  20. Direct visualization of nucleolar G-quadruplexes in live cells by using a fluorescent light-up probe.

    Science.gov (United States)

    Zhang, Suge; Sun, Hongxia; Chen, Hongbo; Li, Qian; Guan, Aijiao; Wang, Lixia; Shi, Yunhua; Xu, Shujuan; Liu, Meirong; Tang, Yalin

    2018-05-01

    Direct detection of G-quadruplexes in human cells has become an important issue due to the vital role of G-quadruplex related to biological functions. Despite several probes have been developed for detection of the G-quadruplexes in cytoplasm or whole cells, the probe being used to monitor the nucleolar G-quadruplexes is still lacking. Formation of the nucleolar G-quadruplex structures was confirmed by using circular dichroism (CD) spectroscopy. The binding affinity and selectivity of Thioflavin T (ThT) towards various DNA/RNA motifs in solution and gel system were measured by using fluorescence spectroscopy and polyacrylamide gel electrophoresis (PAGE), respectively. G-quadruplex imaging in live cells was directly captured by using confocal laser scanning microscopy (CLSM). Formation of the rDNA and rRNA G-quadruplex structures is demonstrated in vitro. ThT is found to show much higher affinity and selectivity towards these G-quadruplex structures versus other nucleic acid motifs either in solution or in gel system. The nucleolar G-quadruplexes in living cells are visualized by using ThT as a fluorescent probe. G-quadruplex-ligand treatments in live cells lead to sharp decrease of ThT signal. The natural existence of the G-quadruplexes structure in the nucleoli of living cells is directly visualized by using ThT as an indicator. The research provides substantive evidence for formation of the rRNA G-quadruplex structures, and also offers an effective probe for direct visualization of the nucleolar G-quadruplexes in living cells. Copyright © 2018. Published by Elsevier B.V.

  1. Structural, intramolecular hydrogen bonding and vibrational studies ...

    Indian Academy of Sciences (India)

    The harmonic oscillator model of aromaticity (HOMA) index elucidated the impact of hydrogen bond- ing in the ring. Intramolecular hydrogen bonding energy has been calculated from topological study. The low wavenumber vibrational modes obtained from experimental FT-Raman spectrum also supported the presence.

  2. Solvent control of intramolecular proton transfer

    DEFF Research Database (Denmark)

    Manolova, Y.; Marciniak, Heinz; Tschierlei, S.

    2017-01-01

    of molecules in the enol and zwitterionic proton transfer (PT) form exists in the ground state. However, the zwitterion is the energetically favored one in the electronically excited state. Optical excitation of the enol form results in intramolecular proton transfer and formation of the PT form within 1.4 ps...

  3. Structural, intramolecular hydrogen bonding and vibrational studies ...

    Indian Academy of Sciences (India)

    An extensive theoretical study on the molecular structure and vibrational analysis of 3-amino-4- methoxy benzamide (3A4MBA) was undertaken using density functional theoretical (DFT) method. The possibility of formation of intramolecular hydrogen bonding was identified from structural parameter analysis and confirmed ...

  4. Structural, intramolecular hydrogen bonding and vibrational studies

    Indian Academy of Sciences (India)

    An extensive theoretical study on the molecular structure and vibrational analysis of 3-amino-4- methoxy benzamide (3A4MBA) was undertaken using density functional theoretical (DFT) method. The possibility of formation of intramolecular hydrogen bonding was identified from structural parameter analysis and confirmed ...

  5. Photoswitchable Intramolecular H-Stacking of Perylenebisimide

    NARCIS (Netherlands)

    Wang, Jiaobing; Kulago, Artem; Browne, Wesley R.; Feringa, Ben L.

    2010-01-01

    Dynamic control over the formation of H- or J-type aggregates of chromophores is of fundamental importance for developing responsive organic optoelectronic materials. In this study, the first example of photoswitching between a nonstacked and an intramolecularly H-stacked arrangement of

  6. Structural, intramolecular hydrogen bonding and vibrational studies ...

    Indian Academy of Sciences (India)

    The harmonic oscillator model of aromaticity (HOMA) index elucidated the impact of hydrogen bond- ing in the ring. Intramolecular hydrogen ... (Figure 3). The total ener- gies obtained for these possible conformers are listed in Table 1. ..... Structure, Reactivity and Intermolecular Forces: An. Euristic Interpretation by Means of ...

  7. Local epigenetic reprogramming induced by G-quadruplex ligands

    Science.gov (United States)

    Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar

    2017-11-01

    DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.

  8. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  9. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G......-quadruplex by single and double replacements of TGT and TT loops. Monomers H15 and H26 were found to destabilize G-quadruplex structures for all single replacements of TGT or TT loops. The largest destabilization was observed when H26 linker replaced a TT loop. In contrast, the presence of anthraquinone monomers...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  10. Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond

    2009-01-01

    the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....

  11. Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří

    2017-01-01

    Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016

  12. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes

    OpenAIRE

    Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-01-01

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...

  13. Intramolecular Energy Transfer, Charge Transfer & Hydrogen Bond

    Indian Academy of Sciences (India)

    Ultrafast Dynamics of Chemical Reactions in Condensed Phase: Intramolecular Energy Transfer, Charge Transfer & Hydrogen Bond · PowerPoint Presentation · Slide 3 · Slide 4 · Slide 5 · Slide 6 · Slide 7 · Slide 8 · Slide 9 · Slide 10 · Slide 11 · Slide 12 · Slide 13 · Slide 14 · Slide 15 · Slide 16 · Slide 17 · Slide 18 · Slide 19.

  14. Intramolecular Energy Relaxation and Statistical Rate Theory

    OpenAIRE

    Okitsugu, KAJIMOTO; Department of Chemistry, Kyoto University

    1994-01-01

    Statistical rate theory is essentially based on the state counting without any restrictions other than the energy and the angular momentum conservation. In this work, two kinds of restrictions are introduced into the statistical theory. The first restriction is related to the intramolecular energy flow within the reacting molecular system. The excess energy of reaction is made distributed with some bias favoring a specific degree of freedom. That is, the statistical weight of each product sta...

  15. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  16. Sites of instability in the human TCF3 (E2A gene adopt G-quadruplex DNA structures in vitro

    Directory of Open Access Journals (Sweden)

    Jonathan David Williams

    2015-05-01

    Full Text Available The formation of highly stable four-stranded DNA, called G-quadruplex (G4, promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human TCF3 gene (also termed E2A is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19 associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19 break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination.

  17. A sensitive fluorescence anisotropy method for detection of lead (II) ion by a G-quadruplex-inducible DNA aptamer

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Dapeng [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing, 100085 (China); Yin, Lei; Meng, Zihui [School of Chemical Engineering and Environment, Beijing Institute of Technology, Beijing, 100081 (China); Yu, Anchi [Department of Chemistry, Renmin University of China, Beijing, 100872 (China); Guo, Lianghong [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing, 100085 (China); Wang, Hailin, E-mail: hlwang@rcees.ac.cn [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing, 100085 (China)

    2014-02-17

    Graphical abstract: -- Highlights: •A fluorescence anisotropy approach for detection of Pb{sup 2+} was developed. •The strategy was based on binding-induced allosteric conformational change of aptamer probe. •The sensing mechanism was established by testing the photoinduced electron transfer interaction. -- Abstract: Sensitive and selective detection of Pb{sup 2+} is of great importance to both human health and environmental protection. Here we propose a novel fluorescence anisotropy (FA) approach for sensing Pb{sup 2+} in homogeneous solution by a G-rich thrombin binding aptamer (TBA). The TBA labeled with 6-carboxytetramethylrhodamine (TMR) at the seventh thymine nucleotide was used as a fluorescent probe for signaling Pb{sup 2+}. It was found that the aptamer probe had a high FA in the absence of Pb{sup 2+}. This is because the rotation of TMR is restricted by intramolecular interaction with the adjacent guanine bases, which results in photoinduced electron transfer (PET). When the aptamer probe binds to Pb{sup 2+} to form G-quadruplex, the intramolecular interaction should be eliminated, resulting in faster rotation of the fluorophore TMR in solution. Therefore, FA of aptamer probe is expected to decrease significantly upon binding to Pb{sup 2+}. Indeed, we observed a decrease in FA of aptamer probe upon Pb{sup 2+} binding. Circular dichroism, fluorescence spectra, and fluorescence lifetime measurement were used to verify the reliability and reasonability of the sensing mechanism. By monitoring the FA change of the aptamer probe, we were able to real-time detect binding between the TBA probe and Pb{sup 2+}. Moreover, the aptamer probe was exploited as a recognition element for quantification of Pb{sup 2+} in homogeneous solution. The change in FA showed a linear response to Pb{sup 2+} from 10 nM to 2.0 μM, with 1.0 nM limit of detection. In addition, this sensing system exhibited good selectivity for Pb{sup 2+} over other metal ions. The method is simple

  18. Folding of guanine quadruplex molecules-funnel-like mechanism or kinetic partitioning? An overview from MD simulation studies

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.

    2017-01-01

    Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

  19. Chelerythrine down regulates expression of VEGFA, BCL2 and KRAS by arresting G-Quadruplex structures at their promoter regions

    Science.gov (United States)

    Jana, Jagannath; Mondal, Soma; Bhattacharjee, Payel; Sengupta, Pallabi; Roychowdhury, Tanaya; Saha, Pranay; Kundu, Pallob; Chatterjee, Subhrangsu

    2017-01-01

    A putative anticancer plant alkaloid, Chelerythrine binds to G-quadruplexes at promoters of VEGFA, BCL2 and KRAS genes and down regulates their expression. The association of Chelerythrine to G-quadruplex at the promoters of these oncogenes were monitored using UV absorption spectroscopy, fluorescence anisotropy, circular dichroism spectroscopy, CD melting, isothermal titration calorimetry, molecular dynamics simulation and quantitative RT-PCR technique. The pronounced hypochromism accompanied by red shifts in UV absorption spectroscopy in conjunction with ethidium bromide displacement assay indicates end stacking mode of interaction of Chelerythrine with the corresponding G-quadruplex structures. An increase in fluorescence anisotropy and CD melting temperature of Chelerythrine-quadruplex complex revealed the formation of stable Chelerythrine-quadruplex complex. Isothermal titration calorimetry data confirmed that Chelerythrine-quadruplex complex formation is thermodynamically favourable. Results of quantative RT-PCR experiment in combination with luciferase assay showed that Chelerythrine treatment to MCF7 breast cancer cells effectively down regulated transcript level of all three genes, suggesting that Chelerythrine efficiently binds to in cellulo quadruplex motifs. MD simulation provides the molecular picture showing interaction between Chelerythrine and G-quadruplex. Binding of Chelerythrine with BCL2, VEGFA and KRAS genes involved in evasion, angiogenesis and self sufficiency of cancer cells provides a new insight for the development of future therapeutics against cancer.

  20. Intramolecular Barbier reaction in water: cyclopentane and cyclohexane ring closure

    Directory of Open Access Journals (Sweden)

    RADOMIR N. SAICIC

    2002-03-01

    Full Text Available Zinc or indium promoted intramolecular Barbier reactions of aldehydes containing a suitably positioned allylic or propargylic halide unit afford unsaturated cyclic alcohols in moderate yields.

  1. Excited state Intramolecular Proton Transfer in Anthralin

    DEFF Research Database (Denmark)

    Møller, Søren; Andersen, Kristine B.; Spanget-Larsen, Jens

    1998-01-01

    Quantum chemical calculations performed on anthralin (1,8-dihydroxy-9(10H)-anthracenone) predict the possibility of an excited-state intramolecular proton transfer process. Fluorescence excitation and emission spectra of the compound dissolved in n-hexane at ambient temperature results...... in an unusually large fluorescence Stokes shift of 10500 cm−1. The emission appears as a broad band with a maximum at 17500 cm−1 and is characterized by a low and nearly temperature-independent quantum yield. The results are interpreted as an indication of a large equilibrium geometry change upon excitation...

  2. Femtosecond laser studies of ultrafast intramolecular processes

    Energy Technology Data Exchange (ETDEWEB)

    Hayden, C. [Sandia National Laboratories, Livermore, CA (United States)

    1993-12-01

    The goal of this research is to better understand the detailed mechanisms of chemical reactions by observing, directly in time, the dynamics of fundamental chemical processes. In this work femtosecond laser pulses are used to initiate chemical processes and follow the progress of these processes in time. The authors are currently studying ultrafast internal conversion and subsequent intramolecular relaxation in unsaturated hydrocarbons. In addition, the authors are developing nonlinear optical techniques to prepare and monitor the time evolution of specific vibrational motions in ground electronic state molecules.

  3. Intramolecular energy transfer reactions in polymetallic

    Energy Technology Data Exchange (ETDEWEB)

    Petersen, J.

    1990-11-01

    This report is concerned with intramolecular, energy-transfer reactions. The concept of preparing synthetically a complex molecular species, capable of absorbing a photon at one metal center (antenna fragment), transferring that energy to a second metal center (reactive fragment) via a bridging ligand was first reported by our group in 1979. It is now apparent that a major emphasis in inorganic chemistry in the future will involve these types of molecular ensembles. Complexes discussed include Rh, Ru, and Cu complexes. 23 refs., 14 tabs.

  4. G-quadruplex induced chirality of methylazacalix[6]pyridine via unprecedented binding stoichiometry: en route to multiplex controlled molecular switch

    Science.gov (United States)

    Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan

    2015-05-01

    Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.

  5. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization.

    Science.gov (United States)

    Dhapola, Parashar; Chowdhury, Shantanu

    2016-07-08

    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Fast and versatile microwave-assisted intramolecular Heck reaction in peptide macrocyclization using microwave energy.

    Science.gov (United States)

    Byk, Gerardo; Cohen-Ohana, Mirit; Raichman, Daniel

    2006-01-01

    We have revisited the intramolecular Heck reaction and investigated the microwave-assisted macrocyclization on preformed peptides using a model series of ring-varying peptides acryloyl-Gly-[Gly](n)-Phe(4-I)NHR; n = 0-4. The method was applied to both solution and solid supported cyclizations. We demonstrate that the intramolecular Heck reaction can be performed in peptides both in solution and solid support using a modified domestic microwave within 1 to 30 minutes in DMF under reflux with moderate yields ranging from 15 to 25% for a scale between 2-45 mg of linear precursors. The approach was applied to the synthesis of a constrained biologically relevant peptidomimetic bearing an Arg-Gly-Asp (RGD) sequence. These results make the microwave-assisted Heck reaction an attractive renovated approach for peptidomimetics. Copyright 2006 Wiley Periodicals, Inc.

  7. Synthesis of New DNA G-Quadruplex Constructs with Anthraquinone Insertions and Their Anticoagulant Activity

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2016-01-01

    anthraquinone linker led to a significant stabilization of the G-quadruplex structure upon replacing a T in each of two neighboring lateral TT loops and a 26.28 increase in thermal melting temperature was found. CD Spectra of the modified quadruplexes confirmed anti-parallel conformations in all cases under...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...... in the TGT loop showed improved anticoagulant activities. Molecular modeling studies explained the increased thermal melting temperatures of anthraquinone-modified G-quadruplexes....

  8. A novel quadruplex real-time PCR method for simultaneous detection of Cry2Ae and two genetically modified cotton events (GHB119 and T304-40)

    Science.gov (United States)

    2014-01-01

    Background To date, over 150 genetically modified (GM) crops are widely cultivated. To comply with regulations developed for genetically modified organisms (GMOs), including labeling policies, many detection methods for GMO identification and quantification have been developed. Results To detect the entrance and exit of unauthorized GM crop events in China, we developed a novel quadruplex real-time PCR method for simultaneous detection and quantification of GM cotton events GHB119 and T304-40 in cotton-derived products (based on the 5′-flanking sequence) and the insect-resistance gene Cry2Ae. The limit of detection was 10 copies for GHB119 and Cry2Ae and 25 copies for T304-40. The limit of quantification was 25 copies for GHB119 and Cry2Ae and 50 copies for T304-40. Moreover, low bias and acceptable standard deviation and relative standard deviation values were obtained in quantification analysis of six blind samples containing different GHB119 and T304-40 ingredients. Conclusions The developed quadruplex quantitative method could be used for quantitative detection of two GM cotton events (GHB119 and T304-40) and Cry2Ae gene ingredient in cotton derived products. PMID:24884946

  9. A novel quadruplex real-time PCR method for simultaneous detection of Cry2Ae and two genetically modified cotton events (GHB119 and T304-40).

    Science.gov (United States)

    Li, Xiang; Wang, Xiuxiu; Yang, Jielin; Liu, Yueming; He, Yuping; Pan, Liangwen

    2014-05-16

    To date, over 150 genetically modified (GM) crops are widely cultivated. To comply with regulations developed for genetically modified organisms (GMOs), including labeling policies, many detection methods for GMO identification and quantification have been developed. To detect the entrance and exit of unauthorized GM crop events in China, we developed a novel quadruplex real-time PCR method for simultaneous detection and quantification of GM cotton events GHB119 and T304-40 in cotton-derived products (based on the 5'-flanking sequence) and the insect-resistance gene Cry2Ae. The limit of detection was 10 copies for GHB119 and Cry2Ae and 25 copies for T304-40. The limit of quantification was 25 copies for GHB119 and Cry2Ae and 50 copies for T304-40. Moreover, low bias and acceptable standard deviation and relative standard deviation values were obtained in quantification analysis of six blind samples containing different GHB119 and T304-40 ingredients. The developed quadruplex quantitative method could be used for quantitative detection of two GM cotton events (GHB119 and T304-40) and Cry2Ae gene ingredient in cotton derived products.

  10. Plastic roles of phenylalanine and tyrosine residues of TLS/FUS in complex formation with the G-quadruplexes of telomeric DNA and TERRA.

    Science.gov (United States)

    Kondo, Keiko; Mashima, Tsukasa; Oyoshi, Takanori; Yagi, Ryota; Kurokawa, Riki; Kobayashi, Naohiro; Nagata, Takashi; Katahira, Masato

    2018-02-12

    The length of a telomere is regulated via elongation and shortening processes. Telomeric DNA and telomeric repeat-containing RNA (TERRA), which both contain G-rich repeated sequences, form G-quadruplex structures. Previously, translocated in liposarcoma (TLS) protein, also known as fused in sarcoma (FUS) protein, was found to form a ternary complex with the G-quadruplex structures of telomeric DNA and TERRA. We then showed that the third RGG motif of TLS, the RGG3 domain, is responsible for the complex formation. However, the structural basis for their binding remains obscure. Here, NMR-based binding assaying revealed the interactions in the binary and ternary complexes of RGG3 with telomeric DNA or/and TERRA. In the ternary complex, tyrosine bound exclusively to TERRA, while phenylalanine bound exclusively to telomeric DNA. Thus, tyrosine and phenylalanine each play a central role in the recognition of TERRA and telomeric DNA, respectively. Surprisingly in the binary complexes, RGG3 used both tyrosine and phenylalanine residues to bind to either TERRA or telomeric DNA. We propose that the plastic roles of tyrosine and phenylalanine are important for RGG3 to efficiently form the ternary complex, and thereby regulate the telomere shortening.

  11. Influence of Intramolecular Charge Transfer and Nuclear Quantum Effects on Intramolecular Hydrogen Bonds in Azopyrimidines.

    Science.gov (United States)

    Bártová, Kateřina; Čechová, Lucie; Procházková, Eliška; Socha, Ondřej; Janeba, Zlatko; Dračínský, Martin

    2017-10-06

    Intramolecular hydrogen bonds (IMHBs) in 5-azopyrimidines are investigated by NMR spectroscopy and DFT computations that involve nuclear quantum effects. A series of substituted 5-phenylazopyrimidines with one or two hydrogen bond donors able to form IMHBs with the azo group is prepared by azo coupling. The barrier of interconversion between two rotamers of the compounds with two possible IMHBs is determined by variable temperature NMR spectroscopy and it is demonstrated that the barrier is significantly affected by intramolecular charge transfer. Through-hydrogen-bond scalar coupling is investigated in 15 N labeled compounds and the stability of the IMHBs is correlated with experimental NMR parameters and rationalized by path integral molecular dynamics simulations that involve nuclear quantum effects. Detailed information on the hydrogen bond geometry upon hydrogen-to-deuterium isotope exchange is obtained from a comparison of experimental and calculated NMR data.

  12. G-Quadruplex Identification in the Genome of Protozoan Parasites Points to Naphthalene Diimide Ligands as New Antiparasitic Agents.

    Science.gov (United States)

    Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos

    2018-02-08

    G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.

  13. Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch

    Czech Academy of Sciences Publication Activity Database

    Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.

    2017-01-01

    Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  14. Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis

    2017-01-01

    Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016

  15. Triplex intermediates in folding of human telomeric quadruplexes probed by microsecond-scale molecular dynamics simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

    105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G- DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014

  16. Mechanochemical properties of individual human telomeric RNA (TERRA) G-quadruplexes.

    Science.gov (United States)

    Yangyuoru, Philip M; Zhang, Amy Y Q; Shi, Zhe; Koirala, Deepak; Balasubramanian, Shankar; Mao, Hanbin

    2013-10-11

    Potential functions: By following the unfolding and refolding of individual human RNA telomeric (TERRA) G-quadruplexes (GQs) in laser tweezers, the mechanical stability and transition kinetics of RNA GQs are obtained. Comparison between TERRA and DNA GQs suggests their different regulatory capacities for processes associated with human telomeres. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Guanine Bases in DNA G-Quadruplex Adopt Nonplanar Geometries Owing to Solvation and Base Pairing

    Czech Academy of Sciences Publication Activity Database

    Sychrovský, Vladimír; Sochorová Vokáčová, Zuzana; Trantírek, L.

    2012-01-01

    Roč. 116, č. 16 (2012), s. 4144-4151 ISSN 1089-5639 R&D Projects: GA ČR GAP205/10/0228 Institutional research plan: CEZ:AV0Z40550506 Keywords : pyramidalization * nonplanarity * G-quadruplex * DNA * solvent effect Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.771, year: 2012

  18. Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence

    Science.gov (United States)

    Tawani, Arpita; Kumar, Amit

    2015-01-01

    Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543

  19. Fluorescence and Intramolecular Energy Transfer in Polyphenylene Dendrimers

    NARCIS (Netherlands)

    Liu, Daojun; Feyter, Steven De; Cotlet, Mircea; Stefan, Alina; Wiesler, Uwe-Martin; Herrmann, Andreas; Grebel-Koehler, Dörthe; Qu, Jianqiang; Müllen, Klaus; Schryver, Frans C. De

    2003-01-01

    The fluorescence of polyphenylene dendrimers and the intramolecular energy transfer in polyphenylene dendrimers containing a perylenediimide core have been investigated in this paper. Polyphenylene dendrimers composed of tens or hundreds of out-of-plane twisted phenyl units exhibit strong

  20. Intramolecularly Hydrogen-Bonded Polypyrroles as Electro-Optical Sensors

    National Research Council Canada - National Science Library

    Nicholson, Jesse

    2001-01-01

    We have developed a new class of polypyrroles bearing both hydrogen-bond acceptor and hydrogen-donor groups such that the intramolecular hydrogen bonding holds the system planar enhancing conjugation...

  1. UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA

    International Nuclear Information System (INIS)

    Das, Anubrata; Misra, H.S.

    2015-01-01

    Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)

  2. Tetrazolylpyrene unnatural nucleoside as a human telomeric multimeric G-quadruplex selective switch-on fluorescent sensor.

    Science.gov (United States)

    Bag, Subhendu Sekhar; Pradhan, Manoj Kumar; Talukdar, Sangita

    2017-12-13

    We report herein the specific sensing of dimeric H45 G-quadruplex DNA via a fluorescence light-up response using fluorescent tetrazolylpyrene nucleoside ( TzPy B Do ) as a probe. The strong binding of the probe via an intercalative stacking interaction inside the connecting loop of two G-quadruplex units of H45 and the discrimination to other monomeric and long DNA duplexes are accompanied by a drastic enhancement of the emission intensity without compromising the conformation and stability.

  3. Specific Stabilization of c-MYC and c-KIT G-Quadruplex DNA Structures by Indolylmethyleneindanone Scaffolds.

    Science.gov (United States)

    Diveshkumar, K V; Sakrikar, Saaz; Rosu, Frédéric; Harikrishna, S; Gabelica, Valérie; Pradeepkumar, P I

    2016-06-28

    Stabilization of G-quadruplex DNA structures by small molecules has emerged as a promising strategy for the development of anticancer drugs. Since G-quadruplex structures can adopt various topologies, attaining specific stabilization of a G-quadruplex topology to halt a particular biological process is daunting. To achieve this, we have designed and synthesized simple structural scaffolds based on an indolylmethyleneindanone pharmacophore, which can specifically stabilize the parallel topology of promoter quadruplex DNAs (c-MYC, c-KIT1, and c-KIT2), when compared to various topologies of telomeric and duplex DNAs. The lead ligands (InEt2 and InPr2) are water-soluble and meet a number of desirable criteria for a small molecule drug. Highly specific induction and stabilization of the c-MYC and c-KIT quadruplex DNAs (ΔT1/2 up to 24 °C) over telomeric and duplex DNAs (ΔT1/2 ∼ 3.2 °C) by these ligands were further validated by isothermal titration calorimetry and electrospray ionization mass spectrometry experiments (Ka ∼ 10(5) to 10(6) M(-1)). Low IC50 (∼2 μM) values were emerged for these ligands from a Taq DNA polymerase stop assay with the c-MYC quadruplex forming template, whereas the telomeric DNA template showed IC50 values >120 μM. Molecular modeling and dynamics studies demonstrated the 5'- and 3'-end stacking modes for these ligands. Overall, these results demonstrate that among the >1000 quadruplex stabilizing ligands reported so far, the indolylmethyleneindanone scaffolds stand out in terms of target specificity and structural simplicity and therefore offer a new paradigm in topology specific G-quadruplex targeting for potential therapeutic and diagnostic applications.

  4. Formation pathways of a guanine-quadruplex DNA revealed by molecular dynamics and thermodynamic analysis of the substates

    Czech Academy of Sciences Publication Activity Database

    Štefl, R.; Cheatham III, T. E.; Špačková, Naďa; Fadrná, E.; Berger, I.; Koča, J.; Šponer, Jiří

    2003-01-01

    Roč. 85, č. 3 (2003), s. 1787-1804 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Science Foundation(US) CDA9601580; GA FRVŠ(CZ) G604; Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : guanine quadruplex * quadruplex formation * molecular dynamics simulations Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  5. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    Science.gov (United States)

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. G-quadruplex recognition activities of E. Coli MutS

    Directory of Open Access Journals (Sweden)

    Ehrat Edward A

    2012-07-01

    Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.

  7. Extratelomeric Binding of the Telomere Binding Protein TRF2 at the PCGF3 Promoter Is G-Quadruplex Motif-Dependent.

    Science.gov (United States)

    Purohit, Gunjan; Mukherjee, Ananda Kishor; Sharma, Shalu; Chowdhury, Shantanu

    2018-04-11

    Telomere repeat binding factor 2 (TRF2) is critical for the protection of chromosome ends. Mounting evidence suggests that TRF2 associates with extratelomeric sites and TRF2 functions may not be limited to telomeres. Here, we show that the PCGF3 promoter harbors a sequence capable of forming the DNA secondary structure G-quadruplex motif, which is required for binding of TRF2 at the PCGF3 promoter. We demonstrate that promoter binding by TRF2 mediates PCGF3 promoter activity, and both the N-terminal and C-terminal domains of TRF2 are necessary for promoter activity. Altogether, this shows for the first time that a telomere binding factor may regulate a component of the polycomb group of proteins.

  8. Investigation of spectral conversion of d(TTAGGG)4 and d(TTAGGG)13 upon potassium titration by a G-quadruplex recognizer BMVC molecule.

    Science.gov (United States)

    Chang, Cheng-Chung; Chien, Chih-Wei; Lin, Yi-Hsueh; Kang, Chi-Chih; Chang, Ta-Chau

    2007-01-01

    We have introduced a G-quadruplex-binding ligand, 3,6-bis(1-methyl-4-vinylpyridinium)carbazole diiodide (BMVC), to verify the major structure of d(T2AG3)4 (H24) in potassium solution and examine the structural conversion of H24 in sodium solution upon potassium titration. The studies of circular dichroism, induced circular dichroism, spectral titration and gel competition have allowed us to determine the binding mode and binding ratio of BMVC to the H24 in solution and eliminate the parallel form as the major G-quadruplex structure. Although the mixed-type form could not be eliminated as a main component, the basket and chair forms are more likely the main components of H24 in potassium solution. In addition, the circular dichroism spectra and the job plots reveal that a longer telomeric sequence d(T2AG3)13 (H78) could form two units of G4 structure both in sodium or potassium solutions. Of particular interest is that no appreciable change on the induced circular dichroism spectra of BMVC is found during the change of the circular dichroism patterns of H24 upon potassium titration. Considering similar spectral conversion detected for H24 and a long sequence H78 together with the G4 structure stabilized by BMVC, it is therefore unlikely that the rapid spectral conversion of H24 and H78 is due to structural change between different types of the G4 structures. With reference to the circular dichroism spectra of d(GAA)7 and d(GAAA)5, we suggest that the spectral conversion of H24 upon potassium titration is attributed to fast ion exchange resulting in different loop base interaction and various hydrogen bonding effects.

  9. Design, Synthesis and Biological Evaluation of New Substituted Diquinolinyl-Pyridine Ligands as Anticancer Agents by Targeting G-Quadruplex.

    Science.gov (United States)

    Das, Rabindra Nath; Chevret, Edith; Desplat, Vanessa; Rubio, Sandra; Mergny, Jean-Louis; Guillon, Jean

    2017-12-30

    G-quadruplexes (G4) are stacked non-canonical nucleic acid structures found in specific G-rich DNA or RNA sequences in the human genome. G4 structures are liable for various biological functions; transcription, translation, cell aging as well as diseases such as cancer. These structures are therefore considered as important targets for the development of anticancer agents. Small organic heterocyclic molecules are well known to target and stabilize G4 structures. In this article, we have designed and synthesized 2,6-di-(4-carbamoyl-2-quinolyl)pyridine derivatives and their ability to stabilize G4-structures have been determined through the FRET melting assay. It has been established that these ligands are selective for G4 over duplexes and show a preference for the parallel conformation. Next, telomerase inhibition ability has been assessed using three cell lines (K562, MyLa and MV-4-11) and telomerase activity is no longer detected at 0.1 μM concentration for the most potent ligand 1c . The most promising G4 ligands were also tested for antiproliferative activity against the two human myeloid leukaemia cell lines, HL60 and K562.

  10. Templated Formation of Discrete RNA and DNA:RNA Hybrid G-Quadruplexes and Their Interactions with Targeting Ligands.

    Science.gov (United States)

    Bonnat, Laureen; Dejeu, Jérôme; Bonnet, Hugues; Génnaro, Béatrice; Jarjayes, Olivier; Thomas, Fabrice; Lavergne, Thomas; Defrancq, Eric

    2016-02-24

    G-rich RNA and DNA oligonucleotides derived from the human telomeric sequence were assembled onto addressable cyclopeptide platforms through oxime ligations and copper-catalyzed azide-alkyne cycloaddition (CuAAc) reactions. The resulting conjugates were able to fold into highly stable RNA and DNA:RNA hybrid G-quadruplex (G4) architectures as demonstrated by UV, circular dichroism (CD), and NMR spectroscopic analysis. Whereas rationally designed parallel RNA and DNA:RNA hybrid G4 topologies could be obtained, we could not force the formation of an antiparallel RNA G4 structure, thus supporting the idea that this topology is strongly disfavored. The binding affinities of four representative G4 ligands toward the discrete RNA and DNA:RNA hybrid G4 topologies were compared to the one obtained with the corresponding DNA G4 structure. Surface plasmon resonance (SPR) binding analysis suggests that the accessibility to G4 recognition elements is different among the three structures and supports the idea that G4 ligands might be shaped to achieve structure selectivity in a biological context. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

    Science.gov (United States)

    Ray, Sujay

    Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We

  12. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP

    Czech Academy of Sciences Publication Activity Database

    Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.

    2014-01-01

    Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single - stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  13. Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela

    2009-01-01

    Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009

  14. G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression

    Czech Academy of Sciences Publication Activity Database

    Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela

    2017-01-01

    Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016

  15. Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif.

    Science.gov (United States)

    Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen

    2010-08-21

    A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

  16. Synthesis, Binding and Antiviral Properties of Potent Core-Extended Naphthalene Diimides Targeting the HIV-1 Long Terminal Repeat Promoter G-Quadruplexes.

    Science.gov (United States)

    Perrone, Rosalba; Doria, Filippo; Butovskaya, Elena; Frasson, Ilaria; Botti, Silvia; Scalabrin, Matteo; Lago, Sara; Grande, Vincenzo; Nadai, Matteo; Freccero, Mauro; Richter, Sara N

    2015-12-24

    We have previously reported that stabilization of the G-quadruplex structures in the HIV-1 long terminal repeat (LTR) promoter suppresses viral transcription. Here we sought to develop new G-quadruplex ligands to be exploited as antiviral compounds by enhancing binding toward the viral G-quadruplex structures. We synthesized naphthalene diimide derivatives with a lateral expansion of the aromatic core. The new compounds were able to bind/stabilize the G-quadruplex to a high extent, and some of them displayed clear-cut selectivity toward the viral G-quadruplexes with respect to the human telomeric G-quadruplexes. This feature translated into low nanomolar anti-HIV-1 activity toward two viral strains and encouraging selectivity indexes. The selectivity depended on specific recognition of LTR loop residues; the mechanism of action was ascribed to inhibition of LTR promoter activity in cells. This is the first example of G-quadruplex ligands that show increased selectivity toward the viral G-quadruplexes and display remarkable antiviral activity.

  17. Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.

    Science.gov (United States)

    Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij

    2015-12-02

    Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    Science.gov (United States)

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  19. Thermal stabilisation of RNA·RNA duplexes and G-quadruplexes by phosphorothiolate linkages.

    Science.gov (United States)

    Piperakis, Michael M; Gaynor, James W; Fisher, Julie; Cosstick, Richard

    2013-02-14

    The effect of 3'-S-phosphorothiolate linkages on the stability of RNA·RNA duplexes and G-quadruplex structures has been studied. 3'-Thio-2'-deoxyuridine was incorporated into RNA duplexes and thermal melting studies revealed that the resulting 3'-S-phosphorothiolate linkages increased the stability of the duplex to thermal denaturation. Additionally, and contrary to expectation, a similar effect on duplex stability was observed when the same thionucleoside was incorporated into the RNA strand of a RNA·DNA duplex. A suitably protected derivative of 3'-thio-2'-deoxyguanosine was prepared using an oxidation-reduction strategy and this residue also increased the thermal stability the [d(TGGGGT)](4) G-quadruplex when positioned centrally. The results are discussed in terms of the influence that the sulfur atom has on the conformation of the furanose ring and imply that the previously noted high thermal stability of parallel RNA quadruplexes is not derived from H-bonding interactions of the 2'-hydroxyl group, but can be attributed to conformational effects.

  20. The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

    Science.gov (United States)

    Zaccaria, F; Paragi, G; Fonseca Guerra, C

    2016-08-21

    The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

  1. Biophysical Characterization of G-Quadruplex Recognition in the PITX1 mRNA by the Specificity Domain of the Helicase RHAU.

    Directory of Open Access Journals (Sweden)

    Emmanuel O Ariyo

    Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.

  2. Evaluation of intramolecular charge transfer state of 4-N, N ...

    Indian Academy of Sciences (India)

    intermediate charge transfer (TICT) model.2 Evidence suggests that the intramolecular TICT process from a donor to an acceptor could be achieved by a twist- ing motion of the donor moiety that promotes initially generated locally excited (LE) state to an energeti- cally relaxed charge transfer state (CT).2–6,8,13 Besides.

  3. Excited state intramolecular charge transfer reaction in 4-(1 ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Excited state intramolecular charge transfer reaction of 4-(1-azetidinyl) benzonitrile (P4C) in deuterated and normal methanol, ethanol and acetonitrile has been studied in order to investigate the solvent isotope effects on reaction rates and yields. These quantities (reaction rates and yields) along with several.

  4. Excited state intramolecular charge transfer reaction of 4 ...

    Indian Academy of Sciences (India)

    An intramolecular charge transfer (ICT) molecule with an extra hetero atom in its donor moiety has been synthesized in order to investigate how ICT reaction is affected by hetero atom replacement. Photo-physical and photo-dynamical properties of this molecule, 4-(morpholenyl)benzonitrile (M6C), have been studied in 20 ...

  5. Preparation of CN x /Carbon Nanotube Intramolecular Junctions by ...

    African Journals Online (AJOL)

    Preparation of CN x /Carbon Nanotube Intramolecular Junctions by Switching Gas Sources in Continuous Chemical Vapour Deposition. ... nanotubes were observed, and such different structures at both sides of the junctions indicated some interesting properties and offered potential applications for future nanodevices.

  6. and Di-hydration on the Intramolecular Proton Transfers and ...

    Indian Academy of Sciences (India)

    of the isomers did not change the stability trend, so that the tri-keto isomer was the most stable isomer among the hydrated and non-hydrated isomers. The activation energies (Ea) of the intramolecular proton transfers. (tautomerisms) and energy barriers of H-rotations around its C-O axis in enolic isomers were calculated.

  7. The intramolecular electron transfer between copper sites of nitrite reductase

    DEFF Research Database (Denmark)

    Farver, O; Eady, R R; Abraham, Z H

    1998-01-01

    The intramolecular electron transfer (ET) between the type 1 Cu(I) and the type 2 Cu(II) sites of Alcaligenes xylosoxidans dissimilatory nitrite reductase (AxNiR) has been studied in order to compare it with the analogous process taking place in ascorbate oxidase (AO). This internal process is in...

  8. Excited state intramolecular charge transfer reaction in 4-(1 ...

    Indian Academy of Sciences (India)

    Excited state intramolecular charge transfer reaction of 4-(1-azetidinyl) benzonitrile (P4C) in deuterated and normal methanol, ethanol and acetonitrile has been studied in order to investigate the solvent isotope effects on reaction rates and yields. These quantities (reaction rates and yields) along with several other ...

  9. Effects of acid concentration on intramolecular charge transfer ...

    Indian Academy of Sciences (India)

    of P4C molecule.7 Temperature-assisted aggregation of alcohol has also been observed by following the fluo- rescence response of the same solute.20 Electrolyte- induced modulation of intramolecular charge transfer rate of P4C molecule in pure solvent has been explored and a non-monotonic dependence observed.18.

  10. Dual Binding of an Antibody and a Small Molecule Increases the Stability of TERRA G-Quadruplex.

    Science.gov (United States)

    Yangyuoru, Philip M; Di Antonio, Marco; Ghimire, Chiran; Biffi, Giulia; Balasubramanian, Shankar; Mao, Hanbin

    2015-01-12

    In investigating the binding interactions between the human telomeric RNA (TERRA) G-quadruplex (GQ) and its ligands, it was found that the small molecule carboxypyridostatin (cPDS) and the GQ-selective antibody BG4 simultaneously bind the TERRA GQ. We previously showed that the overall binding affinity of BG4 for RNA GQs is not significantly affected in the presence of cPDS. However, single-molecule mechanical unfolding experiments revealed a population (48 %) with substantially increased mechanical and thermodynamic stability. Force-jump kinetic investigations suggested competitive binding of cPDS and BG4 to the TERRA GQ. Following this, the two bound ligands slowly rearrange, thereby leading to the minor population with increased stability. Given the relevance of G-quadruplexes in the regulation of biological processes, we anticipate that the unprecedented conformational rearrangement observed in the TERRA-GQ-ligand complex may inspire new strategies for the selective stabilization of G-quadruplexes in cells.

  11. G-quadruplex and calf thymus DNA interaction of quaternized tetra and octa pyridyloxy substituted indium (III) phthalocyanines.

    Science.gov (United States)

    Bağda, Efkan; Bağda, Esra; Durmuş, Mahmut

    2017-10-01

    The interactions of small molecules with G-quadruplex and double stranded DNA are important due to their potential biological and medical usages. In the present paper, the interactions of indium (III) phthalocyanines (quaternized 2,3,9,10,16,17,23,24-octakis-[(3-pyridyloxy) phthalocyaninato] chloroindium(III): OInPc and quaternized 2(3),9(10),16(17),23(24)-tetrakis-[(3-pyridyloxy) phthalocyaninato] chloroindium(III): TInPc) with hybrid G-quadruplex (Tel 21) and parallel G-quadruplexes (nucleolin, KRAS, c-MYC, vegf) were studied. The interactions of these phthalocyanines with ctDNA were also investigated. These interactions were measured by different spectroscopic techniques such as UV-Vis, fluorescence and circular dichroism. The UV-Vis spectroscopic data treated with Benesi-Hildebrand equation and Benesi-Hildebrand constants (K BH ) were calculated. These constants were found higher for octa peripheral pyridyloxy substituted phthalocyanine, OInPc. Besides, UV-Vis analysis showed that the interaction of G-quadruplexes with tetra peripheral pyridyloxy substituted phthalocyanine derivative (TInPc) resulted in removal of central indium (III) atom from the cavity of phthalocyanine macrocycle. The UV-Vis melting studies as well as fluorescence replacement techniques were also employed for clarification of mechanism. The binding mode of molecules with ct DNA was also supported with viscosity measurements. From the results, the stabilization and destabilization of G-quadruplex depending on the concentration of the OInPc and TInPc showed that these two indium (III) phthalocyanines have the potential of both the elucidation role of G-quadruplexes in gene expression and the usage in cancer therapy. Copyright © 2017. Published by Elsevier B.V.

  12. Excited state intramolecular proton transfer in some tautomeric azo dyes and Schiff bases containing an intramolecular hydrogen bond

    NARCIS (Netherlands)

    Joshi, H.C.; Kamounah, F.S.; Gooijer, C.; van der Zwan, G.; Antonov, L.

    2002-01-01

    Photophysical properties of several basically important aromatic azodyes (1-phenylazo-2-naphthol and 2-phenylazo-1-naphthol) and Schiff bases (N-(2-hydroxy-1-naphthylmethylidene) aniline and N-(1-hydroxy-2-naphthylmethylidene) aniline) all containing an intramolecular hydrogen bond were studied by

  13. Real-time and quantitative fluorescent live-cell imaging with quadruplex-specific red-edge probe (G4-REP).

    Science.gov (United States)

    Yang, Sunny Y; Amor, Souheila; Laguerre, Aurélien; Wong, Judy M Y; Monchaud, David

    2017-05-01

    The development of quadruplex-directed molecular diagnostic and therapy rely on mechanistic insights gained at both cellular and tissue levels by fluorescence imaging. This technique is based on fluorescent reporters that label cellular DNA and RNA quadruplexes to spatiotemporally address their complex cell biology. The photophysical characteristics of quadruplex probes usually dictate the modality of cell imaging by governing the selection of the light source (lamp, LED, laser), the optical light filters and the detection modality. Here, we report the characterizations of prototype from a new generation of quadruplex dye termed G4-REP (for quadruplex-specific red-edge probe) that provides fluorescence responses regardless of the excitation wavelength and modality (owing to the versatility gained through the red-edge effect), thus allowing for diverse applications and most imaging facilities. This is demonstrated by cell images (and associated quantifications) collected through confocal and multiphoton microscopy as well as through real-time live-cell imaging system over extended period, monitoring both non-cancerous and cancerous human cell lines. Our results promote a new way of designing versatile, efficient and convenient quadruplex-reporting dyes for tracking these higher-order nucleic acid structures in living human cells. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. ESI-MS Investigation of an Equilibrium between a Bimolecular Quadruplex DNA and a Duplex DNA/RNA Hybrid.

    Science.gov (United States)

    Birrento, Monica L; Bryan, Tracy M; Samosorn, Siritron; Beck, Jennifer L

    2015-07-01

    Electrospray ionization mass spectrometry (ESI-MS) conditions were optimized for simultaneous observation of a bimolecular qDNA and a Watson-Crick base-paired duplex DNA/RNA hybrid. The DNA sequence used was telomeric DNA, and the RNA contained the template for telomerase-mediated telomeric DNA synthesis. Addition of RNA to the quadruplex DNA (qDNA) resulted in formation of the duplex DNA/RNA hybrid. Melting profiles obtained using circular dichroism spectroscopy confirmed that the DNA/RNA hybrid exhibited greater thermal stability than the bimolecular qDNA in solution. Binding of a 13-substituted berberine (1) derivative to the bimolecular qDNA stabilized its structure as evidenced by an increase in its stability in the mass spectrometer, and an increase in its circular dichroism (CD) melting temperature of 10°C. The DNA/RNA hybrid did not bind the ligand extensively and its thermal stability was unchanged in the presence of (1). The qDNA-ligand complex resisted unfolding in the presence of excess RNA, limiting the formation of the DNA/RNA hybrid. Previously, it has been proposed that DNA secondary structures, such as qDNA, may be involved in the telomerase mechanism. DNA/RNA hybrid structures occur at the active site of telomerase. The results presented in the current work show that if telomeric DNA was folded into a qDNA structure, it is possible for a DNA/RNA hybrid to form as is required during template alignment. The discrimination of ligand (1) for binding to the bimolecular qDNA over the DNA/RNA hybrid positions it as a useful compound for probing the role(s), if any, of antiparallel qDNA in the telomerase mechanism.

  15. GTP binding to the ROC domain of DAP-kinase regulates its function through intramolecular signalling

    Science.gov (United States)

    Carlessi, Rodrigo; Levin-Salomon, Vered; Ciprut, Sara; Bialik, Shani; Berissi, Hanna; Albeck, Shira; Peleg, Yoav; Kimchi, Adi

    2011-01-01

    Death-associated protein kinase (DAPk) was recently suggested by sequence homology to be a member of the ROCO family of proteins. Here, we show that DAPk has a functional ROC (Ras of complex proteins) domain that mediates homo-oligomerization and GTP binding through a defined P-loop motif. Upon binding to GTP, the ROC domain negatively regulates the catalytic activity of DAPk and its cellular effects. Mechanistically, GTP binding enhances an inhibitory autophosphorylation at a distal site that suppresses kinase activity. This study presents a new mechanism of intramolecular signal transduction, by which GTP binding operates in cis to affect the catalytic activity of a distal domain in the protein. PMID:21738225

  16. Intramolecular migration of amide hydrogens in protonated peptides upon collisional activation

    DEFF Research Database (Denmark)

    Jørgensen, Thomas J D; Gårdsvoll, Henrik; Ploug, Michael

    2005-01-01

    if collision-induced dissociation (CID) should provide reliable site-specific information from (1)H/(2)H exchange experiments. We have explored a series of unique, regioselectively deuterium-labeled peptides as model systems to probe for intramolecular amide hydrogen migration under low-energy collisional...... are protected against exchange with the solvent, while the amide hydrogens of the nonbinding sequences exchange rapidly with the solvent. We have utilized such long-lived complexes to generate peptides labeled with deuterium in either the binding or nonbinding region, and the expected regioselectivity...... of this labeling was confirmed after pepsin proteolysis. CID of such deuterated peptides, [M + 2H](2+), yielded fragment ions (b- and y-ions) having a deuterium content that resemble the theoretical values calculated for 100% scrambling. Thus, complete randomization of all hydrogen atoms attached to nitrogen...

  17. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří

    2009-01-01

    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  18. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    DEFF Research Database (Denmark)

    Opazo, Felipe; Eiden, Laura; Hansen, Line

    2015-01-01

    Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma...... cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...

  19. Vibrational circular dichroism study of isotropic and liquid crystalline phases formed by guanine quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Andrushchenko, Valery; Tsankov, D.; Krasteva, M.; Wieser, H.; Bouř, Petr

    2012-01-01

    Roč. 19, č. 1 (2012), s. 3-3 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] R&D Projects: GA ČR GAP208/10/0559; GA ČR GAP208/11/0105 Grant - others:AV ČR M200550902 Institutional research plan: CEZ:AV0Z40550506 Keywords : G-quadruplexes * DNA * liquid crystals * VCD spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry

  20. Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.

    2017-01-01

    Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  1. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.

    2011-01-01

    Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011

  2. Mechanism of Intramolecular Rhodium- and Palladium-Catalyzed Alkene Alkoxyfunctionalizations

    KAUST Repository

    Vummaleti, Sai V. C.

    2015-11-13

    Density functional theory calculations have been used to investigate the reaction mechanism for the [Rh]-catalyzed intramolecular alkoxyacylation ([Rh] = [RhI(dppp)+] (dppp, 1,3-bis(diphenylphosphino)propane) and [Pd]/BPh3 dual catalytic system assisted intramolecular alkoxycyanation ([Pd] = Pd-Xantphos) using acylated and cyanated 2-allylphenol derivatives as substrates, respectively. Our results substantially confirm the proposed mechanism for both [Rh]- and [Pd]/ BPh3-mediated alkoxyfunctionalizations, offering a detailed geometrical and energetical understanding of all the elementary steps. Furthermore, for the [Rh]-mediated alkoxyacylation, our observations support the hypothesis that the quinoline group of the substrate is crucial to stabilize the acyl metal complex and prevent further decarbonylation. For [Pd]/BPh3-catalyzed alkoxycyanation, our findings clarify how the Lewis acid BPh3 cocatalyst accelerates the only slow step of the reaction, corresponding to the oxidative addition of the cyanate O-CN bond to the Pd center. © 2015 American Chemical Society.

  3. Structure and Intramolecular Proton Transfer of Alanine Radical Cations

    International Nuclear Information System (INIS)

    Lee, Gab Yong

    2012-01-01

    The structures of the four lowest alanine conformers, along with their radical cations and the effect of ionization on the intramolecular proton transfer process, are studied using the density functional theory and MP2 method. The energy order of the radical cations of alanine differs from that of the corresponding neutral conformers due to changes in the basicity of the NH 2 group upon ionization. Ionization favors the intramolecular proton transfer process, leading to a proton-transferred radical-cation structure, [NH 3 + -CHCH 3 -COO·], which contrasts with the fact that a proton-transferred zwitterionic conformer is not stable for a neutral alanine in the gas phase. The energy barrier during the proton transfer process is calculated to be about 6 kcal/mol

  4. Specific Features of Intramolecular Proton Transfer Reaction in Schiff Bases

    Directory of Open Access Journals (Sweden)

    Aleksander Koll

    2003-06-01

    Full Text Available Abstract: The differences between the intramolecular proton transfer in Mannich and Schiff bases are discussed. The tautomeric forms being in equilibrium in both types of molecules are seriously different. In Mannich bases there are in equilibrium the forms of phenols and phenolates. In Schiff bases each of tautomers is strongly influenced by resonance between zwitterionic and keto structures. Despite the common opinion that the proton transfer forms in compounds with internal π-electronic coupling are mainly keto forms it is shown in this work, that in Schiff bases the content of keto structure is slightly less than zwitterionic one. Almost equal participation of both forms leads to effective resonance between them and stabilization of intramolecular hydrogen bond in this way.

  5. Intramolecular hydrogen bonding and tautomerism in Schiff bases ...

    Indian Academy of Sciences (India)

    N and keto-amine, O…H-N forms) in this series. The molecular structure of 8 has been determined crystallographically, and observed that the compound is in the form of phenol-imine, defined by the strong intramolecular [O-H…N = 1.72(3), 1.81(2) Å] hydrogen bonds. Compound 8 crystallizes in the monoclinic space group ...

  6. Guanine quadruplex monoclonal antibody 1H6 cross-reacts with restrained thymidine-rich single stranded DNA

    NARCIS (Netherlands)

    Kazemier, Hinke G.; Paeschke, Katrin; Lansdorp, Peter M.

    2017-01-01

    Previously we reported the production and characterization of monoclonal antibody 1H6 raised against (T(4)G(4))(2) intermolecular guanine quadruplex (G4) DNA structures (Henderson A. et al. (2014) Nucleic Acids Res., 42, 860-869; Hoffmann R. F. et al. (2016) Nucleic Acids Res., 44, 152-163). It was

  7. A G-quadruplex-binding compound showing anti-tumour activity in an in vivo model for pancreatic cancer

    Czech Academy of Sciences Publication Activity Database

    Ohnmacht, S.A.; Marchetti, C.; Gunaratnam, M.; Besser, R.J.; Haider, S.M.; Di Vita, G.; Lowe, H.L.; Mellinas-Gomez, M.; Diocou, S.; Robson, M.; Šponer, Jiří

    2015-01-01

    Roč. 5, JUN 2015 (2015) ISSN 2045-2322 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : NAPHTHALENE DIIMIDE LIGANDS * AMBER FORCE-FIELD * DNA G-QUADRUPLEX Subject RIV: BO - Biophysics Impact factor: 5.228, year: 2015

  8. 1,10-Phenanthroline platinum(II) complex: a simple molecule for efficient G-quadruplex stabilization.

    Science.gov (United States)

    Wang, Jin-Tao; Zheng, Xiao-Hui; Xia, Qing; Mao, Zong-Wan; Ji, Liang-Nian; Wang, Kui

    2010-08-21

    Two simple complexes [Pt(phen)(2)](PF(6))(2) and [Pt(bpy)(2)](PF(6))(2) exhibit high stabilization potential for G-quadruplex DNA with [Pt(phen)(2)](PF(6))(2) possessing higher capability due to its greater planarity.

  9. A single-molecule force-spectroscopic study on stabilization of G-quadruplex DNA by a telomerase inhibitor.

    Science.gov (United States)

    Funayama, Ryoto; Nakahara, Yoshio; Kado, Shinpei; Tanaka, Mutsuo; Kimura, Keiichi

    2014-08-21

    Single-molecule force spectroscopy was carried out using AFM force measurements for the purpose of direct observation of the stabilization of G-quadruplex DNA by a telomerase inhibitor, which is 5,10,15,20-tetrakis(N-methylpyridinium-4-yl)porphyrin tetrakis(p-toluenesulfonate) (TMPyP). In AFM force measurements, we used an AFM tip and an Au substrate modified chemically with terminal-biotinylated telomere DNA and streptavidin, respectively. The telomere DNA was fully stretched by the AFM tip based on the bridge formation between the AFM tip and the Au substrate through the streptavidin-biotin interaction. The force-extension curves, which reflected the stretching of a single DNA molecule, were distinguished from all of the curves, judging from the rupture force and the contour length. The selected curves were analyzed using a worm-like chain model, and one of the fitting parameters, persistence length (lp), was used as an index for the stabilization of the G-quadruplex structure. Consequently, the lp value was significantly increased by the addition of TMPyP under the experimental conditions where the G-quadruplex structure could be formed. On the other hand, the value was hardly changed by the addition of TMPyP under the conditions except the above. Furthermore, the methodology developed and demonstrated in this work was applied to evaluate the stabilization of G-quadruplex DNA by other telomerase inhibitors such as ethidium bromide and p-xylene-bis(N-pyridinium bromide).

  10. Can We Execute Reliable MM-PBSA Free Energy Computations of Relative Stabilities of Different Guanine Quadruplex Folds?

    Czech Academy of Sciences Publication Activity Database

    Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří

    2016-01-01

    Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR- DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016

  11. Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding

    Czech Academy of Sciences Publication Activity Database

    Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela

    2014-01-01

    Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014

  12. Target guided synthesis using DNA nano-templates for selectively assembling a G-quadruplex binding c-MYC inhibitor

    Science.gov (United States)

    Panda, Deepanjan; Saha, Puja; Das, Tania; Dash, Jyotirmayee

    2017-07-01

    The development of small molecules is essential to modulate the cellular functions of biological targets in living system. Target Guided Synthesis (TGS) approaches have been used for the identification of potent small molecules for biological targets. We herein demonstrate an innovative example of TGS using DNA nano-templates that promote Huisgen cycloaddition from an array of azide and alkyne fragments. A G-quadruplex and a control duplex DNA nano-template have been prepared by assembling the DNA structures on gold-coated magnetic nanoparticles. The DNA nano-templates facilitate the regioselective formation of 1,4-substituted triazole products, which are easily isolated by magnetic decantation. The G-quadruplex nano-template can be easily recovered and reused for five reaction cycles. The major triazole product, generated by the G-quadruplex inhibits c-MYC expression by directly targeting the c-MYC promoter G-quadruplex. This work highlights that the nano-TGS approach may serve as a valuable strategy to generate target-selective ligands for drug discovery.

  13. Discovery of selective ligands for telomeric RNA G-quadruplexes (TERRA) through 19F-NMR based fragment screening.

    Science.gov (United States)

    Garavís, Miguel; López-Méndez, Blanca; Somoza, Alvaro; Oyarzabal, Julen; Dalvit, Claudio; Villasante, Alfredo; Campos-Olivas, Ramón; González, Carlos

    2014-07-18

    Telomeric repeat-containing RNA (TERRA) is a novel and very attractive antitumoral target. Here, we report the first successful application of (19)F-NMR fragment-based screening to identify chemically diverse compounds that bind to an RNA molecule such as TERRA. We have built a library of 355 fluorinated fragments, and checked their interaction with a long telomeric RNA as a target molecule. The screening resulted in the identification of 20 hits (hit rate of 5.6%). For a number of binders, their interaction with TERRA was confirmed by (19)F- and (1)H NMR as well as by CD melting experiments. We have also explored the selectivity of the ligands for RNA G-quadruplexes and found that some of the hits do not interact with other nucleic acids such as tRNA and duplex DNA and, most importantly, favor the propeller-like parallel conformation in telomeric DNA G-quadruplexes. This suggests a selective recognition of this particular quadruplex topology and that different ligands may recognize specific sites in propeller-like parallel G-quadruplexes. Such features make some of the resulting binders promising lead compounds for fragment based drug discovery.

  14. Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.

    Science.gov (United States)

    Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro

    2009-09-16

    We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.

  15. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  16. “One Ring to Bind Them All”—Part I: The Efficiency of the Macrocyclic Scaffold for G-Quadruplex DNA Recognition

    Directory of Open Access Journals (Sweden)

    David Monchaud

    2010-01-01

    Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.

  17. “Turn-off-on” fluorescent sensor for (N-methyl-4-pyridyl) porphyrin -DNA and G-quadruplex interactions based on ZnCdSe quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Dan; Fan, Yao; Gao, Fang; Yang, Tian-ming, E-mail: tmyang@mail.scuec.edu.cn

    2015-08-12

    As a new detection model, the reversible fluorescence “turn-off-on” sensor based on quantum dots (QDs) has already been successfully employed in the detections of many biochemical materials, especially in the researches on the interactions between anticancer drugs. The previous studies, however, mainly focused on simple-structured oligonucleotides and Calf thymus DNA. G-quadruplex, an important target for anti-cancer drug with special secondary structure, has been stimulating increasing research interests. In this paper, we report a new detection method based on the fluorescence “turn-off-on” model with water-soluble ZnCdSe QDs as the fluorescent probe, to analyze the interactions between anticancer drug (N-methyl-4-pyridyl) porphyrin (TMPyP) and nucleic acid, especially the G-quadruplex. The fluorescence of QDs can be quenched by TMPyP via photo-induced electron transfer and fluorescence resonance energy transfer, while on the other hand, the combination between TMPyP and G-quadruplex releases QDs from their quenchers and thus recovers the fluorescence. Most importantly, the fluorescence “turn-off-on” model has been employed, for the first time, to analyze the impacts of special factors on the interaction between TMPyP and G-quadruplex. The excellent selectivity of the system has been verified in the studies of the interactions between TMPyP and different DNAs (double-stranded DNA, single-stranded G-quadruplex, and different types of G-quadruplexes) in Na{sup +} or K{sup +}-containing buffer. - Highlights: • Reversible fluorescence sensor was firstly used on TMPyP and G-quadruplex study. • SsDNA and various G-quadruplexes were successfully recognized by fluorescence. • The new quantum dot is hypotoxicity and can be extensively applied.

  18. Asymmetric Cationic Porphyrin as a New G-Quadruplex Probe with Wash-Free Cancer-Targeted Imaging Ability Under Acidic Microenvironments.

    Science.gov (United States)

    Zhang, Ran; Cheng, Meng; Zhang, Li-Ming; Zhu, Li-Na; Kong, De-Ming

    2018-04-16

    Porphyrins are promising candidates for nucleic acid G-quadruplex-specific optical recognition. We previously demonstrated that G-quadruplex recognition specificity of porphyrins could be improved by introducing bulky side arm substituents, but the enhanced protonation tendency limits their applications in some cases, such as under acidic conditions. Here, we demonstrated that the protonation tendency of porphyrin derivatives could be efficiently overcome by increasing molecular asymmetry. To validate this, an asymmetric, water-soluble, cationic porphyrin FA-TMPipEOPP (5-{4-[2-[[(2 E)-3-[3-methoxy-4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl]-1-oxo-2-propenyl]oxy]ethoxy]phenyl},10,15,20-tri{4-[2-(1-methyl-1-piperidinyl)ethoxy]-phenyl}porphyrin) was synthesized by introducing a ferulic acid (FA) unit at one side arm, and its structure was well-characterized. Unlike its symmetric counterpart TMPipEOPP that has a tendency to protonate under acidic conditions, FA-TMPipEOPP remained in the unprotonated monomeric form under the pH range of 2.0-8.0. Correspondingly, FA-TMPipEOPP showed better G-quadruplex recognition specificity than TMPipEOPP and thus might be used as a specific optical probe for colorimetric and fluorescent recognition of G-quadruplexes under acidic conditions. The feasibility was demonstrated by two proof-of-concept studies: probing structural competition between G-quadruplexes and duplexes and label-free and wash-free cancer cell-targeted bioimaging under an acidic tumor microenvironment. As G-quadruplex optical probes, FA-TMPipEOPP works well under acidic conditions, whereas TMPipEOPP works well under neutral conditions. This finding provides useful information for G-quadruplex probe research. That is, porphyrin-based G-quadruplex probes suitable for different pH conditions might be obtained by adjusting the molecular symmetry.

  19. Phylo-typing of clinical Escherichia coli isolates originating from bovine mastitis and canine pyometra and urinary tract infection by means of quadruplex PCR.

    Science.gov (United States)

    Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar

    2015-01-01

    Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.

  20. Structural and biochemical characterizations of an intramolecular tandem coiled coil protein.

    Science.gov (United States)

    Shin, Donghyuk; Kim, Gwanho; Kim, Gyuhee; Zheng, Xu; Kim, Yang-Gyun; Lee, Sangho

    2014-12-12

    Coiled coil has served as an excellent model system for studying protein folding and developing protein-based biomaterials. Most designed coiled coils function as oligomers, namely intermolecular coiled coils. However, less is known about structural and biochemical behavior of intramolecular coiled coils where coiled coil domains are covalently linked in one polypeptide. Here we prepare a protein which harbors three coiled coil domains with two short linkers, termed intramolecular tandem coiled coil (ITCC) and characterize its structural and biochemical behavior in solution. ITCC consists of three coiled coil domains whose sequences are derived from Coil-Ser and its domain swapped dimer. Modifications include positioning E (Glu) residue at "e" and K (Lys) at "g" positions throughout heptad repeats to enhance ionic interaction among its constituent coiled coil domains. Molecular modeling of ITCC suggests a compact triple helical bundle structure with the second and the third coiled coil domains forming a canonical coiled coil. ITCC exists as a mixture of monomeric and dimeric species in solution. Small-angle X-ray scattering reveals ellipsoidal molecular envelopes for both dimeric and monomeric ITCC in solution. The theoretically modeled structures of ITCC dock well into the envelopes of both species. Higher ionic strength shifts the equilibrium into monomer with apparently more compact structure while secondary structure remains unchanged. Taken together, our results suggest that our designed ITCC is predominantly monomeric structure through the enhanced ionic interactions, and its conformation is affected by the concentration of ionic species in the buffer. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Application to processing system using intra-molecular BRET

    Science.gov (United States)

    Otsuji, Tomomi; Okuda-Ashitaka, Emiko; Kojima, Satoshi; Akiyama, Hidehumi; Ito, Seiji; Ohmiya, Yoshihiro

    2003-07-01

    Luciferases are used as the reporter gene for promoter activity, whereas a green fluorescent protein (GFP) is used as marker for cellular function and localization. Recently, bioluminescence resonance energy transfer (BRET) between luciferase and YFP is used for analysis of inter-molecular reaction such as ligand-receptor in the living cells. The neuropeptides nocistatin (NST) and nociceptin/orphanin FQ (Noc/OFQ) are derived from the same precursor protein, while NST exhibits antagonism against Noc/OFQ-actions. In this study, we attempt an intra-molecular BRET system for monitoring dynamic biological process of the production of NST and Noc/OFQ in the living cells. At first, we constructed a fusion protein (Rluc-GFP) covalently linking luciferase (Renilla luciferase; Rluc) to Aequorea GFP as an intra-molecular BRET partner. Furthermore, we inserted constructs of mouse NST and Noc/OFQ (Rluc-m-GFP) or bovine NST and Noc/OFQ (Rluc-b-GFP) containing a proteolytic cleavage motif (Lys-Arg) within Rluc-GFP. When these constructions were transfected into Cos7 cells, all fusion proteins had luciferase activity and specific fluorescence. Luminescence spectra of Rluc-GFP, Rluc-m-GFP and Rluc-b-GFP fusion proteins with DeepBlueC as a substrate showed two peaks centered at 400 nm and 510 nm, whereas Rluc showed one peak centered at 400 nm. These results indicate that the proteolytic cleavage motif inserted fusion proteins between luciferase and GFP are available for intra-molecular BRET systems at first step.

  2. Intramolecular Hydrogen Bonding in (2-Hydroxybenzoyl)benzoylmethane Enol

    DEFF Research Database (Denmark)

    Hansen, Bjarke Knud Vilster; Winther, Morten; Spanget-Larsen, Jens

    2014-01-01

    , and the dienol form of 1,3-dibenzoylacetone. But in these examples the two H-bonds are equivalent, while in the case of OHDBM they are chemically different, involving one enolic and one phenolic hydroxy group. OHDBM is thus an interesting model compound with two competing H-bonds to the same carbonyl group......In the stable enol tautomer of the title compound (OHDBM), one carbonyl group is flanked by two β-hydroxy groups, giving rise to bifold intramolecular H-bonding. A similar situation is found in other β,β'-dihydroxy carbonyl compounds like chrysazin, anthralin, 2,2'-dihydroxybenzophenone...

  3. Recording Intramolecular Mechanics during the Manipulation of a Large Molecule

    Energy Technology Data Exchange (ETDEWEB)

    Moresco, Francesca; Meyer, Gerhard; Rieder, Karl-Heinz; Tang, Hao; Gourdon, Andre; Joachim, Christian

    2001-08-20

    The technique of single atom manipulation by means of the scanning tunneling microscope (STM) applies to the controlled displacement of large molecules. By a combined experimental and theoretical work, we show that in a constant height mode of manipulation the STM current intensity carries detailed information on the internal mechanics of the molecule when guided by the STM tip. Controlling and time following the intramolecular behavior of a large molecule on a surface is the first step towards the design of molecular tunnel-wired nanorobots.

  4. Human ceruloplasmin. Intramolecular electron transfer kinetics and equilibration

    DEFF Research Database (Denmark)

    Farver, O; Bendahl, L; Skov, L K

    1999-01-01

    Pulse radiolytic reduction of disulfide bridges in ceruloplasmin yielding RSSR(-) radicals induces a cascade of intramolecular electron transfer (ET) processes. Based on the three-dimensional structure of ceruloplasmin identification of individual kinetically active disulfide groups and type 1 (T1...... and indeed electron equilibration between T1A and the trinuclear copper center in the domain 1-6 interface takes place with a rate constant of 2.9 +/- 0.6 s(-1). The equilibrium constant is 0.17. Following reduction of T1A Cu(II), another ET process takes place between RSSR(-) and T1B copper(II) of domain 4...

  5. Intramolecularly coordinated azobenzene selenium derivatives: effect of strength of the Se···N intramolecular interaction on luminescence.

    Science.gov (United States)

    Srivastava, Kriti; Chakraborty, Tapash; Singh, Harkesh B; Butcher, Ray J

    2011-05-07

    A series of selenium derivatives (6-12) of 2-phenylazophenyl have been synthesized using o-lithiation route. The effect of the strength of the intramolecular Se···N interaction on the absorption spectra as well as emission spectra has been studied. The studies suggest that the secondary bonding Se···N interaction give rise to fluorescence, however, the strength of Se···N interaction cannot be directly correlated with the intensity of the fluorescence. TD-DFT calculations show that the main transition involved in the absorption spectra of the compound is the ligand based π-π* type.

  6. Heterocycles by Transition Metals Catalyzed Intramolecular Cyclization of Acetylene Compounds

    International Nuclear Information System (INIS)

    Vizer, S.A.; Yerzhanov, K.B.; Dedeshko, E.C.

    2003-01-01

    Review shows the new strategies in the synthesis of heterocycles, having nitrogen, oxygen and sulfur atoms, via transition metals catalyzed intramolecular cyclization of acetylenic compounds on the data published at the last 30 years, Unsaturated heterocyclic compounds (pyrroles and pyrroline, furans, dihydro furans and benzofurans, indoles and iso-indoles, isoquinolines and isoquinolinones, aurones, iso coumarins and oxazolinone, lactams and lactones with various substitutes in heterocycles) are formed by transition metals, those salts [PdCl 2 , Pd(OAc) 2 , HgCl 2 , Hg(OAc) 2 , Hg(OCOCF 3 ) 2 , AuCl 3 ·2H 2 O, NaAuCl 4 ·2H 2 O, CuI, CuCl], oxides (HgO) and complexes [Pd(OAc) 2 (PPh 3 )2, Pd(PPh 3 ) 4 , PdCl 2 (MeCN) 2 , Pd(OAc ) 2 /TPPTS] catalyzed intramolecular cyclization of acetylenic amines, amides, ethers, alcohols, acids, ketones and βdiketones. More complex hetero polycyclic systems typical for natural alkaloids can to obtain similar. Proposed mechanisms of pyrroles, isoquinolines, iso indoles and indoles, benzofurans and iso coumarins, thiazolopyrimidinones formation are considered. (author)

  7. Excited state intramolecular proton transfer (ESIPT) in dihydroxyphenyl anthracenes.

    Science.gov (United States)

    Wang, Yu-Hsuan; Wan, Peter

    2011-12-01

    The photochemistry of three 9-(dihydroxyphenyl)anthracenes 6-8 was studied in neat CH(3)CN and selected organic solvents, to investigate excited state intramolecular proton transfer (ESIPT) from the phenol to the anthracene moiety. In D(2)O-CH(3)CN mixtures, the observed deuterium exchange of 6-8 is consistent with water-mediated (formal) ESIPT process from the ortho phenolic OH to the 10'-position of the anthracene ring, giving rise to quinone methide (QM) intermediates 12-14. There is no ESIPT for the corresponding methoxy-substituted compounds. Introduction of an extra hydroxyl group onto the phenol ring at different positions led to a range of deuterium exchange quantum yields (Φ = 0.03 to 0.15). In addition to the anticipated ESIPT process to the 10'-position, in neat CH(3)CN and other organic solvents, 6 (but not 7 or 8) undergoes a clean photocyclization to give bridged product 19 in quantitative yield. The mechanism of this unique photocyclization may involve a direct ESIPT or a 1,4-hydrogen transfer from the ortho phenolic OH to the 9'-position of the anthracene ring, generating a zwitterion (20) or diradical (21) intermediate, respectively, followed by ring closure. Fluorescence studies of 6 in various solvents show the existence of both local excited and intramolecular charge transfer states whereas only the former was present for 7 and 8, offering a possible rationalization for the photocyclization pathway.

  8. A biochemical and biophysical model of G-quadruplex DNA recognition by positive coactivator of transcription 4.

    Science.gov (United States)

    Griffin, Wezley C; Gao, Jun; Byrd, Alicia K; Chib, Shubeena; Raney, Kevin D

    2017-06-09

    DNA sequences that are guanine-rich have received considerable attention because of their potential to fold into a secondary, four-stranded DNA structure termed G-quadruplex (G4), which has been implicated in genomic instability and some human diseases. We have previously identified positive coactivator of transcription (PC4), a single-stranded DNA (ssDNA)-binding protein, as a novel G4 interactor. Here, to expand on these previous observations, we biochemically and biophysically characterized the interaction between PC4 and G4DNA. PC4 can bind alternative G4DNA topologies with a low nanomolar K d value of ∼2 nm, similar to that observed for ssDNA. In consideration of the different structural features between G4DNA and ssDNA, these binding data indicated that PC4 can interact with G4DNA in a manner distinct from ssDNA. The stoichiometry of the PC4-G4 complex was 1:1 for PC4 dimer:G4 substrate. PC4 did not enhance the rate of folding of G4DNA, and formation of the PC4-G4DNA complex did not result in unfolding of the G4DNA structure. We assembled a G4DNA structure flanked by duplex DNA. We find that PC4 can interact with this G4DNA, as well as the complementary C-rich strand. Molecular docking simulations and DNA footprinting experiments suggest a model where a PC4 dimer accommodates the DNA with one monomer on the G4 strand and the second monomer bound to the C-rich strand. Collectively, these data provide a novel mode of PC4 binding to a DNA secondary structure that remains within the framework of the model for binding to ssDNA. Additionally, consideration of the PC4-G4DNA interaction could provide insight into the biological functions of PC4, which remain incompletely understood. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

    Science.gov (United States)

    Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

    2016-01-15

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  10. Exploring possible DNA structures in real-time polymerase kinetics using Pacific Biosciences sequencer data.

    Science.gov (United States)

    Sawaya, Sterling; Boocock, James; Black, Michael A; Gemmell, Neil J

    2015-01-28

    Pausing of DNA polymerase can indicate the presence of a DNA structure that differs from the canonical double-helix. Here we detail a method to investigate how polymerase pausing in the Pacific Biosciences sequencer reads can be related to DNA sequences. The Pacific Biosciences sequencer uses optics to view a polymerase and its interaction with a single DNA molecule in real-time, offering a unique way to detect potential alternative DNA structures. We have developed a new way to examine polymerase kinetics data and relate it to the DNA sequence by using a wavelet transform of read information from the sequencer. We use this method to examine how polymerase kinetics are related to nucleotide base composition. We then examine tandem repeat sequences known for their ability to form different DNA structures: (CGG)n and (CG)n repeats which can, respectively, form G-quadruplex DNA and Z-DNA. We find pausing around the (CGG)n repeat that may indicate the presence of G-quadruplexes in some of the sequencer reads. The (CG)n repeat does not appear to cause polymerase pausing, but its kinetics signature nevertheless suggests the possibility that alternative nucleotide conformations may sometimes be present. We discuss the implications of using our method to discover DNA sequences capable of forming alternative structures. The analyses presented here can be reproduced on any Pacific Biosciences kinetics data for any DNA pattern of interest using an R package that we have made publicly available.

  11. Structural dynamics of possible late-stage intermediates in folding of quadruplex DNA studied by molecular simulations

    Czech Academy of Sciences Publication Activity Database

    Stadlbauer, Petr; Krepl, Miroslav; Cheatham III, T. E.; Koča, J.; Šponer, Jiří

    2013-01-01

    Roč. 41, č. 14 (2013), s. 7128-7143 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : HUMAN TELOMERIC DNA * TETRAMOLECULAR G-QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 8.808, year: 2013

  12. Diverse effects of naturally occurring base lesions on the structure and stability of the human telomere DNA quadruplex

    Czech Academy of Sciences Publication Activity Database

    Konvalinová, Helena; Dvořáková, Zuzana; Renčiuk, Daniel; Bednářová, Klára; Kejnovská, Iva; Trantírek, L.; Vorlíčková, Michaela; Sagi, J.

    2015-01-01

    Roč. 118, NOV 2015 (2015), s. 15-25 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GA13-28310S; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : DNA secondary structure * Circular dichroism spectroscopy * Guanine quadruplex Subject RIV: BO - Biophysics Impact factor: 3.017, year: 2015

  13. Guanine quadruplex formation by RNA/DNA hybrid analogs of Oxytricha telomere G4T4G4 fragment

    Czech Academy of Sciences Publication Activity Database

    Vondrušková, Jitka; Kypr, Jaroslav; Kejnovská, Iva; Fialová, Markéta; Vorlíčková, Michaela

    2008-01-01

    Roč. 89, č. 10 (2008), s. 797-806 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : RNA/DNA hybrids * guanine quadruplex * circular dichroism spectroscopy Subject RIV: BO - Biophysics Impact factor: 2.823, year: 2008

  14. Nachweis und Differenzierung von Campylobacter jejuni, C. coli und C. lari in Lebensmitteln mittels Quadruplex real-time PCR

    OpenAIRE

    Mayr, Anja Maria

    2009-01-01

    Es wurde ein Quadruplex real-time PCR-Verfahren zum parallelen Nachweis und zur Differenzierung der lebensmittelrelevanten thermophilen Campylobacter spp. Campylobacter jejuni, Campylobacter coli und Campylobacter lari in Geflügel, Fleisch, Fisch und Muscheln etabliert. Das Nachweissystem wurde hinsichtlich seiner Selektivität, Sensitivität, Effizienz, Präzision und Robustheit überprüft und im Vergleich zur konventionellen Diagnostik (kultureller Nachweis) anhand von 464 Feldproben validiert....

  15. Reações intramoleculares como modelos não miméticos de catálise enzimática Intramolecular reactions as non mimetic models of enzyme catalysis

    Directory of Open Access Journals (Sweden)

    José Carlos Gesser

    1997-12-01

    Full Text Available This review gives a critical idea on the importance of intramolecular reactions as models for enzymatic catalysis. Intramolecular lactonizations, ester and amide hydrolysis studies result in theories which try to explain the difference between intermolecular, intramolecular and enzyme reactions and rationalize the enhancement promoted by these biological catalyst.

  16. Disabling c-Myc in childhood medulloblastoma and atypical teratoid/rhabdoid tumor cells by the potent G-quadruplex interactive agent S2T1-6OTD.

    Science.gov (United States)

    Shalaby, Tarek; von Bueren, André O; Hürlimann, Marie-Louise; Fiaschetti, Giulio; Castelletti, Deborah; Masayuki, Tera; Nagasawa, Kazuo; Arcaro, Alexandre; Jelesarov, Ilian; Shin-ya, Kazuo; Grotzer, Michael

    2010-01-01

    We investigated here the effects of S2T1-6OTD, a novel telomestatin derivative that is synthesized to target G-quadruplex-forming DNA sequences, on a representative panel of human medulloblastoma (MB) and atypical teratoid/rhabdoid (AT/RT) childhood brain cancer cell lines. S2T1-6OTD proved to be a potent c-Myc inhibitor through its high-affinity physical interaction with the G-quadruplex structure in the c-Myc promoter. Treatment with S2T1-6OTD reduced the mRNA and protein expressions of c-Myc and hTERT, which is transcriptionally regulated by c-Myc, and decreased the activities of both genes. In remarkable contrast to control cells, short-term (72-hour) treatment with S2T1-6OTD resulted in a dose- and time-dependent antiproliferative effect in all MB and AT/RT brain tumor cell lines tested (IC(50), 0.25-0.39 micromol/L). Under conditions where inhibition of both proliferation and c-Myc activity was observed, S2T1-6OTD treatment decreased the protein expression of the cell cycle activator cyclin-dependent kinase 2 and induced cell cycle arrest. Long-term treatment (5 weeks) with nontoxic concentrations of S2T1-6OTD resulted in a time-dependent (mainly c-Myc-dependent) telomere shortening. This was accompanied by cell growth arrest starting on day 28 followed by cell senescence and induction of apoptosis on day 35 in all of the five cell lines investigated. On in vivo animal testing, S2T1-6OTD may well represent a novel therapeutic strategy for childhood brain tumors.

  17. The Nature of the Intramolecular Charge Transfer State in Peridinin

    Science.gov (United States)

    Wagner, Nicole L.; Greco, Jordan A.; Enriquez, Miriam M.; Frank, Harry A.; Birge, Robert R.

    2013-01-01

    Experimental and theoretical evidence is presented that supports the theory that the intramolecular charge transfer (ICT) state of peridinin is an evolved state formed via excited-state bond-order reversal and solvent reorganization in polar media. The ICT state evolves in ICT state are generated via mixing of the “11Bu+” ionic state and the lowest-lying “21Ag–” covalent state. The resulting ICT state is primarily 1Bu+-like in character and exhibits not only a large oscillator strength but an unusually large doubly excited character. In most solvents, two populations exist in equilibrium, one with a lowest-lying ICT ionic state and a second with a lowest-lying “21Ag–” covalent state. The two populations are separated by a small barrier associated with solvent relaxation and cavity formation. PMID:23528091

  18. Intramolecular electron transfer in single-site-mutated azurins

    DEFF Research Database (Denmark)

    Farver, O; Skov, L K; Pascher, T

    1993-01-01

    . Natl. Acad. Sci. U.S.A. 86, 6968-6972]. The RSSR- radical produced in the above reaction was reoxidized in a slower intramolecular electron-transfer process (30-70 s-1 at 298 K) concomitant with a further reduction of the Cu(II) ion. The temperature dependence of the latter rates was determined...... and used to derive information on the possible effects of the mutations. The substitution of residue Phe114, situated on the opposite side of Cu relative to the disulfide, by Ala resulted in a rate increase by a factor of almost 2. By assuming that this effect is only due to an increase in driving force......Single-site mutants of the blue, single-copper protein, azurin, from Pseudomonas aeruginosa were reduced by CO2- radicals in pulse radiolysis experiments. The single disulfide group was reduced directly by CO2- with rates similar to those of the native protein [Farver, O., & Pecht, I. (1989) Proc...

  19. Intramolecular electron transfer in Pseudomonas aeruginosa cd(1) nitrite reductase

    DEFF Research Database (Denmark)

    Farver, Ole; Brunori, Maurizio; Cutruzzolà, Francesca

    2009-01-01

    The cd(1) nitrite reductases, which catalyze the reduction of nitrite to nitric oxide, are homodimers of 60 kDa subunits, each containing one heme-c and one heme-d(1). Heme-c is the electron entry site, whereas heme-d(1) constitutes the catalytic center. The 3D structure of Pseudomonas aeruginosa...... nitrite reductase has been determined in both fully oxidized and reduced states. Intramolecular electron transfer (ET), between c and d(1) hemes is an essential step in the catalytic cycle. In earlier studies of the Pseudomonas stutzeri enzyme, we observed that a marked negative cooperativity...... is controlling this internal ET step. In this study we have investigated the internal ET in the wild-type and His369Ala mutant of P. aeruginosa nitrite reductases and have observed similar cooperativity to that of the Pseudomonas stutzeri enzyme. Heme-c was initially reduced, in an essentially diffusion...

  20. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Constraints from protein structure and intra-molecular coevolution influence the fitness of HIV-1 recombinants.

    Science.gov (United States)

    Woo, Jeongmin; Robertson, David L; Lovell, Simon C

    2014-04-01

    A major challenge for developing effective treatments for HIV-1 is the viruses' ability to generate new variants. Inter-strain recombination is a major contributor to this high evolutionary rate, since at least 20% of viruses are observed to be recombinant. However, the patterns of recombination vary across the viral genome. A number of factors influence recombination, including sequence identity and secondary RNA structure. In addition the recombinant genome must code for a functional virus, and expressed proteins must fold to stable and functional structures. Any intragenic recombination that disrupts internal residue contacts may therefore produce an unfolded protein. Here we find that contact maps based on protein structures predict recombination breakpoints observed in the HIV-1 pandemic. Moreover, many pairs of contacting residues that are unlikely to be disrupted by recombination are coevolving. We conclude that purifying selection arising from protein structure and intramolecular coevolutionary changes shapes the observed patterns of recombination in HIV-1. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Spectroscopic studies on the interactions of 5-ethyl-6-phenyl-3,8-bis((3-aminoalkyl)propanamido)phenanthridin-5-ium derivatives with G-quadruplex DNA

    Science.gov (United States)

    Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel

    2018-05-01

    An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.

  3. Detection of a transient intramolecular hydrogen bond using 1JNH scalar couplings

    Science.gov (United States)

    Xiang, ShengQi; Zweckstetter, Markus

    2014-06-01

    Hydrogen bonds are essential for the structure, stability and folding of proteins. The identification of intramolecular hydrogen bonds, however, is challenging, in particular in transiently folded states. Here we studied the presence of intramolecular hydrogen bonds in the folding nucleus of the coiled-coil structure of the GCN4 leucine zipper. Using one-bond 1JNH spin-spin coupling constants and hydrogen/deuterium exchange, we demonstrate that a transient intramolecular hydrogen bond is present in the partially helical folding nucleus of GCN(16-31). The data demonstrate that 1JNH couplings are a sensitive tool for the detection of transient intramolecular hydrogen bonds in challenging systems where the effective/useable protein concentration is low. This includes peptides at natural abundance but also uniformly labeled biomolecules that are limited to low concentrations because of precipitation or aggregation.

  4. Enantioselective synthesis of almorexant via iridium-catalysed intramolecular allylic amidation

    NARCIS (Netherlands)

    Fananas Mastral, Martin; Teichert, Johannes F.; Fernandez-Salas, Jose Antonio; Heijnen, Dorus; Feringa, Ben L.

    2013-01-01

    An enantioselective synthesis of almorexant, a potent antagonist of human orexin receptors, is presented. The chiral tetrahydroisoquinoline core structure was prepared via iridium-catalysed asymmetric intramolecular allylic amidation. Further key catalytic steps of the synthesis include an oxidative

  5. Flower bud transcriptome analysis of Sapium sebiferum (Linn. Roxb. and primary investigation of drought induced flowering: pathway construction and G-quadruplex prediction based on transcriptome.

    Directory of Open Access Journals (Sweden)

    Minglei Yang

    Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.

  6. High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation.

    Science.gov (United States)

    Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya A; Mergny, Jean-Louis; Salgado, Gilmar F

    2017-05-12

    Non-canonical base pairing within guanine-rich DNA and RNA sequences can produce G-quartets, whose stacking leads to the formation of a G-quadruplex (G4). G4s can coexist with canonical duplex DNA in the human genome and have been suggested to suppress gene transcription, and much attention has therefore focused on studying G4s in promotor regions of disease-related genes. For example, the human KRAS proto-oncogene contains a nuclease-hypersensitive element located upstream of the major transcription start site. The KRAS nuclease-hypersensitive element (NHE) region contains a G-rich element (22RT; 5'-AGGGCGGTGTGGGAATAGGGAA-3') and encompasses a Myc-associated zinc finger-binding site that regulates KRAS transcription. The NEH region therefore has been proposed as a target for new drugs that control KRAS transcription, which requires detailed knowledge of the NHE structure. In this study, we report a high-resolution NMR structure of the G-rich element within the KRAS NHE. We found that the G-rich element forms a parallel structure with three G-quartets connected by a four-nucleotide loop and two short one-nucleotide double-chain reversal loops. In addition, a thymine bulge is found between G8 and G9. The loops of different lengths and the presence of a bulge between the G-quartets are structural elements that potentially can be targeted by small chemical ligands that would further stabilize the structure and interfere or block transcriptional regulators such as Myc-associated zinc finger from accessing their binding sites on the KRAS promoter. In conclusion, our work suggests a possible new route for the development of anticancer agents that could suppress KRAS expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  8. G-quadruplexes in pathogens: a common route to virulence control?

    Directory of Open Access Journals (Sweden)

    Lynne M Harris

    2015-02-01

    Full Text Available DNA can form several secondary structures besides the classic double helix: one that has received much attention in recent years is the G-quadruplex (G4. This is a stable four-stranded structure formed by the stacking of quartets of guanine bases. Recent work has convincingly shown that G4s can form in vivo as well as in vitro and can affect both replication and transcription of DNA. They also play important roles at G-rich telomeres. Now, a spate of exciting reports has begun to reveal roles for G4 structures in virulence processes in several important microbial pathogens of humans. Interestingly, these come from a range of kingdoms--bacteria and protozoa as well as viruses--and all facilitate immune evasion in different ways. In particular, roles for G4s have been posited in the antigenic variation systems of bacteria and protozoa, as well as in the silencing of at least two major human viruses, human immunodeficiency virus (HIV and Epstein-Barr virus (EBV. Although antigenic variation and the silencing of latent viruses are quite distinct from one another, both are routes to immune evasion and the maintenance of chronic infections. Thus, highly disparate pathogens can use G4 motifs to control DNA/RNA dynamics in ways that are relevant to common virulence phenotypes. This review explores the evidence for G4 biology in such processes across a range of important human pathogens.

  9. Exploring the Dynamics of Propeller Loops in Human Telomeric DNA Quadruplexes Using Atomistic Simulations

    Science.gov (United States)

    2017-01-01

    We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322

  10. Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.

    Science.gov (United States)

    Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu

    2018-08-01

    In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.

    Science.gov (United States)

    Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo

    2017-06-01

    To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.

  12. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  13. Dynamics of intramolecular spin exchange interaction of a nitronyl nitroxide diradical in solution and on surfaces

    OpenAIRE

    Lloveras Montserrat, Vega; Badetti, Elena; Veciana Miró, Jaume; Vidal-Gancedo, José

    2016-01-01

    In this paper we report the study of the dynamics of a thermally modulated intramolecular spin exchange interaction of a novel diradical nitronyl nitroxide-substituted disulfide in solution and when it is grafted on a gold surface. The structure of this diradical was designed to have flexible chains leading to intramolecular collisions and hence spin exchange interaction, and with an appropriate binding group to be grafted on the gold surface to study its behavior on the surface. In solution,...

  14. Intramolecular distribution of carbon isotopes in fatty acids

    International Nuclear Information System (INIS)

    von Unruh, G.E.; Hayes, J.M.

    1975-01-01

    It is well known that biochemical reactions fractionate the stable isotopes of carbon, distributing them unevenly among their products. For amino acids and biosynthesized acetate, it has been shown that the isotopes are fractionated on an intramolecular basis, with some carbon positions being enriched in 13 C relative to others. With the goal of eventually determining the extent to which the isotopic distribution pattern in acetate is carried over into alkyl chains, we are working to develop methods for determining isotopic distributions within fatty acids. Because there are no purely instrumental approaches with sufficient precision to allow isotopic measurements on the intact fatty acid, chemical degradation must be applied in order to prepare CO 2 from each position of interest. Kinetic isotope effects during the chemical reactions and vapor pressure isotope effects during sample preparation and handling can significantly affect the results, and must be very carefully controlled and investigated. Thus far, suitable methods have been developed for determination of the isotopic composition of the carboxyl carbon in fatty acids. The isotopic composition of the aliphatic portion of the molecule can then be determined by the difference after the overall 13 C content has been determined by combustion

  15. Intramolecular charge transfer effects on 3-aminobenzoic acid

    Energy Technology Data Exchange (ETDEWEB)

    Stalin, T. [Department of Chemistry, Annamalai University, Annamalainagar, Chidambaram 608 002, Tamil Nadu (India); Rajendiran, N. [Department of Chemistry, Annamalai University, Annamalainagar, Chidambaram 608 002, Tamil Nadu (India)], E-mail: drrajendiran@rediffmail.com

    2006-03-20

    Effect of solvents, buffer solutions of different pH and {beta}-cyclodextrin on the absorption and fluorescence spectra of 3-aminobenzoic acid (3ABA) have been investigated. The solid inclusion complex of 3ABA with {beta}-CD is discussed by UV-Vis, fluorimetry, semiempirical quantum calculations (AM1), FT-IR, {sup 1}H NMR and Scanning Electron Microscope (SEM). The thermodynamic parameters ({delta}H, {delta}G and {delta}S) of the inclusion process are also determined. The experimental results indicated that the inclusion processes is an exothermic and spontaneous. The large Stokes shift emission in solvents with 3ABA are correlated with different solvent polarity scales suggest that, 3ABA molecule is more polar in the S{sub 1} state. Solvent, {beta}-CD studies and excited state dipole moment values confirms that the presence of intramolecular charge transfer (ICT) in 3ABA. Acidity constants for different prototropic equilibria of 3ABA in the S{sub 0} and S{sub 1} states are calculated. {beta}-Cyclodextrin studies shows that 3ABA forms a 1:1 inclusion complex with {beta}-CD. {beta}-CD studies suggest COOH group present in non-polar part and amino group present in hydrophilic part of the {beta}-CD cavity. A mechanism is proposed to explain the inclusion process.

  16. Intramolecular Crosstalk between Catalytic Activities of Receptor Kinases

    KAUST Repository

    Kwezi, Lusisizwe

    2018-01-22

    Signal modulation is important for the growth and development of plants and this process is mediated by a number of factors including physiological growth regulators and their associated signal transduction pathways. Protein kinases play a central role in signaling, including those involving pathogen response mechanisms. We previously demonstrated an active guanylate cyclase (GC) catalytic center in the brassinosteroid insensitive receptor (AtBRI1) within an active intracellular kinase domain resulting in dual enzymatic activity. Here we propose a novel type of receptor architecture that is characterized by a functional GC catalytic center nested in the cytosolic kinase domain enabling intramolecular crosstalk. This may be through a cGMP-AtBRI1 complex forming that may induce a negative feedback mechanism leading to desensitisation of the receptor, regulated through the cGMP production pathway. We further argue that the comparatively low but highly localized cGMP generated by the GC in response to a ligand is sufficient to modulate the kinase activity. This type of receptor therefore provides a molecular switch that directly and/or indirectly affects ligand dependent phosphorylation of downstream signaling cascades and suggests that subsequent signal transduction and modulation works in conjunction with the kinase in downstream signaling.

  17. Simultaneous detection and differentiation of human papillomavirus genotypes 6, 11, 16 and 18 by AllGlo quadruplex quantitative PCR.

    Directory of Open Access Journals (Sweden)

    Daojun Yu

    Full Text Available BACKGROUND: Human papillomaviruses (HPV are classified into high-risk HPV and low-risk HPV. The most common high-risk HPV types in cervical cancer are HPV 16 and 18, and the most common low-risk types causing genital warts are HPV 6 and HPV 11. In this study, applying novel AllGlo fluorescent probes, we established a quadruplex quantitative PCR method to simultaneously detect and differentiate HPV 6, 11, 16 and 18 in a single tube. METHODS: The specificity, the sensitivity, the detection limit, the reproducibility and the standard curve of this method were examined. Finally, clinical samples that had been tested previously by TaqMan PCR and HPV GenoArray (GA test were used to verify the accuracy and sensitivity of the method. RESULTS: The assay has a sensitivity of 10(1 to 10(2 copies/test and a linear detection range from 10(1 to 10(8 copies/test. The mean amplification efficiencies for HPV 6, 11, 16, and 18 were 0.97, 1.10, 0.93 and 1.20, respectively, and the mean correlation coefficient (r(2 of each standard curve was above 0.99 for plasmid templates ranging from 10(3 to 10(7 copies/test. There was 100% agreement between the AllGlo quadruplex quantitative PCR, HPV GA test and TaqMan uniplex qPCR methods. CONCLUSIONS: AllGlo quadruplex quantitative PCR in a single tube has the advantages of relatively high throughput, good reproducibility, high sensitivity, high specificity, and a wide linear range of detection. The convenient single tube format makes this assay a powerful tool for the studies of mixed infections by multiple pathogens, viral typing and viral load quantification.

  18. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    -modified UNA (amino-UNA) on the structural dynamics and stability of TBA. All three modifications were incorporated at three different loop positions (T3, T7, T12) of the TBA G-quadruplex structure to result in a series of TBA variants and their stability was studied by thermal denaturation; folding...... was studied by circular dichroism spectroscopy and thrombin clotting time. The results showed that spacer-C3 introduction at the T7 loop position (TBA-SP7) significantly improved stability and thrombin clotting time while maintaining a similar binding affinity as TBA to thrombin. Detailed molecular modelling...

  19. Intramolecular Schmidt reaction of acyl chlorides with alkyl azides: preparation of pyrrolizine by intramolecular capture of intermediates with alkenes or alkynes.

    Science.gov (United States)

    Wang, Bao-Juan; Xue, Ping; Gu, Peiming

    2015-02-11

    The preparation of substituted pyrrolizines through the Schmidt reaction of acyl chlorides with alkyl azides has been realized. Intramolecular capture of the isocyanate ion and N-acyliminium ion intermediates from the Schmidt process with alkene or alkyne units was achieved, and the efficiency of the conversion with respect to ring construction and bond formation was demonstrated.

  20. Dynamics of the excited state intramolecular charge transfer

    International Nuclear Information System (INIS)

    Joo, T.; Kim, C.H.

    2006-01-01

    The 6-dodecanoyl-2-dimethylaminonaphtalene (laurdan), a derivative of 6-propanoyl- 2-dimethylaminonaphthalene (prodan), has been used as a fluorescent probe in cell imaging, especially in visualizing the lipid rafts by the generalized polarization (GP) images, where GP=(I 440 -I 490 )/(I 440 +I 490 ) with I being the fluorescence intensity. The fluorescence spectrum of laurdan is sensitive to its dipolar environment due to the intramolecular charge transfer (ICT) process in S 1 state, which results in a dual emission from the locally excited (LE) and the ICT states. The ICT process and the solvation of the ICT state are very sensitive to the dipolar nature of the environment. In this work, the ICT of laurdan in ethanol has been studied by femtosecond time resolved fluorescence (TRF), especially TRF spectra measurement without the conventional spectral reconstruction method. TRF probes the excited states exclusively, a unique advantage over the pump/probe transient absorption technique, although time resolution of the TRF is generally lower than transient absorption and the TRF spectra measurement was possible only though the spectral reconstruction. Over the years, critical advances in TRF technique have been made in our group to achieve <50 fs time resolution with direct full spectra measurement capability. Detailed ICT and the subsequent solvation processes can be visualized unambiguously from the TRF spectra. Fig. 1 shows the TRF spectra of laurdan in ethanol at several time delays. Surprisingly, two bands at 433 and 476 nm are clearly visible in the TRF spectra of laurdan even at T = 0 fs. As time increases, the band at 476 nm shifts to the red while its intensity increases. The band at 433 nm also shifts slightly to the red, but loses intensity as time increases. The intensity of the 476 nm band reaches maximum at around 5 ps, where it is roughly twice as intense as that at 0 fs, and stays constant until lifetime decay is noticeable. The spectra were fit by

  1. Quadruplex DNA formation in a region of the tRNA gene supE associated with hydrogen peroxide mediated mutations

    Energy Technology Data Exchange (ETDEWEB)

    Akman, S.A.; Lingeman, R.G.; Doroshow, J.H.; Smith, S.S. (City of Hope National Medical Center and Beckman Research Inst., Duarte, CA (United States))

    1991-09-03

    A hot spot for H{sub 2}O{sub 2}/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189. To further characterize this hot spot, the authors synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50C into major forms, one of which migrates more slowly than does d(pT){sub 33} on nondenaturing 12% polyacrylamide gels. They propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quarters involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following: (1) pZ33 migrates as a single form that comigrates with d(pT){sub 33} on denaturing 20% acrylamide-8 M urea gels; (2) annealing an equimolar mixture of 5{prime}-{sup 32}P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5{prime}-{sup 32}P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels; (3) an oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating for; (4) dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H{sub 2}O{sub 2}/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsten bonded.

  2. New fast organic scintillators using intramolecular bromine quenching

    Science.gov (United States)

    Berlman, I. B.; Lutz, S. S.; Flournoy, J. M.; Ashford, C. B.; Franks, L. A.; Lyons, P. B.

    1984-08-01

    Organic scintillator solutions with decay times as fast as 500 ps and with relatively high conversion efficiencies have been developed. The intramolecular quenching was achieved through the novel approach of adding a bromine atom to the 3- or 4-position of para-oligophenylenes, the fluorescent solutes in these binary solutions. The bromine serves to enhance singlet-to-triplet intersystem crossing in the chromophore, causing a reduction in the scintillation yield and a conconitant reduction in the decay time. The very fast value given above probably also involves some intermolecular self-quenching at high concentration. In addition, the bromine reduces the symmetry of the molecules, thereby increasing their solubility. Finally, an alkyl chain on the opposite para position further increases the solubility and also increases the immunity of the chromophore to quenching. The following solutes were studied in binary liquid solutions and to a limited extent in plastics: 4-bromo-4″-(5-hexadecyl)-p-terphenyl: (4-BHTP), 3-bromo-4″-(5-hexadecyl)-p-terphenyl: (3-BHTP), 4-bromo-p-terphenyl: (4-BTP), 3-bromo-p-terphenyl: (3-BTP), 4-bromo-4‴-(5-hexadecyl)-p-quaterphenyl: (4-BHQP). The decay times for binary liquid solutions in toluene (at the indicated concentrations) were 0.51 ns for 4-BHTP (0.14 M), 0.75 ns for 3-BHTP (0.14 M), 0.57 ns for 3-BTP (0.14 M), and 1.3 ns for 4-BHQP (0.06 M). Binary plastics with 4-BHTP as the solute in concentrations up to 0.14 M were cast in polystyrene. The shortest decay time, 0.40 ns, was measured for the 0.14 M concentration. A plastic scintillator containing 3-BTP (0.11 M in polystyrene) had a decay time of 0.85 ns. These results compare favorably with the plastic scintillator BC-422 whose decay time is about 1.4 ns.

  3. New fast organic scintillators using intramolecular bromine quenching

    International Nuclear Information System (INIS)

    Berlman, I.B.; Lutz, S.S.; Flournoy, J.M.; Ashford, C.B.; Franks, L.A.

    1984-01-01

    Organic scintillator solutions with decay times as fast as 500 ps and with relatively high conversion efficiencies have been developed. The intramolecular quenching was achieved through the novel approach of adding a bromine atom to the 3- or 4-position of para-oligophenylenes, the fluorescent solutes in these binary solutions. The bromine serves to enhance singlet-to-triplet intersystem crossing in the chromophore, causing a reduction in the scintillation yield and a concomitant reduction in the decay time. The very fast value given above probably also involves some intermolecular self-quenching at high concentration. In addition, the bromine reduces the symmetry of the molecules, thereby increasing their solubility. Finally, an alkyl chain on the opposite para position further increases the solubility and also increases the immunity of the chromophore to quenching. The decay times for binary liquid solutions in toluene (at the indicated concentrations) were 0.51 ns for 4-BHTP (0.14 M), 0.75 ns for 3-BHTP (0.14 M), 0.57 ns for 3-BTP (0.14 M), and 1.3 ns for 4-BHQP (0.06 M). Binary plastics with 4-BHTP as the solute in concentrations up to 0.14 M were cast in polystyrene. The shortest decay time, 0.40 ns, was measured for the 0.14 M concentration. A plastic scintillator containing 3-BTP (0.11 M in polystyrene) had a decay time of 0.85 ns. These results compare favorably with the plastic scintillator BC-422 whose decay time is about 1.4 ns. (orig./HSI)

  4. Formation and temperature stability of G-quadruplex structures studied by electronic and vibrational dichroism spectroscopy combined with ab initio calculations

    Czech Academy of Sciences Publication Activity Database

    Nový, J.; Böhm, S.; Králová, Jarmila; Král, V.; Urbanová, M.

    2008-01-01

    Roč. 89, č. 2 (2008), s. 144-152 ISSN 0006-3525 Institutional research plan: CEZ:AV0Z50520514 Keywords : vibrational circular dichroism * quadruplex * G-rich nucleotide Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.823, year: 2008

  5. G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques

    Czech Academy of Sciences Publication Activity Database

    Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk

    2015-01-01

    Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015

  6. Separation of the potential G-quadruplex ligands from the butanol extract of Zanthoxylum ailanthoides Sieb. & Zucc. by countercurrent chromatography and preparative high performance liquid chromatography.

    Science.gov (United States)

    Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin

    2017-07-21

    G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable

  7. Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.

    Science.gov (United States)

    Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

    2017-03-14

    G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.

  8. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO

    Science.gov (United States)

    Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo

    2018-02-01

    As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.

  9. Conductance and activation energy for electron transport in series and parallel intramolecular circuits.

    Science.gov (United States)

    Hsu, Liang-Yan; Wu, Ning; Rabitz, Herschel

    2016-11-30

    We investigate electron transport through series and parallel intramolecular circuits in the framework of the multi-level Redfield theory. Based on the assumption of weak monomer-bath couplings, the simulations depict the length and temperature dependence in six types of intramolecular circuits. In the tunneling regime, we find that the intramolecular circuit rule is only valid in the weak monomer coupling limit. In the thermally activated hopping regime, for circuits based on two different molecular units M a and M b with distinct activation energies E act,a > E act,b , the activation energies of M a and M b in series are nearly the same as E act,a while those in parallel are nearly the same as E act,b . This study gives a comprehensive description of electron transport through intramolecular circuits from tunneling to thermally activated hopping. We hope that this work can motivate additional studies to design intramolecular circuits based on different types of building blocks, and to explore the corresponding circuit laws and the length and temperature dependence of conductance.

  10. Accounting for intra-molecular vibrational modes in open quantum system description of molecular systems.

    Science.gov (United States)

    Roden, Jan; Strunz, Walter T; Whaley, K Birgitta; Eisfeld, Alexander

    2012-11-28

    Electronic-vibrational dynamics in molecular systems that interact with an environment involve a large number of degrees of freedom and are therefore often described by means of open quantum system approaches. A popular approach is to include only the electronic degrees of freedom into the system part and to couple these to a non-Markovian bath of harmonic vibrational modes that is characterized by a spectral density. Since this bath represents both intra-molecular and external vibrations, it is important to understand how to construct a spectral density that accounts for intra-molecular vibrational modes that couple further to other modes. Here, we address this problem by explicitly incorporating an intra-molecular vibrational mode together with the electronic degrees of freedom into the system part and using the Fano theory for a resonance coupled to a continuum to derive an "effective" bath spectral density, which describes the contribution of intra-molecular modes. We compare this effective model for the intra-molecular mode with the method of pseudomodes, a widely used approach in simulation of non-Markovian dynamics. We clarify the difference between these two approaches and demonstrate that the respective resulting dynamics and optical spectra can be very different.

  11. Surprisingly Mild Enolate-Counterion-Free Pd(0)-Catalyzed Intramolecular Allylic Alkylations

    DEFF Research Database (Denmark)

    Madec, David; Prestat, Guillaume; Martini, Elisabetta

    2005-01-01

    Palladium-catalyzed intramolecular allylic alkylations of unsaturated EWG-activated amides can take place under phase-transfer conditions or in the presence of a crown ether. These new reaction conditions are milder and higher yielding than those previously reported. A rationalization for such an......Palladium-catalyzed intramolecular allylic alkylations of unsaturated EWG-activated amides can take place under phase-transfer conditions or in the presence of a crown ether. These new reaction conditions are milder and higher yielding than those previously reported. A rationalization...

  12. Gold versus silver catalyzed intramolecular hydroarylation reactions of [(3-arylprop-2-ynyl)oxy]benzene derivatives.

    Science.gov (United States)

    Arcadi, Antonio; Blesi, Federico; Cacchi, Sandro; Fabrizi, Giancarlo; Goggiamani, Antonella; Marinelli, Fabio

    2012-12-28

    The scope and the generality of gold versus silver catalyzed intramolecular hydroarylation reactions of 3-[(3-arylprop-2-ynyl)oxy]benzene derivatives in terms of rings substitution were investigated. Only products deriving from 6-endo cyclization were exclusively formed. The features of substituents had a considerable effect on the reaction outcome in the presence of silver catalysis, whereas gold catalysis revealed a unique blend of reactivity and selectivity and represented the only choice for the intramolecular hydroarylation reaction of the starting substrates bearing electron deficient arenes.

  13. The effect of intramolecular quantum modes on free energy relationships for electron transfer reactions

    DEFF Research Database (Denmark)

    Ulstrup, Jens; Jortner, Joshua

    1975-01-01

    -frequency intramolecular degrees of feedom on the free energy relationship for series of closely related reactions was investigated for various model systems involving displacement of potential energy surfaces, frequency shift, and anharmonicity effects. The free energy plots are generally found to pass through a maximum...... and to be asymmetric with a slower decrease in the transition probability with increasing energy of reaction. For high-frequency intramolecular modes this provides a rationalization of the experimental observation of ''activationless'' regions. Isotope effects are discussed as also are the oscillatory free energy...

  14. Influence of intramolecular and intermolecular hydrogen bonding on the fluorescence decay time of indigo derivatives

    International Nuclear Information System (INIS)

    Schneider, S.; Lill, E.; Hefferle, P.; Doerr, F.

    1981-01-01

    It is well known that both intramolecular and intermolecular hydrogen bonding can lead to drastic changes in the lifetime of the first excited singlet state. By employing a synchronously pumped, mode-locked dye-laser for excitation in connection with a continuously operated streak camera for detection, the solvent-dependent fluorescence decay times of several indigo derivatives were determined with high temporal resolution (approx. 5 ps with deconvolution). It is found that in indigo dyes intramolecular hydrogen bonding gives rise to a strong fluorescence quenching; intermolecular hydrogen bonding can also provide a channel for fast radiationless deactivation in those derivatives in which the former are not present. (author)

  15. Microwave-assisted synthesis of ruthenium(II) complexes with alkynes as potential inhibitor by selectively recognizing c-myc G-quadruplex DNA.

    Science.gov (United States)

    Zhang, Shuangyan; Wu, Qiong; Zhang, Hao; Wang, Qi; Wang, Xicheng; Mei, Wenjie; Wu, Xiaohui; Zheng, Wenjie

    2017-11-01

    Herein, two polypyridyl ruthenium(II) complexes with alkynes, [Ru(bpy) 2 L](ClO 4 ) 2 (L=p-TEPIP (1) and p-BEPIP (2); bpy=2,2'-bipyridine; p-TEPIP=2-(4-trimethylsilylpropargyl)-1H-imidazo[4,5f][1,10]phenanthroline; p-BEPIP=2-(4-phenyacetylenephenyl)-1H-imidazo[4,5f][1,10]phenanthroline) have been successfully achieved in yields of 32%-89% by a Sonogashira coupling reaction under microwave irradiation. We studied these complexes as potential stabilizers of c-myc G-quadruplex DNA. Observations revealed that both complexes could selectively bind to and stabilize c-myc G-quadruplex DNA with a constant of approximately 1.61±0.78 and 9.47±4.20×10 3 M -1 , respectively, as determined from ITC (isothermal ttitration calorimetry) experiments, FRET (fluorescence resonance energy ttransfer) assay and competitive FRET assay. Moreover, the melting point (T m ) of the c-myc G-quadruplex DNA increased in the presence of 1 and 2 ([Ru]=0.2μM) by approximately 9 and 19.9°C, respectively. It is noteworthy that the conformation of the c-myc G-quadruplex DNA appeared to change when titrated with 1 and 2, which was accompanied by a negative-induced CD (circular dichroism) signal that appeared at a wavelength of 295nm. Furthermore, the conformational change in c-myc G-quadruplex DNA induced by 1 and 2have also been confirmed by TEM (transmission electron microscopy) and AFM (atomic force microscopy). Consequently, the replication of c-myc DNA was blocked by 1 and 2, and especially by 2, as verified by PCR (polymerase chain reaction) -stop assay and Western-blot assay. Thus, these ruthenium(II) complexes can be developed as potential inhibitors in chemotherapy through their binding and stabilization of c-myc G-quadruplex DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Label-free monitoring of DNA polymerase activity based on a thrombin-binding aptamer G-quadruplex.

    Science.gov (United States)

    Wang, Jing; Liu, Haisheng; Ma, Changbei; Wang, Jun; Zhong, Linxiu; Wu, Kefeng

    2017-04-01

    We have developed a label-free assay for the detection of DNA polymerase activity based on a thrombin-binding aptamer (TBA) G-quadruplex. In the presence of DNA polymerase, the 3'-OH termini of the hairpin substrate are immediately elongated to replace the TBA, which can be recognized quickly by the ThT dye and results in an increase of fluorescence. This method is highly sensitive with a detection limit of 0.1 U/mL. It is simple and cost-effective without any requirement of labeling with a fluorophore-quencher pair. Furthermore, the proposed method can also be applied to analyze the inhibition of DNA polymerase, which clearly indicates that the proposed method can be applied for screening of potential DNA polymerase inhibitors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Intramolecular Diels-Alder reactions of pyrimidines, a synthetic and computational study

    NARCIS (Netherlands)

    Stolle, W.A.W.

    1992-01-01

    This thesis deals with an investigation on the ringtransformation reactions of 2and 5-(ω-alkynyl)pyrimidine derivatives, which undergo upon heating an intramolecular Diels-Alder reaction and subsequently a spontaneous retro Diels- Alder reaction. To get a better insight into the

  18. Potassium hydroxide/dimethyl sulfoxide promoted intramolecular cyclization for the synthesis of benzimidazol-2-ones.

    Science.gov (United States)

    Beyer, Astrid; Reucher, Christine M M; Bolm, Carsten

    2011-06-03

    A new protocol for intramolecular N-arylations of ureas to form benzimidazol-2-ones has been developed. The cyclization reaction occurs in the presence of KOH and DMSO at close to ambient temperature. Under these conditions the yields are high and a wide range of functional groups are tolerated.

  19. Optimized measurements of separations and angles between intra-molecular fluorescent markers

    DEFF Research Database (Denmark)

    Mortensen, Kim; Sung, Jongmin; Flyvbjerg, Henrik

    2015-01-01

    We demonstrate a novel, yet simple tool for the study of structure and function of biomolecules by extending two-colour co-localization microscopy to fluorescent molecules with fixed orientations and in intra-molecular proximity. From each colour-separated microscope image in a time-lapse movie...

  20. Symmetry-breaking intramolecular charge transfer in the excited state of meso-linked BODIPY dyads

    KAUST Repository

    Whited, Matthew T.

    2012-01-01

    We report the synthesis and characterization of symmetric BODIPY dyads where the chromophores are attached at the meso position, using either a phenylene bridge or direct linkage. Both molecules undergo symmetry-breaking intramolecular charge transfer in the excited state, and the directly linked dyad serves as a visible-light-absorbing analogue of 9,9′-bianthryl.

  1. Intramolecular hydrogen bond: Can it be part of the basis set of ...

    Indian Academy of Sciences (India)

    IMHB appears in one of the equivalent complete VIC basis sets, its RFC could be used as a measure of bond strength parameter. Keywords. Hydrogen bond; intramolecular; relaxed force constant; normal mode analysis; bond strength parameter. 1. Introduction. The advantages of the compliance constants (the inverse.

  2. Neutral versus cationic Group 3 metal alkyl catalysts : performance in intramolecular hydroamination/cyclisation

    NARCIS (Netherlands)

    de Araujo Bambirra, Sergio; Tsurugi, H; van Leusen, D; Hessen, B

    2006-01-01

    The relative catalytic activity of neutral dialkyl versus cationic monoalkyl Group 3 metal catalysts in the intramolecular hydroamination/cyclisation of the 2,2-dimethyl-4-pentenylamine reference substrate was investigated. This was found to depend strongly on the nature of the monoanionic ancillary

  3. Isotope effects on chemical shifts in the study of intramolecular hydrogen bonds

    DEFF Research Database (Denmark)

    Hansen, Poul Erik

    2015-01-01

    The paper deals with the use of isotope effects on chemical shifts in characterizing intramolecular hydrogen bonds. Both so-called resonance-assisted (RAHB) and non-RAHB systems are treated. The importance of RAHB will be discussed. Another very important issue is the borderline between “static” ...

  4. Regio-Selective Intramolecular Hydrogen/Deuterium Exchange in Gas-Phase Electron Transfer Dissociation

    Science.gov (United States)

    Hamuro, Yoshitomo

    2017-05-01

    Protein backbone amide hydrogen/deuterium exchange mass spectrometry (HDX-MS) typically utilizes enzymatic digestion after the exchange reaction and before MS analysis to improve data resolution. Gas-phase fragmentation of a peptic fragment prior to MS analysis is a promising technique to further increase the resolution. The biggest technical challenge for this method is elimination of intramolecular hydrogen/deuterium exchange (scrambling) in the gas phase. The scrambling obscures the location of deuterium. Jørgensen's group pioneered a method to minimize the scrambling in gas-phase electron capture/transfer dissociation. Despite active investigation, the mechanism of hydrogen scrambling is not well-understood. The difficulty stems from the fact that the degree of hydrogen scrambling depends on instruments, various parameters of mass analysis, and peptide analyzed. In most hydrogen scrambling investigations, the hydrogen scrambling is measured by the percentage of scrambling in a whole molecule. This paper demonstrates that the degree of intramolecular hydrogen/deuterium exchange depends on the nature of exchangeable hydrogen sites. The deuterium on Tyr amide of neurotensin (9-13), Arg-Pro-Tyr-Ile-Leu, migrated significantly faster than that on Ile or Leu amides, indicating the loss of deuterium from the original sites is not mere randomization of hydrogen and deuterium but more site-specific phenomena. This more precise approach may help understand the mechanism of intramolecular hydrogen exchange and provide higher confidence for the parameter optimization to eliminate intramolecular hydrogen/deuterium exchange during gas-phase fragmentation.

  5. Intramolecular 13C analysis of tree rings provides multiple plant ecophysiology signals covering decades.

    Science.gov (United States)

    Wieloch, Thomas; Ehlers, Ina; Yu, Jun; Frank, David; Grabner, Michael; Gessler, Arthur; Schleucher, Jürgen

    2018-03-22

    Measurements of carbon isotope contents of plant organic matter provide important information in diverse fields such as plant breeding, ecophysiology, biogeochemistry and paleoclimatology. They are currently based on 13 C/ 12 C ratios of specific, whole metabolites, but we show here that intramolecular ratios provide higher resolution information. In the glucose units of tree-ring cellulose of 12 tree species, we detected large differences in 13 C/ 12 C ratios (>10‰) among carbon atoms, which provide isotopically distinct inputs to major global C pools, including wood and soil organic matter. Thus, considering position-specific differences can improve characterisation of soil-to-atmosphere carbon fluxes and soil metabolism. In a Pinus nigra tree-ring archive formed from 1961 to 1995, we found novel 13 C signals, and show that intramolecular analysis enables more comprehensive and precise signal extraction from tree rings, and thus higher resolution reconstruction of plants' responses to climate change. Moreover, we propose an ecophysiological mechanism for the introduction of a 13 C signal, which links an environmental shift to the triggered metabolic shift and its intramolecular 13 C signature. In conclusion, intramolecular 13 C analyses can provide valuable new information about long-term metabolic dynamics for numerous applications.

  6. Synthesis of benzannelated sultams by intramolecular Pd-catalyzed arylation of tertiary sulfonamides

    Directory of Open Access Journals (Sweden)

    Valentin A. Rassadin

    2017-09-01

    Full Text Available A new and efficient approach to five- and six-membered benzannelated sultams by intramolecular C-arylation of tertiary 1-(methoxycarbonylmethanesulfonamides under palladium catalysis is described. In case of the α-toluenesulfonamide derivative, an unexpected formation of a 2,3-diarylindole was observed under the same conditions.

  7. Synthesis of benzannelated sultams by intramolecular Pd-catalyzed arylation of tertiary sulfonamides.

    Science.gov (United States)

    Rassadin, Valentin A; Scholz, Mirko; Klochkova, Anastasiia A; de Meijere, Armin; Sokolov, Victor V

    2017-01-01

    A new and efficient approach to five- and six-membered benzannelated sultams by intramolecular C -arylation of tertiary 1-(methoxycarbonyl)methanesulfonamides under palladium catalysis is described. In case of the α-toluenesulfonamide derivative, an unexpected formation of a 2,3-diarylindole was observed under the same conditions.

  8. Intramolecular butenolide allene photocycloadditions and ensuing retro-ene reactions of some photoadducts

    NARCIS (Netherlands)

    Lutteke, G.; Kleinnijenhuis, R.A.; Jacobs, I.; Wrigstedt, P.J.; Correia, A.C.A.; Nieuwenhuizen, R.; Hue, B.T.B.; Goubitz, K.; Peschar, R.; van Maarseveen, J.H.; Hiemstra, H.

    2011-01-01

    This report describes intramolecular [2+2] photocycloadditions of several butenolides with an allenylmethyl substituent at the 5-position. These photosubstrates were prepared from 2-(silyloxy)furans through silver-mediated reactions with allenylmethyl bromides. Two cases were studied where the

  9. Intramolecular Morita-Baylis-Hillman reaction as a strategy for the construction of tricyclic sesquiterpene cores.

    Science.gov (United States)

    Peter, Clovis; Geoffroy, Philippe; Miesch, Michel

    2018-02-21

    Starting from a common polyfunctionalized bicyclo[3.2.1]octane-6,8-dione intermediate, a concise synthetic route to tricyclic cores found in quadrane, suberosane, cedrane and related sesquiterpenes was developed using a Morita-Baylis-Hillman intramolecular reaction as a key step.

  10. Synthesis of neplanocin A and its 3'-epimer via an intramolecular Baylis-Hillman reaction.

    Science.gov (United States)

    Tan, Yun Xuan; Santhanakrishnan, Sridhar; Yang, Hai Yan; Chai, Christina L L; Tam, Eric Kwok Wai

    2014-09-05

    The key cyclopentenyl intermediate 11b was synthesized in 4 steps from d-ribose in 41% overall yield via an efficient intramolecular Baylis-Hillman reaction. This novel key intermediate can be modified easily and transformed to neplanocin A (1a) and its 3'-epimer (1b).

  11. Recent applications of intramolecular Diels-Alder reactions to natural product synthesis

    DEFF Research Database (Denmark)

    Juhl, M.; Tanner, David Ackland

    2009-01-01

    This tutorial review presents some recent examples of intramolecular Diels-Alder (IMDA) reactions as key complexity-generating steps in the total synthesis of structurally intricate natural products. The opportunities afforded by transannular (TADA) versions of the IMDA reaction in complex molecule...

  12. Effect of intramolecular hydrogen bonding and electron donation on substituted anthrasemiquinone characteristics

    International Nuclear Information System (INIS)

    Pal, H.; Mukherjee, T.

    1994-01-01

    The acid-base and redox characteristics of the semiquinones of a number of hydroxy and amino-substituted anthraquinones have been investigated. Results are explained on the basis of electron-donating properties and intramolecular hydrogen bond forming capabilities of the substituents. (author). 4 refs., 1 tab., 1 fig

  13. 1 H NMR-Based Kinetic-Mechanistic Study of the Intramolecular ...

    African Journals Online (AJOL)

    A 1H NMR study of the acid-catalyzed, intramolecular trans-esterification between isomeric 2-exo-3-exo-dihydroxybornane monoacrylate esters has afforded insights into the reaction mechanism and permitted the determination of kinetic and thermodynamic parameters for the pseudo-first-order processes. KEYWORDS ...

  14. The first strand transfer during HIV-1 reverse transcription can occur either intramolecularly or intermolecularly

    NARCIS (Netherlands)

    van Wamel, J. L.; Berkhout, B.

    1998-01-01

    Reverse transcription is a complicated process that involves at least two cDNA transfer reactions to produce a full-length copy DNA of the retroviral RNA genome. Because one retrovirus particle contains two identical genomic RNA molecules, the transfers can occur in an intramolecular or

  15. Intramolecular Transannulation of Alkynyl Triazoles via Alkyne-Carbene Metathesis Step: Access to Fused Pyrroles

    Science.gov (United States)

    Shi, Yi; Gevorgyan, Vladimir

    2013-01-01

    An intramolecular Rh-catalyzed transannulation reaction of alkynyl triazoles has been developed. This method allows efficient construction of various 5,5-fused pyrroles, including tetrahydropyrrolo and spiro systems. The method demonstrates excellent functional group compatibility. A rhodium carbene-alkyne metathesis mechanism is proposed for this transformation. PMID:24093728

  16. On prediction of OH stretching frequencies in intramolecularly hydrogen bonded systems

    DEFF Research Database (Denmark)

    Hansen, Poul Erik; Spanget-Larsen, Jens

    2012-01-01

    OH stretching frequencies are investigated for a series of non-tautomerizing systems with intramolecular hydrogen bonds. Effective OH stretching wavenumbers are predicted by the application of empirical correlation procedures based on the results of B3LYP/6-31G(d) theoretical calculations in the ...

  17. Rationalizing Ring-Size Selectivity in Intramolecular Pd-Catalyzed Allylations of Resonance-Stabilized Carbanions

    DEFF Research Database (Denmark)

    Norrby, Per-Ola; Mader, Mary M.; Vitale, Maxime

    2003-01-01

    Computational methods were applied to the Pd-catalyzed intramolecular allylations of resonance-stabilized carbanions obtained from amide and ketone substrates, with the aim of rationalizing the endo- vs. exo-selectivity in the cyclizations. In addition, ester substrates were prepared and subjecte...

  18. Intramolecular Pnicogen Interactions in PHF(CH2)nPHF (n=26) Systems

    Czech Academy of Sciences Publication Activity Database

    Sanchez-Sanz, Goar; Alkorta, I.; Trujillo, Cristina; Elguero, J.

    2013-01-01

    Roč. 14, č. 8 (2013), s. 1656-1665 ISSN 1439-4235 Institutional support: RVO:61388963 Keywords : electron density shift * intramolecular interactions * ab initio calculations * pnicogens * electrostatic interactions Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.360, year: 2013

  19. Identification of G-quadruplex DNA/RNA binders: Structure-based virtual screening and biophysical characterization.

    Science.gov (United States)

    Rocca, Roberta; Moraca, Federica; Costa, Giosuè; Nadai, Matteo; Scalabrin, Matteo; Talarico, Carmine; Distinto, Simona; Maccioni, Elias; Ortuso, Francesco; Artese, Anna; Alcaro, Stefano; Richter, Sara N

    2017-05-01

    Recent findings demonstrated that, in mammalian cells, telomere DNA (Tel) is transcribed into telomeric repeat-containing RNA (TERRA), which is involved in fundamental biological processes, thus representing a promising anticancer target. For this reason, the discovery of dual (as well as selective) Tel/TERRA G-quadruplex (G4) binders could represent an innovative strategy to enhance telomerase inhibition. Initially, docking simulations of known Tel and TERRA active ligands were performed on the 3D coordinates of bimolecular G4 Tel DNA (Tel 2 ) and TERRA (TERRA 2 ). Structure-based pharmacophore models were generated on the best complexes and employed for the virtual screening of ~257,000 natural compounds. The 20 best candidates were submitted to biophysical assays, which included circular dichroism and mass spectrometry at different K + concentrations. Three hits were here identified and characterized by biophysical assays. Compound 7 acts as dual Tel 2 /TERRA 2 G4-ligand at physiological KCl concentration, while hits 15 and 17 show preferential thermal stabilization for Tel 2 DNA. The different molecular recognition against the two targets was also discussed. Our successful results pave the way to further lead optimization to achieve both increased selectivity and stabilizing effect against TERRA and Tel DNA G4s. The current study combines for the first time molecular modelling and biophysical assays applied to bimolecular DNA and RNA G4s, leading to the identification of innovative ligand chemical scaffolds with a promising anticancer profile. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III) complex.

    Science.gov (United States)

    Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung

    2013-01-01

    We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  1. A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.

    Directory of Open Access Journals (Sweden)

    Ka-Ho Leung

    Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.

  2. Structural dynamics of thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) quadruplex DNA studied by large-scale explicit solvent simulations

    Czech Academy of Sciences Publication Activity Database

    Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří

    2010-01-01

    Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010

  3. Role of loops in the guanine quadruplex formation by DNA/RNA hybrid analogs of G4T4G4

    Czech Academy of Sciences Publication Activity Database

    Vondrušková, Jitka; Kypr, Jaroslav; Kejnovská, Iva; Fialová, Markéta; Vorlíčková, Michaela

    2008-01-01

    Roč. 43, č. 5 (2008), s. 463-467 ISSN 0141-8130 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : nucleic acids * RNA /DNA hybrids * guanine quadruplexes Subject RIV: BO - Biophysics Impact factor: 1.867, year: 2008

  4. Ion Binding to Quadruplex DNA Stems. Comparison of MM and QM Descriptions Reveals Sizable Polarization Effects Not Included in Contemporary Simulations

    Czech Academy of Sciences Publication Activity Database

    Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří

    2014-01-01

    Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  5. Quadruplexes of human telomere DNA analogs designed to contain G:A:G:A, G:G:A:A, and A:A:A:A tetrads

    Czech Academy of Sciences Publication Activity Database

    Sagi, J.; Renčiuk, Daniel; Tomaško, Martin; Vorlíčková, Michaela

    2010-01-01

    Roč. 93, č. 10 (2010), s. 880-886 ISSN 0006-3525 R&D Projects: GA AV ČR(CZ) IAA100040701; GA AV ČR(CZ) IAA500040903 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : human telomere quadruplex * adenine for guanine substitution * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 2.572, year: 2010

  6. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci

    Directory of Open Access Journals (Sweden)

    Aaron J. Stevens

    2017-03-01

    Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.

  7. Architecture based on the integration of intermolecular G-quadruplex structure with sticky-end pairing and colorimetric detection of DNA hybridization.

    Science.gov (United States)

    Li, Hongbo; Wu, Zai-Sheng; Shen, Zhifa; Shen, Guoli; Yu, Ruqin

    2014-02-21

    An interesting discovery is reported in that G-rich hairpin-based recognition probes can self-assemble into a nano-architecture based on the integration of an intermolecular G-quadruplex structure with the sticky-end pairing effect in the presence of target DNAs. Moreover, GNPs modified with partly complementary DNAs can intensively aggregate by hybridization-based intercalation between intermolecular G-quadruplexes, indicating an inspiring assembly mechanism and a powerful colorimetric DNA detection. The proposed intermolecular G-quadruplex-integrated sticky-end pairing assembly (called GISA)-based colorimetric system allows a specific and quantitative assay of p53 DNA with a linear range of more than two orders of magnitude and a detection limit of 0.2 nM, suggesting a considerably improved analytical performance. And more to the point, the discrimination of single-base mismatched target DNAs can be easily conducted via visual observation. The successful development of the present colorimetric system, especially the GISA-based aggregation mechanism of GNPs is different from traditional approaches, and offers a critical insight into the dependence of the GNP aggregation on the structural properties of oligonucleotides, opening a good way to design colorimetric sensing probes and DNA nanostructure.

  8. Proximity hybridization triggered hemin/G-quadruplex formation for construction a label-free and signal-on electrochemical DNA sensor.

    Science.gov (United States)

    Gao, Fenglei; Fan, Taotao; Wu, Jing; Liu, Sha; Du, Yan; Yao, Yao; Zhou, Fuyi; Zhang, Yu; Liao, Xianjiu; Geng, Deqin

    2017-10-15

    We describe a novel label-free and signal-on electrochemical DNA sensing platform via proximity hybridization triggered hemin/G-quadruplex formation based on the direct electron transfer of hemin. The thiolated modified G-DNA1 was first immobilized onto the Au electrode surface. In the presence of target DNA, Y-junction-structure ternary complex can be formed to trigger the proximity assembly of G-DNA1, hemin, and G-DNA2, which leads to the formation of hemin/G-quadruplex for generation an amplified electrochemical signal by differential pulse voltammetry. The observed signal gain was sufficient to achieve a demonstrated detection limit of 54 fM, with a wide linear dynamic range from 10 -13 to 10 -9 M and discriminated mismatched DNA from perfect matched target DNA with a high selectivity. Benefiting from the one step proximity dependent hemin/G-quadruplex formation, the assay method is extremely simple and can be carried out within 40min. The advantages of free of any label conjugation step, and versatility make it a promising candidate for point-of-care testing and commercial application. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Expression of Telomere-Associated Proteins is Interdependent to Stabilize Native Telomere Structure and Telomere Dysfunction by G-Quadruplex Ligand Causes TERRA Upregulation.

    Science.gov (United States)

    Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal

    2017-11-13

    Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.

  10. Synthesis of tetrahydrokhusitone. Annulation of the cyclohexane ring by free radical and carbanionic sequence of reactions

    Directory of Open Access Journals (Sweden)

    ZIVORAD CEKOVIC

    2003-05-01

    Full Text Available The synthesis of norcadinane sesquiterpene tetrahydrokhusitone 1 has been achieved by a new method for annulation of cyclohexane ring involving a sequence of free radical d-alkylation of the non-activated carbon atom and intramolecular carbanionic alkylation. (–-Menthol was used as the starting compound.

  11. Intramolecular localization and effect on conformational stability in vitro of irreversible interphase phosphorylation of Physarum histone H1

    International Nuclear Information System (INIS)

    Jerzmanowski, A.; Krezel, A.M.

    1986-01-01

    To elucidate the intramolecular localization of irreversible interphase phosphorylation of Physarum histone H1 and its effect on H1,s conformational properties, the circular dichroism spectra, the pH- and salt-dependent folding, and the products of trypsin digestion for the interphase phosphorylated (with five to nine phosphates per molecule) and enzymatically dephosphorylated H1 were compared. Both phosphorylated and dephosphorylated H1 show similar amounts of helicity at high ionic strength and upon limited digestion with trysin form identical trypsin-resistant peptides of the size slightly larger than the analogous peptide from calf thymus H1. The circular dichroism analysis of the pH-dependent folding of Physarum H1 in water shows a strong effect of phosphorylation on the folding process in both the acidic and alkaline pH region. The analysis of the products of trypsin digestion of [ 32 P] PO 4 -labeled Physarum H1 before and after enzymatic dephosphorylation is consistent with the interpretation that the interphase phosphorylation occurs predominantly within the 50-70 amino acid sequence directly adjacent to the trypsin-resistant peptide on its C-terminal side and that this sequence is itself involved in some kind of loose folding at high ionic strength. The studies of the formation of the trypsin-resistant peptide (the globular domain) as a function of salt concentration show that it is induced at 300 mM lower NaCl concentration for phosphorylated than for dephosphorylated H1. These results indicate that the stable, interphase phosphorylation of Physarum H1 enhances the salt-induced formation of the folded globular region in vitro. This conclusion together with the finding that only nonphosphorylated H1 occurs in the DNase I solubilized fraction of Physarum chromatin may be relevant for a mechanism of chromatin activation in Physarum

  12. Theoretical Investigation of Intramolecular Hydrogen Shift Reactions in 3-Methyltetrahydrofuran (3-MTHF) Oxidation.

    Science.gov (United States)

    Parab, Prajakta R; Sakade, Naoki; Sakai, Yasuyuki; Fernandes, Ravi; Heufer, K Alexander

    2015-11-05

    3-Methyltetrahydrofuran (3-MTHF) is proposed to be a promising fuel component among the cyclic oxygenated species. To have detailed insight of its combustion kinetics, intramolecular hydrogen shift reactions for the ROO to QOOH reaction class are studied for eight ROO isomers of 3-MTHF. Rate constants of all possible reaction paths that involve formation of cyclic transition states are computed by employing the CBS-QB3 composite method. A Pitzer-Gwinn-like approximation has been applied for the internal rotations in reactants, products, and transition states for the accurate treatment of hindered rotors. Calculated relative barrier heights highlight that the most favorable reaction channel proceeds via a six membered transition state, which is consistent with the computed rate constants. Comparing total rate constants in ROO isomers of 3-MTHF with the corresponding isomers of methylcyclopentane depicts faster kinetics in 3-MTHF than methylcyclopentane reflecting the effect of ring oxygen on the intramolecular hydrogen shift reactions.

  13. Long-range intramolecular electron transfer in aromatic radical anions and binuclear transition metal complexes

    DEFF Research Database (Denmark)

    Kuznetsov, A. M.; Ulstrup, Jens

    1981-01-01

    radicals containing two aromatic end groups connected by a flexible polymethylene chain or a rigid cyclohexane frame is thus trapped on either aromatic end group, and ET between these groups can be detected by ESR techniques. Intramolecular ET also occurs in binuclear transition metal complexes in which......, and for intramolecular and inner sphere ET for transition metal complexes. The Journal of Chemical Physics is copyrighted by The American Institute of Physics....... the coupling between the metal centers [(Ru(II)/Ru(III) and Ru(II)/Co(III) couples] is sufficiently weak (class I or II mixed valence compounds). The ET mechanism can involve either direct transfer between the donor and acceptor groups or a higher order mechanism in which ET proceeds through intermediate...

  14. Communication: Practical intramolecular symmetry adapted perturbation theory via Hartree-Fock embedding.

    Science.gov (United States)

    Parrish, Robert M; Gonthier, Jérôme F; Corminbœuf, Clémence; Sherrill, C David

    2015-08-07

    We develop a simple methodology for the computation of symmetry-adapted perturbation theory (SAPT) interaction energy contributions for intramolecular noncovalent interactions. In this approach, the local occupied orbitals of the total Hartree-Fock (HF) wavefunction are used to partition the fully interacting system into three chemically identifiable units: the noncovalent fragments A and B and a covalent linker C. Once these units are identified, the noninteracting HF wavefunctions of the fragments A and B are separately optimized while embedded in the HF wavefunction of C, providing the dressed zeroth order wavefunctions for A and B in the presence of C. Standard two-body SAPT (particularly SAPT0) is then applied between the relaxed wavefunctions for A and B. This intramolecular SAPT procedure is found to be remarkably straightforward and efficient, as evidenced by example applications ranging from diols to hexaphenyl-ethane derivatives.

  15. Enantioselective Intramolecular Hydroarylation of Alkenes via Directed C-H Bond Activation

    Energy Technology Data Exchange (ETDEWEB)

    Harada, Hitoshi; Thalji, Reema; Bergman, Robert; Ellman, Jonathan

    2008-05-22

    Highly enantioselective catalytic intramolecular ortho-alkylation of aromatic imines containing alkenyl groups tethered at the meta position relative to the imine directing group has been achieved using [RhCl(coe){sub 2}]{sub 2} and chiral phosphoramidite ligands. Cyclization of substrates containing 1,1- and 1,2-disubstituted as well as trisubstituted alkenes were achieved with enantioselectivities >90% ee for each substrate class. Cyclization of substrates with Z-alkene isomers proceeded much more efficiently than substrates with E-alkene isomers. This further enabled the highly stereoselective intramolecular alkylation of certain substrates containing Z/E-alkene mixtures via a Rh-catalyzed alkene isomerization with preferential cyclization of the Z-isomer.

  16. Enantioselective intramolecular hydroarylation of alkenes via directed C-H bond activation.

    Science.gov (United States)

    Harada, Hitoshi; Thalji, Reema K; Bergman, Robert G; Ellman, Jonathan A

    2008-09-05

    Highly enantioselective catalytic intramolecular ortho-alkylation of aromatic imines containing alkenyl groups tethered at the meta position relative to the imine directing group has been achieved using [RhCl(coe)2]2 and chiral phosphoramidite ligands. Cyclization of substrates containing 1,1- and 1,2-disubstituted as well as trisubstituted alkenes were achieved with enantioselectivities >90% ee for each substrate class. Cyclization of substrates with Z-alkene isomers proceeded much more efficiently than substrates with E-alkene isomers. This further enabled the highly stereoselective intramolecular alkylation of certain substrates containing Z/E-alkene mixtures via a Rh-catalyzed alkene isomerization with preferential cyclization of the Z-isomer.

  17. Enantioselective Intramolecular Hydroarylation of Alkenes via Directed C–H Bond Activation

    Science.gov (United States)

    Harada, Hitoshi; Thalji, Reema K.; Bergman, Robert G.; Ellman, Jonathan A.

    2008-01-01

    Highly enantioselective catalytic intramolecular ortho-alkylation of aromatic imines containing alkenyl groups tethered at the meta position relative to the imine directing group has been achieved using [RhCl(coe)2]2 and chiral phosphoramidite ligands. Cyclization of substrates containing 1,1- and 1,2-disubstituted as well as trisubstituted alkenes were achieved with enantioselectivities >90% ee for each substrate class. Cyclization of substrates with Z-alkene isomers proceeded much more efficiently than substrates with E-alkene isomers. This further enabled the highly stereoselective intramolecular alkylation of certain substrates containing Z/E-alkene mixtures via a Rh-catalyzed alkene isomerization with preferential cyclization of the Z-isomer. PMID:18681407

  18. Ciclização intramolecular de 2-(w-Bromoalquiloxi) anilinas /

    OpenAIRE

    Martendal, Adriano

    1999-01-01

    Dissertação (Mestrado) - Universidade Federal de Santa Catarina, Centro de Ciências Físicas e Matemáticas. Ciclizações intramoleculares podem ser estudadas como modelos miméticos de catálise enzimática. Esses modelos fundamentam-se no princípio de que os parâmetros físico-químicos que governam a reatividade entre dois grupamentos funcionais em uma reação intramolecular, estejam presentes também no mecanismo da ação enzimática. Os brometos de 2-(w-bromoalquiloxi)anilínio e 2-(w-bromoalquilo...

  19. EVAPORATION: a new vapour pressure estimation methodfor organic molecules including non-additivity and intramolecular interactions

    Science.gov (United States)

    Compernolle, S.; Ceulemans, K.; Müller, J.-F.

    2011-09-01

    We present EVAPORATION (Estimation of VApour Pressure of ORganics, Accounting for Temperature, Intramolecular, and Non-additivity effects), a method to predict (subcooled) liquid pure compound vapour pressure p0 of organic molecules that requires only molecular structure as input. The method is applicable to zero-, mono- and polyfunctional molecules. A simple formula to describe log10p0(T) is employed, that takes into account both a wide temperature dependence and the non-additivity of functional groups. In order to match the recent data on functionalised diacids an empirical modification to the method was introduced. Contributions due to carbon skeleton, functional groups, and intramolecular interaction between groups are included. Molecules typically originating from oxidation of biogenic molecules are within the scope of this method: aldehydes, ketones, alcohols, ethers, esters, nitrates, acids, peroxides, hydroperoxides, peroxy acyl nitrates and peracids. Therefore the method is especially suited to describe compounds forming secondary organic aerosol (SOA).

  20. A colorimetric and ratiometric fluorescent probe for sulfite based on an intramolecular cleavage mechanism.

    Science.gov (United States)

    Hou, Peng; Chen, Song; Voitchovsky, Kislon; Song, Xiangzhi

    2014-11-01

    A colorimetric and ratiometric fluorescent sulfite probe, the levulinate of 4-hydroxynaphthalimide, was successfully synthesized from 4-hydroxy-naphthalimide and levulinic acid. Through sulfite-mediated intramolecular cleavage, the probe was converted into 4-hydroxynaphthalimide, which when excited at 450 nm, displayed a large Stokes shift due to the intramolecular charge transfer process. The probe exhibited high selectivity and sensitivity towards sulfite over other typical anionic species (F(-), Cl(-), Br(-), I(-), HPO(4)(2-), SO(4)(2-), NO(3)(-), AcO(-), ClO(4)(-), HCO(3)(-)) in HEPES-buffered solution (25 mm, pH 7.4, 50% acetonitrile, v/v). Copyright © 2013 John Wiley & Sons, Ltd.

  1. Some kinetic and spectroscopic evidence on intramolecular relaxation processes in polyatomic molecules

    International Nuclear Information System (INIS)

    Quack, M.

    1983-01-01

    The description and definition of intramolecular vibrational relaxation processes is discussed within the framework of the quantum mechanical and statistical mechanical equations of motion. The evidence from quite different experimental sources is summarized under the common aspect of vibrational relaxation. Although much of the evidence remains ambiguous, there is good indication that a localized vibrational excitation relaxes typically in 0.1 to 10 picoseconds, which is long compared to many optical and reactive processes

  2. Intramolecular Azide to Alkene Cycloadditions for the Construction of Pyrrolobenzodiazepines and Azetidino-Benzodiazepines

    Directory of Open Access Journals (Sweden)

    Karl Hemming

    2014-10-01

    Full Text Available The coupling of proline- and azetidinone-substituted alkenes to 2-azidobenzoic and 2-azidobenzenesulfonic acid gives precursors that undergo intramolecular azide to alkene 1,3-dipolar cycloadditions to give imine-, triazoline- or aziridine-containing pyrrolo[1,4]benzodiazepines (PBDs, pyrrolo[1,2,5]benzothiadiazepines (PBTDs, and azetidino[1,4]benzodiazepines. The imines and aziridines are formed after loss of nitrogen from a triazoline cycloadduct. The PBDs are a potent class of antitumour antibiotics.

  3. Efficient intramolecular cyclizations of phenoxyethynyl diols into multisubstituted α,β-unsaturated lactones.

    Science.gov (United States)

    Egi, Masahiro; Ota, Yuya; Nishimura, Yuka; Shimizu, Kaori; Azechi, Kenji; Akai, Shuji

    2013-08-16

    AgOTf-catalyzed intramolecular cyclization of phenoxyethynyl diols proceeded under mild conditions to afford the multisubstituted α,β-unsaturated-γ-lactones in 55-98% yields. This method was also applicable to the synthesis of α,β-unsaturated-δ-lactones. A similar cyclization proceeded when AgOTf was replaced with a stoichiometric amount of N-bromosuccinimide to furnish the α-bromo-substituted α,β-unsaturated lactones.

  4. An intramolecular inverse electron demand Diels–Alder approach to annulated α-carbolines

    Directory of Open Access Journals (Sweden)

    Zhiyuan Ma

    2012-06-01

    Full Text Available Intramolecular inverse electron demand cycloadditions of isatin-derived 1,2,4-triazines with acetylenic dienophiles tethered by amidations or transesterifications proceed in excellent yields to produce lactam- or lactone-fused α-carbolines. Beginning with various isatins and alkynyl dienophiles, a pilot-scale library of eighty-eight α-carbolines was prepared by using this robust methodology for biological evaluation.

  5. Intramolecular electron transfer through a bridging carboxylate group coordinated to two cobalt(III)-ions

    International Nuclear Information System (INIS)

    Wieghardt, K.

    1978-01-01

    Reduction of the binuclear μ-p-nitrobenzoato -di-μ-hydroxo -bis[triammine cobalt(III)] cation with (CH 3 ) 2 COH radicals yields a radical cation with the p-nitrobenzoato radical being coordinated to two cobalt(III) ions at the carboxylic group. The unprotonated form of this species undergoes intramolecular electron transfer producing Co(II) (k = (3.3 +- 0.3). x 10 3 s -1 ). The role of the carboxylate group in the intramolecular electron transfer process is tentatively assessed in terms of an intramolecular outer-sphere reaction because of lack of overlap of the donor orbitals (π) and the acceptor orbital (sigma). The protonated form of the radical cation (pKsub(a) = 2.5) disproportionates via a bimolecular process without production of Co(II). The effect of two coordinated Co(III) ions as compared to only one on the properties of the nitrobenzoate radical anion are discussed. (orig.) 891 HK 892 GM [de

  6. THE ROLE OF INTRAMOLECULAR TIES ENERGY IN THE PYROLYSIS PROCESS OF PET

    Directory of Open Access Journals (Sweden)

    P. Iu. Salikov

    2014-01-01

    Full Text Available Summary. Recycling plastic waste to focus on. The main type of used products made of polyethylene terephthalate (PET is a container from the various types of beverages. There was considered a possibility of waste of PET (bottles, bottles, packaging containers by pyrolysis. Most of the proposed methods are not suitable for recycling (recycling of waste consumption contamination. Purpose - to develop technological foundations and optimum modes waste PET to obtain useful secondary products, taking into account the energy of chemical intramolecular bonds. Applied scientific basis of recycling PET into useful forms of secondary products, in particular the establishment of the collapse of the intramolecular bonds, depending on the temperature of the pyrolysis method of mathematical processing - differentiation of polynomial equations change in the degree of pyrolysis temperature-dependent. The optimum modes of processing. The block diagram of apparatus for processing contaminated waste PET pyrolysis methods of control processing in accordance with the specified composition of secondary products. The possibility of controlling the amount and types of fuel components of secondary products due to measurable parameters of the pyrolysis process. The effective temperature pyrolysis of waste PET with the CCA-tures energy intramolecular bonds.

  7. Time-Resolved Signatures across the Intramolecular Response in Substituted Cyanine Dyes

    Science.gov (United States)

    Nairat, Muath; Webb, Morgan; Esch, Michael; Lozovoy, Vadim V.; Levine, Benjamin G.; Dantus, Marcos

    2017-06-01

    The optically populated excited state wave packet propagates along multidimensional intramolecular coordinates soon after photoexcitation. This action occurs alongside an intermolecular response from the surrounding solvent. Disentangling the multidimensional convoluted signal enables the possibility to separate and understand the initial intramolecular relaxation pathways over the excited state potential energy surface. Here we track the initial excited state dynamics by measuring the fluorescence yield from the first excited state as a function of time delay between two color femtosecond pulses for several cyanine dyes, having different electronic configurations. We find that when the high frequency pulse precedes the low frequency one and for timescales up to 200 fs, the excited state can be depleted through stimulated emission with efficiency that is dependent on the molecular electronic structure. A similar observation at even shorter times was made by scanning the chirp (frequencies ordering) of a femtosecond pulse. These changes reflect the rate at which the nuclear coordinates of the excited state leave the Franck-Condon (FC) region and progress towards achieving equilibrium. Through functional group substitution, we explore these dynamic changes as a function of dipolar change following photoexcitation. We show that with proper knowledge and control over the phase of the excitation pulses, we can extract the relative energy relaxation rates through which the early intramolecular modes are populated at the FC geometry soon after excitation

  8. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins

  9. Automatic sequences

    CERN Document Server

    Haeseler, Friedrich

    2003-01-01

    Automatic sequences are sequences which are produced by a finite automaton. Although they are not random they may look as being random. They are complicated, in the sense of not being not ultimately periodic, they may look rather complicated, in the sense that it may not be easy to name the rule by which the sequence is generated, however there exists a rule which generates the sequence. The concept automatic sequences has special applications in algebra, number theory, finite automata and formal languages, combinatorics on words. The text deals with different aspects of automatic sequences, in particular:· a general introduction to automatic sequences· the basic (combinatorial) properties of automatic sequences· the algebraic approach to automatic sequences· geometric objects related to automatic sequences.

  10. Intramolecular stable isotope distributions detect plant metabolic responses on century time scales

    Science.gov (United States)

    Schleucher, Jürgen; Ehlers, Ina; Augusti, Angela; Betson, Tatiana

    2014-05-01

    Plants respond to environmental changes on a vast range of time scales, and plant gas exchanges constitute important feedback mechanisms in the global C cycle. Responses on time scales of decades to centuries are most important for climate models, for prediction of crop productivity, and for adaptation to climate change. Unfortunately, responses on these timescale are least understood. We argue that the knowledge gap on intermediate time scales is due to a lack of adequate methods that can bridge between short-term manipulative experiments (e.g. FACE) and paleo research. Manipulative experiments in plant ecophysiology give information on metabolism on time scales up to years. However, this information cannot be linked to results from retrospective studies in paleo research, because little metabolic information can be derived from paleo archives. Stable isotopes are prominent tools in plant ecophysiology, biogeochemistry and in paleo research, but in all applications to date, isotope ratios of whole molecules are measured. However, it is well established that stable isotope abundance varies among intramolecular groups of biochemical metabolites, that is each so-called "isotopomer" has a distinct abundance. This intramolecular variation carries information on metabolic regulation, which can even be traced to individual enzymes (Schleucher et al., Plant, Cell Environ 1999). Here, we apply intramolecular isotope distributions to study the metabolic response of plants to increasing atmospheric [CO2] during the past century. Greenhouse experiments show that the deuterium abundance among the two positions in the C6H2 group of photosynthetic glucose depends on [CO2] during growth. This is observed for all plants using C3 photosynthesis, and reflects the metabolic flux ratio between photorespiration and photosynthesis. Photorespiration is a major C flux that limits assimilation in C3 plants, which encompass the overwhelming fraction of terrestrial photosynthesis and the

  11. Synthesis of a Cholesteryl-HEG Phosphoramidite Derivative and Its Application to Lipid-conjugates of the Anti-HIV 5'TGGGAG3' Hotoda’s Sequence

    Directory of Open Access Journals (Sweden)

    Domenica Musumeci

    2012-10-01

    Full Text Available A novel phosphoramidite derivative of cholesterol, with an ether-linked hexaethylene glycol (HEG spacer arm, has been obtained through simple and reproducible solid phase modified oligonucleotide synthesis manipulations. This building block and the known phosphoramidite derivative of 3b-(2-hydroxyethoxycholesterol have been exploited in standard oligonucleotide synthesis protocols for the preparation of 5'- conjugates of the G-quadruplex-forming 5'TGGGAG3' oligomer, known as the Hotoda’s sequence, to produce new potential anti-HIV agents.

  12. A G-quadruplex based fluorescent oligonucleotide turn-on probe towards iodides detection in real samples.

    Science.gov (United States)

    Li, Qian; Li, Shuaihua; Chen, Xiu; Bian, Liujiao

    2017-09-01

    A basket-type G-quadruplex (GQ) fluorescent oligonucleotide (OND) probe is designed to detect iodides dependent on thymine-Hg(II)-thymine (T-Hg(II)-T) base pairs and the intrinsic fluorescence quenching capacity of GQ. In the presence of Hg(II) ions (Hg 2+ ), the two hexachloro-fluorescein-labeled ONDs form a hairpin structure and the fluorophores are dragged close to the GQ, leading to fluorescence quenching of the probe due to photoinduced electron transfer. Upon addition of iodide anions, Hg 2+ are extracted from T-Hg(II)-T complexes which attributes to the stronger binding with iodide anions, resulting in the fluorescence recovery. Through performing the fluorescence quenching and recovery processes, this probe developed a fluorescence turn-on sensor for iodide anions determination over a linear range of 20-200nmol/L with a limit of detection of 5nmol/L. The practical use of the turn-on technology was demonstrated by its application in determination of iodides in water, food, pharmaceutical products and biological samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  14. Fuzzy logic sensing of G-quadruplex DNA and its cleavage reagents based on reduced graphene oxide.

    Science.gov (United States)

    Huang, Wei Tao; Zhang, Jian Rong; Xie, Wan Yi; Shi, Yan; Luo, Hong Qun; Li, Nian Bing

    2014-07-15

    Herein, by combining the merits of nanotechnology and fuzzy logic theory, we develop a simple, label-free, and general strategy based on an organic dye-graphene hybrid system for fluorescence intelligent sensing of G-quadruplexes (G4) formation, hydroxyl radical (HO∙), and Fe(2+) in vitro. By exploiting acridine orange (AO) dyes-graphene as a nanofilter and nanoswitch and the ability of graphene to interact with DNA with different structures, our approach can efficiently distinguish, quantitatively detect target analytes. In vitro assays with G4DNA demonstrated increases in fluorescence intensity of the AO-rGO system with a linear range of 16-338 nM and a detection limit as low as 2.0 nM. The requenched fluorescence of the G4TBA-AO-rGO system has a non-linear response to Fenton reagent. But this requenching reduces the fluorescence intensity in a manner proportional to the logarithm to the base 10 of the concentration of Fenton reagent in the range of 0.1-100 μM and 100-2000 μM, respectively. Furthermore, we develop a novel and intelligent sensing method based on fuzzy logic which mimics human reasoning, solves complex and non-linear problems, and transforms the numerical output into the language description output for potential application in biochemical systems, environmental monitoring systems, and molecular-level fuzzy logic computing system. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Tandem application of ligand-based virtual screening and G4-OAS assay to identify novel G-quadruplex-targeting chemotypes.

    Science.gov (United States)

    Musumeci, Domenica; Amato, Jussara; Zizza, Pasquale; Platella, Chiara; Cosconati, Sandro; Cingolani, Chiara; Biroccio, Annamaria; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Pagano, Bruno; Montesarchio, Daniela

    2017-05-01

    G-quadruplex (G4) structures are key elements in the regulation of cancer cell proliferation and their targeting is deemed to be a promising strategy in anticancer therapy. A tandem application of ligand-based virtual screening (VS) calculations together with the experimental G-quadruplex on Oligo Affinity Support (G4-OAS) assay was employed to discover novel G4-targeting compounds. The interaction of the selected compounds with the investigated G4 in solution was analysed through a series of biophysical techniques and their biological activity investigated by immunofluorescence and MTT assays. A focused library of 60 small molecules, designed as putative G4 groove binders, was identified through the VS. The G4-OAS experimental screening led to the selection of 7 ligands effectively interacting with the G4-forming human telomeric DNA. Evaluation of the biological activity of the selected compounds showed that 3 ligands of this sub-library induced a marked telomere-localized DNA damage response in human tumour cells. The combined application of virtual and experimental screening tools proved to be a successful strategy to identify new bioactive chemotypes able to target the telomeric G4 DNA. These compounds may represent useful leads for the development of more potent and selective G4 ligands. Expanding the repertoire of the available G4-targeting chemotypes with improved physico-chemical features, in particular aiming at the discovery of novel, selective G4 telomeric ligands, can help in developing effective anti-cancer drugs with fewer side effects. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. The KIM-family protein-tyrosine phosphatases use distinct reversible oxidation intermediates: Intramolecular or intermolecular disulfide bond formation.

    Science.gov (United States)

    Machado, Luciana E S F; Shen, Tun-Li; Page, Rebecca; Peti, Wolfgang

    2017-05-26

    The kinase interaction motif (KIM) family of protein-tyrosine phosphatases (PTPs) includes hematopoietic protein-tyrosine phosphatase (HePTP), striatal-enriched protein-tyrosine phosphatase (STEP), and protein-tyrosine phosphatase receptor type R (PTPRR). KIM-PTPs bind and dephosphorylate mitogen-activated protein kinases (MAPKs) and thereby critically modulate cell proliferation and differentiation. PTP activity can readily be diminished by reactive oxygen species (ROS), e.g. H 2 O 2 , which oxidize the catalytically indispensable active-site cysteine. This initial oxidation generates an unstable sulfenic acid intermediate that is quickly converted into either a sulfinic/sulfonic acid (catalytically dead and irreversible inactivation) or a stable sulfenamide or disulfide bond intermediate (reversible inactivation). Critically, our understanding of ROS-mediated PTP oxidation is not yet sufficient to predict the molecular responses of PTPs to oxidative stress. However, identifying distinct responses will enable novel routes for PTP-selective drug design, important for managing diseases such as cancer and Alzheimer's disease. Therefore, we performed a detailed biochemical and molecular study of all KIM-PTP family members to determine their H 2 O 2 oxidation profiles and identify their reversible inactivation mechanism(s). We show that despite having nearly identical 3D structures and sequences, each KIM-PTP family member has a unique oxidation profile. Furthermore, we also show that whereas STEP and PTPRR stabilize their reversibly oxidized state by forming an intramolecular disulfide bond, HePTP uses an unexpected mechanism, namely, formation of a reversible intermolecular disulfide bond. In summary, despite being closely related, KIM-PTPs significantly differ in oxidation profiles. These findings highlight that oxidation protection is critical when analyzing PTPs, for example, in drug screening. © 2017 by The American Society for Biochemistry and Molecular Biology

  18. Syntheses of strychnine, norfluorocurarine, dehydrodesacetylretuline, and valparicine enabled by intramolecular cycloadditions of Zincke aldehydes.

    Science.gov (United States)

    Martin, David B C; Nguyen, Lucas Q; Vanderwal, Christopher D

    2012-01-06

    A full account of the development of the base-mediated intramolecular Diels-Alder cycloadditions of tryptamine-derived Zincke aldehydes is described. This important complexity-generating transformation provides the tetracyclic core of many indole monoterpene alkaloids in only three steps from commercially available starting materials and played a key role in short syntheses of norfluorocurarine (five steps), dehydrodesacetylretuline (six steps), valparicine (seven steps), and strychnine (six steps). Reasonable mechanistic possibilities for this reaction, a surprisingly facile dimerization of the products, and an unexpected cycloreversion to regenerate Zincke aldehydes under specific conditions are also discussed.

  19. Deuterium isotope effect on the intramolecular electron transfer in Pseudomonas aeruginosa azurin

    DEFF Research Database (Denmark)

    Farver, O.; Zhang, Jingdong; Chi, Qijin

    2001-01-01

    rather than negative. Isotope effects are, however, also inherent in the nuclear reorganization Gibbs free energy and in the tunneling factor for the electron transfer process. A slightly larger thermal protein expansion in H2O than in D2O (0.001 nm K-1) is sufficient both to account for the activation......Intramolecular electron transfer in azurin in water and deuterium oxide has been studied over a broad temperature range. The kinetic deuterium isotope effect, k(H)/k(D), is smaller than unity (0.7 at 298 K), primarily caused by the different activation entropies in water (-56.5 J K-1 mol(-1...

  20. A concise, efficient synthesis of sugar-based benzothiazoles through chemoselective intramolecular C-S coupling

    KAUST Repository

    Shen, Chao

    2012-01-01

    Sugar-based benzothiazoles are a new class of molecules promising for many biological applications. Here, we have synthesized a wide range of sugar-based benzothiazoles from readily accessible glycosyl thioureas by chemoselective, palladium-catalyzed C-S coupling reactions. Corroborated by theoretical calculations, a mechanistic investigation indicates that the coordination to the palladium by a pivaloyl carbonyl group and the presence of intramolecular hydrogen bonding play important roles in the efficiency and chemoselectivity of reaction. These fluorescent glycoconjugates can be observed to readily enter mammalian tumor cells and exhibit potential in vitro antitumor activity. This journal is © The Royal Society of Chemistry 2012.

  1. Path-integral calculation of the second virial coefficient including intramolecular flexibility effects

    Energy Technology Data Exchange (ETDEWEB)

    Garberoglio, Giovanni, E-mail: garberoglio@fbk.eu [Interdisciplinary Laboratory for Computational Science (LISC), FBK-CMM and University of Trento, via Sommarive 18, I-38123 Povo (Italy); Jankowski, Piotr [Department of Quantum Chemistry, Faculty of Chemistry, Nicolaus Copernicus University, Gagarina 7, PL-87-100 Toruń (Poland); Szalewicz, Krzysztof [Department of Physics and Astronomy, University of Delaware, Newark, Delaware 19716 (United States); Harvey, Allan H. [Applied Chemicals and Materials Division, National Institute of Standards and Technology, 325 Broadway, Boulder, Colorado 80305-3337 (United States)

    2014-07-28

    We present a path-integral Monte Carlo procedure for the fully quantum calculation of the second molecular virial coefficient accounting for intramolecular flexibility. This method is applied to molecular hydrogen (H{sub 2}) and deuterium (D{sub 2}) in the temperature range 15–2000 K, showing that the effect of molecular flexibility is not negligible. Our results are in good agreement with experimental data, as well as with virials given by recent empirical equations of state, although some discrepancies are observed for H{sub 2} between 100 and 200 K.

  2. Dynamics of excited-state intramolecular proton transfer reactions in piroxicam. Role of triplet states

    Science.gov (United States)

    Cho, Dae Won; Kim, Yong Hee; Yoon, Minjoong; Jeoung, Sae Chae; Kim, Dongho

    1994-08-01

    The picosecond time-resolved fluorescence and transient absorption behavior of piroxicam at room temperature are reported. The keto tautomer in the excited singlet state ( 1K*) formed via the fast intramolecular proton transfer (≈ 20 ps) is observed. The short-lived (7.5 ns) triplet state of keto tauomer ( 3K*) is generated from 1K * in toluene whereas it is hardly observed in ethanol. Consequently, rapid reverse proton transfer takes place from 3K * to the enol triplet state ( 3E *.

  3. The Preparation and Intramolecular Radical Cyclisation Reactions of Chiral Oxime Ethers

    Directory of Open Access Journals (Sweden)

    Booth Susan E.

    1998-01-01

    Full Text Available Chiral oxime ether 2 and Oxime ester 4 have been prepared by alkylation and esterification of the oxime 1. Racemic hydroxylamine 6 and chiral hydroxylamine 10 have been synthesised from N-hydroxysuccinimide and the corresponding alcohol in the presence of diethylazodicarboxylate, the two products were converted into the oxime ethers 7 and 11 respectively. The intramolecular radical cyclisation reactions of these oxime ethers and esters has been studied, successful reaction was observed to produce alkyl hydroxylamines 3, 8 and 12.

  4. Some Brief Notes on Theoretical and Experimental Investigations of Intramolecular Hydrogen Bonding

    Directory of Open Access Journals (Sweden)

    Lucjan Sobczyk

    2016-12-01

    Full Text Available A review of selected literature data related to intramolecular hydrogen bonding in ortho-hydroxyaryl Schiff bases, ortho-hydroxyaryl ketones, ortho-hydroxyaryl amides, proton sponges and ortho-hydroxyaryl Mannich bases is presented. The paper reports on the application of experimental spectroscopic measurements (IR and NMR and quantum-mechanical calculations for investigations of the proton transfer processes, the potential energy curves, tautomeric equilibrium, aromaticity etc. Finally, the equilibrium between the intra- and inter-molecular hydrogen bonds in amides is discussed.

  5. Use of ionic model for analysis of intramolecular movement in alkali metal metaborate molecules

    International Nuclear Information System (INIS)

    Ezhov, Yu.S.; Vinogradov, V.S.

    1978-01-01

    To clear out the peculiarities of intramolecular movement in MBO 2 (where M=Li, Na, K, Rb, Cs) molecules the energy dependence of cation electrostatic interaction with BO 2 anion on the charge value of oxygen, values of the MOB valence angle and internuclear distance r(M-O) is calculated. The calculation results on the base of ionic model show that the minimum of potential energy function corresponds to angular configuration of the MBO 2 molecules. Parameters of potential function of deformation oscillation connected with the change of MOB angle, are evaluated

  6. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones.

    Science.gov (United States)

    Molander, Gary A; St Jean, David J

    2002-05-31

    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  7. Intramolecular hydrogen bond in molecular and proton-transfer forms of Schiff bases

    Energy Technology Data Exchange (ETDEWEB)

    Filarowski, A.; Koll, A.; Karpfen, A.; Wolschann, P

    2004-02-16

    The force field and structural parameters modifications upon the formation of intramolecular hydrogen bond and proton transfer reaction in N-methyl-2-hydroxybenzylidene amine (HBZA) are determined on the basis of ab initio and DFT calculations. Reliability of the calculations is verified by comparing of the theoretical vibrational spectra with those experimentally determined in the gas phase. A model of resonance interactions is applied and the quantitative contribution of ortho-quinoid structure in the particular conformers is estimated. A comparison is also made to the systems without {pi}-electron coupling (Mannich bases)

  8. Cooperative Metal–Ligand Catalyzed Intramolecular Hydroamination and Hydroalkoxylation of Allenes Using a Stable Iron Catalyst

    KAUST Repository

    El-Sepelgy, Osama

    2018-01-18

    A new iron-catalyzed chemoselective intramolecular hydroamination and hydroalkoxylation of the readily available α-allenic amines and alcohols to valuable unsaturated 5-membered heterocycles, 2,3-dihydropyrrole and 2,3-dihydrofuran, is reported. Effective selectivity control is achieved by a metal–ligand cooperative activation of the substrates. The mild reaction conditions and the use of low amounts of an air and moisture stable iron catalyst allow for the hydrofunctionalization of a wide range of allenes bearing different functional groups in good yields in the absence of base or any sensitive additives.

  9. Pulse radiolytic and electrochemical investigations of intramolecular electron transfer in carotenoporphyrins and carotenoporphyrin-quinone triads

    International Nuclear Information System (INIS)

    Land, E.J.; Lexa, D.; Bensasson, R.V.; Gust, D.; Moore, T.A.; Moore, A.L.; Liddell, P.A.; Nemeth, G.A.

    1987-01-01

    Thermodynamic and kinetic aspects of intramolecular electron-transfer reactions in carotenoporphyrin dyads and carotenoid-porphyrin-quinone triads have been studied by using pulse radiolysis and cyclic voltammetry. Rapid (<1 μs) electron transfer from carotenoid radical anions to attached porphyrins has been inferred. Carotenoid cations, on the other hand, do not readily accept electrons from attached porphyrins or pyropheophorbides. Electrochemical studies provide the thermodynamic basis for these observations and also allow estimation of the energetics of photoinitiated two-step electron transfer and two-step charge recombination in triad models for photosynthetic charge separation

  10. A sensitive electrochemical aptasensor based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes.

    Science.gov (United States)

    Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo

    2015-01-28

    In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).

  11. Approach to Interfacial and Intramolecular Electron Transfer of the Diheme Protein Cytochrome c(4) Assembled on Au(111) Surfaces

    DEFF Research Database (Denmark)

    Chi, Qijin; Zhang, Jingdong; Taner, Arslan

    2010-01-01

    protein Pseudomonas stutzeri cytochrome c(4) has been a target for intramolecular, interheme ET. We report here voltammetric and in situ scanning tunneling microscopy (STM) data for P. stutzeri cyt c(4) at single-crystal, atomically planar Au(111)-electrode surfaces modified by variable-length omega...... direction and a single two-ET peak in the anodic direction. Intramolecular, interheme ET with high, 8,000-30,000 s(-1), rate constants is notably an essential part of this mechanism. The high rate constants are in striking contrast to ET reactions of P. stutzeri cyt c4 with small reaction partners...... in homogeneous solution for which kinetic analysis clearly testifies to electrostatic cooperative effects but no intramolecular, interheme ET higher than 0.1-10 s(-1). This difference suggests a strong gating feature of the process. On the basis of the three-dimensional structure of P. stutzeri cyt c(4), gating...

  12. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    Science.gov (United States)

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  13. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    Science.gov (United States)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  14. Quantification of Chemical and Mechanical Effects on the Formation of the G-Quadruplex and i-Motif in Duplex DNA.

    Science.gov (United States)

    Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin

    2017-09-05

    The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.

  15. Microwave-Assisted Synthesis of Imidazo[4,5-f][1,10]phenanthroline Derivatives as Apoptosis Inducers in Chemotherapy by Stabilizing Bcl-2 G-quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Li Li

    2017-05-01

    Full Text Available Herein, a series of imidazo[4,5-f][1,10] phenanthroline derivatives RPIP (PIP = imidazo [4,5-f][1,10] phenanthroline, R = NO2, 1; CF3, 2; Cl, 3; OH, 4 have been synthesized in yields of 82.3–94.7% at 100 °C under the irradiation of microwave. MTT assay has been utilized to evaluate the inhibitory activity (IC50 of these compounds against the growth of various tumor cells, and the results revealed that these compounds, especially 1, exhibited excellent inhibitory activity against the growth of A549 cells with IC50 of 15.03 μM. Moreover, it’s also confirmed that 1 can penetrate into the membrane of tumor cells and distribute in mitochondria when observed under microscopy, resulting apoptosis of tumor cells. The further studies showed that 1 can bind to bcl-2 G-quadruplex DNA, which demonstrated by the increase of melting point of bcl-2 G4 DNA in the presence of 1, as well as electronic titration and emission spectra. In a word, this kind of compound may develop as a potential apoptosis inducer in cancer chemotherapy via binding and stabilizing to the bcl-2 G-quadruplex DNA.

  16. Intramolecular Hydrogen Bonding Involving Organic Fluorine: NMR Investigations Corroborated by DFT-Based Theoretical Calculations

    Directory of Open Access Journals (Sweden)

    Sandeep Kumar Mishra

    2017-03-01

    Full Text Available The combined utility of many one and two dimensional NMR methodologies and DFT-based theoretical calculations have been exploited to detect the intramolecular hydrogen bond (HB in number of different organic fluorine-containing derivatives of molecules, viz. benzanilides, hydrazides, imides, benzamides, and diphenyloxamides. The existence of two and three centered hydrogen bonds has been convincingly established in the investigated molecules. The NMR spectral parameters, viz., coupling mediated through hydrogen bond, one-bond NH scalar couplings, physical parameter dependent variation of chemical shifts of NH protons have paved the way for understanding the presence of hydrogen bond involving organic fluorine in all the investigated molecules. The experimental NMR findings are further corroborated by DFT-based theoretical calculations including NCI, QTAIM, MD simulations and NBO analysis. The monitoring of H/D exchange with NMR spectroscopy established the effect of intramolecular HB and the influence of electronegativity of various substituents on the chemical kinetics in the number of organic building blocks. The utility of DQ-SQ technique in determining the information about HB in various fluorine substituted molecules has been convincingly established.

  17. Organometallic copper I, II or III species in an intramolecular dechlorination reaction

    KAUST Repository

    Poater, Albert

    2013-03-15

    The present paper gives insight into an intramolecular dechlorination reaction involving Copper (I) and an ArCH2Cl moiety. The discussion of the presence of a CuIII organometallic intermediate becomes a challenge, and because of the lack of clear experimental detection of this proposed intermediate, and due to the computational evidence that it is less stable than other isomeric species, it can be ruled out for the complex studied here. Our calculations are completely consistent with the key hypothesis of Karlin et al. that TMPA-CuI is the substrate of intramolecular dechlorination reactions as well as the source to generate organometallic species. However the organometallic character of some intermediates has been refused because computationally these species are less stable than other isomers. Thus this study constitutes an additional piece towards the full understanding of a class of reaction of biological relevance. Further, the lack of high energy barriers and deep energy wells along the reaction pathway explains the experimental difficulties to trap other intermediates. © Springer-Verlag Berlin Heidelberg 2013.

  18. Effect of Hartree-Fock exact exchange on intramolecular magnetic coupling constants of organic diradicals.

    Science.gov (United States)

    Cho, Daeheum; Ko, Kyoung Chul; Ikabata, Yasuhiro; Wakayama, Kazufumi; Yoshikawa, Takeshi; Nakai, Hiromi; Lee, Jin Yong

    2015-01-14

    The intramolecular magnetic coupling constant (J) of diradical systems linked with five- or six-membered aromatic rings was calculated to obtain the scaling factor (experimental J/calculated J ratio) for various density functional theory (DFT) functionals. Scaling factors of group A (PBE, TPSSh, B3LYP, B97-1, X3LYP, PBE0, and BH&HLYP) and B (M06-L, M06, M06-2X, and M06-HF) were shown to decrease as the amount of Hartree-Fock exact exchange (HFx) increases, in other words, overestimation of calculated J becomes more severe as the HFx increases. We further investigated the effect of HFx fraction of DFT functional on J value, spin contamination, and spin density distributions by comparing the B3LYP analogues containing different amount of HFx. It was revealed that spin contamination and spin densities at each atom increases as the HFx increases. Above all, newly developed BLYP-5 functional, which has 5% of HFx, was found to have the scaling factor of 1.029, indicating that calculated J values are very close to that of experimental values without scaling. BLYP-5 has potential to be utilized for accurate evaluation of intramolecular magnetic coupling constant (J) of diradicals linked by five- or six-membered aromatic ring couplers.

  19. Discovery of intramolecular signal transduction network based on a new protein dynamics model of energy dissipation.

    Directory of Open Access Journals (Sweden)

    Cheng-Wei Ma

    Full Text Available A novel approach to reveal intramolecular signal transduction network is proposed in this work. To this end, a new algorithm of network construction is developed, which is based on a new protein dynamics model of energy dissipation. A key feature of this approach is that direction information is specified after inferring protein residue-residue interaction network involved in the process of signal transduction. This enables fundamental analysis of the regulation hierarchy and identification of regulation hubs of the signaling network. A well-studied allosteric enzyme, E. coli aspartokinase III, is used as a model system to demonstrate the new method. Comparison with experimental results shows that the new approach is able to predict all the sites that have been experimentally proved to desensitize allosteric regulation of the enzyme. In addition, the signal transduction network shows a clear preference for specific structural regions, secondary structural types and residue conservation. Occurrence of super-hubs in the network indicates that allosteric regulation tends to gather residues with high connection ability to collectively facilitate the signaling process. Furthermore, a new parameter of propagation coefficient is defined to determine the propagation capability of residues within a signal transduction network. In conclusion, the new approach is useful for fundamental understanding of the process of intramolecular signal transduction and thus has significant impact on rational design of novel allosteric proteins.

  20. Dynamic intramolecular regulation of the histone chaperone nucleoplasmin controls histone binding and release.

    Science.gov (United States)

    Warren, Christopher; Matsui, Tsutomu; Karp, Jerome M; Onikubo, Takashi; Cahill, Sean; Brenowitz, Michael; Cowburn, David; Girvin, Mark; Shechter, David

    2017-12-20

    Nucleoplasmin (Npm) is a highly conserved histone chaperone responsible for the maternal storage and zygotic release of histones H2A/H2B. Npm contains a pentameric N-terminal core domain and an intrinsically disordered C-terminal tail domain. Though intrinsically disordered regions are common among histone chaperones, their roles in histone binding and chaperoning remain unclear. Using an NMR-based approach, here we demonstrate that the Xenopus laevis Npm tail domain controls the binding of histones at its largest acidic stretch (A2) via direct competition with both the C-terminal basic stretch and basic nuclear localization signal. NMR and small-angle X-ray scattering (SAXS) structural analyses allowed us to construct models of both the tail domain and the pentameric complex. Functional analyses demonstrate that these competitive intramolecular interactions negatively regulate Npm histone chaperone activity in vitro. Together these data establish a potentially generalizable mechanism of histone chaperone regulation via dynamic and specific intramolecular shielding of histone interaction sites.

  1. EVAPORATION: a new vapour pressure estimation methodfor organic molecules including non-additivity and intramolecular interactions

    Directory of Open Access Journals (Sweden)

    S. Compernolle

    2011-09-01

    Full Text Available We present EVAPORATION (Estimation of VApour Pressure of ORganics, Accounting for Temperature, Intramolecular, and Non-additivity effects, a method to predict (subcooled liquid pure compound vapour pressure p0 of organic molecules that requires only molecular structure as input. The method is applicable to zero-, mono- and polyfunctional molecules. A simple formula to describe log10p0(T is employed, that takes into account both a wide temperature dependence and the non-additivity of functional groups. In order to match the recent data on functionalised diacids an empirical modification to the method was introduced. Contributions due to carbon skeleton, functional groups, and intramolecular interaction between groups are included. Molecules typically originating from oxidation of biogenic molecules are within the scope of this method: aldehydes, ketones, alcohols, ethers, esters, nitrates, acids, peroxides, hydroperoxides, peroxy acyl nitrates and peracids. Therefore the method is especially suited to describe compounds forming secondary organic aerosol (SOA.

  2. The role of hydrogen bonding in excited state intramolecular charge transfer.

    Science.gov (United States)

    Chipem, Francis A S; Mishra, Anasuya; Krishnamoorthy, G

    2012-07-07

    Intramolecular charge transfer (ICT) that occurs upon photoexcitation of molecules is a vital process in nature and it has ample applications in chemistry and biology. The ICT process of the excited molecules is affected by several environmental factors including polarity, viscosity and hydrogen bonding. The effect of polarity and viscosity on the ICT processes is well understood. But, despite the fact that hydrogen bonding significantly influences the ICT process, the specific role of hydrogen bonding in the formation and stabilization of the ICT state is not unambiguously established. Some literature reports predicted that the hydrogen bonding of the solvent with a donor promotes the formation of a twisted intramolecular charge transfer (TICT) state. Some other reports stated that it inhibits the formation of the TICT state. Alternatively, it was proposed that the hydrogen bonding of the solvent with an acceptor favors the TICT state. It is also observed that a dynamic equilibrium is established between the free and the hydrogen bonded ICT states. This perspective focuses on the specific role played by hydrogen bonding of the solvent with the donor and the acceptor, and by proton transfer in the ICT process. The utility of such influence in molecular recognition and anion sensing is discussed with a few recent literature examples in the end.

  3. Visible absorbing croconium dyes with intramolecular hydrogen bonding: A combined experimental and computational study

    Science.gov (United States)

    Prabhakar, Ch.; Promila; Tripathi, Anuj; Bhanuprakash, K.; Jayathirtharao, V.

    2017-10-01

    Croconium molecules CR1-CR4 with break-in conjugation (Csbnd N Bonding) was synthesized by condensation of croconic acid and arylamines. By using combined experimental and theoretical methods like UV-visible spectra, DFT and TDDFT studies, we have characterized electronic absorption properties. The reported molecules are having absorption in visible region ranging from 450 to 550 nm with large extinction coefficient (2.5-5.0 × 104 M-1 cm-1). We find that CR2 and CR4 are showing 50 to 100 nm red shifted absorption than CR1 and CR3. This red shift is possibly due to presence of intramolecular hydrogen bonding in CR2 and CR4. Further this is supported by DFT studies, in case of CR2 and CR4 shows strong intramolecular hydrogen bonding between oxygen of carboxylate group (at ortho position of phenyl ring) and hydrogen of nitrogen attached to the central croconate ring. It is also observed that, there is small diradicaloid character in these molecules. This study is helpful in design and synthesis of new croconium dyes which are useful in materials applications.

  4. Regioselective Synthesis of Procyanidin B6, A 4-6-Condensed (+-Catechin Dimer, by Intramolecular Condensation

    Directory of Open Access Journals (Sweden)

    Yusuke Higashino

    2018-01-01

    Full Text Available Proanthocyanidins, also known as condensed tannins or oligomeric flavonoids, are found in many edible plants and exhibit interesting biological activities. Herein, we report a new, simple method for the stereoselective synthesis of procyanidin B6, a (+-catechin-(4-6-(+-catechin dimer, by Lewis acid-catalyzed intramolecular condensation. The 5-O-t-butyldimethylsilyl (TBDMS group of 5,7,3′4′-tetra-O-TBDMS-(+-catechin was regioselectively removed using trifluoroacetic acid, leading to the “regio-controlled” synthesis of procyanidin B6. The 5-hydroxyl group of the 7,3′,4′-tri-O-TBDMS-(+-catechin nucleophile and the 3-hydroxyl group of 5,7,3′,4′-tetra-O-benzylated-(+-catechin electrophile were connected with an azelaic acid. The subsequent SnCl4-catalyzed intramolecular condensation proceeded smoothly to give the 4-6-condensed catechin dimer. This is the first report on the complete regioselective synthesis of a 4-6-connected oligomer without modifying the 8-position.

  5. Instantaneous normal mode analysis for intermolecular and intramolecular vibrations of water from atomic point of view

    Science.gov (United States)

    Chen, Yu-Chun; Tang, Ping-Han; Wu, Ten-Ming

    2013-11-01

    By exploiting the instantaneous normal mode (INM) analysis for models of flexible molecules, we investigate intermolecular and intramolecular vibrations of water from the atomic point of view. With two flexible SPC/E models, our investigations include three aspects about their INM spectra, which are separated into the unstable, intermolecular, bending, and stretching bands. First, the O- and H-atom contributions in the four INM bands are calculated and their stable INM spectra are compared with the power spectra of the atomic velocity autocorrelation functions. The unstable and intermolecular bands of the flexible models are also compared with those of the SPC/E model of rigid molecules. Second, we formulate the inverse participation ratio (IPR) of the INMs, respectively, for the O- and H-atom and molecule. With the IPRs, the numbers of the three species participated in the INMs are estimated so that the localization characters of the INMs in each band are studied. Further, by the ratio of the IPR of the H atom to that of the O atom, we explore the number of involved OH bond per molecule participated in the INMs. Third, by classifying simulated molecules into subensembles according to the geometry of their local environments or their H-bond configurations, we examine the local-structure effects on the bending and stretching INM bands. All of our results are verified to be insensible to the definition of H-bond. Our conclusions about the intermolecular and intramolecular vibrations in water are given.

  6. Redox-Tag Processes: Intramolecular Electron Transfer and Its Broad Relationship to Redox Reactions in General.

    Science.gov (United States)

    Okada, Yohei; Chiba, Kazuhiro

    2017-12-08

    Explosive growth in the use of open shell reactivity, including neutral radicals and radical ions, in the field of synthetic organic chemistry has been observed in the past decade, particularly since the advent of ruthenium complexes in 2008. These complexes generally induce single-electron transfer (SET) processes via visible-light absorption. Additionally, recent significant advancements in organic electrochemistry involving SET processes to provide open shell reactivity offer a complementary method to traditional polarity-driven reactions described by two-electron transfer processes. In this Review, we highlight the importance of intramolecular SET processes in the field of synthetic organic chemistry, which seem to be more elusive than the intermolecular versions, since they are net redox-neutral and thus cannot simply be regarded as oxidations or reductions. Such intramolecular SET processes can rationally be understood in combination with concomitant bond formations and/or cleavages, and are regulated by a structural motif that we call a "redox tag." In order to describe modern radical-driven reactions involving SET processes, we focus on a classical formalism in which electrons are treated as particles rather than waves, which offers a practical yet powerful approach to explain and/or predict synthetic outcomes.

  7. Instantaneous normal mode analysis for intermolecular and intramolecular vibrations of water from atomic point of view.

    Science.gov (United States)

    Chen, Yu-Chun; Tang, Ping-Han; Wu, Ten-Ming

    2013-11-28

    By exploiting the instantaneous normal mode (INM) analysis for models of flexible molecules, we investigate intermolecular and intramolecular vibrations of water from the atomic point of view. With two flexible SPC/E models, our investigations include three aspects about their INM spectra, which are separated into the unstable, intermolecular, bending, and stretching bands. First, the O- and H-atom contributions in the four INM bands are calculated and their stable INM spectra are compared with the power spectra of the atomic velocity autocorrelation functions. The unstable and intermolecular bands of the flexible models are also compared with those of the SPC/E model of rigid molecules. Second, we formulate the inverse participation ratio (IPR) of the INMs, respectively, for the O- and H-atom and molecule. With the IPRs, the numbers of the three species participated in the INMs are estimated so that the localization characters of the INMs in each band are studied. Further, by the ratio of the IPR of the H atom to that of the O atom, we explore the number of involved OH bond per molecule participated in the INMs. Third, by classifying simulated molecules into subensembles according to the geometry of their local environments or their H-bond configurations, we examine the local-structure effects on the bending and stretching INM bands. All of our results are verified to be insensible to the definition of H-bond. Our conclusions about the intermolecular and intramolecular vibrations in water are given.

  8. Vibrational Spectroscopy of Intramolecular Hydrogen Bonds in the Infrared and Near-Infrared Regions

    DEFF Research Database (Denmark)

    Schrøder, Sidsel Dahl

    and 1,4-diaminobutane). Experimentally, the hydrogen bonds have been studied with vibrational spectroscopy in the infrared and near-infrared regions. The focus is primarily on spectra recorded in the near-infrared regions, which in these studies are dominated by O-H and N-H stretching overtones....... Overtone spectra have been recorded with intracavity laser photoacoustic laser spectroscopy and conventional long path absorption spectroscopy. Theoretically, a combination of electronic structure calculations and local mode models have been employed to guide the assignment of bands in the vibrational......,4-diaminobutane, no sign of intramolecular N-H···N hydrogen bonds were identified in the overtone spectra. However, theoretical analyzes indicate that intramolecular N-H···N hydrogen bonds are present in all three diamines if two hydrogen atoms on one of the methylene groups are substituted with triuoromethyl...

  9. On the nature of intramolecular vibrational energy transfer in dense molecular environments

    Energy Technology Data Exchange (ETDEWEB)

    Benten, Rebekka S. von [Institut fuer Physikalische Chemie der Universitaet Goettingen, Tammannstrasse 6, D-37077 Goettingen (Germany); Abel, Bernd, E-mail: Bernd.Abel@uni-lepzig.de [Wilhelm-Ostwald-Institut fuer Physikalische und Theoretische Chemie, Universitaet Leipzig, Linne-Strasse 2, D-04103 Leipzig (Germany)

    2010-12-09

    Graphical abstract: Mechanisms of IVR in multi-tiers of intramolecular energy levels in different molecular environments are investigated. - Abstract: Transient femtosecond-IR-pump-UV-absorption probe-spectroscopy has been employed to shed light on the nature of intramolecular vibrational energy transfer (IVR) in dense molecular environments ranging from the diluted gas phase to the liquid. A general feature in our experiments and those of others is that IVR proceeds via multiple timescales if overtones or combination vibrations of high frequency modes are excited. It has been found that collisions enhance IVR if its (slower) timescales can compete with collisions. This enhancement is, however, much more weaker and rather inefficient as opposed to the effect of collisions on intermolecular energy transfer which is well known. In a series of experiments we found that IVR depends not significantly on the average energy transferred in a collision but rather on the number of collisions. The collisions are much less efficient in affecting IVR than VET. We conclude that collision induced broadening of vibrational energy levels reduces the energy gaps and enhances existing couplings between tiers. The present results are an important step forward to rationalize and understand apparently different and not consistent results from different groups on different molecular systems between gas and liquid phases.

  10. Multiwall nanotubes with intramolecular junctions (CNx/C): Preparation, rectification, logic gates, and application

    Science.gov (United States)

    Hu, Ping'an; Xiao, Kai; Liu, Yunqi; Yu, Gui; Wang, Xianbao; Fu, Lei; Cui, Guanglei; Zhu, Daoben

    2004-06-01

    We prepared a large quantity of multiwall nanotubes with intramolecular junctions (CNx/C) by pyrolysis of iron phthalocyanine with or without an inlet of ammonia gas. The nanotubes consist of two sections, one section made of carbon nitride featuring bamboo-like structure and the other one made of carbon featuring empty hollow cylinder structure, and thus the intramolecular junctions were formed in the middle as a result of being doped or undoped with nitrogen. Nanodiode based on a single CNx/C junction shows reproducible rectifying behavior with a rectification ratio of 1.3×103 at ±2 V. In addition, the nanodiode demonstrated as a half-wave rectifier worked at an input sine wave of 1 kHz. Two CNx/C junctions were configured together to exhibit functions of OR and AND logic gates. Moreover, after substituting the wave-detection silicon diode in common transistor radio set with our nanodiode, the radio set still worked normally, representing an important step toward the potential application for nano-scale devices.

  11. An excited-state intramolecular photon transfer fluorescence probe for localizable live cell imaging of cysteine

    Science.gov (United States)

    Liu, Wei; Chen, Wen; Liu, Si-Jia; Jiang, Jian-Hui

    2017-03-01

    Small molecule probes suitable for selective and specific fluorescence imaging of some important but low-concentration intracellular reactive sulfur species such as cysteine (Cys) pose a challenge in chemical biology. We present a readily available, fast-response fluorescence probe CHCQ-Ac, with 2-(5‧-chloro-2-hydroxyl-phenyl)-6-chloro-4(3 H)-quinazolinone (CHCQ) as the fluorophore and acrylate group as the functional moiety, that enables high-selectivity and high-sensitivity for detecting Cys in both solution and biological system. After specifically reacted with Cys, the probe undergoes a seven-membered intramolecular cyclization and released the fluorophore CHCQ with excited-state intramolecular photon transfer effect. A highly fluorescent, insoluble aggregate was then formed to facilitate high-sensitivity and high-resolution imaging. The results showed that probe CHCQ-Ac affords a remarkably large Stokes shift and can detect Cys under physiological pH condition with no interference from other analytes. Moreover, this probe was proved to have excellent chemical stability, low cytotoxicity and good cell permeability. Our design of this probe provides a novel potential tool to visualize and localize cysteine in bioimaging of live cells that would greatly help to explore various Cys-related physiological and pathological cellular processes in cell biology and diagnostics.

  12. Estimating the energy of intramolecular hydrogen bonds from1H NMR and QTAIM calculations.

    Science.gov (United States)

    Afonin, Andrei V; Vashchenko, Alexander V; Sigalov, Mark V

    2016-11-29

    The values of the downfield chemical shift of the bridge hydrogen atom were estimated for a series of compounds containing an intramolecular hydrogen bond O-HO, O-HN, O-HHal, N-HO, N-HN, C-HO, C-HN and C-HHal. Based on these values, the empirical estimation of the hydrogen bond energy was obtained by using known relationships. For the compounds containing an intramolecular hydrogen bond, the DFT B3LYP/6-311++G(d,p) method was used both for geometry optimization and for QTAIM calculations of the topological parameters (electron density ρ BCP and the density of potential energy V in the critical point of the hydrogen bond). The calculated geometric and topological parameters of hydrogen bonds were also used to evaluate the energy of the hydrogen bond based on the equations from the literature. Comparison of calibrating energies from the 1 H NMR data with the energies predicted by calculations showed that the most reliable are the linear dependence on the topological ρ BCP and V parameters. However, the correct prediction of the hydrogen bond energy is determined by proper fitting of the linear regression coefficients. To obtain them, new linear relationships were found between the calculated ρ BCP and V parameters and the hydrogen bond energies obtained from empirical 1 H NMR data. These relationships allow the comparison of the energies of different types of hydrogen bonds for various molecules and biological ensembles.

  13. Characteristics of Intramolecular Charge Transfer by J-Aggregates in Merocyanine Dye LB Films.

    Science.gov (United States)

    Yang, Chang Heon; Kwon, Young-Soo; Shin, Hoon-Kyu

    2016-06-01

    In this study, for the development of future molecular electronic devices, we have investigated the characteristics of the aggregates of Langmuir-Blodgett films. The characteristics of intramolecular charge transfer by J-aggregates in merocyanine dye LB films have been studied experimentally by using UV irradiation and heat treatment. In addition to intramolecular charge transfer, we also studied the conjugation and energy changes of the molecules. In case a dye is thinned by LB method, the alkyl chain is often displaced in order to form a mono-molecular film with ease. Since the molecular association form is often made by self-organization of molecules themselves, in case the dye and the alkyl chain are strongly bonded by the covalent bond, it may be said that the properties of the LB film to be built up are almost determined at the time of synthesis of film-forming molecules. Meanwhile, since, in case LB film is fabricated by the diffusion absorption method, the cohesive force between the water-soluble dye and the surface-active mono-molecular film is electrostatic, the dye molecule can move relatively freely on the air/water interface, which may be regarded as a two-dimensional crystal growth process.

  14. Intramolecular proton transfer and tunnelling reactions of hydroxyphenylbenzoxazole derivatives in Xenon at 15 K

    Energy Technology Data Exchange (ETDEWEB)

    Walla, Peter J. [Max-Planck-Institute for Biophysical Chemistry, Department 010, Spectroscopy and Photochemical Kinetics, Am Fassberg 11, D-37077 Goettingen (Germany) and Department for Biophysical Chemistry, Technical University of Brunswick, Institute for Physical and Theoretical Chemistry, Hans-Sommerstr. 10, D-38106 Braunschweig (Germany)]. E-mail: pwalla@gwdg.de; Nickel, Bernhard [Max-Planck-Institute for Biophysical Chemistry, Department 010, Spectroscopy and Photochemical Kinetics, Am Fassberg 11, D-37077 Goettingen (Germany)

    2005-06-06

    We investigated the site dependence and the tunnelling processes of the intramolecular proton and deuteron transfer in the triplet state of the compounds 2-(2'-hydroxy-4'-methylphenyl)benzoxazole (m-MeHBO) and 2-(2'-hydroxy-3'-methylphenyl)benzoxazoles (o-MeHBO) and their deuterio-oxy analogues in a solid xenon matrix. After singlet excitation there occurs an ultrafast intramolecular enol {yields} keto proton transfer and subsequent intersystem crossing mainly to the keto triplet state. In the triplet state of m-MeHBO, the proton transfer back to the lower enol triplet state is governed by tunnelling processes. In o-MeHBO, however, the enol triplet state is higher and therefore normally no tunnel reaction can be observed. Because of the external heavy atom-effect in a xenon matrix, we were able to investigate the reverse enol-keto-tunnelling after exciting directly the enol triplet state of deuterated o-MeHBO. The time constants of the reverse enol-keto tautomerization are similar to those of the normal keto-enol tautomerization. In a xenon matrix, the observed site-selective phosphorescence spectra are very well-resolved vibrationally. This allowed the study of the tunnel rates in different well-defined sites. The vibrational energies obtained in the spectra are in good agreement with vibrational energies found in resonant Raman and IR spectra of 2-(2'-hydroxyphenyl)benzoxazole (HBO)

  15. Hydroxyalkoxy radicals: importance of intramolecular hydrogen bonding on chain branching reactions in the combustion and atmospheric decomposition of hydrocarbons.

    Science.gov (United States)

    Davis, Alexander C; Francisco, Joseph S

    2014-11-20

    During both the atmospheric oxidation and combustion of volatile organic compounds, sequential addition of oxygen can lead to compounds that contain multiple hydrogen-bonding sites. The presence of two or more of these sites on a hydrocarbon introduces the possibility of intramolecular H-bonding, which can have a stabilizing effect on the reactants, products, and transition states of subsequent reactions. The present work compares the absolute energies of two sets of conformations, those that contain intramolecular H-bonds and those that lack intramolecular H-bonds, for each reactant, product, and transition state species in the 1,2 through 1,7 H-migrations and Cα-Cβ, Cα-H, and Cα-OH-bond scission reactions in the n-hydroxyeth-1-oxy through n-hydroxyhex-1-oxy radicals, for n ranging from 1 to 6. The difference in energy between the two conformations represents the balance between the stabilizing effects of H-bonds and the steric cost of bringing the two H-bonding sites together. The effect of intramolecular H-bonding and the OH group is assessed by comparing the net intramolecular H-bond stabilization energies, the reaction enthalpies, and barrier heights of the n-hydroxyalkoxy radical reactions with the corresponding alkoxy radicals values. The results suggest that there is a complex dependence on the location of the two H-bonding groups, the location of the abstraction or bond scission, and the shape of the transition state that dictates the extent to which intramolecular H-bonding effects the relative importance of H-migration and bond scission reactions for each n-hydroxyalkoxy radical. These findings have important implications for future studies on hydrocarbons with multiple H-bonding sites.

  16. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...... on transcriptional evidence. Analysis of repetitive sequences suggests that they are underrepresented in the reference assembly, reflecting an enrichment of gene-rich regions in the current assembly. Characterization of Lotus natural variation by resequencing of L. japonicus accessions and diploid Lotus species...... is currently ongoing, facilitated by the MG20 reference sequence...

  17. Modeling and computations of the intramolecular electron transfer process in the two-heme protein cytochrome c4

    DEFF Research Database (Denmark)

    Natzmutdinov, Renat R.; Bronshtein, Michael D.; Zinkicheva, Tamara T.

    2012-01-01

    ligands in both low- and high-spin states by structure-optimized DFT. The computations enable estimating the intramolecular reorganization energy of the ET process for different combinations of low- and high-spin heme couples. Environmental reorganization free energies, work terms (‘‘gating’’) and driving...... performed computational modeling of the intramolecular ET process by a combination of density functional theory (DFT) and quantum mechanical charge transfer theory to disclose reasons for this difference. We first address the electronic structures of the model heme core with histidine and methionine axial...

  18. Novel molecular targets for kRAS downregulation: promoter G-quadruplexes

    Science.gov (United States)

    2016-11-01

    monitor the effect of G4 formation, rather than mutating the promoter sequence. We screened the Diversity Set II and III from the National Cancer...Bgl I (kRAS-500 plasmid) or Nhe I (all kRAS-324 plasmids) and HIND III cut sites. kRAS-324 was con- structed by Operon; the kRAS-500, 324 mt Near, and...molecular targets for breast cancer therapeutics, Molecules ( Basel , Switz.) 18 (2013) 15019–15034. [38] T.C. He, A.B. Sparks, C. Rago, H. Hermeking

  19. Enantiodivergent synthesis of either enantiomer of ABCDE-ring analogue of antitumor antibiotic fredericamycin A via intramolecular [4 + 2] cycloaddition approach.

    Science.gov (United States)

    Akai, S; Tsujino, T; Fukuda, N; Iio, K; Takeda, Y; Kawaguchi Ki, K; Naka, T; Higuchi, K; Kita, Y

    2001-12-13

    [reaction: see text] An intramolecular enantiodivergent synthesis of both enantiomers of the ABCDE-ring analogue 22 of fredericamycin A is reported. Key steps involve an intramolecular [4 + 2] cycloaddition of 17 and an aromatic Pummerer-type reaction of 19. A lipase-catalyzed enantioselective desymmetrization of prochiral diol 2 using 1-ethoxyvinyl 2-furoate 3 led to the pivotal intermediate (R)-4.

  20. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Revaud, D.

    2009-06-01

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  1. Structural effects on the electronic characteristics of intramolecularly intercalated alkali-rubrene complexes

    Energy Technology Data Exchange (ETDEWEB)

    Li, Tsung-Lung, E-mail: quantum@mail.ncyu.edu.tw [Department of Electrophysics, National Chia-Yi University, 300 Hsueh-Fu Road, Chiayi, 60004, Taiwan, ROC (China); Lu, Wen-Cai, E-mail: wencailu@jlu.edu.cn [Laboratory of Fiber Materials and Modern Textile, Growing Base for State Key Laboratory, College of Physics, Qingdao University, Qingdao, Shandong 266071 (China); State Key Laboratory of Theoretical and Computational Chemistry, Institute of Theoretical Chemistry, Jilin University, Changchun, Jilin 130021 (China)

    2016-11-01

    The geometric and electronic structures of neutral monolithium- and monosodium-rubrene (Li{sub 1} Rub and Na{sub 1} Rub) isomers are investigated and compared with monopotassium-rubrene (K{sub 1} Rub). Based on the alkali binding site, all isomers of these alkali-rubrene complexes can be subdivided into two types: intramolecularly intercalated and extramolecularly adsorbed. The minimum-energy Li{sub 1} Rub and Na{sub 1} Rub are intercalated structures, whereas the minimum-energy K{sub 1} Rub is adsorbed. The fact that the intercalated Li{sub 1} Rub and Na{sub 1} Rub structures are energetically favorable over the adsorbed ones can be explained by two energy rules. First, “double” proximity of the intercalating alkali element to a pair of phenyl side groups enormously reduces the total energy. Second, accommodation of a minuscule intercalant does not significantly deform the carbon frame and, thus, increases the energy only by a small amount. Additionally, the peculiar effects of intramolecular intercalation on the electronic structures of molecules are also studied in this simulation of monoalkali intercalation. In the monoalkali-intercalated rubrene complex, only one of the two pairs of phenyl groups of rubrene is intercalated, intentionally leaving another pair pristine, which facilitates the comparison of electronic structures between the intercalated and pristine pairs of phenyl side groups in a single molecule. The uniformity of chemical environments of the phenyl groups of the intercalated Li{sub 1} Rub/Na{sub 1} Rub is deteriorated by the incorporation of the intercalant, and leads to their spectral characteristics in contrast to K{sub 1} Rub. In particular, the introduction of the intercalant promotes the carbon 2p orbitals of the intercalated phenyl pair to take part in the electronic structures of the HOMO and LUMO peaks of Li{sub 1} Rub/Na{sub 1} Rub. The unpaired electron in the HOMO is delocalized over the backbone with higher probability of

  2. Structural effects on the electronic characteristics of intramolecularly intercalated alkali-rubrene complexes

    International Nuclear Information System (INIS)

    Li, Tsung-Lung; Lu, Wen-Cai

    2016-01-01

    The geometric and electronic structures of neutral monolithium- and monosodium-rubrene (Li 1 Rub and Na 1 Rub) isomers are investigated and compared with monopotassium-rubrene (K 1 Rub). Based on the alkali binding site, all isomers of these alkali-rubrene complexes can be subdivided into two types: intramolecularly intercalated and extramolecularly adsorbed. The minimum-energy Li 1 Rub and Na 1 Rub are intercalated structures, whereas the minimum-energy K 1 Rub is adsorbed. The fact that the intercalated Li 1 Rub and Na 1 Rub structures are energetically favorable over the adsorbed ones can be explained by two energy rules. First, “double” proximity of the intercalating alkali element to a pair of phenyl side groups enormously reduces the total energy. Second, accommodation of a minuscule intercalant does not significantly deform the carbon frame and, thus, increases the energy only by a small amount. Additionally, the peculiar effects of intramolecular intercalation on the electronic structures of molecules are also studied in this simulation of monoalkali intercalation. In the monoalkali-intercalated rubrene complex, only one of the two pairs of phenyl groups of rubrene is intercalated, intentionally leaving another pair pristine, which facilitates the comparison of electronic structures between the intercalated and pristine pairs of phenyl side groups in a single molecule. The uniformity of chemical environments of the phenyl groups of the intercalated Li 1 Rub/Na 1 Rub is deteriorated by the incorporation of the intercalant, and leads to their spectral characteristics in contrast to K 1 Rub. In particular, the introduction of the intercalant promotes the carbon 2p orbitals of the intercalated phenyl pair to take part in the electronic structures of the HOMO and LUMO peaks of Li 1 Rub/Na 1 Rub. The unpaired electron in the HOMO is delocalized over the backbone with higher probability of distributing over the central two fused rings than over the outer two

  3. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  4. Intramolecular Valence and Spin Interaction in meso and rac Diastereomers of a p-Quinonoid-Bridged Diruthenium Complex

    Czech Academy of Sciences Publication Activity Database

    Kumbhakar, D.; Sarkar, B.; Maji, S.; Mobin, S. M.; Fiedler, Jan; Urbanos, F. A.; Jimenez-Aparicio, R.; Kaim, W.; Lahiri, G. K.

    2008-01-01

    Roč. 130, č. 51 (2008), s. 17575-17583 ISSN 0002-7863 R&D Projects: GA MŠk OC 139; GA MŠk LC510 Institutional research plan: CEZ:AV0Z40400503 Keywords : intramolecular valence * spin interaction * diruthenium complex Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 8.091, year: 2008

  5. On Hydrogen Bonding in the Intramolecularly Chelated Taitomers of Enolic Malondialdehyde and its Mono- and Dithio-Analogues

    DEFF Research Database (Denmark)

    Carlsen, Lars; Duus, Fritz

    1980-01-01

    The intramolecular hydrogen bondings in enolic malondialdehyde and it mono- and dithio-analogues have been evaluated by a semiempricial SCF–MO–CNDO method. The calculations predict that the hydrogen bonds play an important part in the stabilities of malondialdehyde and monothiomalondialdehyde...

  6. Modeling and computations of the intramolecular electron transfer process in the two-heme protein cytochrome c4

    DEFF Research Database (Denmark)

    Natzmutdinov, Renat R.; Bronshtein, Michael D.; Zinkicheva, Tamara T.

    2012-01-01

    The di-heme protein Pseudomonas stutzeri cytochrome c4 (cyt c4) has emerged as a useful model for studying long-range protein electron transfer (ET). Recent experimental observations have shown a dramatically different pattern of intramolecular ET between the two heme groups in different local...

  7. Enantioselective synthesis of benzofurans and benzoxazines via an olefin cross-metathesis-intramolecular oxo-Michael reaction.

    Science.gov (United States)

    Zhang, Jun-Wei; Cai, Quan; Gu, Qing; Shi, Xiao-Xin; You, Shu-Li

    2013-09-11

    Chiral phosphoric acid and Hoveyda-Grubbs II were found to catalyze an olefin cross-metathesis-intramolecular oxo-Michael cascade reaction of the ortho-allylphenols and enones to provide a variety of benzofuran and benzoxazine derivatives in moderate to good yields and enantioselectivity.

  8. The effect of driving force on intramolecular electron transfer in proteins. Studies on single-site mutated azurins

    DEFF Research Database (Denmark)

    Farver, O; Skov, L K; van de Kamp, M

    1992-01-01

    An intramolecular electron-transfer process has previously been shown to take place between the Cys3--Cys26 radical-ion (RSSR-) produced pulse radiolytically and the Cu(II) ion in the blue single-copper protein, azurin [Farver, O. & Pecht, I. (1989) Proc. Natl Acad. Sci. USA 86, 6868-6972]. To fu...

  9. Asymmetric Synthesis of (-)-Incarvillateine Employing an Intramolecular Alkylation via Rh-Catalyzed Olefinic C-H Bond Activation

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, Andy; Bergman, Robert; Ellman, Jonathan

    2008-02-18

    An asymmetric total synthesis of (-)-incarvillateine, a natural product having potent analgesic properties, has been achieved in 11 steps and 15.4% overall yield. The key step is a rhodium-catalyzed intramolecular alkylation of an olefinic C-H bond to set two stereocenters. Additionally, this transformation produces an exocyclic, tetrasubstituted alkene through which the bicyclic piperidine moiety can readily be accessed.

  10. Environment-sensitive quinolone demonstrating long-lived fluorescence and unusually slow excited-state intramolecular proton transfer kinetics

    Czech Academy of Sciences Publication Activity Database

    Zamotaiev, O. M.; Shvadchak, Volodymyr; Sych, T. P.; Melnychuk, N. A.; Yushchenko, Dmytro A.; Mely, Y.; Pivovarenko, V. G.

    2016-01-01

    Roč. 4, č. 3 (2016), č. článku 034004. ISSN 2050-6120 Institutional support: RVO:61388963 Keywords : quinolone * fluorescent probes * local polarity * hydration * excited-state intramolecular proton transfer * kinetics Subject RIV: CC - Organic Chemistry Impact factor: 2.656, year: 2016

  11. Bifunctional ferrocene-based squaramide-phosphine as an organocatalyst for highly enantioselective intramolecular Morita-Baylis-Hillman reaction.

    Science.gov (United States)

    Zhang, Xiaorui; Ma, Pengfei; Zhang, Dongxu; Lei, Yang; Zhang, Shengyong; Jiang, Ru; Chen, Weiping

    2014-04-21

    This work demonstrates that, in accord with metal catalysis, ferrocene could be an excellent scaffold for organocatalysts. The simple and easily accessible bifunctional ferrocene-based squaramide-phosphine shows high enantioselectivity in the intramolecular Morita-Baylis-Hillman reaction of 7-aryl-7-oxo-5-heptenals, giving a variety of 2-aroyl-2-cyclohexenols in up to 96% ee.

  12. Intramolecular TAT triplex in (dA).sub.58. (dT).sub.58. Influence of ions

    Czech Academy of Sciences Publication Activity Database

    Pečinka, Petr; Huertas, D.; Azorín, F.; Paleček, Emil

    1995-01-01

    Roč. 13, č. 1 (1995), s. 029-046 ISSN 0739-1102 R&D Projects: GA AV ČR IAA504402; GA ČR GA204/93/2336 Keywords : intramolecular triplex * H-DNA * chemical probing * osmium tetroxide complex * DEPC Impact factor: 1.528, year: 1995

  13. Deuterium isotope effect on the intramolecular electron transfer in Pseudomonas aeruginosa azurin

    DEFF Research Database (Denmark)

    Farver, O.; Zhang, Jingdong; Chi, Qijin

    2001-01-01

    -0' is also different, yielding entropy changes of -57 J K-1 mol-l in water and -84 J K-1 mol(-1) in deuterium oxide. The driving force difference of 10 mV is in keeping with the kinetic isotope effect, but the contribution to DeltaS(double dagger) from the temperature dependence of E-0' is positive......Intramolecular electron transfer in azurin in water and deuterium oxide has been studied over a broad temperature range. The kinetic deuterium isotope effect, k(H)/k(D), is smaller than unity (0.7 at 298 K), primarily caused by the different activation entropies in water (-56.5 J K-1 mol(-1...... entropy difference and to compensate for the different temperature dependencies of E-0'. Thus, differences in driving force and thermal expansion appear as the most straightforward rationale for the observed isotope effect....

  14. Cp*Rh(III)/Bicyclic Olefin Cocatalyzed C-H Bond Amidation by Intramolecular Amide Transfer.

    Science.gov (United States)

    Wang, Xiaoming; Gensch, Tobias; Lerchen, Andreas; Daniliuc, Constantin G; Glorius, Frank

    2017-05-10

    A bicyclic olefin was discovered as a cocatalyst in a Cp*Rh(III)-catalyzed C-H bond amidation proceeding by an intramolecular amide transfer in N-phenoxyacetamide derivatives. Combining experimental and theoretical studies, we propose that the olefin promotes a Rh(III) intermediate to undergo oxidative addition into the O-N bond to form a Rh(V) nitrenoid species and subsequently direct the nitrenoid to add to the ortho position. The amide directing group plays a dual role as a cleavable coordinating moiety as well as an essential coupling partner for the C-H amidation. This methodology was successfully applied to the late-stage diversification of natural products and a marketed drug under mild conditions.

  15. Di- and sesquiterpenoids from Cystoseira genus: structure, intra-molecular transformations and biological activity.

    Science.gov (United States)

    Gouveia, Vera; Seca, Ana M L; Barreto, M Carmo; Pinto, Diana C G A

    2013-06-01

    Natural products have been the single most productive source of leads for the development of drugs, because of the great variety of their chemical structures. Previous chemical investigation of members of the genus Cystoseira resulted in the discovery of various bioactive secondary metabolites. The secondary metabolites isolated and characterized are very interesting, both from the biological activity and structural complexity points of view, which make this genus an attractive target for further investigations. The present review covers the research progress on natural products isolated from this genus since January 1995 until now, concerning the isolation and structural elucidation of the secondary metabolites from Cystoseira species. In this contribution significant biological properties are briefly discussed. Simultaneously, we gradually construct an intra-molecular pathway that logically interrelates the isolated compounds.

  16. Electron capture dissociation proceeds with a low degree of intramolecular migration of peptide amide hydrogens

    DEFF Research Database (Denmark)

    Rand, Kasper D; Adams, Christopher M; Zubarev, Roman A

    2008-01-01

    ECD using peptides with a unique selective deuterium incorporation. Our results show that only limited amide hydrogen migration occurs upon ECD, provided that vibrational excitation prior to the electron capture event is minimized. Peptide ions that are excessively vibrationally excited......Hydrogen (1H/2H) exchange combined with mass spectrometry (HX-MS) has become a recognized method for the analysis of protein structural dynamics. Presently, the incorporated deuterons are typically localized by enzymatic cleavage of the labeled proteins and single residue resolution is normally...... only obtained for a few residues. Determination of site-specific deuterium levels by gas-phase fragmentation in tandem mass spectrometers would greatly increase the applicability of the HX-MS method. The biggest obstacle in achieving this goal is the intramolecular hydrogen migration (i.e., hydrogen...

  17. Photophysical Model of 10-Hydroxybenzo[h]quinoline: Internal Conversion and Excited State Intramolecular Proton Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Junghwa; Joo, Taiha [Pohang Univ. of Science and Technology, Pohang (Korea, Republic of)

    2014-03-15

    Photophysics of 10-hydroxybenzo[h]quinoline (HBQ) has been in controversy, in particular, on the nature of the electronic states before and after the excited state intramolecular proton transfer (ESIPT), even though the dynamics and mechanism of the ESIPT have been well established. We report highly time resolved fluorescence spectra over the full emission frequency regions of the enol and keto isomers and the anisotropy in time domain to determine the accurate rates of the population decay, spectral relaxation and anisotropy decay of the keto isomer. We have shown that the ∼300 fs component observed frequently in ESIPT dynamics arises from the S{sub 2}→S{sub 1} internal conversion in the reaction product keto isomer and that the ESIPT occurs from the enol isomer in S{sub 1} state to the keto isomer in S{sub 2} state.

  18. Intramolecular synergistic effect of glutamic acid, cysteine and glycine against copper corrosion in hydrochloric acid solution

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Daquan, E-mail: zhdq@sh163.net [Department of Environmental Engineering, Shanghai University of Electric Power, Shanghai 200090 (China); Xie Bin; Gao Lixin; Cai Qirui [Department of Environmental Engineering, Shanghai University of Electric Power, Shanghai 200090 (China); Joo, Hyung Goun; Lee, Kang Yong [Stress Analysis and Failure Design Laboratory, School of Mechanical Engineering, Yonsei University, Seoul 120-749 (Korea, Republic of)

    2011-10-31

    The corrosion protection of copper by glutamic acid, cysteine, glycine and their derivative (glutathione) in 0.5 M hydrochloric acid solution has been studied by the electrochemical impedance spectroscopy and cyclic voltammetry. The inhibition efficiency of the organic inhibitors on copper corrosion increases in the order: glutathione > cysteine > cysteine + glutamic acid + glycine > glutamic acid > glycine. Maximum inhibition efficiency for cysteine reaches about 92.9% at 15 mM concentration level. The glutathione can give 96.4% inhibition efficiency at a concentration of 10 mM. The molecular structure parameters were obtained by PM3 (Parametric Method 3) semi-empirical calculation. The intramolecular synergistic effect of glutamic acid, cysteine and glycine moieties in glutathione is attributed to the lower energy of the lowest unoccupied molecular orbital (E{sub LUMO}) level and to the excess hetero-atom adsorption centers and the bigger coverage on the copper surface.

  19. Unusual NHC-Iridium(I) Complexes and Their Use in the Intramolecular Hydroamination of Unactivated Aminoalkenes

    KAUST Repository

    Sipos, Gellért

    2016-04-10

    N-heterocyclic carbene (NHC) ligands with naphthyl side chains were employed for the synthesis of unsaturated, yet isolable [(NHC)Ir(cod)]+ (cod=1,5-cyclooctadiene) complexes. These compounds are stabilised by an interaction of the aromatic wingtip that leads to a sideways tilt of the NHC-Ir bond. Detailed studies show how the tilting of such N-heterocyclic carbenes affects the electronic shielding properties of the carbene carbon atom and how this is reflected by significant upfield shifts in the 13CNMR signals. When employed in the intramolecular hydroamination, these [(NHC)Ir(cod)]+ species show very high catalytic activity under mild reaction conditions. An enantiopure version of the catalyst system produces pyrrolidines with excellent enantioselectivities. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Controlling Long-Lived Triplet Generation from Intramolecular Singlet Fission in the Solid State

    KAUST Repository

    Pace, Natalie A.

    2017-11-30

    The conjugated polymer poly(benzothiophene dioxide) (PBTDO1) has recently been shown to exhibit efficient intramolecular singlet fission in solution. In this paper, we investigate the role of intermolecular interactions in triplet separation dynamics after singlet fission. We use transient absorption spectroscopy to determine the singlet fission rate and triplet yield in two polymers differing only by side chain motif in both solution and the solid state. Whereas solid-state films show singlet fission rates identical to those measured in solution, the average lifetime of the triplet population increases dramatically, and is strongly dependent on side-chain identity. These results show that it may be necessary to carefully engineer the solid-state microstructure of these “singlet fission polymers” in order to produce the long-lived triplets needed to realize efficient photovoltaic devices.

  1. Intramolecular stabilization of a catalytic [FeFe]-hydrogenase mimic investigated by experiment and theory.

    Science.gov (United States)

    Pandey, Indresh Kumar; Natarajan, Mookan; Faujdar, Hemlata; Hussain, Firasat; Stein, Matthias; Kaur-Ghumaan, Sandeep

    2018-04-03

    The mono-substituted complex [Fe2(CO)5(μ-naphthalene-2-thiolate)2(P(PhOMe-p)3)] was prepared taking after the structural principles from both [NiFe] and [FeFe]-hydrogenase enzymes. Crystal structures are reported for this complex and the all carbonyl analogue. The bridging naphthalene thiolates resemble μ-bridging cysteine amino acids. One of the naphthyl moieties forms π-π stacking interactions with the terminal bulky phosphine ligand in the crystal structure and in calculations. This interaction stabilizes the reduced and protonated forms during electrocatalytic proton reduction in the presence of acetic acid and hinders the rotation of the phosphine ligand. The intramolecular π-π stabilization, the electrochemistry and the mechanism of the hydrogen evolution reaction were investigated using computational approaches.

  2. Inter- and intramolecular aldol reactions promiscuously catalyzed by a proline-based tautomerase.

    Science.gov (United States)

    Rahimi, Mehran; Geertsema, Edzard M; Miao, Yufeng; van der Meer, Jan-Ytzen; van den Bosch, Thea; de Haan, Pim; Zandvoort, Ellen; Poelarends, Gerrit J

    2017-03-28

    The enzyme 4-oxalocrotonate tautomerase (4-OT), which in nature catalyzes a tautomerization step as part of a catabolic pathway for aromatic hydrocarbons, was found to promiscuously catalyze different types of aldol reactions. These include the self-condensation of propanal, the cross-coupling of propanal and benzaldehyde, the cross-coupling of propanal and pyruvate, and the intramolecular cyclizations of hexanedial and heptanedial. Mutation of the catalytic amino-terminal proline (P1A) greatly reduces 4-OT's aldolase activities, whereas mutation of another active site residue (F50A) strongly enhances 4-OT's aldolase activities, indicating that aldolization is an active site process. This catalytic promiscuity of 4-OT could be exploited as starting point to create tailor-made, artificial aldolases for challenging self- and cross-aldolizations.

  3. Voltage Losses in Organic Solar Cells: Understanding the Contributions of Intramolecular Vibrations to Nonradiative Recombinations

    KAUST Repository

    Chen, Xiankai

    2017-12-18

    The large voltage losses usually encountered in organic solar cells significantly limit the power conversion efficiencies (PCEs) of these devices, with the result that the current highest PCE values in single-junction organic photovoltaic remain smaller than for other solar cell technologies, such as crystalline silicon or perovskite solar cells. In particular, the nonradiative recombinations to the electronic ground state from the lowest-energy charge-transfer (CT) states at the donor-acceptor interfaces in the active layer of organic devices, are responsible for a significant part of the voltage losses. Here, to better comprehend the nonradiative voltage loss mechanisms, a fully quantum-mechanical rate formula is employed within the framework of time-dependent perturbation theory, combined with density functional theory. The objective is to uncover the specific contributions of intramolecular vibrations to the CT-state nonradiative recombinations in several model systems, which include small-molecule and polymer donors as well as fullerene and nonfullerene acceptors.

  4. Intramolecular synergistic effect of glutamic acid, cysteine and glycine against copper corrosion in hydrochloric acid solution

    International Nuclear Information System (INIS)

    Zhang Daquan; Xie Bin; Gao Lixin; Cai Qirui; Joo, Hyung Goun; Lee, Kang Yong

    2011-01-01

    The corrosion protection of copper by glutamic acid, cysteine, glycine and their derivative (glutathione) in 0.5 M hydrochloric acid solution has been studied by the electrochemical impedance spectroscopy and cyclic voltammetry. The inhibition efficiency of the organic inhibitors on copper corrosion increases in the order: glutathione > cysteine > cysteine + glutamic acid + glycine > glutamic acid > glycine. Maximum inhibition efficiency for cysteine reaches about 92.9% at 15 mM concentration level. The glutathione can give 96.4% inhibition efficiency at a concentration of 10 mM. The molecular structure parameters were obtained by PM3 (Parametric Method 3) semi-empirical calculation. The intramolecular synergistic effect of glutamic acid, cysteine and glycine moieties in glutathione is attributed to the lower energy of the lowest unoccupied molecular orbital (E LUMO ) level and to the excess hetero-atom adsorption centers and the bigger coverage on the copper surface.

  5. Comparative analysis of intramolecular parameters of nitrocompounds: crystalline and gas phases

    Science.gov (United States)

    Arnautova, Elena A.; Pivina, Tatyana S.; Gladkikh, Olga P.; Vilkov, Lev V.

    1996-01-01

    The results of a study of intramolecular parameters for chemical classes of nitrocompounds in different states of aggregation are collected and analyzed: electron-diffraction experiments and microwave spectroscopy for the gas phase, and X-ray diffraction (from the Cambridge Bank of X-ray and neutron-diffraction data) for molecules in crystals. Systematic analysis of molecular structural parameters for valence bonds and angles of the nitrogroups in these compounds shows these properties to be conserved. This allows us to use the calculated geometrical molecular parameters of nitrocompounds (obtained theoretically by quantum-chemical schemes) when building models of base (rigid) molecules for constructing elementary cells within different structural classes, with the aim of a subsequent computer search for dense packing in the corresponding molecular crystals.

  6. Mechanisms of intramolecular communication in a hyperthermophilic acylaminoacyl peptidase: a molecular dynamics investigation.

    Science.gov (United States)

    Papaleo, Elena; Renzetti, Giulia; Tiberti, Matteo

    2012-01-01

    Protein dynamics and the underlying networks of intramolecular interactions and communicating residues within the three-dimensional (3D) structure are known to influence protein function and stability, as well as to modulate conformational changes and allostery. Acylaminoacyl peptidase (AAP) subfamily of enzymes belongs to a unique class of serine proteases, the prolyl oligopeptidase (POP) family, which has not been thoroughly investigated yet. POPs have a characteristic multidomain three-dimensional architecture with the active site at the interface of the C-terminal catalytic domain and a β-propeller domain, whose N-terminal region acts as a bridge to the hydrolase domain. In the present contribution, protein dynamics signatures of a hyperthermophilic acylaminoacyl peptidase (AAP) of the prolyl oligopeptidase (POP) family, as well as of a deletion variant and alanine mutants (I12A, V13A, V16A, L19A, I20A) are reported. In particular, we aimed at identifying crucial residues for long range communications to the catalytic site or promoting the conformational changes to switch from closed to open ApAAP conformations. Our investigation shows that the N-terminal α1-helix mediates structural intramolecular communication to the catalytic site, concurring to the maintenance of a proper functional architecture of the catalytic triad. Main determinants of the effects induced by α1-helix are a subset of hydrophobic residues (V16, L19 and I20). Moreover, a subset of residues characterized by relevant interaction networks or coupled motions have been identified, which are likely to modulate the conformational properties at the interdomain interface.

  7. Tether-directed synthesis of highly substituted oxasilacycles via an intramolecular allylation employing allylsilanes

    Directory of Open Access Journals (Sweden)

    Cox Liam R

    2007-02-01

    Full Text Available Abstract Background Using a silyl tether to unite an aldehyde electrophile and allylsilane nucleophile into a single molecule allows a subsequent Lewis-acid-mediated allylation to proceed in an intramolecular sense and therefore receive all the benefits associated with such processes. However, with the ability to cleave the tether post allylation, a product that is the result of a net intermolecular reaction can be obtained. In the present study, four diastereoisomeric β-silyloxy-α-methyl aldehydes, which contain an allylsilane tethered through the β-carbinol centre, have been prepared, in order to probe how the relative configuration of the two stereogenic centres affects the efficiency and selectivity of the intramolecular allylation. Results Syn-aldehydes, syn-4a and syn-4b, both react poorly, affording all four possible diastereoisomeric oxasilacycle products. In contrast, the anti aldehydes anti-4a and anti-4b react analogously to substrates that lack substitution at the α-site, affording only two of the four possible allylation products. Conclusion The outcome of the reaction with anti-aldehydes is in accord with reaction proceeding through a chair-like transition state (T.S.. In these systems, the sense of 1,3-stereoinduction can be rationalised by the aldehyde electrophile adopting a pseudoaxial orientation, which will minimise dipole-dipole interactions in the T.S. The 1,4-stereoinduction in these substrates is modest and seems to be modulated by the R substituent in the starting material. In the case of the syn-substrates, cyclisation through a chair T.S. is unlikely as this would require the methyl substituent α to the reacting carbonyl group to adopt an unfavourable pseudoaxial position. It is therefore proposed that these substrates react through poorly-defined T.S.s and consequently exhibit essentially no stereoselectivity.

  8. Reaction Coordinate, Free Energy, and Rate of Intramolecular Proton Transfer in Human Carbonic Anhydrase II.

    Science.gov (United States)

    Paul, Sanjib; Paul, Tanmoy Kumar; Taraphder, Srabani

    2018-03-22

    The role of structure and dynamics of an enzyme has been investigated at three different stages of its function including the chemical event it catalyzes. A one-pot computational method has been designed for each of these stages on the basis of classical and/or quantum mechanical-molecular mechanical molecular dynamics and transition path sampling simulations. For a pair of initial and final states A and B separated by a high free-energy barrier, using a two-stage selection process, several collective variables (CVs) are identified that can delineate A and B. However, these CVs are found to exhibit strong cross-coupling over the transition paths. A set of mutually orthogonal order parameters is then derived from these CVs and an optimal reaction coordinate, r, determined applying half-trajectory likelihood maximization along with a Bayesian information criterion. The transition paths are also used to project the multidimensional free energy surface and barrier crossing dynamics along r. The proposed scheme has been applied to the rate-determining intramolecular proton transfer reaction of the well-known enzyme human carbonic anhydrase II. The potential of mean force, F( r), in the absence of the chemical step is found to reproduce earlier results on the equilibrium population of two side-chain orientations of key residue His-64. Estimation of rate constants, k, from mean first passage times for the three different stages of catalysis shows that the rate-determining step of intramolecular proton transfer occurs with k ≃ 1.0 × 10 6 s -1 , in close agreement with known experimental results.

  9. A dynamic programming algorithm for identification of triplex-forming sequences

    Czech Academy of Sciences Publication Activity Database

    Lexa, M.; Martínek, T.; Burgetová, I.; Kopeček, D.; Brázdová, Marie

    2011-01-01

    Roč. 27, č. 18 (2011), s. 2510-2517 ISSN 1367-4803 R&D Projects: GA ČR(CZ) GA204/08/1560; GA ČR(CZ) GAP301/10/2370 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : OLIGONUCLEOTIDE TARGET SEQUENCES * INTRAMOLECULAR DNA TRIPLEXES * HELIX FORMATION Subject RIV: BO - Biophysics Impact factor: 5.468, year: 2011

  10. Poly purine.pyrimidine sequences upstream of the beta-galactosidase gene affect gene expression in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Brahmachari Samir K

    2001-10-01

    Full Text Available Abstract Background Poly purine.pyrimidine sequences have the potential to adopt intramolecular triplex structures and are overrepresented upstream of genes in eukaryotes. These sequences may regulate gene expression by modulating the interaction of transcription factors with DNA sequences upstream of genes. Results A poly purine.pyrimidine sequence with the potential to adopt an intramolecular triplex DNA structure was designed. The sequence was inserted within a nucleosome positioned upstream of the β-galactosidase gene in yeast, Saccharomyces cerevisiae, between the cycl promoter and gal 10Upstream Activating Sequences (UASg. Upon derepression with galactose, β-galactosidase gene expression is reduced 12-fold in cells carrying single copy poly purine.pyrimidine sequences. This reduction in expression is correlated with reduced transcription. Furthermore, we show that plasmids carrying a poly purine.pyrimidine sequence are not specifically lost from yeast cells. Conclusion We propose that a poly purine.pyrimidine sequence upstream of a gene affects transcription. Plasmids carrying this sequence are not specifically lost from cells and thus no additional effort is needed for the replication of these sequences in eukaryotic cells.

  11. Label-free and nicking enzyme-assisted fluorescence signal amplification for RNase H determination based on a G-quadruplexe/thioflavin T complex.

    Science.gov (United States)

    Wu, Kefeng; Ma, Changbei; Deng, Zhiyi; Fang, Ning; Tang, Zhenwei; Zhu, Xingxing; Wang, Kemin

    2018-05-15

    In this paper, we describe a novel, label-free and nicking enzyme-assisted fluorescence signal amplification strategy that demonstrates to be cost efficient, sensitive, and unique for assaying the RNase H activity and inhibition based on G-quadruplex formation using a thioflavin T (ThT) dye. This novel assay method is able to detect RNase H with a detection limit of 0.03 U /mL and further exhibits a good linearity R 2 = 0.9923 at a concentration range of 0.03-1 U/mL under optimized conditions. Moreover, the inhibition effect of gentamycin on the RNase H activity is also studied. This strategy provides a potential tool for the biochemical enzyme analysis and inhibitor screening. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Microwave-Assisted Synthesis of Arene Ru(II Complexes Induce Tumor Cell Apoptosis Through Selectively Binding and Stabilizing bcl-2 G-Quadruplex DNA

    Directory of Open Access Journals (Sweden)

    Yanhua Chen

    2016-05-01

    Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.

  13. Intra-molecular Charge Transfer and Electron Delocalization in Non-Fullerene Organic Solar Cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qinghe; Zhao, Donglin; Goldey, Matthew B.; Filatov, Alexander S.; Sharapov, Valerii; Colon, Yamil; Cai, Zhengxu; Jiang, Xuanfeng; Wang, Junpeng; Chen, Wei; de Pablo, Juan; Galli, Giulia; Yu, Luping

    2018-03-28

    Two types of electron acceptors were synthesized by coupling two kinds of electron-rich cores with four equivalent perylene diimides (PDIs) at the a position. With fully aromatic cores, TPB and TPSe have pi-orbitals spread continuously over the whole aromatic conjugated backbone, unlike TPC and TPSi, which contain isolated PDI units due to the use of a tetrahedron carbon or silicon linker. Density functional theory calculations of the projected density of states showed that the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) for TPB are localized in separate regions of space. Further, the LUMO of TPB shows a greater contribution from the orbitals belonging to the connective core of the molecules than that of TPC. Overall, the properties of the HOMO and LUMO point at increased intra-molecular delocalization of negative charge carriers for TPB and TPSe than for TPC and TPSi and hence at a more facile intra-molecular charge transfer for the former. The film absorption and emission spectra showed evidences for the inter -molecular electron delocalization in TPB and TPSe, which is consistent with the network structure revealed by X-ray diffraction studies on single crystals of TPB. These features benefit the formation of charge transfer states and/or facilitate charge transport. Thus, higher electron mobility and higher charge dissociation probabilities under J(sc) condition were observed in blend films of TPB:PTB7-Th and TPSe:PTB7-Th than those in TPC:PTB7Th and TPSi:PTB7-Th blend films. As a result, the J(sc) and fill factor values of 15.02 mA/cm(2), 0.58 and 14.36 mA/cm(2), 0.55 for TPB- and TPSe-based solar cell are observed, whereas those for TPC and TPSi are 11.55 mA/cm2, 0.47 and 10.35 mA/cm(2), 0.42, respectively.

  14. An intramolecular bond at cluster of differentiation 81 ectodomain is important for hepatitis C virus entry.

    Science.gov (United States)

    Yang, Wei; Zhang, Meng; Chi, Xiaojing; Liu, Xiuying; Qin, Bo; Cui, Sheng

    2015-10-01

    Hepatitis C virus (HCV) infection is one of the leading causes of chronic liver diseases; however, HCV vaccine remains unavailable to date. One main obstacle is the lack of an efficient small animal model. Cluster of differentiation 81 (CD81) is an essential entry coreceptor for HCV species specificity to humans, though the underlying mechanisms are yet to be fully elucidated. We performed structural, biophysical, and virologic studies on HCV nonpermissive CD81s from mice and African green monkeys [mouse cluster of differentiation 81 (mCD81) and African green monkey cluster of differentiation 81 (agmCD81)] and compared with human cluster of differentiation 81 (hCD81). We discovered an intramolecular hydrogen bond (Gln188-Nε2-H: Glu196-Oε2, 2 Å, 124°) within the large extracellular loop (LEL) of mCD81 and a salt bridge (Lys188-Nζ: Asp196-Oδ2, 2.4 Å) within agmCD81-LEL between residues 188 and 196. This structural feature is missing in hCD81. We demonstrated that the introduction of a single 188-196 bond to hCD81 impaired its binding affinity to HCV envelope glycoprotein 2 (HCV E2) and significantly decreased HCV pseudoviral particle (HCVpp) entry efficiency (4.92- to 8.42-fold) and cell culture-grown HCV (HCVcc) infectivity (4.55-fold), despite the availability of Phe186. For HCV nonpermissive CD81s, the introduction of Phe186 by Leu186F substitution alone was insufficient to confer HCV permissiveness. The disruption of the original 188-196 bond and Leu186F substitution were both required for potent binding to HCV E2 HCVpp entry efficiency and HCVcc infectivity. Our structural and biophysical analyses suggest that the intramolecular 188-196 bond restricts the intrinsic conformational dynamics of D-helix of CD81-LEL, which is essential for HCV entry, thus impairs HCV permissiveness. Our findings reveal a novel molecular determinant for HCV entry in addition to the well-characterized Phe186 and provide further guideline for selecting an HCV small animal model

  15. Hydrogen bond strengthening induces fluorescence quenching of PRODAN derivative by turning on twisted intramolecular charge transfer

    Science.gov (United States)

    Yang, Yonggang; Li, Donglin; Li, Chaozheng; Liu, YuFang; Jiang, Kai

    2017-12-01

    Researchers have proposed different effective mechanisms of hydrogen bonding (HB) on the fluorescence of 6-propionyl-2-dimethylaminonaphthalene (PRODAN) and its derivatives. Herein, excited state transition and dynamics analysis confirm that the fluorescence of PD (a derivative of PRODAN with ethyl replaced by 3-hydroxy-2,2-dimethylpropan) emits from the planar intramolecular charge transfer (PICT) state rather than twist ICT (TICT) state, because the fluorescence emission and surface hopping from the TICT state to the twist ground (T-S0) state is energy forbidden. Nevertheless, the strengthening of intramolecular-HB (intra-HB) and intermolecular-HB (inter-HB) of PD-(methanol)2 smooth the pathway of surface hopping from TICT to T-S0 state and the external conversion going to planar ground state by decreasing the energy difference of the two states. This smoothing changes the fluorescence state of PD-(methanol)2 to the TICT state in which fluorescence emission does not occur but surface hopping, leading to the partial fluorescence quenching of PD in methanol solvent. This conclusion is different from previous related reports. Moreover, the inter-HB strengthening of PD-methanol in PICT state induces the cleavage of intra-HB and a fluorescence red-shift of 54 nm compared to PD. This red-shift increases to 66 nm for PD-(methanol)2 for the strengthening of the one intra-HB and two inter-HBs. The dipole moments of PD-methanol and PD-(methanol)2 respectively increase about 10.3D and 8.1D in PICT state compared to PD. The synergistic effect of intra-HB and inter-HB induces partial quenching of PD in methanol solvent by turning on the TICT state and fluorescence red-shift. This work gives a reasonable description on the fluorescence red-shift and partial quenching of PD in methanol solvent, which will bring insight into the study of spectroscopic properties of molecules owning better spectral characteristics.

  16. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  17. Intramolecular charge separation in spirobifluorene-based donor–acceptor compounds adsorbed on Au and indium tin oxide electrodes

    International Nuclear Information System (INIS)

    Heredia, Daniel; Otero, Luis; Gervaldo, Miguel; Fungo, Fernando; Dittrich, Thomas; Lin, Chih-Yen; Chi, Liang-Chen; Fang, Fu-Chuan; Wong, Ken-Tsung

    2013-01-01

    Surface photovoltage (SPV) measurements were performed with a Kelvin-probe in spirobifluorene-based donor (diphenylamine)–acceptor (dicyano or cyanoacrylic acid moieties) compounds adsorbed from highly diluted solutions onto Au and indium tin oxide electrode surfaces. Strong intramolecular charge separation (negative SPV signals up to more than 0.1 V) due to directed molecule adsorption was observed only for spirobifluorene donor–acceptor compounds with carboxylic acid moiety. SPV signals and onset energies of electronic transitions depended on ambience conditions. - Highlights: ► Fluorene donor–acceptor derivatives were adsorbed at Au and indium tin oxide. ► Surface photovoltage measurements were performed with a Kelvin-probe. ► Strong intra-molecular charge separation was observed. ► SPV signals depended on ambience conditions

  18. EVAPORATION: a new vapor pressure estimation method for organic molecules including non-additivity and intramolecular interactions

    Science.gov (United States)

    Compernolle, S.; Ceulemans, K.; Müller, J.-F.

    2011-04-01

    We present EVAPORATION (Estimation of VApour Pressure of ORganics, Accounting for Temperature, Intramolecular, and Non-additivity effects), a method to predict vapour pressure p0 of organic molecules needing only molecular structure as input. The method is applicable to zero-, mono- and polyfunctional molecules. A simple formula to describe log10p0(T) is employed, that takes into account both a wide temperature dependence and the non-additivity of functional groups. In order to match the recent data on functionalised diacids an empirical modification to the method was introduced. Contributions due to carbon skeleton, functional groups, and intramolecular interaction between groups are included. Molecules typically originating from oxidation of biogenic molecules are within the scope of this method: carbonyls, alcohols, ethers, esters, nitrates, acids, peroxides, hydroperoxides, peroxy acyl nitrates and peracids. Therefore the method is especially suited to describe compounds forming secondary organic aerosol (SOA).

  19. Use of Alkyl Ethers as Traceless Hydride Donors in Brønsted Acid-Catalyzed Intramolecular Hydrogen Atom Transfer.

    Science.gov (United States)

    Gandamana, Dhika Aditya; Wang, Bin; Tejo, Ciputra; Bolte, Benoit; Gagosz, Fabien; Chiba, Shunsuke

    2018-03-25

    A new protocol for the deoxygenation of alcohols and the hydrogenation of alkenes under Brønsted acid catalysis has been developed. The method is based on the use of a benzyl or an isopropyl ether as a traceless hydrogen atom donor and involves an intramolecular hydride transfer as a key step that can be achieved in regio- and stereoselective manners. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. An efficient and green synthesis of 1-indanone and 1-tetralone via intramolecular Friedel-Crafts acylation reaction

    DEFF Research Database (Denmark)

    Tran, Phuong Hoang; Huynh, Vy Hieu; Hansen, Poul Erik

    2015-01-01

    Metal-triflate-catalyzed intramolecular Friedel–Crafts acylation of 3-arylpropanoic and 4-arylbutanoic acids in triflate-anion ionic liquids under monomodal microwave irradiation is reported. The environmentally benign synthetic procedure allows the formation of cyclic ketones in good yields with...... a short reaction time. The catalytic metal triflate in triflate-anion ionic liquids can be easily recovered and reused several times without significant loss of the catalytic performance....

  1. Synthesis of Amidines from Amides Using a Nickel-Catalyzed Decarbonylative Amination through CO Extrusion Intramolecular Recombination Fragment Coupling.

    Science.gov (United States)

    Liu, Xiangqian; Yue, Huifeng; Jia, Jiaqi; Guo, Lin; Rueping, Magnus

    2017-09-04

    A catalytic synthesis of amidines from amides has been established for the first time. The newly developed CO extrusion recombination process takes advantage of an inexpensive nickel(II) catalyst and provides the corresponding amidines with high efficiency. The intramolecular fragment coupling shows excellent chemoselectivity, starts from readily available amides, and provides a valuable alternative amidine synthesis protocol. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Synthesis of 2,3-dihydro-1H-pyrroles by intramolecular cyclization of N-(3-butynyl)-sulfonamides.

    Science.gov (United States)

    Chung, Min-Ching; Chan, Yung-Hsiang; Chang, Wen-Jung; Hou, Duen-Ren

    2017-05-03

    Hydroamination of 3-butynamine derivatives to give non-aromatic 2,3-dihydropyrroles was achieved by using PdCl 2 or AuCl as the catalyst. With microwave-assisted heating, up to 92% isolated yield was obtained from this intramolecular 5-endo-dig cyclisation. The cyclopentane- and cyclohexane-fused 2,3-dihydropyrroles were transformed into the corresponding N-tosyl-pyrrolidine-2-carboxylic acids.

  3. An enantioselective organocatalytic intramolecular Morita-Baylis-Hillman (IMBH) reaction of dienones, and elaboration of the IMBH adducts to fluorenones.

    Science.gov (United States)

    Satpathi, Bishnupada; Wagulde, Siddhant V; Ramasastry, S S V

    2017-07-13

    An enantioselective organocatalytic intramolecular Morita-Baylis-Hillman (IMBH) reaction of dienones is reported for the first time. This has been achieved by incorporating entropy and synergy considerations during the substrate design. The reaction conditions are thoroughly verified for an efficient synthesis of highly functionalised cyclopenta-fused arenes and heteroarenes in excellent yields and enantioselectivities. The synthetic utility of the IMBH-adducts has been demonstrated by transforming them into 3,4-disubstituted fluorenones in a serendipitous manner.

  4. On the Possibility of Uphill Intramolecular Electron Transfer in Multicopper Oxidases: Electrochemical and Quantum Chemical Study of Bilirubin Oxidase

    Czech Academy of Sciences Publication Activity Database

    Shleev, S.; Andoralov, V.; Falk, M.; Reimann, C. T.; Ruzgas, T.; Srnec, Martin; Ryde, U.; Rulíšek, Lubomír

    2012-01-01

    Roč. 24, č. 7 (2012), s. 1524-1540 ISSN 1040-0397 Grant - others:7th Framework Program(XE) NMP4-SL-2009-229255 Institutional research plan: CEZ:AV0Z40550506 Keywords : bilirubin oxidase * intramolecular electron transfer * rate-limiting catalytic step * reorganization energy * QM/MM calculations Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.817, year: 2012

  5. Tandem repeats and G-rich sequences are enriched at human CNV breakpoints.

    Directory of Open Access Journals (Sweden)

    Promita Bose

    Full Text Available Chromosome breakage in germline and somatic genomes gives rise to copy number variation (CNV responsible for genomic disorders and tumorigenesis. DNA sequence is known to play an important role in breakage at chromosome fragile sites; however, the sequences susceptible to double-strand breaks (DSBs underlying CNV formation are largely unknown. Here we analyze 140 germline CNV breakpoints from 116 individuals to identify DNA sequences enriched at breakpoint loci compared to 2800 simulated control regions. We find that, overall, CNV breakpoints are enriched in tandem repeats and sequences predicted to form G-quadruplexes. G-rich repeats are overrepresented at terminal deletion breakpoints, which may be important for the addition of a new telomere. Interstitial deletions and duplication breakpoints are enriched in Alu repeats that in some cases mediate non-allelic homologous recombination (NAHR between the two sides of the rearrangement. CNV breakpoints are enriched in certain classes of repeats that may play a role in DNA secondary structure, DSB susceptibility and/or DNA replication errors.

  6. A Critical Check for the Role of Resonance in Intramolecular Hydrogen Bonding.

    Science.gov (United States)

    Jiang, Xiaoyu; Zhang, Huaiyu; Wu, Wei; Mo, Yirong

    2017-11-27

    Although resonance-assisted H-bonds (RAHBs) are well recognized, the role of π resonance in RAHBs is controversial, as the seemingly enhanced H-bonds in unsaturated compounds may result from the constraints imposed by the σ skeleton. Herein the block-localized wave function (BLW) method, which can derive optimal yet resonance-quenched structures with related physiochemical properties, was employed to examine the correlation between π resonance and the strength of intramolecular RAHBs. Examination of a series of paradigmatic molecules with RAHBs and their saturated analogues showed that it is inappropriate to compare a conjugated system with its saturated counterpart, as they may have quite different σ frameworks. Nevertheless, comparison between a conjugated system and its resonance-quenched (i.e., electron-localized) state, which have identical σ skeletons, shows that in all studied cases, π resonance unanimously reduces the bonding distance by 0.111-0.477 Å, strengthens the bonding by 40-56 %, and redshifts the D-H vibrational frequency by 104-628 cm -1 . Furthermore, there is an excellent correlation between hydrogen-bonding strength and the classical Coulomb attraction between the hydrogen-bond donor and the acceptor, which suggests that the dominant role of the electrostatic interaction in H-bonds and RAHBs originates from the charge flow from H-bond donors to acceptors through π conjugation. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Mechanochemical Preparation of Cobalt Nanoparticles through a Novel Intramolecular Reaction in Cobalt(II Complexes

    Directory of Open Access Journals (Sweden)

    Seyed Abolghasem Kahani

    2015-01-01

    Full Text Available A novel solid state reaction involving a series of cobalt(II hydrazine-azides has been used to prepare metallic cobalt nanoparticles. The reactions of [Co(N2H4(N32], [Co(N2H42(N32], and [Co(N2H4(N3Cl]·H2O via NaOH, KOH as reactants were carried out in the solid state. These complexes undergo an intramolecular two-electron oxidation-reduction reaction at room temperature, producing metallic cobalt nanoparticles (Co1–Co6. The aforementioned complexes contain cobalt(II that is an oxidizing agent and also hydrazine ligand as a reducing agent. Other products produced include sodium azide and ammonia gas. The cobalt metal nanoparticles were characterized using X-ray powder diffraction (XRD, scanning electron microscopy (SEM, and vibrating sample magnetometer (VSM. The synthesized cobalt nanoparticles have similar morphologies; however, their particle size distributions are different.

  8. NMR investigation of intramolecular dynamics of heteroleptic triple-decker (porphyrinato)(phthalocyaninato) lanthanides.

    Science.gov (United States)

    Birin, Kirill P; Gorbunova, Yulia G; Tsivadze, Aslan Yu

    2011-11-21

    Intramolecular dynamics of meso-aryl substituents of porphyrin deck in the triple-decker lanthanide (porphyrinato)(phthalocyaninates) of symmetrical type [Br(4)TPP]Ln[(15C5)(4)Pc]Ln[Br(4)TPP] (Ln = La, Nd, Eu; [Br(4)TPP] = tetrakis-5,10,15,20-(4-bromophenyl)-porphyrinato-ligand; [(15C5)(4)Pc] = tetrakis-(15-crown-5)-phthalocyaninato-ligand) are investigated. Attempts to achieve coalescence were not successful, although the trend of exchanging protons to coalescence point was observed in the case of Nd and Eu complexes. The analysis of NOESY cross-peaks between exchanging protons allowed to evaluate the rotation rate constants at different temperatures. The activation barrier of the meso-aryl substituent rotation was calculated with Arrhenius equation based on determined rate constants. The rate constants are lower and activation barriers are higher than ones found previously for related compounds. This journal is © The Royal Society of Chemistry 2011

  9. Spectroscopic and theoretical investigations on intramolecular charge transfer phenomenon in 1-3-dioxolane derivative

    Science.gov (United States)

    Zhang, Zhiyong; Zhang, Zhongzhi; Luo, Yijing; Sun, Shanshan; Zhang, Guangqing

    2018-02-01

    High fluorescence quantum yield (FQY) and large Stokes shift (SS) cannot be easily achieved simultaneously by traditional PICT or TICT fluorescent probe. However, an 1-3-dioxolane derivative named 5-methyl-8,9-dihydro-5H-[1,3]dioxolo[4,5-b]carbazol-6(7H)-one (MDDCO) features both high FQY and large SS. The purpose of this study is to search the mechanism behind this phenomenon by theoretical method. Simulated structure changes and charge transfer suggest ICT process in MDDCO is similar to PLICT (Planarized Intramolecular Charge Transfer) process. Calculated UV-Vis spectra and fluorescence spectra show that PLICT-like state (S1 state) of MDDCO leads to large SS. Computed transient-absorption spectra and radiative decay rates indicate that PLICT-like state is key factor for high FQY of MDDCO. These findings suggest that PLICT-like state in 1,3-dioxolane derivatives can achieve both large SS and high FQY, which presents a new method for high-performance fluorescent probe design.

  10. Dynamics of intramolecular spin exchange interaction of a nitronyl nitroxide diradical in solution and on surfaces

    Science.gov (United States)

    Lloveras, V.; Badetti, E.; Veciana, J.; Vidal-Gancedo, J.

    2016-02-01

    In this paper we report the study of the dynamics of a thermally modulated intramolecular spin exchange interaction of a novel diradical nitronyl nitroxide-substituted disulfide in solution and when it is grafted on a gold surface. The structure of this diradical was designed to have flexible chains leading to intramolecular collisions and hence spin exchange interaction, and with an appropriate binding group to be grafted on the gold surface to study its behavior on the surface. In solution, this diradical shows a strong spin exchange interaction between both radicals which is modulated by temperature, but also gold nanoparticles (AuNPs) functionalized with this diradical permit investigation of such a phenomenon in surface-grafted radicals. The spin-labelled AuNP synthesis was optimized to obtain high coverage of spin labels to lead to high spin exchange interaction. The obtained AuNPs were studied by Electron Paramagnetic Resonance (EPR), UV-Vis, and IR spectroscopies, HR-TEM microscopy, Cyclic Voltammetry (CV), Energy Dispersive X-ray analysis (EDX) and Thermogravimetric Analysis (TGA). This inorganic-organic hybrid material also showed dipolar interactions between its radicals which were confirmed by the appearance in the EPR spectra of an |Δms| = 2 transition at half-field. This signal gives direct evidence of the presence of a high-spin state and permitted us to study the nature of the magnetic coupling between the spins which was found to be antiferromagnetic. Self-Assembled Monolayers (SAMs) of these radicals on the Au (111) substrate were also prepared and studied by contact angle, X-Ray Photoelectron Spectroscopy (XPS), Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS), Cyclic Voltammetry and EPR. The magnetic as well as the electrochemical properties of the hybrid surfaces were studied and compared with the properties of this diradical in solution. Analogies between the properties of AuNPs with high coverage of radicals and those of SAM were

  11. Contribution of inter- and intramolecular energy transfers to heat conduction in liquids.

    Science.gov (United States)

    Torii, Daichi; Nakano, Takeo; Ohara, Taku

    2008-01-28

    The molecular dynamics expression of heat flux, originally derived by Irving and Kirkwood [J. Chem. Phys. 18, 817 (1950)] for pairwise potentials, is generalized in this paper for systems with many-body potentials. The original formula consists of a kinetic part and a potential part, and the latter term is found in the present study to be expressible as a summation of contributions from all the many-body potentials defined in the system. The energy transfer among a set of sites for which a many-body potential is defined is discussed and evaluated by the rate of increase in the kinetic energy of each site due to the potential, and its accumulation over all the potentials in the system is shown to make up the potential part of the generalized expression. A molecular dynamics simulation for liquid n-octane was performed to demonstrate the applicability of the new expression obtained in this study to measure the heat flux and to elucidate the contributions of inter- and intramolecular potentials to heat conduction.

  12. Discovery of intramolecular trans-sialidases in human gut microbiota suggests novel mechanisms of mucosal adaptation

    Science.gov (United States)

    Tailford, Louise E.; Owen, C. David; Walshaw, John; Crost, Emmanuelle H.; Hardy-Goddard, Jemma; Le Gall, Gwenaelle; de Vos, Willem M.; Taylor, Garry L.; Juge, Nathalie

    2015-07-01

    The gastrointestinal mucus layer is colonized by a dense community of microbes catabolizing dietary and host carbohydrates during their expansion in the gut. Alterations in mucosal carbohydrate availability impact on the composition of microbial species. Ruminococcus gnavus is a commensal anaerobe present in the gastrointestinal tract of >90% of humans and overrepresented in inflammatory bowel diseases (IBD). Using a combination of genomics, enzymology and crystallography, we show that the mucin-degrader R. gnavus ATCC 29149 strain produces an intramolecular trans-sialidase (IT-sialidase) that cleaves off terminal α2-3-linked sialic acid from glycoproteins, releasing 2,7-anhydro-Neu5Ac instead of sialic acid. Evidence of IT-sialidases in human metagenomes indicates that this enzyme occurs in healthy subjects but is more prevalent in IBD metagenomes. Our results uncover a previously unrecognized enzymatic activity in the gut microbiota, which may contribute to the adaptation of intestinal bacteria to the mucosal environment in health and disease.

  13. Polarization of emission from asymmetric rotors. II. Vector reorientation through intramolecular coupling and inelastic collisions

    Science.gov (United States)

    Truhins, Kaspars; McCaffery, Anthony J.; Alwahabi, Zeyad T.; Rawi, Zaid

    1997-07-01

    We report measurements of the linear and circular polarization ratios from fully resolved rotational levels of the asymmetric rotor NH2 populated by collisions with H atoms. The results compare well with a theoretical model that includes the depolarizing effects of intramolecular coupling of rotational angular momentum N to nuclear and to electron spin. These have a very significant influence on fluorescence polarization. The model also incorporates the tilting of the N vector in the molecule frame that occurs when inter-k stack transitions take place. Changes in N vector orientation are described with the aid of the angular momentum sphere, a classical representation of the motion of the N vector in a molecule fixed frame. The theoretical treatment assumes the classically impulsive limit for the collisional interaction with conservation of the m quantum number along the kinematic apse. This description of the fate of the N vector under the influence of intra- and intermolecular interactions allows stereodynamical conclusions to be drawn from experimental observations of fluorescence polarization.

  14. C—C bond formation in the intramolecular Diels-Alder reaction of triene amides

    Directory of Open Access Journals (Sweden)

    Abdelilah Benallou

    2018-02-01

    Full Text Available The mechanism nature of the intramolecular Diels–Alder reaction has been performed; and thus, the changes of C—C bond forming/breaking along IRC are characterized in this study. Conceptual DFT analyses of the most favorable adduct fused/exo shows that the flux electronic will take place from diene to dienophile moiety. Moreover, ELF topological analysis based on the electron density predicts that C—C bond is formed by the coupling of two pseudoradical centers generated at the most significant atoms of the molecules. However, C2 vs C3, also C1 and C4 interaction comes mainly from the global electron density transfer which takes place along the reaction. Two- stage one-step is the proposed mechanism of this reaction, the first stage aims for the formation of C2—C3 σ bond while the second stage aims for C1—C4 σ bond formation. Interestingly, the observed asynchronicity of this IMDA reaction due principally to the asymmetric reorganization of electron density at the most attractive centers.

  15. Absence of Intramolecular Singlet Fission in Pentacene-Perylenediimide Heterodimers: The Role of Charge Transfer State.

    Science.gov (United States)

    Wang, Long; Wu, Yishi; Chen, Jianwei; Wang, Lanfen; Liu, Yanping; Yu, Zhenyi; Yao, Jiannian; Fu, Hongbing

    2017-11-16

    A new class of donor-acceptor heterodimers based on two singlet fission (SF)-active chromophores, i.e., pentacene (Pc) and perylenediimide (PDI), was developed to investigate the role of charge transfer (CT) state on the excitonic dynamics. The CT state is efficiently generated upon photoexcitation. However, the resulting CT state decays to different energy states depending on the energy levels of the CT state. It undergoes extremely rapid deactivation to the ground state in polar CH 2 Cl 2 , whereas it undergoes transformation to a Pc triplet in nonpolar toluene. The efficient triplet generation in toluene is not due to SF but CT-mediated intersystem crossing. In light of the energy landscape, it is suggested that the deep energy level of the CT state relative to that of the triplet pair state makes the CT state actually serve as a trap state that cannot undergoes an intramolecular singlet fission process. These results provide guidance for the design of SF materials and highlight the requisite for more widely applicable design principles.

  16. Ruthenium-modified cytochrome c: temperature dependence of the rate of intramolecular electron transfer

    International Nuclear Information System (INIS)

    Isied, S.S.; Kuehn, C.; Worosila, G.

    1984-01-01

    The ruthenium-modified horse heart cytochrome c, Ru(III)-cyt c(III), where the ruthenium is bound to the histidines-33 residue has been synthesized and characterized by ruthenium analysis, UV-vis and CD spectra, and differential pulse polarography and cyclic voltammetry. The intermediate Ru(III)-cyt c(III) has been generated by pulse-radioanalysis with use of four different radicals, CO 2 -., (CH 3 )COH., (CH 2 OH) 3 CCHOH, and -OCCH(OH)C(OH)CO 2 -. The rate of intramolecular electron transfer within the Ru(III)-cyt c(III) complex and its temperature dependence were determined over a 40 0 C temperature range with the CO 2 -. radical. At 25 0 C, these values are k/sub u/=53 +/- s/sup -1/ (pH 7.01 M phosphate buffer, 0.1 M NaHCO 2 ), ΔH/sup +/=3.5 +/- 0.2 kcal mol/sup -1/, and ΔS/sup +/=-39 +/- 1 eu

  17. Structural factors influencing the intramolecular charge transfer and photoinduced electron transfer in tetrapyrazinoporphyrazines.

    Science.gov (United States)

    Novakova, Veronika; Hladík, Petr; Filandrová, Tereza; Zajícová, Ivana; Krepsová, Veronika; Miletin, Miroslav; Lenčo, Juraj; Zimcik, Petr

    2014-03-21

    A series of unsymmetrical tetrapyrazinoporphyrazines (TPyzPzs) from the group of azaphthalocyanines with one peripherally attached amino substituent (donor) were synthesized, and their photophysical properties (fluorescence quantum yield and singlet oxygen quantum yield) were determined. The synthesized TPyzPzs were expected to undergo intramolecular charge transfer (ICT) as the main pathway for deactivating their excited states. Several structural factors were found to play a critical role in ICT efficiency. The substituent in the ortho position to the donor center significantly influences the ICT, with tert-butylsulfanyl and butoxy substituents inducing the strongest ICTs, whereas chloro, methyl, phenyl, and hydrogen substituents in this position reduce the efficiency. The strength of the donor positively influences the ICT efficiency and correlates well with the oxidation potential of the amines used as the substituents on the TPyzPz as follows: n-butylamine ICT (with conjugated donors and acceptors) in the TPyzPz also proved to be much stronger than a photoinduced electron transfer in which the donor and the acceptor are connected through an aliphatic linker.

  18. Intramolecular Cooperativity in the Reaction of Diacyl Phosphates with Serine ß-Lactamases

    Science.gov (United States)

    Majumdar, Sudipta; Pratt, R.F.

    2010-01-01

    Asymmetric diaroyl phosphates (ArCOOPO2−OCOAr′, where Ar = Ph, Ar′ = 4-biphenyl, 2-benzothiophenyl and 2-benzofuranyl), have been prepared, evaluated as serine (classes A, C, D) β-lactamase inhibitors, and compared with respect to the latter with their symmetric “parents”, where Ar = Ar′. The asymmetric compounds, in general, were found to react with the β-lactamases in two modes, corresponding to different orientations with respect to the active site, whereby either of the two aroyl groups may acylate the enzyme to form two different inert acyl-enzymes, E-COAr and E-COAr′. In all cases, the asymmetric compounds, in one orientation, react more rapidly with the enzymes tested than one symmetrical “parent” but not both. From comparisons of activation free energy differences, it was found that the changes in free energy on changing from one aryl group to another, in either the acyl group or the leaving group, were not additive, i.e. that the effect of changing one aroyl group to another depended on the leaving group and vice versa. Thus, intramolecular cooperativity between the aroyl groups must exist, arising either from direct interaction between them or from protein-mediated interaction, or from a combination of both. Such cooperativity brings fresh opportunities and challenges to the search for novel ß-lactamase inhibitors. PMID:19678666

  19. Intramolecular hydrogen bonding in 5-nitrosalicylaldehyde: IR spectrum and quantum chemical calculations

    Science.gov (United States)

    Moosavi-Tekyeh, Zainab; Taherian, Fatemeh; Tayyari, Sayyed Faramarz

    2016-05-01

    The structural parameters, and vibrational frequencies of 5-nitrosalicylaldehyde (5NSA) were studied by the FT-IR and Raman spectra and the quantum chemical calculations carried out at the B3LYP/6-311++G(d,p) level of theory in order to investigate the intramolecular hydrogen bonding (IHB) present in its structure. The strength and nature of IHB in the optimized structure of 5NSA were studied in detail by means of the atoms in molecules (AIM) and the natural bond orbital (NBO) approaches. The results obtained were then compared with the corresponding data for its parent molecule, salicylaldehyde (SA). Comparisons made between the geometrical structures for 5NSA and SA, their OH/OD stretching and out-of-plane bending modes, their enthalpies for the hydrogen bond, and their AIM parameters demonstrated a stronger H-bonding in 5NSA compared with that in SA. The calculated binding enthalpy (ΔHbind) for 5NSA was -10.92 kcal mol-1. The observed νOH and γOH appeared at about 3120 cm-1 and 786 cm-1 respectively. The stretching frequency shift of H-bond formation was 426 cm-1 which is consistent with ΔHbind and the strength of H-bond in 5NSA. The delocalization energies and electron delocalization indices derived by the NBO and AIM approaches indicate that the resonance effects were responsible for the stronger IHB in 5NSA than in SA.

  20. Intramolecular interactions contributing for the conformational preference of bioactive diphenhydramine: Manifestation of the gauche effect

    Science.gov (United States)

    de Rezende, Fátima M. P.; Andrade, Laize A. F.; Freitas, Matheus P.

    2015-08-01

    Diphenhydramine is an antihistamine used to treat some symptoms of allergies and the common cold. It is usually marketed as the hydrochloride salt, and both the neutral and cation forms have the O-C-C-N fragment. The gauche effect is well known in fluorine-containing chains, because its main origin is hyperconjugative and the σ∗C-F is a low-lying acceptor orbital, allowing electron delocalization in the conformation where F and an adjacent electronegative substituent in an ethane fragment are in the gauche orientation. Our experimental (NMR) and theoretical findings indicate that diphenhydramine exhibits the gauche effect, since the preferential conformations have the O-C-C-N moiety in this orientation due especially to antiperiplanar σC-H → σ∗C-O and σC-H → σ∗C-N interactions. This conformational preference is strengthened in the protonated form due to an incremental electrostatic gauche effect. Because the gauche conformation matches the bioactive structure of diphenhydramine complexed with histamine methyltransferase, it is suggested that intramolecular interactions, and not only induced fit, rule its bioactive form.

  1. Hydrogen-deuterium exchange in spiro cyclic ketones: a search for intramolecular catalysis

    International Nuclear Information System (INIS)

    Hsu, R.C.L.

    1979-01-01

    The synthesis and characterization of 1'-hydroxy-3',3'-dimethylspiro[cyclohexane-1,2'-indan]-4-one (17b), 1'-amino-3',3'-dimethylspiro[cyclohexane-1,2'-indan]4-one (6a), 1'-N,N-dimethylamino-3',3'-dimethylspiro[cyclohexane-1,2'-indan]-4-one (6c) and 1'-[N-ethyl-α(d 2 )-amino]-3'-3'-dimethylspiro[cyclohexane-1,2'-indan]-4-one (6b) are described. The hydrogen-deuterium exchange reactions of aminoketones 6b and 6c with CH 3 OD are too fast to be followed by the mass spectrometric methodology. However, the H/D exchange between hydroxyketone 17b and CH 3 OD is shown to be intramolecularly catalyzed under both basic and neutral conditions. The rate constant for the exchange of C(3)-axial-H in 17b is 35 times greater than the rate constant for the exchange of an axial α-H in 4-t-butylcyclohexanone

  2. Intermolecular and very strong intramolecular C-SeO/N chalcogen bonds in nitrophenyl selenocyanate crystals.

    Science.gov (United States)

    Wang, Hui; Liu, Ju; Wang, Weizhou

    2018-02-14

    Single-crystal X-ray diffraction reveals that polymorphic ortho-nitrophenyl selenocyanate (o-NSC, crystals 1a and 1b) and monomorphic para-nitrophenyl selenocyanate (p-NSC, crystal 2) crystals are all stabilized mainly by intermolecular and very strong intramolecular C-SeO/N chalcogen bonds, as well as by other different interactions. Thermogravimetric (TG) and differential scanning calorimetry thermogram (DSC) analyses show that the starting decomposition temperatures and melting points of the three crystals are different, following the order 1b > 1a > 2, which is consistent with the structural characteristics of the crystals. In addition, atoms in molecules (AIM) and natural bond orbital (NBO) analyses indicate that the total strengths of the C-SeO and C-SeN chalcogen bonds decrease in the order 1b > 1a > 2. This study could be significant for engineering functional crystals based on robust C-SeO and C-SeN chalcogen bonds, and for designing drugs containing selenium as well as understanding their interaction in biosystems.

  3. Suppression of human immunodeficiency virus type 1 activity in vitro by oligonucleotides which form intramolecular tetrads.

    Science.gov (United States)

    Rando, R F; Ojwang, J; Elbaggari, A; Reyes, G R; Tinder, R; McGrath, M S; Hogan, M E

    1995-01-27

    An oligonucleotide (I100-15) composed of only deoxyguanosine and thymidine was able to inhibit human immunodeficiency virus type-1 (HIV-1) in culture assay systems. I100-15 did not block virus entry into cells but did reduce viral-specific transcripts. As assessed by NMR and polyacrylamide gel methods, I100-15 appears to form a structure in which two stacked guanosine tetrads are connected by three two-base long loops. Structure/activity experiments indicated that formation of intramolecular guanosine tetrads was necessary to achieve maximum antiviral activity. The single deoxyguanosine nucleotide present in each loop was found to be extremely important for the overall antiviral activity. The toxicity of I100-15 was determined to be well above the 50% effective dose (ED50) in culture which yielded a high therapeutic index (> 100). The addition of a cholesterol moiety to the 3' terminus of I100-15 (I100-23) reduced the ED50 value to less than 50 nM (from 0.12 microM for I100-15) and increased the duration of viral suppression to greater than 21 days (versus 7-10 days for I100-15) after removal of the drug from infected cell cultures. The favorable therapeutic index of such molecules coupled with the prolonged suppression of HIV-1, suggest that such compounds further warrant investigation as potential therapeutic agents.

  4. Intramolecular energy transfer at donor-acceptor interactions in model and biological membranes

    International Nuclear Information System (INIS)

    Umarova, Fatima T.

    2011-01-01

    Intramolecular triplet-triplet energy transfer between molecules of sensibilisator and photochrome for registration of protein interactions in the membrane preparation of Na,K-ATPase was investigated. Erythrosinithiocyanate (ERITC) was used as the triplet label of sensibilisator, and 4-acetoamido-4 -isothiocyanatostilbene-2,2 disullfonic acid (SITS) was used as the photochrome label. Na,K-ATPase preparations were covalently bound with ERITC in active centre of enzyme, and SITS molecules were covalently bound by NH2-groups. In model system, in chymotrypsinogene molecule, SITS and ERITC labels were used also. The cis-trans-isomerization of SITS was initiated by triplet-triplet energy transfer from light excited ERITC molecule to photochrome. The kinetics of isomerization was recorded by the SITS fluorescence measurements. The constant of rate of triplet-triplet energy transfer from ERITC to cis-isomers of SITS in Na,K-ATPase was determined as (3-7)x10 3 M -1 s -1 , and in model system it equals 1x 10 7 M 1 s -1 . The value of energy transfer between loos molecules of erythrosine and SITS in buffer solution equaled to 7x10 7 M -1 s -1 . This drop of R m y in the membrane preparation of Na,K-ATPase at 10 4 reflected the decrease in the frequency of label collisions caused by the increase in the media viscosity and steric hindrances. (author)

  5. Fluorescent sensors for selective detection of thiols: expanding the intramolecular displacement based mechanism to new chromophores.

    Science.gov (United States)

    Niu, Li-Ya; Zheng, Hai-Rong; Chen, Yu-Zhe; Wu, Li-Zhu; Tung, Chen-Ho; Yang, Qing-Zheng

    2014-03-21

    Biological thiols, including cysteine (Cys), homocystein (Hcy) and glutathione (GSH), play crucial roles in maintaining the appropriate redox status of biological systems. An abnormal level of biothiols is associated with different diseases, therefore, the discrimination between them is of great importance. Herein, we present two fluorescent sensors for selective detection of biothiols based on our recently reported intramolecular displacement mechanism. We expanded this mechanism to commercially available chromophores, 4-chloro-7-nitro-2,1,3-benzoxadiazole (NBD-Cl) and heptamethine cyanine dye IR-780. The sensors operate by undergoing displacement of chloride by thiolate. The amino groups of Cys/Hcy further replace the thiolate to form amino-substituted products, which exhibit dramatically different photophysical properties compared to sulfur-substituted products from the reaction with GSH. NBD-Cl is highly selective towards Cys/Hcy and exhibits significant fluorescence enhancement. IR-780 showed a variation in its fluorescence ratio towards Cys over other thiols. Both of the sensors can be used for live-cell imaging of Cys. The wide applicability of the mechanism may provide a powerful tool for developing novel fluorescent sensors for selective detection of biothiols.

  6. NIR Phosphorescent Intramolecularly Bridged Benzoporphyrins and Their Application in Oxygen-Compensated Glucose Optode.

    Science.gov (United States)

    Zach, Peter W; Hofmann, Oliver T; Klimant, Ingo; Borisov, Sergey M

    2018-02-20

    A glucose optode measuring the internal oxygen gradient is presented. The multilayer biosensor is composed of (i) analyte-impermeable transparent support, (ii) first oxygen-sensing layer combined with an enzymatic layer, (iii) diffusion barrier, and (iv) second oxygen-sensing layer. To make this design suitable for measurement in subcutaneous tissue, a pair of NIR phosphorescent indicators with very different spectral properties is chosen. Combination of a conventional Pt(II) tetrabenzoporphyrin dye (absorption and emission maxima at 617 and 772 nm, respectively) used in the first layer and a new intramolecularly bridged Pt(II) complex (absorption and emission maxima at 673 and 872 nm, respectively) in the second layer enables efficient separation of both emission signals. This specially designed dye class is accessible via Scholl-reaction from tetraphenyltetrabenzoporphyrin complexes. For the first time, the new optode allows simultaneous glucose and oxygen measurement in a single spot and therefore accurate compensation of oxygen heterogeneities resulting from fluctuations in the tissue. The presented material covers the dynamic ranges from 0 to 150 hPa O 2 and from 0 to 360 mg/dL (20 mM) glucose (at 37 °C).

  7. Photoinduced symmetry-breaking intramolecular charge transfer in a quadrupolar pyridinium derivative.

    Science.gov (United States)

    Carlotti, Benedetta; Benassi, Enrico; Spalletti, Anna; Fortuna, Cosimo G; Elisei, Fausto; Barone, Vincenzo

    2014-07-21

    We report here a joint experimental and theoretical study of a quadrupolar, two-branched pyridinium derivative of interest as a potential non-linear optical material. The spectral and photophysical behaviour of this symmetric system is greatly affected by the polarity of the medium. A very efficient photoinduced intramolecular charge transfer, surprisingly more efficient than in the dipolar asymmetric analogue, is found to occur by femtosecond resolved transient absorption spectroscopy. TD-DFT calculations are in excellent agreement with these experimental findings and predict large charge displacements in the molecular orbitals describing the ground state and the lowest excited singlet state. The theoretical study also revealed that in highly polar media the symmetry of the excited state is broken giving a possible explanation to the fluorescence and transient absorption spectra resembling those of the one-branched analogous compound in the same solvents. The present study may give an important insight into the excited state deactivation mechanism of cationic (donor-π-acceptor-π-donor)(+) quadrupolar compounds characterised by negative solvatochromism, which are expected to show significant two-photon absorption (TPA). Moreover, the water solubility of the investigated quadrupolar system may represent an added value in view of the most promising applications of TPA materials in biology and medicine.

  8. The Intramolecular Hydrogen Bond N-H···S in 2,2'-Diaminodiphenyl Disulfide: Experimental and Computational Thermochemistry.

    Science.gov (United States)

    Ramos, Fernando; Flores, Henoc; Hernández-Pérez, Julio M; Sandoval-Lira, Jacinto; Camarillo, E Adriana

    2018-01-11

    The intramolecular hydrogen bond of the N-H···S type has been investigated sparingly by thermochemical and computational methods. In order to study this interaction, the standard molar enthalpies of formation in gaseous phase of diphenyl disulfide, 2,2'-diaminodiphenyl disulfide and 4,4'-diaminodiphenyl disulfide at T = 298.15 K were determined by experimental thermochemical methods and computational calculations. The experimental enthalpies of formation in gas-phase were obtained from enthalpies of formation in crystalline phase and enthalpies of sublimation. Enthalpies of formation in crystalline phase were obtained using rotatory bomb combustion calorimetry. By thermogravimetry, enthalpies of vaporization were obtained, and by combining them with enthalpies of fusion, the enthalpies of sublimation were calculated. The Gaussian-4 procedure and the atomization method were applied to obtain enthalpies of formation in gas-phase of the compounds under study. Theoretical and experimental values are in good agreement. Through natural bond orbital (NBO) analysis and a topological analysis of the electronic density, the intramolecular hydrogen bridge (N-H···S) in the 2,2'-diaminodiphenyl disulfide was confirmed. Finally, an enthalpic difference of 11.8 kJ·mol -1 between the 2,2'-diaminodiphenyl disulfide and 4,4'-diaminodiphenyl disulfide was found, which is attributed to the intramolecular N-H···S interaction.

  9. Emission Spectroscopy as a Probe into Photoinduced Intramolecular Electron Transfer in Polyazine Bridged Ru(II,Rh(III Supramolecular Complexes

    Directory of Open Access Journals (Sweden)

    Karen J. Brewer

    2010-08-01

    Full Text Available Steady-state and time-resolved emission spectroscopy are valuable tools to probe photochemical processes of metal-ligand, coordination complexes. Ru(II polyazine light absorbers are efficient light harvesters absorbing in the UV and visible with emissive 3MLCT excited states known to undergo excited state energy and electron transfer. Changes in emission intensity, energy or band-shape, as well as excited state lifetime, provide insight into excited state dynamics. Photophysical processes such as intramolecular electron transfer between electron donor and electron acceptor sub-units may be investigated using these methods. This review investigates the use of steady-state and time-resolved emission spectroscopy to measure excited state intramolecular electron transfer in polyazine bridged Ru(II,Rh(III supramolecular complexes. Intramolecular electron transfer in these systems provides for conversion of the emissive 3MLCT (metal-to-ligand charge transfer excited state to a non-emissive, but potentially photoreactive, 3MMCT (metal-to-metal charge transfer excited state. The details of the photophysics of Ru(II,Rh(III and Ru(II,Rh(III,Ru(II systems as probed by steady-state and time-resolved emission spectroscopy will be highlighted.

  10. Heat conduction in chain polymer liquids: molecular dynamics study on the contributions of inter- and intramolecular energy transfer.

    Science.gov (United States)

    Ohara, Taku; Yuan, Tan Chia; Torii, Daichi; Kikugawa, Gota; Kosugi, Naohiro

    2011-07-21

    In this paper, the molecular mechanisms which determine the thermal conductivity of long chain polymer liquids are discussed, based on the results observed in molecular dynamics simulations. Linear n-alkanes, which are typical polymer molecules, were chosen as the target of our studies. Non-equilibrium molecular dynamics simulations of bulk liquid n-alkanes under a constant temperature gradient were performed. Saturated liquids of n-alkanes with six different chain lengths were examined at the same reduced temperature (0.7T(c)), and the contributions of inter- and intramolecular energy transfer to heat conduction flux, which were identified as components of heat flux by the authors' previous study [J. Chem. Phys. 128, 044504 (2008)], were observed. The present study compared n-alkane liquids with various molecular lengths at the same reduced temperature and corresponding saturated densities, and found that the contribution of intramolecular energy transfer to the total heat flux, relative to that of intermolecular energy transfer, increased with the molecular length. The study revealed that in long chain polymer liquids, thermal energy is mainly transferred in the space along the stiff intramolecular bonds. This finding implies a connection between anisotropic thermal conductivity and the orientation of molecules in various organized structures with long polymer molecules aligned in a certain direction, which includes confined polymer liquids and self-organized structures such as membranes of amphiphilic molecules in water.

  11. A dynamic programming algorithm for identification of triplex-forming sequences.

    Science.gov (United States)

    Lexa, Matej; Martínek, Tomáš; Burgetová, Ivana; Kopeček, Daniel; Brázdová, Marie

    2011-09-15

    Current methods for identification of potential triplex-forming sequences in genomes and similar sequence sets rely primarily on detecting homopurine and homopyrimidine tracts. Procedures capable of detecting sequences supporting imperfect, but structurally feasible intramolecular triplex structures are needed for better sequence analysis. We modified an algorithm for detection of approximate palindromes, so as to account for the special nature of triplex DNA structures. From available literature, we conclude that approximate triplexes tolerate two classes of errors. One, analogical to mismatches in duplex DNA, involves nucleotides in triplets that do not readily form Hoogsteen bonds. The other class involves geometrically incompatible neighboring triplets hindering proper alignment of strands for optimal hydrogen bonding and stacking. We tested the statistical properties of the algorithm, as well as its correctness when confronted with known triplex sequences. The proposed algorithm satisfactorily detects sequences with intramolecular triplex-forming potential. Its complexity is directly comparable to palindrome searching. Our implementation of the algorithm is available at http://www.fi.muni.cz/lexa/triplex as source code and a web-based search tool. The source code compiles into a library providing searching capability to other programs, as well as into a stand-alone command-line application based on this library. lexa@fi.muni.cz Supplementary data are available at Bioinformatics online.

  12. Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

    Science.gov (United States)

    Rackwitz, Jenny; Bald, Ilko

    2018-03-26

    During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Moebius sequence

    DEFF Research Database (Denmark)

    Pedersen, Line Kjeldgaard; Maimburg, Rikke Damkjær; Hertz, Jens Michael

    2017-01-01

    and photographical evaluation. Five patients maintained the diagnosis of MS according to the diagnostic criteria. RESULTS: All five patients had bilateral facial and abducens paralysis confirmed by ophthalmological examination. Three of five had normal brain MR imaging. Two had missing facial nerves and one had......BACKGROUND: Moebius Sequence (MS) is a rare disorder defined by bilateral congenital paralysis of the abducens and facial nerves in combination with various odontological, craniofacial, ophthalmological and orthopaedic conditions. The aetiology is still unknown; but both genetic (de novo mutations...

  14. From α-Bromomethylbutenolide to Fused Tri(Tetra) Cyclic Dihydrofurandiones through Barbier Reaction–Heck Arylation Sequence

    OpenAIRE

    Arbia Talbi; Anne Gaucher; Flavien Bourdreux; Jérôme Marrot; Mohamed L. Efrit; Hédi M’Rabet; Damien Prim

    2017-01-01

    A Barbier reaction–Heck arylation sequence from α-bromomethylbutenolide to fused tri and tetracyclic lactones has been developed. The first step involving a Barbier reaction enabled installing ortho-bromoaromatics in α-ylidene γ-lactones. The latter substrates were subjected to intramolecular Heck reaction conditions which selectively afforded 6,5,5 or 6,6,5 fused ring systems depending on the nature of the base employed.

  15. From α-Bromomethylbutenolide to Fused Tri(Tetra Cyclic Dihydrofurandiones through Barbier Reaction–Heck Arylation Sequence

    Directory of Open Access Journals (Sweden)

    Arbia Talbi

    2017-12-01

    Full Text Available A Barbier reaction–Heck arylation sequence from α-bromomethylbutenolide to fused tri and tetracyclic lactones has been developed. The first step involving a Barbier reaction enabled installing ortho-bromoaromatics in α-ylidene γ-lactones. The latter substrates were subjected to intramolecular Heck reaction conditions which selectively afforded 6,5,5 or 6,6,5 fused ring systems depending on the nature of the base employed.

  16. From α-Bromomethylbutenolide to Fused Tri(Tetra) Cyclic Dihydrofurandiones through Barbier Reaction-Heck Arylation Sequence.

    Science.gov (United States)

    Talbi, Arbia; Gaucher, Anne; Bourdreux, Flavien; Marrot, Jérôme; Efrit, Mohamed L; M'Rabet, Hédi; Prim, Damien

    2017-12-08

    A Barbier reaction-Heck arylation sequence from α-bromomethylbutenolide to fused tri and tetracyclic lactones has been developed. The first step involving a Barbier reaction enabled installing ortho -bromoaromatics in α-ylidene γ-lactones. The latter substrates were subjected to intramolecular Heck reaction conditions which selectively afforded 6,5,5 or 6,6,5 fused ring systems depending on the nature of the base employed.

  17. Intramolecular energy transfer and the driving mechanisms for large-amplitude collective motions of clusters

    Science.gov (United States)

    Yanao, Tomohiro; Koon, Wang Sang; Marsden, Jerrold E.

    2009-04-01

    This paper uncovers novel and specific dynamical mechanisms that initiate large-amplitude collective motions in polyatomic molecules. These mechanisms are understood in terms of intramolecular energy transfer between modes and driving forces. Structural transition dynamics of a six-atom cluster between a symmetric and an elongated isomer is highlighted as an illustrative example of what is a general message. First, we introduce a general method of hyperspherical mode analysis to analyze the energy transfer among internal modes of polyatomic molecules. In this method, the (3n-6) internal modes of an n-atom molecule are classified generally into three coarse level gyration-radius modes, three fine level twisting modes, and (3n-12) fine level shearing modes. We show that a large amount of kinetic energy flows into the gyration-radius modes when the cluster undergoes structural transitions by changing its mass distribution. Based on this fact, we construct a reactive mode as a linear combination of the three gyration-radius modes. It is shown that before the reactive mode acquires a large amount of kinetic energy, activation or inactivation of the twisting modes, depending on the geometry of the isomer, plays crucial roles for the onset of a structural transition. Specifically, in a symmetric isomer with a spherical mass distribution, activation of specific twisting modes drives the structural transition into an elongated isomer by inducing a strong internal centrifugal force, which has the effect of elongating the mass distribution of the system. On the other hand, in an elongated isomer, inactivation of specific twisting modes initiates the structural transition into a symmetric isomer with lower potential energy by suppressing the elongation effect of the internal centrifugal force and making the effects of the potential force dominant. This driving mechanism for reactions as well as the present method of hyperspherical mode analysis should be widely applicable to

  18. Short Intramolecular N–H⋯C(carbonyl Interactions in Mixed-Ligand Molybdenum Hexacarbonyl Derivatives

    Directory of Open Access Journals (Sweden)

    Matthew G. Budge

    2011-06-01

    Full Text Available The syntheses and single-crystal structures of Mo(CO3(phen(dipy (1, Mo(CO3(biquin(dipy (2 and Mo(CO3(dpme(dipy (3, (phen = 1,10-phenanthroline, C12H8N2; dipy = 2,2'-dipyridylamine, C10H9N3; biquin = 2,2'-biquinoline, C18H12N2; dpme = 2,2'-dipyridylmethane, C11H10N2 are described. In each case, distorted fac-MoC3N3 octahedral coordination geometries arise for the metal atoms. Short intramolecular N–H…C interactions from the dipy N–H group to a carbonyl carbon atom occur in each structure. Crystal data: 1 (C25H17MoN5O3, Mr = 531.38, monoclinic, P21/n (No. 14, Z = 4, a = 11.0965 (5 Å, b = 13.0586 (6 Å, c = 16.6138 (8 Å, b = 108.324 (1°, V = 2285.31 (18 Å3, R(F = 0.035, wR(F2 = 0.070. 2 (C31H21MoN5O3, Mr = 607.47, monoclinic, P21/n (No. 14, Z = 4, a = 11.4788 (6 Å, b = 19.073 (1 Å, c = 11.9881 (6 Å, b = 95.179 (1°, V = 2613.9 (2 Å3, R(F = 0.030, wR(F2 = 0.076. 3 (C24H19MoN5O3, Mr = 521.38, monoclinic, P21/n (No. 14, Z = 4, a = 8.4222 (3 Å, b = 21.5966 (9 Å, c = 12.5011 (5 Å, b = 94.065 (1°, V = 2268.12 (15 Å3, R(F = 0.025, wR(F2 = 0.065.

  19. Euglena gracilis ascorbate peroxidase forms an intramolecular dimeric structure: its unique molecular characterization.

    Science.gov (United States)

    Ishikawa, Takahiro; Tajima, Naoko; Nishikawa, Hitoshi; Gao, Yongshun; Rapolu, Madhusudhan; Shibata, Hitoshi; Sawa, Yoshihiro; Shigeoka, Shigeru

    2010-02-09

    Euglena gracilis lacks a catalase and contains a single APX (ascorbate peroxidase) and enzymes related to the redox cycle of ascorbate in the cytosol. In the present study, a full-length cDNA clone encoding the Euglena APX was isolated and found to contain an open reading frame encoding a protein of 649 amino acids with a calculated molecular mass of 70.5 kDa. Interestingly, the enzyme consisted of two entirely homologous catalytic domains, designated APX-N and APX-C, and an 102 amino acid extension in the N-terminal region, which had a typical class II signal proposed for plastid targeting in Euglena. A computer-assisted analysis indicated a novel protein structure with an intramolecular dimeric structure. The analysis of cell fractionation showed that the APX protein is distributed in the cytosol, but not the plastids, suggesting that Euglena APX becomes mature in the cytosol after processing of the precursor. The kinetics of the recombinant mature FL (full-length)-APX and the APX-N and APX-C domains with ascorbate and H2O2 were almost the same as that of the native enzyme. However, the substrate specificity of the mature FL-APX and the native enzyme was different from that of APX-N and APX-C. The mature FL-APX, but not the truncated forms, could reduce alkyl hydroperoxides, suggesting that the dimeric structure is correlated with substrate recognition. In Euglena cells transfected with double-stranded RNA, the silencing of APX expression resulted in a significant increase in the cellular level of H2O2, indicating the physiological importance of APX to the metabolism of H2O2.

  20. Microsolvation and the Effects of Non-Covalent Interactions on Intramolecular Dynamics

    Science.gov (United States)

    Foguel, Lidor; Vealey, Zachary; Vaccaro, Patrick

    2017-06-01

    Physicochemical processes brought about by non-covalent interactions between neighboring molecules are undeniably of crucial importance in the world around us, being responsible for effects ranging from the subtle (yet precise) control of biomolecular recognition events to the very existence of condensed phases. Of particular interest is the differential ability of distinct non-covalent forces, such as those mediated by dispersion-dominated aryl (π-π) coupling and electrostatically-driven hydrogen bonding, to affect unimolecular transformations by altering potential surface topographies and the nature of reaction coordinates. A concerted experimental and computational investigation of "microsolvation" (solvation at the molecular level) has been undertaken to elucidate the site-specific coupling between solute and solvent degrees of freedom, as well as attendant consequences for the efficiency and pathway of intrinsic proton-transfer dynamics. Targeted species have been synthesized in situ under "cold" supersonic free-jet expansion conditions (T_{rot} ≈ 1-2K) by complexing an active (proton-transfer) substrate with various ligands (e.g., water isotopologs and benzene derivatives) for which competing interaction mechanisms can lead to unique binding motifs. A series of fluorescence-based spectroscopic measurements have been performed on binary adducts formed with the prototypical 6-hydroxy-2-formylfulvene (HFF) system, where a quasi-linear intramolecular O-H...O bond and a zero-point energy that straddles the proton-transfer barrier crest synergistically yield the largest tunneling-induced splitting ever reported for the ground electronic state of an isolated neutral molecule. Such characteristics afford a localized metric for unraveling incipient changes in unimolecular reactivity, with comparison of experimentally observed and quantum-chemical predicted rovibronic landscapes serving to discriminate complexes built upon electrostatic (hydrogen-bonding) and

  1. Excited state intramolecular charge transfer reaction in nonaqueous electrolyte solutions: temperature dependence.

    Science.gov (United States)

    Pradhan, Tuhin; Gazi, Harun Al Rasid; Biswas, Ranjit

    2009-08-07

    Temperature dependence of the excited state intramolecular charge transfer reaction of 4-(1-azetidinyl)benzonitrile (P4C) in ethyl acetate (EA), acetonitrile (ACN), and ethanol at several concentrations of lithium perchlorate (LiClO(4)) has been investigated by using the steady state and time resolved fluorescence spectroscopic techniques. The temperature range considered is 267-343 K. The temperature dependent spectral peak shifts and reaction driving force (-DeltaG(r)) in electrolyte solutions of these solvents can be explained qualitatively in terms of interaction between the reactant molecule and ion-atmosphere. Time resolved studies indicate that the decay kinetics of P4C is biexponential, regardless of solvents, LiClO(4) concentrations, and temperatures considered. Except at higher electrolyte concentrations in EA, reaction rates in solutions follow the Arrhenius-type temperature dependence where the estimated activation energy exhibits substantial electrolyte concentration dependence. The average of the experimentally measured activation energies in these three neat solvents is found to be in very good agreement with the predicted value based on data in room temperature solvents. While the rate constant in EA shows a electrolyte concentration induced parabolic dependence on reaction driving force (-DeltaG(r)), the former in ethanol and ACN increases only linearly with the increase in driving force (-DeltaG(r)). The data presented here also indicate that the step-wise increase in solvent reorganization energy via sequential addition of electrolyte induces the ICT reaction in weakly polar solvents to crossover from the Marcus inverted region to the normal region.

  2. Mechanically induced intramolecular electron transfer in a mixed-valence molecular shuttle

    Energy Technology Data Exchange (ETDEWEB)

    Barnes, J. C.; Fahrenbach, A. C.; Dyar, S. M.; Frasconi, M.; Giesener, M. A.; Zhu, Z.; Liu, Z.; Hartlieb, K. J.; Carmieli, R.; Wasielewski, M. R.; Stoddart, J. F.

    2012-06-08

    The kinetics and thermodynamics of intramolecular electron transfer (IET) can be subjected to redox control in a bistable [2]rotaxane comprised of a dumbbell component containing an electron-rich 1,5-dioxynaphthalene (DNP) unit and an electron-poor phenylene-bridged bipyridinium (P-BIPY2+) unit and a cyclobis (paraquat-p-phenylene) (CBPQT4+) ring component. The [2]rotaxane exists in the ground-state co-conformation (GSCC) wherein the CBPQT4+ ring encircles the DNP unit. Reduction of the CBPQT4+ leads to the CBPQT2(•+) diradical dication while the P-BIPY2+ unit is reduced to its P-BIPY•+ radical cation. A radical-state co-conformation (RSCC) results from movement of the CBPQT2(•+) ring along the dumbbell to surround the P-BIPY•+ unit. This shuttling event induces IET to occur between the pyridinium redox centers of the P-BIPY•+ unit, a property which is absent between these redox centers in the free dumbbell and in the 1:1 complex formed between the CBPQT2(•+) ring and the radical cation of methyl-phenylene-viologen (MPV•+). Using electron paramagnetic resonance (EPR) spectroscopy, the process of IET was investigated by monitoring the line broadening at varying temperatures and determining the rate constant (kET = 1.33 × 107 s-1) and activation energy (ΔG‡ = 1.01 kcal mol-1) for electron transfer. These values were compared to the corresponding values predicted, using the optical absorption spectra and Marcus–Hush theory.

  3. Weak intramolecular interaction effects on the torsional spectra of ethylene glycol, an astrophysical species

    Energy Technology Data Exchange (ETDEWEB)

    Boussessi, R., E-mail: rahma.boussesi@iem.cfmac.csic.es [Departamento de Química y Física Teóricas, I. Estructura de la Materia, IEM-CSIC, Serrano 121, Madrid 28006 (Spain); Laboratoire de Spectroscopie Atomique, Moléculaire et Applications-LSAMA LR01ES09, Faculté des sciences de Tunis, Université de Tunis El Manar, 2092 Tunis (Tunisia); Senent, M. L., E-mail: ml.senent@csic.es [Departamento de Química y Física Teóricas, I. Estructura de la Materia, IEM-CSIC, Serrano 121, Madrid 28006 (Spain); Jaïdane, N. [Laboratoire de Spectroscopie Atomique, Moléculaire et Applications-LSAMA LR01ES09, Faculté des sciences de Tunis, Université de Tunis El Manar, 2092 Tunis (Tunisia)

    2016-04-28

    An elaborate variational procedure of reduced dimensionality based on explicitly correlated coupled clusters calculations is applied to understand the far infrared spectrum of ethylene-glycol, an astrophysical species. This molecule can be classified in the double molecular symmetry group G{sub 8} and displays nine stable conformers, gauche and trans. In the gauche region, the effect of the potential energy surface anisotropy due to the formation of intramolecular hydrogen bonds is relevant. For the primary conformer, stabilized by a hydrogen bond, the ground vibrational state rotational constants are computed to be A{sub 0} = 15 369.57 MHz, B{sub 0} = 5579.87 MHz, and C{sub 0} = 4610.02 MHz corresponding to differences of 6.3 MHz, 7.2 MHz, and 3.5 MHz from the experimental parameters. Ethylene glycol displays very low torsional energy levels whose classification is not straightforward and requires a detailed analysis of the torsional wavefunctions. Tunneling splittings are significant and unpredictable due to the anisotropy of the potential energy surface PES. The ground vibrational state splits into 16 sublevels separated ∼142 cm{sup −1}. The splitting of the “G1 sublevels” was calculated to be ∼0.26 cm{sup −1} in very good agreement with the experimental data (0.2 cm{sup −1} = 6.95 MHz). Transitions corresponding to the three internal rotation modes allow assignment of previously observed Q branches. Band patterns, calculated between 362.3 cm{sup −1} and 375.2 cm{sup −1}, 504 cm{sup −1} and 517 cm{sup −1}, and 223.3 cm{sup −1} and 224.1 cm{sup −1}, that correspond to the tunnelling components of the v{sub 21} fundamental (v{sub 21} = OH-torsional mode), are assigned to the prominent experimental Q branches.

  4. Ciclização intramolecular: uma estratégia promissora no desenvolvimento de pró-fármacos Intramolecular cyclization: a promising strategy in the prodrug conception

    Directory of Open Access Journals (Sweden)

    Cledir Santos

    2008-09-01

    Full Text Available Muitos fármacos estão associados a vários efeitos adversos e limitada biodisponibilidade. A resolução destes problemas continua sendo um alvo importante para a comunidade científica. O desenvolvimento de pró-fármacos que conduzam a uma liberação controlada in vivo é um caminho atrativo para resolver estes problemas. Um pró-fármaco clássico é molécula inativa, em que o princípio ativo é ligado covalentemente a uma unidade transportadora, de modo que o fármaco pode ser liberado através de uma reação química ou enzimática. Um sistema novo e interessante de pró-fármaco, que tem sido apresentado para fármacos possuidores de grupos amino, álcool e tiol, é aquele no qual o princípio ativo é liberado através de uma ciclização intramolecular. Neste caso, o processo de ciclização, dependendo da cadeia da unidade transportadora e do próprio fármaco, pode controlar a velocidade de liberação do princípio ativo. Desta forma, este trabalho apresenta uma revisão do desenvolvimento de pró-fármacos baseados na liberação do princípio ativo através de uma ciclização intramolecular.Many drugs used for the treatment of common diseases are associated with various adverse effects and limited bioavailability. The suppression of such problems continues to be a very important target for scientists. The development of prodrugs for controlled release in vivo is an attractive way to overcome these problems. Classical in prodrug is an inactive molecule which the parent drug is covalently bonded to a carrier unit, and which can liberate the drug through chemical or enzymatic pathways. A new and interesting prodrug system for amine, alcohol, and thiol drugs takes advantage of several easy intramolecular cyclization reactions. So, the cyclization process can control the release rate of the parent drug. In this paper is a review about the prodrug strategies based on intramolecular cyclization reactions is presented.

  5. Molecular eigenstate spectroscopy: Application to the intramolecular dynamics of some polyatomic molecules in the 3000 to 7000 cm{sup {minus}1} region

    Energy Technology Data Exchange (ETDEWEB)

    Perry, D.S. [Univ. of Akron, OH (United States)

    1993-12-01

    Intramolecular vibrational redistribution (IVR) appears to be a universal property of polyatomic molecules in energy regions where the vibrational density of states is greater than about 5 to 30 states per cm{sup {minus}1}. Interest in IVR stems from its central importance to the spectroscopy, photochemistry, and reaction kinetics of these molecules. A bright state, {var_phi}{sub s}, which may be a C-H stretching vibration, carries the oscillator strength from the ground state. This bright state may mix with bath rotational-vibrational levels to form a clump of molecular eigenstates, each of which carries a portion of the oscillator strength from the ground state. In this work the authors explicitly resolve transitions to each of these molecular eigenstates. Detailed information about the nature of IVR is contained in the frequencies and intensities of the observed discrete transitions. The primary goal of this research is to probe the coupling mechanisms by which IVR takes place. The most fundamental distinction to be made is between anharmonic coupling which is independent of molecular rotation and rotationally-mediated coupling. The authors are also interested in the rate at which IVR takes place. Measurements are strictly in the frequency domain but information is obtained about the decay of the zero order state, {var_phi}{sub s}, which could be prepared in a hypothetical experiment as a coherent excitation of the clump of molecular eigenstates. As the coherent superposition dephases, the energy would flow from the initially prepared mode into nearby overtones and combinations of lower frequency vibrational modes. The decay of the initially prepared mode is related to a pure sequence infrared absorption spectrum by a Fourier transform.

  6. Glucose oxidase-initiated cascade catalysis for sensitive impedimetric aptasensor based on metal-organic frameworks functionalized with Pt nanoparticles and hemin/G-quadruplex as mimicking peroxidases.

    Science.gov (United States)

    Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju

    2017-12-15

    Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Voltammetry and Molecular Assembly of G-quadruplex DNAzyme on Single-crystal Au(111)-electrode Surfaces – Hemin as an Electrochemical Intercalator

    DEFF Research Database (Denmark)

    Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong

    2016-01-01

    ). The target DNZyme is formed from a single-strand OGN with 12 guanines and iron (III) porphyrin IX (hemin), and assembles on Au(111) by the mercapto alkyl linker. The DNAzyme monolayers exhibit a strong pair of redox peaks at 0.0 V (NHE) at pH 7 in acetate buffer, shifted positively by about 50 mV compared......DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity similar...... to free hemin physisorbed on the Au(111). The voltammetric signal of DNZyme is enhanced 15 times, indicative that hemin is strongly bound to the immobilized 12G-qs and in well-defined orientation favorable for interfacial ET with a rate constant of 6.0 s−1. The G-quartet structures with a size of 1.6 ± 0...

  8. Tunable excited-state intramolecular proton transfer reactions with Nsbnd H or Osbnd H as a proton donor: A theoretical investigation

    Science.gov (United States)

    Li, Yuanyuan; Wen, Keke; Feng, Songyan; Yuan, Huijuan; An, Beibei; Zhu, Qiuling; Guo, Xugeng; Zhang, Jinglai

    2017-12-01

    Excited-state intramolecular proton transfer (ESIPT) reactions occurring in the S1 state for five molecules, which possess five/six-membered ring intramolecular Nsbnd H···N or Osbnd H···N hydrogen bonds bearing quinoline or 2-phenylpyridine moiety, have been described in detail by the time-dependent density functional theory (TD-DFT) approach using the B3LYP hybrid functional. For the five molecules, the constrained potential energy profiles along the ESIPT reactions show that proton transfer is barrierless in molecules possessing six-membered ring intramolecular H-bonds, which is smoother than that with certain barriers in five-membered ring H-bonding systems. For the latter, chemical modification by a more strong acid group can lower the ESIPT barrier significantly, which harnesses the ESIPT reaction from a difficult type to a fast one. The energy barrier of the ESIPT reaction depends on the intensity of the intramolecular H-bond, which can be measured with the topological descriptors by topology analysis of the bond critical point (BCP) of the intramolecular H-bond. It is found that when the value of electron density ρ(r) at BCP is bigger than 0.025 a.u., the corresponding molecule might go through an ultrafast and barrierless ESIPT process, which opens a new scenario to explore the ESIPT reactions.

  9. EL APRENDIZAJE DE LOS CONCEPTOS DE FUERZAS INTERMOLECULARES E INTRAMOLECULARES MEDIANTE LA MODELIZACIÓN DIDÁCTICA

    OpenAIRE

    CHRISTIAN FERNNEY GIRALDO MACÍAS

    2013-01-01

    La modelización está siendo usada para la enseñanza y el aprendizaje en las Ciencias Naturales en diferentes contextos y para atender a diferentes problemáticas. En este caso será utilizada para explorar y analizar la relevancia que puede tener su uso en el aprendizaje de los conceptos Fuerzas Intramoleculares e Intermolecualres, partiendo de la aplicación de una serie de actividades basadas en el Ciclo Didáctico (Jorba y Sanmartí, 1996). Los datos se discuten mediante tres aspectos principal...

  10. Ring-size-selective construction of fluorine-containing carbocycles via intramolecular iodoarylation of 1,1-difluoro-1-alkenes

    Directory of Open Access Journals (Sweden)

    Takeshi Fujita

    2017-12-01

    Full Text Available 1,1-Difluoro-1-alkenes bearing a biaryl-2-yl group effectively underwent site-selective intramolecular iodoarylation by the appropriate cationic iodine species. Iodoarylation of 2-(2-aryl-3,3-difluoroallylbiaryls proceeded via regioselective carbon–carbon bond formation at the carbon atoms in β-position to the fluorine substituents, thereby constructing dibenzo-fused six-membered carbocycles bearing a difluoroiodomethyl group. In contrast, 2-(3,3-difluoroallylbiaryls underwent a similar cyclization at the α-carbon atoms to afford ring-difluorinated seven-membered carbocycles.

  11. Effect of structural changes in sesquifulvalene on the intramolecular charge transfer and nonlinear polarizations a theoretical study

    Science.gov (United States)

    Nandi, P. K.; Mandal, K.; Kar, T.

    2003-11-01

    Ab initio HF calculations of the ground state structural parameters, and the time dependent HF (TDHF) calculations of static nonlinear polarizabilities have been performed for a number of sesquifulvalene derivatives. The calculated NLO parameters show a good correlation with the hardness parameters. The nature of hetero-atoms and their positions can strongly influence the intramolecular charge transfer (ICT) interactions and the nonlinear polarizations of sesquifulvalene. Nonlinear polarizabilities in the twisted structures have been found to depend both on the energy barrier to twist and the transition energy corresponding to the twisted ICT (TICT) state characterized by the HOMO → LUMO transition.

  12. Tandem cross enyne metathesis (CEYM–intramolecular Diels–Alder reaction (IMDAR. An easy entry to linear bicyclic scaffolds

    Directory of Open Access Journals (Sweden)

    Javier Miró

    2015-08-01

    Full Text Available A new tandem cross enyne metathesis (CEYM–intramolecular Diels–Alder reaction (IMDAR has been carried out. It involves conjugated ketones, esters or amides bearing a remote olefin and aromatic alkynes as the starting materials. The overall process enables the preparation of a small family of linear bicyclic scaffolds in a very simple manner with moderate to good levels of diastereoselectivity. This methodology constitutes one of the few examples that employ olefins differently than ethylene in tandem CEYM–IMDAR protocols.

  13. Pd(II)-catalyzed ortho-hydroxylation and intramolecular oxidative C-C coupling of N- benzylbenzene sulfonamides

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Eun Joo; Jo, Yoon Hyung; Jang, Min Jung; Youn, So Won [Dept. of Chemistry and Research Institute for Natural Sciences, Center for New Directions in Organic Synthesis, Hanyang University, Seoul (Korea, Republic of)

    2015-02-15

    We reported highly effective Pd-catalyzed C-C and/or C-N bond formations via C-H activation of aniline derivatives. Considering the lack of regioselective C(sp{sup 2}) H hydroxylation of benzylamines, our continued interest in Pd-catalyzed C-H bond functionalization prompted us to investigate the possibility of a Pd-catalyzed ortho-hydroxylation of NH-containing benzylamines. We have developed the Pd-catalyzed ortho-hydroxylation and/or intramolecular oxidative C-C coupling of N-benzyl sulfonamides, which operate through two different postulated mechanistic routes, as depicted in Scheme 2, depending on the reaction conditions.

  14. Unprecedented twofold intramolecular hydroamination in diam(m)ine-dicarboxylatodichloridoplatinum(IV) complexes - ethane-1,2-diamine vs. ammine ligands.

    Science.gov (United States)

    Reithofer, Michael R; Galanski, Markus; Arion, Vladimir B; Keppler, Bernhard K

    2008-03-07

    Reaction of (OC-6-13)-bis(2Z-3-carboxyacrylato)dichlorido(ethane-1,2-diamine)platinum(IV) and (OC-6-13)-diamminebis(2Z-3-carboxyacrylato)dichloridoplatinum(IV) with propylamine in the presence of 1,1'-carbonyl diimidazole afforded not the expected amides; instead, beside amide formation, a twofold intramolecular attack of the am(m)ine ligand at the C[double bond, length as m-dash]C bonds was observed involving either both (ethane-1,2-diamine) or only one (ammine) coordinated nitrogen atom(s).

  15. A classical trajectory study of the intramolecular dynamics, isomerization, and unimolecular dissociation of HO2.

    Science.gov (United States)

    Perry, Jamin W; Dawes, Richard; Wagner, Albert F; Thompson, Donald L

    2013-08-28

    The classical dynamics and rates of isomerization and dissociation of HO2 have been studied using two potential energy surfaces (PESs) based on interpolative fittings of ab initio data: An interpolative moving least-squares (IMLS) surface [A. Li, D. Xie, R. Dawes, A. W. Jasper, J. Ma, and H. Guo, J. Chem. Phys. 133, 144306 (2010)] and the cubic-spline-fitted PES reported by Xu, Xie, Zhang, Lin, and Guo (XXZLG) [J. Chem. Phys. 127, 024304 (2007)]. Both PESs are based on similar, though not identical, internally contracted multi-reference configuration interaction with Davidson correction (icMRCI+Q) electronic structure calculations; the IMLS PES includes complete basis set (CBS) extrapolation. The coordinate range of the IMLS PES is limited to non-reactive processes. Surfaces-of-section show similar generally regular phase space structures for the IMLS and XXZLG PESs with increasing energy. The intramolecular vibrational energy redistribution (IVR) at energies above and below the threshold of isomerization is slow, especially for O-O stretch excitations, consistent with the regularity in the surfaces-of-section. The slow IVR rates lead to mode-specific effects that are prominent for isomerization (on both the IMLS and XXZLG) and modest for unimolecular dissociation to H + O2 (accessible only on the XXZLG PES). Even with statistical distributions of initial energy, slow IVR rates result in double exponential decay for isomerization, with the slower rate correlated with slow IVR rates for O-O vibrational excitation. The IVR and isomerization rates computed for the IMLS and XXZLG PESs are quantitatively, but not qualitatively, different from one another with the largest differences ascribed to the ~2 kcal/mol difference in the isomerization barrier heights. The IMLS and XXZLG results are compared with those obtained using the global, semi-empirical double-many-body expansion DMBE-IV PES [M. R. Pastrana, L. A. M. Quintales, J. Brandão, and A. J. C. Varandas, J. Chem

  16. Controlling the ambiphilic nature of σ-arylpalladium intermediates in intramolecular cyclization reactions.

    Science.gov (United States)

    Solé, Daniel; Fernández, Israel

    2014-01-21

    the metal center with the carbonyl group. Second, the additive phenol exchanges the iodide ligand to give an arylpalladium(II) phenoxide complex, which has a beneficial effect on the arylation. The formation of this transient intermediate not only stabilizes the arylpalladium moiety, thus preventing the nucleophilic attack at the carbonyl group, but also assists the enolization reaction, which takes place in a more favorable intramolecular manner. The azapalladacycle intermediate is, in the words of J. R. R. Tolkien, "the one ring to bring them all and in the darkness to bind them." With this intermediate, we can easily achieve the synthesis of a variety of heterocyclic systems by selectively promoting electrophilic α-arylation or nucleophilic addition reactions from the same precursors.

  17. Relaxation dynamics in quantum dissipative systems: The microscopic effect of intramolecular vibrational energy redistribution

    Energy Technology Data Exchange (ETDEWEB)

    Uranga-Piña, L. [Facultad de Física, Universidad de la Habana, San Lázaro y L, Vedado, 10400 Havana (Cuba); Institute for Chemistry and Biochemistry, Freie Universität Berlin, Takustr. 3, D-14195 Berlin (Germany); Tremblay, J. C., E-mail: jean.c.tremblay@gmail.com [Institute for Chemistry and Biochemistry, Freie Universität Berlin, Takustr. 3, D-14195 Berlin (Germany)

    2014-08-21

    We investigate the effect of inter-mode coupling on the vibrational relaxation dynamics of molecules in weak dissipative environments. The simulations are performed within the reduced density matrix formalism in the Markovian regime, assuming a Lindblad form for the system-bath interaction. The prototypical two-dimensional model system representing two CO molecules approaching a Cu(100) surface is adapted from an ab initio potential, while the diatom-diatom vibrational coupling strength is systematically varied. In the weak system-bath coupling limit and at low temperatures, only first order non-adiabatic uni-modal coupling terms contribute to surface-mediated vibrational relaxation. Since dissipative dynamics is non-unitary, the choice of representation will affect the evolution of the reduced density matrix. Two alternative representations for computing the relaxation rates and the associated operators are thus compared: the fully coupled spectral basis, and a factorizable ansatz. The former is well-established and serves as a benchmark for the solution of Liouville-von Neumann equation. In the latter, a contracted grid basis of potential-optimized discrete variable representation is tailored to incorporate most of the inter-mode coupling, while the Lindblad operators are represented as tensor products of one-dimensional operators, for consistency. This procedure results in a marked reduction of the grid size and in a much more advantageous scaling of the computational cost with respect to the increase of the dimensionality of the system. The factorizable method is found to provide an accurate description of the dissipative quantum dynamics of the model system, specifically of the time evolution of the state populations and of the probability density distribution of the molecular wave packet. The influence of intra-molecular vibrational energy redistribution appears to be properly taken into account by the new model on the whole range of coupling strengths. It

  18. The effect of intramolecular donor–acceptor moieties with donor–π-bridge–acceptor structure on the solar photovoltaic performance

    Directory of Open Access Journals (Sweden)

    T. L. Wang

    2015-10-01

    Full Text Available A series of intramolecular donor–acceptor polymers containing different contents of (E-1-(2-ethylhexyl-6,9-dioctyl-2-(2-(thiophen-3-ylvinyl-1H-phenanthro[9,10-d]imidazole (thiophene-DOPI moiety and 4,4-diethylhexylcyclopenta[ 2,1-b:3,4-b']dithiophene (CPDT unit was synthesized via Grignard metathesis (GRIM polymerization. The synthesized random copolymers and homopolymer of thiophene-DOPI contain the donor–π-bridge–acceptor conjugated structure to tune the absorption spectra and energy levels of the resultant polymers. UV-vis spectra of the three polymer films exhibit panchromatic absorptions ranging from 300 to 1100 nm and low band gaps from 1.38 to 1.51 eV. It is found that more thiophene-DOPI moieties result in the decrease of band gap and lower the highest occupied molecular orbital (HOMO and lowest unoccupied molecular orbital (LUMO values of polymers. Photovoltaic performance results indicate that if the content of the intramolecular donor–acceptor moiety is high enough, the copolymer structure may be better than homopolymer due to more light-harvesting afforded by both monomer units.

  19. Intramolecular Immunological Signal Hypothesis Revived - Structural Background of Signalling Revealed by Using Congo Red as a Specific Tool

    Science.gov (United States)

    Jagusiak, A.; Konieczny, L.; Król, M.; Marszałek, P.; Piekarska, B.; Piwowar, P.; Roterman, I.; Rybarska, J.; Stopa, B.; Zemanek, G.

    2014-01-01

    Micellar structures formed by self-assembling Congo red molecules bind to proteins penetrating into functionrelated unstable packing areas. Here, we have used Congo red - a supramolecular protein ligand to investigate how the intramolecular structural changes that take place in antibodies following antigen binding lead to complement activation. According to our findings, Congo red binding significantly enhances the formation of antigen-antibody complexes. As a result, even low-affinity transiently binding antibodies can participate in immune complexes in the presence of Congo red, although immune complexes formed by these antibodies fail to trigger the complement cascade. This indicates that binding of antibodies to the antigen may not, by itself, fulfill the necessary conditions to generate the signal which triggers effector activity. These findings, together with the results of molecular dynamics simulation studies, enable us to conclude that, apart from the necessary assembling of antibodies, intramolecular structural changes generated by strains which associate high- affinity bivalent antibody fitting to antigen determinants are also required to cross the complement activation threshold. PMID:25429660

  20. Intramolecular immunological signal hypothesis revived--structural background of signalling revealed by using Congo Red as a specific tool.

    Science.gov (United States)

    Jagusiak, A; Konieczny, L; Krol, M; Marszalek, P; Piekarska, B; Piwowar, P; Roterman, I; Rybarska, J; Stopa, B; Zemanek, G

    2015-01-01

    Micellar structures formed by self-assembling Congo red molecules bind to proteins penetrating into function-related unstable packing areas. Here, we have used Congo red--a supramolecular protein ligand--to investigate how the intramolecular structural changes that take place in antibodies following antigen binding lead to complement activation. According to our findings, Congo red binding significantly enhances the formation of antigen-antibody complexes. As a result, even low-affinity transiently binding antibodies can participate in immune complexes in the presence of Congo red, although immune complexes formed by these antibodies fail to trigger the complement cascade. This indicates that binding of antibodies to the antigen may not, by itself, fulfill the necessary conditions to generate the signal which triggers effector activity. These findings, together with the results of molecular dynamics simulation studies, enable us to conclude that, apart from the necessary assembling of antibodies, intramolecular structural changes generated by strains which associate high- affinity bivalent antibody fitting to antigen determinants are also required to cross the complement activation threshold.